#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								9000	SO:0001628	intergenic_variant	4508																															Unknown.37:g.0T>C		Somatic		Capture	Illumina GAIIx	4	9000		Missense_Mutation	SNP	HMMPfam_ATP-synt_A,superfamily_ATPase_F0_A,PatternScan_ATPASE_A	p.V158A		37	c.473		MT																																																																																			-	HMMPfam_ATP-synt_A,superfamily_ATPase_F0_A,PatternScan_ATPASE_A	0	0					MT-ATP6			T			9000	+1	no_errors	ENST00000361899	ensembl	human	known	54_36p	missense	SNP	NULL	C
MUC5B	727897	genome.wustl.edu	37	11	1263795	1263795	+	Silent	SNP	C	C	G			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr11:1263795C>G	ENST00000529681.1	+	31	5743	c.5685C>G	c.(5683-5685)gcC>gcG	p.A1895A	MUC5B_ENST00000447027.1_Silent_p.A1898A|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1895	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GCTCCACGGCCACGCCCTCCT	0.612																																																0			11											87.0	108.0	101.0					11																	1263795		2185	4267	6452	1220371	SO:0001819	synonymous_variant	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.5685C>G	11.37:g.1263795C>G		Somatic		Capture	Illumina GAIIx	4	1220371	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	HMMSmart_SM00216,HMMPfam_VWD,HMMPfam_C8,superfamily_Serine proterase inhibitors,HMMPfam_TIL,HMMSmart_SM00214,HMMSmart_SM00215,superfamily_PMP inhibitors,PatternScan_VWFC_1,HMMPfam_VWC,HMMSmart_SM00041,HMMPfam_Cys_knot,PatternScan_CTCK_1	p.A1898	ENST00000529681.1	37	c.5694	CCDS44515.2	11																																																																																			-	NULL		0.612	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	protein_coding	OTTHUMT00000390041.2	C	XM_001126093		1220371	+1	no_errors	NM_002458	genbank	human	validated	54_36p	silent	SNP	0.000	G
LPCAT1	79888	genome.wustl.edu	37	5	1489912	1489912	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr5:1489912T>A	ENST00000283415.3	-	4	687	c.555A>T	c.(553-555)aaA>aaT	p.K185N		NM_024830.3	NP_079106.3	Q8NF37	PCAT1_HUMAN	lysophosphatidylcholine acyltransferase 1	185					cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|negative regulation of phosphatidylcholine biosynthetic process (GO:2001246)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|positive regulation of protein catabolic process (GO:0045732)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|surfactant homeostasis (GO:0043129)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphocholine O-acyltransferase activity (GO:0047159)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|1-alkylglycerophosphocholine O-acyltransferase activity (GO:0047191)|calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)		CTTCTACTGTTTTCCTGCGAG	0.512																																																0			5											218.0	217.0	217.0					5																	1489912		2203	4300	6503	1542912	SO:0001583	missense	79888			BC020166	CCDS3864.1	5p15.33	2013-01-10	2007-12-17	2007-12-17	ENSG00000153395	ENSG00000153395		"""EF-hand domain containing"""	25718	protein-coding gene	gene with protein product		610472	"""acyltransferase like 2"""	AYTL2		8619474, 16704971	Standard	NM_024830		Approved	FLJ12443	uc003jcm.3	Q8NF37	OTTHUMG00000131017	ENST00000283415.3:c.555A>T	5.37:g.1489912T>A	ENSP00000283415:p.Lys185Asn	Somatic		Capture	Illumina GAIIx	4	1542912	Q1HAQ1|Q7Z4G6|Q8N3U7|Q8WUL8|Q9GZW6	Missense_Mutation	SNP	PatternScan_EF_HAND_1,superfamily_SSF69593,HMMPfam_Acyltransferase,HMMSmart_PlsC,superfamily_SSF47473,HMMSmart_EFh	p.K185N	ENST00000283415.3	37	c.555	CCDS3864.1	5	.	.	.	.	.	.	.	.	.	.	T	4.223	0.040310	0.08148	.	.	ENSG00000153395	ENST00000283415	D	0.93547	-3.24	4.19	-1.89	0.07689	Phospholipid/glycerol acyltransferase (2);	0.047169	0.85682	D	0.000000	T	0.81221	0.4777	N	0.11651	0.15	0.49483	D	0.99979	B	0.13594	0.008	B	0.17722	0.019	T	0.63800	-0.6555	10	0.11485	T	0.65	-22.9288	9.5358	0.39222	0.0:0.369:0.0:0.631	.	185	Q8NF37	PCAT1_HUMAN	N	185	ENSP00000283415:K185N	ENSP00000283415:K185N	K	-	3	2	LPCAT1	1542912	1.000000	0.71417	0.778000	0.31720	0.636000	0.38137	0.582000	0.23834	-0.236000	0.09753	-0.379000	0.06801	AAA	-	superfamily_SSF69593,HMMPfam_Acyltransferase,HMMSmart_PlsC		0.512	LPCAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT1	protein_coding	OTTHUMT00000304032.1	T	NM_024830		1542912	-1	no_errors	NM_024830	genbank	human	validated	54_36p	missense	SNP	0.991	A
TGM6	343641	genome.wustl.edu	37	20	2380266	2380266	+	Silent	SNP	C	C	T	rs200686759	byFrequency	TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr20:2380266C>T	ENST00000202625.2	+	6	793	c.732C>T	c.(730-732)ggC>ggT	p.G244G	TGM6_ENST00000477505.1_3'UTR|TGM6_ENST00000381423.1_Silent_p.G244G	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	244					cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	AGTACGGCGGCGGCACCAGCC	0.647													C|||	2	0.000399361	0.0	0.0	5008	,	,		12312	0.001		0.001	False		,,,				2504	0.0															0			20											69.0	58.0	62.0					20																	2380266		2203	4300	6503	2328266	SO:0001819	synonymous_variant	343641			AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.732C>T	20.37:g.2380266C>T		Somatic		Capture	Illumina GAIIx	4	2328266	Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Silent	SNP	HMMPfam_Transglut_N,superfamily_E set domains,superfamily_Cysteine proteinases,HMMSmart_SM00460,HMMPfam_Transglut_core,PatternScan_TRANSGLUTAMINASES,superfamily_Transglutaminase two C-terminal domains,HMMPfam_Transglut_C	p.G244	ENST00000202625.2	37	c.732	CCDS13025.1	20																																																																																			-	superfamily_Cysteine proteinases		0.647	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM6	protein_coding	OTTHUMT00000077581.2	C	NM_198994		2328266	+1	no_errors	NM_198994	genbank	human	validated	54_36p	silent	SNP	0.917	T
SLX4	84464	genome.wustl.edu	37	16	3639412	3639412	+	Silent	SNP	G	G	C			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr16:3639412G>C	ENST00000294008.3	-	12	4867	c.4227C>G	c.(4225-4227)gcC>gcG	p.A1409A		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	1409	Interaction with MUS81.|Interaction with PLK1 and TERF2-TERF2IP.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						GGCTTCTGTTGGCCTGATGGG	0.612								Direct reversal of damage																																								0			16											63.0	68.0	66.0					16																	3639412		2174	4252	6426	3579413	SO:0001819	synonymous_variant	84464			AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.4227C>G	16.37:g.3639412G>C		Somatic		Capture	Illumina GAIIx	4	3579413	Q69YT8|Q8TF15|Q96JP1	Silent	SNP	superfamily_POZ domain,HMMPfam_BTB,HMMSmart_SM00225	p.A1409	ENST00000294008.3	37	c.4227	CCDS10506.2	16																																																																																			-	NULL		0.612	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD12	protein_coding	OTTHUMT00000157301.3	G	NM_032444		3579413	-1	no_errors	NM_032444	genbank	human	provisional	54_36p	silent	SNP	0.000	C
KCNA6	3742	genome.wustl.edu	37	12	4920127	4920127	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr12:4920127A>T	ENST00000280684.3	+	1	1786	c.920A>T	c.(919-921)tAc>tTc	p.Y307F	RP11-234B24.4_ENST00000542988.1_lincRNA|KCNA6_ENST00000433855.1_Missense_Mutation_p.Y307F			P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 6	307					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|endometrium(5)|large_intestine(6)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(5)	49					Dalfampridine(DB06637)	ATCTTCCCCTACTTCATCACC	0.592										HNSCC(72;0.22)																																						0			12											79.0	70.0	73.0					12																	4920127		2203	4300	6503	4790388	SO:0001583	missense	3742			X17622	CCDS8534.1	12p13	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6225	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 96"""	176257				16382104	Standard	NM_002235		Approved	Kv1.6, HBK2, PPP1R96	uc001qng.3	P17658		ENST00000280684.3:c.920A>T	12.37:g.4920127A>T	ENSP00000280684:p.Tyr307Phe	Somatic		Capture	Illumina GAIIx	4	4790388		Missense_Mutation	SNP	superfamily_BTB/POZ_fold,HMMSmart_BTB,HMMPfam_K_tetra,superfamily_SSF81324,HMMPfam_Ion_trans	p.Y307F	ENST00000280684.3	37	c.920	CCDS8534.1	12	.	.	.	.	.	.	.	.	.	.	A	20.9	4.070258	0.76301	.	.	ENSG00000151079	ENST00000433855;ENST00000280684	D;D	0.98313	-4.86;-4.86	5.28	5.28	0.74379	Ion transport (1);	0.061213	0.64402	D	0.000002	D	0.97414	0.9154	L	0.28740	0.885	0.47862	D	0.999532	P	0.49358	0.923	P	0.57548	0.823	D	0.97710	1.0190	10	0.48119	T	0.1	.	14.5578	0.68113	1.0:0.0:0.0:0.0	.	307	P17658	KCNA6_HUMAN	F	307	ENSP00000408321:Y307F;ENSP00000280684:Y307F	ENSP00000280684:Y307F	Y	+	2	0	KCNA6	4790388	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.067000	0.93955	2.217000	0.71921	0.533000	0.62120	TAC	-	superfamily_SSF81324,HMMPfam_Ion_trans		0.592	KCNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA6	protein_coding	OTTHUMT00000398909.1	A	NM_002235		4790388	+1	no_errors	NM_002235	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
CNGA4	1262	genome.wustl.edu	37	11	6265372	6265372	+	Silent	SNP	C	C	T	rs376820772		TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr11:6265372C>T	ENST00000379936.2	+	6	1576	c.1461C>T	c.(1459-1461)atC>atT	p.I487I		NM_001037329.3	NP_001032406.1	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	487					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|kidney(1)|large_intestine(9)|lung(24)|prostate(3)|skin(1)	40		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAGCTGAGATCGCCCTGCAGG	0.557																																																0			11						C		1,4401	2.1+/-5.4	0,1,2200	100.0	87.0	91.0		1461	-4.5	1.0	11		91	0,8592		0,0,4296	no	coding-synonymous	CNGA4	NM_001037329.3		0,1,6496	TT,TC,CC		0.0,0.0227,0.0077		487/576	6265372	1,12993	2201	4296	6497	6221948	SO:0001819	synonymous_variant	1262			AK122736	CCDS31408.1	11p15.4	2011-07-05		2002-01-18		ENSG00000132259		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2152	protein-coding gene	gene with protein product		609472	"""cyclic nucleotide gated channel beta 2"""	CNCA2, CNGB2		11764791, 16382102	Standard	NM_001037329		Approved	OCNC2, OCNCb, CNG5	uc001mco.3	Q8IV77		ENST00000379936.2:c.1461C>T	11.37:g.6265372C>T		Somatic		Capture	Illumina GAIIx	4	6221948		Silent	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,superfamily_cAMP-binding domain-like,HMMSmart_SM00100,HMMPfam_cNMP_binding,PatternScan_CNMP_BINDING_1,PatternScan_CNMP_BINDING_2	p.I487	ENST00000379936.2	37	c.1461	CCDS31408.1	11																																																																																			-	NULL		0.557	CNGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNGA4	protein_coding	OTTHUMT00000383765.2	C	NM_001037329		6221948	+1	no_errors	NM_001037329	genbank	human	validated	54_36p	silent	SNP	0.995	T
FAM86MP	644517	genome.wustl.edu	37	4	9698351	9698351	+	IGR	SNP	T	T	C			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr4:9698351T>C								AC097493.1 (96300 upstream) : DRD5 (84906 downstream)																							GGACGAGCTGTACAAGGTGCT	0.567																																																0			4																																								9307449	SO:0001628	intergenic_variant	0																															4.37:g.9698351T>C		Somatic		Capture	Illumina GAIIx	4	9307449		Missense_Mutation	SNP	HMMPfam_Methyltransf_16,superfamily_S-adenosyl-L-methionine-dependent methyltransferases	p.Y63H		37	c.187		4																																																																																			-	NULL	0	0.567					ENSG00000186234			T			9307449	+1	no_start_codon	ENST00000340703	ensembl	human	known	54_36p	missense	SNP	1.000	C
MYH13	8735	genome.wustl.edu	37	17	10263282	10263282	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr17:10263282T>G	ENST00000418404.3	-	6	803	c.640A>C	c.(640-642)Atg>Ctg	p.M214L	MYH13_ENST00000252172.4_Missense_Mutation_p.M214L			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	214	Myosin motor.				cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						CTCACCTGCATTTTGCCTGGC	0.512																																																0			17											71.0	73.0	72.0					17																	10263282		2203	4300	6503	10204007	SO:0001583	missense	8735			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.640A>C	17.37:g.10263282T>G	ENSP00000404570:p.Met214Leu	Somatic		Capture	Illumina GAIIx	4	10204007	O95252|Q9P0U8	Missense_Mutation	SNP	HMMPfam_Myosin_N,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00242,HMMPfam_Myosin_head,superfamily_Prefoldin,HMMPfam_Myosin_tail_1	p.M214L	ENST00000418404.3	37	c.640	CCDS45613.1	17	.	.	.	.	.	.	.	.	.	.	T	14.03	2.414430	0.42817	.	.	ENSG00000006788	ENST00000252172	D	0.86865	-2.18	3.92	3.92	0.45320	Myosin head, motor domain (2);	.	.	.	.	T	0.78052	0.4223	N	0.20304	0.555	0.36145	D	0.847087	B	0.02656	0.0	B	0.06405	0.002	T	0.76408	-0.2970	9	0.32370	T	0.25	.	13.2263	0.59916	0.0:0.0:0.0:1.0	.	214	Q9UKX3	MYH13_HUMAN	L	214	ENSP00000252172:M214L	ENSP00000252172:M214L	M	-	1	0	MYH13	10204007	1.000000	0.71417	1.000000	0.80357	0.720000	0.41350	2.940000	0.49003	1.773000	0.52216	0.460000	0.39030	ATG	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00242,HMMPfam_Myosin_head		0.512	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYH13	protein_coding	OTTHUMT00000442255.1	T	NM_003802		10204007	-1	no_errors	NM_003802	genbank	human	validated	54_36p	missense	SNP	1.000	G
MYH1	4619	genome.wustl.edu	37	17	10406165	10406165	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr17:10406165T>C	ENST00000226207.5	-	24	3095	c.3001A>G	c.(3001-3003)Aag>Gag	p.K1001E	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1001					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						TGGAGAGCCTTCTTCTCCTTG	0.493																																																0			17											153.0	145.0	148.0					17																	10406165		2203	4300	6503	10346890	SO:0001583	missense	4619				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.3001A>G	17.37:g.10406165T>C	ENSP00000226207:p.Lys1001Glu	Somatic		Capture	Illumina GAIIx	4	10346890	Q14CA4|Q9Y622	Missense_Mutation	SNP	HMMPfam_Myosin_N,superfamily_SSF52540,HMMSmart_MYSc,HMMPfam_Myosin_head,HMMSmart_IQ,HMMPfam_IQ,HMMPfam_Myosin_tail_1	p.K1001E	ENST00000226207.5	37	c.3001	CCDS11155.1	17	.	.	.	.	.	.	.	.	.	.	T	25.5	4.647205	0.87958	.	.	ENSG00000109061	ENST00000226207	D	0.89939	-2.59	5.24	5.24	0.73138	.	0.000000	0.45126	U	0.000381	D	0.93135	0.7814	H	0.97491	4.015	0.48830	D	0.999716	P	0.36438	0.553	B	0.35899	0.213	D	0.94467	0.7681	10	0.87932	D	0	.	15.4365	0.75152	0.0:0.0:0.0:1.0	.	1001	P12882	MYH1_HUMAN	E	1001	ENSP00000226207:K1001E	ENSP00000226207:K1001E	K	-	1	0	MYH1	10346890	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.915000	0.87484	2.117000	0.64856	0.455000	0.32223	AAG	-	NULL		0.493	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	protein_coding	OTTHUMT00000252725.1	T	NM_005963		10346890	-1	no_errors	NM_005963	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
TAS2R42	353164	genome.wustl.edu	37	12	11339377	11339377	+	Missense_Mutation	SNP	A	A	T	rs149471990		TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr12:11339377A>T	ENST00000334266.1	-	1	166	c.167T>A	c.(166-168)aTt>aAt	p.I56N		NM_181429.1	NP_852094.1	Q7RTR8	T2R42_HUMAN	taste receptor, type 2, member 42	56					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|kidney(2)|lung(4)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(49;0.0455)			CAGTTGTCCAATTGTGGAGAT	0.408																																					Melanoma(15;352 722 10077 19546 48810)											0			12											147.0	132.0	137.0					12																	11339377		2203	4300	6503	11230644	SO:0001583	missense	353164			AX097739, AB199241	CCDS31747.1	12p13	2012-08-22			ENSG00000186136	ENSG00000186136		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18888	protein-coding gene	gene with protein product		613966				12679530	Standard	NM_181429		Approved	T2R24, T2R55, hT2R55, TAS2R55	uc001qzr.1	Q7RTR8	OTTHUMG00000168567	ENST00000334266.1:c.167T>A	12.37:g.11339377A>T	ENSP00000334050:p.Ile56Asn	Somatic		Capture	Illumina GAIIx	4	11230644	A2RRP4|Q645X0	Missense_Mutation	SNP	HMMPfam_TAS2R,superfamily_SSF81321	p.I56N	ENST00000334266.1	37	c.167	CCDS31747.1	12	.	.	.	.	.	.	.	.	.	.	A	13.60	2.284724	0.40394	.	.	ENSG00000186136	ENST00000334266	T	0.01209	5.17	3.21	3.21	0.36854	GPCR, rhodopsin-like superfamily (1);	0.190997	0.30920	U	0.008610	T	0.08313	0.0207	M	0.94063	3.49	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.03840	-1.0999	10	0.87932	D	0	.	8.079	0.30733	1.0:0.0:0.0:0.0	.	56	Q7RTR8	T2R42_HUMAN	N	56	ENSP00000334050:I56N	ENSP00000334050:I56N	I	-	2	0	TAS2R42	11230644	0.143000	0.22626	0.012000	0.15200	0.002000	0.02628	2.721000	0.47260	1.489000	0.48450	0.533000	0.62120	ATT	-	HMMPfam_TAS2R,superfamily_SSF81321		0.408	TAS2R42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R42	protein_coding	OTTHUMT00000400243.1	A	NM_181429		11230644	-1	no_errors	NM_181429	genbank	human	provisional	54_36p	missense	SNP	0.002	T
GCDH	2639	genome.wustl.edu	37	19	13007161	13007161	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr19:13007161G>A	ENST00000222214.5	+	8	989	c.778G>A	c.(778-780)Gcc>Acc	p.A260T	GCDH_ENST00000422947.2_Missense_Mutation_p.A216T|GCDH_ENST00000457854.1_Missense_Mutation_p.A260T|GCDH_ENST00000591470.1_Missense_Mutation_p.A260T			Q92947	GCDH_HUMAN	glutaryl-CoA dehydrogenase	260					cellular nitrogen compound metabolic process (GO:0034641)|fatty acid oxidation (GO:0019395)|fatty-acyl-CoA biosynthetic process (GO:0046949)|lysine catabolic process (GO:0006554)|small molecule metabolic process (GO:0044281)|tryptophan metabolic process (GO:0006568)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)|glutaryl-CoA dehydrogenase activity (GO:0004361)			autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)	19					Flavin adenine dinucleotide(DB03147)	GCGGGCCTCAGCCACAGGCAT	0.622																																					GBM(123;875 1636 7726 16444 26754)											0			19											55.0	54.0	55.0					19																	13007161		2203	4300	6503	12868161	SO:0001583	missense	2639			AF012342	CCDS12286.1	19p13.2	2010-04-30	2010-04-30			ENSG00000105607	1.3.99.7		4189	protein-coding gene	gene with protein product		608801	"""glutaryl-Coenzyme A dehydrogenase"""			1438360, 8088809	Standard	NM_000159		Approved	ACAD5	uc002mvq.4	Q92947		ENST00000222214.5:c.778G>A	19.37:g.13007161G>A	ENSP00000222214:p.Ala260Thr	Somatic		Capture	Illumina GAIIx	4	12868161	A8K2Z2|O14719	Missense_Mutation	SNP	superfamily_Acyl-CoA dehydrogenase NM domain-like,HMMPfam_Acyl-CoA_dh_N,HMMPfam_Acyl-CoA_dh_M,PatternScan_ACYL_COA_DH_1,superfamily_Acyl-CoA dehydrogenase C-terminal domain-like,HMMPfam_Acyl-CoA_dh_1,PatternScan_ACYL_COA_DH_2	p.A260T	ENST00000222214.5	37	c.778	CCDS12286.1	19	.	.	.	.	.	.	.	.	.	.	G	11.88	1.770094	0.31320	.	.	ENSG00000105607	ENST00000457854;ENST00000222214;ENST00000421816;ENST00000422947	D;D;D	0.98862	-5.19;-5.19;-5.19	5.22	-1.07	0.09968	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (1);	0.491354	0.22737	N	0.056244	D	0.94311	0.8172	L	0.27053	0.805	0.31676	N	0.64376	B;B;B;B;B	0.23891	0.093;0.02;0.0;0.001;0.002	B;B;B;B;B	0.16722	0.016;0.007;0.002;0.003;0.012	D	0.89939	0.4071	10	0.37606	T	0.19	.	6.0495	0.19777	0.1504:0.0:0.462:0.3876	.	216;96;227;260;260	B4DK85;B4DUY0;B4DQF2;Q92947;Q92947-2	.;.;.;GCDH_HUMAN;.	T	260;260;227;216	ENSP00000394872:A260T;ENSP00000222214:A260T;ENSP00000394821:A216T	ENSP00000222214:A260T	A	+	1	0	GCDH	12868161	0.690000	0.27699	0.129000	0.21949	0.426000	0.31534	0.861000	0.27885	-0.007000	0.14345	0.563000	0.77884	GCC	-	superfamily_Acyl-CoA dehydrogenase NM domain-like		0.622	GCDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCDH	protein_coding	OTTHUMT00000451897.1	G			12868161	+1	no_errors	NM_000159	genbank	human	reviewed	54_36p	missense	SNP	0.552	A
PDPN	10630	genome.wustl.edu	37	1	13910532	13910532	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr1:13910532T>A	ENST00000294489.6	+	1	573	c.232T>A	c.(232-234)Tgg>Agg	p.W78R	PDPN_ENST00000487038.1_5'Flank|PDPN_ENST00000376057.4_Missense_Mutation_p.W78R|PDPN_ENST00000509009.1_5'Flank|PDPN_ENST00000475043.1_5'Flank|PDPN_ENST00000376061.4_5'Flank|PDPN_ENST00000513143.1_5'Flank					podoplanin											endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	16	Ovarian(185;0.249)	all_lung(284;2.29e-05)|Lung NSC(185;4.37e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00969)|Colorectal(212;4.48e-06)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000347)|Kidney(185;0.00087)|KIRC - Kidney renal clear cell carcinoma(229;0.0027)|STAD - Stomach adenocarcinoma(313;0.00802)|READ - Rectum adenocarcinoma(331;0.0678)		GGGAACGATGTGGAAGGTGTC	0.597																																																0			1											50.0	39.0	42.0					1																	13910532		2200	4294	6494	13783119	SO:0001583	missense	10630			AB127958, AY194238	CCDS30602.1, CCDS41266.1, CCDS44060.1, CCDS53270.1	1p36.21	2008-02-05			ENSG00000162493	ENSG00000162493			29602	protein-coding gene	gene with protein product	"""lung type I cell membrane associated glycoprotein"""	608863				10393083, 9651190	Standard	NM_006474		Approved	T1A-2, Gp38, aggrus, GP40, PA2.26	uc001avd.3	Q86YL7	OTTHUMG00000007912	ENST00000294489.6:c.232T>A	1.37:g.13910532T>A	ENSP00000294489:p.Trp78Arg	Somatic		Capture	Illumina GAIIx	4	13783119		Missense_Mutation	SNP	HMMPfam_Podoplanin	p.W78R	ENST00000294489.6	37	c.232	CCDS30602.1	1	.	.	.	.	.	.	.	.	.	.	T	10.55	1.381397	0.24944	.	.	ENSG00000162493	ENST00000294489;ENST00000376057;ENST00000510906	T;T;T	0.54279	0.58;0.58;0.58	4.93	2.58	0.30949	.	0.403701	0.24296	N	0.039765	T	0.63698	0.2533	M	0.61703	1.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.70016	0.967;0.967	T	0.61598	-0.7030	10	0.87932	D	0	-9.8365	6.7472	0.23468	0.0:0.1892:0.0:0.8108	.	78;78	Q86YL7-3;Q86YL7-4	.;.	R	78;78;69	ENSP00000294489:W78R;ENSP00000365225:W78R;ENSP00000426302:W69R	ENSP00000294489:W78R	W	+	1	0	PDPN	13783119	1.000000	0.71417	0.993000	0.49108	0.195000	0.23768	1.674000	0.37544	0.312000	0.23038	0.460000	0.39030	TGG	-	HMMPfam_Podoplanin		0.597	PDPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDPN	protein_coding	OTTHUMT00000021783.2	T	NM_006474		13783119	+1	no_errors	NM_006474	genbank	human	reviewed	54_36p	missense	SNP	0.854	A
FLRT3	23767	genome.wustl.edu	37	20	14307301	14307301	+	Silent	SNP	A	A	G			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr20:14307301A>G	ENST00000378053.3	-	2	1108	c.852T>C	c.(850-852)agT>agC	p.S284S	MACROD2_ENST00000217246.4_Intron|FLRT3_ENST00000462077.1_5'Flank|MACROD2_ENST00000310348.4_Intron|FLRT3_ENST00000341420.4_Silent_p.S284S	NM_013281.3	NP_037413.1	Q9NZU0	FLRT3_HUMAN	fibronectin leucine rich transmembrane protein 3	284					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			breast(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Colorectal(1;0.0464)	COAD - Colon adenocarcinoma(2;0.129)	Colorectal(1;0.0393)		GAGGTAAATTACTTAGGTTAT	0.403																																																0			20											54.0	56.0	55.0					20																	14307301		2203	4300	6503	14255301	SO:0001819	synonymous_variant	23767			AF169677	CCDS13121.1	20p11	2013-02-11			ENSG00000125848	ENSG00000125848		"""Fibronectin type III domain containing"""	3762	protein-coding gene	gene with protein product		604808				10644439	Standard	NM_198391		Approved		uc002wow.2	Q9NZU0	OTTHUMG00000031914	ENST00000378053.3:c.852T>C	20.37:g.14307301A>G		Somatic		Capture	Illumina GAIIx	4	14255301	D3DW20|Q542Z9|Q96K39|Q96K42|Q96KB1|Q9P259	Silent	SNP	superfamily_SSF52058,HMMPfam_LRRNT,HMMSmart_LRRNT,HMMPfam_LRR_1,HMMSmart_LRR_TYP,HMMSmart_LRRCT,HMMPfam_LRRCT,HMMSmart_FN3,HMMPfam_fn3	p.S284	ENST00000378053.3	37	c.852	CCDS13121.1	20																																																																																			-	superfamily_SSF52058,HMMSmart_LRR_TYP,HMMPfam_LRR_1		0.403	FLRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLRT3	protein_coding	OTTHUMT00000078075.1	A	NM_013281		14255301	-1	no_errors	NM_013281	genbank	human	reviewed	54_36p	silent	SNP	0.997	G
GALNT15	117248	genome.wustl.edu	37	3	16261470	16261470	+	Silent	SNP	C	C	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr3:16261470C>A	ENST00000339732.5	+	8	2081	c.1578C>A	c.(1576-1578)atC>atA	p.I526I	GALNT15_ENST00000437509.1_Silent_p.I526I	NM_054110.4	NP_473451.3	Q8N3T1	GLT15_HUMAN	polypeptide N-acetylgalactosaminyltransferase 15	526	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										AAGGGGACATCCTGGGCTGTC	0.537																																																0			3											194.0	181.0	186.0					3																	16261470		2203	4300	6503	16236474	SO:0001819	synonymous_variant	117248			AY358443	CCDS33711.1	3p25.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000131386	ENSG00000131386	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	21531	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 15"""	615131	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 2"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"""	GALNTL2		12975309, 14702039, 15147861	Standard	NM_054110		Approved	GALNT7, pp-GalNAc-T15	uc003car.4	Q8N3T1	OTTHUMG00000156893	ENST00000339732.5:c.1578C>A	3.37:g.16261470C>A		Somatic		Capture	Illumina GAIIx	4	16236474	A6NMN1|B2R638|F1LIP6|Q86T60|Q96C46|Q96DJ5	Silent	SNP	superfamily_SSF53448,HMMPfam_Glycos_transf_2,superfamily_RicinB_like,HMMPfam_Ricin_B_lectin,HMMSmart_RICIN	p.I526	ENST00000339732.5	37	c.1578	CCDS33711.1	3																																																																																			-	superfamily_RicinB_like,HMMPfam_Ricin_B_lectin,HMMSmart_RICIN		0.537	GALNT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNTL2	protein_coding	OTTHUMT00000346483.2	C	NM_054110		16236474	+1	no_errors	NM_054110	genbank	human	validated	54_36p	silent	SNP	0.001	A
KIF16B	55614	genome.wustl.edu	37	20	16354921	16354921	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr20:16354921C>A	ENST00000354981.2	-	20	3488	c.3331G>T	c.(3331-3333)Gtt>Ttt	p.V1111F	KIF16B_ENST00000355755.3_Missense_Mutation_p.V1111F|KIF16B_ENST00000408042.1_Missense_Mutation_p.V1111F|KIF16B_ENST00000378003.2_Missense_Mutation_p.V337F	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	1111					ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						ATGAGGGGAACCAGGTGTGAT	0.458																																																0			20											105.0	92.0	97.0					20																	16354921		2203	4300	6503	16302921	SO:0001583	missense	55614			AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.3331G>T	20.37:g.16354921C>A	ENSP00000347076:p.Val1111Phe	Somatic		Capture	Illumina GAIIx	4	16302921	A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Missense_Mutation	SNP	HMMSmart_SM00129,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Kinesin,PatternScan_KINESIN_MOTOR_DOMAIN1,PatternScan_LECTIN_LEGUME_BETA,superfamily_SMAD/FHA domain,HMMPfam_FHA,superfamily_PX domain,HMMPfam_PX,HMMSmart_SM00312	p.V1111F	ENST00000354981.2	37	c.3331	CCDS13122.1	20	.	.	.	.	.	.	.	.	.	.	C	15.97	2.989185	0.53934	.	.	ENSG00000089177	ENST00000354981;ENST00000355755;ENST00000377997;ENST00000378003;ENST00000408042	T;T;T;T	0.71103	-0.54;-0.54;2.43;-0.54	5.57	-0.159	0.13379	.	1.176350	0.06046	N	0.655697	T	0.56630	0.1998	L	0.29908	0.895	0.09310	N	1	P;B	0.44380	0.834;0.148	B;B	0.37144	0.242;0.054	T	0.51172	-0.8739	10	0.56958	D	0.05	.	9.0442	0.36336	0.0:0.3828:0.48:0.1372	.	1111;1111	Q96L93-2;Q96L93	.;KI16B_HUMAN	F	1111;1111;955;337;1111	ENSP00000347076:V1111F;ENSP00000347995:V1111F;ENSP00000367242:V337F;ENSP00000384164:V1111F	ENSP00000347076:V1111F	V	-	1	0	KIF16B	16302921	0.000000	0.05858	0.002000	0.10522	0.515000	0.34225	-0.558000	0.05978	0.023000	0.15187	0.643000	0.83706	GTT	-	NULL		0.458	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF16B	protein_coding	OTTHUMT00000078104.2	C	NM_017683		16302921	-1	no_errors	NM_024704	genbank	human	validated	54_36p	missense	SNP	0.000	A
LDHC	3948	genome.wustl.edu	37	11	18472564	18472564	+	Silent	SNP	C	C	A	rs200582503		TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr11:18472564C>A	ENST00000541669.1	+	8	1000	c.889C>A	c.(889-891)Cgg>Agg	p.R297R	LDHC_ENST00000536880.1_Silent_p.R283R|LDHC_ENST00000535809.1_Missense_Mutation_p.A216E|LDHC_ENST00000544105.1_3'UTR|LDHC_ENST00000537486.1_Missense_Mutation_p.A158E|LDHC_ENST00000546146.1_3'UTR|LDHC_ENST00000280704.4_Silent_p.R297R			P07864	LDHC_HUMAN	lactate dehydrogenase C	297					ATP biosynthetic process (GO:0006754)|cellular carbohydrate metabolic process (GO:0044262)|lactate biosynthetic process from pyruvate (GO:0019244)|lactate oxidation (GO:0019516)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|motile cilium (GO:0031514)|nucleus (GO:0005634)	L-lactate dehydrogenase activity (GO:0004459)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TGTCTTGGGGCGGAATGGTGT	0.373																																																0			11											115.0	113.0	113.0					11																	18472564		2199	4293	6492	18429140	SO:0001819	synonymous_variant	3948			AY286300	CCDS7840.1	11p15.1	2012-10-02			ENSG00000166796	ENSG00000166796	1.1.1.27		6544	protein-coding gene	gene with protein product	"""cancer/testis antigen 32"""	150150					Standard	NM_002301		Approved	CT32	uc001mom.4	P07864	OTTHUMG00000167722	ENST00000541669.1:c.889C>A	11.37:g.18472564C>A		Somatic		Capture	Illumina GAIIx	4	18429140	D3DQY4|Q6GSG8|Q7Z7J4	Silent	SNP	superfamily_NAD(P)-bd,HMMPfam_Ldh_1_N,superfamily_Lactate_DH/Glyco_hydro_4_C,HMMPfam_Ldh_1_C,PatternScan_L_LDH	p.R297	ENST00000541669.1	37	c.889	CCDS7840.1	11	.	.	.	.	.	.	.	.	.	.	C	11.50	1.657607	0.29425	.	.	ENSG00000166796	ENST00000537486;ENST00000535809	D;D	0.91180	-2.8;-1.78	4.65	3.72	0.42706	.	.	.	.	.	T	0.79452	0.4448	.	.	.	0.09310	N	1	B	0.31485	0.325	B	0.26094	0.066	T	0.65681	-0.6109	8	0.14656	T	0.56	-0.6244	6.5413	0.22382	0.0:0.7177:0.1855:0.0968	.	216	F5H155	.	E	158;216	ENSP00000441478:A158E;ENSP00000443997:A216E	ENSP00000443997:A216E	A	+	2	0	LDHC	18429140	0.011000	0.17503	0.172000	0.22920	0.930000	0.56654	1.565000	0.36386	1.288000	0.44600	0.561000	0.74099	GCG	-	superfamily_Lactate_DH/Glyco_hydro_4_C,HMMPfam_Ldh_1_C		0.373	LDHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LDHC	protein_coding	OTTHUMT00000395892.1	C	NM_017448		18429140	+1	no_errors	NM_002301	genbank	human	reviewed	54_36p	silent	SNP	0.017	A
OR4E2	26686	genome.wustl.edu	37	14	22134002	22134002	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr14:22134002G>T	ENST00000408935.1	+	1	706	c.706G>T	c.(706-708)Gcc>Tcc	p.A236S		NM_001001912.1	NP_001001912.1	Q8NGC2	OR4E2_HUMAN	olfactory receptor, family 4, subfamily E, member 2	236						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0137)		GCGCCAGAAAGCCCTGTCTAC	0.522																																																0			14											106.0	101.0	103.0					14																	22134002		1967	4153	6120	21203842	SO:0001583	missense	26686				CCDS41916.1	14q11.2	2013-09-23			ENSG00000221977	ENSG00000221977		"""GPCR / Class A : Olfactory receptors"""	8297	protein-coding gene	gene with protein product							Standard	NM_001001912		Approved		uc010tmd.2	Q8NGC2	OTTHUMG00000168979	ENST00000408935.1:c.706G>T	14.37:g.22134002G>T	ENSP00000386195:p.Ala236Ser	Somatic		Capture	Illumina GAIIx	4	21203842	Q6IET6|Q96R62	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.A236S	ENST00000408935.1	37	c.706	CCDS41916.1	14	.	.	.	.	.	.	.	.	.	.	G	23.0	4.356321	0.82243	.	.	ENSG00000221977	ENST00000408935	T	0.00359	7.87	5.68	5.68	0.88126	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37857	U	0.001906	T	0.01320	0.0043	M	0.93550	3.43	0.58432	D	0.999998	D	0.76494	0.999	D	0.79784	0.993	T	0.51387	-0.8712	10	0.87932	D	0	.	17.6362	0.88123	0.0:0.0:1.0:0.0	.	236	Q8NGC2	OR4E2_HUMAN	S	236	ENSP00000386195:A236S	ENSP00000386195:A236S	A	+	1	0	OR4E2	21203842	1.000000	0.71417	1.000000	0.80357	0.676000	0.39594	5.508000	0.67006	2.829000	0.97493	0.655000	0.94253	GCC	-	superfamily_SSF81321,HMMPfam_7tm_1		0.522	OR4E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4E2	protein_coding	OTTHUMT00000401874.1	G			21203842	+1	no_errors	NM_001001912	genbank	human	validated	54_36p	missense	SNP	1.000	T
OR4E2	26686	genome.wustl.edu	37	14	22134044	22134044	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr14:22134044T>A	ENST00000408935.1	+	1	748	c.748T>A	c.(748-750)Ttc>Atc	p.F250I		NM_001001912.1	NP_001001912.1	Q8NGC2	OR4E2_HUMAN	olfactory receptor, family 4, subfamily E, member 2	250						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0137)		GGTTGCCCTCTTCTTTGGGCC	0.517																																																0			14											90.0	86.0	87.0					14																	22134044		1948	4143	6091	21203884	SO:0001583	missense	26686				CCDS41916.1	14q11.2	2013-09-23			ENSG00000221977	ENSG00000221977		"""GPCR / Class A : Olfactory receptors"""	8297	protein-coding gene	gene with protein product							Standard	NM_001001912		Approved		uc010tmd.2	Q8NGC2	OTTHUMG00000168979	ENST00000408935.1:c.748T>A	14.37:g.22134044T>A	ENSP00000386195:p.Phe250Ile	Somatic		Capture	Illumina GAIIx	4	21203884	Q6IET6|Q96R62	Missense_Mutation	SNP	HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321	p.F250I	ENST00000408935.1	37	c.748	CCDS41916.1	14	.	.	.	.	.	.	.	.	.	.	T	19.91	3.914523	0.72983	.	.	ENSG00000221977	ENST00000408935	T	0.00289	8.28	5.68	4.54	0.55810	GPCR, rhodopsin-like superfamily (1);	0.232477	0.22509	U	0.059138	T	0.00580	0.0019	H	0.94964	3.605	0.41821	D	0.990025	P	0.39831	0.69	P	0.46452	0.517	T	0.58463	-0.7632	10	0.49607	T	0.09	.	9.8877	0.41272	0.0:0.0808:0.0:0.9191	.	250	Q8NGC2	OR4E2_HUMAN	I	250	ENSP00000386195:F250I	ENSP00000386195:F250I	F	+	1	0	OR4E2	21203884	0.452000	0.25713	0.892000	0.35008	0.983000	0.72400	2.683000	0.46943	1.092000	0.41356	0.533000	0.62120	TTC	-	HMMPfam_7tm_1,superfamily_SSF81321		0.517	OR4E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4E2	protein_coding	OTTHUMT00000401874.1	T			21203884	+1	no_errors	NM_001001912	genbank	human	validated	54_36p	missense	SNP	0.873	A
