#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
KANK1	23189	genome.wustl.edu	37	9	712314	712314	+	Silent	SNP	G	G	T			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr9:712314G>T	ENST00000382303.1	+	7	2200	c.1548G>T	c.(1546-1548)gtG>gtT	p.V516V	KANK1_ENST00000382297.2_Silent_p.V516V|KANK1_ENST00000489369.1_3'UTR|KANK1_ENST00000382293.3_Silent_p.V358V	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	516					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		GTAAGGTGGTGGAGGCAGTGG	0.537																																																0			9											68.0	66.0	67.0					9																	712314		2203	4300	6503	702314	SO:0001819	synonymous_variant	23189			AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.1548G>T	9.37:g.712314G>T		Somatic		Capture	Illumina GAIIx	4	702314	A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Silent	SNP	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank	p.V516	ENST00000382303.1	37	c.1548	CCDS34976.1	9																																																																																			-	superfamily_ANK		0.537	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KANK1	protein_coding	OTTHUMT00000051484.2	G	NM_015158		702314	+1	no_errors	NM_015158	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
PCGF3	10336	genome.wustl.edu	37	4	727539	727539	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr4:727539C>G	ENST00000362003.5	+	4	465	c.70C>G	c.(70-72)Ctc>Gtc	p.L24V	PCGF3_ENST00000400151.2_Missense_Mutation_p.L24V|PCGF3_ENST00000470161.2_Missense_Mutation_p.L24V|PCGF3_ENST00000521023.2_5'UTR|PCGF3_ENST00000505655.2_Missense_Mutation_p.L24V|PCGF3_ENST00000482726.1_3'UTR	NM_006315.4	NP_006306.2	Q3KNV8	PCGF3_HUMAN	polycomb group ring finger 3	24					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(1)	7						CAGCGGGTACCTCATCGACGC	0.602																																																0			4											74.0	84.0	80.0					4																	727539		2170	4254	6424	717539	SO:0001583	missense	10336			AK093869	CCDS3339.2	4p16.3	2013-01-09	2005-01-17	2005-01-19	ENSG00000185619	ENSG00000185619		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	10066	protein-coding gene	gene with protein product			"""ring finger protein 3"""	RNF3			Standard	XM_005272250		Approved	FLJ36550, DONG1, RNF3A, MGC40413	uc003gbe.3	Q3KNV8	OTTHUMG00000119000	ENST00000362003.5:c.70C>G	4.37:g.727539C>G	ENSP00000354724:p.Leu24Val	Somatic		Capture	Illumina GAIIx	4	717539	D3DVN1|O15262	Missense_Mutation	SNP	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1	p.L24V	ENST00000362003.5	37	c.70	CCDS3339.2	4	.	.	.	.	.	.	.	.	.	.	C	27.5	4.834667	0.91036	.	.	ENSG00000185619	ENST00000419774;ENST00000362003;ENST00000427463;ENST00000470161;ENST00000400151;ENST00000433814;ENST00000505655	D;D;T;D;T;D;D	0.86497	-2.13;-2.13;-0.41;-2.13;0.28;-2.13;-2.13	5.22	5.22	0.72569	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.64402	D	0.000001	D	0.93409	0.7898	M	0.81942	2.565	0.80722	D	1	D	0.89917	1.0	D	0.72338	0.977	D	0.93997	0.7272	10	0.72032	D	0.01	-29.5464	16.6341	0.85042	0.0:1.0:0.0:0.0	.	24	Q3KNV8	PCGF3_HUMAN	V	24	ENSP00000416279:L24V;ENSP00000354724:L24V;ENSP00000401431:L24V;ENSP00000420489:L24V;ENSP00000383015:L24V;ENSP00000398493:L24V;ENSP00000423393:L24V	ENSP00000354724:L24V	L	+	1	0	PCGF3	717539	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	5.278000	0.65592	2.598000	0.87819	0.655000	0.94253	CTC	-	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4		0.602	PCGF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCGF3	protein_coding	OTTHUMT00000239197.2	C	NM_006315		717539	+1	no_errors	NM_006315	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
PSMF1	9491	genome.wustl.edu	37	20	1115936	1115936	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr20:1115936C>T	ENST00000335877.6	+	4	714	c.538C>T	c.(538-540)Cgg>Tgg	p.R180W	PSMF1_ENST00000381898.4_Missense_Mutation_p.R92W|PSMF1_ENST00000484891.1_3'UTR|PSMF1_ENST00000438768.2_Intron|PSMF1_ENST00000333082.3_Missense_Mutation_p.R180W|PSMF1_ENST00000246015.4_Missense_Mutation_p.R180W	NM_006814.3	NP_006805.2	Q92530	PSMF1_HUMAN	proteasome (prosome, macropain) inhibitor subunit 1 (PI31)	180	Pro-rich.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteasomal protein catabolic process (GO:1901799)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome core complex (GO:0005839)	endopeptidase inhibitor activity (GO:0004866)|proteasome binding (GO:0070628)			endometrium(1)|kidney(1)|large_intestine(3)|lung(8)	13						ACACACCAGTCGGCAGCCTCC	0.612																																																0			20											50.0	47.0	48.0					20																	1115936		2203	4300	6503	1063936	SO:0001583	missense	9491			D88378	CCDS13010.1	20p13	2008-07-02			ENSG00000125818	ENSG00000125818		"""Proteasome (prosome, macropain) subunits"""	9571	protein-coding gene	gene with protein product	"""proteasome inhibitor hP131 subunit"""					10363639	Standard	NM_006814		Approved	PI31	uc002wen.4	Q92530	OTTHUMG00000031656	ENST00000335877.6:c.538C>T	20.37:g.1115936C>T	ENSP00000338039:p.Arg180Trp	Somatic		Capture	Illumina GAIIx	4	1063936	A0AVQ9|D3DVW3|Q9H4I1	Missense_Mutation	SNP	HMMPfam_PI31_Prot_Reg	p.R180W	ENST00000335877.6	37	c.538	CCDS13010.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.35|11.35	1.613229|1.613229	0.28712|0.28712	.|.	.|.	ENSG00000125818|ENSG00000125818	ENST00000333082;ENST00000381898;ENST00000381899;ENST00000454500;ENST00000246015;ENST00000335877|ENST00000435720	T;T;T;T;T|T	0.48201|0.51071	1.4;0.82;1.15;1.39;1.4|0.72	5.22|5.22	2.06|2.06	0.26882|0.26882	.|.	0.318100|.	0.29113|.	N|.	0.013103|.	T|T	0.49745|0.49745	0.1575|0.1575	L|L	0.60455|0.60455	1.87|1.87	0.42198|0.42198	D|D	0.991756|0.991756	B;B;P;P|.	0.35745|.	0.116;0.06;0.518;0.518|.	B;B;B;B|.	0.27076|.	0.017;0.029;0.076;0.076|.	T|T	0.43782|0.43782	-0.9370|-0.9370	10|7	0.38643|0.39692	T|T	0.18|0.17	-1.7711|-1.7711	7.4716|7.4716	0.27353|0.27353	0.2898:0.6311:0.0:0.0791|0.2898:0.6311:0.0:0.0791	.|.	92;92;180;180|.	F5H4Z3;B4DUJ0;Q5QPM7;Q92530|.	.;.;.;PSMF1_HUMAN|.	W|L	180;92;180;92;180;180|39	ENSP00000327704:R180W;ENSP00000371323:R92W;ENSP00000371324:R180W;ENSP00000246015:R180W;ENSP00000338039:R180W|ENSP00000396547:S39L	ENSP00000246015:R180W|ENSP00000396547:S39L	R|S	+|+	1|2	2|0	PSMF1|PSMF1	1063936|1063936	0.995000|0.995000	0.38212|0.38212	0.986000|0.986000	0.45419|0.45419	0.506000|0.506000	0.33950|0.33950	0.259000|0.259000	0.18405|0.18405	0.761000|0.761000	0.33130|0.33130	-0.157000|-0.157000	0.13467|0.13467	CGG|TCG	-	NULL		0.612	PSMF1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMF1	protein_coding	OTTHUMT00000077504.2	C	NM_178578		1063936	+1	no_errors	NM_006814	genbank	human	reviewed	54_36p	missense	SNP	0.999	T