KIAA0319	9856	genome.wustl.edu	37	6	24596166	24596166	+	Nonsense_Mutation	SNP	C	C	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr6:24596166C>A	ENST00000378214.3	-	3	1260	c.736G>T	c.(736-738)Gag>Tag	p.E246*	KIAA0319_ENST00000543707.1_Nonsense_Mutation_p.E246*|KIAA0319_ENST00000430948.2_Nonsense_Mutation_p.E201*|KIAA0319_ENST00000535378.1_Nonsense_Mutation_p.E237*|KIAA0319_ENST00000537886.1_Nonsense_Mutation_p.E246*	NM_001168375.1|NM_014809.3	NP_001161847.1|NP_055624.2	Q5VV43	K0319_HUMAN	KIAA0319	246					negative regulation of dendrite development (GO:2000171)|neuron migration (GO:0001764)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|kidney(3)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	53						TCCAACACCTCTCCTGAAGAT	0.527																																																0			6											107.0	103.0	104.0					6																	24596166		2203	4300	6503	24704145	SO:0001587	stop_gained	9856			AB002317	CCDS34348.1, CCDS54969.1, CCDS54970.1, CCDS54971.1, CCDS75409.1	6p22.3	2013-12-13			ENSG00000137261	ENSG00000137261			21580	protein-coding gene	gene with protein product	"""neuronal migration"""	609269				9205841, 15514892	Standard	NM_014809		Approved	NMIG	uc003neh.1	Q5VV43	OTTHUMG00000014358	ENST00000378214.3:c.736G>T	6.37:g.24596166C>A	ENSP00000367459:p.Glu246*	Somatic		Capture	Illumina GAIIx	4	24704145	A7MD37|B2RTU7|B4DHA7|B4DK75|B7ZML3|F5H123|Q9UJC8|Q9Y4G7	Nonsense_Mutation	SNP	HMMSmart_SM00765,HMMSmart_SM00060,HMMSmart_SM00089,superfamily_PKD domain	p.E246*	ENST00000378214.3	37	c.736	CCDS34348.1	6	.	.	.	.	.	.	.	.	.	.	C	24.2	4.501703	0.85176	.	.	ENSG00000137261	ENST00000537886;ENST00000535378;ENST00000430948;ENST00000378214;ENST00000543707	.	.	.	4.09	-0.261	0.12963	.	0.261433	0.26935	N	0.021752	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-4.8664	4.874	0.13648	0.0:0.375:0.2892:0.3358	.	.	.	.	X	246;237;201;246;246	.	ENSP00000367459:E246X	E	-	1	0	KIAA0319	24704145	0.050000	0.20438	0.003000	0.11579	0.028000	0.11728	0.367000	0.20382	0.036000	0.15547	0.609000	0.83330	GAG	-	NULL		0.527	KIAA0319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0319	protein_coding	OTTHUMT00000040009.1	C	NM_014809		24704145	-1	no_errors	NM_014809	genbank	human	validated	54_36p	nonsense	SNP	0.007	A
ITPR2	3709	genome.wustl.edu	37	12	26774142	26774142	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr12:26774142A>C	ENST00000381340.3	-	26	3792	c.3376T>G	c.(3376-3378)Tct>Gct	p.S1126A	RP11-666F17.1_ENST00000414098.2_RNA|ITPR2_ENST00000545902.1_5'UTR	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1126					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	CATAGCTCAGACTTTTCTACT	0.423																																																0			12											335.0	310.0	318.0					12																	26774142		1887	4127	6014	26665409	SO:0001583	missense	3709			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.3376T>G	12.37:g.26774142A>C	ENSP00000370744:p.Ser1126Ala	Somatic		Capture	Illumina GAIIx	4	26665409	O94773	Missense_Mutation	SNP	HMMPfam_Ins145_P3_rec,superfamily_MIR domain (Pfam 02815),HMMSmart_SM00472,HMMPfam_MIR,superfamily_IP3 receptor type 1 binding core domain 2,HMMPfam_RYDR_ITPR,HMMPfam_RIH_assoc,HMMPfam_Ion_trans	p.S1126A	ENST00000381340.3	37	c.3376	CCDS41764.1	12	.	.	.	.	.	.	.	.	.	.	A	25.8	4.672317	0.88348	.	.	ENSG00000123104	ENST00000381340	D	0.96011	-3.88	4.82	4.82	0.62117	.	0.186955	0.49305	D	0.000150	D	0.97430	0.9159	M	0.85197	2.74	0.80722	D	1	D	0.67145	0.996	D	0.63381	0.914	D	0.98039	1.0381	10	0.66056	D	0.02	.	14.5562	0.68101	1.0:0.0:0.0:0.0	.	1126	Q14571	ITPR2_HUMAN	A	1126	ENSP00000370744:S1126A	ENSP00000370744:S1126A	S	-	1	0	ITPR2	26665409	1.000000	0.71417	0.799000	0.32177	0.906000	0.53458	9.087000	0.94110	2.024000	0.59613	0.528000	0.53228	TCT	-	NULL		0.423	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	protein_coding	OTTHUMT00000402732.1	A	NM_002223		26665409	-1	no_errors	NM_002223	genbank	human	validated	54_36p	missense	SNP	1.000	C
CCDC34	91057	genome.wustl.edu	37	11	27363055	27363055	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr11:27363055C>G	ENST00000328697.6	-	4	1322	c.649G>C	c.(649-651)Gaa>Caa	p.E217Q	CCDC34_ENST00000529615.1_5'UTR	NM_030771.1	NP_110398.1	Q96HJ3	CCD34_HUMAN	coiled-coil domain containing 34	217										endometrium(2)|large_intestine(4)|lung(1)|prostate(1)|urinary_tract(1)	9						gctgctttttcctccatttct	0.264																																																0			11											106.0	95.0	99.0					11																	27363055		1858	3605	5463	27319631	SO:0001583	missense	91057			AF382034	CCDS7863.1, CCDS31448.1	11p14.1	2010-03-30			ENSG00000109881	ENSG00000109881			25079	protein-coding gene	gene with protein product		612324				11173847	Standard	NM_080654		Approved	NY-REN-41, L15, RAMA3	uc001mrh.1	Q96HJ3	OTTHUMG00000166211	ENST00000328697.6:c.649G>C	11.37:g.27363055C>G	ENSP00000330240:p.Glu217Gln	Somatic		Capture	Illumina GAIIx	4	27319631	B2R8G2|Q8IX69|Q9H2A6|Q9Y599	Missense_Mutation	SNP	NULL	p.E217Q	ENST00000328697.6	37	c.649	CCDS31448.1	11	.	.	.	.	.	.	.	.	.	.	C	16.11	3.029850	0.54790	.	.	ENSG00000109881	ENST00000328697	T	0.23147	1.92	3.84	3.84	0.44239	.	0.149656	0.43579	D	0.000542	T	0.39708	0.1088	L	0.55481	1.735	0.80722	D	1	D	0.76494	0.999	D	0.63283	0.913	T	0.06356	-1.0831	10	0.38643	T	0.18	-6.5991	11.5494	0.50713	0.0:1.0:0.0:0.0	.	217	Q96HJ3	CCD34_HUMAN	Q	217	ENSP00000330240:E217Q	ENSP00000330240:E217Q	E	-	1	0	CCDC34	27319631	0.991000	0.36638	0.990000	0.47175	0.948000	0.59901	3.710000	0.54860	2.440000	0.82611	0.591000	0.81541	GAA	-	NULL		0.264	CCDC34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC34	protein_coding	OTTHUMT00000388396.2	C	NM_030771		27319631	-1	no_errors	NM_030771	genbank	human	validated	54_36p	missense	SNP	0.998	G
RP11-85G18.6	0	genome.wustl.edu	37	10	27535107	27535107	+	lincRNA	SNP	T	T	C			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr10:27535107T>C	ENST00000574842.1	+	0	255				LRRC37A6P_ENST00000284414.4_RNA																							TCATCCTCATTAGATGACTTC	0.502																																																0			10																																								27575113			387646																															10.37:g.27535107T>C		Somatic		Capture	Illumina GAIIx	4	27575113		RNA	SNP	-	NULL	ENST00000574842.1	37	NULL		10																																																																																			-	-		0.502	RP11-85G18.6-001	KNOWN	basic	lincRNA	LOC387646	lincRNA	OTTHUMT00000436904.1	T			27575113	-1	pseudogene	NR_003525	genbank	human	provisional	54_36p	rna	SNP	0.003	C
CHRNA7	1139	genome.wustl.edu	37	15	32323117	32323117	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr15:32323117G>C	ENST00000306901.3	+	2	169	c.72G>C	c.(70-72)gaG>gaC	p.E24D	CHRNA7_ENST00000455693.2_5'UTR|CHRNA7_ENST00000454250.3_Missense_Mutation_p.E53D	NM_000746.5	NP_000737.1	P36544	ACHA7_HUMAN	cholinergic receptor, nicotinic, alpha 7 (neuronal)	24					activation of MAPK activity (GO:0000187)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to ethanol (GO:0048149)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cellular calcium ion homeostasis (GO:0006874)|cognition (GO:0050890)|dopamine biosynthetic process (GO:0042416)|endocytosis (GO:0006897)|generation of ovulation cycle rhythm (GO:0060112)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|memory (GO:0007613)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of tumor necrosis factor production (GO:0032720)|neuronal action potential (GO:0019228)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart rate involved in baroreceptor response to decreased systemic arterial blood pressure (GO:0001988)|regulation of norepinephrine secretion (GO:0014061)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to food (GO:0032094)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|signal transduction (GO:0007165)|sperm motility (GO:0030317)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|T cell activation (GO:0042110)	acetylcholine-gated channel complex (GO:0005892)|apical plasma membrane (GO:0016324)|asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|external side of plasma membrane (GO:0009897)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|acetylcholine-gated cation channel activity (GO:0022848)|beta-amyloid binding (GO:0001540)|chloride channel regulator activity (GO:0017081)|drug binding (GO:0008144)|protein homodimerization activity (GO:0042803)|toxic substance binding (GO:0015643)			endometrium(3)|large_intestine(1)|lung(6)|ovary(2)	12		all_lung(180;6.35e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	TGCAAGGCGAGTTCCAGAGGA	0.637																																					Esophageal Squamous(193;529 2900 40232 43193)											0			15											48.0	46.0	47.0					15																	32323117		2201	4300	6501	30110409	SO:0001583	missense	1139			Z23141	CCDS10027.1, CCDS53924.1	15q13.3	2012-02-11	2012-02-07		ENSG00000175344	ENSG00000175344		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1960	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 7 (neuronal)"""	118511	"""cholinergic receptor, nicotinic, alpha polypeptide 7"""			8188270	Standard	NM_001190455		Approved		uc021sic.2	P36544	OTTHUMG00000129285	ENST00000306901.3:c.72G>C	15.37:g.32323117G>C	ENSP00000303727:p.Glu24Asp	Somatic		Capture	Illumina GAIIx	4	30110409	A8K7Q4|B4DFS0|Q15826|Q8IUZ4|Q96RH2|Q99555|Q9BXH0	Missense_Mutation	SNP	superfamily_Neur_chan_LBD,HMMPfam_Neur_chan_LBD,PatternScan_NEUROTR_ION_CHANNEL,superfamily_Neu_channel_TM,HMMPfam_Neur_chan_memb	p.E24D	ENST00000306901.3	37	c.72	CCDS10027.1	15	.	.	.	.	.	.	.	.	.	.	G	12.82	2.052172	0.36181	.	.	ENSG00000175344	ENST00000454250;ENST00000306901;ENST00000449991	T;T	0.78364	-1.17;-1.15	4.41	4.41	0.53225	Neurotransmitter-gated ion-channel ligand-binding (1);	0.131443	0.49916	D	0.000139	T	0.67011	0.2848	N	0.16266	0.395	0.80722	D	1	B;B;B	0.28900	0.003;0.052;0.227	B;B;B	0.34301	0.018;0.028;0.179	T	0.68704	-0.5338	10	0.51188	T	0.08	.	14.8598	0.70372	0.0:0.0:1.0:0.0	.	24;40;24	F5H8K5;B1N7F6;P36544	.;.;ACHA7_HUMAN	D	53;24;24	ENSP00000407546:E53D;ENSP00000303727:E24D	ENSP00000303727:E24D	E	+	3	2	CHRNA7	30110409	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.729000	0.47327	2.190000	0.69967	0.491000	0.48974	GAG	-	superfamily_Neur_chan_LBD		0.637	CHRNA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CHRNA7	protein_coding	OTTHUMT00000251410.2	G			30110409	+1	no_errors	NM_000746	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
PRRC2A	7916	genome.wustl.edu	37	6	31599160	31599160	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr6:31599160C>T	ENST00000376033.2	+	16	2944	c.2710C>T	c.(2710-2712)Cgc>Tgc	p.R904C	PRRC2A_ENST00000376007.4_Missense_Mutation_p.R904C	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	904	4 X 57 AA type A repeats.			PARGVGSGGQ -> LPASRSGA (in Ref. 1; AAA35585/AAA35586 and 8; CAA78744). {ECO:0000305}.		cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						AAAGCCTGCCCGCGGAGTCGG	0.647																																																0			6											24.0	20.0	22.0					6																	31599160		1508	2707	4215	31707139	SO:0001583	missense	7916			M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.2710C>T	6.37:g.31599160C>T	ENSP00000365201:p.Arg904Cys	Somatic		Capture	Illumina GAIIx	4	31707139	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	HMMPfam_BAT2_N	p.R904C	ENST00000376033.2	37	c.2710	CCDS4708.1	6	.	.	.	.	.	.	.	.	.	.	C	6.511	0.462439	0.12342	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033;ENST00000376010	T;T	0.01854	4.6;4.6	4.93	4.93	0.64822	.	0.271232	0.27072	N	0.021080	T	0.00815	0.0027	N	0.19112	0.55	0.46774	D	0.999199	B	0.16166	0.016	B	0.08055	0.003	T	0.50136	-0.8863	10	0.87932	D	0	-9.0305	7.311	0.26475	0.0:0.8212:0.0:0.1788	.	904	P48634	PRC2A_HUMAN	C	904;893;904;904;129	ENSP00000365175:R904C;ENSP00000365201:R904C	ENSP00000365175:R904C	R	+	1	0	PRRC2A	31707139	0.005000	0.15991	0.925000	0.36789	0.496000	0.33645	0.874000	0.28065	2.566000	0.86566	0.561000	0.74099	CGC	-	NULL		0.647	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BAT2	protein_coding	OTTHUMT00000259319.1	C	NM_080686		31707139	+1	no_errors	NM_080686	genbank	human	reviewed	54_36p	missense	SNP	0.011	T
EPC1	80314	genome.wustl.edu	37	10	32581969	32581969	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr10:32581969T>G	ENST00000263062.8	-	4	882	c.613A>C	c.(613-615)Aat>Cat	p.N205H	EPC1_ENST00000375110.2_Missense_Mutation_p.N155H|EPC1_ENST00000319778.6_Missense_Mutation_p.N205H	NM_025209.2	NP_079485.1	Q9H2F5	EPC1_HUMAN	enhancer of polycomb homolog 1 (Drosophila)	205					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(5)|urinary_tract(1)	24		Prostate(175;0.0199)				TAAGGATCATTTGTGCTGGAA	0.313																																																0			10											67.0	68.0	67.0					10																	32581969		2202	4300	6502	32621975	SO:0001583	missense	80314			AF277374	CCDS7172.1, CCDS60511.1, CCDS73083.1	10p11	2005-12-12			ENSG00000120616	ENSG00000120616			19876	protein-coding gene	gene with protein product		610999				10976108	Standard	NM_025209		Approved	Epl1	uc001iwg.2	Q9H2F5	OTTHUMG00000017925	ENST00000263062.8:c.613A>C	10.37:g.32581969T>G	ENSP00000263062:p.Asn205His	Somatic		Capture	Illumina GAIIx	4	32621975	B4DSC3|D3DRX7|Q5VW54|Q5VW56|Q5VW58|Q8NAQ4|Q8NE21|Q96LF4|Q96RR6|Q9H7T7	Missense_Mutation	SNP	HMMPfam_EPL1,HMMPfam_E_Pc_C	p.N205H	ENST00000263062.8	37	c.613	CCDS7172.1	10	.	.	.	.	.	.	.	.	.	.	T	21.4	4.147673	0.77888	.	.	ENSG00000120616	ENST00000375110;ENST00000319778;ENST00000263062	.	.	.	6.08	6.08	0.98989	.	0.127384	0.64402	D	0.000001	D	0.83599	0.5289	M	0.86268	2.805	0.58432	D	0.999999	P;D;D;B	0.63046	0.599;0.988;0.992;0.439	B;P;D;B	0.70016	0.133;0.804;0.967;0.23	D	0.85983	0.1484	9	0.72032	D	0.01	-21.2473	16.6512	0.85203	0.0:0.0:0.0:1.0	.	205;155;205;205	B8XCX7;Q9H2F5-3;Q9H2F5-2;Q9H2F5	.;.;.;EPC1_HUMAN	H	155;205;205	.	ENSP00000263062:N205H	N	-	1	0	EPC1	32621975	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.162000	0.64942	2.333000	0.79357	0.482000	0.46254	AAT	-	NULL		0.313	EPC1-004	KNOWN	basic|CCDS	protein_coding	EPC1	protein_coding	OTTHUMT00000047484.1	T			32621975	-1	no_errors	NM_025209	genbank	human	provisional	54_36p	missense	SNP	1.000	G
HLA-DQB2	3120	genome.wustl.edu	37	6	32724241	32724241	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr6:32724241G>A	ENST00000437316.2	-	6	847	c.784C>T	c.(784-786)Ctc>Ttc	p.L262F	HLA-DQB2_ENST00000411527.1_Missense_Mutation_p.L225F|HLA-DQB2_ENST00000435145.2_3'UTR			P05538	DQB2_HUMAN	major histocompatibility complex, class II, DQ beta 2	266					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|B cell affinity maturation (GO:0002344)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of alpha-beta T cell activation (GO:0046635)|positive regulation of antigen processing and presentation (GO:0002579)|positive regulation of T-helper 1 type immune response (GO:0002827)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome (GO:0005769)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)|toxic substance binding (GO:0015643)			endometrium(1)|kidney(1)|lung(1)|prostate(2)	5						CAGTGCAGGAGTCCTGGAGAA	0.552																																																0			6																																								32832219	SO:0001583	missense	3120			M83890	CCDS56419.1	6p21.3	2013-01-11			ENSG00000232629	ENSG00000232629		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4945	protein-coding gene	gene with protein product		615161		HLA-DXB		2564844	Standard	NM_001198858		Approved		uc003oby.4	P05538	OTTHUMG00000031125	ENST00000437316.2:c.784C>T	6.37:g.32724241G>A	ENSP00000396330:p.Leu262Phe	Somatic		Capture	Illumina GAIIx	4	32832219	A6NIA5|Q29826|Q29870|Q29871|Q29872|Q29873|Q5SR06	Missense_Mutation	SNP	superfamily_MHC_I/II-like_Ag-recog,HMMPfam_MHC_II_beta,superfamily_SSF48726,HMMPfam_C1-set,HMMSmart_IGc1,PatternScan_IG_MHC	p.L262F	ENST00000437316.2	37	c.784		6	.	.	.	.	.	.	.	.	.	.	.	15.84	2.950796	0.53186	.	.	ENSG00000232629	ENST00000437316;ENST00000411527	T;T	0.00638	6.06;6.04	2.41	2.41	0.29592	.	.	.	.	.	T	0.00496	0.0016	N	0.08118	0	0.28024	N	0.934386	D	0.71674	0.998	D	0.75484	0.986	T	0.60772	-0.7197	9	0.87932	D	0	.	8.4181	0.32683	0.0:0.0:1.0:0.0	.	225	Q5SR06	.	F	262;225	ENSP00000396330:L262F;ENSP00000390431:L225F	ENSP00000390431:L225F	L	-	1	0	HLA-DQB2	32832219	1.000000	0.71417	0.990000	0.47175	0.204000	0.24138	2.095000	0.41729	1.662000	0.50781	0.491000	0.48974	CTC	-	NULL		0.552	HLA-DQB2-003	KNOWN	basic|appris_principal	protein_coding	HLA-DQB2	protein_coding	OTTHUMT00000076216.2	G			32832219	-1	no_errors	ENST00000374931	ensembl	human	known	54_36p	missense	SNP	0.362	A
HLA-DPA1	3113	genome.wustl.edu	37	6	33036866	33036866	+	Silent	SNP	G	G	C			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr6:33036866G>C	ENST00000419277.1	-	4	687	c.558C>G	c.(556-558)ccC>ccG	p.P186P	HLA-DPA1_ENST00000428995.1_Silent_p.P186P|HLA-DPA1_ENST00000463066.1_5'Flank	NM_001242524.1|NM_001242525.1	NP_001229453.1|NP_001229454.1	P20036	DPA1_HUMAN	major histocompatibility complex, class II, DP alpha 1	186	Alpha-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cellular response to interferon-gamma (GO:0071346)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)			kidney(5)|large_intestine(1)|lung(6)|prostate(1)|skin(2)	15						CCTCTGCTGAGGGCACAAAGG	0.552																																																0			6											210.0	231.0	223.0					6																	33036866		1509	2708	4217	33144844	SO:0001819	synonymous_variant	3113			X00457	CCDS4764.1	6p21.3	2013-01-11			ENSG00000231389	ENSG00000231389		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4938	protein-coding gene	gene with protein product		142880		HLA-DP1A		6584734	Standard	NM_033554		Approved		uc003ocs.2	P20036	OTTHUMG00000031058	ENST00000419277.1:c.558C>G	6.37:g.33036866G>C		Somatic		Capture	Illumina GAIIx	4	33144844	A9YWH7|B9UKH4|O19722|O46883|P01905|P79554|Q2Q060|Q2Q061|Q5EY03|Q5STP1|Q6DQK4|Q9BCQ1|Q9TPX3|Q9XS10	Silent	SNP	superfamily_MHC antigen-recognition domain,HMMPfam_MHC_II_alpha,superfamily_Immunoglobulin,HMMPfam_C1-set,HMMSmart_SM00407,PatternScan_IG_MHC	p.P186	ENST00000419277.1	37	c.558	CCDS4764.1	6	.	.	.	.	.	.	.	.	.	.	G	0.244	-1.011328	0.02095	.	.	ENSG00000231389	ENST00000437811	.	.	.	3.4	2.52	0.30459	.	.	.	.	.	T	0.36717	0.0977	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.24261	-1.0165	4	.	.	.	.	4.7381	0.12999	0.1221:0.0:0.6655:0.2124	.	.	.	.	V	54	.	.	L	-	1	0	HLA-DPA1	33144844	0.549000	0.26481	0.258000	0.24420	0.123000	0.20343	0.694000	0.25512	0.702000	0.31825	0.643000	0.83706	CTC	-	superfamily_Immunoglobulin,HMMPfam_C1-set,HMMSmart_SM00407		0.552	HLA-DPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DPA1	protein_coding	OTTHUMT00000076071.3	G	NM_033554		33144844	-1	no_errors	NM_033554	genbank	human	reviewed	54_36p	silent	SNP	0.162	C
MYH9	4627	genome.wustl.edu	37	22	36695039	36695039	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr22:36695039G>A	ENST00000216181.5	-	24	3256	c.3026C>T	c.(3025-3027)aCa>aTa	p.T1009I		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	1009					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						CTCCTCTTCTGTGAGGTTGGT	0.512			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																														Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	0			22											251.0	205.0	220.0					22																	36695039		2203	4300	6503	35024985	SO:0001583	missense	4627	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.3026C>T	22.37:g.36695039G>A	ENSP00000216181:p.Thr1009Ile	Somatic		Capture	Illumina GAIIx	4	35024985	A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	HMMPfam_Myosin_N,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00242,HMMPfam_Myosin_head,HMMSmart_SM00015,HMMPfam_IQ,superfamily_Prefoldin,HMMPfam_Myosin_tail_1,superfamily_Regulator of G-protein signaling RGS	p.T1009I	ENST00000216181.5	37	c.3026	CCDS13927.1	22	.	.	.	.	.	.	.	.	.	.	G	14.21	2.467689	0.43839	.	.	ENSG00000100345	ENST00000216181	D	0.87571	-2.27	5.84	-2.41	0.06562	.	0.441156	0.25765	N	0.028441	T	0.79816	0.4511	L	0.44542	1.39	0.31396	N	0.677283	B	0.13145	0.007	B	0.17433	0.018	T	0.71941	-0.4440	10	0.72032	D	0.01	.	10.9143	0.47126	0.3811:0.0:0.6189:0.0	.	1009	P35579	MYH9_HUMAN	I	1009	ENSP00000216181:T1009I	ENSP00000216181:T1009I	T	-	2	0	MYH9	35024985	0.994000	0.37717	0.866000	0.34008	0.939000	0.58152	2.310000	0.43708	-0.262000	0.09392	-0.459000	0.05422	ACA	-	superfamily_Prefoldin		0.512	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	protein_coding	OTTHUMT00000259110.3	G	NM_002473		35024985	-1	no_errors	NM_002473	genbank	human	reviewed	54_36p	missense	SNP	0.191	A
UNC5D	137970	genome.wustl.edu	37	8	35583892	35583892	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr8:35583892C>A	ENST00000404895.2	+	10	1854	c.1526C>A	c.(1525-1527)aCt>aAt	p.T509N	UNC5D_ENST00000449677.1_Missense_Mutation_p.T85N|UNC5D_ENST00000287272.2_Missense_Mutation_p.T440N|UNC5D_ENST00000416672.1_Missense_Mutation_p.T514N|UNC5D_ENST00000453357.2_Missense_Mutation_p.T504N|UNC5D_ENST00000420357.1_Missense_Mutation_p.T442N	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	509					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		CATTCCAGGACTTTTCCCCAT	0.468																																																0			8											97.0	98.0	97.0					8																	35583892		2203	4300	6503	35703434	SO:0001583	missense	137970			AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.1526C>A	8.37:g.35583892C>A	ENSP00000385143:p.Thr509Asn	Somatic		Capture	Illumina GAIIx	4	35703434	Q8WYP7	Missense_Mutation	SNP	superfamily_SSF48726,HMMSmart_IGc2,HMMPfam_ig,superfamily_TSP1,HMMSmart_TSP1,HMMPfam_TSP_1,PatternScan_SERPIN,HMMPfam_ZU5,superfamily_DEATH_like,HMMSmart_DEATH,HMMPfam_Death	p.T504N	ENST00000404895.2	37	c.1511	CCDS6093.2	8	.	.	.	.	.	.	.	.	.	.	C	14.69	2.611618	0.46631	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357;ENST00000449677	T;T;T;T;T;T	0.55234	0.56;0.99;0.98;0.56;0.53;2.41	6.04	6.04	0.98038	.	0.088294	0.85682	D	0.000000	T	0.56262	0.1973	L	0.55743	1.74	0.58432	D	0.999999	D;P;P;P	0.53619	0.961;0.799;0.873;0.799	B;B;B;B	0.43916	0.36;0.252;0.436;0.252	T	0.59413	-0.7459	10	0.62326	D	0.03	-19.3655	20.5948	0.99439	0.0:1.0:0.0:0.0	.	85;514;504;509	E9PDS8;C9J2B6;Q6UXZ4-2;Q6UXZ4	.;.;.;UNC5D_HUMAN	N	509;442;440;514;504;85	ENSP00000385143:T509N;ENSP00000392739:T442N;ENSP00000287272:T440N;ENSP00000412652:T514N;ENSP00000394303:T504N;ENSP00000397211:T85N	ENSP00000287272:T440N	T	+	2	0	UNC5D	35703434	0.999000	0.42202	0.918000	0.36340	0.058000	0.15608	4.486000	0.60286	2.873000	0.98535	0.563000	0.77884	ACT	-	NULL		0.468	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC5D	protein_coding	OTTHUMT00000347586.2	C			35703434	+1	no_errors	NM_080872	genbank	human	validated	54_36p	missense	SNP	0.999	A
NIPBL	25836	genome.wustl.edu	37	5	37064957	37064957	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr5:37064957G>A	ENST00000282516.8	+	47	8877	c.8378G>A	c.(8377-8379)cGa>cAa	p.R2793Q		NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	2793					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			CAGACTTTACGATCCCTGTAT	0.363																																																0			5											55.0	57.0	56.0					5																	37064957		2203	4300	6503	37100714	SO:0001583	missense	25836			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.8378G>A	5.37:g.37064957G>A	ENSP00000282516:p.Arg2793Gln	Somatic		Capture	Illumina GAIIx	4	37100714	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	superfamily_ARM repeat	p.R2793Q	ENST00000282516.8	37	c.8378	CCDS3920.1	5	.	.	.	.	.	.	.	.	.	.	G	15.21	2.767355	0.49574	.	.	ENSG00000164190	ENST00000282516	D	0.96885	-4.16	5.84	5.84	0.93424	.	0.000000	0.64402	D	0.000001	D	0.96682	0.8917	L	0.27053	0.805	0.80722	D	1	D	0.69078	0.997	D	0.70227	0.968	D	0.97484	1.0049	10	0.87932	D	0	-7.1816	20.139	0.98050	0.0:0.0:1.0:0.0	.	2793	Q6KC79	NIPBL_HUMAN	Q	2793	ENSP00000282516:R2793Q	ENSP00000282516:R2793Q	R	+	2	0	NIPBL	37100714	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.605000	0.82844	2.764000	0.94973	0.655000	0.94253	CGA	-	NULL		0.363	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPBL	protein_coding	OTTHUMT00000207582.1	G	NM_015384		37100714	+1	no_errors	NM_133433	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
NUP155	9631	genome.wustl.edu	37	5	37330175	37330175	+	Silent	SNP	T	T	C			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr5:37330175T>C	ENST00000231498.3	-	15	1892	c.1689A>G	c.(1687-1689)agA>agG	p.R563R	NUP155_ENST00000513532.1_Silent_p.R563R|NUP155_ENST00000381843.2_Silent_p.R504R|RNU7-75P_ENST00000516071.1_RNA	NM_153485.1	NP_705618.1	O75694	NU155_HUMAN	nucleoporin 155kDa	563					atrial cardiac muscle cell action potential (GO:0086014)|carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear envelope organization (GO:0006998)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			endometrium(1)|kidney(16)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	62	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CAGATACTTCTCTATCACAGG	0.368																																																0			5											63.0	64.0	63.0					5																	37330175		2203	4300	6503	37365932	SO:0001819	synonymous_variant	9631			AJ007558	CCDS3921.1, CCDS43310.1, CCDS64142.1	5p13.1	2008-02-05	2002-08-29		ENSG00000113569	ENSG00000113569			8063	protein-coding gene	gene with protein product		606694	"""nucleoporin 155kD"""			10191094	Standard	NM_153485		Approved	KIAA0791, N155	uc003jku.1	O75694	OTTHUMG00000090803	ENST00000231498.3:c.1689A>G	5.37:g.37330175T>C		Somatic		Capture	Illumina GAIIx	4	37365932	Q9UBE9|Q9UFL5	Silent	SNP	HMMPfam_Nucleoporin	p.R563	ENST00000231498.3	37	c.1689	CCDS3921.1	5																																																																																			-	HMMPfam_Nucleoporin		0.368	NUP155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP155	protein_coding	OTTHUMT00000207593.2	T	NM_153485, NM_004298		37365932	-1	no_errors	NM_153485	genbank	human	reviewed	54_36p	silent	SNP	1.000	C
LRRK2	120892	genome.wustl.edu	37	12	40671761	40671761	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr12:40671761T>G	ENST00000298910.7	+	17	2071	c.2013T>G	c.(2011-2013)ttT>ttG	p.F671L	LRRK2_ENST00000343742.2_Missense_Mutation_p.F671L	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	671					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				ATCATTCATTTGACTTAGTAA	0.308																																																0			12											75.0	70.0	72.0					12																	40671761		2203	4299	6502	38958028	SO:0001583	missense	120892			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.2013T>G	12.37:g.40671761T>G	ENSP00000298910:p.Phe671Leu	Somatic		Capture	Illumina GAIIx	4	38958028	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	superfamily_ARM-type_fold,superfamily_SSF52058,HMMPfam_LRR_1,superfamily_SSF52540,HMMPfam_Miro,superfamily_Kinase_like,PatternScan_PROTEIN_KINASE_ATP,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ST,superfamily_WD40_like,HMMSmart_WD40,PatternScan_RCC1_2	p.F671L	ENST00000298910.7	37	c.2013	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	T	10.69	1.420583	0.25639	.	.	ENSG00000188906	ENST00000416796;ENST00000343742;ENST00000298910	T;T;T	0.58358	0.34;1.6;1.6	6.08	3.69	0.42338	.	0.166261	0.53938	N	0.000049	T	0.44871	0.1314	L	0.53249	1.67	0.40525	D	0.980876	B;B	0.15141	0.012;0.007	B;B	0.16722	0.012;0.016	T	0.31052	-0.9957	10	0.36615	T	0.2	.	8.0865	0.30775	0.1216:0.0652:0.0:0.8132	.	671;671	E9PC85;Q5S007	.;LRRK2_HUMAN	L	419;671;671	ENSP00000398726:F419L;ENSP00000341930:F671L;ENSP00000298910:F671L	ENSP00000298910:F671L	F	+	3	2	LRRK2	38958028	1.000000	0.71417	0.641000	0.29422	0.004000	0.04260	1.318000	0.33643	0.515000	0.28320	-0.468000	0.05107	TTT	-	NULL		0.308	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	protein_coding	OTTHUMT00000277179.1	T	XM_058513		38958028	+1	no_errors	NM_198578	genbank	human	reviewed	54_36p	missense	SNP	0.949	G
EHD4	30844	genome.wustl.edu	37	15	42235274	42235274	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr15:42235274T>G	ENST00000220325.4	-	3	585	c.502A>C	c.(502-504)Atc>Ctc	p.I168L		NM_139265.3	NP_644670.1	Q9H223	EHD4_HUMAN	EH-domain containing 4	168	Dynamin-type G.				cellular response to growth factor stimulus (GO:0071363)|endocytic recycling (GO:0032456)|pinocytosis (GO:0006907)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein homooligomerization (GO:0051260)|regulation of endocytosis (GO:0030100)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(7)|ovary(2)|stomach(1)|urinary_tract(1)	20		all_cancers(109;2.54e-12)|all_epithelial(112;6.59e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		OV - Ovarian serous cystadenocarcinoma(18;1.6e-19)|GBM - Glioblastoma multiforme(94;3.77e-06)|COAD - Colon adenocarcinoma(120;0.0474)|Colorectal(105;0.0538)		CCTCGGCTGATGCGCTGCTTC	0.572																																																0			15											62.0	50.0	54.0					15																	42235274		2199	4296	6495	40022566	SO:0001583	missense	30844			AF181265	CCDS10081.1	15q11.1	2013-01-10			ENSG00000103966	ENSG00000103966		"""EF-hand domain containing"""	3245	protein-coding gene	gene with protein product		605892		PAST4		10673336, 11533061	Standard	NM_139265		Approved		uc001zot.3	Q9H223	OTTHUMG00000130370	ENST00000220325.4:c.502A>C	15.37:g.42235274T>G	ENSP00000220325:p.Ile168Leu	Somatic		Capture	Illumina GAIIx	4	40022566	Q9HAR1|Q9NZN2	Missense_Mutation	SNP	superfamily_SSF52540,HMMPfam_Dynamin_N,superfamily_SSF47473,HMMSmart_EH,PatternScan_EF_HAND_1	p.I168L	ENST00000220325.4	37	c.502	CCDS10081.1	15	.	.	.	.	.	.	.	.	.	.	T	15.15	2.746617	0.49257	.	.	ENSG00000103966	ENST00000220325	D	0.96685	-4.09	5.31	2.79	0.32731	Dynamin, GTPase domain (1);	0.159668	0.51477	D	0.000091	D	0.91540	0.7328	L	0.28274	0.84	0.53688	D	0.999979	B;B	0.11235	0.004;0.002	B;B	0.14023	0.01;0.006	D	0.86342	0.1705	10	0.33141	T	0.24	-20.8312	11.4061	0.49898	0.0:0.0:0.287:0.713	.	168;168	A8K9B9;Q9H223	.;EHD4_HUMAN	L	168	ENSP00000220325:I168L	ENSP00000220325:I168L	I	-	1	0	EHD4	40022566	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.529000	0.45632	0.828000	0.34709	0.460000	0.39030	ATC	-	superfamily_SSF52540,HMMPfam_Dynamin_N		0.572	EHD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHD4	protein_coding	OTTHUMT00000252737.2	T	NM_139265		40022566	-1	no_errors	NM_139265	genbank	human	provisional	54_36p	missense	SNP	0.997	G
TTBK2	146057	genome.wustl.edu	37	15	43094263	43094263	+	Intron	SNP	G	G	T	rs192556131	byFrequency	TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr15:43094263G>T	ENST00000267890.6	-	10	931				TTBK2_ENST00000567274.1_Intron|TTBK2_ENST00000567840.1_Intron	NM_173500.3	NP_775771.3	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2						cell death (GO:0008219)|cilium assembly (GO:0042384)|peptidyl-serine phosphorylation (GO:0018105)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	43		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		CAAGCATCTTGTTCTGCTGCT	0.517																																																0			15											171.0	156.0	160.0					15																	43094263		876	1991	2867	40881555	SO:0001627	intron_variant	146057			AB020654	CCDS42029.1	15q15.2	2014-01-21			ENSG00000128881	ENSG00000128881			19141	protein-coding gene	gene with protein product		611695	"""spinocerebellar ataxia 11"""	SCA11		10048485	Standard	NM_173500		Approved	KIAA0847	uc001zqo.2	Q6IQ55	OTTHUMG00000175802	ENST00000267890.6:c.823-7264C>A	15.37:g.43094263G>T		Somatic		Capture	Illumina GAIIx	4	40881555	O94932|Q6ZN52|Q8IVV1	Missense_Mutation	SNP	HMMSmart_SM00220,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase,HMMPfam_Filament,PatternScan_IF	p.N368K	ENST00000267890.6	37	c.1104	CCDS42029.1	15	.	.	.	.	.	.	.	.	.	.	G	5.177	0.218251	0.09810	.	.	ENSG00000128881	ENST00000263802	.	.	.	0.149	0.149	0.14863	.	.	.	.	.	T	0.59500	0.2198	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59241	-0.7491	5	0.87932	D	0	.	6.0152	0.19598	5.0E-4:0.0:0.9995:0.0	.	.	.	.	K	368	.	ENSP00000263802:N368K	N	-	3	2	TTBK2	40881555	1.000000	0.71417	0.211000	0.23655	0.214000	0.24535	1.603000	0.36794	0.192000	0.20272	0.195000	0.17529	AAC	-	HMMPfam_Filament		0.517	TTBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTBK2	protein_coding	OTTHUMT00000431106.2	G	NM_173500		40881555	-1	no_errors	ENST00000263802	ensembl	human	known	54_36p	missense	SNP	1.000	T
SLC14A2	8170	genome.wustl.edu	37	18	43221298	43221298	+	Silent	SNP	C	C	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr18:43221298C>T	ENST00000255226.6	+	8	1932	c.1116C>T	c.(1114-1116)gcC>gcT	p.A372A	SLC14A2_ENST00000586448.1_Silent_p.A372A	NM_007163.3	NP_009094.3	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter), member 2	372					transmembrane transport (GO:0055085)|urea transport (GO:0015840)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|urea transmembrane transporter activity (GO:0015204)			NS(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(35)|ovary(1)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						ACCTGCTGGCCCTCATCTGTG	0.522																																																0			18											110.0	85.0	93.0					18																	43221298		2203	4300	6503	41475296	SO:0001819	synonymous_variant	8170			X96969	CCDS11924.1	18q12.1-q21.1	2013-05-22			ENSG00000132874	ENSG00000132874		"""Solute carriers"""	10919	protein-coding gene	gene with protein product		601611				8647271	Standard	NM_007163		Approved	HUT2, UT2	uc010dnj.3	Q15849	OTTHUMG00000132616	ENST00000255226.6:c.1116C>T	18.37:g.43221298C>T		Somatic		Capture	Illumina GAIIx	4	41475296	A8K8Q7|Q2TBD6|Q96PH5	Silent	SNP	HMMPfam_UT,PatternScan_MULTICOPPER_OXIDASE1	p.A372	ENST00000255226.6	37	c.1116	CCDS11924.1	18																																																																																			-	HMMPfam_UT		0.522	SLC14A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC14A2	protein_coding	OTTHUMT00000255858.1	C			41475296	+1	no_errors	NM_007163	genbank	human	validated	54_36p	silent	SNP	0.971	T