SDCBP2	27111	genome.wustl.edu	37	20	1293341	1293341	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr20:1293341G>C	ENST00000360779.3	-	6	623	c.450C>G	c.(448-450)gaC>gaG	p.D150E	SDCBP2_ENST00000381808.3_Missense_Mutation_p.D65E|SDCBP2_ENST00000467129.1_5'Flank|SDCBP2_ENST00000339987.3_Missense_Mutation_p.D150E|SDCBP2_ENST00000381812.1_Missense_Mutation_p.D150E	NM_080489.4	NP_536737.3	Q9H190	SDCB2_HUMAN	syndecan binding protein (syntenin) 2	150	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(3)|lung(1)|skin(1)|stomach(1)	7						GCAGGAGCTGGTCCCCAAAGC	0.622																																																0			20											62.0	57.0	59.0					20																	1293341		2203	4300	6503	1241341	SO:0001583	missense	27111			AF131809	CCDS13013.1, CCDS42848.1	20p13	2008-07-02			ENSG00000125775	ENSG00000125775			15756	protein-coding gene	gene with protein product						11152476	Standard	NM_080489		Approved	ST-2, SITAC18	uc021vzn.1	Q9H190	OTTHUMG00000031661	ENST00000360779.3:c.450C>G	20.37:g.1293341G>C	ENSP00000354013:p.Asp150Glu	Somatic		Capture	Illumina GAIIx	4	1241341	O95892|Q5W0X1|Q9BZ42|Q9H567|Q9NRY8	Missense_Mutation	SNP	superfamily_PDZ domain-like,HMMPfam_PDZ,HMMSmart_SM00228	p.D150E	ENST00000360779.3	37	c.450	CCDS42848.1	20	.	.	.	.	.	.	.	.	.	.	g	18.02	3.529947	0.64860	.	.	ENSG00000125775	ENST00000381812;ENST00000381808;ENST00000360779;ENST00000339987	T;T;T;T	0.73789	-0.78;-0.78;-0.78;-0.78	4.51	3.53	0.40419	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	D	0.88566	0.6471	H	0.96691	3.865	0.48185	D	0.999602	D	0.62365	0.991	D	0.70487	0.969	D	0.88623	0.3164	10	0.87932	D	0	-17.5952	7.299	0.26409	0.2835:0.0:0.7165:0.0	.	150	Q9H190	SDCB2_HUMAN	E	150;65;150;150	ENSP00000371233:D150E;ENSP00000371229:D65E;ENSP00000354013:D150E;ENSP00000342935:D150E	ENSP00000342935:D150E	D	-	3	2	SDCBP2	1241341	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.541000	0.45735	1.167000	0.42706	0.561000	0.74099	GAC	-	superfamily_PDZ domain-like,HMMPfam_PDZ,HMMSmart_SM00228		0.622	SDCBP2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SDCBP2	protein_coding	OTTHUMT00000077513.2	G	NM_080489		1241341	-1	no_errors	NM_080489	genbank	human	validated	54_36p	missense	SNP	1.000	C
SLX4	84464	genome.wustl.edu	37	16	3658570	3658570	+	Silent	SNP	T	T	C			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr16:3658570T>C	ENST00000294008.3	-	2	1036	c.396A>G	c.(394-396)gaA>gaG	p.E132E		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	132	Interaction with SLX4IP, ERCC4 and MSH2.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						AGTGGGCCGGTTCACTTGCTT	0.567								Direct reversal of damage																																								0			16											101.0	97.0	98.0					16																	3658570		2197	4300	6497	3598571	SO:0001819	synonymous_variant	84464			AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.396A>G	16.37:g.3658570T>C		Somatic		Capture	Illumina GAIIx	4	3598571	Q69YT8|Q8TF15|Q96JP1	Silent	SNP	superfamily_POZ domain,HMMPfam_BTB,HMMSmart_SM00225	p.E132	ENST00000294008.3	37	c.396	CCDS10506.2	16																																																																																			-	NULL		0.567	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD12	protein_coding	OTTHUMT00000157301.3	T	NM_032444		3598571	-1	no_errors	NM_032444	genbank	human	provisional	54_36p	silent	SNP	0.000	C
TP53	7157	genome.wustl.edu	37	17	7578188	7578188	+	Nonsense_Mutation	SNP	C	C	A			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr17:7578188C>A	ENST00000269305.4	-	6	850	c.661G>T	c.(661-663)Gag>Tag	p.E221*	TP53_ENST00000359597.4_Nonsense_Mutation_p.E221*|TP53_ENST00000420246.2_Nonsense_Mutation_p.E221*|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Nonsense_Mutation_p.E221*|TP53_ENST00000445888.2_Nonsense_Mutation_p.E221*|TP53_ENST00000413465.2_Nonsense_Mutation_p.E221*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	221	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		E -> A (in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> Q (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E221*(14)|p.?(11)|p.0?(8)|p.E221fs*4(3)|p.E128*(3)|p.E221K(2)|p.Y220_P223delYEPP(1)|p.E221fs*2(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.Y220fs*25(1)|p.E221fs*26(1)|p.V218fs*26(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCAGGCGGCTCATAGGGCACC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	48	Substitution - Nonsense(17)|Unknown(11)|Whole gene deletion(8)|Deletion - Frameshift(4)|Deletion - In frame(3)|Insertion - Frameshift(3)|Substitution - Missense(2)	upper_aerodigestive_tract(9)|biliary_tract(5)|endometrium(5)|urinary_tract(5)|lung(5)|bone(4)|central_nervous_system(3)|oesophagus(2)|ovary(2)|vulva(1)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|salivary_gland(1)|breast(1)|skin(1)|large_intestine(1)|liver(1)	17											100.0	92.0	94.0					17																	7578188		2203	4300	6503	7518913	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.661G>T	17.37:g.7578188C>A	ENSP00000269305:p.Glu221*	Somatic		Capture	Illumina GAIIx	4	7518913	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.E221*	ENST00000269305.4	37	c.661	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	34	5.353387	0.95830	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	.	.	.	5.28	4.31	0.51392	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-8.6014	12.2235	0.54447	0.0:0.9162:0.0:0.0838	.	.	.	.	X	221;221;221;221;221;221;210;128;89;128	.	ENSP00000269305:E221X	E	-	1	0	TP53	7518913	1.000000	0.71417	0.299000	0.25016	0.996000	0.88848	6.045000	0.71020	1.364000	0.46038	0.563000	0.77884	GAG	-	HMMPfam_P53,superfamily_p53-like transcription factors		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7518913	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	A
Unknown	0	genome.wustl.edu	37	7	9767753	9767753	+	IGR	SNP	A	A	G			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr7:9767753A>G								AC079756.1 (133400 upstream) : AC060834.3 (9197 downstream)																							TTTTCCAGGAACTGGAAGATT	0.587																																																0			7																																								9734278	SO:0001628	intergenic_variant	0																															7.37:g.9767753A>G		Somatic		Capture	Illumina GAIIx	4	9734278		Silent	SNP	HMMPfam_A2M_N	p.E414		37	c.1242		7																																																																																			-	NULL	0	0.587					ENSG00000197320			A			9734278	+1	no_stop_codon	ENST00000361014	ensembl	human	known	54_36p	silent	SNP	0.998	G
KLRK1	22914	genome.wustl.edu	37	12	10532070	10532070	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr12:10532070G>C	ENST00000240618.6	-	5	393	c.253C>G	c.(253-255)Caa>Gaa	p.Q85E	RP11-277P12.20_ENST00000500682.1_RNA|KLRC4-KLRK1_ENST00000539300.1_3'UTR|KLRK1_ENST00000540818.1_Missense_Mutation_p.Q85E	NM_001199805.1|NM_007360.3	NP_001186734.1|NP_031386.2	P26718	NKG2D_HUMAN	killer cell lectin-like receptor subfamily K, member 1	85					cell differentiation (GO:0030154)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)	9						TGAACTTCTTGGTTGAATAAT	0.249																																																0			12											18.0	19.0	19.0					12																	10532070		2154	4225	6379	10423337	SO:0001583	missense	22914			AJ001687	CCDS8623.1	12p13.2-p12.3	2010-02-17	2003-02-19		ENSG00000213809	ENSG00000213809		"""Killer cell lectin-like receptors"", ""CD molecules"""	18788	protein-coding gene	gene with protein product		611817	"""DNA segment on chromosome 12 (unique) 2489 expressed sequence"""	D12S2489E		9683661, 2007850	Standard	NM_007360		Approved	NKG2D, KLR, NKG2-D, CD314	uc009zhj.3	P26718	OTTHUMG00000168574	ENST00000240618.6:c.253C>G	12.37:g.10532070G>C	ENSP00000240618:p.Gln85Glu	Somatic		Capture	Illumina GAIIx	4	10423337	A8K7K5|A8K7P4|Q9NR41	Missense_Mutation	SNP	superfamily_C-type lectin-like,HMMSmart_SM00034,HMMPfam_Lectin_C	p.Q85E	ENST00000240618.6	37	c.253	CCDS8623.1	12	.	.	.	.	.	.	.	.	.	.	G	11.96	1.794469	0.31777	.	.	ENSG00000213809	ENST00000240618;ENST00000540818	T;T	0.01414	4.92;4.92	5.65	0.166	0.14999	.	1.261320	0.05503	N	0.558842	T	0.01627	0.0052	L	0.42744	1.35	0.09310	N	1	P;P	0.40794	0.729;0.495	B;B	0.38616	0.277;0.095	T	0.44682	-0.9312	10	0.05620	T	0.96	.	9.6197	0.39714	0.0:0.125:0.3352:0.5399	.	66;85	Q1HEA1;P26718	.;NKG2D_HUMAN	E	85	ENSP00000240618:Q85E;ENSP00000446003:Q85E	ENSP00000240618:Q85E	Q	-	1	0	KLRK1	10423337	0.012000	0.17670	0.411000	0.26484	0.915000	0.54546	0.462000	0.21956	0.023000	0.15187	0.585000	0.79938	CAA	-	NULL		0.249	KLRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLRK1	protein_coding	OTTHUMT00000400269.1	G	NM_007360		10423337	-1	no_errors	NM_007360	genbank	human	reviewed	54_36p	missense	SNP	0.004	C
TNFRSF8	943	genome.wustl.edu	37	1	12157161	12157161	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr1:12157161T>A	ENST00000263932.2	+	3	377	c.155T>A	c.(154-156)cTg>cAg	p.L52Q	TNFRSF8_ENST00000417814.2_5'UTR	NM_001243.3|NM_001281430.1	NP_001234.2|NP_001268359.1	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily, member 8	52					cellular response to mechanical stimulus (GO:0071260)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of TRAIL biosynthetic process (GO:0045556)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Brentuximab vedotin(DB08870)	TTCCCAGGGCTGTTCCCGACA	0.592																																																0			1											88.0	85.0	86.0					1																	12157161		2203	4300	6503	12079748	SO:0001583	missense	943			M83554	CCDS144.1, CCDS59989.1	1p36	2008-02-05			ENSG00000120949	ENSG00000120949		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11923	protein-coding gene	gene with protein product		153243		CD30, D1S166E		1330892, 1310894	Standard	XM_006711049		Approved	KI-1	uc001atq.3	P28908	OTTHUMG00000001827	ENST00000263932.2:c.155T>A	1.37:g.12157161T>A	ENSP00000263932:p.Leu52Gln	Somatic		Capture	Illumina GAIIx	4	12079748	B1AN79|B9EGD9|D3YTD8|Q6P4D9	Missense_Mutation	SNP	HMMPfam_TNFR_c6,HMMSmart_SM00208,superfamily_TNF receptor-like,PatternScan_TNFR_NGFR_1	p.L52Q	ENST00000263932.2	37	c.155	CCDS144.1	1	.	.	.	.	.	.	.	.	.	.	T	6.860	0.527992	0.13127	.	.	ENSG00000120949	ENST00000263932	D	0.90955	-2.76	3.98	-7.96	0.01144	TNFR/CD27/30/40/95 cysteine-rich region (2);	2.760190	0.01700	N	0.027154	T	0.80497	0.4634	L	0.27053	0.805	0.09310	N	0.999998	B	0.29481	0.245	B	0.31946	0.138	T	0.71540	-0.4562	10	0.28530	T	0.3	0.4099	1.2815	0.02042	0.3361:0.1643:0.3406:0.159	.	52	P28908	TNR8_HUMAN	Q	52	ENSP00000263932:L52Q	ENSP00000263932:L52Q	L	+	2	0	TNFRSF8	12079748	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.230000	0.01207	-2.194000	0.00753	-0.313000	0.08912	CTG	-	HMMPfam_TNFR_c6,HMMSmart_SM00208,superfamily_TNF receptor-like		0.592	TNFRSF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF8	protein_coding	OTTHUMT00000005130.1	T			12079748	+1	no_errors	NM_001243	genbank	human	reviewed	54_36p	missense	SNP	0.000	A
NUP210	23225	genome.wustl.edu	37	3	13407537	13407537	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr3:13407537G>C	ENST00000254508.5	-	14	1923	c.1841C>G	c.(1840-1842)gCc>gGc	p.A614G		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	614					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					AGAGCCCTGGGCCTCGGCCTT	0.582																																																0			3											94.0	86.0	89.0					3																	13407537		2203	4300	6503	13382537	SO:0001583	missense	23225			AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.1841C>G	3.37:g.13407537G>C	ENSP00000254508:p.Ala614Gly	Somatic		Capture	Illumina GAIIx	4	13382537	A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	superfamily_Invasin/intimin cell-adhesion fragments,HMMPfam_Big_2,HMMSmart_SM00635	p.A614G	ENST00000254508.5	37	c.1841	CCDS33704.1	3	.	.	.	.	.	.	.	.	.	.	G	3.941	-0.014281	0.07681	.	.	ENSG00000132182	ENST00000254508	T	0.05258	3.47	5.21	3.15	0.36227	.	0.669254	0.15597	N	0.254119	T	0.06781	0.0173	L	0.53249	1.67	0.20926	N	0.999825	B;B	0.09022	0.002;0.001	B;B	0.09377	0.004;0.002	T	0.30179	-0.9987	10	0.27082	T	0.32	.	6.6134	0.22763	0.2504:0.1486:0.601:0.0	.	614;614	Q8TEM1-2;Q8TEM1	.;PO210_HUMAN	G	614	ENSP00000254508:A614G	ENSP00000254508:A614G	A	-	2	0	NUP210	13382537	1.000000	0.71417	0.966000	0.40874	0.117000	0.20001	1.815000	0.38981	1.185000	0.42971	0.655000	0.94253	GCC	-	NULL		0.582	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	NUP210	protein_coding	OTTHUMT00000340085.1	G	NM_024923		13382537	-1	no_errors	NM_024923	genbank	human	reviewed	54_36p	missense	SNP	0.466	C