EPSTI1	94240	genome.wustl.edu	37	13	43469190	43469190	+	Silent	SNP	G	G	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr13:43469190G>A	ENST00000398762.3	-	11	902	c.903C>T	c.(901-903)ctC>ctT	p.L301L	EPSTI1_ENST00000313640.7_Silent_p.L301L|EPSTI1_ENST00000313624.7_Silent_p.L290L			Q96J88	ESIP1_HUMAN	epithelial stromal interaction 1 (breast)	301										endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|skin(1)	17		Lung NSC(96;3.6e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000528)|BRCA - Breast invasive adenocarcinoma(63;0.0858)		CAGATTGCTCGAGGCCACCTG	0.388																																																0			13											65.0	64.0	64.0					13																	43469190		2203	4300	6503	42367190	SO:0001819	synonymous_variant	94240			AF396928	CCDS9387.1, CCDS31964.1	13q13.3	2011-06-27			ENSG00000133106	ENSG00000133106			16465	protein-coding gene	gene with protein product	"""epithelial stromal interaction protein 1"""	607441				11991720	Standard	NM_033255		Approved	BRESI1, MGC29634	uc001uyw.2	Q96J88	OTTHUMG00000016814	ENST00000398762.3:c.903C>T	13.37:g.43469190G>A		Somatic		Capture	Illumina GAIIx	4	42367190	Q8IVC7|Q8NDQ7	Silent	SNP	NULL	p.L301	ENST00000398762.3	37	c.903	CCDS9387.1	13																																																																																			-	NULL		0.388	EPSTI1-010	PUTATIVE	basic|CCDS	protein_coding	EPSTI1	protein_coding	OTTHUMT00000400321.1	G	NM_001002264		42367190	-1	no_errors	NM_001002264	genbank	human	validated	54_36p	silent	SNP	0.925	A
ZNF383	163087	genome.wustl.edu	37	19	37726922	37726922	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr19:37726922C>A	ENST00000589413.1	+	7	761	c.178C>A	c.(178-180)Caa>Aaa	p.Q60K	ZNF383_ENST00000590503.1_Missense_Mutation_p.Q60K|ZNF383_ENST00000352998.3_Missense_Mutation_p.Q60K			Q8NA42	ZN383_HUMAN	zinc finger protein 383	60	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|skin(1)	15			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CTTATTGGAACAAGGGAAAGA	0.483																																																0			19											127.0	119.0	122.0					19																	37726922		2203	4300	6503	42418762	SO:0001583	missense	163087			AY438646	CCDS12501.1	19q13.13	2013-01-08				ENSG00000188283		"""Zinc fingers, C2H2-type"", ""-"""	18609	protein-coding gene	gene with protein product							Standard	NM_152604		Approved	FLJ35863	uc002ofu.1	Q8NA42		ENST00000589413.1:c.178C>A	19.37:g.37726922C>A	ENSP00000464871:p.Gln60Lys	Somatic		Capture	Illumina GAIIx	4	42418762	Q6X2C7	Missense_Mutation	SNP	superfamily_Krueppel-associated_box,HMMPfam_KRAB,HMMSmart_KRAB,superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.Q60K	ENST00000589413.1	37	c.178	CCDS12501.1	19	.	.	.	.	.	.	.	.	.	.	C	13.53	2.265421	0.40095	.	.	ENSG00000188283	ENST00000352998	T	0.00949	5.51	3.39	3.39	0.38822	Krueppel-associated box (3);	0.000000	0.31020	N	0.008417	T	0.01029	0.0034	L	0.48218	1.51	0.22034	N	0.999408	B	0.30406	0.278	B	0.24974	0.057	T	0.49437	-0.8940	9	.	.	.	.	8.9104	0.35550	0.0:0.7707:0.2293:0.0	.	60	Q8NA42	ZN383_HUMAN	K	60	ENSP00000340132:Q60K	.	Q	+	1	0	ZNF383	42418762	0.995000	0.38212	1.000000	0.80357	0.982000	0.71751	1.804000	0.38873	2.179000	0.69175	0.563000	0.77884	CAA	-	superfamily_Krueppel-associated_box,HMMSmart_KRAB		0.483	ZNF383-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF383	protein_coding	OTTHUMT00000458141.1	C	NM_152604		42418762	+1	no_errors	NM_152604	genbank	human	provisional	54_36p	missense	SNP	1.000	A
HSF2BP	11077	genome.wustl.edu	37	21	45050276	45050276	+	Silent	SNP	C	C	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr21:45050276C>T	ENST00000291560.2	-	6	832	c.501G>A	c.(499-501)tcG>tcA	p.S167S	HSF2BP_ENST00000542962.1_Silent_p.S92S	NM_007031.1	NP_008962.1	O75031	HSF2B_HUMAN	heat shock transcription factor 2 binding protein	167					spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)				kidney(2)|large_intestine(3)|prostate(1)|skin(1)	7				STAD - Stomach adenocarcinoma(101;0.18)		CACCGTCTAACGACTTCACAA	0.428																																																0			21											115.0	91.0	99.0					21																	45050276		2203	4300	6503	43874704	SO:0001819	synonymous_variant	11077			AB007131	CCDS13697.1	21q22.3	2008-07-31			ENSG00000160207	ENSG00000160207			5226	protein-coding gene	gene with protein product	"""heat shock factor 2 binding protein"""	604554				9651507	Standard	XM_005261090		Approved		uc002zdi.3	O75031	OTTHUMG00000086863	ENST00000291560.2:c.501G>A	21.37:g.45050276C>T		Somatic		Capture	Illumina GAIIx	4	43874704	B4DX36	Silent	SNP	superfamily_ARM repeat	p.S167	ENST00000291560.2	37	c.501	CCDS13697.1	21																																																																																			-	superfamily_ARM repeat		0.428	HSF2BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSF2BP	protein_coding	OTTHUMT00000195620.1	C	NM_007031		43874704	-1	no_errors	NM_007031	genbank	human	reviewed	54_36p	silent	SNP	0.019	T
RAMP3	10268	genome.wustl.edu	37	7	45216942	45216942	+	Silent	SNP	A	A	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr7:45216942A>T	ENST00000242249.4	+	2	131	c.93A>T	c.(91-93)acA>acT	p.T31T	RAMP3_ENST00000481345.1_Silent_p.T31T|RAMP3_ENST00000496212.1_Silent_p.T31T	NM_005856.2	NP_005847.1	O60896	RAMP3_HUMAN	receptor (G protein-coupled) activity modifying protein 3	31					calcium ion transport (GO:0006816)|cellular response to estradiol stimulus (GO:0071392)|G-protein coupled receptor signaling pathway involved in heart process (GO:0086103)|intracellular protein transport (GO:0006886)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of receptor recycling (GO:0001921)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			breast(1)|endometrium(1)|large_intestine(4)|lung(4)|stomach(1)	11					Pramlintide(DB01278)	GCAACGAGACAGGCATGTTGG	0.592																																																0			7											150.0	119.0	130.0					7																	45216942		2203	4300	6503	45183467	SO:0001819	synonymous_variant	10268			AJ001016	CCDS5503.1	7p13-p12	2006-11-21	2006-11-21		ENSG00000122679	ENSG00000122679		"""Receptor (G protein-coupled) activity modifying proteins"""	9845	protein-coding gene	gene with protein product		605155	"""receptor activity modifying protein 3"", ""receptor (calcitonin) activity modifying protein 3"""				Standard	NM_005856		Approved		uc003tnb.3	O60896	OTTHUMG00000023729	ENST00000242249.4:c.93A>T	7.37:g.45216942A>T		Somatic		Capture	Illumina GAIIx	4	45183467	Q7Z2Y1	Silent	SNP	HMMPfam_RAMP	p.T31	ENST00000242249.4	37	c.93	CCDS5503.1	7																																																																																			-	NULL		0.592	RAMP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RAMP3	protein_coding	OTTHUMT00000251343.1	A	NM_005856		45183467	+1	no_errors	NM_005856	genbank	human	reviewed	54_36p	silent	SNP	0.131	T
KRBOX4	55634	genome.wustl.edu	37	X	46332267	46332267	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chrX:46332267G>C	ENST00000344302.4	+	6	967	c.336G>C	c.(334-336)aaG>aaC	p.K112N	KRBOX4_ENST00000478600.1_Intron|KRBOX4_ENST00000487081.1_3'UTR|KRBOX4_ENST00000360017.5_3'UTR|KRBOX4_ENST00000298190.6_Missense_Mutation_p.K107N	NM_001129898.1|NM_017776.2	NP_001123370.1|NP_060246.2	Q5JUW0	KRBX4_HUMAN	KRAB box domain containing 4	112					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	nucleic acid binding (GO:0003676)										TCATAGGCAAGGAAACACTGA	0.398																																																0			X											121.0	105.0	111.0					X																	46332267		2203	4300	6503	46217211	SO:0001583	missense	55634				CCDS14267.1, CCDS48097.1, CCDS48098.1	Xp11.3	2013-01-08	2013-01-08	2013-01-08	ENSG00000147121	ENSG00000147121		"""-"""	26007	protein-coding gene	gene with protein product	"""hypothetical protein FLJ20344"""	300585	"""zinc finger protein 673"", ""zinc finger family member 673"""	ZNF673		11944989	Standard	NM_001129898		Approved	FLJ20344	uc004dgn.4	Q5JUW0	OTTHUMG00000021421	ENST00000344302.4:c.336G>C	X.37:g.46332267G>C	ENSP00000345797:p.Lys112Asn	Somatic		Capture	Illumina GAIIx	4	46217211	A8K0Y8|B3KU22|Q96EA3|Q9NXB1	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349	p.K107N	ENST00000344302.4	37	c.321	CCDS48097.1	X	.	.	.	.	.	.	.	.	.	.	G	1.051	-0.675911	0.03378	.	.	ENSG00000147121	ENST00000344302;ENST00000298190;ENST00000397212	T;T	0.00840	5.63;5.69	2.39	2.39	0.29439	.	.	.	.	.	T	0.00695	0.0023	N	0.20357	0.565	0.09310	N	0.999999	B;B	0.24043	0.096;0.058	B;B	0.20955	0.014;0.032	T	0.42916	-0.9423	9	0.06757	T	0.87	-2.1339	7.5408	0.27737	0.0:0.0:1.0:0.0	.	112;107	Q5JUW0;Q5JUW0-2	ZN673_HUMAN;.	N	112;107;112	ENSP00000345797:K112N;ENSP00000298190:K107N	ENSP00000298190:K107N	K	+	3	2	ZNF673	46217211	0.000000	0.05858	0.162000	0.22713	0.605000	0.37080	0.087000	0.14958	1.480000	0.48289	0.544000	0.68410	AAG	-	NULL		0.398	KRBOX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF673	protein_coding	OTTHUMT00000056359.2	G	NM_017776		46217211	+1	no_errors	NM_017776	genbank	human	validated	54_36p	missense	SNP	0.964	C
RP2	6102	genome.wustl.edu	37	X	46719515	46719515	+	Silent	SNP	C	C	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chrX:46719515C>T	ENST00000218340.3	+	3	1022	c.861C>T	c.(859-861)gaC>gaT	p.D287D		NM_006915.2	NP_008846.2	O75695	XRP2_HUMAN	retinitis pigmentosa 2 (X-linked recessive)	287					cell morphogenesis (GO:0000902)|CTP biosynthetic process (GO:0006241)|cytoskeleton organization (GO:0007010)|GTP biosynthetic process (GO:0006183)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein transport (GO:0015031)|UTP biosynthetic process (GO:0006228)|visual perception (GO:0007601)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|periciliary membrane compartment (GO:1990075)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|nucleoside diphosphate kinase activity (GO:0004550)|unfolded protein binding (GO:0051082)			NS(1)|large_intestine(4)|lung(5)|stomach(1)	11						AAGCACCTGACTTCCTTCCTC	0.383																																																0			X											95.0	84.0	88.0					X																	46719515		2203	4300	6503	46604459	SO:0001819	synonymous_variant	6102			AJ007590	CCDS14270.1	Xp11.3	2013-01-08			ENSG00000102218	ENSG00000102218			10274	protein-coding gene	gene with protein product		300757				6325945, 9697692, 19852809	Standard	NM_006915		Approved	TBCCD2, NME10, NM23-H10	uc004dgw.4	O75695	OTTHUMG00000021430	ENST00000218340.3:c.861C>T	X.37:g.46719515C>T		Somatic		Capture	Illumina GAIIx	4	46604459	Q86XJ7|Q9NU67	Silent	SNP	HMMPfam_TBCC,HMMSmart_CARP,superfamily_NDK	p.D287	ENST00000218340.3	37	c.861	CCDS14270.1	X																																																																																			-	superfamily_NDK		0.383	RP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP2	protein_coding	OTTHUMT00000056375.1	C	NM_006915		46604459	+1	no_errors	NM_006915	genbank	human	reviewed	54_36p	silent	SNP	0.994	T
MKNK1	8569	genome.wustl.edu	37	1	47040634	47040634	+	Missense_Mutation	SNP	C	C	G	rs578193339		TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr1:47040634C>G	ENST00000371946.4	-	6	536	c.373G>C	c.(373-375)Gag>Cag	p.E125Q	MKNK1_ENST00000371945.4_Missense_Mutation_p.E125Q|MKNK1_ENST00000341183.5_Missense_Mutation_p.E125Q|MKNK1_ENST00000545730.1_Missense_Mutation_p.E125Q|MKNK1_ENST00000371944.4_Intron|MKNK1_ENST00000428112.2_Missense_Mutation_p.E125Q	NM_003684.5	NP_003675.2	Q9BUB5	MKNK1_HUMAN	MAP kinase interacting serine/threonine kinase 1	125	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fibroblast growth factor receptor signaling pathway (GO:0008543)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)|response to salt stress (GO:0009651)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	13	Acute lymphoblastic leukemia(166;0.155)					TGCAATTTCTCAAAGACCAAG	0.418																																																0			1											88.0	76.0	80.0					1																	47040634		2203	4300	6503	46813221	SO:0001583	missense	8569			AB000409	CCDS538.1, CCDS30705.1, CCDS44134.1	1p33	2008-02-05			ENSG00000079277	ENSG00000079277			7110	protein-coding gene	gene with protein product		606724				9155018	Standard	NM_003684		Approved	MNK1	uc001cqb.4	Q9BUB5	OTTHUMG00000007983	ENST00000371946.4:c.373G>C	1.37:g.47040634C>G	ENSP00000361014:p.Glu125Gln	Somatic		Capture	Illumina GAIIx	4	46813221	D3DQ20|D3DQ21|O00312|Q5TC06|Q5TC07|Q6V0N6	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.E125Q	ENST00000371946.4	37	c.373	CCDS538.1	1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.940183	0.73557	.	.	ENSG00000079277	ENST00000371946;ENST00000371945;ENST00000341183;ENST00000428112;ENST00000532783;ENST00000496619;ENST00000528237;ENST00000545730	T;T;T;T;T;T;T;T	0.64618	1.08;1.08;1.08;1.08;-0.11;0.66;-0.11;2.27	6.01	6.01	0.97437	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.090883	0.85682	D	0.000000	D	0.83041	0.5168	M	0.89030	3	0.80722	D	1	D;D;D;P;D	0.63880	0.983;0.993;0.991;0.898;0.981	P;D;D;P;D	0.77557	0.831;0.99;0.982;0.857;0.944	D	0.83475	0.0061	10	0.48119	T	0.1	-10.4413	19.0747	0.93156	0.0:1.0:0.0:0.0	.	125;125;125;125;125	B4E1V9;A8K341;Q9BUB5-3;Q9BUB5-2;Q9BUB5	.;.;.;.;MKNK1_HUMAN	Q	125;125;125;125;113;125;119;125	ENSP00000361014:E125Q;ENSP00000361013:E125Q;ENSP00000339573:E125Q;ENSP00000411135:E125Q;ENSP00000431837:E113Q;ENSP00000436709:E125Q;ENSP00000432665:E119Q;ENSP00000440974:E125Q	ENSP00000339573:E125Q	E	-	1	0	MKNK1	46813221	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.495000	0.81514	2.851000	0.98039	0.609000	0.83330	GAG	-	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase		0.418	MKNK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKNK1	protein_coding	OTTHUMT00000021897.2	C	NM_003684		46813221	-1	no_errors	NM_003684	genbank	human	validated	54_36p	missense	SNP	1.000	G
SPPL2A	84888	genome.wustl.edu	37	15	51028856	51028856	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr15:51028856G>A	ENST00000261854.5	-	7	1089	c.815C>T	c.(814-816)cCa>cTa	p.P272L		NM_032802.3	NP_116191.2	Q8TCT8	SPP2A_HUMAN	signal peptide peptidase like 2A	272					membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|regulation of immune response (GO:0050776)	extracellular vesicular exosome (GO:0070062)|Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15				all cancers(107;0.000712)|GBM - Glioblastoma multiforme(94;0.00314)		TTGTCCATATGGTATCTTATG	0.313																																					Melanoma(50;790 1209 4069 22965 33125)											0			15											105.0	102.0	103.0					15																	51028856		2196	4293	6489	48816148	SO:0001583	missense	84888				CCDS10138.1	15q21.2	2012-02-21			ENSG00000138600	ENSG00000138600			30227	protein-coding gene	gene with protein product	"""intramembrane protease 3"", ""presenilin-like protein 2"""	608238				12077416, 12139484	Standard	NM_032802		Approved	IMP3, PSL2	uc001zyv.3	Q8TCT8	OTTHUMG00000131647	ENST00000261854.5:c.815C>T	15.37:g.51028856G>A	ENSP00000261854:p.Pro272Leu	Somatic		Capture	Illumina GAIIx	4	48816148	B2RDS0|Q8TAW1|Q96SZ8	Missense_Mutation	SNP	superfamily_Transferrin receptor ectodomain apical domain,HMMPfam_PA,HMMPfam_Peptidase_A22B,HMMSmart_SM00730	p.P272L	ENST00000261854.5	37	c.815	CCDS10138.1	15	.	.	.	.	.	.	.	.	.	.	G	16.91	3.252352	0.59212	.	.	ENSG00000138600	ENST00000261854	T	0.18338	2.22	5.61	5.61	0.85477	.	0.175020	0.52532	D	0.000075	T	0.26011	0.0634	N	0.25094	0.71	0.80722	D	1	D	0.60575	0.988	P	0.57244	0.816	T	0.00790	-1.1565	10	0.39692	T	0.17	-10.9098	20.0016	0.97412	0.0:0.0:1.0:0.0	.	272	Q8TCT8	PSL2_HUMAN	L	272	ENSP00000261854:P272L	ENSP00000261854:P272L	P	-	2	0	AC012100.1	48816148	1.000000	0.71417	0.994000	0.49952	0.519000	0.34347	3.428000	0.52792	2.802000	0.96397	0.655000	0.94253	CCA	-	HMMPfam_Peptidase_A22B,HMMSmart_SM00730		0.313	SPPL2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPPL2A	protein_coding	OTTHUMT00000254543.3	G	NM_032802		48816148	-1	no_errors	NM_032802	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
NICN1	84276	genome.wustl.edu	37	3	49463718	49463718	+	Silent	SNP	T	T	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr3:49463718T>A	ENST00000273598.3	-	2	362	c.276A>T	c.(274-276)ggA>ggT	p.G92G	NICN1_ENST00000422593.1_5'UTR|NICN1-AS1_ENST00000424915.1_RNA|NICN1_ENST00000436744.2_Silent_p.G92G	NM_032316.3	NP_115692.1	Q9BSH3	NICN1_HUMAN	nicolin 1	92						microtubule (GO:0005874)|nucleus (GO:0005634)				kidney(1)|large_intestine(3)|lung(1)	5				BRCA - Breast invasive adenocarcinoma(193;4.52e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		ACTCCTGGGCTCCCTCCTCAC	0.597																																																0			3											79.0	68.0	72.0					3																	49463718		2203	4300	6503	49438722	SO:0001819	synonymous_variant	84276			AJ299740	CCDS2798.1	3p21.31	2008-07-18			ENSG00000145029	ENSG00000145029			18317	protein-coding gene	gene with protein product		611516				12392556	Standard	NM_032316		Approved	MGC12936	uc003cwz.1	Q9BSH3	OTTHUMG00000156848	ENST00000273598.3:c.276A>T	3.37:g.49463718T>A		Somatic		Capture	Illumina GAIIx	4	49438722	Q8IZQ2	Silent	SNP	NULL	p.G92	ENST00000273598.3	37	c.276	CCDS2798.1	3																																																																																			-	NULL		0.597	NICN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NICN1	protein_coding	OTTHUMT00000346224.3	T	NM_032316		49438722	-1	no_errors	NM_032316	genbank	human	reviewed	54_36p	silent	SNP	0.999	A
PYGL	5836	genome.wustl.edu	37	14	51410969	51410969	+	Silent	SNP	G	G	A	rs77316189	byFrequency	TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr14:51410969G>A	ENST00000216392.7	-	1	485	c.153C>T	c.(151-153)gaC>gaT	p.D51D	PYGL_ENST00000544180.2_Silent_p.D51D|PYGL_ENST00000532462.1_Silent_p.D51D	NM_002863.4	NP_002854.3	P06737	PYGL_HUMAN	phosphorylase, glycogen, liver	51					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|carbohydrate metabolic process (GO:0005975)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|necroptotic process (GO:0070266)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	AMP binding (GO:0016208)|ATP binding (GO:0005524)|bile acid binding (GO:0032052)|drug binding (GO:0008144)|glucose binding (GO:0005536)|glycogen phosphorylase activity (GO:0008184)|protein homodimerization activity (GO:0042803)|purine nucleobase binding (GO:0002060)|pyridoxal phosphate binding (GO:0030170)|vitamin binding (GO:0019842)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)|skin(3)	25	all_epithelial(31;0.00825)|Breast(41;0.148)				Adenosine monophosphate(DB00131)	CGAAGTAGTAGTCGCGGGTGG	0.642													G|||	290	0.0579073	0.1566	0.0231	5008	,	,		13995	0.001		0.0338	False		,,,				2504	0.0327															0			14						G	,	677,3729	284.9+/-277.9	49,579,1575	72.0	55.0	60.0		153,153	2.5	1.0	14	dbSNP_131	60	310,8290	111.2+/-171.5	4,302,3994	no	coding-synonymous,coding-synonymous	PYGL	NM_001163940.1,NM_002863.4	,	53,881,5569	AA,AG,GG		3.6047,15.3654,7.5888	,	51/814,51/848	51410969	987,12019	2203	4300	6503	50480719	SO:0001819	synonymous_variant	5836				CCDS32080.1, CCDS53894.1	14q11.2-q24.3	2013-03-01	2008-07-31		ENSG00000100504	ENSG00000100504	2.4.1.1	"""Glycogen phosphorylases"""	9725	protein-coding gene	gene with protein product	"""Hers disease"", ""glycogen storage disease type VI"", ""glycogen phosphorylase, liver form"""	613741	"""phosphorylase, glycogen; liver"""			2877458	Standard	NM_002863		Approved		uc001wyu.3	P06737	OTTHUMG00000166596	ENST00000216392.7:c.153C>T	14.37:g.51410969G>A		Somatic		Capture	Illumina GAIIx	4	50480719	A6NDQ4|B4DUB7|F5H816|O60567|O60752|O60913|Q501V9|Q641R5|Q96G82	Silent	SNP	superfamily_SSF53756,HMMPfam_Phosphorylase,PatternScan_PHOSPHORYLASE	p.D51	ENST00000216392.7	37	c.153	CCDS32080.1	14																																																																																			-	superfamily_SSF53756		0.642	PYGL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGL	protein_coding	OTTHUMT00000390654.3	G	NM_002863		50480719	-1	no_errors	NM_002863	genbank	human	validated	54_36p	silent	SNP	1.000	A
KRT85	3891	genome.wustl.edu	37	12	52757086	52757086	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr12:52757086A>G	ENST00000257901.3	-	5	970	c.895T>C	c.(895-897)Tat>Cat	p.Y299H	KRT85_ENST00000544265.1_Missense_Mutation_p.Y87H	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	299	Coil 2.|Rod.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		ACATCGTCATACTGAGCCTTG	0.577																																																0			12											122.0	86.0	98.0					12																	52757086		2203	4300	6503	51043353	SO:0001583	missense	3891			X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.895T>C	12.37:g.52757086A>G	ENSP00000257901:p.Tyr299His	Somatic		Capture	Illumina GAIIx	4	51043353	Q9NSB1	Missense_Mutation	SNP	HMMPfam_Filament,PatternScan_IF	p.Y299H	ENST00000257901.3	37	c.895	CCDS8824.1	12	.	.	.	.	.	.	.	.	.	.	A	22.8	4.332815	0.81801	.	.	ENSG00000135443	ENST00000257901;ENST00000544265	D;D	0.92805	-3.11;-3.11	4.83	4.83	0.62350	Filament (1);	0.000000	0.50627	D	0.000110	D	0.96623	0.8898	M	0.93594	3.435	0.33048	D	0.532366	D	0.76494	0.999	D	0.76575	0.988	D	0.98813	1.0744	10	0.87932	D	0	.	10.8652	0.46851	0.8592:0.0:0.0:0.1408	.	299	P78386	KRT85_HUMAN	H	299;87	ENSP00000257901:Y299H;ENSP00000440240:Y87H	ENSP00000257901:Y299H	Y	-	1	0	KRT85	51043353	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.519000	0.81809	1.803000	0.52742	0.459000	0.35465	TAT	-	HMMPfam_Filament		0.577	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT85	protein_coding	OTTHUMT00000405184.1	A	NM_002283		51043353	-1	no_errors	NM_002283	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
THSD1	55901	genome.wustl.edu	37	13	52952624	52952624	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr13:52952624A>T	ENST00000258613.4	-	5	1659	c.1481T>A	c.(1480-1482)aTc>aAc	p.I494N	THSD1_ENST00000544466.1_Missense_Mutation_p.I115N|THSD1_ENST00000349258.4_Missense_Mutation_p.I441N	NM_018676.3	NP_061146.1	Q9NS62	THSD1_HUMAN	thrombospondin, type I, domain containing 1	494					hematopoietic progenitor cell differentiation (GO:0002244)	cell periphery (GO:0071944)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)		GGTCAGAGGGATGCCTGTGTC	0.637																																																0			13											59.0	62.0	61.0					13																	52952624		2203	4300	6503	51850625	SO:0001583	missense	55901			AK096289	CCDS9432.1, CCDS9433.1	13q14.13	2010-04-20	2004-03-11		ENSG00000136114	ENSG00000136114			17754	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain 1"""				Standard	NM_018676		Approved	TMTSP	uc001vgo.3	Q9NS62	OTTHUMG00000016963	ENST00000258613.4:c.1481T>A	13.37:g.52952624A>T	ENSP00000258613:p.Ile494Asn	Somatic		Capture	Illumina GAIIx	4	51850625	A2A3J3|B2RCF5|Q6P3U1|Q6UXZ2	Missense_Mutation	SNP	superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1	p.I494N	ENST00000258613.4	37	c.1481	CCDS9432.1	13	.	.	.	.	.	.	.	.	.	.	a	14.84	2.656096	0.47467	.	.	ENSG00000136114	ENST00000349258;ENST00000544466;ENST00000258613	T;T;T	0.36520	1.97;1.25;2.15	6.06	6.06	0.98353	.	0.367890	0.29431	N	0.012179	T	0.57169	0.2035	M	0.69823	2.125	0.46113	D	0.99887	P;D	0.58620	0.802;0.983	B;P	0.60345	0.231;0.873	T	0.60530	-0.7245	10	0.87932	D	0	-31.5221	15.7938	0.78394	1.0:0.0:0.0:0.0	.	441;494	Q9NS62-2;Q9NS62	.;THSD1_HUMAN	N	441;115;494	ENSP00000340650:I441N;ENSP00000438512:I115N;ENSP00000258613:I494N	ENSP00000258613:I494N	I	-	2	0	THSD1	51850625	1.000000	0.71417	1.000000	0.80357	0.274000	0.26718	3.344000	0.52174	2.322000	0.78497	0.528000	0.53228	ATC	-	NULL		0.637	THSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THSD1	protein_coding	OTTHUMT00000045058.3	A			51850625	-1	no_errors	NM_018676	genbank	human	reviewed	54_36p	missense	SNP	0.847	T
ITIH1	3697	genome.wustl.edu	37	3	52811694	52811694	+	Silent	SNP	C	C	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr3:52811694C>T	ENST00000273283.2	+	1	87	c.63C>T	c.(61-63)atC>atT	p.I21I	ITIH1_ENST00000540715.1_5'Flank|ITIH1_ENST00000542827.1_Silent_p.I21I|ITIH1_ENST00000537050.1_5'Flank	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	21					hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		CTCTCCTCATCCTGCAGGCCA	0.607																																																0			3											109.0	95.0	99.0					3																	52811694		2203	4300	6503	52786734	SO:0001819	synonymous_variant	3697				CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.63C>T	3.37:g.52811694C>T		Somatic		Capture	Illumina GAIIx	4	52786734	A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Silent	SNP	HMMSmart_SM00609,HMMPfam_VIT,superfamily_vWA-like,HMMSmart_SM00327,HMMPfam_VWA,HMMPfam_ITI_HC_C	p.I21	ENST00000273283.2	37	c.63	CCDS2864.1	3																																																																																			-	NULL		0.607	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITIH1	protein_coding	OTTHUMT00000317522.1	C	NM_002215		52786734	+1	no_errors	NM_002215	genbank	human	validated	54_36p	silent	SNP	0.002	T
FST	10468	genome.wustl.edu	37	5	52778710	52778710	+	Splice_Site	SNP	C	C	G			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr5:52778710C>G	ENST00000256759.3	+	2	469	c.86C>G	c.(85-87)gCt>gGt	p.A29G	FST_ENST00000396947.3_Splice_Site_p.A29G	NM_013409.2	NP_037541.1	P19883	FST_HUMAN	follistatin	29					BMP signaling pathway (GO:0030509)|female gonad development (GO:0008585)|gamete generation (GO:0007276)|hair follicle morphogenesis (GO:0031069)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinocyte proliferation (GO:0043616)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|pattern specification process (GO:0007389)|positive regulation of hair follicle development (GO:0051798)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)	activin binding (GO:0048185)|signal transducer activity (GO:0004871)			breast(1)|endometrium(1)|large_intestine(4)|lung(7)|prostate(1)|urinary_tract(1)	15		Ovarian(174;1.78e-06)|Lung NSC(810;3.55e-06)|Breast(144;4.08e-05)				CTCTTCACAGCTGGGAACTGC	0.657											OREG0016608	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			5											38.0	35.0	36.0					5																	52778710		2203	4300	6503	52814467	SO:0001630	splice_region_variant	10468			M19481	CCDS3959.1, CCDS43315.1	5q11.2	2008-02-05			ENSG00000134363	ENSG00000134363			3971	protein-coding gene	gene with protein product		136470				10411917, 3380788	Standard	NM_006350		Approved	FS	uc003jpd.3	P19883	OTTHUMG00000131183	ENST00000256759.3:c.86-1C>G	5.37:g.52778710C>G		Somatic	987	Capture	Illumina GAIIx	4	52814467	B5BU94|Q9BTH0	Missense_Mutation	SNP	HMMPfam_PRKCSH,HMMSmart_SM00274,HMMPfam_FOLN,superfamily_Kazal-type serine protease inhibitors,HMMSmart_SM00280,HMMPfam_Kazal_1	p.A29G	ENST00000256759.3	37	c.86	CCDS3959.1	5	.	.	.	.	.	.	.	.	.	.	C	15.01	2.707723	0.48412	.	.	ENSG00000134363	ENST00000256759;ENST00000511025;ENST00000396947	D;D	0.92699	-3.09;-3.09	4.39	4.39	0.52855	Matrix fibril-associated (1);	0.052089	0.85682	N	0.000000	D	0.89125	0.6626	L	0.48362	1.52	0.80722	D	1	B	0.12013	0.005	B	0.12156	0.007	D	0.85675	0.1297	10	0.30854	T	0.27	.	16.9399	0.86215	0.0:1.0:0.0:0.0	.	29	P19883	FST_HUMAN	G	29	ENSP00000256759:A29G;ENSP00000380151:A29G	ENSP00000256759:A29G	A	+	2	0	FST	52814467	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	5.508000	0.67006	1.987000	0.57996	0.491000	0.48974	GCT	-	NULL		0.657	FST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FST	protein_coding	OTTHUMT00000253906.1	C	NM_013409	Missense_Mutation	52814467	+1	no_errors	NM_013409	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
NEDD4L	23327	genome.wustl.edu	37	18	55989692	55989692	+	Silent	SNP	T	T	C			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr18:55989692T>C	ENST00000400345.3	+	7	667	c.384T>C	c.(382-384)ttT>ttC	p.F128F	NEDD4L_ENST00000456986.1_Silent_p.F7F|NEDD4L_ENST00000431212.2_Silent_p.F7F|NEDD4L_ENST00000456173.2_Silent_p.F7F|NEDD4L_ENST00000382850.4_Silent_p.F128F|NEDD4L_ENST00000256832.7_Silent_p.F7F|NEDD4L_ENST00000435432.2_Silent_p.F7F|NEDD4L_ENST00000357895.5_Silent_p.F120F|NEDD4L_ENST00000589054.1_Intron|NEDD4L_ENST00000586263.1_Silent_p.F120F|NEDD4L_ENST00000356462.6_Silent_p.F128F|NEDD4L_ENST00000256830.9_Silent_p.F128F	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase	128					cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						CCTATACATTTAAGGACTTTC	0.453											OREG0025007	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			18											44.0	41.0	42.0					18																	55989692		1868	4096	5964	54140672	SO:0001819	synonymous_variant	23327			AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.384T>C	18.37:g.55989692T>C		Somatic	1012	Capture	Illumina GAIIx	4	54140672	O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	Silent	SNP	superfamily_C2_CaLB,HMMSmart_C2,HMMPfam_C2,superfamily_WW_Rsp5_WWP,HMMSmart_WW,HMMPfam_WW,PatternScan_WW_DOMAIN_1,superfamily_HECT,HMMSmart_HECTc,HMMPfam_HECT	p.F128	ENST00000400345.3	37	c.384	CCDS45872.1	18																																																																																			-	superfamily_C2_CaLB		0.453	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEDD4L	protein_coding	OTTHUMT00000448749.1	T			54140672	+1	no_errors	NM_015277	genbank	human	validated	54_36p	silent	SNP	1.000	C
MALT1	10892	genome.wustl.edu	37	18	56376637	56376637	+	Missense_Mutation	SNP	A	A	G	rs149988025	byFrequency	TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr18:56376637A>G	ENST00000348428.3	+	5	935	c.677A>G	c.(676-678)aAg>aGg	p.K226R	RP11-126O1.4_ENST00000588835.1_RNA|MALT1_ENST00000345724.3_Missense_Mutation_p.K226R	NM_006785.2|NM_173844.1	NP_006776.1|NP_776216.1	Q9UDY8	MALT1_HUMAN	mucosa associated lymphoid tissue lymphoma translocation gene 1	226	Ig-like C2-type 2.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|B-1 B cell differentiation (GO:0001923)|defense response (GO:0006952)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|nuclear export (GO:0051168)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|protein oligomerization (GO:0051259)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of T cell receptor signaling pathway (GO:0050856)|response to fungus (GO:0009620)|response to molecule of bacterial origin (GO:0002237)|T cell proliferation (GO:0042098)|T cell receptor signaling pathway (GO:0050852)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)|protein self-association (GO:0043621)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|large_intestine(7)|lung(1)|ovary(2)|skin(1)	12						TCTGAATCCAAGTTGCAAATC	0.358			T	BIRC3	MALT																																		Dom	yes		18	18q21	10892	mucosa associated lymphoid tissue lymphoma translocation gene 1		L	0			18						A	ARG/LYS,ARG/LYS	0,4406	2.1+/-5.4	0,0,2203	124.0	115.0	118.0		677,677	-0.9	0.9	18	dbSNP_134	118	9,8591	7.1+/-27.0	0,9,4291	yes	missense,missense	MALT1	NM_006785.2,NM_173844.1	26,26	0,9,6494	GG,GA,AA		0.1047,0.0,0.0692	benign,benign	226/825,226/814	56376637	9,12997	2203	4300	6503	54527617	SO:0001583	missense	10892				CCDS11967.1, CCDS11968.1	18q21	2013-01-11			ENSG00000172175	ENSG00000172175		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6819	protein-coding gene	gene with protein product	"""paracaspase"""	604860		MLT		10339464, 10406266, 10523859	Standard	NM_006785		Approved		uc002lhm.1	Q9UDY8	OTTHUMG00000132761	ENST00000348428.3:c.677A>G	18.37:g.56376637A>G	ENSP00000319279:p.Lys226Arg	Somatic		Capture	Illumina GAIIx	4	54527617	Q9NTB7|Q9ULX4	Missense_Mutation	SNP	superfamily_DEATH domain,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig,superfamily_Caspase-like,HMMPfam_Peptidase_C14	p.K226R	ENST00000348428.3	37	c.677	CCDS11967.1	18	.	.	.	.	.	.	.	.	.	.	A	9.030	0.987134	0.18889	0.0	0.001047	ENSG00000172175	ENST00000348428;ENST00000345724	T;T	0.03889	3.77;3.77	5.17	-0.927	0.10451	Immunoglobulin-like (1);	0.343803	0.34178	N	0.004182	T	0.01976	0.0062	N	0.10972	0.075	0.24492	N	0.994296	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.47262	-0.9131	10	0.11794	T	0.64	.	5.6398	0.17557	0.4608:0.1506:0.3886:0.0	.	226;226	Q9UDY8-2;Q9UDY8	.;MALT1_HUMAN	R	226	ENSP00000319279:K226R;ENSP00000304161:K226R	ENSP00000304161:K226R	K	+	2	0	MALT1	54527617	0.011000	0.17503	0.908000	0.35775	0.989000	0.77384	-0.042000	0.12063	-0.320000	0.08640	0.533000	0.62120	AAG	-	superfamily_Immunoglobulin		0.358	MALT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MALT1	protein_coding	OTTHUMT00000256132.2	A			54527617	+1	no_errors	NM_006785	genbank	human	reviewed	54_36p	missense	SNP	0.967	G
DKKL1	27120	genome.wustl.edu	37	19	49868869	49868869	+	Missense_Mutation	SNP	G	G	T	rs150574340		TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr19:49868869G>T	ENST00000221498.2	+	3	692	c.287G>T	c.(286-288)gGg>gTg	p.G96V	DKKL1_ENST00000594268.1_Intron	NM_014419.3	NP_055234.1	Q9UK85	DKKL1_HUMAN	dickkopf-like 1	96					anatomical structure morphogenesis (GO:0009653)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	signal transducer activity (GO:0004871)			large_intestine(2)|upper_aerodigestive_tract(1)	3		all_lung(116;1.66e-06)|Lung NSC(112;5.89e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0456)		CACCAGCTGGGGAACAACACC	0.602																																																0			19											93.0	84.0	87.0					19																	49868869		2203	4300	6503	54560681	SO:0001583	missense	27120			AB047816	CCDS12762.1	19q13.3	2010-10-12	2010-10-12		ENSG00000104901	ENSG00000104901			16528	protein-coding gene	gene with protein product	"""cancer/testis antigen 34"", ""soggy"""	605418	"""dickkopf-like 1 (soggy)"""			10570958	Standard	NM_001197301		Approved	SGY-1, CT34	uc002pnk.3	Q9UK85		ENST00000221498.2:c.287G>T	19.37:g.49868869G>T	ENSP00000221498:p.Gly96Val	Somatic		Capture	Illumina GAIIx	4	54560681		Missense_Mutation	SNP	NULL	p.G96V	ENST00000221498.2	37	c.287	CCDS12762.1	19	.	.	.	.	.	.	.	.	.	.	G	19.09	3.760360	0.69763	.	.	ENSG00000104901	ENST00000221498	T	0.28454	1.61	4.85	4.85	0.62838	.	0.000000	0.43919	D	0.000513	T	0.55130	0.1901	M	0.73962	2.25	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.59563	-0.7431	10	0.87932	D	0	-33.6717	13.8494	0.63487	0.0:0.0:1.0:0.0	.	96	Q9UK85	DKKL1_HUMAN	V	96	ENSP00000221498:G96V	ENSP00000221498:G96V	G	+	2	0	DKKL1	54560681	1.000000	0.71417	0.986000	0.45419	0.932000	0.56968	4.826000	0.62715	2.411000	0.81874	0.561000	0.74099	GGG	-	NULL		0.602	DKKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DKKL1	protein_coding	OTTHUMT00000465454.2	G	NM_014419		54560681	+1	no_errors	NM_014419	genbank	human	reviewed	54_36p	missense	SNP	0.982	T
ESYT1	23344	genome.wustl.edu	37	12	56532006	56532006	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr12:56532006T>A	ENST00000394048.5	+	21	2551	c.2287T>A	c.(2287-2289)Ttg>Atg	p.L763M	ESYT1_ENST00000267113.4_Missense_Mutation_p.L773M|ESYT1_ENST00000550878.1_3'UTR|ESYT1_ENST00000541590.1_Missense_Mutation_p.L773M	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	763					lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						CCGCCTGCACTTGCGCCTGGA	0.587																																																0			12											134.0	137.0	136.0					12																	56532006		2203	4300	6503	54818273	SO:0001583	missense	23344			AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.2287T>A	12.37:g.56532006T>A	ENSP00000377612:p.Leu763Met	Somatic		Capture	Illumina GAIIx	4	54818273	A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Missense_Mutation	SNP	superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2,PatternScan_G_PROTEIN_RECEP_F1_1	p.L763M	ENST00000394048.5	37	c.2287	CCDS8904.1	12	.	.	.	.	.	.	.	.	.	.	T	17.27	3.345929	0.61073	.	.	ENSG00000139641	ENST00000394048;ENST00000402331;ENST00000267113;ENST00000541590	T;T;T	0.14022	2.54;2.54;2.54	5.47	2.84	0.33178	C2 calcium/lipid-binding domain, CaLB (1);	0.354070	0.25561	N	0.029827	T	0.23249	0.0562	L	0.55990	1.75	0.43756	D	0.996269	P;D	0.89917	0.881;1.0	P;D	0.69307	0.701;0.963	T	0.04333	-1.0959	10	0.48119	T	0.1	-11.5704	2.7447	0.05263	0.1865:0.2309:0.0:0.5826	.	773;763	Q9BSJ8-2;Q9BSJ8	.;ESYT1_HUMAN	M	763;717;773;773	ENSP00000377612:L763M;ENSP00000267113:L773M;ENSP00000445952:L773M	ENSP00000267113:L773M	L	+	1	2	ESYT1	54818273	0.672000	0.27530	1.000000	0.80357	0.998000	0.95712	-0.298000	0.08265	1.015000	0.39444	0.459000	0.35465	TTG	-	superfamily_C2 domain (Calcium/lipid-binding domain CaLB)		0.587	ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM62A	protein_coding	OTTHUMT00000407906.1	T	NM_015292		54818273	+1	no_errors	NM_015292	genbank	human	provisional	54_36p	missense	SNP	1.000	A
VRK3	51231	genome.wustl.edu	37	19	50510925	50510925	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr19:50510925C>T	ENST00000599538.1	-	5	1112	c.448G>A	c.(448-450)Gaa>Aaa	p.E150K	VRK3_ENST00000316763.3_Missense_Mutation_p.E150K|VRK3_ENST00000601912.1_Missense_Mutation_p.E100K|VRK3_ENST00000601341.1_Missense_Mutation_p.E100K|VRK3_ENST00000594092.1_Missense_Mutation_p.E150K|VRK3_ENST00000377011.2_Missense_Mutation_p.E100K|VRK3_ENST00000443401.2_5'UTR|VRK3_ENST00000424804.2_5'UTR|VRK3_ENST00000594948.1_Missense_Mutation_p.E150K|VRK3_ENST00000593919.1_Missense_Mutation_p.E150K			Q8IV63	VRK3_HUMAN	vaccinia related kinase 3	150					negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|skin(2)|stomach(2)|urinary_tract(1)	23		all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00166)|OV - Ovarian serous cystadenocarcinoma(262;0.00652)		GGCAAAGCTTCAAGTGAGGTG	0.582																																					Pancreas(6;90 181 4352 12603 17050 34726 35237 44094)											0			19											204.0	158.0	174.0					19																	50510925		2203	4300	6503	55202737	SO:0001583	missense	51231			AB031052	CCDS12791.1, CCDS33076.1	19q13.33	2011-01-14			ENSG00000105053	ENSG00000105053			18996	protein-coding gene	gene with protein product							Standard	XM_005258971		Approved		uc002prh.1	Q8IV63		ENST00000599538.1:c.448G>A	19.37:g.50510925C>T	ENSP00000469880:p.Glu150Lys	Somatic		Capture	Illumina GAIIx	4	55202737	A6NEG5|A8KA53|Q502Y2|Q9P2V8	Missense_Mutation	SNP	HMMSmart_SM00220,superfamily_Protein kinase-like (PK-like)	p.E150K	ENST00000599538.1	37	c.448	CCDS12791.1	19	.	.	.	.	.	.	.	.	.	.	C	14.28	2.489614	0.44249	.	.	ENSG00000105053	ENST00000316763;ENST00000377011;ENST00000424804	T;T	0.26067	1.76;1.79	4.45	-1.8	0.07907	.	0.364836	0.29972	N	0.010721	T	0.20577	0.0495	M	0.62209	1.925	0.19775	N	0.999953	B;B;B;B;B	0.19445	0.036;0.03;0.005;0.017;0.017	B;B;B;B;B	0.17433	0.012;0.018;0.008;0.009;0.009	T	0.16837	-1.0389	10	0.44086	T	0.13	-14.3564	6.4312	0.21798	0.0:0.3603:0.46:0.1797	.	150;150;150;100;150	E7EMG6;Q8IV63-2;B4E0U5;A6NEG5;Q8IV63	.;.;.;.;VRK3_HUMAN	K	150;100;150	ENSP00000324636:E150K;ENSP00000366210:E100K	ENSP00000324636:E150K	E	-	1	0	VRK3	55202737	0.010000	0.17322	0.052000	0.19188	0.881000	0.50899	-0.429000	0.06982	-0.134000	0.11516	0.655000	0.94253	GAA	-	NULL		0.582	VRK3-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	VRK3	protein_coding	OTTHUMT00000464815.1	C	NM_016440		55202737	-1	no_errors	NM_016440	genbank	human	reviewed	54_36p	missense	SNP	0.095	T
OR5W2	390148	genome.wustl.edu	37	11	55681179	55681179	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr11:55681179T>A	ENST00000344514.1	-	1	879	c.880A>T	c.(880-882)Aac>Tac	p.N294Y		NM_001001960.1	NP_001001960.1	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W, member 2	294						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(28)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						ACATCCTTGTTCCTCAGGCTA	0.343																																					Melanoma(48;171 1190 15239 43886 49348)											0			11											34.0	37.0	36.0					11																	55681179		2200	4296	6496	55437755	SO:0001583	missense	390148			BK004398	CCDS31513.1	11q11	2012-08-09		2004-03-10	ENSG00000187612	ENSG00000187612		"""GPCR / Class A : Olfactory receptors"""	15299	protein-coding gene	gene with protein product				OR5W2P, OR5W3P			Standard	NM_001001960		Approved		uc010rir.2	Q8NH69	OTTHUMG00000166818	ENST00000344514.1:c.880A>T	11.37:g.55681179T>A	ENSP00000342448:p.Asn294Tyr	Somatic		Capture	Illumina GAIIx	4	55437755		Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.N294Y	ENST00000344514.1	37	c.880	CCDS31513.1	11	.	.	.	.	.	.	.	.	.	.	T	12.64	1.998866	0.35226	.	.	ENSG00000187612	ENST00000344514	T	0.50001	0.76	5.01	5.01	0.66863	.	0.000000	0.41396	D	0.000889	T	0.65386	0.2686	H	0.96048	3.76	0.31374	N	0.679829	P	0.41450	0.75	B	0.42995	0.404	T	0.78897	-0.2023	10	0.87932	D	0	.	12.6788	0.56910	0.0:0.0:0.0:1.0	.	294	Q8NH69	OR5W2_HUMAN	Y	294	ENSP00000342448:N294Y	ENSP00000342448:N294Y	N	-	1	0	OR5W2	55437755	0.947000	0.32204	0.791000	0.31998	0.396000	0.30629	3.259000	0.51515	1.874000	0.54306	0.448000	0.29417	AAC	-	superfamily_SSF81321		0.343	OR5W2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5W2	protein_coding	OTTHUMT00000391523.1	T	NM_001001960		55437755	-1	no_errors	NM_001001960	genbank	human	provisional	54_36p	missense	SNP	0.787	A
RP11-866E20.3	0	genome.wustl.edu	37	18	57684009	57684009	+	lincRNA	SNP	A	A	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr18:57684009A>T	ENST00000585691.1	+	0	3524				RNU6-567P_ENST00000516746.1_RNA																							AACCTCAGTCACCACTCCTGA	0.438																																																0			18																																								55834989			728115																															18.37:g.57684009A>T		Somatic		Capture	Illumina GAIIx	4	55834989		RNA	SNP	-	NULL	ENST00000585691.1	37	NULL		18																																																																																			-	-		0.438	RP11-866E20.3-001	KNOWN	basic	lincRNA	LOC728115	lincRNA	OTTHUMT00000449078.1	A			55834989	-1	pseudogene	XR_038858	genbank	human	model	54_36p	rna	SNP	1.000	T
LOC101928517	101928517	genome.wustl.edu	37	19	51671043	51671043	+	RNA	SNP	C	C	T	rs188272311		TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr19:51671043C>T	ENST00000600074.1	-	0	493				SIGLEC17P_ENST00000598286.1_RNA																							GCATCAGAGACGCCAGGAGGA	0.498													.|||	1	0.000199681	0.0	0.0	5008	,	,		20742	0.001		0.0	False		,,,				2504	0.0															0			19																																								56362855			284367																															19.37:g.51671043C>T		Somatic		Capture	Illumina GAIIx	4	56362855		Silent	SNP	superfamily_SSF48726,HMMSmart_IG,HMMPfam_V-set,HMMPfam_ig	p.D132	ENST00000600074.1	37	c.396		19																																																																																			-	superfamily_SSF48726,HMMSmart_IG,HMMPfam_V-set		0.498	CTD-3187F8.14-001	KNOWN	basic	antisense	SIGLECP3	antisense	OTTHUMT00000465635.1	C			56362855	+1	no_start_codon	ENST00000341811	ensembl	human	known	54_36p	silent	SNP	0.001	T
ZNF525	170958	genome.wustl.edu	37	19	53885437	53885437	+	IGR	SNP	A	A	C			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr19:53885437A>C	ENST00000355326.3	+	0	594				ZNF525_ENST00000593918.1_Intron|ZNF525_ENST00000474037.1_3'UTR|ZNF525_ENST00000467003.1_3'UTR|ZNF525_ENST00000475179.1_Intron			Q8N782	ZN525_HUMAN	zinc finger protein 525						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)|lung(3)	9						TCAGTTTCAAATCAAACCTTG	0.383																																																0			19																																								58577249	SO:0001628	intergenic_variant	170958			AB075859		19q13.42	2013-01-16			ENSG00000203326	ENSG00000203326		"""Zinc fingers, C2H2-type"", ""-"""	29423	protein-coding gene	gene with protein product						11853319	Standard	NR_003699		Approved	KIAA1979	uc010eqn.3	Q8N782	OTTHUMG00000158277		19.37:g.53885437A>C		Somatic		Capture	Illumina GAIIx	4	58577249	Q8TF23	RNA	SNP	-	NULL	ENST00000355326.3	37	NULL		19																																																																																			-	-		0.383	ZNF525-201	KNOWN	basic	protein_coding	ZNF525	protein_coding		A	NR_003699		58577249	+1	pseudogene	NR_003699	genbank	human	validated	54_36p	rna	SNP	0.000	C
VPS13C	54832	genome.wustl.edu	37	15	62214766	62214766	+	Missense_Mutation	SNP	G	G	C	rs372868009		TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr15:62214766G>C	ENST00000261517.5	-	54	6878	c.6805C>G	c.(6805-6807)Cat>Gat	p.H2269D	VPS13C_ENST00000249837.3_Missense_Mutation_p.H2226D|VPS13C_ENST00000395898.3_Missense_Mutation_p.H2226D|VPS13C_ENST00000395896.4_Missense_Mutation_p.H2269D	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						ATCAGTGAATGTTCAATGCCT	0.378																																																0			15						G	ASP/HIS,ASP/HIS,ASP/HIS,ASP/HIS	1,4405	2.1+/-5.4	0,1,2202	175.0	166.0	169.0		6805,6676,6676,6805	2.0	0.0	15		169	0,8600		0,0,4300	no	missense,missense,missense,missense	VPS13C	NM_001018088.2,NM_017684.4,NM_018080.3,NM_020821.2	81,81,81,81	0,1,6502	CC,CG,GG		0.0,0.0227,0.0077	benign,benign,benign,benign	2269/3629,2226/3711,2226/3586,2269/3754	62214766	1,13005	2203	4300	6503	60002058	SO:0001583	missense	54832			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.6805C>G	15.37:g.62214766G>C	ENSP00000261517:p.His2269Asp	Somatic		Capture	Illumina GAIIx	4	60002058		Missense_Mutation	SNP	HMMPfam_DUF1162	p.H2269D	ENST00000261517.5	37	c.6805	CCDS32257.1	15	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.764691	0.00651	2.27E-4	0.0	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.42513	0.97;0.97;0.97	5.07	2.05	0.26809	.	1.015460	0.07829	N	0.961088	T	0.33118	0.0852	L	0.41236	1.265	0.09310	N	1	B;B;B;B	0.12630	0.001;0.003;0.0;0.006	B;B;B;B	0.16722	0.007;0.016;0.004;0.005	T	0.31336	-0.9947	10	0.18276	T	0.48	.	8.6127	0.33813	0.0704:0.0:0.5224:0.4072	.	2226;2269;2226;2269	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	D	2226;2269;2269;2269	ENSP00000249837:H2226D;ENSP00000261517:H2269D;ENSP00000379233:H2269D	ENSP00000249837:H2226D	H	-	1	0	VPS13C	60002058	0.011000	0.17503	0.000000	0.03702	0.014000	0.08584	0.986000	0.29590	0.216000	0.20781	0.650000	0.86243	CAT	-	NULL		0.378	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13C	protein_coding	OTTHUMT00000415997.1	G	NM_017684		60002058	-1	no_errors	NM_020821	genbank	human	validated	54_36p	missense	SNP	0.001	C
CCDC88B	283234	genome.wustl.edu	37	11	64108210	64108210	+	Silent	SNP	G	G	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr11:64108210G>T	ENST00000356786.5	+	2	236	c.192G>T	c.(190-192)cgG>cgT	p.R64R	CCDC88B_ENST00000463837.1_3'UTR	NM_032251.5	NP_115627.6	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88B	64						membrane (GO:0016020)				endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TGCTCCTCCGGGTGCTGGGCA	0.672																																																0			11											36.0	47.0	43.0					11																	64108210		2155	4262	6417	63864786	SO:0001819	synonymous_variant	283234			AK090436	CCDS8072.2	11q13.1	2013-03-13	2007-05-31	2007-05-31	ENSG00000168071	ENSG00000168071			26757	protein-coding gene	gene with protein product	"""brain leucine zipper protein"", ""GRP78-interacting protein induced by ER stress"""	611205	"""coiled-coil domain containing 88"""	CCDC88		15882442, 21289099	Standard	NM_032251		Approved	FLJ37970, BRLZ, HkRP3, FLJ00354, GIPIE	uc001nzy.3	A6NC98	OTTHUMG00000045419	ENST00000356786.5:c.192G>T	11.37:g.64108210G>T		Somatic		Capture	Illumina GAIIx	4	63864786	A5D8Y5|B5MDM2|Q05BL2|Q6RUV3|Q8N1Q6|Q8NF44|Q9H0H1	Silent	SNP	NULL	p.R64	ENST00000356786.5	37	c.192	CCDS8072.2	11																																																																																			-	NULL		0.672	CCDC88B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC88B	protein_coding	OTTHUMT00000104845.1	G	NM_032251		63864786	+1	no_errors	NM_032251	genbank	human	validated	54_36p	silent	SNP	0.996	T
SPTB	6710	genome.wustl.edu	37	14	65237749	65237749	+	Silent	SNP	C	C	T	rs146536978	byFrequency	TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr14:65237749C>T	ENST00000389721.5	-	26	5684	c.5652G>A	c.(5650-5652)gcG>gcA	p.A1884A	SPTB_ENST00000556626.1_Silent_p.A1884A|SPTB_ENST00000389720.3_Silent_p.A1884A|SPTB_ENST00000542895.1_Silent_p.A1884A|SPTB_ENST00000389722.3_Silent_p.A1884A	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1884					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		GCGCCTGCCACGCGGCAGACA	0.637													C|||	2	0.000399361	0.0015	0.0	5008	,	,		22334	0.0		0.0	False		,,,				2504	0.0															0			14						C	,	13,4393	20.2+/-43.8	0,13,2190	79.0	78.0	78.0		5652,5652	-5.9	0.0	14	dbSNP_134	78	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	SPTB	NM_000347.5,NM_001024858.2	,	0,13,6490	TT,TC,CC		0.0,0.2951,0.1	,	1884/2138,1884/2329	65237749	13,12993	2203	4300	6503	64307502	SO:0001819	synonymous_variant	6710				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.5652G>A	14.37:g.65237749C>T		Somatic		Capture	Illumina GAIIx	4	64307502	Q15510|Q15519	Silent	SNP	superfamily_Calponin-homology,HMMPfam_CH,PatternScan_ACTININ_1,HMMSmart_CH,PatternScan_ACTININ_2,superfamily_Spectrin,HMMPfam_Spectrin,HMMSmart_SPEC,superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH	p.A1884	ENST00000389721.5	37	c.5652	CCDS32100.1	14																																																																																			-	HMMPfam_Spectrin,superfamily_Spectrin,HMMSmart_SPEC		0.637	SPTB-004	KNOWN	basic|CCDS	protein_coding	SPTB	protein_coding	OTTHUMT00000414080.1	C			64307502	-1	no_errors	NM_001024858	genbank	human	validated	54_36p	silent	SNP	0.991	T
ADAMTS9	56999	genome.wustl.edu	37	3	64619529	64619529	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr3:64619529A>C	ENST00000498707.1	-	13	2225	c.1883T>G	c.(1882-1884)gTa>gGa	p.V628G	ADAMTS9_ENST00000295903.4_Missense_Mutation_p.V600G	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	628	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		TCTACGTCCTACACAGTATTT	0.413																																																0			3											78.0	70.0	73.0					3																	64619529		2203	4300	6503	64594569	SO:0001583	missense	56999			AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.1883T>G	3.37:g.64619529A>C	ENSP00000418735:p.Val628Gly	Somatic		Capture	Illumina GAIIx	4	64594569	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMPfam_ADAM_spacer1,HMMPfam_GON"	p.V628G	ENST00000498707.1	37	c.1883	CCDS2903.1	3	.	.	.	.	.	.	.	.	.	.	A	15.52	2.856627	0.51376	.	.	ENSG00000163638	ENST00000295903;ENST00000498707	T;T	0.03831	3.79;3.79	5.51	1.47	0.22746	.	0.618757	0.15669	N	0.250489	T	0.15392	0.0371	M	0.67569	2.06	0.20196	N	0.999923	D;D;P;D	0.58620	0.963;0.983;0.943;0.963	D;D;P;D	0.65010	0.931;0.927;0.736;0.931	T	0.02781	-1.1111	10	0.87932	D	0	.	10.1493	0.42782	0.7767:0.0:0.2233:0.0	.	600;628;628;628	B7ZVX9;Q9P2N4-2;Q9P2N4-1;Q9P2N4	.;.;.;ATS9_HUMAN	G	600;628	ENSP00000295903:V600G;ENSP00000418735:V628G	ENSP00000295903:V600G	V	-	2	0	ADAMTS9	64594569	0.977000	0.34250	0.006000	0.13384	0.780000	0.44128	5.029000	0.64121	0.407000	0.25591	0.533000	0.62120	GTA	-	superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1		0.413	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS9	protein_coding	OTTHUMT00000351891.1	A			64594569	-1	no_errors	NM_182920	genbank	human	reviewed	54_36p	missense	SNP	0.995	C
EDA	1896	genome.wustl.edu	37	X	69253373	69253373	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chrX:69253373G>A	ENST00000374552.4	+	7	1161	c.919G>A	c.(919-921)Gta>Ata	p.V307I	EDA_ENST00000374553.2_Splice_Site|EDA_ENST00000524573.1_Splice_Site	NM_001399.4	NP_001390.1	Q92838	EDA_HUMAN	ectodysplasin A	307			V -> G (in XHED). {ECO:0000269|PubMed:18231121}.		cell differentiation (GO:0030154)|cell-matrix adhesion (GO:0007160)|ectoderm development (GO:0007398)|gene expression (GO:0010467)|hair follicle placode formation (GO:0060789)|immune response (GO:0006955)|odontogenesis of dentin-containing tooth (GO:0042475)|pigmentation (GO:0043473)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|salivary gland cavitation (GO:0060662)|signal transduction (GO:0007165)|trachea gland development (GO:0061153)	apical part of cell (GO:0045177)|collagen trimer (GO:0005581)|cytoskeleton (GO:0005856)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|urinary_tract(1)	14						CTATAGTCAGGTAGAAGTGAG	0.537											OREG0019847	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			X											96.0	69.0	78.0					X																	69253373		2203	4300	6503	69170098	SO:0001583	missense	1896			U59227	CCDS14394.1, CCDS35318.1, CCDS35319.1, CCDS43966.1, CCDS35318.2, CCDS35319.2, CCDS55436.1	Xq12-q13.1	2013-05-22	2004-08-09	2004-08-12	ENSG00000158813	ENSG00000158813		"""Tumor necrosis factor (ligand) superfamily"""	3157	protein-coding gene	gene with protein product		300451	"""ectodermal dysplasia 1, anhidrotic"", ""oligodontia 1"""	ED1, EDA2, ODT1		8696334, 18657636, 16583127	Standard	NM_001005612		Approved	EDA1, XLHED, HED, XHED, ED1-A1, ED1-A2, EDA-A1, EDA-A2	uc004dxs.3	Q92838	OTTHUMG00000021764	ENST00000374552.4:c.919G>A	X.37:g.69253373G>A	ENSP00000363680:p.Val307Ile	Somatic	1113	Capture	Illumina GAIIx	4	69170098	A0AUZ2|A2A337|B7ZLU2|B7ZLU4|O75910|Q5JS00|Q5JUM7|Q9UP77|Q9Y6L0|Q9Y6L1|Q9Y6L2|Q9Y6L3|Q9Y6L4	Splice_Site	SNP	-	e7+1	ENST00000374552.4	37	c.918+1	CCDS14394.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.3|26.3	4.723808|4.723808	0.89298|0.89298	.|.	.|.	ENSG00000158813|ENSG00000158813	ENST00000374553;ENST00000524573|ENST00000374552	.|D	.|0.95690	.|-3.78	5.48|5.48	5.48|5.48	0.80851|0.80851	.|Tumour necrosis factor (3);Tumour necrosis factor-like (2);	.|0.000000	.|0.64402	.|D	.|0.000001	.|D	.|0.96664	.|0.8911	L|L	0.52126|0.52126	1.63|1.63	0.80722|0.80722	D|D	1|1	.|D	.|0.57257	.|0.979	.|D	.|0.70487	.|0.969	.|D	.|0.96273	.|0.9200	.|9	.|.	.|.	.|.	.|-6.5153	17.2271|17.2271	0.86973|0.86973	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|307	.|Q92838	.|EDA_HUMAN	.|I	-1|307	.|ENSP00000363680:V307I	.|.	.|V	+|+	.|1	.|0	EDA|EDA	69170098|69170098	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.238000|9.238000	0.95380|0.95380	2.279000|2.279000	0.76181|0.76181	0.600000|0.600000	0.82982|0.82982	.|GTA	-	-		0.537	EDA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EDA	protein_coding	OTTHUMT00000057048.2	G	NM_001399		69170098	+1	no_errors	NM_001005609	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	A
LLGL2	3993	genome.wustl.edu	37	17	73567116	73567116	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr17:73567116C>G	ENST00000392550.3	+	17	2228	c.2111C>G	c.(2110-2112)tCg>tGg	p.S704W	LLGL2_ENST00000167462.5_Missense_Mutation_p.S704W|LLGL2_ENST00000577200.1_Missense_Mutation_p.S704W	NM_001031803.1	NP_001026973.1	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 (Drosophila)	704					cell cycle (GO:0007049)|cell division (GO:0051301)|exocytosis (GO:0006887)|regulation of establishment or maintenance of cell polarity (GO:0032878)	cytoplasm (GO:0005737)	PDZ domain binding (GO:0030165)			NS(1)|breast(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			GAGGCTCGCTCGGCAGAGGAC	0.657																																																0			17											65.0	72.0	70.0					17																	73567116		2203	4297	6500	71078711	SO:0001583	missense	3993			X87342	CCDS11725.1, CCDS32733.1, CCDS45776.1	17q25.1	2013-01-10	2001-11-28			ENSG00000073350		"""WD repeat domain containing"""	6629	protein-coding gene	gene with protein product			"""lethal giant larvae (Drosophila) homolog 2"""				Standard	XR_243659		Approved	HGL	uc002joh.3	Q6P1M3		ENST00000392550.3:c.2111C>G	17.37:g.73567116C>G	ENSP00000376333:p.Ser704Trp	Somatic		Capture	Illumina GAIIx	4	71078711	Q14521|Q9BR62	Missense_Mutation	SNP	HMMSmart_SM00320,superfamily_WD40 repeat-like,HMMPfam_LLGL,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.S704W	ENST00000392550.3	37	c.2111	CCDS32733.1	17	.	.	.	.	.	.	.	.	.	.	C	15.50	2.850752	0.51270	.	.	ENSG00000073350	ENST00000167462;ENST00000392550;ENST00000545227	T;T	0.52295	0.67;0.67	5.0	5.0	0.66597	.	0.062472	0.64402	D	0.000002	T	0.70631	0.3246	M	0.78637	2.42	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.998;0.999;0.999;0.999	D;D;D;D;D	0.76575	0.983;0.921;0.964;0.978;0.988	T	0.75496	-0.3297	10	0.87932	D	0	-3.4744	18.2923	0.90134	0.0:1.0:0.0:0.0	.	331;693;693;704;704	B4DVR9;B3KX47;G3V1I9;Q6P1M3-2;Q6P1M3	.;.;.;.;L2GL2_HUMAN	W	704;704;693	ENSP00000167462:S704W;ENSP00000376333:S704W	ENSP00000167462:S704W	S	+	2	0	LLGL2	71078711	1.000000	0.71417	0.915000	0.36163	0.935000	0.57460	7.770000	0.85390	2.338000	0.79540	0.555000	0.69702	TCG	-	NULL		0.657	LLGL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LLGL2	protein_coding	OTTHUMT00000447633.1	C	NM_004524		71078711	+1	no_errors	NM_001031803	genbank	human	reviewed	54_36p	missense	SNP	0.999	G
FAM135A	57579	genome.wustl.edu	37	6	71195924	71195924	+	Intron	SNP	G	G	A	rs369691884		TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr6:71195924G>A	ENST00000418814.2	+	10	1437				FAM135A_ENST00000361499.3_Intron|FAM135A_ENST00000457062.2_Missense_Mutation_p.R250Q|FAM135A_ENST00000505769.1_Intron|FAM135A_ENST00000505868.1_Intron|FAM135A_ENST00000370479.3_Missense_Mutation_p.R250Q	NM_001105531.2|NM_001162529.1	NP_001099001.1|NP_001156001.1	Q9P2D6	F135A_HUMAN	family with sequence similarity 135, member A											breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38						AAACAGCTACGAACACAGAAA	0.363																																																0			6						G	,,GLN/ARG	0,4406		0,0,2203	94.0	85.0	88.0		,,749	4.9	0.8	6		88	1,8599	1.2+/-3.3	0,1,4299	no	intron,intron,missense	FAM135A	NM_001105531.2,NM_001162529.1,NM_020819.4	,,43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	,,250/1303	71195924	1,13005	2203	4300	6503	71252645	SO:0001627	intron_variant	57579			AK000183	CCDS34481.1, CCDS47448.1, CCDS55028.1	6q13	2008-10-30	2007-05-11	2007-05-11	ENSG00000082269	ENSG00000082269			21084	protein-coding gene	gene with protein product			"""KIAA1411"""	KIAA1411		10718198	Standard	NM_001105531		Approved	FLJ20176	uc003pfj.3	Q9P2D6	OTTHUMG00000014991	ENST00000418814.2:c.823+4067G>A	6.37:g.71195924G>A		Somatic		Capture	Illumina GAIIx	4	71252645	A2RRQ5|Q3C0H3|Q5JXK0|Q5JXK1|Q68DW0|Q6P081|Q9H0F2|Q9NU48|Q9NUQ5|Q9NXL5	Missense_Mutation	SNP	superfamily_SSF53474,HMMPfam_DUF676	p.R250Q	ENST00000418814.2	37	c.749	CCDS55028.1	6	.	.	.	.	.	.	.	.	.	.	G	11.55	1.670786	0.29693	0.0	1.16E-4	ENSG00000082269	ENST00000370479;ENST00000457062	T;T	0.17054	2.3;2.3	5.73	4.86	0.63082	.	.	.	.	.	T	0.04003	0.0112	L	0.29908	0.895	0.19945	N	0.99994	B;P	0.44309	0.349;0.832	B;B	0.34536	0.065;0.185	T	0.29027	-1.0025	9	0.12766	T	0.61	.	15.0068	0.71519	0.0:0.2886:0.7114:0.0	.	24;250	Q5JXJ9;Q9P2D6-3	.;.	Q	250	ENSP00000359510:R250Q;ENSP00000409201:R250Q	ENSP00000359510:R250Q	R	+	2	0	FAM135A	71252645	1.000000	0.71417	0.836000	0.33094	0.926000	0.56050	3.978000	0.56881	1.425000	0.47237	0.650000	0.86243	CGA	-	NULL		0.363	FAM135A-001	KNOWN	basic|CCDS	protein_coding	FAM135A	protein_coding	OTTHUMT00000041137.2	G	NM_020819		71252645	+1	no_errors	NM_020819	genbank	human	validated	54_36p	missense	SNP	0.991	A
RP11-24M17.5	0	genome.wustl.edu	37	15	76075411	76075411	+	RNA	SNP	G	G	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr15:76075411G>A	ENST00000395215.3	+	0	1051				RN7SL319P_ENST00000480656.2_RNA																							AAAATGAGAGGCTTCGGGAGC	0.602																																																0			15																																								73862466			441728																															15.37:g.76075411G>A		Somatic		Capture	Illumina GAIIx	4	73862466		RNA	SNP	-	NULL	ENST00000395215.3	37	NULL		15																																																																																			-	-		0.602	RP11-24M17.5-001	KNOWN	basic	processed_transcript	LOC441728	pseudogene	OTTHUMT00000420501.1	G			73862466	+1	no_errors	XR_017329	genbank	human	model	54_36p	rna	SNP	0.009	A
AREL1	9870	genome.wustl.edu	37	14	75134212	75134212	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr14:75134212C>T	ENST00000356357.4	-	16	2515	c.2000G>A	c.(1999-2001)cGg>cAg	p.R667Q	AREL1_ENST00000557401.1_5'UTR	NM_001039479.1	NP_001034568.1	O15033	AREL1_HUMAN	apoptosis resistant E3 ubiquitin protein ligase 1	667	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										ACTGGCCAGCCGATATTGGGC	0.448																																																0			14											78.0	81.0	80.0					14																	75134212		1859	4092	5951	74203965	SO:0001583	missense	9870			AB002315	CCDS41971.1	14q24.2	2013-04-15	2013-04-15	2013-04-15	ENSG00000119682	ENSG00000119682			20363	protein-coding gene	gene with protein product		615380	"""KIAA0317"""	KIAA0317		9205841, 23479728	Standard	XM_006720344		Approved		uc001xqb.3	O15033	OTTHUMG00000154499	ENST00000356357.4:c.2000G>A	14.37:g.75134212C>T	ENSP00000348714:p.Arg667Gln	Somatic		Capture	Illumina GAIIx	4	74203965	B4E2C7|Q7LDY1|Q8IYY9	Missense_Mutation	SNP	superfamily_E set domains,HMMPfam_Filamin,PatternScan_RCC1_2,superfamily_Hect E3 ligase catalytic domain,HMMSmart_SM00119,HMMPfam_HECT	p.R667Q	ENST00000356357.4	37	c.2000	CCDS41971.1	14	.	.	.	.	.	.	.	.	.	.	C	36	5.906299	0.97087	.	.	ENSG00000119682	ENST00000356357;ENST00000543377;ENST00000556202	T;T	0.50548	0.74;0.74	5.55	5.55	0.83447	HECT (4);	0.000000	0.85682	D	0.000000	T	0.79528	0.4461	H	0.95437	3.67	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.85181	0.1004	10	0.87932	D	0	.	19.8667	0.96806	0.0:1.0:0.0:0.0	.	667	O15033	K0317_HUMAN	Q	667;506;506	ENSP00000348714:R667Q;ENSP00000452101:R506Q	ENSP00000348714:R667Q	R	-	2	0	KIAA0317	74203965	1.000000	0.71417	0.995000	0.50966	0.999000	0.98932	6.026000	0.70873	2.773000	0.95371	0.655000	0.94253	CGG	-	superfamily_Hect E3 ligase catalytic domain,HMMSmart_SM00119,HMMPfam_HECT		0.448	AREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0317	protein_coding	OTTHUMT00000335517.2	C	NM_014821		74203965	-1	no_errors	NM_001039479	genbank	human	validated	54_36p	missense	SNP	1.000	T
SV2C	22987	genome.wustl.edu	37	5	75427663	75427663	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr5:75427663G>T	ENST00000502798.2	+	2	530	c.88G>T	c.(88-90)Gtg>Ttg	p.V30L	SV2C_ENST00000322285.7_Missense_Mutation_p.V30L	NM_014979.1	NP_055794.1	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	30	Interaction with SYT1. {ECO:0000250}.				neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)			NS(1)|breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		AGTAAAGAAGGTGAATCAAGC	0.473																																																0			5											145.0	140.0	142.0					5																	75427663		1960	4152	6112	75463419	SO:0001583	missense	22987			AB028977	CCDS43331.1, CCDS75261.1	5q13	2008-02-05			ENSG00000122012	ENSG00000122012			30670	protein-coding gene	gene with protein product		610291				10470851, 9801366	Standard	XM_005248470		Approved		uc003kei.1	Q496J9	OTTHUMG00000162384	ENST00000502798.2:c.88G>T	5.37:g.75427663G>T	ENSP00000423541:p.Val30Leu	Somatic		Capture	Illumina GAIIx	4	75463419	Q496K1|Q9UPU8	Missense_Mutation	SNP	superfamily_MFS_gen_substrate_transporter,HMMPfam_MFS_1	p.V30L	ENST00000502798.2	37	c.88	CCDS43331.1	5	.	.	.	.	.	.	.	.	.	.	G	14.80	2.642808	0.47153	.	.	ENSG00000122012	ENST00000502798;ENST00000322285	T;T	0.26660	1.72;1.72	5.76	5.76	0.90799	Major facilitator superfamily domain, general substrate transporter (1);	0.061993	0.64402	D	0.000005	T	0.24890	0.0604	L	0.50333	1.59	0.39522	D	0.968537	B	0.26512	0.151	B	0.25884	0.064	T	0.03818	-1.1001	10	0.29301	T	0.29	-17.8453	13.2055	0.59793	0.0726:0.0:0.9274:0.0	.	30	Q496J9	SV2C_HUMAN	L	30	ENSP00000423541:V30L;ENSP00000316983:V30L	ENSP00000316983:V30L	V	+	1	0	SV2C	75463419	1.000000	0.71417	1.000000	0.80357	0.534000	0.34807	4.276000	0.58933	2.719000	0.93026	0.655000	0.94253	GTG	-	superfamily_MFS_gen_substrate_transporter		0.473	SV2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SV2C	protein_coding	OTTHUMT00000368700.4	G			75463419	+1	no_errors	NM_014979	genbank	human	provisional	54_36p	missense	SNP	1.000	T
MAGEE1	57692	genome.wustl.edu	37	X	75649202	75649202	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chrX:75649202C>A	ENST00000361470.2	+	1	1157	c.879C>A	c.(877-879)agC>agA	p.S293R		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	293	Pro-rich.					dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						AGGGATCAAGCACCTCCGTGC	0.706																																																0			X											26.0	23.0	24.0					X																	75649202		2198	4298	6496	75565606	SO:0001583	missense	57692			AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.879C>A	X.37:g.75649202C>A	ENSP00000354912:p.Ser293Arg	Somatic		Capture	Illumina GAIIx	4	75565606	Q5JXC7|Q86TG0|Q8TD92|Q9H216	Missense_Mutation	SNP	HMMPfam_MAGE	p.S293R	ENST00000361470.2	37	c.879	CCDS14433.1	X	.	.	.	.	.	.	.	.	.	.	C	9.016	0.983587	0.18889	.	.	ENSG00000198934	ENST00000361470	T	0.24538	1.85	1.6	1.6	0.23607	.	.	.	.	.	T	0.09158	0.0226	N	0.08118	0	0.09310	N	1	P	0.44690	0.841	B	0.32211	0.142	T	0.14643	-1.0465	9	0.66056	D	0.02	.	3.6277	0.08119	0.0:0.7499:0.0:0.2501	.	293	Q9HCI5	MAGE1_HUMAN	R	293	ENSP00000354912:S293R	ENSP00000354912:S293R	S	+	3	2	MAGEE1	75565606	0.001000	0.12720	0.004000	0.12327	0.021000	0.10359	1.330000	0.33781	1.063000	0.40649	0.431000	0.28591	AGC	-	NULL		0.706	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEE1	protein_coding	OTTHUMT00000057298.1	C	NM_020932		75565606	+1	no_errors	NM_020932	genbank	human	validated	54_36p	missense	SNP	0.008	A
NAV3	89795	genome.wustl.edu	37	12	78444819	78444819	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr12:78444819A>G	ENST00000397909.2	+	11	2581	c.2408A>G	c.(2407-2409)gAg>gGg	p.E803G	RP11-136F16.1_ENST00000549103.1_RNA|NAV3_ENST00000228327.6_Missense_Mutation_p.E803G|NAV3_ENST00000536525.2_Missense_Mutation_p.E803G|NAV3_ENST00000266692.7_Missense_Mutation_p.E803G			Q8IVL0	NAV3_HUMAN	neuron navigator 3	803						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						GACATGAGTGAGAAAGCAAGC	0.498										HNSCC(70;0.22)																																						0			12											67.0	67.0	67.0					12																	78444819		2092	4224	6316	76968950	SO:0001583	missense	89795			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.2408A>G	12.37:g.78444819A>G	ENSP00000381007:p.Glu803Gly	Somatic		Capture	Illumina GAIIx	4	76968950	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,HMMSmart_SM00033,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382	p.E803G	ENST00000397909.2	37	c.2408		12	.	.	.	.	.	.	.	.	.	.	A	20.3	3.970948	0.74246	.	.	ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T	0.33216	1.53;1.52;1.53;1.42	5.79	5.79	0.91817	.	0.000000	0.40554	U	0.001079	T	0.34687	0.0906	L	0.59436	1.845	0.80722	D	1	B;B;B	0.18013	0.005;0.003;0.025	B;B;B	0.18561	0.009;0.001;0.022	T	0.11348	-1.0591	10	0.87932	D	0	-24.5674	16.1249	0.81386	1.0:0.0:0.0:0.0	.	803;803;803	E7EUC6;Q8IVL0;Q8IVL0-2	.;NAV3_HUMAN;.	G	803	ENSP00000446132:E803G;ENSP00000381007:E803G;ENSP00000228327:E803G;ENSP00000266692:E803G	ENSP00000228327:E803G	E	+	2	0	NAV3	76968950	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	7.050000	0.76620	2.208000	0.71279	0.533000	0.62120	GAG	-	NULL		0.498	NAV3-001	KNOWN	basic	protein_coding	NAV3	protein_coding	OTTHUMT00000406812.1	A	NM_001024383		76968950	+1	no_errors	NM_014903	genbank	human	validated	54_36p	missense	SNP	1.000	G