LIPI	149998	genome.wustl.edu	37	21	15554105	15554105	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr21:15554105A>C	ENST00000536861.1	-	4	616	c.617T>G	c.(616-618)gTg>gGg	p.V206G	LIPI_ENST00000344577.2_Missense_Mutation_p.V227G			Q6XZB0	LIPI_HUMAN	lipase, member I	206					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)			endometrium(1)|kidney(13)|large_intestine(9)|liver(3)|lung(24)|ovary(3)|urinary_tract(1)	54				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		GATGACATCCACAAACTTTGC	0.403																																																0			21											101.0	94.0	96.0					21																	15554105		2203	4300	6503	14475976	SO:0001583	missense	149998			BC028732	CCDS13564.1	21q11.2	2012-07-31			ENSG00000188992	ENSG00000188992			18821	protein-coding gene	gene with protein product	"""membrane-associated phospholipase A1 beta"", ""cancer/testis antigen 17"""	609252				12719377	Standard	XM_005260924		Approved	PRED5, LPDL, CT17, mPA-PLA1beta, PLA1C	uc002yjm.3	Q6XZB0	OTTHUMG00000074258	ENST00000536861.1:c.617T>G	21.37:g.15554105A>C	ENSP00000440381:p.Val206Gly	Somatic		Capture	Illumina GAIIx	4	14475976	G1JSG3|G1JSG4|G1JSG5|G1JSG6|G1JSG7|G1JSG8|G1JSG9	Missense_Mutation	SNP	HMMPfam_Lipase,superfamily_SSF53474	p.V227G	ENST00000536861.1	37	c.680		21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.86|17.86	3.492839|3.492839	0.64074|0.64074	.|.	.|.	ENSG00000188992|ENSG00000188992	ENST00000400211|ENST00000344577;ENST00000536861;ENST00000382981	.|D;D	.|0.96136	.|-3.92;-3.92	5.46|5.46	5.46|5.46	0.80206|0.80206	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.98713|0.98713	0.9568|0.9568	H|H	0.98466|0.98466	4.24|4.24	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.87578	.|0.998;0.998	D|D	0.99679|0.99679	1.0998|1.0998	5|10	.|0.87932	.|D	.|0	.|.	15.5223|15.5223	0.75875|0.75875	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|206;227	.|G1JSG6;Q6XZB0-2	.|.;.	W|G	85|227;206;101	.|ENSP00000343331:V227G;ENSP00000440381:V206G	.|ENSP00000343331:V227G	C|V	-|-	3|2	2|0	LIPI|LIPI	14475976|14475976	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.550000|0.550000	0.35303|0.35303	8.246000|8.246000	0.89828|0.89828	2.207000|2.207000	0.71202|0.71202	0.533000|0.533000	0.62120|0.62120	TGT|GTG	-	HMMPfam_Lipase,superfamily_SSF53474		0.403	LIPI-201	KNOWN	basic|appris_candidate	protein_coding	LIPI	protein_coding		A	NM_198996		14475976	-1	no_errors	NM_198996	genbank	human	validated	54_36p	missense	SNP	1.000	C
SLC6A6	6533	genome.wustl.edu	37	3	14508101	14508101	+	Silent	SNP	G	G	A			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr3:14508101G>A	ENST00000454876.2	+	7	1139	c.810G>A	c.(808-810)gcG>gcA	p.A270A	SLC6A6_ENST00000360861.3_Silent_p.A270A			P31641	SC6A6_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 6	270					amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|taurine transport (GO:0015734)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|taurine binding (GO:0030977)|taurine:sodium symporter activity (GO:0005369)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)	28						TGCCGGGCGCGGGCGCAGGCA	0.617																																																0			3											83.0	72.0	76.0					3																	14508101		2203	4300	6503	14483105	SO:0001819	synonymous_variant	6533				CCDS33705.1, CCDS46765.1	3p25.1	2013-07-19	2013-07-19		ENSG00000131389	ENSG00000131389		"""Solute carriers"""	11052	protein-coding gene	gene with protein product	"""taurine transporter"""	186854	"""solute carrier family 6 (neurotransmitter transporter, taurine), member 6"""			8010975, 8382624	Standard	XM_006713307		Approved	TAUT	uc010heg.4	P31641	OTTHUMG00000155525	ENST00000454876.2:c.810G>A	3.37:g.14508101G>A		Somatic		Capture	Illumina GAIIx	4	14483105	B2RNU7|Q9BRI2|Q9BXB0	Silent	SNP	HMMPfam_SNF,PatternScan_NA_NEUROTRAN_SYMP_1,PatternScan_NA_NEUROTRAN_SYMP_2	p.A270	ENST00000454876.2	37	c.810	CCDS33705.1	3																																																																																			-	HMMPfam_SNF		0.617	SLC6A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A6	protein_coding	OTTHUMT00000340507.1	G	NM_003043		14483105	+1	no_errors	NM_003043	genbank	human	validated	54_36p	silent	SNP	0.280	A
IGSF22	283284	genome.wustl.edu	37	11	18738463	18738463	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr11:18738463T>G	ENST00000513874.1	-	10	1197	c.1058A>C	c.(1057-1059)aAg>aCg	p.K353T	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	353										NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						GGGCTCTTTCTTGGAGAGGCG	0.512																																																0			11											197.0	196.0	196.0					11																	18738463		2050	4186	6236	18695039	SO:0001583	missense	283284			AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.1058A>C	11.37:g.18738463T>G	ENSP00000421191:p.Lys353Thr	Somatic		Capture	Illumina GAIIx	4	18695039	A6NNA0|D6RGV7	Missense_Mutation	SNP	superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IG,superfamily_FN_III-like,HMMSmart_FN3,HMMPfam_fn3	p.K353T	ENST00000513874.1	37	c.1058	CCDS41625.2	11	.	.	.	.	.	.	.	.	.	.	T	15.02	2.709782	0.48517	.	.	ENSG00000179057	ENST00000513874	T	0.66815	-0.23	4.94	3.8	0.43715	.	0.000000	0.37906	U	0.001886	T	0.66597	0.2805	L	0.28649	0.875	0.23669	N	0.997157	D	0.69078	0.997	D	0.79108	0.992	T	0.55623	-0.8112	10	0.15952	T	0.53	.	8.26	0.31779	0.0:0.1646:0.0:0.8354	.	353	D6RGV7	.	T	353	ENSP00000421191:K353T	ENSP00000322422:K353T	K	-	2	0	IGSF22	18695039	1.000000	0.71417	0.983000	0.44433	0.993000	0.82548	1.955000	0.40372	0.724000	0.32296	0.533000	0.62120	AAG	-	superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IG		0.512	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF22	protein_coding	OTTHUMT00000360850.2	T	NM_173588		18695039	-1	no_errors	NM_173588	genbank	human	validated	54_36p	missense	SNP	0.985	G
DENND4C	55667	genome.wustl.edu	37	9	19346042	19346042	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr9:19346042G>C	ENST00000380432.2	+	18	2453	c.2420G>C	c.(2419-2421)aGg>aCg	p.R807T	DENND4C_ENST00000434457.2_Missense_Mutation_p.R1092T|DENND4C_ENST00000602925.1_Missense_Mutation_p.R1043T			Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C	807					cellular response to insulin stimulus (GO:0032869)|positive regulation of Rab GTPase activity (GO:0032851)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)	cytosol (GO:0005829)|insulin-responsive compartment (GO:0032593)|plasma membrane (GO:0005886)|retromer complex (GO:0030904)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(8)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						TTTCCTGAGAGGAGTTGTAGT	0.393																																																0			9											128.0	124.0	125.0					9																	19346042		2203	4300	6503	19336042	SO:0001583	missense	55667			AK000693	CCDS6491.2, CCDS6491.3	9p22.1	2012-10-03	2006-01-27	2006-01-27	ENSG00000137145	ENSG00000137145		"""DENN/MADD domain containing"""	26079	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 55B"", ""chromosome 9 open reading frame 55"""	C9orf55B, C9orf55		12906859	Standard	NM_017925		Approved	FLJ20686, bA513M16.3	uc031tcw.1	Q5VZ89	OTTHUMG00000019627	ENST00000380432.2:c.2420G>C	9.37:g.19346042G>C	ENSP00000369797:p.Arg807Thr	Somatic		Capture	Illumina GAIIx	4	19336042	A2A3R1|A2A3R2|A2A3R3|A2A3R9|Q6AI48|Q6ZUB3|Q8NCY7|Q9H6N4|Q9NUT1|Q9NWA5|Q9NWT3	Missense_Mutation	SNP	HMMPfam_DENN,HMMSmart_SM00799,HMMPfam_dDENN,HMMSmart_SM00801,HMMPfam_PPR	p.R807T	ENST00000380432.2	37	c.2420		9	.	.	.	.	.	.	.	.	.	.	G	20.8	4.044216	0.75732	.	.	ENSG00000137145	ENST00000380437;ENST00000307015;ENST00000540671;ENST00000380432	T;T	0.55413	0.6;0.52	5.3	5.3	0.74995	.	0.305373	0.34580	N	0.003854	T	0.70885	0.3275	L	0.58101	1.795	0.52099	D	0.999941	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.97	T	0.72253	-0.4347	10	0.72032	D	0.01	-18.3548	19.144	0.93457	0.0:0.0:1.0:0.0	.	137;807	B7Z660;Q5VZ89	.;DEN4C_HUMAN	T	807;280;137;280	ENSP00000305795:R280T;ENSP00000443804:R137T	ENSP00000305795:R280T	R	+	2	0	DENND4C	19336042	1.000000	0.71417	0.986000	0.45419	0.858000	0.48976	8.556000	0.90697	2.745000	0.94114	0.655000	0.94253	AGG	-	NULL		0.393	DENND4C-201	KNOWN	basic	protein_coding	DENND4C	protein_coding		G	NM_017925		19336042	+1	no_errors	NM_017925	genbank	human	provisional	54_36p	missense	SNP	1.000	C