PHIP	55023	genome.wustl.edu	37	6	79665394	79665394	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr6:79665394T>A	ENST00000275034.4	-	33	3955	c.3788A>T	c.(3787-3789)cAg>cTg	p.Q1263L	PHIP_ENST00000479165.1_5'UTR	NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	1263					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		ATAACAAGTCTGATCCCTACA	0.249																																																0			6											29.0	32.0	31.0					6																	79665394		2161	4243	6404	79722113	SO:0001583	missense	55023			AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.3788A>T	6.37:g.79665394T>A	ENSP00000275034:p.Gln1263Leu	Somatic		Capture	Illumina GAIIx	4	79722113	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	HMMSmart_SM00320,HMMPfam_WD40,superfamily_YVTN repeat-like/Quinoprotein amine dehydrogenase,PatternScan_WD_REPEATS_1,superfamily_Bromodomain,HMMSmart_SM00297,HMMPfam_Bromodomain,PatternScan_BROMODOMAIN_1	p.Q1263L	ENST00000275034.4	37	c.3788	CCDS4987.1	6	.	.	.	.	.	.	.	.	.	.	T	15.36	2.811874	0.50527	.	.	ENSG00000146247	ENST00000275034	T	0.43688	0.94	5.48	4.25	0.50352	.	0.000000	0.64402	D	0.000001	T	0.23649	0.0572	M	0.63843	1.955	0.58432	D	0.999998	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.08146	-1.0736	9	.	.	.	-8.3535	11.6076	0.51041	0.1329:0.0:0.0:0.8671	.	1263;1263	A7J992;Q8WWQ0	.;PHIP_HUMAN	L	1263	ENSP00000275034:Q1263L	.	Q	-	2	0	PHIP	79722113	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	5.587000	0.67510	2.212000	0.71576	0.374000	0.22700	CAG	-	superfamily_Bromodomain		0.249	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHIP	protein_coding	OTTHUMT00000041297.2	T			79722113	-1	no_errors	NM_017934	genbank	human	validated	54_36p	missense	SNP	1.000	A
SLC28A1	9154	genome.wustl.edu	37	15	85464278	85464278	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr15:85464278C>A	ENST00000286749.3	+	10	1025	c.935C>A	c.(934-936)gCt>gAt	p.A312D	SLC28A1_ENST00000537624.1_Missense_Mutation_p.A312D|SLC28A1_ENST00000538177.1_Missense_Mutation_p.A312D|SLC28A1_ENST00000537703.1_Missense_Mutation_p.A234D|SLC28A1_ENST00000537216.1_Missense_Mutation_p.A312D|SLC28A1_ENST00000394573.1_Missense_Mutation_p.A312D			O00337	S28A1_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 1	312					nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside transmembrane transporter activity (GO:0005337)|nucleoside:sodium symporter activity (GO:0005415)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	41			BRCA - Breast invasive adenocarcinoma(143;0.0587)		Gemcitabine(DB00441)|Stavudine(DB00649)|Zidovudine(DB00495)	CTGAGTGTGGCTGGAAACATC	0.542																																																0			15											112.0	90.0	97.0					15																	85464278		2203	4299	6502	83265282	SO:0001583	missense	9154			U62967	CCDS10334.1, CCDS10335.1, CCDS73777.1	15q25.3	2013-07-17	2013-07-17		ENSG00000156222	ENSG00000156222		"""Solute carriers"""	11001	protein-coding gene	gene with protein product		606207	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 1"""			9124315	Standard	NM_004213		Approved	CNT1	uc002blg.3	O00337	OTTHUMG00000148668	ENST00000286749.3:c.935C>A	15.37:g.85464278C>A	ENSP00000286749:p.Ala312Asp	Somatic		Capture	Illumina GAIIx	4	83265282	A0AV42|A8K7I2|O00335|O00336|Q5U5S6|Q5U648|Q9UEZ9	Missense_Mutation	SNP	HMMPfam_Nucleos_tra2_N,HMMPfam_Gate,HMMPfam_Nucleos_tra2_C	p.A312D	ENST00000286749.3	37	c.935	CCDS10334.1	15	.	.	.	.	.	.	.	.	.	.	C	24.1	4.493688	0.84962	.	.	ENSG00000156222	ENST00000537216;ENST00000538177;ENST00000537624;ENST00000286749;ENST00000394573;ENST00000537703	T;T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44;1.44	4.22	4.22	0.49857	Nucleoside recognition (1);	0.000000	0.85682	D	0.000000	T	0.68035	0.2957	H	0.97023	3.925	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;1.0;0.999;1.0	D;D;D;D;D	0.97110	1.0;0.995;0.999;0.996;1.0	T	0.80063	-0.1539	10	0.87932	D	0	-2.8682	14.1551	0.65413	0.0:1.0:0.0:0.0	.	312;312;312;234;312	B7Z533;F5H560;B7Z3L6;B7Z3M4;O00337	.;.;.;.;S28A1_HUMAN	D	312;312;312;312;312;234	ENSP00000440546:A312D;ENSP00000443752:A312D;ENSP00000444700:A312D;ENSP00000286749:A312D;ENSP00000378074:A312D;ENSP00000443764:A234D	ENSP00000286749:A312D	A	+	2	0	SLC28A1	83265282	1.000000	0.71417	0.994000	0.49952	0.991000	0.79684	5.325000	0.65869	2.195000	0.70347	0.655000	0.94253	GCT	-	HMMPfam_Gate		0.542	SLC28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC28A1	protein_coding	OTTHUMT00000308998.2	C			83265282	+1	no_errors	NM_004213	genbank	human	validated	54_36p	missense	SNP	0.999	A
AGBL1	123624	genome.wustl.edu	37	15	86813299	86813299	+	Splice_Site	SNP	G	G	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr15:86813299G>T	ENST00000441037.2	+	13	1944		c.e13+1		AGBL1_ENST00000389298.3_Splice_Site|AGBL1_ENST00000421325.2_Splice_Site	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1						C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						TTTAATTATGGTATGAACGCT	0.478																																																0			15											33.0	32.0	32.0					15																	86813299		1919	4136	6055	84614303	SO:0001630	splice_region_variant	123624			AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.1849+1G>T	15.37:g.86813299G>T		Somatic		Capture	Illumina GAIIx	4	84614303	A1A4X5|A6NJH6|C9JHL5	Splice_Site	SNP	-	e12+1	ENST00000441037.2	37	c.1849+1	CCDS58398.1	15	.	.	.	.	.	.	.	.	.	.	G	25.2	4.613349	0.87359	.	.	ENSG00000166748	ENST00000441037;ENST00000421325;ENST00000389298	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7157	0.91675	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AGBL1	84614303	1.000000	0.71417	0.996000	0.52242	0.937000	0.57800	9.663000	0.98605	2.663000	0.90544	0.561000	0.74099	.	-	-		0.478	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	AGBL1	protein_coding	OTTHUMT00000314929.5	G	NM_152336	Intron	84614303	+1	no_errors	NM_152336	genbank	human	validated	54_36p	splice_site	SNP	1.000	T
CLCA1	1179	genome.wustl.edu	37	1	86954814	86954814	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr1:86954814T>G	ENST00000234701.3	+	9	1669	c.1318T>G	c.(1318-1320)Tct>Gct	p.S440A	CLCA1_ENST00000394711.1_Missense_Mutation_p.S440A			A8K7I4	CLCA1_HUMAN	chloride channel accessory 1	440	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				calcium ion transport (GO:0006816)|cellular response to hypoxia (GO:0071456)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|zymogen granule membrane (GO:0042589)	chloride channel activity (GO:0005254)			NS(1)|breast(3)|endometrium(1)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		TTTGGGGCCCTCTGCAGCTCA	0.512																																																0			1											69.0	69.0	69.0					1																	86954814		2203	4300	6503	86727402	SO:0001583	missense	1179				CCDS709.1	1p22.3	2012-02-26	2009-01-29		ENSG00000016490	ENSG00000016490			2015	protein-coding gene	gene with protein product		603906	"""chloride channel, calcium activated, family member 1"", ""chloride channel regulator 1"""			9828122	Standard	NM_001285		Approved	CaCC, CLCRG1	uc001dlt.3	A8K7I4	OTTHUMG00000010254	ENST00000234701.3:c.1318T>G	1.37:g.86954814T>G	ENSP00000234701:p.Ser440Ala	Somatic		Capture	Illumina GAIIx	4	86727402	B2RAV5|O95151|Q5TDF4|Q9UNF6|Q9UPC6	Missense_Mutation	SNP	HMMPfam_CLCA_N,superfamily_vWA-like,HMMSmart_SM00327,HMMPfam_VWA,HMMPfam_DUF1973,PatternScan_ATPASE_GAMMA	p.S440A	ENST00000234701.3	37	c.1318	CCDS709.1	1	.	.	.	.	.	.	.	.	.	.	T	8.397	0.840959	0.16891	.	.	ENSG00000016490	ENST00000234701;ENST00000394711;ENST00000539889	T;T	0.15017	2.46;2.46	5.68	4.53	0.55603	von Willebrand factor, type A (3);	0.327053	0.29021	N	0.013390	T	0.04092	0.0114	L	0.36672	1.1	0.20563	N	0.999885	B;B	0.06786	0.001;0.001	B;B	0.20577	0.03;0.023	T	0.35574	-0.9783	10	0.37606	T	0.19	-16.22	3.3976	0.07311	0.1366:0.0732:0.1428:0.6474	.	440;203	A8K7I4;B4DUZ6	CLCA1_HUMAN;.	A	440;440;153	ENSP00000234701:S440A;ENSP00000378200:S440A	ENSP00000234701:S440A	S	+	1	0	CLCA1	86727402	0.000000	0.05858	0.987000	0.45799	0.149000	0.21700	0.297000	0.19101	0.936000	0.37367	0.533000	0.62120	TCT	-	superfamily_vWA-like,HMMSmart_SM00327,HMMPfam_VWA		0.512	CLCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCA1	protein_coding	OTTHUMT00000028277.1	T	NM_001285		86727402	+1	no_errors	NM_001285	genbank	human	reviewed	54_36p	missense	SNP	0.917	G
SH3GLB1	51100	genome.wustl.edu	37	1	87185210	87185210	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr1:87185210G>C	ENST00000370558.4	+	3	559	c.235G>C	c.(235-237)Gtt>Ctt	p.V79L	SH3GLB1_ENST00000482504.1_Missense_Mutation_p.V79L|SH3GLB1_ENST00000535010.1_5'UTR	NM_001206651.1|NM_001206653.1|NM_016009.4	NP_001193580.1|NP_001193582.1|NP_057093.1	Q9Y371	SHLB1_HUMAN	SH3-domain GRB2-like endophilin B1	79	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				'de novo' posttranslational protein folding (GO:0051084)|apoptotic process (GO:0006915)|phosphatidic acid biosynthetic process (GO:0006654)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrial outer membrane (GO:0005741)|protein complex (GO:0043234)	fatty acid binding (GO:0005504)|identical protein binding (GO:0042802)|lysophosphatidic acid acyltransferase activity (GO:0042171)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|stomach(1)	11		Lung NSC(277;0.209)		all cancers(265;0.0136)|Epithelial(280;0.0414)		AGAAGAATTTGTTTATGAGAA	0.373																																																0			1											58.0	62.0	60.0					1																	87185210		2203	4299	6502	86957798	SO:0001583	missense	51100			AF263293	CCDS710.1, CCDS55612.1, CCDS55613.1, CCDS72819.1	1p22.3	2012-04-17	2001-12-04		ENSG00000097033	ENSG00000097033		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	10833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 70"""	609287	"""SH3-domain, GRB2-like, endophilin B1"""			11161816, 11259440	Standard	NM_016009		Approved	CGI-61, KIAA0491, Bif-1, PPP1R70	uc001dly.3	Q9Y371	OTTHUMG00000010257	ENST00000370558.4:c.235G>C	1.37:g.87185210G>C	ENSP00000473267:p.Val79Leu	Somatic		Capture	Illumina GAIIx	4	86957798	B4E182|Q5H8U5|Q9H3Z0|Q9NR47|Q9NYA9	Missense_Mutation	SNP	HMMSmart_SM00721,HMMPfam_BAR,superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326	p.V79L	ENST00000370558.4	37	c.235	CCDS710.1	1	.	.	.	.	.	.	.	.	.	.	G	5.762	0.325002	0.10900	.	.	ENSG00000097033	ENST00000212369;ENST00000482504	T	0.64803	-0.12	5.95	5.95	0.96441	BAR (3);	0.112392	0.64402	D	0.000014	T	0.17789	0.0427	N	0.01576	-0.805	0.80722	D	1	B;B	0.12630	0.006;0.0	B;B	0.15052	0.012;0.006	T	0.30534	-0.9975	10	0.08381	T	0.77	.	16.6401	0.85069	0.0:0.0:0.8696:0.1303	.	79;79	Q9Y371-2;Q9Y371	.;SHLB1_HUMAN	L	79	ENSP00000418744:V79L	ENSP00000212369:V79L	V	+	1	0	SH3GLB1	86957798	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.672000	0.54583	2.817000	0.96982	0.563000	0.77884	GTT	-	HMMSmart_SM00721,HMMPfam_BAR		0.373	SH3GLB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3GLB1	protein_coding	OTTHUMT00000028287.2	G	NM_016009		86957798	+1	no_errors	NM_016009	genbank	human	validated	54_36p	missense	SNP	1.000	C
MFGE8	4240	genome.wustl.edu	37	15	89453070	89453070	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr15:89453070T>C	ENST00000566497.1	-	2	219	c.158A>G	c.(157-159)tAc>tGc	p.Y53C	MFGE8_ENST00000542878.1_Intron|MFGE8_ENST00000268151.7_Missense_Mutation_p.Y53C|MFGE8_ENST00000268150.8_Missense_Mutation_p.Y53C|MFGE8_ENST00000559997.1_Intron|MFGE8_ENST00000539437.1_Missense_Mutation_p.Y45C			Q08431	MFGM_HUMAN	milk fat globule-EGF factor 8 protein	53	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|phagocytosis, engulfment (GO:0006911)|phagocytosis, recognition (GO:0006910)|positive regulation of apoptotic cell clearance (GO:2000427)|single fertilization (GO:0007338)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|vesicle (GO:0031982)	phosphatidylethanolamine binding (GO:0008429)|phosphatidylserine binding (GO:0001786)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	22	Lung NSC(78;0.0392)|all_lung(78;0.077)					CGTGCAGGTGTACGAGGGGAA	0.547																																																0			15											183.0	144.0	157.0					15																	89453070		2200	4299	6499	87254074	SO:0001583	missense	4240			U58516	CCDS10347.1, CCDS45345.1	15q25	2009-03-25			ENSG00000140545	ENSG00000140545			7036	protein-coding gene	gene with protein product	"""sperm surface protein hP47"""	602281	"""sperm associated antigen 10"""	SPAG10		9027496, 19204935	Standard	NM_005928		Approved	SED1, EDIL1, BA46, OAcGD3S, HsT19888, MFG-E8, hP47	uc002bng.4	Q08431	OTTHUMG00000148682	ENST00000566497.1:c.158A>G	15.37:g.89453070T>C	ENSP00000456281:p.Tyr53Cys	Somatic		Capture	Illumina GAIIx	4	87254074	B2R6M7|Q53FU9|Q7Z3D2|Q9BTL9	Missense_Mutation	SNP	superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2,HMMSmart_SM00231,superfamily_Galactose-binding domain-like,HMMPfam_F5_F8_type_C,PatternScan_FA58C_1,PatternScan_FA58C_2	p.Y53C	ENST00000566497.1	37	c.158	CCDS10347.1	15	.	.	.	.	.	.	.	.	.	.	T	19.36	3.813169	0.70912	.	.	ENSG00000140545	ENST00000268150;ENST00000268151;ENST00000539437	D;D;D	0.95724	-3.79;-3.79;-3.79	5.39	5.39	0.77823	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.97620	0.9220	M	0.84082	2.675	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;0.997;1.0	D	0.98113	1.0421	10	0.59425	D	0.04	-43.6847	14.532	0.67934	0.0:0.0:0.0:1.0	.	45;45;53;53	B3KTQ2;F5H7N9;Q08431-3;Q08431	.;.;.;MFGM_HUMAN	C	53;53;45	ENSP00000268150:Y53C;ENSP00000268151:Y53C;ENSP00000442386:Y45C	ENSP00000268150:Y53C	Y	-	2	0	MFGE8	87254074	1.000000	0.71417	0.039000	0.18376	0.001000	0.01503	4.600000	0.61083	2.181000	0.69327	0.459000	0.35465	TAC	-	superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF		0.547	MFGE8-015	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	MFGE8	protein_coding	OTTHUMT00000432804.1	T	NM_005928		87254074	-1	no_errors	NM_005928	genbank	human	validated	54_36p	missense	SNP	0.970	C
SPG7	6687	genome.wustl.edu	37	16	89620251	89620251	+	Silent	SNP	G	G	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr16:89620251G>A	ENST00000268704.2	+	15	2001	c.1986G>A	c.(1984-1986)gtG>gtA	p.V662V		NM_003119.2	NP_003110.1	Q9UQ90	SPG7_HUMAN	spastic paraplegia 7 (pure and complicated autosomal recessive)	662					anterograde axon cargo transport (GO:0008089)|cell death (GO:0008219)|mitochondrion organization (GO:0007005)|nervous system development (GO:0007399)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|peptidase activity (GO:0008233)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|urinary_tract(1)	20		all_hematologic(23;0.00824)|Colorectal(91;0.102)		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)		ACTCCATGGTGAAGCAGTTTG	0.672																																																0			16											102.0	80.0	87.0					16																	89620251		2198	4300	6498	88147752	SO:0001819	synonymous_variant	6687			Y16610	CCDS10977.1, CCDS10978.1	16q24.3	2010-04-21	2007-04-23		ENSG00000197912	ENSG00000197912		"""ATPases / AAA-type"""	11237	protein-coding gene	gene with protein product	"""paraplegin"""	602783	"""cell matrix adhesion regulator"""	CMAR		9635427, 9634528	Standard	XM_006721264		Approved	CAR, SPG5C	uc002fnj.3	Q9UQ90	OTTHUMG00000138046	ENST00000268704.2:c.1986G>A	16.37:g.89620251G>A		Somatic		Capture	Illumina GAIIx	4	88147752	O75756|Q2TB70|Q58F00|Q96IB0	Silent	SNP	HMMPfam_FtsH_ext,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_AAA,HMMPfam_Peptidase_M41	p.V662	ENST00000268704.2	37	c.1986	CCDS10977.1	16																																																																																			-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Peptidase_M41		0.672	SPG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPG7	protein_coding	OTTHUMT00000269921.2	G	NM_003119		88147752	+1	no_errors	NM_003119	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
IGKV1-33	28933	genome.wustl.edu	37	2	89567844	89567844	+	RNA	SNP	A	A	G			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr2:89567844A>G	ENST00000473726.1	-	0	295									immunoglobulin kappa variable 1-33																		TCTGTCCCAGATCCACTTCCA	0.453																																																0			2											1.0	1.0	1.0					2																	89567844		743	1452	2195	89348959			0			M64856		2p11.2	2012-02-10			ENSG00000242076	ENSG00000242076		"""Immunoglobulins / IGK locus"""	5737	other	immunoglobulin gene							Standard	NG_000834		Approved	IGKV133, O18			OTTHUMG00000151682		2.37:g.89567844A>G		Somatic		Capture	Illumina GAIIx	4	89348959		Missense_Mutation	SNP	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00406	p.S89P	ENST00000473726.1	37	c.265		2																																																																																			-	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00406		0.453	IGKV1-33-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	ENSG00000211616	IG_V_gene	OTTHUMT00000323480.1	A	NG_000834		89348959	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390261	ensembl	human	known	54_36p	missense	SNP	0.999	G
GBP6	163351	genome.wustl.edu	37	1	89846078	89846078	+	Silent	SNP	A	A	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr1:89846078A>T	ENST00000370456.4	+	6	852	c.759A>T	c.(757-759)tcA>tcT	p.S253S	GBP6_ENST00000535065.1_Silent_p.S123S	NM_198460.2	NP_940862.2	Q6ZN66	GBP6_HUMAN	guanylate binding protein family, member 6	253	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.				cellular response to interferon-gamma (GO:0071346)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42		Lung NSC(277;0.0908)		all cancers(265;0.0108)|Epithelial(280;0.0398)		AGAAGGTGTCAGAAAAGCAAC	0.448																																																0			1											77.0	73.0	75.0					1																	89846078		2203	4300	6503	89618666	SO:0001819	synonymous_variant	163351			BX537949	CCDS723.1	1p22	2008-02-05			ENSG00000183347	ENSG00000183347			25395	protein-coding gene	gene with protein product		612467					Standard	NM_198460		Approved	DKFZp686G0786	uc001dnf.2	Q6ZN66	OTTHUMG00000010123	ENST00000370456.4:c.759A>T	1.37:g.89846078A>T		Somatic		Capture	Illumina GAIIx	4	89618666	A2RRM3|Q6ZN86|Q7Z3F0	Silent	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_GBP,HMMPfam_GBP_C,superfamily_Interferon-induced guanylate-binding protein 1 (GBP1) C-terminal domain	p.S253	ENST00000370456.4	37	c.759	CCDS723.1	1																																																																																			-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_GBP		0.448	GBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP6	protein_coding	OTTHUMT00000028001.1	A	NM_198460		89618666	+1	no_errors	NM_198460	genbank	human	validated	54_36p	silent	SNP	0.000	T
FAM13A	10144	genome.wustl.edu	37	4	89671577	89671577	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr4:89671577C>T	ENST00000264344.5	-	15	2145	c.1938G>A	c.(1936-1938)atG>atA	p.M646I	FAM13A_ENST00000513837.1_Missense_Mutation_p.M292I|FAM13A_ENST00000508369.1_Missense_Mutation_p.M320I|FAM13A_ENST00000503556.1_Missense_Mutation_p.M306I|FAM13A_ENST00000395002.2_Missense_Mutation_p.M320I|FAM13A_ENST00000511976.1_Missense_Mutation_p.M232I	NM_014883.3	NP_055698.2	O94988	FA13A_HUMAN	family with sequence similarity 13, member A	646					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	55						AAACATACCTCATGAAAGAAT	0.443																																																0			4											94.0	92.0	93.0					4																	89671577		2203	4300	6503	89890600	SO:0001583	missense	10144			AB020721	CCDS34029.1, CCDS43251.1, CCDS58911.1, CCDS58912.1, CCDS58913.1	4q22.1	2011-09-07	2009-01-20	2009-01-20	ENSG00000138640	ENSG00000138640		"""Rho GTPase activating proteins"""	19367	protein-coding gene	gene with protein product		613299	"""family with sequence similarity 13, member A1"""	FAM13A1			Standard	NM_014883		Approved	KIAA0914, ARHGAP48	uc003hse.2	O94988	OTTHUMG00000161006	ENST00000264344.5:c.1938G>A	4.37:g.89671577C>T	ENSP00000264344:p.Met646Ile	Somatic		Capture	Illumina GAIIx	4	89890600	B4DLC1|Q24JP0|Q5PR21|Q8NBA3	Missense_Mutation	SNP	superfamily_Rho_GAP,HMMSmart_RhoGAP,HMMPfam_RhoGAP	p.M646I	ENST00000264344.5	37	c.1938	CCDS34029.1	4	.	.	.	.	.	.	.	.	.	.	C	14.82	2.649400	0.47362	.	.	ENSG00000138640	ENST00000395002;ENST00000264344;ENST00000503556;ENST00000511976;ENST00000508369;ENST00000513837	T;T;T;T;T;T	0.44083	0.93;2.2;1.51;1.52;1.51;1.51	5.64	5.64	0.86602	.	0.132972	0.64402	D	0.000001	T	0.39306	0.1073	L	0.40543	1.245	0.80722	D	1	B;B;B;B;B;B;B	0.26483	0.008;0.008;0.008;0.15;0.008;0.008;0.01	B;B;B;B;B;B;B	0.19946	0.006;0.006;0.006;0.027;0.006;0.006;0.005	T	0.15636	-1.0430	10	0.54805	T	0.06	.	19.8946	0.96949	0.0:1.0:0.0:0.0	.	292;325;232;646;320;306;320	O94988-6;E7ENS3;E9PGM7;O94988;O94988-3;O94988-5;O94988-1	.;.;.;FA13A_HUMAN;.;.;.	I	320;646;306;232;320;292	ENSP00000378450:M320I;ENSP00000264344:M646I;ENSP00000427189:M306I;ENSP00000421914:M232I;ENSP00000421562:M320I;ENSP00000423252:M292I	ENSP00000264344:M646I	M	-	3	0	FAM13A	89890600	1.000000	0.71417	1.000000	0.80357	0.356000	0.29392	5.802000	0.69122	2.937000	0.99478	0.650000	0.86243	ATG	-	NULL		0.443	FAM13A-022	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM13A	protein_coding	OTTHUMT00000363371.1	C			89890600	-1	no_errors	NM_014883	genbank	human	validated	54_36p	missense	SNP	1.000	T
GPR98	84059	genome.wustl.edu	37	5	89925251	89925251	+	Silent	SNP	A	A	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr5:89925251A>T	ENST00000405460.2	+	9	1830	c.1734A>T	c.(1732-1734)tcA>tcT	p.S578S		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	578					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TAAATATATCAAGGAGAAATG	0.388																																																0			5											81.0	77.0	78.0					5																	89925251		1855	4089	5944	89961007	SO:0001819	synonymous_variant	84059			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.1734A>T	5.37:g.89925251A>T		Somatic		Capture	Illumina GAIIx	4	89961007	O75171|Q8TF58|Q9H0X5|Q9UL61	Silent	SNP	HMMSmart_SM00237,HMMPfam_Calx-beta,superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_EPTP,PatternScan_A_DEAMINASE,PatternScan_LIPOYL,HMMPfam_GPS	p.S578	ENST00000405460.2	37	c.1734	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	A	4.692	0.128680	0.08981	.	.	ENSG00000164199	ENST00000504142	.	.	.	5.52	-3.1	0.05315	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.5148	0.00601	0.2301:0.1521:0.2449:0.3729	.	.	.	.	X	167	.	.	K	+	1	0	GPR98	89961007	0.988000	0.35896	0.624000	0.29186	0.433000	0.31745	0.255000	0.18333	-0.483000	0.06772	-0.909000	0.02823	AAG	-	NULL		0.388	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	protein_coding	OTTHUMT00000369993.2	A	NM_032119		89961007	+1	no_errors	NM_032119	genbank	human	reviewed	54_36p	silent	SNP	0.102	T
GPC5	2262	genome.wustl.edu	37	13	92101130	92101130	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr13:92101130C>A	ENST00000377067.3	+	2	651	c.279C>A	c.(277-279)agC>agA	p.S93R		NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	93					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				AAACGTCCAGCTCTACATTAA	0.433																																																0			13											126.0	116.0	119.0					13																	92101130		2203	4300	6503	90899131	SO:0001583	missense	2262			AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.279C>A	13.37:g.92101130C>A	ENSP00000366267:p.Ser93Arg	Somatic		Capture	Illumina GAIIx	4	90899131	B2R726|O60436|Q9BX27	Missense_Mutation	SNP	HMMPfam_Glypican,PatternScan_GLYPICAN	p.S93R	ENST00000377067.3	37	c.279	CCDS9468.1	13	.	.	.	.	.	.	.	.	.	.	C	14.64	2.595312	0.46318	.	.	ENSG00000179399	ENST00000377067	T	0.56611	0.45	5.5	2.43	0.29744	.	0.041479	0.85682	D	0.000000	T	0.67401	0.2889	M	0.79926	2.475	0.36718	D	0.881022	D	0.89917	1.0	D	0.79108	0.992	T	0.70831	-0.4765	10	0.87932	D	0	.	5.2984	0.15764	0.0:0.4771:0.0:0.5229	.	93	P78333	GPC5_HUMAN	R	93	ENSP00000366267:S93R	ENSP00000366267:S93R	S	+	3	2	GPC5	90899131	1.000000	0.71417	0.993000	0.49108	0.277000	0.26821	0.883000	0.28200	0.697000	0.31718	-0.373000	0.07131	AGC	-	HMMPfam_Glypican		0.433	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC5	protein_coding	OTTHUMT00000045454.1	C	NM_004466		90899131	+1	no_errors	NM_004466	genbank	human	reviewed	54_36p	missense	SNP	0.992	A
OGN	4969	genome.wustl.edu	37	9	95155465	95155465	+	Silent	SNP	G	G	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr9:95155465G>A	ENST00000262551.4	-	4	750	c.330C>T	c.(328-330)gaC>gaT	p.D110D	OGN_ENST00000468743.1_5'Flank|CENPP_ENST00000375587.3_Intron|OGN_ENST00000375561.5_Silent_p.D110D	NM_033014.2	NP_148935.1	P20774	MIME_HUMAN	osteoglycin	110					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|negative regulation of smooth muscle cell proliferation (GO:0048662)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)		p.D110D(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	13						CAGCATCAATGTCAACTTCTT	0.373																																																1	Substitution - coding silent(1)	central_nervous_system(1)	9											137.0	122.0	127.0					9																	95155465		2203	4300	6503	94195286	SO:0001819	synonymous_variant	4969			AI424992	CCDS6695.1	9q22	2008-02-05	2007-02-16		ENSG00000106809	ENSG00000106809		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	8126	protein-coding gene	gene with protein product	"""mimecan proteoglycan"""	602383	"""osteoglycin (osteoinductive factor)"""			2372374	Standard	NM_033014		Approved	mimecan, OIF, SLRR3A	uc004asa.3	P20774	OTTHUMG00000020224	ENST00000262551.4:c.330C>T	9.37:g.95155465G>A		Somatic		Capture	Illumina GAIIx	4	94195286	Q6FIB0|Q9UF90|Q9UNK5	Silent	SNP	superfamily_L domain-like,HMMSmart_SM00369,HMMPfam_LRR_1	p.D110	ENST00000262551.4	37	c.330	CCDS6695.1	9																																																																																			-	superfamily_L domain-like		0.373	OGN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	OGN	protein_coding	OTTHUMT00000053087.1	G	NM_024416		94195286	-1	no_errors	NM_014057	genbank	human	reviewed	54_36p	silent	SNP	0.672	A
TCL1A	8115	genome.wustl.edu	37	14	96178659	96178659	+	Silent	SNP	G	G	T	rs200758121		TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr14:96178659G>T	ENST00000402399.1	-	2	324	c.195C>A	c.(193-195)acC>acA	p.T65T	TCL1A_ENST00000556450.1_Silent_p.T65T|TCL1A_ENST00000555202.1_Silent_p.T65T|RP11-164H13.1_ENST00000547644.2_RNA|RP11-164H13.1_ENST00000553445.1_RNA|TCL1A_ENST00000554012.1_Silent_p.T65T	NM_021966.2	NP_068801.1	P56279	TCL1A_HUMAN	T-cell leukemia/lymphoma 1A	65					multicellular organismal development (GO:0007275)|stem cell maintenance (GO:0019827)	cell cortex (GO:0005938)|endoplasmic reticulum (GO:0005783)|pronucleus (GO:0045120)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(5)|prostate(1)|skin(1)	12		all_cancers(154;0.103)		COAD - Colon adenocarcinoma(157;0.205)|Epithelial(152;0.248)		GGCCTATCTGGGTGGGGGTCA	0.547			T	TRA@	T-CLL																																Ovarian(96;1068 2019 35393 39316)		Dom	yes		14	14q32.1	8115	T-cell leukemia/lymphoma 1A		L	0			14											102.0	102.0	102.0					14																	96178659		2203	4300	6503	95248412	SO:0001819	synonymous_variant	8115			X82240	CCDS9941.1	14q32.1	2008-07-03				ENSG00000100721			11648	protein-coding gene	gene with protein product		186960				2783489, 7809072	Standard	NM_021966		Approved	TCL1	uc001yfb.4	P56279		ENST00000402399.1:c.195C>A	14.37:g.96178659G>T		Somatic		Capture	Illumina GAIIx	4	95248412	Q6IBK7	Silent	SNP	HMMPfam_TCL1_MTCP1,superfamily_TCL1_MTCP1	p.T65	ENST00000402399.1	37	c.195	CCDS9941.1	14	.	.	.	.	.	.	.	.	.	.	G	4.449	0.083168	0.08533	.	.	ENSG00000100721	ENST00000557043	.	.	.	3.61	0.728	0.18260	.	.	.	.	.	T	0.25044	0.0608	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24764	-1.0151	4	.	.	.	-7.2674	5.462	0.16622	0.3808:0.0:0.6192:0.0	.	.	.	.	T	40	.	.	P	-	1	0	TCL1A	95248412	0.019000	0.18553	0.036000	0.18154	0.016000	0.09150	-0.076000	0.11412	0.152000	0.19188	0.462000	0.41574	CCA	-	HMMPfam_TCL1_MTCP1,superfamily_TCL1_MTCP1		0.547	TCL1A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TCL1A	protein_coding	OTTHUMT00000413246.1	G			95248412	-1	no_errors	NM_001098725	genbank	human	validated	54_36p	silent	SNP	0.131	T
LRRC28	123355	genome.wustl.edu	37	15	99903409	99903409	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr15:99903409A>G	ENST00000301981.3	+	9	1210	c.970A>G	c.(970-972)Acc>Gcc	p.T324A	LRRC28_ENST00000442993.2_3'UTR|LRRC28_ENST00000447360.2_Intron|LRRC28_ENST00000558879.1_Intron|LRRC28_ENST00000331450.5_Intron|LRRC28_ENST00000422500.2_Missense_Mutation_p.T255A	NM_144598.2	NP_653199.2	Q86X40	LRC28_HUMAN	leucine rich repeat containing 28	324										endometrium(2)|large_intestine(3)|lung(6)|prostate(1)	12	Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00106)			GCCTATGTTTACCATCGTCTA	0.527																																																0			15											116.0	100.0	105.0					15																	99903409		2197	4297	6494	97720932	SO:0001583	missense	123355			AK091588	CCDS10380.1, CCDS66873.1	15q26.3	2004-06-29			ENSG00000168904	ENSG00000168904			28355	protein-coding gene	gene with protein product						12975309	Standard	XM_005254861		Approved	MGC24976, FLJ34269, FLJ45242	uc002bva.1	Q86X40	OTTHUMG00000149854	ENST00000301981.3:c.970A>G	15.37:g.99903409A>G	ENSP00000304923:p.Thr324Ala	Somatic		Capture	Illumina GAIIx	4	97720932	A8KA22|Q6UY49|Q6ZSS6	Missense_Mutation	SNP	superfamily_L domain-like,HMMSmart_SM00364,HMMSmart_SM00369,HMMPfam_LRR_1	p.T324A	ENST00000301981.3	37	c.970	CCDS10380.1	15	.	.	.	.	.	.	.	.	.	.	A	29.1	4.980361	0.92982	.	.	ENSG00000168904	ENST00000301981;ENST00000422500	T;T	0.51817	0.69;1.04	5.76	5.76	0.90799	.	0.044863	0.85682	D	0.000000	T	0.65523	0.2699	M	0.61703	1.905	0.80722	D	1	D;P	0.64830	0.994;0.533	D;B	0.70716	0.97;0.185	T	0.66372	-0.5940	10	0.51188	T	0.08	.	15.2508	0.73545	1.0:0.0:0.0:0.0	.	255;324	B4DHL3;Q86X40	.;LRC28_HUMAN	A	324;255	ENSP00000304923:T324A;ENSP00000398606:T255A	ENSP00000304923:T324A	T	+	1	0	LRRC28	97720932	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.785000	0.91822	2.194000	0.70268	0.528000	0.53228	ACC	-	NULL		0.527	LRRC28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC28	protein_coding	OTTHUMT00000313546.1	A	NM_144598		97720932	+1	no_errors	NM_144598	genbank	human	provisional	54_36p	missense	SNP	1.000	G
TRRAP	8295	genome.wustl.edu	37	7	98567880	98567880	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr7:98567880C>G	ENST00000359863.4	+	51	7846	c.7637C>G	c.(7636-7638)cCc>cGc	p.P2546R	TRRAP_ENST00000446306.3_Missense_Mutation_p.P2528R|TRRAP_ENST00000355540.3_Missense_Mutation_p.P2528R	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	2546					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			AAGCAGGAGCCCCGGGAGCGG	0.642																																																0			7											71.0	71.0	71.0					7																	98567880		2203	4300	6503	98405816	SO:0001583	missense	8295			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.7637C>G	7.37:g.98567880C>G	ENSP00000352925:p.Pro2546Arg	Somatic		Capture	Illumina GAIIx	4	98405816	A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	superfamily_ARM repeat,PatternScan_COPPER_BLUE,superfamily_Protein prenylyltransferase,HMMPfam_FAT,superfamily_TPR-like,superfamily_Protein kinase-like (PK-like),HMMPfam_PI3_PI4_kinase,HMMSmart_SM00146,HMMPfam_FATC	p.P2528R	ENST00000359863.4	37	c.7583	CCDS59066.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.12|19.12	3.765397|3.765397	0.69878|0.69878	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000456197|ENST00000359863;ENST00000355540;ENST00000446306	T|T;T	0.02974|0.03065	4.09|4.07;4.06	5.85|5.85	5.85|5.85	0.93711|0.93711	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.07908|0.07908	0.0198|0.0198	L|L	0.59436|0.59436	1.845|1.845	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.33583	.|0.418;0.138;0.346	.|B;B;B	.|0.33521	.|0.165;0.074;0.059	T|T	0.06075|0.06075	-1.0847|-1.0847	8|10	0.48119|0.72032	T|D	0.1|0.01	.|.	20.1634|20.1634	0.98142|0.98142	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|2528;2267;2546	.|Q9Y4A5-2;Q59FH1;Q9Y4A5	.|.;.;TRRAP_HUMAN	A|R	2268|2546;2528;2527	ENSP00000394645:P2268A|ENSP00000352925:P2546R;ENSP00000347733:P2528R	ENSP00000394645:P2268A|ENSP00000347733:P2528R	P|P	+|+	1|2	0|0	TRRAP|TRRAP	98405816|98405816	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.942000|0.942000	0.58702|0.58702	6.074000|6.074000	0.71253|0.71253	2.773000|2.773000	0.95371|0.95371	0.655000|0.655000	0.94253|0.94253	CCC|CCC	-	superfamily_ARM repeat		0.642	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	protein_coding	OTTHUMT00000317978.1	C	NM_003496		98405816	+1	no_errors	NM_003496	genbank	human	validated	54_36p	missense	SNP	0.984	G
HIAT1	64645	genome.wustl.edu	37	1	100534077	100534077	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr1:100534077A>T	ENST00000370152.3	+	7	890	c.754A>T	c.(754-756)Aca>Tca	p.T252S	RP4-714D9.2_ENST00000432294.1_RNA	NM_033055.2	NP_149044.2	Q96MC6	HIAT1_HUMAN	hippocampus abundant transcript 1	252					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(8)|skin(1)	16		all_epithelial(167;2.96e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0832)|all cancers(265;0.136)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)		GATCTGCATTACAGTGTTTCT	0.393																																																0			1											162.0	157.0	159.0					1																	100534077		2203	4300	6503	100306665	SO:0001583	missense	64645			AK096669	CCDS763.1	1p21.3	2008-02-05			ENSG00000156875	ENSG00000156875			23363	protein-coding gene	gene with protein product						9299464	Standard	NM_033055		Approved	DKFZP564L0864	uc001dst.3	Q96MC6	OTTHUMG00000010755	ENST00000370152.3:c.754A>T	1.37:g.100534077A>T	ENSP00000359171:p.Thr252Ser	Somatic		Capture	Illumina GAIIx	4	100306665	Q6P2N7|Q8N8K2|Q8NBV3|Q96NY0|Q9NT25	Missense_Mutation	SNP	superfamily_MFS_gen_substrate_transporter,HMMPfam_MFS_1,PatternScan_SUGAR_TRANSPORT_1	p.T252S	ENST00000370152.3	37	c.754	CCDS763.1	1	.	.	.	.	.	.	.	.	.	.	A	20.1	3.937894	0.73557	.	.	ENSG00000156875	ENST00000370152	T	0.57752	0.38	5.93	5.93	0.95920	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.62829	0.2460	M	0.85630	2.765	0.80722	D	1	P	0.47910	0.902	P	0.56163	0.793	T	0.63305	-0.6667	10	0.25106	T	0.35	-30.0086	16.3797	0.83452	1.0:0.0:0.0:0.0	.	252	Q96MC6	HIAT1_HUMAN	S	252	ENSP00000359171:T252S	ENSP00000359171:T252S	T	+	1	0	HIAT1	100306665	1.000000	0.71417	0.930000	0.37139	0.251000	0.25915	9.339000	0.96797	2.271000	0.75665	0.533000	0.62120	ACA	-	superfamily_MFS_gen_substrate_transporter,HMMPfam_MFS_1		0.393	HIAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIAT1	protein_coding	OTTHUMT00000029657.1	A	NM_033055		100306665	+1	no_errors	NM_033055	genbank	human	validated	54_36p	missense	SNP	1.000	T
DRP2	1821	genome.wustl.edu	37	X	100506033	100506033	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chrX:100506033A>G	ENST00000395209.3	+	16	2353	c.1826A>G	c.(1825-1827)aAg>aGg	p.K609R	DRP2_ENST00000402866.1_Missense_Mutation_p.K609R|DRP2_ENST00000538510.1_Missense_Mutation_p.K609R|DRP2_ENST00000541709.1_Missense_Mutation_p.K531R	NM_001939.2	NP_001930.2	Q13474	DRP2_HUMAN	dystrophin related protein 2	609					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	31						CATCAGACCAAGTGCTCTATC	0.498																																																0			X											153.0	126.0	135.0					X																	100506033		2203	4300	6503	100392689	SO:0001583	missense	1821			U43519	CCDS14480.2, CCDS55465.1	Xq22	2008-02-05			ENSG00000102385	ENSG00000102385			3032	protein-coding gene	gene with protein product		300052				8640231	Standard	NM_001939		Approved		uc004egz.2	Q13474	OTTHUMG00000022020	ENST00000395209.3:c.1826A>G	X.37:g.100506033A>G	ENSP00000378635:p.Lys609Arg	Somatic		Capture	Illumina GAIIx	4	100392689	A6ZKI5|A8K1B0|B1B1F3|B4DIZ0	Missense_Mutation	SNP	HMMSmart_SPEC,superfamily_Spectrin,HMMPfam_Spectrin,superfamily_WW_Rsp5_WWP,HMMSmart_WW,HMMPfam_WW,PatternScan_WW_DOMAIN_1,superfamily_SSF47473,HMMPfam_efhand_1,HMMPfam_efhand_2,HMMPfam_ZZ,HMMSmart_ZnF_ZZ,PatternScan_ZF_ZZ_1	p.K609R	ENST00000395209.3	37	c.1826	CCDS14480.2	X	.	.	.	.	.	.	.	.	.	.	A	20.9	4.064585	0.76187	.	.	ENSG00000102385	ENST00000402866;ENST00000395209;ENST00000541709;ENST00000538510	D;D;D;D	0.92099	-2.97;-2.97;-2.97;-2.97	6.06	6.06	0.98353	Zinc finger, ZZ-type (3);	0.052902	0.64402	D	0.000001	D	0.93812	0.8021	L	0.35644	1.08	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.94462	0.7677	10	0.66056	D	0.02	-23.6056	15.4998	0.75687	1.0:0.0:0.0:0.0	.	609	Q13474	DRP2_HUMAN	R	609;609;531;609	ENSP00000385038:K609R;ENSP00000378635:K609R;ENSP00000444752:K531R;ENSP00000441051:K609R	ENSP00000378635:K609R	K	+	2	0	DRP2	100392689	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.219000	0.78000	2.044000	0.60594	0.486000	0.48141	AAG	-	HMMPfam_ZZ,HMMSmart_ZnF_ZZ		0.498	DRP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DRP2	protein_coding	OTTHUMT00000057522.3	A	NM_001939		100392689	+1	no_errors	NM_001939	genbank	human	validated	54_36p	missense	SNP	1.000	G
TMEM263	90488	genome.wustl.edu	37	12	107365122	107365122	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr12:107365122G>T	ENST00000280756.4	+	4	722	c.304G>T	c.(304-306)Gta>Tta	p.V102L	C12orf23_ENST00000547081.1_Missense_Mutation_p.V102L|C12orf23_ENST00000548125.1_Missense_Mutation_p.V102L|C12orf23_ENST00000550344.1_Missense_Mutation_p.V102L|C12orf23_ENST00000547242.1_Missense_Mutation_p.V102L|C12orf23_ENST00000551813.1_Missense_Mutation_p.V102L	NM_152261.2	NP_689474.1	Q8WUH6	TM263_HUMAN		102						integral component of membrane (GO:0016021)				endometrium(1)|lung(2)	3						GTCTGCTGTTGTAAACAAAGT	0.468																																																0			12											111.0	94.0	100.0					12																	107365122		2203	4300	6503	105889252	SO:0001583	missense	90488																														ENST00000280756.4:c.304G>T	12.37:g.107365122G>T	ENSP00000280756:p.Val102Leu	Somatic		Capture	Illumina GAIIx	4	105889252	B3KMN9	Missense_Mutation	SNP	NULL	p.V102L	ENST00000280756.4	37	c.304	CCDS9110.1	12	.	.	.	.	.	.	.	.	.	.	G	14.99	2.701783	0.48307	.	.	ENSG00000151135	ENST00000548125;ENST00000280756;ENST00000547242;ENST00000550344;ENST00000547081;ENST00000551813	.	.	.	6.03	6.03	0.97812	.	0.115681	0.64402	D	0.000016	T	0.52224	0.1721	L	0.29908	0.895	0.43540	D	0.995832	B	0.14438	0.01	B	0.10450	0.005	T	0.47971	-0.9075	9	0.62326	D	0.03	-0.1861	14.4568	0.67420	0.0:0.0:0.8534:0.1466	.	102	Q8WUH6	CL023_HUMAN	L	102	.	ENSP00000280756:V102L	V	+	1	0	C12orf23	105889252	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.954000	0.56708	2.854000	0.98071	0.655000	0.94253	GTA	-	NULL		0.468	C12orf23-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C12orf23	protein_coding	OTTHUMT00000406857.1	G			105889252	+1	no_errors	NM_152261	genbank	human	validated	54_36p	missense	SNP	1.000	T
COL4A5	1287	genome.wustl.edu	37	X	107783015	107783015	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chrX:107783015A>C	ENST00000361603.2	+	2	365	c.121A>C	c.(121-123)Agt>Cgt	p.S41R	COL4A5_ENST00000328300.6_Missense_Mutation_p.S41R	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	41	Nonhelical region (NC2).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						GTGTGACTGCAGTGGCATAAA	0.343									Alport syndrome with Diffuse Leiomyomatosis																																							0			X											149.0	134.0	139.0					X																	107783015		2203	4300	6503	107669671	SO:0001583	missense	1287	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.121A>C	X.37:g.107783015A>C	ENSP00000354505:p.Ser41Arg	Somatic		Capture	Illumina GAIIx	4	107669671	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	HMMPfam_Collagen,superfamily_C-type_lectin_fold,HMMPfam_C4,HMMSmart_C4	p.S41R	ENST00000361603.2	37	c.121	CCDS14543.1	X	.	.	.	.	.	.	.	.	.	.	A	13.13	2.144187	0.37825	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.93189	-3.18;-3.18	4.98	2.4	0.29515	.	0.275476	0.39407	N	0.001364	D	0.84424	0.5469	N	0.16862	0.45	0.40227	D	0.977808	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.72381	-0.4311	10	0.22706	T	0.39	.	8.4791	0.33032	0.6182:0.3818:0.0:0.0	.	41;41	E7EVY4;P29400	.;CO4A5_HUMAN	R	41	ENSP00000331902:S41R;ENSP00000354505:S41R	ENSP00000331902:S41R	S	+	1	0	COL4A5	107669671	0.995000	0.38212	0.623000	0.29173	0.987000	0.75469	1.606000	0.36826	0.148000	0.19059	0.481000	0.45027	AGT	-	NULL		0.343	COL4A5-001	KNOWN	basic|CCDS	protein_coding	COL4A5	protein_coding	OTTHUMT00000057880.2	A			107669671	+1	no_errors	NM_033380	genbank	human	reviewed	54_36p	missense	SNP	0.987	C
RGAG1	57529	genome.wustl.edu	37	X	109697238	109697238	+	Silent	SNP	G	G	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chrX:109697238G>A	ENST00000465301.2	+	3	3639	c.3393G>A	c.(3391-3393)gcG>gcA	p.A1131A	RGAG1_ENST00000540313.1_Silent_p.A1131A	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	1131										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						CTGAAACTGCGAAACCACCAC	0.542																																																0			X											175.0	156.0	162.0					X																	109697238		2203	4300	6503	109583894	SO:0001819	synonymous_variant	57529			AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.3393G>A	X.37:g.109697238G>A		Somatic		Capture	Illumina GAIIx	4	109583894	Q9P2M8	Silent	SNP	HMMPfam_Retrotrans_gag	p.A1131	ENST00000465301.2	37	c.3393	CCDS14552.1	X																																																																																			-	NULL		0.542	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGAG1	protein_coding	OTTHUMT00000057906.2	G	NM_020769		109583894	+1	no_errors	NM_020769	genbank	human	provisional	54_36p	silent	SNP	0.001	A
PKHD1L1	93035	genome.wustl.edu	37	8	110457211	110457211	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr8:110457211G>C	ENST00000378402.5	+	38	5217	c.5113G>C	c.(5113-5115)Gtg>Ctg	p.V1705L		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1705	IPT/TIG 9.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AGTTCTATCAGTGAATTATAC	0.453										HNSCC(38;0.096)																																						0			8											190.0	181.0	184.0					8																	110457211		1877	4117	5994	110526387	SO:0001583	missense	93035			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.5113G>C	8.37:g.110457211G>C	ENSP00000367655:p.Val1705Leu	Somatic		Capture	Illumina GAIIx	4	110526387	Q567P2|Q9UF27	Missense_Mutation	SNP	superfamily_E set domains,HMMSmart_SM00429,HMMPfam_TIG,HMMSmart_SM00758,superfamily_Anthrax protective antigen,HMMSmart_SM00710,superfamily_Cupredoxins,HMMPfam_G8,superfamily_Pectin lyase-like	p.V1705L	ENST00000378402.5	37	c.5113	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	G	14.37	2.514085	0.44763	.	.	ENSG00000205038	ENST00000378402	T	0.78126	-1.15	6.17	4.39	0.52855	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.637189	0.15664	N	0.250750	T	0.78729	0.4329	L	0.45422	1.42	0.21527	N	0.999659	D	0.56287	0.975	P	0.57548	0.823	T	0.66044	-0.6021	10	0.17369	T	0.5	.	11.1352	0.48370	0.1491:0.0:0.8509:0.0	.	1705	Q86WI1	PKHL1_HUMAN	L	1705	ENSP00000367655:V1705L	ENSP00000367655:V1705L	V	+	1	0	PKHD1L1	110526387	0.974000	0.33945	0.718000	0.30602	0.273000	0.26683	1.657000	0.37366	0.933000	0.37291	0.655000	0.94253	GTG	-	HMMSmart_SM00429,superfamily_E set domains,HMMPfam_TIG		0.453	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	protein_coding	OTTHUMT00000381017.1	G	NM_177531		110526387	+1	no_errors	NM_177531	genbank	human	validated	54_36p	missense	SNP	0.837	C
TTC12	54970	genome.wustl.edu	37	11	113220879	113220879	+	Silent	SNP	G	G	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr11:113220879G>T	ENST00000529221.1	+	14	1344	c.1239G>T	c.(1237-1239)ctG>ctT	p.L413L	TTC12_ENST00000478125.1_3'UTR|TTC12_ENST00000483239.2_Silent_p.L419L|TTC12_ENST00000314756.3_Silent_p.L413L|TTC12_ENST00000393020.1_Silent_p.L413L	NM_017868.3	NP_060338.3	Q9H892	TTC12_HUMAN	tetratricopeptide repeat domain 12	413										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		all_cancers(61;2.73e-16)|all_epithelial(67;8.64e-10)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.183)|Renal(330;0.187)		BRCA - Breast invasive adenocarcinoma(274;5.3e-06)|Epithelial(105;8.37e-05)|all cancers(92;0.000694)		ACTTGGCTCTGGAAGAAAGGT	0.373																																																0			11											123.0	122.0	122.0					11																	113220879		2201	4296	6497	112726089	SO:0001819	synonymous_variant	54970			AK000542	CCDS8360.2	11q23.2	2013-01-10			ENSG00000149292	ENSG00000149292		"""Tetratricopeptide (TTC) repeat domain containing"""	23700	protein-coding gene	gene with protein product		610732				12964006	Standard	XM_005271607		Approved	FLJ13859, FLJ20535, TPARM	uc001pnu.3	Q9H892	OTTHUMG00000142832	ENST00000529221.1:c.1239G>T	11.37:g.113220879G>T		Somatic		Capture	Illumina GAIIx	4	112726089	Q8N5H9|Q9NWY3	Silent	SNP	superfamily_ARM-type_fold,HMMPfam_TPR_1,HMMSmart_TPR,superfamily_SSF48452,PatternScan_CPSASE_2	p.L413	ENST00000529221.1	37	c.1239	CCDS8360.2	11																																																																																			-	superfamily_ARM-type_fold		0.373	TTC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC12	protein_coding	OTTHUMT00000286455.2	G	NM_017868		112726089	+1	no_errors	NM_017868	genbank	human	validated	54_36p	silent	SNP	0.999	T
PPP1R3A	5506	genome.wustl.edu	37	7	113558852	113558852	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr7:113558852G>T	ENST00000284601.3	-	1	268	c.200C>A	c.(199-201)gCt>gAt	p.A67D		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	67					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						AAAGGAATCAGCAAATGAAAC	0.423																																																0			7											88.0	81.0	83.0					7																	113558852		2203	4300	6503	113346088	SO:0001583	missense	5506			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.200C>A	7.37:g.113558852G>T	ENSP00000284601:p.Ala67Asp	Somatic		Capture	Illumina GAIIx	4	113346088	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	HMMPfam_CBM_21	p.A67D	ENST00000284601.3	37	c.200	CCDS5759.1	7	.	.	.	.	.	.	.	.	.	.	G	23.8	4.455118	0.84209	.	.	ENSG00000154415	ENST00000284601	T	0.49432	0.78	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.72676	0.3490	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72978	-0.4127	10	0.87932	D	0	-0.0927	20.8794	0.99867	0.0:0.0:1.0:0.0	.	67	Q16821	PPR3A_HUMAN	D	67	ENSP00000284601:A67D	ENSP00000284601:A67D	A	-	2	0	PPP1R3A	113346088	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.229000	0.95273	2.941000	0.99782	0.655000	0.94253	GCT	-	NULL		0.423	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3A	protein_coding	OTTHUMT00000346724.1	G	NM_002711		113346088	-1	no_errors	NM_002711	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
LRCH2	57631	genome.wustl.edu	37	X	114418981	114418981	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chrX:114418981A>C	ENST00000317135.8	-	3	644	c.614T>G	c.(613-615)aTg>aGg	p.M205R	LRCH2_ENST00000538422.1_Missense_Mutation_p.M205R	NM_020871.3	NP_065922.3	Q5VUJ6	LRCH2_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 2	205										breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	19						CACCAATTCCATTAAATCTTT	0.279																																																0			X											45.0	42.0	42.0					X																	114418981		1789	4058	5847	114325237	SO:0001583	missense	57631			AB040928	CCDS48155.1, CCDS59175.1	Xq24	2008-02-05			ENSG00000130224	ENSG00000130224			29292	protein-coding gene	gene with protein product						10819331	Standard	NM_020871		Approved	KIAA1495	uc010nqe.3	Q5VUJ6	OTTHUMG00000022233	ENST00000317135.8:c.614T>G	X.37:g.114418981A>C	ENSP00000325091:p.Met205Arg	Somatic		Capture	Illumina GAIIx	4	114325237	F5H2T1|Q08AD5|Q9HA88|Q9P233	Missense_Mutation	SNP	superfamily_SSF52058,HMMPfam_LRR_1,HMMSmart_LRR_TYP,superfamily_Calponin-homology,HMMPfam_CH,HMMSmart_CH	p.M205R	ENST00000317135.8	37	c.614	CCDS48155.1	X	.	.	.	.	.	.	.	.	.	.	A	14.84	2.654425	0.47467	.	.	ENSG00000130224	ENST00000317135;ENST00000538422	T;T	0.55413	0.52;0.52	5.66	5.66	0.87406	.	0.084614	0.85682	D	0.000000	T	0.41396	0.1157	N	0.00996	-1.065	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.85130	0.99;0.997	T	0.53975	-0.8362	10	0.14252	T	0.57	-13.3373	13.6488	0.62299	1.0:0.0:0.0:0.0	.	205;205	Q5VUJ6;F5H2T1	LRCH2_HUMAN;.	R	205	ENSP00000325091:M205R;ENSP00000439366:M205R	ENSP00000325091:M205R	M	-	2	0	LRCH2	114325237	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.730000	0.91510	1.904000	0.55121	0.376000	0.23039	ATG	-	superfamily_SSF52058		0.279	LRCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRCH2	protein_coding	OTTHUMT00000057971.2	A	NM_020871		114325237	-1	no_errors	NM_020871	genbank	human	validated	54_36p	missense	SNP	1.000	C
WDR31	114987	genome.wustl.edu	37	9	116094296	116094296	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr9:116094296G>T	ENST00000374193.4	-	3	253	c.7C>A	c.(7-9)Cta>Ata	p.L3I	WDR31_ENST00000374195.3_5'UTR|WDR31_ENST00000341761.4_Missense_Mutation_p.L3I|WDR31_ENST00000461942.1_5'UTR	NM_001012361.2|NM_145241.3	NP_001012361.1|NP_660284.1	Q8NA23	WDR31_HUMAN	WD repeat domain 31	3										NS(1)|large_intestine(1)|lung(2)|prostate(2)	6						CACCTGAGTAGCAGCATCCCT	0.403																																																0			9											126.0	108.0	114.0					9																	116094296		2203	4300	6503	115134117	SO:0001583	missense	114987			BC012352	CCDS6792.1, CCDS35110.1	9q33.1	2013-01-09			ENSG00000148225	ENSG00000148225		"""WD repeat domain containing"""	21421	protein-coding gene	gene with protein product	"""similar to spermatid WD-repeat protein"""						Standard	NM_145241		Approved	FLJ35921	uc004bhb.3	Q8NA23	OTTHUMG00000020525	ENST00000374193.4:c.7C>A	9.37:g.116094296G>T	ENSP00000363308:p.Leu3Ile	Somatic		Capture	Illumina GAIIx	4	115134117	Q5W0T9|Q96EG8	Missense_Mutation	SNP	PatternScan_TONB_DEPENDENT_REC_1,superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.L3I	ENST00000374193.4	37	c.7	CCDS35110.1	9	.	.	.	.	.	.	.	.	.	.	G	10.27	1.304083	0.23736	.	.	ENSG00000148225	ENST00000374193;ENST00000341761;ENST00000465979	T;T;T	0.66815	-0.19;-0.23;0.28	5.81	-5.41	0.02648	.	1.697190	0.03095	N	0.160325	T	0.54854	0.1884	L	0.51422	1.61	0.09310	N	0.999998	B;B	0.21905	0.037;0.062	B;B	0.24269	0.023;0.052	T	0.36768	-0.9734	10	0.40728	T	0.16	5.7807	2.8193	0.05467	0.4881:0.2318:0.1713:0.1088	.	3;3	Q8NA23;Q8NA23-2	WDR31_HUMAN;.	I	3	ENSP00000363308:L3I;ENSP00000345027:L3I;ENSP00000419246:L3I	ENSP00000345027:L3I	L	-	1	2	WDR31	115134117	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.201000	0.09464	-0.725000	0.04901	-0.142000	0.14014	CTA	-	PatternScan_TONB_DEPENDENT_REC_1		0.403	WDR31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR31	protein_coding	OTTHUMT00000053734.2	G	NM_145241		115134117	-1	no_errors	NM_001012361	genbank	human	reviewed	54_36p	missense	SNP	0.001	T
CTTNBP2	83992	genome.wustl.edu	37	7	117359617	117359617	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr7:117359617C>A	ENST00000160373.3	-	21	4676	c.4585G>T	c.(4585-4587)Gat>Tat	p.D1529Y		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1529					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		TTGACAAGATCTGCTTCGTCA	0.433																																																0			7											131.0	116.0	121.0					7																	117359617		2203	4300	6503	117146853	SO:0001583	missense	83992				CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.4585G>T	7.37:g.117359617C>A	ENSP00000160373:p.Asp1529Tyr	Somatic		Capture	Illumina GAIIx	4	117146853	O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	HMMPfam_CortBP2,superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank	p.D1529Y	ENST00000160373.3	37	c.4585	CCDS5774.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.6|23.6	4.436480|4.436480	0.83885|0.83885	.|.	.|.	ENSG00000077063|ENSG00000077063	ENST00000160373|ENST00000446636	T|.	0.80214|.	-1.35|.	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	0.130549|.	0.64402|.	D|.	0.000002|.	T|T	0.76328|0.76328	0.3972|0.3972	M|M	0.69823|0.69823	2.125|2.125	0.58432|0.58432	D|D	0.999999|0.999999	D|.	0.89917|.	1.0|.	D|.	0.72075|.	0.976|.	T|T	0.74657|0.74657	-0.3592|-0.3592	10|5	0.87932|.	D|.	0|.	-8.0215|-8.0215	19.5918|19.5918	0.95518|0.95518	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1529|.	Q8WZ74|.	CTTB2_HUMAN|.	Y|I	1529|1016	ENSP00000160373:D1529Y|.	ENSP00000160373:D1529Y|.	D|R	-|-	1|2	0|0	CTTNBP2|CTTNBP2	117146853|117146853	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	6.683000|6.683000	0.74533|0.74533	2.700000|2.700000	0.92200|0.92200	0.563000|0.563000	0.77884|0.77884	GAT|AGA	-	NULL		0.433	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTNBP2	protein_coding	OTTHUMT00000059201.4	C	NM_033427		117146853	-1	no_errors	NM_033427	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
PXN	5829	genome.wustl.edu	37	12	120662173	120662173	+	Silent	SNP	C	C	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr12:120662173C>A	ENST00000228307.7	-	2	162	c.21G>T	c.(19-21)ctG>ctT	p.L7L	PXN_ENST00000536957.1_Silent_p.L5L|PXN_ENST00000424649.2_Silent_p.L7L|PXN_ENST00000267257.7_Silent_p.L7L|PXN_ENST00000458477.2_5'UTR|PXN_ENST00000538144.1_5'UTR	NM_001080855.2	NP_001074324.1	P49023	PAXI_HUMAN	paxillin	7					activation of MAPK activity (GO:0000187)|branching morphogenesis of an epithelial tube (GO:0048754)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cellular component movement (GO:0006928)|cellular response to reactive oxygen species (GO:0034614)|cytoskeleton organization (GO:0007010)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|growth hormone receptor signaling pathway (GO:0060396)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|muscle contraction (GO:0006936)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of cell shape (GO:0008360)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	beta-catenin binding (GO:0008013)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AGTCCGCCAGCAGGGCGTCTG	0.592																																																0			12											45.0	51.0	49.0					12																	120662173		2004	4156	6160	119146556	SO:0001819	synonymous_variant	5829			U14588	CCDS44996.1, CCDS44997.1, CCDS44998.1, CCDS58281.1	12q24	2006-01-23			ENSG00000089159	ENSG00000089159			9718	protein-coding gene	gene with protein product		602505				7534286	Standard	NM_001080855		Approved		uc001txv.3	P49023	OTTHUMG00000169169	ENST00000228307.7:c.21G>T	12.37:g.120662173C>A		Somatic		Capture	Illumina GAIIx	4	119146556	B2RAI3|B7ZMB4|O14970|O14971|O60360|Q5HYA4	Silent	SNP	HMMPfam_Paxillin,superfamily_Glucocorticoid receptor-like (DNA-binding domain),HMMSmart_SM00132,PatternScan_LIM_DOMAIN_1,HMMPfam_LIM	p.L7	ENST00000228307.7	37	c.21	CCDS44997.1	12																																																																																			-	NULL		0.592	PXN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PXN	protein_coding	OTTHUMT00000402679.4	C	NM_002859		119146556	-1	no_errors	NM_002859	genbank	human	validated	54_36p	silent	SNP	1.000	A
PTPRZ1	5803	genome.wustl.edu	37	7	121650743	121650743	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr7:121650743C>A	ENST00000393386.2	+	12	2054	c.1643C>A	c.(1642-1644)tCt>tAt	p.S548Y	PTPRZ1_ENST00000449182.1_Missense_Mutation_p.S548Y	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	548					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						GTTCTTAGATCTCCACATATG	0.403																																																0			7											67.0	64.0	65.0					7																	121650743		2203	4300	6503	121437979	SO:0001583	missense	5803			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.1643C>A	7.37:g.121650743C>A	ENSP00000377047:p.Ser548Tyr	Somatic		Capture	Illumina GAIIx	4	121437979	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	superfamily_Carbonic anhydrase,HMMPfam_Carb_anhydrase,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00194,HMMPfam_Y_phosphatase,HMMSmart_SM00404,PatternScan_TYR_PHOSPHATASE_1	p.S548Y	ENST00000393386.2	37	c.1643	CCDS34740.1	7	.	.	.	.	.	.	.	.	.	.	C	0.464	-0.887709	0.02511	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	T;T	0.41758	1.03;0.99	5.81	-6.12	0.02124	.	0.665018	0.14466	N	0.317899	T	0.17831	0.0428	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39683	-0.9602	10	0.02654	T	1	.	8.2038	0.31441	0.6339:0.0668:0.0:0.2993	.	548;548	C9JFM0;P23471	.;PTPRZ_HUMAN	Y	548	ENSP00000377047:S548Y;ENSP00000410000:S548Y	ENSP00000377047:S548Y	S	+	2	0	PTPRZ1	121437979	0.000000	0.05858	0.012000	0.15200	0.881000	0.50899	-0.632000	0.05489	-1.341000	0.02225	-0.953000	0.02652	TCT	-	NULL		0.403	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	protein_coding	OTTHUMT00000347288.1	C	NM_002851		121437979	+1	no_errors	NM_002851	genbank	human	reviewed	54_36p	missense	SNP	0.000	A
CCDC15	80071	genome.wustl.edu	37	11	124862563	124862563	+	Nonsense_Mutation	SNP	C	C	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr11:124862563C>T	ENST00000344762.5	+	10	2378	c.2119C>T	c.(2119-2121)Caa>Taa	p.Q707*	CCDC15_ENST00000529051.1_Nonsense_Mutation_p.Q707*	NM_025004.2	NP_079280.2	Q0P6D6	CCD15_HUMAN	coiled-coil domain containing 15	707						centrosome (GO:0005813)				central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(1)	23	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)		AATCCAGGACCAAGACTCCCC	0.403																																																0			11											63.0	58.0	60.0					11																	124862563		1845	4094	5939	124367773	SO:0001587	stop_gained	80071			BC018540	CCDS44756.1	11q24.2	2008-02-05			ENSG00000149548	ENSG00000149548			25798	protein-coding gene	gene with protein product							Standard	NM_025004		Approved	FLJ13215	uc001qbm.4	Q0P6D6	OTTHUMG00000165940	ENST00000344762.5:c.2119C>T	11.37:g.124862563C>T	ENSP00000341684:p.Gln707*	Somatic		Capture	Illumina GAIIx	4	124367773	Q9H8U7	Nonsense_Mutation	SNP	NULL	p.Q707*	ENST00000344762.5	37	c.2119	CCDS44756.1	11	.	.	.	.	.	.	.	.	.	.	C	37	6.500285	0.97616	.	.	ENSG00000149548	ENST00000529051;ENST00000344762	.	.	.	4.69	-0.622	0.11560	.	1.972730	0.02991	N	0.146809	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	2.7408	0.9222	0.01317	0.3208:0.3421:0.1561:0.181	.	.	.	.	X	707	.	ENSP00000341684:Q707X	Q	+	1	0	CCDC15	124367773	0.000000	0.05858	0.001000	0.08648	0.076000	0.17211	-0.357000	0.07651	-0.083000	0.12618	0.655000	0.94253	CAA	-	NULL		0.403	CCDC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC15	protein_coding	OTTHUMT00000387131.1	C	NM_025004		124367773	+1	no_errors	NM_025004	genbank	human	validated	54_36p	nonsense	SNP	0.000	T
FAT4	79633	genome.wustl.edu	37	4	126240548	126240548	+	Silent	SNP	A	A	G			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr4:126240548A>G	ENST00000394329.3	+	1	2995	c.2982A>G	c.(2980-2982)ccA>ccG	p.P994P		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	994	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						ACAATTCACCAGTGTTTGACC	0.413																																																0			4											117.0	113.0	114.0					4																	126240548		1922	4127	6049	126459998	SO:0001819	synonymous_variant	79633			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.2982A>G	4.37:g.126240548A>G		Somatic		Capture	Illumina GAIIx	4	126459998	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA,PatternScan_CADHERIN_1,superfamily_SSF57196,HMMSmart_EGF,PatternScan_EGF_1,PatternScan_EGF_2,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_EGF_CA,PatternScan_ASX_HYDROXYL,superfamily_ConA_like_lec_gl,HMMSmart_LamG,HMMPfam_Laminin_G_2,HMMPfam_EGF	p.P994	ENST00000394329.3	37	c.2982	CCDS3732.3	4																																																																																			-	HMMSmart_CA,PatternScan_CADHERIN_1,superfamily_Cadherin		0.413	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	protein_coding	OTTHUMT00000256765.2	A	NM_024582		126459998	+1	no_errors	NM_024582	genbank	human	validated	54_36p	silent	SNP	0.998	G
SLC12A2	6558	genome.wustl.edu	37	5	127503468	127503468	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr5:127503468C>T	ENST00000262461.2	+	18	2821	c.2632C>T	c.(2632-2634)Cgt>Tgt	p.R878C	SLC12A2_ENST00000343225.4_Missense_Mutation_p.R878C	NM_001046.2	NP_001037.1	P55011	S12A2_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 2	878					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|branching involved in mammary gland duct morphogenesis (GO:0060444)|chloride transmembrane transport (GO:1902476)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|gamma-aminobutyric acid signaling pathway (GO:0007214)|hyperosmotic response (GO:0006972)|ion transport (GO:0006811)|mammary duct terminal end bud growth (GO:0060763)|multicellular organism growth (GO:0035264)|positive regulation of cell volume (GO:0045795)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transepithelial ammonium transport (GO:0070634)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ammonium transmembrane transporter activity (GO:0008519)|sodium:potassium:chloride symporter activity (GO:0008511)			breast(3)|endometrium(5)|kidney(5)|large_intestine(12)|lung(16)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)	TGGTCTTGGTCGTATGAAGCC	0.333																																																0			5											126.0	125.0	125.0					5																	127503468		2203	4300	6503	127531367	SO:0001583	missense	6558				CCDS4144.1, CCDS58965.1	5q23.3	2014-06-13	2013-07-18		ENSG00000064651	ENSG00000064651		"""Solute carriers"""	10911	protein-coding gene	gene with protein product	"""bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1"", ""basolateral Na-K-Cl symporter"", ""protein phosphatase 1, regulatory subunit 141"""	600840				7629105	Standard	NM_001256461		Approved	NKCC1, BSC, BSC2, PPP1R141	uc003kus.3	P55011	OTTHUMG00000128983	ENST00000262461.2:c.2632C>T	5.37:g.127503468C>T	ENSP00000262461:p.Arg878Cys	Somatic		Capture	Illumina GAIIx	4	127531367	Q8N713|Q8WWH7	Missense_Mutation	SNP	HMMPfam_AA_permease_N,HMMPfam_AA_permease	p.R878C	ENST00000262461.2	37	c.2632	CCDS4144.1	5	.	.	.	.	.	.	.	.	.	.	C	19.75	3.885466	0.72410	.	.	ENSG00000064651	ENST00000262461;ENST00000343225	D;D	0.91631	-2.88;-2.88	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	D	0.96592	0.8888	M	0.88906	2.99	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.984;0.999;0.964	D	0.97308	0.9935	10	0.87932	D	0	.	16.8137	0.85727	0.0:1.0:0.0:0.0	.	878;92;878	P55011-3;Q59GB7;P55011	.;.;S12A2_HUMAN	C	878	ENSP00000262461:R878C;ENSP00000340878:R878C	ENSP00000262461:R878C	R	+	1	0	SLC12A2	127531367	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.773000	0.47686	2.503000	0.84419	0.591000	0.81541	CGT	-	NULL		0.333	SLC12A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC12A2	protein_coding	OTTHUMT00000250972.1	C	NM_001046		127531367	+1	no_errors	NM_001046	genbank	human	validated	54_36p	missense	SNP	1.000	T
PPAPDC3	84814	genome.wustl.edu	37	9	134183659	134183659	+	Silent	SNP	C	C	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr9:134183659C>A	ENST00000372264.3	+	2	1105	c.801C>A	c.(799-801)ctC>ctA	p.L267L		NM_032728.3	NP_116117.3	Q8NBV4	PPAC3_HUMAN	phosphatidic acid phosphatase type 2 domain containing 3	267			L -> V (in dbSNP:rs11244366).		negative regulation of myotube differentiation (GO:0010832)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	hydrolase activity (GO:0016787)			breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16	all_hematologic(7;0.0119)			OV - Ovarian serous cystadenocarcinoma(145;1.22e-05)|Epithelial(140;0.000173)		GCCAGATGCTCATCTCTGCCT	0.682																																																0			9											19.0	20.0	20.0					9																	134183659		2201	4300	6501	133173480	SO:0001819	synonymous_variant	84814			AK027568	CCDS6942.1	9q34.2-q34.3	2008-02-26	2005-07-15	2005-07-15	ENSG00000160539	ENSG00000160539			28174	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 67"""	C9orf67		12958361	Standard	NM_032728		Approved	MGC12921, FLJ14662, NET39	uc004cal.2	Q8NBV4	OTTHUMG00000020822	ENST00000372264.3:c.801C>A	9.37:g.134183659C>A		Somatic		Capture	Illumina GAIIx	4	133173480	Q5T6P0|Q96SS7|Q9BRC3	Silent	SNP	superfamily_AcPase_VanPerase,HMMSmart_acidPPc,HMMPfam_PAP2	p.L267	ENST00000372264.3	37	c.801	CCDS6942.1	9																																																																																			-	NULL		0.682	PPAPDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAPDC3	protein_coding	OTTHUMT00000054724.1	C	NM_032728		133173480	+1	no_errors	NM_032728	genbank	human	validated	54_36p	silent	SNP	1.000	A
RALGDS	5900	genome.wustl.edu	37	9	135979137	135979137	+	Silent	SNP	C	C	G			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr9:135979137C>G	ENST00000372050.3	-	11	1776	c.1755G>C	c.(1753-1755)ctG>ctC	p.L585L	RALGDS_ENST00000393157.3_Silent_p.L584L|RALGDS_ENST00000469972.1_5'UTR|RALGDS_ENST00000372062.3_Silent_p.L556L|RALGDS_ENST00000542690.1_Silent_p.L656L|RALGDS_ENST00000372047.3_Silent_p.L573L|RALGDS_ENST00000393160.3_Silent_p.L530L	NM_006266.2	NP_006257.1	Q12967	GNDS_HUMAN	ral guanine nucleotide dissociation stimulator	585	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|small GTPase regulator activity (GO:0005083)			endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	10				OV - Ovarian serous cystadenocarcinoma(145;3.66e-06)|Epithelial(140;2.77e-05)		CACTCACATACAGATAGTCCT	0.622			T	CIITA	"""PMBL, Hodgkin Lymphona, """						OREG0019581	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Melanoma(189;762 2088 15384 21931 52515)		Dom	yes		9	9q34.3	5900	ral guanine nucleotide dissociation stimulator		L	0			9											123.0	108.0	113.0					9																	135979137		2203	4300	6503	134968958	SO:0001819	synonymous_variant	5900			AB037729	CCDS6959.1, CCDS43897.1, CCDS65172.1, CCDS65173.1, CCDS65174.1	9q34.3	2009-04-08			ENSG00000160271	ENSG00000160271			9842	protein-coding gene	gene with protein product		601619				7972015	Standard	NM_006266		Approved	RGF, RalGEF, RGDS	uc004ccr.3	Q12967	OTTHUMG00000020858	ENST00000372050.3:c.1755G>C	9.37:g.135979137C>G		Somatic	1622	Capture	Illumina GAIIx	4	134968958	B7Z753|E7ER93|E7ERZ0|Q5T7V4|Q6KH11|Q6PCE1|Q6ZSD5|Q9HAX7|Q9HAY1|Q9HCT1|Q9P2N8	Silent	SNP	superfamily_Ras GEF,HMMSmart_SM00229,HMMPfam_RasGEF_N,HMMSmart_SM00147,HMMPfam_RasGEF,PatternScan_RASGEF,superfamily_Ubiquitin-like,HMMPfam_RA,HMMSmart_SM00314	p.L585	ENST00000372050.3	37	c.1755	CCDS6959.1	9																																																																																			-	superfamily_Ras GEF,HMMSmart_SM00147,HMMPfam_RasGEF,PatternScan_RASGEF		0.622	RALGDS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RALGDS	protein_coding	OTTHUMT00000054837.1	C	NM_006266		134968958	-1	no_errors	NM_006266	genbank	human	validated	54_36p	silent	SNP	1.000	G
ADCK2	90956	genome.wustl.edu	37	7	140373432	140373432	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr7:140373432T>A	ENST00000072869.4	+	1	480	c.302T>A	c.(301-303)cTt>cAt	p.L101H	ADCK2_ENST00000476491.1_Missense_Mutation_p.L101H	NM_052853.3	NP_443085.2	Q7Z695	ADCK2_HUMAN	aarF domain containing kinase 2	101						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			cervix(1)|kidney(2)|large_intestine(2)|lung(5)|prostate(1)|skin(4)	15	Melanoma(164;0.00956)					CGCCTCTGGCTTCGCGCCGGC	0.701																																																0			7											48.0	55.0	53.0					7																	140373432		2203	4300	6503	140019901	SO:0001583	missense	90956			AF131745	CCDS5861.1	7q34	2003-07-21			ENSG00000133597	ENSG00000133597			19039	protein-coding gene	gene with protein product							Standard	NM_052853		Approved	MGC20727	uc003vvy.1	Q7Z695	OTTHUMG00000157409	ENST00000072869.4:c.302T>A	7.37:g.140373432T>A	ENSP00000072869:p.Leu101His	Somatic		Capture	Illumina GAIIx	4	140019901	Q96CN6|Q9Y6T5	Missense_Mutation	SNP	HMMPfam_ABC1,superfamily_Protein kinase-like (PK-like)	p.L101H	ENST00000072869.4	37	c.302	CCDS5861.1	7	.	.	.	.	.	.	.	.	.	.	T	24.9	4.582312	0.86748	.	.	ENSG00000133597	ENST00000072869;ENST00000476491	T;T	0.49432	0.78;0.78	4.53	3.31	0.37934	.	0.000000	0.64402	D	0.000005	T	0.56529	0.1991	M	0.68952	2.095	0.19300	N	0.99997	D;D	0.61080	0.989;0.989	P;P	0.54965	0.765;0.765	T	0.51180	-0.8738	10	0.87932	D	0	1.7979	10.3652	0.44019	0.1464:0.0:0.0:0.8536	.	101;101	C9JE15;Q7Z695	.;ADCK2_HUMAN	H	101	ENSP00000072869:L101H;ENSP00000420512:L101H	ENSP00000072869:L101H	L	+	2	0	ADCK2	140019901	1.000000	0.71417	0.012000	0.15200	0.276000	0.26787	5.486000	0.66856	1.690000	0.51089	0.459000	0.35465	CTT	-	NULL		0.701	ADCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCK2	protein_coding	OTTHUMT00000348734.1	T	NM_052853		140019901	+1	no_errors	NM_052853	genbank	human	validated	54_36p	missense	SNP	0.381	A