ZMYM2	7750	genome.wustl.edu	37	13	20567974	20567974	+	Silent	SNP	T	T	C			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr13:20567974T>C	ENST00000382874.2	+	4	952	c.762T>C	c.(760-762)acT>acC	p.T254T	ZMYM2_ENST00000382881.3_Silent_p.T167T|ZMYM2_ENST00000382869.3_Silent_p.T254T|ZMYM2_ENST00000382871.2_Silent_p.T254T	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	254					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)			large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		AGACCAAGACTGGAGTAGGAC	0.403																																																0			13											122.0	124.0	123.0					13																	20567974		2203	4300	6503	19465974	SO:0001819	synonymous_variant	7750			AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.762T>C	13.37:g.20567974T>C		Somatic		Capture	Illumina GAIIx	4	19465974	A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Silent	SNP	HMMPfam_zf-FCS,HMMSmart_TRASH	p.T254	ENST00000382874.2	37	c.762	CCDS45016.1	13																																																																																			-	NULL		0.403	ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM2	protein_coding	OTTHUMT00000044051.2	T	NM_003453		19465974	+1	no_errors	NM_003453	genbank	human	validated	54_36p	silent	SNP	1.000	C
RIN2	54453	genome.wustl.edu	37	20	19955642	19955642	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr20:19955642C>G	ENST00000255006.6	+	8	1269	c.1120C>G	c.(1120-1122)Ctg>Gtg	p.L374V	RIN2_ENST00000484638.1_3'UTR|RIN2_ENST00000440354.2_Intron	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	325					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						AAGCCCTCGGCTGGCCAGGAC	0.597																																																0			20											86.0	91.0	89.0					20																	19955642		1967	4161	6128	19903642	SO:0001583	missense	54453			AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.1120C>G	20.37:g.19955642C>G	ENSP00000255006:p.Leu374Val	Somatic		Capture	Illumina GAIIx	4	19903642	Q00425|Q5TFT8|Q9BQL3|Q9H071	Missense_Mutation	SNP	superfamily_SH2 domain,superfamily_VPS9 domain (Pfam 02204),HMMSmart_SM00167,HMMPfam_VPS9,HMMPfam_RA,HMMSmart_SM00314	p.L325V	ENST00000255006.6	37	c.973	CCDS56182.1	20	.	.	.	.	.	.	.	.	.	.	C	11.15	1.554283	0.27739	.	.	ENSG00000132669	ENST00000255006	T	0.08984	3.03	5.59	4.59	0.56863	.	0.722424	0.12668	N	0.449003	T	0.10252	0.0251	L	0.57536	1.79	0.80722	D	1	P	0.35077	0.483	B	0.25140	0.058	T	0.20874	-1.0262	9	.	.	.	-10.6311	15.5953	0.76574	0.0:0.862:0.138:0.0	.	325	Q8WYP3	RIN2_HUMAN	V	374	ENSP00000255006:L374V	.	L	+	1	2	RIN2	19903642	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	1.929000	0.40114	2.628000	0.89032	0.655000	0.94253	CTG	-	NULL		0.597	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN2	protein_coding	OTTHUMT00000078212.1	C			19903642	+1	no_errors	NM_018993	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
LZTS1	11178	genome.wustl.edu	37	8	20112382	20112382	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr8:20112382G>T	ENST00000381569.1	-	2	668	c.311C>A	c.(310-312)cCc>cAc	p.P104H	LZTS1_ENST00000265801.6_Missense_Mutation_p.P104H|LZTS1_ENST00000522290.1_Missense_Mutation_p.P104H			Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	104					cell cycle (GO:0007049)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of macroautophagy (GO:0016242)|positive regulation of type I interferon production (GO:0032481)|regulation of dendrite morphogenesis (GO:0048814)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|nucleoplasm (GO:0005654)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(2)|skin(1)|urinary_tract(1)	29				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		CATGAGCTTGGGGGGTGTGGA	0.597																																																0			8											38.0	39.0	39.0					8																	20112382		2203	4300	6503	20156662	SO:0001583	missense	11178			AF123659	CCDS6015.1	8p22	2012-10-05			ENSG00000061337	ENSG00000061337			13861	protein-coding gene	gene with protein product		606551	"""F37/Esophageal cancer-related gene-coding leucine-zipper motif"""			10097140, 17349584	Standard	NM_021020		Approved	FEZ1	uc003wzr.3	Q9Y250	OTTHUMG00000097027	ENST00000381569.1:c.311C>A	8.37:g.20112382G>T	ENSP00000370981:p.Pro104His	Somatic		Capture	Illumina GAIIx	4	20156662	D3DSQ6|Q9Y5V7|Q9Y5V8|Q9Y5V9|Q9Y5W0|Q9Y5W1|Q9Y5W2	Missense_Mutation	SNP	HMMPfam_Fez1	p.P104H	ENST00000381569.1	37	c.311	CCDS6015.1	8	.	.	.	.	.	.	.	.	.	.	G	21.8	4.205051	0.79127	.	.	ENSG00000061337	ENST00000381569;ENST00000265801;ENST00000522290;ENST00000360248	T;T;T	0.51325	1.1;1.1;0.71	6.02	6.02	0.97574	.	0.159839	0.56097	D	0.000031	T	0.63486	0.2515	L	0.55213	1.73	0.47511	D	0.999448	D;D	0.89917	1.0;0.991	D;P	0.69307	0.963;0.635	T	0.63980	-0.6514	10	0.87932	D	0	-52.4497	14.8091	0.69979	0.0:0.0:0.8554:0.1446	.	104;104	Q9Y250-4;Q9Y250	.;LZTS1_HUMAN	H	104	ENSP00000370981:P104H;ENSP00000265801:P104H;ENSP00000429263:P104H	ENSP00000265801:P104H	P	-	2	0	LZTS1	20156662	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.471000	0.66762	2.857000	0.98124	0.650000	0.86243	CCC	-	NULL		0.597	LZTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LZTS1	protein_coding	OTTHUMT00000214122.1	G	NM_021020		20156662	-1	no_errors	NM_021020	genbank	human	validated	54_36p	missense	SNP	0.982	T
NEBL	10529	genome.wustl.edu	37	10	21461356	21461356	+	Silent	SNP	G	G	A			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr10:21461356G>A	ENST00000417816.2	-	2	473	c.120C>T	c.(118-120)aaC>aaT	p.N40N	NEBL-AS1_ENST00000439097.1_RNA|NEBL_ENST00000464278.1_5'UTR|NEBL-AS1_ENST00000417845.1_RNA	NM_001173484.1|NM_213569.2	NP_001166955.1|NP_998734.1	O76041	NEBL_HUMAN	nebulette	0					cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						AGTTGTTCATGTTGAGTGCCA	0.403																																																0			10											186.0	173.0	178.0					10																	21461356		2203	4300	6503	21501362	SO:0001819	synonymous_variant	10529			Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000417816.2:c.120C>T	10.37:g.21461356G>A		Somatic		Capture	Illumina GAIIx	4	21501362	B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Silent	SNP	superfamily_SSF57716,HMMSmart_LIM,PatternScan_LIM_DOMAIN_1,HMMPfam_LIM,HMMSmart_NEBU,HMMPfam_Nebulin,superfamily_SH3,HMMPfam_SH3_1,HMMSmart_SH3	p.N40	ENST00000417816.2	37	c.120	CCDS7133.1	10																																																																																			-	HMMSmart_LIM,HMMPfam_LIM		0.403	NEBL-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NEBL	protein_coding	OTTHUMT00000047112.1	G	NM_006393		21501362	-1	no_errors	NM_213569	genbank	human	validated	54_36p	silent	SNP	1.000	A
AP1G2	8906	genome.wustl.edu	37	14	24036403	24036403	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr14:24036403C>T	ENST00000308724.5	-	1	876	c.121G>A	c.(121-123)Gac>Aac	p.D41N	AP1G2_ENST00000556277.1_5'UTR|RP11-66N24.3_ENST00000555968.1_RNA|AP1G2_ENST00000397120.3_Missense_Mutation_p.D41N	NM_003917.2	NP_003908.1	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2 subunit	41					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	28	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		GGGTCCCCGTCGCGGAAGGAG	0.627											OREG0022606	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			14											69.0	59.0	62.0					14																	24036403		2203	4300	6503	23106243	SO:0001583	missense	8906			AB015318	CCDS9602.1	14q11.2	2008-07-03			ENSG00000213983	ENSG00000213983			556	protein-coding gene	gene with protein product		603534				9733768, 9762922	Standard	XM_005268167		Approved	G2AD	uc001wkl.2	O75843	OTTHUMG00000028760	ENST00000308724.5:c.121G>A	14.37:g.24036403C>T	ENSP00000312442:p.Asp41Asn	Somatic	768	Capture	Illumina GAIIx	4	23106243	D3DS51|O75504	Missense_Mutation	SNP	superfamily_ARM-type_fold,HMMPfam_Adaptin_N,superfamily_Clath_adapt,HMMPfam_Alpha_adaptinC2,HMMSmart_Alpha_adaptinC2	p.D41N	ENST00000308724.5	37	c.121	CCDS9602.1	14	.	.	.	.	.	.	.	.	.	.	C	24.9	4.584522	0.86748	.	.	ENSG00000213983	ENST00000308724;ENST00000397120;ENST00000557189;ENST00000556843	T;T;T;T	0.14266	2.52;2.52;2.52;2.52	4.09	4.09	0.47781	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.181583	0.48286	D	0.000185	T	0.18045	0.0433	L	0.52011	1.625	0.80722	D	1	P	0.52170	0.951	P	0.46320	0.512	T	0.01512	-1.1336	10	0.49607	T	0.09	-5.6325	14.1527	0.65398	0.0:1.0:0.0:0.0	.	41	O75843	AP1G2_HUMAN	N	41	ENSP00000312442:D41N;ENSP00000380309:D41N;ENSP00000452153:D41N;ENSP00000451504:D41N	ENSP00000312442:D41N	D	-	1	0	AP1G2	23106243	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	4.172000	0.58243	2.273000	0.75805	0.436000	0.28706	GAC	-	superfamily_ARM-type_fold,HMMPfam_Adaptin_N		0.627	AP1G2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AP1G2	protein_coding	OTTHUMT00000071812.4	C	NM_003917		23106243	-1	no_errors	NM_003917	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
IGF2BP3	10643	genome.wustl.edu	37	7	23381704	23381704	+	Silent	SNP	A	A	C			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr7:23381704A>C	ENST00000258729.3	-	10	1538	c.1182T>G	c.(1180-1182)acT>acG	p.T394T		NM_006547.2	NP_006538.2	O00425	IF2B3_HUMAN	insulin-like growth factor 2 mRNA binding protein 3	394					anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation regulator activity (GO:0045182)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(2)|prostate(2)|skin(4)|stomach(1)	34						GGTAGGGAGGAGTCATGGCTG	0.498																																																0			7											45.0	39.0	41.0					7																	23381704		2203	4300	6503	23348229	SO:0001819	synonymous_variant	10643			AF117108	CCDS5382.1	7p15.3	2014-02-19			ENSG00000136231	ENSG00000136231		"""RNA binding motif (RRM) containing"""	28868	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 3"", ""cancer/testis antigen 98"""	608259				9891060, 9178771	Standard	NM_006547		Approved	IMP-3, CT98, IMP3	uc003swg.3	O00425	OTTHUMG00000128445	ENST00000258729.3:c.1182T>G	7.37:g.23381704A>C		Somatic		Capture	Illumina GAIIx	4	23348229	A0A4Z5|Q63HM0|Q6MZZ2|Q86VB1	Silent	SNP	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1,superfamily_Eukaryotic type KH-domain (KH-domain type I),HMMSmart_SM00322,HMMPfam_KH_1	p.T394	ENST00000258729.3	37	c.1182	CCDS5382.1	7																																																																																			-	superfamily_Eukaryotic type KH-domain (KH-domain type I)		0.498	IGF2BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2BP3	protein_coding	OTTHUMT00000250243.2	A	NM_006547		23348229	-1	no_errors	NM_006547	genbank	human	reviewed	54_36p	silent	SNP	0.997	C
ZNF337	26152	genome.wustl.edu	37	20	25657433	25657433	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr20:25657433T>C	ENST00000376436.1	-	4	1030	c.491A>G	c.(490-492)gAa>gGa	p.E164G	ZNF337_ENST00000481610.1_5'Flank|ZNF337_ENST00000252979.5_Missense_Mutation_p.E164G|RP4-694B14.5_ENST00000428254.1_RNA|RP4-694B14.5_ENST00000414393.1_RNA|RP4-694B14.5_ENST00000455791.1_RNA|RP4-694B14.5_ENST00000439498.1_RNA|RP4-694B14.5_ENST00000421829.1_RNA|ZNF337_ENST00000538750.1_Missense_Mutation_p.E132G			Q9Y3M9	ZN337_HUMAN	zinc finger protein 337	164					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TTTGTCTATTTCTGTAGGATT	0.448																																																0			20											173.0	166.0	168.0					20																	25657433		2203	4300	6503	25605433	SO:0001583	missense	26152				CCDS13174.1	20p11.1	2013-09-20			ENSG00000130684	ENSG00000130684		"""Zinc fingers, C2H2-type"", ""-"""	15809	protein-coding gene	gene with protein product							Standard	XM_005260702		Approved	dJ694B14.1	uc002wuz.3	Q9Y3M9	OTTHUMG00000032131	ENST00000376436.1:c.491A>G	20.37:g.25657433T>C	ENSP00000365619:p.Glu164Gly	Somatic		Capture	Illumina GAIIx	4	25605433	B4DSM2|Q9Y3Y5	Missense_Mutation	SNP	superfamily_Krueppel-associated_box,HMMPfam_KRAB,HMMSmart_KRAB,HMMSmart_ZnF_C2H2,superfamily_SSF57667,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.E164G	ENST00000376436.1	37	c.491	CCDS13174.1	20	.	.	.	.	.	.	.	.	.	.	.	11.33	1.608035	0.28623	.	.	ENSG00000130684	ENST00000376436;ENST00000252979;ENST00000376412;ENST00000538750	T;T;T	0.07021	3.3;3.3;3.23	1.13	1.13	0.20643	.	.	.	.	.	T	0.06690	0.0171	L	0.49778	1.585	0.09310	N	1	B;B	0.31931	0.347;0.347	B;B	0.17722	0.013;0.019	T	0.32851	-0.9891	9	0.28530	T	0.3	.	6.4437	0.21865	0.0:0.0:0.0:1.0	.	132;164	B4DSM2;Q9Y3M9	.;ZN337_HUMAN	G	164;164;164;132	ENSP00000365619:E164G;ENSP00000252979:E164G;ENSP00000442181:E132G	ENSP00000252979:E164G	E	-	2	0	ZNF337	25605433	0.008000	0.16893	0.005000	0.12908	0.749000	0.42624	0.500000	0.22562	0.766000	0.33244	0.254000	0.18369	GAA	-	NULL		0.448	ZNF337-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF337	protein_coding	OTTHUMT00000078454.1	T			25605433	-1	no_errors	NM_015655	genbank	human	validated	54_36p	missense	SNP	0.056	C