PCDHGA4	56111	genome.wustl.edu	37	5	140736022	140736022	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr5:140736022A>T	ENST00000571252.1	+	1	1255	c.1255A>T	c.(1255-1257)Aac>Tac	p.N419Y	PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	419	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCAGAATATAACATCACTGT	0.418																																																0			5											58.0	57.0	58.0					5																	140736022		2022	4189	6211	140716206	SO:0001583	missense	56111			AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.1255A>T	5.37:g.140736022A>T	ENSP00000458570:p.Asn419Tyr	Somatic		Capture	Illumina GAIIx	4	140716206	Q9Y5D3	Missense_Mutation	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin_2,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.N419Y	ENST00000571252.1	37	c.1255	CCDS58979.1	5																																																																																			-	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112		0.418	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA4	protein_coding	OTTHUMT00000437959.1	A	NM_018917		140716206	+1	no_errors	NM_018917	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
PCDHGB6	56100	genome.wustl.edu	37	5	140789183	140789183	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr5:140789183G>T	ENST00000520790.1	+	1	1414	c.1414G>T	c.(1414-1416)Gcg>Tcg	p.A472S	PCDHGA7_ENST00000518325.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_018926.2|NM_032100.1	NP_061749.1|NP_115271.1	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6	472	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)	48			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCCTCCATTGCGCAAGTGAG	0.587																																																0			5											34.0	40.0	38.0					5																	140789183		2094	4214	6308	140769367	SO:0001583	missense	56100			AF152522	CCDS54929.1, CCDS75342.1	5q31	2010-01-26				ENSG00000253305		"""Cadherins / Protocadherins : Clustered"""	8713	other	protocadherin		606303				10380929	Standard	NM_018926		Approved	PCDH-GAMMA-B6		Q9Y5F9		ENST00000520790.1:c.1414G>T	5.37:g.140789183G>T	ENSP00000428603:p.Ala472Ser	Somatic		Capture	Illumina GAIIx	4	140769367	Q9Y5C5	Missense_Mutation	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin_2,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.A472S	ENST00000520790.1	37	c.1414	CCDS54929.1	5	.	.	.	.	.	.	.	.	.	.	g	8.342	0.828878	0.16749	.	.	ENSG00000253305	ENST00000520790	T	0.01745	4.66	5.22	2.1	0.27182	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.01940	0.0061	L	0.39397	1.21	0.09310	N	1	B;B	0.30889	0.299;0.155	B;B	0.36186	0.219;0.168	T	0.47711	-0.9096	9	0.30854	T	0.27	.	2.508	0.04650	0.0992:0.1453:0.3298:0.4257	.	472;472	Q9Y5F9;Q9Y5F9-2	PCDGI_HUMAN;.	S	472	ENSP00000428603:A472S	ENSP00000428603:A472S	A	+	1	0	PCDHGB6	140769367	0.000000	0.05858	0.239000	0.24122	0.047000	0.14425	0.034000	0.13776	0.501000	0.28013	0.462000	0.41574	GCG	-	superfamily_Cadherin-like,HMMPfam_Cadherin		0.587	PCDHGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB6	protein_coding	OTTHUMT00000374746.1	G	NM_018926		140769367	+1	no_errors	NM_018926	genbank	human	reviewed	54_36p	missense	SNP	0.001	T
ARHGAP26	23092	genome.wustl.edu	37	5	142273829	142273829	+	Silent	SNP	G	G	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr5:142273829G>A	ENST00000274498.4	+	6	891	c.513G>A	c.(511-513)cgG>cgA	p.R171R	ARHGAP26_ENST00000378004.3_Silent_p.R171R	NM_015071.4	NP_055886.1	Q9UNA1	RHG26_HUMAN	Rho GTPase activating protein 26	171					actin cytoskeleton organization (GO:0030036)|filopodium assembly (GO:0046847)|nervous system development (GO:0007399)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)	p.R171R(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(7)|ovary(1)	25		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACCTGGTCCGGCAGCATTTCT	0.433																																																1	Substitution - coding silent(1)	large_intestine(1)	5											88.0	86.0	86.0					5																	142273829		2203	4300	6503	142254013	SO:0001819	synonymous_variant	23092			AB014521	CCDS4277.1, CCDS47297.1	5q31	2011-06-29			ENSG00000145819	ENSG00000145819		"""Rho GTPase activating proteins"""	17073	protein-coding gene	gene with protein product	"""GTPase regulator associated with the focal adhesion kinase pp125"""	605370				9858476, 8649427	Standard	NM_001135608		Approved	GRAF, KIAA0621, OPHN1L, OPHN1L1	uc011dbj.2	Q9UNA1	OTTHUMG00000059705	ENST00000274498.4:c.513G>A	5.37:g.142273829G>A		Somatic		Capture	Illumina GAIIx	4	142254013	O75117|Q5D035|Q9BYS6|Q9BYS7|Q9UJ00	Silent	SNP	superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,superfamily_GTPase activation domain GAP,HMMSmart_SM00324,HMMPfam_RhoGAP,superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326,PatternScan_IG_MHC	p.R171	ENST00000274498.4	37	c.513	CCDS4277.1	5																																																																																			-	NULL		0.433	ARHGAP26-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP26	protein_coding	OTTHUMT00000132744.3	G	NM_015071		142254013	+1	no_errors	NM_015071	genbank	human	validated	54_36p	silent	SNP	1.000	A
FAM131B	9715	genome.wustl.edu	37	7	143054049	143054049	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr7:143054049A>T	ENST00000409408.1	-	6	2301	c.593T>A	c.(592-594)cTg>cAg	p.L198Q	FAM131B_ENST00000409222.3_Missense_Mutation_p.L198Q|FAM131B_ENST00000409578.1_Missense_Mutation_p.L214Q|FAM131B_ENST00000409346.1_Missense_Mutation_p.L198Q|FAM131B_ENST00000443739.2_Missense_Mutation_p.L226Q			Q86XD5	F131B_HUMAN	family with sequence similarity 131, member B	198										breast(1)|endometrium(4)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24	Melanoma(164;0.205)					TGACGACCCCAGACAGTACAT	0.567																																																0			7											58.0	52.0	54.0					7																	143054049		2203	4300	6503	142764171	SO:0001583	missense	9715			BC045611	CCDS5882.1, CCDS47734.1	7q34	2007-03-20			ENSG00000159784	ENSG00000159784			22202	protein-coding gene	gene with protein product							Standard	NM_014690		Approved	KIAA0773	uc010lpa.3	Q86XD5	OTTHUMG00000152697	ENST00000409408.1:c.593T>A	7.37:g.143054049A>T	ENSP00000387017:p.Leu198Gln	Somatic		Capture	Illumina GAIIx	4	142764171	A4D2H6|A6NDW3|A8K605|B8ZZN2|D3DXE3|J3KQX2|Q7L0D6|Q86T97	Missense_Mutation	SNP	NULL	p.L198Q	ENST00000409408.1	37	c.593	CCDS5882.1	7	.	.	.	.	.	.	.	.	.	.	A	24.7	4.563420	0.86335	.	.	ENSG00000159784	ENST00000443739;ENST00000409578;ENST00000409346;ENST00000452076;ENST00000409408;ENST00000409222	T;T;T;T;T	0.23950	1.88;1.88;1.88;1.88;1.88	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.47377	0.1442	M	0.61703	1.905	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.74023	0.982;0.961	T	0.33777	-0.9855	10	0.33141	T	0.24	-21.0262	15.5417	0.76057	1.0:0.0:0.0:0.0	.	214;198	Q86XD5-2;Q86XD5	.;F131B_HUMAN	Q	226;214;198;202;198;198	ENSP00000410603:L226Q;ENSP00000386568:L214Q;ENSP00000386984:L198Q;ENSP00000387017:L198Q;ENSP00000387147:L198Q	ENSP00000387147:L198Q	L	-	2	0	FAM131B	142764171	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.817000	0.91985	2.072000	0.62099	0.533000	0.62120	CTG	-	NULL		0.567	FAM131B-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	FAM131B	protein_coding	OTTHUMT00000328057.1	A	NM_014690		142764171	-1	no_errors	NM_001031690	genbank	human	validated	54_36p	missense	SNP	1.000	T
FAM115A	9747	genome.wustl.edu	37	7	143573339	143573339	+	Silent	SNP	G	G	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr7:143573339G>T	ENST00000479870.1	-	2	571	c.363C>A	c.(361-363)tcC>tcA	p.S121S	FAM115A_ENST00000355951.2_Silent_p.S121S|FAM115A_ENST00000392900.3_Intron	NM_001206938.1|NM_001206941.1|NM_014719.2	NP_001193867.1|NP_001193870.1|NP_055534	Q9Y4C2	F115A_HUMAN	family with sequence similarity 115, member A	121										NS(1)|endometrium(1)|lung(5)	7	Melanoma(164;0.0903)					AAACCCCCAGGGAGTCTTTCA	0.517																																																0			7											87.0	95.0	92.0					7																	143573339		2203	4300	6503	143204272	SO:0001819	synonymous_variant	9747			AB018281	CCDS5886.1, CCDS56514.1	7q35	2011-05-03	2006-03-23	2006-03-23	ENSG00000198420	ENSG00000198420			22201	protein-coding gene	gene with protein product						9872452	Standard	NM_014719		Approved	KIAA0738	uc003wdo.2	Q9Y4C2	OTTHUMG00000157773	ENST00000479870.1:c.363C>A	7.37:g.143573339G>T		Somatic		Capture	Illumina GAIIx	4	143204272	A8K6E0|Q75KM8|Q75KM9|Q7L665|Q9BW63	Silent	SNP	NULL	p.S121	ENST00000479870.1	37	c.363	CCDS5886.1	7																																																																																			-	NULL		0.517	FAM115A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM115A	protein_coding	OTTHUMT00000349583.1	G	NM_014719		143204272	-1	no_errors	NM_014719	genbank	human	predicted	54_36p	silent	SNP	0.998	T
CTAGE8	100142659	genome.wustl.edu	37	7	143965394	143965394	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr7:143965394T>A	ENST00000487179.1	-	1	987	c.950A>T	c.(949-951)aAa>aTa	p.K317I	OR2A1-AS1_ENST00000463561.1_RNA|RP4-545C24.1_ENST00000460955.1_RNA|OR2A1-AS1_ENST00000461843.1_RNA|OR2A1-AS1_ENST00000489488.1_RNA|ARHGEF35_ENST00000543357.1_Intron|OR2A1-AS1_ENST00000476560.1_RNA|OR2A1-AS1_ENST00000487102.1_RNA|OR2A1-AS1_ENST00000478806.1_RNA			P0CG41	CTGE8_HUMAN	CTAGE family, member 8	317						integral component of membrane (GO:0016021)											ATGAATCAGTTTCTTCAAAGC	0.353																																																0			7																																								143596327	SO:0001583	missense	0			AK292236	CCDS64791.1	7q35	2014-08-13			ENSG00000244693	ENSG00000244693			37294	protein-coding gene	gene with protein product							Standard	NM_001278507		Approved			P0CG41	OTTHUMG00000158009	ENST00000487179.1:c.950A>T	7.37:g.143965394T>A	ENSP00000417289:p.Lys317Ile	Somatic		Capture	Illumina GAIIx	4	143596327		RNA	SNP	-	NULL	ENST00000487179.1	37	NULL		7	.	.	.	.	.	.	.	.	.	.	-	10.13	1.265973	0.23136	.	.	ENSG00000244693	ENST00000487179	T	0.40225	1.04	.	.	.	.	.	.	.	.	T	0.57917	0.2086	.	.	.	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.44757	-0.9307	6	0.87932	D	0	.	.	.	.	.	317	P0CG41	CTGE8_HUMAN	I	317	ENSP00000417289:K317I	ENSP00000417289:K317I	K	-	2	0	CTAGE8	143596327	0.984000	0.35163	0.076000	0.20297	0.076000	0.17211	2.194000	0.42668	0.149000	0.19098	0.147000	0.16070	AAA	-	-		0.353	CTAGE8-001	KNOWN	basic|appris_principal	protein_coding	LOC728377	protein_coding	OTTHUMT00000349996.1	T			143596327	-1	no_errors	XR_041052	genbank	human	model	54_36p	rna	SNP	0.967	A
CYC1	1537	genome.wustl.edu	37	8	145151614	145151614	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr8:145151614C>G	ENST00000318911.4	+	5	812	c.739C>G	c.(739-741)Ccc>Gcc	p.P247A	SHARPIN_ENST00000533948.1_5'Flank	NM_001916.3	NP_001907	P08574	CY1_HUMAN	cytochrome c-1	247					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to glucagon (GO:0033762)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|respiratory chain (GO:0070469)	electron transporter, transferring electrons from CoQH2-cytochrome c reductase complex and cytochrome c oxidase complex activity (GO:0045155)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(2)	15	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;8.71e-40)|all cancers(56;3e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CATGGCCCCTCCCATCTACAC	0.582																																																0			8											61.0	58.0	59.0					8																	145151614		2203	4300	6503	145223602	SO:0001583	missense	1537			BC001006	CCDS6415.1	8q24	2011-07-04			ENSG00000179091	ENSG00000179091		"""Mitochondrial respiratory chain complex / Complex III"""	2579	protein-coding gene	gene with protein product		123980					Standard	NM_001916		Approved	UQCR4	uc003zaz.4	P08574	OTTHUMG00000165242	ENST00000318911.4:c.739C>G	8.37:g.145151614C>G	ENSP00000317159:p.Pro247Ala	Somatic		Capture	Illumina GAIIx	4	145223602	Q5U062|Q6FHS7	Missense_Mutation	SNP	superfamily_Cytochrome c,HMMPfam_Cytochrom_C1,superfamily_Cytochrome c1 subunit of cytochrome bc1 complex (Ubiquinol-cytochrome c reductase) transmembrane anchor	p.P247A	ENST00000318911.4	37	c.739	CCDS6415.1	8	.	.	.	.	.	.	.	.	.	.	C	7.633	0.679190	0.14907	.	.	ENSG00000179091	ENST00000318911	T	0.44482	0.92	5.11	4.22	0.49857	Cytochrome c domain (2);	0.000000	0.85682	D	0.000000	T	0.37652	0.1011	L	0.55481	1.735	0.54753	D	0.999987	B	0.12013	0.005	B	0.10450	0.005	T	0.14559	-1.0468	10	0.25751	T	0.34	-20.6731	12.6948	0.56997	0.1662:0.8338:0.0:0.0	.	247	P08574	CY1_HUMAN	A	247	ENSP00000317159:P247A	ENSP00000317159:P247A	P	+	1	0	CYC1	145223602	1.000000	0.71417	0.877000	0.34402	0.239000	0.25481	7.383000	0.79741	1.134000	0.42165	-0.314000	0.08810	CCC	-	superfamily_Cytochrome c,HMMPfam_Cytochrom_C1		0.582	CYC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYC1	protein_coding	OTTHUMT00000382895.1	C	NM_001916		145223602	+1	no_errors	NM_001916	genbank	human	validated	54_36p	missense	SNP	0.996	G
MBD5	55777	genome.wustl.edu	37	2	149260043	149260043	+	Silent	SNP	G	G	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr2:149260043G>A	ENST00000407073.1	+	13	5299	c.4302G>A	c.(4300-4302)ttG>ttA	p.L1434L	MBD5_ENST00000404807.1_Silent_p.L1667L	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	1434	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.				glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		CAGAAGGTTTGGAAGCCTACA	0.398																																																0			2											59.0	59.0	59.0					2																	149260043		2203	4300	6503	148976513	SO:0001819	synonymous_variant	55777			AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.4302G>A	2.37:g.149260043G>A		Somatic		Capture	Illumina GAIIx	4	148976513	A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Silent	SNP	HMMSmart_SM00391,HMMPfam_MBD,superfamily_Tudor/PWWP/MBT,HMMPfam_PWWP	p.L1434	ENST00000407073.1	37	c.4302	CCDS33302.1	2	.	.	.	.	.	.	.	.	.	.	G	9.783	1.175943	0.21704	.	.	ENSG00000204406	ENST00000416015	.	.	.	5.93	1.75	0.24633	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-4.056	8.7284	0.34483	0.5106:0.0:0.4894:0.0	.	.	.	.	X	1004	.	.	W	+	2	0	MBD5	148976513	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	0.507000	0.22675	0.686000	0.31488	0.655000	0.94253	TGG	-	superfamily_Tudor/PWWP/MBT,HMMPfam_PWWP		0.398	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD5	protein_coding	OTTHUMT00000318111.2	G			148976513	+1	no_errors	NM_018328	genbank	human	validated	54_36p	silent	SNP	1.000	A
RFX5	5993	genome.wustl.edu	37	1	151315400	151315400	+	Silent	SNP	G	G	A	rs377016578		TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr1:151315400G>A	ENST00000290524.4	-	11	1291	c.1113C>T	c.(1111-1113)gcC>gcT	p.A371A	RFX5_ENST00000478564.1_5'Flank|RFX5_ENST00000368870.2_Silent_p.A371A|RFX5_ENST00000452513.2_Silent_p.A331A|RP11-126K1.8_ENST00000422153.1_RNA|RFX5_ENST00000452671.2_Silent_p.A371A	NM_000449.3|NM_001025603.1	NP_000440.1|NP_001020774.1	P48382	RFX5_HUMAN	regulatory factor X, 5 (influences HLA class II expression)	371					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GGGGTGCCCCGGCCCTACTAG	0.592																																																0			1						G	,	0,4406		0,0,2203	47.0	56.0	53.0		1113,1113	-4.7	0.9	1		53	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous,coding-synonymous	RFX5	NM_000449.3,NM_001025603.1	,	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	,	371/617,371/617	151315400	1,13003	2203	4299	6502	149582024	SO:0001819	synonymous_variant	5993				CCDS994.1	1q21	2014-09-17			ENSG00000143390	ENSG00000143390			9986	protein-coding gene	gene with protein product		601863				9401005	Standard	XM_005245405		Approved		uc001exw.1	P48382	OTTHUMG00000012495	ENST00000290524.4:c.1113C>T	1.37:g.151315400G>A		Somatic		Capture	Illumina GAIIx	4	149582024	B7Z848|D3DV19|E9PFU4|Q5VWC3	Silent	SNP	HMMPfam_RFX_DNA_binding,superfamily_SSF46785	p.A371	ENST00000290524.4	37	c.1113	CCDS994.1	1																																																																																			-	NULL		0.592	RFX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX5	protein_coding	OTTHUMT00000034892.6	G	NM_000449		149582024	-1	no_errors	NM_000449	genbank	human	reviewed	54_36p	silent	SNP	0.171	A
HTR5A	3361	genome.wustl.edu	37	7	154862784	154862784	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr7:154862784C>A	ENST00000287907.2	+	1	751	c.175C>A	c.(175-177)Ctg>Atg	p.L59M	HTR5A-AS1_ENST00000543018.1_Missense_Mutation_p.R77M|HTR5A-AS1_ENST00000493904.1_5'UTR|HTR5A-AS1_ENST00000395731.2_Missense_Mutation_p.R77M	NM_024012.3	NP_076917.1	P47898	5HT5A_HUMAN	5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled	59					cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hippocampus development (GO:0021766)|response to estradiol (GO:0032355)|serotonin receptor signaling pathway (GO:0007210)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(3)|stomach(1)	48	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	Asenapine(DB06216)|Loxapine(DB00408)|Olanzapine(DB00334)	CGCCTGGAACCTGCTGGTGCT	0.652																																																0			7											92.0	68.0	76.0					7																	154862784		2203	4300	6503	154493717	SO:0001583	missense	3361				CCDS5936.1	7q36.1	2012-08-08	2012-02-03		ENSG00000157219	ENSG00000157219		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5300	protein-coding gene	gene with protein product		601305	"""5-hydroxytryptamine (serotonin) receptor 5A"""			7988681	Standard	NM_024012		Approved	5-HT5A	uc003wlu.2	P47898	OTTHUMG00000151327	ENST00000287907.2:c.175C>A	7.37:g.154862784C>A	ENSP00000287907:p.Leu59Met	Somatic		Capture	Illumina GAIIx	4	154493717	Q2M2D2	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.L59M	ENST00000287907.2	37	c.175	CCDS5936.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.96|15.96	2.986906|2.986906	0.53934|0.53934	.|.	.|.	ENSG00000157219|ENSG00000220575	ENST00000287907|ENST00000395731;ENST00000543018	T|.	0.44482|.	0.92|.	4.44|4.44	0.132|0.132	0.14762|0.14762	GPCR, rhodopsin-like superfamily (1);|.	0.469780|.	0.20293|.	N|.	0.095182|.	T|T	0.44644|0.44644	0.1303|0.1303	L|L	0.55743|0.55743	1.74|1.74	0.47905|0.47905	D|D	0.999543|0.999543	P|B	0.41008|0.21225	0.735|0.053	B|B	0.44224|0.16289	0.444|0.015	T|T	0.42258|0.42258	-0.9462|-0.9462	10|8	0.46703|0.87932	T|D	0.11|0	.|.	2.156|2.156	0.03813|0.03813	0.1334:0.2093:0.4245:0.2327|0.1334:0.2093:0.4245:0.2327	.|.	59|77	P47898|B7Z8E6	5HT5A_HUMAN|.	M|M	59|77	ENSP00000287907:L59M|.	ENSP00000287907:L59M|ENSP00000379080:R77M	L|R	+|-	1|2	2|0	HTR5A|AC093726.4	154493717|154493717	0.999000|0.999000	0.42202|0.42202	0.999000|0.999000	0.59377|0.59377	0.996000|0.996000	0.88848|0.88848	0.472000|0.472000	0.22116|0.22116	0.130000|0.130000	0.18549|0.18549	0.467000|0.467000	0.42956|0.42956	CTG|AGG	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.652	HTR5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR5A	protein_coding	OTTHUMT00000322240.1	C	NM_024012		154493717	+1	no_errors	NM_024012	genbank	human	reviewed	54_36p	missense	SNP	0.993	A
ETV3L	440695	genome.wustl.edu	37	1	157067661	157067661	+	Splice_Site	SNP	G	G	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr1:157067661G>A	ENST00000454449.2	-	4	890	c.606C>T	c.(604-606)taC>taT	p.Y202Y		NM_001004341.2	NP_001004341.1	Q6ZN32	ETV3L_HUMAN	ets variant 3-like	202					cell differentiation (GO:0030154)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Hepatocellular(266;0.158)	Prostate(1639;0.184)				AGCACTCACGGTAGACGCTGC	0.637																																																0			1											106.0	108.0	107.0					1																	157067661		2203	4300	6503	155334285	SO:0001630	splice_region_variant	440695			AK131392	CCDS30893.1	1q23.1	2013-09-24	2008-09-12		ENSG00000253831	ENSG00000253831			33834	protein-coding gene	gene with protein product			"""ets variant gene 3-like"""				Standard	NM_001004341		Approved	FLJ16478	uc001fqq.2	Q6ZN32	OTTHUMG00000041325	ENST00000454449.2:c.607+1C>T	1.37:g.157067661G>A		Somatic		Capture	Illumina GAIIx	4	155334285		Silent	SNP	superfamily_SSF46785,HMMPfam_Ets,HMMSmart_ETS,PatternScan_ETS_DOMAIN_1,PatternScan_ETS_DOMAIN_2	p.Y202	ENST00000454449.2	37	c.606	CCDS30893.1	1																																																																																			-	NULL		0.637	ETV3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV3L	protein_coding	OTTHUMT00000099024.2	G	NM_001004341	Silent	155334285	-1	no_errors	NM_001004341	genbank	human	provisional	54_36p	silent	SNP	0.109	A
NPY5R	4889	genome.wustl.edu	37	4	164271769	164271769	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr4:164271769A>G	ENST00000515560.1	+	4	1866	c.344A>G	c.(343-345)cAt>cGt	p.H115R	NPY5R_ENST00000338566.3_Missense_Mutation_p.H115R|NPY5R_ENST00000506953.1_Missense_Mutation_p.H115R			Q15761	NPY5R_HUMAN	neuropeptide Y receptor Y5	115					cardiac left ventricle morphogenesis (GO:0003214)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of ovulation cycle rhythm (GO:0060112)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of smooth muscle cell proliferation (GO:0048661)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)			NS(2)|biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(4)|lung(26)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_hematologic(180;0.166)	Prostate(90;0.109)				GTCATGTGCCATATTATGCCT	0.373																																					Melanoma(139;1287 1774 9781 19750 25599)											0			4											287.0	276.0	280.0					4																	164271769		2203	4300	6503	164491219	SO:0001583	missense	4889			BC042416	CCDS3804.1	4q31-q32	2012-08-08				ENSG00000164129		"""GPCR / Class A : Neuropeptide receptors : Y"""	7958	protein-coding gene	gene with protein product		602001				8700207, 9417917	Standard	NM_006174		Approved	NPYR5	uc003iqn.3	Q15761		ENST00000515560.1:c.344A>G	4.37:g.164271769A>G	ENSP00000423917:p.His115Arg	Somatic		Capture	Illumina GAIIx	4	164491219	Q6GTR7|Q92916	Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.H115R	ENST00000515560.1	37	c.344	CCDS3804.1	4	.	.	.	.	.	.	.	.	.	.	A	6.280	0.419766	0.11928	.	.	ENSG00000164129	ENST00000338566;ENST00000515560;ENST00000506953	T;T;T	0.70516	-0.49;-0.49;-0.49	5.12	3.92	0.45320	GPCR, rhodopsin-like superfamily (1);	0.095449	0.43416	D	0.000567	T	0.57621	0.2066	L	0.35854	1.095	0.45452	D	0.998426	B	0.22146	0.065	B	0.21360	0.034	T	0.53315	-0.8456	10	0.21540	T	0.41	.	11.4215	0.49985	0.925:0.0:0.075:0.0	.	115	Q15761	NPY5R_HUMAN	R	115	ENSP00000339377:H115R;ENSP00000423917:H115R;ENSP00000423474:H115R	ENSP00000339377:H115R	H	+	2	0	NPY5R	164491219	0.988000	0.35896	0.889000	0.34880	0.881000	0.50899	2.911000	0.48774	2.048000	0.60808	0.482000	0.46254	CAT	-	superfamily_SSF81321,HMMPfam_7tm_1		0.373	NPY5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPY5R	protein_coding	OTTHUMT00000364633.1	A	NM_006174		164491219	+1	no_errors	NM_006174	genbank	human	provisional	54_36p	missense	SNP	0.923	G
TNFSF18	8995	genome.wustl.edu	37	1	173010755	173010755	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr1:173010755A>C	ENST00000404377.3	-	3	352	c.352T>G	c.(352-354)Tta>Gta	p.L118V	RP1-15D23.2_ENST00000432694.2_lincRNA|TNFSF18_ENST00000239468.2_Missense_Mutation_p.L96V	NM_005092.3	NP_005083.2	Q9UNG2	TNF18_HUMAN	tumor necrosis factor (ligand) superfamily, member 18	118					cell-cell signaling (GO:0007267)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|regulation of T cell proliferation (GO:0042129)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)|tumor necrosis factor receptor superfamily binding (GO:0032813)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)	9						CCATAAATTAAATATAAGCCA	0.408																																																0			1											120.0	126.0	124.0					1																	173010755		2203	4299	6502	171277378	SO:0001583	missense	8995			AF117713	CCDS1305.2	1q23	2008-02-05			ENSG00000120337	ENSG00000120337		"""Tumor necrosis factor (ligand) superfamily"""	11932	protein-coding gene	gene with protein product		603898				10037686, 10074428	Standard	NM_005092		Approved	AITRL, TL6, hGITRL	uc001giu.2	Q9UNG2	OTTHUMG00000034835	ENST00000404377.3:c.352T>G	1.37:g.173010755A>C	ENSP00000385470:p.Leu118Val	Somatic		Capture	Illumina GAIIx	4	171277378	A9IQG8|O95852|Q6ISV1	Missense_Mutation	SNP	superfamily_TNF_like,HMMPfam_TNF	p.L118V	ENST00000404377.3	37	c.352	CCDS1305.2	1	.	.	.	.	.	.	.	.	.	.	A	10.18	1.277993	0.23307	.	.	ENSG00000120337	ENST00000404377;ENST00000239468	D;D	0.95171	-3.63;-3.63	5.37	-5.51	0.02568	Tumour necrosis factor (1);Tumour necrosis factor-like (2);	0.893166	0.09263	N	0.826317	T	0.81866	0.4913	L	0.53249	1.67	0.09310	N	1	B	0.23735	0.09	B	0.28011	0.085	T	0.71431	-0.4595	10	0.87932	D	0	0.0223	0.1628	0.00105	0.2393:0.2399:0.236:0.2848	.	118	Q9UNG2	TNF18_HUMAN	V	118;96	ENSP00000385470:L118V;ENSP00000239468:L96V	ENSP00000239468:L96V	L	-	1	2	TNFSF18	171277378	0.215000	0.23574	0.003000	0.11579	0.280000	0.26924	-0.406000	0.07187	-0.945000	0.03681	-0.256000	0.11100	TTA	-	superfamily_TNF_like,HMMPfam_TNF		0.408	TNFSF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNFSF18	protein_coding	OTTHUMT00000084268.2	A	NM_005092		171277378	-1	no_errors	NM_005092	genbank	human	reviewed	54_36p	missense	SNP	0.403	C
TTN	7273	genome.wustl.edu	37	2	179397416	179397416	+	Silent	SNP	A	A	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr2:179397416A>T	ENST00000591111.1	-	308	99227	c.99003T>A	c.(99001-99003)ccT>ccA	p.P33001P	TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN_ENST00000342175.6_Silent_p.P25769P|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Silent_p.P25702P|TTN_ENST00000460472.2_Silent_p.P25577P|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN_ENST00000589042.1_Silent_p.P34642P|TTN_ENST00000342992.6_Silent_p.P32074P|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA			Q8WZ42	TITIN_HUMAN	titin	33001					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGTCATAATCAGGAGAAGGTG	0.443																																																0			2											64.0	62.0	63.0					2																	179397416		1923	4121	6044	179105662	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.99003T>A	2.37:g.179397416A>T		Somatic		Capture	Illumina GAIIx	4	179105662	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,superfamily_Ypt/Rab-GAP domain of gyp1p,superfamily_beta-sandwich domain of Sec23/24,superfamily_vWA-like,HMMPfam_Titin_Z,HMMSmart_SM00406,PatternScan_IG_MHC,HMMPfam_PPAK,HMMPfam_ig,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,PatternScan_RCC1_2	p.L32074Q	ENST00000591111.1	37	c.96221		2																																																																																			-	NULL		0.443	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	A	NM_133378		179105662	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_133378	genbank	human	reviewed	54_36p	missense	SNP	0.903	T
KIAA1614	57710	genome.wustl.edu	37	1	180885527	180885527	+	Silent	SNP	G	G	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr1:180885527G>T	ENST00000367588.4	+	2	343	c.288G>T	c.(286-288)gtG>gtT	p.V96V		NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	96										NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						AGATGACAGTGGCCAAACAGG	0.607																																																0			1											73.0	81.0	78.0					1																	180885527		2017	4176	6193	179152150	SO:0001819	synonymous_variant	57710			AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.288G>T	1.37:g.180885527G>T		Somatic		Capture	Illumina GAIIx	4	179152150	Q5VZ45|Q9HCF8	Silent	SNP	NULL	p.V96	ENST00000367588.4	37	c.288	CCDS41442.1	1																																																																																			-	NULL		0.607	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1614	protein_coding	OTTHUMT00000085151.1	G	XM_046531		179152150	+1	no_errors	NM_020950	genbank	human	validated	54_36p	silent	SNP	0.000	T
TTN	7273	genome.wustl.edu	37	2	179654828	179654828	+	Silent	SNP	A	A	G			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr2:179654828A>G	ENST00000591111.1	-	12	2039	c.1815T>C	c.(1813-1815)acT>acC	p.T605T	TTN_ENST00000360870.5_Silent_p.T605T|TTN_ENST00000342175.6_Silent_p.T559T|TTN_ENST00000359218.5_Silent_p.T559T|TTN_ENST00000460472.2_Silent_p.T559T|TTN_ENST00000589042.1_Silent_p.T605T|TTN_ENST00000342992.6_Silent_p.T605T			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGTTTTCCTAGTTTCCTTCA	0.323																																																0			2											189.0	171.0	177.0					2																	179654828		2203	4299	6502	179363073	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.1815T>C	2.37:g.179654828A>G		Somatic		Capture	Illumina GAIIx	4	179363073	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IGc2,HMMSmart_IG,HMMPfam_Titin_Z,HMMPfam_ig,PatternScan_IG_MHC,PatternScan_THIOL_PROTEASE_HIS	p.T605	ENST00000591111.1	37	c.1815		2																																																																																			-	HMMPfam_Titin_Z		0.323	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	A	NM_133378		179363073	-1	no_errors	NM_133379	genbank	human	reviewed	54_36p	silent	SNP	0.986	G
SMG7	9887	genome.wustl.edu	37	1	183506328	183506328	+	Silent	SNP	A	A	G			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr1:183506328A>G	ENST00000347615.2	+	11	1331	c.1212A>G	c.(1210-1212)gaA>gaG	p.E404E	SMG7_ENST00000515829.2_Silent_p.E404E|SMG7_ENST00000367537.3_Silent_p.E433E|SMG7_ENST00000508461.1_Silent_p.E362E|SMG7_ENST00000507469.1_Silent_p.E404E|SMG7_ENST00000456731.2_Silent_p.E362E	NM_173156.2	NP_775179.1	Q92540	SMG7_HUMAN	SMG7 nonsense mediated mRNA decay factor	404					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(16)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	46						ATCCCCATGAAGAGGACCTCT	0.393																																																0			1											157.0	140.0	146.0					1																	183506328		2203	4300	6503	181772951	SO:0001819	synonymous_variant	9887			D87437	CCDS1355.1, CCDS41445.1, CCDS41445.2, CCDS53444.1, CCDS53445.1	1q25	2013-07-02	2013-07-02	2006-02-16	ENSG00000116698	ENSG00000116698			16792	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog C (S. cerevisiae)"""	610964	"""chromosome 1 open reading frame 16"", ""smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C1orf16		14636577, 15721257	Standard	NM_173156		Approved	KIAA0250, EST1C, SGA56M, SMG-7	uc001gqf.3	Q92540	OTTHUMG00000035221	ENST00000347615.2:c.1212A>G	1.37:g.183506328A>G		Somatic		Capture	Illumina GAIIx	4	181772951	B4DRB2|E9PCI0|E9PEH2|Q5T1Q0|Q6PIE0|Q7Z7H9|Q8IXC1|Q8IXC2	Silent	SNP	HMMPfam_EST1,superfamily_TPR-like	p.E404	ENST00000347615.2	37	c.1212	CCDS1355.1	1																																																																																			-	NULL		0.393	SMG7-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SMG7	protein_coding	OTTHUMT00000085432.1	A	NM_014837		181772951	+1	no_errors	NM_173156	genbank	human	validated	54_36p	silent	SNP	0.998	G
TUBB7P	56604	genome.wustl.edu	37	4	190904382	190904382	+	IGR	SNP	A	A	G	rs74346489	byFrequency	TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr4:190904382A>G								FRG1 (20023 upstream) : RNA5SP174 (31910 downstream)																							TTATCTATGCAGAAGGTCTCA	0.532													.|||	144	0.028754	0.0008	0.0216	5008	,	,		24552	0.0446		0.0308	False		,,,				2504	0.0532															0			4						A		40,3740		9,22,1859	17.0	25.0	23.0			0.2	0.0	4	dbSNP_131	23	407,7673		81,245,3714	no	intergenic				90,267,5573	GG,GA,AA		5.0371,1.0582,3.769			190904382	447,11413	1890	4040	5930	191141376	SO:0001628	intergenic_variant	56604																															4.37:g.190904382A>G		Somatic		Capture	Illumina GAIIx	4	191141376		Missense_Mutation	SNP	superfamily_Tubulin nucleotide-binding domain-like,HMMPfam_Tubulin,PatternScan_TUBULIN,superfamily_Tubulin C-terminal domain-like,HMMPfam_Tubulin_C	p.C201R		37	c.601		4																																																																																			-	superfamily_Tubulin nucleotide-binding domain-like,HMMPfam_Tubulin	0	0.532					TUBB4Q			A			191141376	-1	no_start_codon	NM_020040	genbank	human	validated	54_36p	missense	SNP	1.000	G