HS3ST4	9951	genome.wustl.edu	37	16	26147165	26147165	+	Silent	SNP	C	C	T			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr16:26147165C>T	ENST00000331351.5	+	2	1359	c.967C>T	c.(967-969)Ctg>Ttg	p.L323L	HS3ST4_ENST00000475436.1_3'UTR	NM_006040.2	NP_006031.2	Q9Y661	HS3S4_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 4	323					heparan sulfate proteoglycan metabolic process (GO:0030201)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			breast(2)|endometrium(3)|large_intestine(1)|lung(9)	15				GBM - Glioblastoma multiforme(48;0.0988)		GACCCTCGGGCTGATCGATGC	0.552																																																0			16											183.0	172.0	176.0					16																	26147165		1568	3582	5150	26054666	SO:0001819	synonymous_variant	9951			AF105378	CCDS53995.1	16p11.2	2008-03-12			ENSG00000182601	ENSG00000182601	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5200	protein-coding gene	gene with protein product		604059				9988767	Standard	NM_006040		Approved	3OST4	uc002dof.3	Q9Y661	OTTHUMG00000059978	ENST00000331351.5:c.967C>T	16.37:g.26147165C>T		Somatic		Capture	Illumina GAIIx	4	26054666	Q5QI42|Q8NDC2	Silent	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Sulfotransfer_1	p.L323	ENST00000331351.5	37	c.967	CCDS53995.1	16																																																																																			-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Sulfotransfer_1		0.552	HS3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS3ST4	protein_coding	OTTHUMT00000133286.2	C	NM_006040		26054666	+1	no_errors	ENST00000331351	ensembl	human	known	54_36p	silent	SNP	1.000	T
CLN3	1201	genome.wustl.edu	37	16	28499048	28499048	+	Silent	SNP	C	C	T			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr16:28499048C>T	ENST00000569430.1	-	7	1128	c.309G>A	c.(307-309)gcG>gcA	p.A103A	CLN3_ENST00000357857.9_Silent_p.A49A|CLN3_ENST00000567963.1_Silent_p.A103A|CLN3_ENST00000565316.1_Silent_p.A103A|CLN3_ENST00000354630.5_Silent_p.A103A|CLN3_ENST00000568224.1_Silent_p.A25A|CLN3_ENST00000360019.2_Silent_p.A103A|CLN3_ENST00000355477.5_Silent_p.A103A|CLN3_ENST00000357806.7_Intron|CLN3_ENST00000333496.9_Silent_p.A79A|CLN3_ENST00000395653.4_Intron|CLN3_ENST00000535392.1_Silent_p.A25A|CLN3_ENST00000359984.7_Silent_p.A103A|CLN3_ENST00000357076.5_Silent_p.A103A			Q13286	CLN3_HUMAN	ceroid-lipofuscinosis, neuronal 3	103					action potential (GO:0001508)|amyloid precursor protein catabolic process (GO:0042987)|arginine transport (GO:0015809)|associative learning (GO:0008306)|autophagic vacuole fusion (GO:0000046)|cell death (GO:0008219)|cellular amino acid metabolic process (GO:0006520)|ceramide metabolic process (GO:0006672)|cytosolic calcium ion homeostasis (GO:0051480)|galactosylceramide metabolic process (GO:0006681)|globoside metabolic process (GO:0001575)|glucosylceramide metabolic process (GO:0006678)|ionotropic glutamate receptor signaling pathway (GO:0035235)|lysosomal lumen acidification (GO:0007042)|lysosomal lumen pH elevation (GO:0035752)|lysosome organization (GO:0007040)|macroautophagy (GO:0016236)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of macroautophagy (GO:0016242)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteolysis (GO:0045861)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter metabolic process (GO:0042133)|protein catabolic process (GO:0030163)|protein processing (GO:0016485)|receptor-mediated endocytosis (GO:0006898)|sphingomyelin metabolic process (GO:0006684)|vacuolar transport (GO:0007034)|vesicle transport along microtubule (GO:0047496)	autophagic vacuole (GO:0005776)|caveola (GO:0005901)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|trans-Golgi network (GO:0005802)	unfolded protein binding (GO:0051082)			breast(1)|large_intestine(2)|lung(11)|upper_aerodigestive_tract(1)	15						GGAGGATGTCCGCCAGGAGCA	0.622																																																0			16											103.0	70.0	81.0					16																	28499048		2197	4300	6497	28406549	SO:0001819	synonymous_variant	1201			U32680	CCDS10632.1, CCDS73852.1, CCDS73853.1, CCDS73854.1, CCDS73855.1	16p12	2014-09-17	2008-07-29		ENSG00000188603	ENSG00000188603			2074	protein-coding gene	gene with protein product	"""juvenile neuronal ceroid lipofuscinosis"""	607042	"""Batten, Spielmeyer-Vogt disease"""	BTS		18317235	Standard	NM_001042432		Approved	JNCL	uc002dpp.3	Q13286	OTTHUMG00000097024	ENST00000569430.1:c.309G>A	16.37:g.28499048C>T		Somatic		Capture	Illumina GAIIx	4	28406549	B2R7J1|O00668|O95089|Q549S9|Q9UP09|Q9UP11|Q9UP12|Q9UP13|Q9UP14	Missense_Mutation	SNP	NULL	p.R47Q	ENST00000569430.1	37	c.140	CCDS10632.1	16																																																																																			-	NULL		0.622	CLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLN3	protein_coding	OTTHUMT00000214115.2	C			28406549	-1	no_errors	ENST00000333496	ensembl	human	known	54_36p	missense	SNP	0.915	T
ZBED9	114821	genome.wustl.edu	37	6	28540554	28540554	+	Silent	SNP	A	A	G			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr6:28540554A>G	ENST00000452236.2	-	4	3729	c.3112T>C	c.(3112-3114)Tta>Cta	p.L1038L		NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						aaagagaataatcttgaattc	0.299																																																0			6											45.0	47.0	46.0					6																	28540554		2200	4295	6495	28648533	SO:0001819	synonymous_variant	114821																														ENST00000452236.2:c.3112T>C	6.37:g.28540554A>G		Somatic		Capture	Illumina GAIIx	4	28648533		Silent	SNP	HMMPfam_SCAN,HMMSmart_SCAN,superfamily_RNaseH_fold,HMMPfam_rve,HMMPfam_hATC	p.L1038	ENST00000452236.2	37	c.3112	CCDS34355.1	6																																																																																			-	NULL		0.299	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SCAND3	protein_coding	OTTHUMT00000043551.3	A			28648533	-1	no_errors	NM_052923	genbank	human	provisional	54_36p	silent	SNP	1.000	G
TRPM1	4308	genome.wustl.edu	37	15	31338416	31338416	+	Silent	SNP	C	C	T			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr15:31338416C>T	ENST00000256552.6	-	16	1932	c.1785G>A	c.(1783-1785)ctG>ctA	p.L595L	TRPM1_ENST00000397795.2_Silent_p.L573L|TRPM1_ENST00000542188.1_Silent_p.L612L	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		CTTCCATTCCCAGAAGTTTAA	0.308																																																0			15											79.0	75.0	76.0					15																	31338416		1807	4083	5890	29125708	SO:0001819	synonymous_variant	4308			AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.1785G>A	15.37:g.31338416C>T		Somatic		Capture	Illumina GAIIx	4	29125708		Silent	SNP	HMMPfam_Ion_trans	p.L573	ENST00000256552.6	37	c.1719	CCDS58346.1	15																																																																																			-	NULL		0.308	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	TRPM1	protein_coding	OTTHUMT00000417166.2	C	NM_002420		29125708	-1	no_errors	NM_002420	genbank	human	reviewed	54_36p	silent	SNP	0.941	T