MYO1B	4430	genome.wustl.edu	37	2	192267427	192267427	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr2:192267427T>A	ENST00000392318.3	+	24	2786	c.2539T>A	c.(2539-2541)Tac>Aac	p.Y847N	MYO1B_ENST00000304164.4_Missense_Mutation_p.Y847N|MYO1B_ENST00000392316.1_Missense_Mutation_p.Y818N|MYO1B_ENST00000439065.2_Missense_Mutation_p.Y92N|MYO1B_ENST00000339514.4_Intron	NM_001130158.1	NP_001123630.1	O43795	MYO1B_HUMAN	myosin IB	847	IQ 6. {ECO:0000255|PROSITE- ProRule:PRU00116}.				actin filament bundle assembly (GO:0051017)|actin filament organization (GO:0007015)|actin filament-based movement (GO:0030048)|metabolic process (GO:0008152)|post-Golgi vesicle-mediated transport (GO:0006892)	actin filament (GO:0005884)|brush border (GO:0005903)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(1)|central_nervous_system(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(19)|ovary(1)	55			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			CATTTGGGCTTACTGGCTTGG	0.428																																																0			2											169.0	137.0	147.0					2																	192267427		1568	3582	5150	191975672	SO:0001583	missense	4430			L29138	CCDS2311.1, CCDS46477.1	2q12-q34	2011-09-27			ENSG00000128641	ENSG00000128641		"""Myosins / Myosin superfamily : Class I"""	7596	protein-coding gene	gene with protein product		606537				8022818, 8449985	Standard	NM_012223		Approved	myr1	uc010fsg.2	O43795	OTTHUMG00000132718	ENST00000392318.3:c.2539T>A	2.37:g.192267427T>A	ENSP00000376132:p.Tyr847Asn	Somatic		Capture	Illumina GAIIx	4	191975672	O43794|Q7Z6L5	Missense_Mutation	SNP	HMMSmart_SM00242,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Myosin_head,HMMSmart_SM00015,HMMPfam_IQ,HMMPfam_Myosin_TH1	p.Y847N	ENST00000392318.3	37	c.2539	CCDS46477.1	2	.	.	.	.	.	.	.	.	.	.	T	16.25	3.068890	0.55539	.	.	ENSG00000128641	ENST00000392318;ENST00000304164;ENST00000392316;ENST00000439065	D;D;T;T	0.87103	-2.21;-2.21;-0.55;-0.55	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.75012	0.3792	N	0.08118	0	0.51482	D	0.999927	P;P	0.47409	0.895;0.718	B;B	0.40602	0.334;0.216	T	0.76849	-0.2807	10	0.27785	T	0.31	.	14.5673	0.68185	0.0:0.0:0.0:1.0	.	92;847	E7EPB4;O43795	.;MYO1B_HUMAN	N	847;847;818;92	ENSP00000376132:Y847N;ENSP00000306382:Y847N;ENSP00000376130:Y818N;ENSP00000391442:Y92N	ENSP00000306382:Y847N	Y	+	1	0	MYO1B	191975672	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.600000	0.67599	2.180000	0.69256	0.459000	0.35465	TAC	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00015		0.428	MYO1B-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MYO1B	protein_coding	OTTHUMT00000334774.1	T	NM_012223		191975672	+1	no_errors	ENST00000304164	ensembl	human	known	54_36p	missense	SNP	1.000	A
CFH	3075	genome.wustl.edu	37	1	196646645	196646645	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr1:196646645A>T	ENST00000367429.4	+	5	707	c.467A>T	c.(466-468)aAa>aTa	p.K156I	CFH_ENST00000439155.2_Missense_Mutation_p.K156I|CFH_ENST00000359637.2_Intron	NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	156	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						GAGAATGGAAAAATTGTCAGT	0.353																																																0			1											144.0	131.0	135.0					1																	196646645		2203	4300	6503	194913268	SO:0001583	missense	3075			Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.467A>T	1.37:g.196646645A>T	ENSP00000356399:p.Lys156Ile	Somatic		Capture	Illumina GAIIx	4	194913268	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032	p.K156I	ENST00000367429.4	37	c.467	CCDS1385.1	1	.	.	.	.	.	.	.	.	.	.	A	12.12	1.843146	0.32606	.	.	ENSG00000000971	ENST00000367429;ENST00000439155;ENST00000391986	T;T	0.65364	-0.15;-0.15	5.1	-5.62	0.02481	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.48409	0.1498	L	0.31207	0.915	0.09310	N	1	P;B;D	0.56287	0.465;0.156;0.975	B;B;P	0.48166	0.096;0.072;0.569	T	0.49513	-0.8932	9	0.37606	T	0.19	.	7.4066	0.26993	0.6177:0.0:0.2584:0.1239	.	156;156;156	P08603-2;P08603;F8WDX4	.;CFAH_HUMAN;.	I	156	ENSP00000356399:K156I;ENSP00000402656:K156I	ENSP00000356399:K156I	K	+	2	0	CFH	194913268	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.682000	0.05185	-0.708000	0.05015	-0.415000	0.06103	AAA	-	superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032		0.353	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFH	protein_coding	OTTHUMT00000086412.2	A	NM_000186		194913268	+1	no_errors	NM_000186	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
SATB2	23314	genome.wustl.edu	37	2	200137015	200137015	+	Silent	SNP	G	G	A	rs141424911	byFrequency	TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr2:200137015G>A	ENST00000417098.1	-	11	2937	c.2121C>T	c.(2119-2121)tcC>tcT	p.S707S	SATB2_ENST00000260926.5_Silent_p.S707S|SATB2_ENST00000457245.1_Silent_p.S707S|SATB2_ENST00000443023.1_Silent_p.S648S|SATB2_ENST00000428695.1_Silent_p.S589S	NM_001172509.1	NP_001165980.1	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	707					cartilage development (GO:0051216)|cellular response to organic substance (GO:0071310)|chromatin remodeling (GO:0006338)|embryonic pattern specification (GO:0009880)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|osteoblast development (GO:0002076)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(40)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						ACATCTCCTCGGAGCCTTCCT	0.537													G|||	2	0.000399361	0.0015	0.0	5008	,	,		16725	0.0		0.0	False		,,,				2504	0.0				Colon(30;262 767 11040 24421 36230)											0			2						G	,,	7,4399	14.3+/-33.2	0,7,2196	124.0	116.0	119.0		2121,2121,2121	-11.3	0.6	2	dbSNP_134	119	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	SATB2	NM_001172509.1,NM_001172517.1,NM_015265.3	,,	0,8,6495	AA,AG,GG		0.0116,0.1589,0.0615	,,	707/734,707/734,707/734	200137015	8,12998	2203	4300	6503	199845260	SO:0001819	synonymous_variant	23314			AB028957	CCDS2327.1	2q33.1	2011-06-20	2007-02-15		ENSG00000119042	ENSG00000119042		"""Homeoboxes / CUT class"""	21637	protein-coding gene	gene with protein product		608148	"""SATB family member 2"""				Standard	NM_015265		Approved	KIAA1034, FLJ21474	uc002uva.2	Q9UPW6	OTTHUMG00000132767	ENST00000417098.1:c.2121C>T	2.37:g.200137015G>A		Somatic		Capture	Illumina GAIIx	4	199845260	A8K5Z8|Q3ZB87|Q4V763	Silent	SNP	HMMPfam_CUT,HMMSmart_SM00389,superfamily_Homeodomain-like,HMMPfam_Homeobox	p.S707	ENST00000417098.1	37	c.2121	CCDS2327.1	2																																																																																			-	NULL		0.537	SATB2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SATB2	protein_coding	OTTHUMT00000256140.1	G	NM_015265		199845260	-1	no_errors	NM_015265	genbank	human	validated	54_36p	silent	SNP	0.004	A
TRAK2	66008	genome.wustl.edu	37	2	202276317	202276317	+	Intron	SNP	C	C	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr2:202276317C>A	ENST00000332624.3	-	3	520				TRAK2_ENST00000430254.1_Intron	NM_015049.2	NP_055864.2	O60296	TRAK2_HUMAN	trafficking protein, kinesin binding 2						protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|endosome (GO:0005768)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GABA receptor binding (GO:0050811)|receptor binding (GO:0005102)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	23						GTTTTCAATACTCAGGGGAAT	0.358																																																0			2																																								201984562	SO:0001627	intron_variant	729191			AB038951	CCDS2347.1	2q33.1	2012-03-05	2005-12-13	2005-12-13	ENSG00000115993	ENSG00000115993			13206	protein-coding gene	gene with protein product	"""gamma-aminobutyric acid(A) receptor-interacting factor"", ""milton homolog 2 (Drosophila)"", ""O-linked N-acetylglucosamine transferase interacting protein 98"""	607334	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3"""	ALS2CR3		11161814, 16380713, 20230862	Standard	NM_015049		Approved	CALS-C, KIAA0549, GRIF-1, OIP98, MILT2	uc002uyb.4	O60296	OTTHUMG00000132822	ENST00000332624.3:c.92-3997G>T	2.37:g.202276317C>A		Somatic		Capture	Illumina GAIIx	4	201984562	E7EV21|Q8WVH7|Q96NS2|Q9C0K5|Q9C0K6	RNA	SNP	-	NULL	ENST00000332624.3	37	NULL	CCDS2347.1	2																																																																																			-	-		0.358	TRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC729191	protein_coding	OTTHUMT00000256284.3	C	NM_015049		201984562	-1	pseudogene	XR_015913	genbank	human	model	54_36p	rna	SNP	1.000	A
STK16	8576	genome.wustl.edu	37	2	220112996	220112996	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr2:220112996C>G	ENST00000409638.3	+	7	911	c.739C>G	c.(739-741)Ctt>Gtt	p.L247V	TUBA4A_ENST00000498660.1_5'Flank|GLB1L_ENST00000392089.2_5'Flank|STK16_ENST00000396738.2_Missense_Mutation_p.L247V|STK16_ENST00000409260.1_Missense_Mutation_p.L292V|GLB1L_ENST00000295759.7_5'Flank|STK16_ENST00000409743.1_Missense_Mutation_p.L215V|STK16_ENST00000409516.3_Missense_Mutation_p.L129V|GLB1L_ENST00000356283.3_5'Flank	NM_001008910.2	NP_001008910.1	O75716	STK16_HUMAN	serine/threonine kinase 16	247	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to transforming growth factor beta stimulus (GO:0071560)|protein autophosphorylation (GO:0046777)	Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			skin(1)	1		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CAGTGTGGCCCTTGCTGTGCA	0.512																																					Pancreas(34;887 922 17165 36961 39622)											0			2											160.0	153.0	155.0					2																	220112996		2074	4221	6295	219821240	SO:0001583	missense	8576			AF060798	CCDS42822.1	2q35	2010-04-16			ENSG00000115661	ENSG00000115661			11394	protein-coding gene	gene with protein product		604719				9712705	Standard	NM_001008910		Approved	PKL12, MPSK	uc002vko.2	O75716	OTTHUMG00000154520	ENST00000409638.3:c.739C>G	2.37:g.220112996C>G	ENSP00000386928:p.Leu247Val	Somatic		Capture	Illumina GAIIx	4	219821240	A8K9H9|Q5U0F8|Q96KI2|Q9BUH4|Q9UEN3|Q9UP78	Missense_Mutation	SNP	PatternScan_PROTEIN_KINASE_ATP,superfamily_Kinase_like,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ST	p.L247V	ENST00000409638.3	37	c.739	CCDS42822.1	2	.	.	.	.	.	.	.	.	.	.	C	16.57	3.159319	0.57368	.	.	ENSG00000115661	ENST00000409638;ENST00000396738;ENST00000409516;ENST00000409260;ENST00000409743	T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17;-0.17	5.12	4.16	0.48862	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.74749	0.3757	M	0.75447	2.3	0.80722	D	1	D;D;D	0.61697	0.99;0.975;0.987	D;D;D	0.77004	0.989;0.957;0.983	T	0.75866	-0.3166	10	0.66056	D	0.02	-7.591	8.2131	0.31494	0.0:0.7804:0.0:0.2196	.	129;292;247	B4DPS1;B8ZZN3;O75716	.;.;STK16_HUMAN	V	247;247;129;292;215	ENSP00000386928:L247V;ENSP00000379964:L247V;ENSP00000386309:L129V;ENSP00000387156:L292V;ENSP00000386553:L215V	ENSP00000379964:L247V	L	+	1	0	STK16	219821240	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.370000	0.52372	2.664000	0.90586	0.655000	0.94253	CTT	-	superfamily_Kinase_like,HMMPfam_Pkinase		0.512	STK16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK16	protein_coding	OTTHUMT00000335679.1	C			219821240	+1	no_errors	NM_001008910	genbank	human	validated	54_36p	missense	SNP	1.000	G
RYR2	6262	genome.wustl.edu	37	1	237780703	237780703	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr1:237780703A>T	ENST00000366574.2	+	38	6150	c.5833A>T	c.(5833-5835)Aac>Tac	p.N1945Y	RYR2_ENST00000360064.6_Missense_Mutation_p.N1943Y|RYR2_ENST00000542537.1_Missense_Mutation_p.N1929Y	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1945	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTTCCGATACAACGAAGTCAT	0.458																																																0			1											103.0	96.0	98.0					1																	237780703		1997	4198	6195	235847326	SO:0001583	missense	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.5833A>T	1.37:g.237780703A>T	ENSP00000355533:p.Asn1945Tyr	Somatic		Capture	Illumina GAIIx	4	235847326	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	HMMPfam_Ins145_P3_rec,HMMSmart_SM00472,HMMPfam_MIR,superfamily_MIR domain (Pfam 02815),HMMPfam_RYDR_ITPR,HMMPfam_SPRY,HMMSmart_SM00449,HMMPfam_RyR,HMMPfam_RIH_assoc,superfamily_EF-hand,HMMPfam_RR_TM4-6,HMMPfam_Ion_trans	p.N1945Y	ENST00000366574.2	37	c.5833	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	A	18.81	3.702539	0.68501	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.74002	-0.8;-0.8;-0.8	5.39	5.39	0.77823	.	0.000000	0.64402	D	0.000002	T	0.82098	0.4963	L	0.57536	1.79	0.80722	D	1	D	0.69078	0.997	P	0.62089	0.898	T	0.82579	-0.0387	10	0.46703	T	0.11	.	15.4156	0.74966	1.0:0.0:0.0:0.0	.	1945	Q92736	RYR2_HUMAN	Y	1945;1943;1929	ENSP00000355533:N1945Y;ENSP00000353174:N1943Y;ENSP00000443798:N1929Y	ENSP00000353174:N1943Y	N	+	1	0	RYR2	235847326	1.000000	0.71417	0.679000	0.29978	0.944000	0.59088	9.287000	0.95975	2.036000	0.60181	0.528000	0.53228	AAC	-	NULL		0.458	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	protein_coding	OTTHUMT00000095402.2	A	NM_001035		235847326	+1	no_errors	NM_001035	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
PLD5	200150	genome.wustl.edu	37	1	242253391	242253391	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr1:242253391T>C	ENST00000536534.2	-	10	1617	c.1376A>G	c.(1375-1377)aAt>aGt	p.N459S	PLD5_ENST00000442594.2_Missense_Mutation_p.N367S|PLD5_ENST00000427495.1_Missense_Mutation_p.N397S			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	459	PLD phosphodiesterase 2.					integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			AGTGAAATCATTCCCTACCCA	0.398																																																0			1											109.0	105.0	106.0					1																	242253391		2203	4300	6503	240320014	SO:0001583	missense	200150			AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.1376A>G	1.37:g.242253391T>C	ENSP00000440896:p.Asn459Ser	Somatic		Capture	Illumina GAIIx	4	240320014	A1KXV0|B7Z324|Q494U9|Q8NB22	Missense_Mutation	SNP	superfamily_SSF56024,HMMPfam_PLDc,HMMSmart_PLDc,HMMPfam_PLD_envelope	p.N367S	ENST00000536534.2	37	c.1100	CCDS1621.2	1	.	.	.	.	.	.	.	.	.	.	T	10.93	1.489793	0.26686	.	.	ENSG00000180287	ENST00000427495;ENST00000442594;ENST00000536534	T;T;T	0.20598	2.06;2.06;2.06	5.77	5.77	0.91146	Phospholipase D/Transphosphatidylase (1);	0.049461	0.85682	D	0.000000	T	0.14657	0.0354	N	0.24115	0.695	0.36972	D	0.893898	B;B;B	0.24823	0.112;0.08;0.112	B;B;B	0.22601	0.04;0.015;0.029	T	0.14364	-1.0475	10	0.35671	T	0.21	-30.266	11.0619	0.47953	0.0:0.0:0.1548:0.8451	.	367;459;397	Q8N7P1-2;Q8N7P1;Q8N7P1-4	.;PLD5_HUMAN;.	S	397;367;459	ENSP00000401285:N397S;ENSP00000414188:N367S;ENSP00000440896:N459S	ENSP00000401285:N397S	N	-	2	0	PLD5	240320014	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	3.848000	0.55903	2.199000	0.70637	0.533000	0.62120	AAT	-	superfamily_SSF56024,HMMPfam_PLDc,HMMSmart_PLDc		0.398	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLD5	protein_coding	OTTHUMT00000397213.2	T	NM_152666		240320014	-1	no_errors	NM_152666	genbank	human	provisional	54_36p	missense	SNP	1.000	C
PPP1R7	5510	genome.wustl.edu	37	2	242102756	242102756	+	Silent	SNP	C	C	T			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr2:242102756C>T	ENST00000234038.6	+	7	1128	c.654C>T	c.(652-654)aaC>aaT	p.N218N	PPP1R7_ENST00000401987.1_Silent_p.N175N|PPP1R7_ENST00000402734.1_Silent_p.N159N|PPP1R7_ENST00000485630.1_3'UTR|PPP1R7_ENST00000406106.3_Silent_p.N218N|PPP1R7_ENST00000272983.8_Silent_p.N175N|PPP1R7_ENST00000407025.1_Silent_p.N218N|PPP1R7_ENST00000404405.3_Silent_p.N212N	NM_001282412.1|NM_001282413.1|NM_002712.1	NP_001269341.1|NP_001269342.1|NP_002703.1	Q15435	PP1R7_HUMAN	protein phosphatase 1, regulatory subunit 7	218					positive regulation of protein dephosphorylation (GO:0035307)|regulation of catalytic activity (GO:0050790)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	enzyme regulator activity (GO:0030234)|protein phosphatase type 1 regulator activity (GO:0008599)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)	23		all_cancers(19;6.1e-33)|all_epithelial(40;1.07e-13)|Breast(86;0.000141)|Renal(207;0.00528)|all_lung(227;0.0446)|Ovarian(221;0.104)|Lung NSC(271;0.115)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.92e-32)|all cancers(36;5.35e-29)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-14)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.24e-08)|BRCA - Breast invasive adenocarcinoma(100;3.56e-06)|Lung(119;0.000588)|LUSC - Lung squamous cell carcinoma(224;0.0048)|Colorectal(34;0.0137)|COAD - Colon adenocarcinoma(134;0.096)		TGGGGAAAAACAAAATTACTA	0.498																																					NSCLC(62;446 1299 5417 11238 27640)											0			2											136.0	147.0	144.0					2																	242102756		2203	4300	6503	241751429	SO:0001819	synonymous_variant	5510			AF067136	CCDS2546.1, CCDS63190.1, CCDS63192.1, CCDS63193.1, CCDS63194.1	2q37.3	2012-04-17	2011-10-04		ENSG00000115685	ENSG00000115685		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9295	protein-coding gene	gene with protein product		602877	"""protein phosphatase 1, regulatory (inhibitor) subunit 7"""			7498485, 7670491, 10231361	Standard	NM_001282413		Approved	sds22	uc002wat.1	Q15435	OTTHUMG00000133390	ENST00000234038.6:c.654C>T	2.37:g.242102756C>T		Somatic		Capture	Illumina GAIIx	4	241751429	B4DFD4|B5MCY6|Q9UQE5|Q9UQE6|Q9Y6K4	Silent	SNP	superfamily_L domain-like,HMMSmart_SM00365,HMMSmart_SM00369,HMMPfam_LRR_1,HMMSmart_SM00446	p.N218	ENST00000234038.6	37	c.654	CCDS2546.1	2	.	.	.	.	.	.	.	.	.	.	C	9.277	1.047216	0.19827	.	.	ENSG00000115685	ENST00000450367	.	.	.	5.03	3.19	0.36642	.	.	.	.	.	T	0.58538	0.2129	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55042	-0.8202	4	.	.	.	-32.3349	8.7585	0.34661	0.0:0.6944:0.0:0.3056	.	.	.	.	I	193	.	.	T	+	2	0	PPP1R7	241751429	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.383000	0.44354	1.245000	0.43885	-0.150000	0.13652	ACA	-	superfamily_L domain-like,HMMSmart_SM00369,HMMSmart_SM00365,HMMPfam_LRR_1		0.498	PPP1R7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R7	protein_coding	OTTHUMT00000257244.4	C	NM_002712		241751429	+1	no_errors	NM_002712	genbank	human	provisional	54_36p	silent	SNP	1.000	T
CNST	163882	genome.wustl.edu	37	1	246784865	246784865	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr1:246784865T>C	ENST00000366513.4	+	3	783	c.514T>C	c.(514-516)Tct>Cct	p.S172P	CNST_ENST00000366512.3_Missense_Mutation_p.S172P|CNST_ENST00000483271.1_3'UTR	NM_152609.2	NP_689822.2	Q6PJW8	CNST_HUMAN	consortin, connexin sorting protein	172					negative regulation of phosphatase activity (GO:0010923)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	connexin binding (GO:0071253)|phosphatase binding (GO:0019902)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|urinary_tract(2)	28						TGTTCTGCAGTCTCTGTTTTC	0.453																																																0			1											204.0	201.0	202.0					1																	246784865		2203	4300	6503	244851488	SO:0001583	missense	163882			AK056563	CCDS1628.1, CCDS44343.1	1q44	2012-04-17	2009-11-03	2009-11-03	ENSG00000162852	ENSG00000162852		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26486	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 64"""	613439	"""chromosome 1 open reading frame 71"""	C1orf71		19864490	Standard	NM_152609		Approved	FLJ32001, PPP1R64	uc001ibp.3	Q6PJW8	OTTHUMG00000040090	ENST00000366513.4:c.514T>C	1.37:g.246784865T>C	ENSP00000355470:p.Ser172Pro	Somatic		Capture	Illumina GAIIx	4	244851488	Q5VSY9|Q5VTM7|Q8IYA9|Q8N3L5|Q8NB09|Q8TEI2|Q96MR5	Missense_Mutation	SNP	NULL	p.S172P	ENST00000366513.4	37	c.514	CCDS1628.1	1	.	.	.	.	.	.	.	.	.	.	T	10.35	1.326515	0.24080	.	.	ENSG00000162852	ENST00000366513;ENST00000366512	T;T	0.24538	1.85;1.85	5.46	-0.543	0.11851	.	0.417567	0.23762	N	0.044806	T	0.12902	0.0313	N	0.21142	0.635	0.09310	N	1	B;B	0.14438	0.01;0.01	B;B	0.11329	0.006;0.006	T	0.14117	-1.0484	10	0.37606	T	0.19	-18.4946	4.5269	0.11986	0.0:0.2127:0.3071:0.4801	.	172;172	Q6PJW8;Q6PJW8-2	CNST_HUMAN;.	P	172	ENSP00000355470:S172P;ENSP00000355469:S172P	ENSP00000355469:S172P	S	+	1	0	CNST	244851488	0.930000	0.31532	0.003000	0.11579	0.672000	0.39443	0.783000	0.26802	-0.349000	0.08274	0.533000	0.62120	TCT	-	NULL		0.453	CNST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf71	protein_coding	OTTHUMT00000096780.1	T	NM_152609		244851488	+1	no_errors	NM_152609	genbank	human	validated	54_36p	missense	SNP	0.451	C
PRKAR1B	5575	genome.wustl.edu	37	7	720328	720364	+	Splice_Site	DEL	TGACTTTTGCCGCGCCAAAATCTGCCTGTTTTCTTCC	TGACTTTTGCCGCGCCAAAATCTGCCTGTTTTCTTCC	-	rs147480983|rs183383238|rs374729888|rs370909605|rs140110814|rs150538055|rs530700943|rs371160585|rs143819086	byFrequency	TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	TGACTTTTGCCGCGCCAAAATCTGCCTGTTTTCTTCC	TGACTTTTGCCGCGCCAAAATCTGCCTGTTTTCTTCC					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr7:720328_720364delTGACTTTTGCCGCGCCAAAATCTGCCTGTTTTCTTCC	ENST00000406797.1	-	3	352_387	c.178_213delGGAAGAAAACAGGCAGATTTTGGCGCGGCAAAAGTCA	c.(178-213)ggaagaaaacaggcagattttggcgcggcaaaagtcdel	p.GRKQADFGAAKV60fs	PRKAR1B_ENST00000544935.1_Splice_Site_p.GRKQADFGAAKV60fs|PRKAR1B_ENST00000403562.1_Splice_Site_p.GRKQADFGAAKV60fs|PRKAR1B_ENST00000537384.1_Splice_Site_p.GRKQADFGAAKV60fs|PRKAR1B_ENST00000360274.4_Splice_Site_p.GRKQADFGAAKV60fs	NM_001164761.1	NP_001158233.1	P31321	KAP1_HUMAN	protein kinase, cAMP-dependent, regulatory, type I, beta	60	Dimerization and phosphorylation.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)			endometrium(4)|large_intestine(1)|liver(1)|lung(10)|prostate(1)	17		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|Epithelial(4;5.75e-19)|OV - Ovarian serous cystadenocarcinoma(56;2.01e-18)|all cancers(6;3.96e-16)|BRCA - Breast invasive adenocarcinoma(126;0.152)		ACTGTGAGTTTGACTTTTGCCGCGCCAAAATCTGCCTGTTTTCTTCCTGTGTGGGAG	0.608																																																0			7																																								686890	SO:0001630	splice_region_variant	5575			M65066	CCDS34579.1	7p22.3	2013-09-19			ENSG00000188191	ENSG00000188191	2.7.11.1		9390	protein-coding gene	gene with protein product		176911				1358799, 3479018	Standard	NM_002735		Approved		uc003siw.2	P31321	OTTHUMG00000151411	ENST00000406797.1:c.178-1GGAAGAAAACAGGCAGATTTTGGCGCGGCAAAAGTCA>-	7.37:g.720328_720364delTGACTTTTGCCGCGCCAAAATCTGCCTGTTTTCTTCC		Somatic		Capture	Illumina GAIIx	4	686854	Q8N422	In_Frame_Del	DEL	HMMPfam_RIIa,HMMSmart_RIIa,superfamily_cNMP_binding,HMMSmart_cNMP,HMMPfam_cNMP_binding,PatternScan_CNMP_BINDING_1,PatternScan_CNMP_BINDING_2	p.EENRQILARQKS60in_frame_del	ENST00000406797.1	37	c.213_178	CCDS34579.1	7																																																																																			(deletion:cds_exon[686719,686889], intron[686890,717491])	HMMPfam_RIIa,HMMSmart_RIIa		0.608	PRKAR1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRKAR1B	protein_coding	OTTHUMT00000322525.1	TGACTTTTGCCGCGCCAAAATCTGCCTGTTTTCTTCC		Frame_Shift_Del	686890	-1	no_errors	NM_002735	genbank	human	provisional	54_36p	in_frame_del	DEL	0.623:0.997:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.963:0.953:0.953:0.852:0.985:0.989:0.987:0.827:0.265:0.210:0.945:1.000:1.000:1.000:1.000:0.995:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
TP53	7157	genome.wustl.edu	37	17	7578275	7578275	+	Frame_Shift_Del	DEL	G	G	-			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr17:7578275delG	ENST00000269305.4	-	6	763	c.574delC	c.(574-576)cagfs	p.Q192fs	TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Frame_Shift_Del_p.Q192fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.Q192fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.Q192fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.Q192fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.Q192fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	192	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Q -> H (in sporadic cancers; somatic mutation).|Q -> K (in a sporadic cancer; somatic mutation).|Q -> L (in sporadic cancers; somatic mutation).|Q -> P (in sporadic cancers; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Q192*(83)|p.0?(8)|p.Q99*(6)|p.?(6)|p.Q60*(6)|p.P191del(4)|p.P191delP(4)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.P191fs*53(2)|p.G187fs*16(2)|p.P59delP(2)|p.P98delP(2)|p.P191fs*6(1)|p.A189_Q192>E(1)|p.P59_E66>Q(1)|p.P191fs*15(1)|p.P191_Q192delPQ(1)|p.Q192K(1)|p.P98_E105>Q(1)|p.A189fs*53(1)|p.Q192del(1)|p.Q192fs*16(1)|p.L188_P191del(1)|p.Q192fs*30(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATAAGATGCTGAGGAGGGGCC	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	144	Substitution - Nonsense(95)|Deletion - In frame(19)|Whole gene deletion(8)|Deletion - Frameshift(7)|Complex - deletion inframe(6)|Unknown(6)|Insertion - Frameshift(1)|Complex - frameshift(1)|Substitution - Missense(1)	breast(26)|ovary(20)|urinary_tract(15)|lung(12)|upper_aerodigestive_tract(10)|skin(8)|biliary_tract(7)|oesophagus(7)|large_intestine(6)|kidney(6)|stomach(5)|haematopoietic_and_lymphoid_tissue(5)|liver(5)|bone(4)|central_nervous_system(3)|pancreas(2)|cervix(1)|endometrium(1)|eye(1)	17											89.0	80.0	83.0					17																	7578275		2203	4300	6503	7519000	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.574delC	17.37:g.7578275delG	ENSP00000269305:p.Gln192fs	Somatic		Capture	Illumina GAIIx	4	7519000	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.Q192fs	ENST00000269305.4	37	c.574	CCDS11118.1	17																																																																																			(deletion:cds_exon[7518902,7519014])	HMMPfam_P53,superfamily_p53-like transcription factors		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546		7519000	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000	-
MPRIP	23164	genome.wustl.edu	37	17	17039562	17039564	+	In_Frame_Del	DEL	CAG	CAG	-	rs3833098|rs113250356|rs35599326|rs202138172	byFrequency	TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	CAG	CAG					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr17:17039562_17039564delCAG	ENST00000341712.4	+	6	534_536	c.534_536delCAG	c.(532-537)accagc>acc	p.S189del	MPRIP_ENST00000444976.1_In_Frame_Del_p.S189del|MPRIP_ENST00000395804.3_In_Frame_Del_p.S189del|MPRIP_ENST00000395811.5_In_Frame_Del_p.S189del			Q6WCQ1	MPRIP_HUMAN	myosin phosphatase Rho interacting protein	189	Interaction with F-actin. {ECO:0000250}.|Ser-rich.			Missing (in Ref. 1; AAQ63176, 3; BAC78198 and 5; CAD39169). {ECO:0000305}.|Missing (in Ref. 2; BAD89507 and 6; AAH09982). {ECO:0000305}.		actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)		p.S189delS(1)		biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	31						TGGCTGTTACcagcagcagcagc	0.601																																																1	Deletion - In frame(1)	kidney(1)	17																																								16980289	SO:0001651	inframe_deletion	23164			BC014102	CCDS32578.1, CCDS42268.1	17p11.2	2013-01-10			ENSG00000133030	ENSG00000133030		"""Pleckstrin homology (PH) domain containing"""	30321	protein-coding gene	gene with protein product	"""Rho interacting protein 3"""	612935				10048485	Standard	NM_201274		Approved	RHOIP3, M-RIP, p116Rip	uc002gqy.2	Q6WCQ1	OTTHUMG00000059276	ENST00000341712.4:c.534_536delCAG	17.37:g.17039571_17039573delCAG	ENSP00000342379:p.Ser189del	Somatic		Capture	Illumina GAIIx	4	16980287	Q3KQZ5|Q5FB94|Q6DHW2|Q7Z5Y2|Q8N390|Q96G40	In_Frame_Del	DEL	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH	p.S182in_frame_del	ENST00000341712.4	37	c.534_536	CCDS32578.1	17																																																																																			(deletion:cds_exon[16980258,16980489])	NULL		0.601	MPRIP-002	KNOWN	basic|CCDS	protein_coding	MPRIP	protein_coding	OTTHUMT00000131587.1	CAG	NM_015134		16980289	+1	no_errors	NM_015134	genbank	human	validated	54_36p	in_frame_del	DEL	0.997:0.998:0.998	-
Unknown	0	genome.wustl.edu	37	6	51275496	51275537	+	IGR	DEL	GTCCTTTCCGGGGAGCCTGGTGCGAGCTCCGCGGGCGCCGGA	GTCCTTTCCGGGGAGCCTGGTGCGAGCTCCGCGGGCGCCGGA	-	rs539214160|rs535140497	byFrequency	TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	GTCCTTTCCGGGGAGCCTGGTGCGAGCTCCGCGGGCGCCGGA	GTCCTTTCCGGGGAGCCTGGTGCGAGCTCCGCGGGCGCCGGA					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr6:51275496_51275537delGTCCTTTCCGGGGAGCCTGGTGCGAGCTCCGCGGGCGCCGGA								TFAP2B (460170 upstream) : SNORD66 (53950 downstream)																							AACACGCCCCGTCCTTTCCGGGGAGCCTGGTGCGAGCTCCGCGGGCGCCGGAGCTCAGCAAG	0.603																																																0			6																																								51383496	SO:0001628	intergenic_variant	646517																															6.37:g.51275496_51275537delGTCCTTTCCGGGGAGCCTGGTGCGAGCTCCGCGGGCGCCGGA		Somatic		Capture	Illumina GAIIx	4	51383455		RNA	DEL	-	NULL		37	NULL		6																																																																																			(deletion:rna[51382842,51383471], flank[51383472,51433471])	-	0	0.603					LOC646517			GTCCTTTCCGGGGAGCCTGGTGCGAGCTCCGCGGGCGCCGGA			51383496	-1	pseudogene	XR_017669	genbank	human	model	54_36p	rna	DEL	0.000:0.000:0.001:0.004:0.003:0.002:0.001:0.001:0.001:0.000:0.000:0.000:0.000:0.000:0.001:0.001:0.002:0.002:0.003:0.003:0.001:0.001:0.001:0.002:0.002:0.005:0.005:0.005:0.006:0.005:0.003:0.001:0.001:0.000:0.001:0.001:0.003:0.004:0.003:0.006:0.007:0.007	-
NPIPB15	440348	genome.wustl.edu	37	16	74425400	74425402	+	In_Frame_Del	DEL	CAA	CAA	-	rs370078939		TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	CAA	CAA					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr16:74425400_74425402delCAA	ENST00000429990.1	+	7	850_852	c.754_756delCAA	c.(754-756)caadel	p.Q253del				A6NHN6	NPB15_HUMAN	nuclear pore complex interacting protein family, member B15	253	Pro-rich.					extracellular region (GO:0005576)											TCCTCCAACTCAACAACATTCTA	0.517																																																0			16																																								72982903	SO:0001651	inframe_deletion	0			BC160029		16q22.3	2013-06-11	2013-06-11	2013-06-11	ENSG00000196436	ENSG00000196436			34409	protein-coding gene	gene with protein product			"""nuclear pore complex interacting protein-like 2"""	NPIPL2			Standard	XM_005256273		Approved	LOC440348	uc010vmt.1	A6NHN6	OTTHUMG00000156916	ENST00000429990.1:c.754_756delCAA	16.37:g.74425403_74425405delCAA	ENSP00000411140:p.Gln253del	Somatic		Capture	Illumina GAIIx	4	72982901	C9J9U8	In_Frame_Del	DEL	HMMPfam_NPIP	p.Q192in_frame_del	ENST00000429990.1	37	c.571_573		16																																																																																			(deletion:cds_exon[72982790,72983479])	HMMPfam_NPIP		0.517	NPIPB15-001	KNOWN	basic|appris_principal	protein_coding	NPIPL2	protein_coding	OTTHUMT00000346597.2	CAA	NM_001018059		72982903	+1	no_errors	ENST00000355290	ensembl	human	known	54_36p	in_frame_del	DEL	0.000:0.000:0.000	-
IFIT1B	439996	genome.wustl.edu	37	10	91143824	91143848	+	Frame_Shift_Del	DEL	TATGTCTTTCAATATGCAGCCAAGT	TATGTCTTTCAATATGCAGCCAAGT	-	rs142404774|rs543130541|rs1062963|rs148786050|rs199716259		TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	TATGTCTTTCAATATGCAGCCAAGT	TATGTCTTTCAATATGCAGCCAAGT					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr10:91143824_91143848delTATGTCTTTCAATATGCAGCCAAGT	ENST00000371809.3	+	2	834_858	c.754_778delTATGTCTTTCAATATGCAGCCAAGT	c.(754-780)tatgtctttcaatatgcagccaagtttfs	p.YVFQYAAKF252fs	LIPA_ENST00000371837.1_Intron	NM_001010987.2	NP_001010987.1	Q5T764	IFT1B_HUMAN	interferon-induced protein with tetratricopeptide repeats 1B	252										endometrium(2)|large_intestine(3)|lung(8)	13						TTCACAGGCCTATGTCTTTCAATATGCAGCCAAGTTTTATCGAAG	0.449																																																0			10																																								91133828	SO:0001589	frameshift_variant	439996				CCDS31242.1	10q23.31	2014-05-22	2010-03-22	2010-03-22	ENSG00000204010	ENSG00000204010		"""Tetratricopeptide (TTC) repeat domain containing"""	23442	protein-coding gene	gene with protein product			"""interferon-induced protein with tetratricopeptide repeats 1-like"""	IFIT1L			Standard	NM_001010987		Approved	bA149I23.6	uc001kgh.3	Q5T764	OTTHUMG00000018709	ENST00000371809.3:c.754_778delTATGTCTTTCAATATGCAGCCAAGT	10.37:g.91143824_91143848delTATGTCTTTCAATATGCAGCCAAGT	ENSP00000360874:p.Tyr252fs	Somatic		Capture	Illumina GAIIx	4	91133804	A7E245	Frame_Shift_Del	DEL	HMMPfam_TPR_1,HMMSmart_SM00028,superfamily_TPR-like	p.Y252fs	ENST00000371809.3	37	c.754_778	CCDS31242.1	10																																																																																			(deletion:cds_exon[91133056,91134475])	superfamily_TPR-like,HMMPfam_TPR_1,HMMSmart_SM00028		0.449	IFIT1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFIT1L	protein_coding	OTTHUMT00000049296.3	TATGTCTTTCAATATGCAGCCAAGT	NM_001010987		91133828	+1	no_errors	NM_001010987	genbank	human	provisional	54_36p	frame_shift_del	DEL	0.051:0.708:0.797:0.804:0.946:0.975:0.970:0.951:0.941:0.935:0.956:0.967:0.952:0.995:1.000:0.998:1.000:0.998:0.997:1.000:0.996:0.996:1.000:0.997:0.995	-
FXR1	8087	genome.wustl.edu	37	3	180685868	180685869	+	Frame_Shift_Ins	INS	-	-	A			TCGA-61-1910-01A-01W-0639-09	TCGA-61-1910-11A-01W-0640-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3d4c15e7-3706-41ec-9443-38d89c9646aa	6f5d55e5-eb09-4296-a789-b326d3d50fdd	g.chr3:180685868_180685869insA	ENST00000357559.4	+	14	1612_1613	c.1228_1229insA	c.(1228-1230)gaafs	p.E410fs	FXR1_ENST00000491062.1_Frame_Shift_Ins_p.E361fs|FXR1_ENST00000445140.2_Frame_Shift_Ins_p.E410fs|FXR1_ENST00000305586.7_Frame_Shift_Ins_p.E325fs|FXR1_ENST00000468861.1_Frame_Shift_Ins_p.E325fs|FXR1_ENST00000480918.1_Frame_Shift_Ins_p.E397fs	NM_001013438.2|NM_005087.3	NP_001013456.1|NP_005078.2	P51114	FXR1_HUMAN	fragile X mental retardation, autosomal homolog 1	410					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of translation (GO:0017148)	costamere (GO:0043034)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysome (GO:0005844)	G-quadruplex RNA binding (GO:0002151)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|large_intestine(5)|lung(12)|skin(2)	26	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			TAACCCCTCTGAAACGGAATCT	0.426																																																0			3																																								182168563	SO:0001589	frameshift_variant	8087			M67468	CCDS3238.1, CCDS33894.1, CCDS46965.1	3q28	2014-01-28			ENSG00000114416	ENSG00000114416			4023	protein-coding gene	gene with protein product		600819				7781595, 9642279	Standard	NM_005087		Approved		uc003fkq.3	P51114	OTTHUMG00000158138	ENST00000357559.4:c.1231dupA	3.37:g.180685871_180685871dupA	ENSP00000350170:p.Glu410fs	Somatic		Capture	Illumina GAIIx	4	182168562	A8K9B8|Q7Z450|Q8N6R8	Frame_Shift_Ins	INS	HMMPfam_Agenet,superfamily_Eukaryotic type KH-domain (KH-domain type I),HMMSmart_SM00322,HMMPfam_KH_1	p.T411fs	ENST00000357559.4	37	c.1228_1229	CCDS3238.1	3																																																																																			-	NULL		0.426	FXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FXR1	protein_coding	OTTHUMT00000350265.5	-			182168563	+1	no_errors	NM_005087	genbank	human	reviewed	54_36p	frame_shift_ins	INS	1.000:1.000	A