FAM57B	83723	genome.wustl.edu	37	16	30037081	30037081	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr16:30037081G>C	ENST00000380495.4	-	4	1237	c.506C>G	c.(505-507)aCg>aGg	p.T169R	FAM57B_ENST00000279389.4_Missense_Mutation_p.T119R|FAM57B_ENST00000564806.1_Missense_Mutation_p.T119R	NM_031478.4	NP_113666.2	Q71RH2	FA57B_HUMAN	family with sequence similarity 57, member B	169	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				ceramide biosynthetic process (GO:0046513)|negative regulation of fat cell differentiation (GO:0045599)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sphingosine N-acyltransferase activity (GO:0050291)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(1)	14						GACGAAGGGCGTGCTGACCTC	0.602																																																0			16											182.0	170.0	174.0					16																	30037081		2197	4300	6497	29944582	SO:0001583	missense	83723			AF370365	CCDS10667.2	16p11.2	2013-02-19			ENSG00000149926	ENSG00000149926			25295	protein-coding gene	gene with protein product		615175				11230166, 23275342	Standard	NM_031478		Approved	DKFZP434I2117	uc002dvt.3	Q71RH2	OTTHUMG00000132105	ENST00000380495.4:c.506C>G	16.37:g.30037081G>C	ENSP00000369863:p.Thr169Arg	Somatic		Capture	Illumina GAIIx	4	29944582	Q9H0J1	Missense_Mutation	SNP	HMMSmart_SM00724,HMMPfam_TRAM_LAG1_CLN8	p.T169R	ENST00000380495.4	37	c.506	CCDS10667.2	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.5|29.5	5.007447|5.007447	0.93287|0.93287	.|.	.|.	ENSG00000149926|ENSG00000149926	ENST00000279389|ENST00000380495	.|D	.|0.87334	.|-2.24	5.17|5.17	5.17|5.17	0.71159|0.71159	.|TRAM/LAG1/CLN8 homology domain (3);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.94328|0.94328	0.8177|0.8177	M|M	0.87617|0.87617	2.895|2.895	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;0.996	D|D	0.95203|0.95203	0.8318|0.8318	5|10	.|0.87932	.|D	.|0	-14.1907|-14.1907	17.439|17.439	0.87560|0.87560	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|169;169	.|F1T0F5;Q71RH2	.|.;FA57B_HUMAN	G|R	136|169	.|ENSP00000369863:T169R	.|ENSP00000369863:T169R	R|T	-|-	1|2	0|0	FAM57B|FAM57B	29944582|29944582	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.939000|0.939000	0.58152|0.58152	9.764000|9.764000	0.98949|0.98949	2.408000|2.408000	0.81797|0.81797	0.561000|0.561000	0.74099|0.74099	CGC|ACG	-	HMMSmart_SM00724,HMMPfam_TRAM_LAG1_CLN8		0.602	FAM57B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM57B	protein_coding	OTTHUMT00000255142.2	G	NM_031478		29944582	-1	no_errors	NM_031478	genbank	human	validated	54_36p	missense	SNP	1.000	C
SNRNP40	9410	genome.wustl.edu	37	1	31764789	31764789	+	Silent	SNP	C	C	T			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr1:31764789C>T	ENST00000263694.4	-	3	354	c.336G>A	c.(334-336)gtG>gtA	p.V112V	SNRNP40_ENST00000446633.2_Silent_p.V112V	NM_004814.2	NP_004805.2	Q96DI7	SNR40_HUMAN	small nuclear ribonucleoprotein 40kDa (U5)	112					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	7						GCAATTCCATCACTGCTCCAC	0.448																																																0			1											253.0	190.0	211.0					1																	31764789		2203	4300	6503	31537376	SO:0001819	synonymous_variant	9410			AF090988	CCDS340.1	1p35.2	2013-01-09	2008-10-29	2008-10-29	ENSG00000060688	ENSG00000060688		"""WD repeat domain containing"""	30857	protein-coding gene	gene with protein product		607797	"""WD repeat domain 57 (U5 snRNP specific)"""	WDR57		9774689, 9731529, 10788320	Standard	NM_004814		Approved	PRP8BP, SPF38, PRPF8BP, HPRP8BP	uc009vtt.3	Q96DI7	OTTHUMG00000003790	ENST00000263694.4:c.336G>A	1.37:g.31764789C>T		Somatic		Capture	Illumina GAIIx	4	31537376	B4DQJ1|O75938|O95320	Silent	SNP	HMMSmart_SM00320,HMMPfam_WD40,superfamily_WD40 repeat-like,PatternScan_WD_REPEATS_1	p.V112	ENST00000263694.4	37	c.336	CCDS340.1	1																																																																																			-	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40		0.448	SNRNP40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRNP40	protein_coding	OTTHUMT00000010657.1	C	NM_004814		31537376	-1	no_errors	NM_004814	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
NOTCH4	4855	genome.wustl.edu	37	6	32170091	32170091	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr6:32170091G>A	ENST00000375023.3	-	21	3655	c.3517C>T	c.(3517-3519)Ccc>Tcc	p.P1173S		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	1173					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						TTGGCTCCGGGTTTCTGACAC	0.647																																																0			6											21.0	23.0	22.0					6																	32170091		1509	2707	4216	32278069	SO:0001583	missense	4855				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.3517C>T	6.37:g.32170091G>A	ENSP00000364163:p.Pro1173Ser	Somatic		Capture	Illumina GAIIx	4	32278069	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	HMMSmart_SM00181,HMMPfam_EGF,HMMSmart_SM00179,superfamily_EGF/Laminin,PatternScan_EGF_1,PatternScan_EGF_2,PatternScan_EGF_CA,HMMPfam_EGF_CA,PatternScan_ASX_HYDROXYL,superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00004,HMMPfam_Notch,superfamily_Notch domain,HMMPfam_NODP,superfamily_Ankyrin repeat,HMMPfam_Ank,HMMSmart_SM00248	p.P1173S	ENST00000375023.3	37	c.3517	CCDS34420.1	6	.	.	.	.	.	.	.	.	.	.	G	3.508	-0.100326	0.06967	.	.	ENSG00000204301	ENST00000375023	D	0.81739	-1.53	4.77	1.78	0.24846	Notch domain (3);	0.156484	0.30347	N	0.009829	T	0.43122	0.1233	N	0.13168	0.305	0.80722	D	1	B	0.15719	0.014	B	0.22152	0.038	T	0.21484	-1.0244	10	0.16896	T	0.51	.	7.8186	0.29274	0.3086:0.0:0.6914:0.0	.	1173	Q99466	NOTC4_HUMAN	S	1173	ENSP00000364163:P1173S	ENSP00000364163:P1173S	P	-	1	0	NOTCH4	32278069	0.063000	0.20901	0.518000	0.27811	0.133000	0.20885	0.692000	0.25482	0.626000	0.30322	-0.258000	0.10820	CCC	-	superfamily_EGF/Laminin,HMMSmart_SM00004,HMMPfam_Notch,superfamily_Notch domain		0.647	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH4	protein_coding	OTTHUMT00000076045.2	G			32278069	-1	no_errors	NM_004557	genbank	human	reviewed	54_36p	missense	SNP	0.013	A
AQR	9716	genome.wustl.edu	37	15	35210572	35210572	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr15:35210572C>G	ENST00000156471.5	-	15	1454	c.1229G>C	c.(1228-1230)cGt>cCt	p.R410P		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	410					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		ACGTTCATGACGAGATACCTA	0.343																																																0			15											82.0	73.0	76.0					15																	35210572		1839	4089	5928	32997864	SO:0001583	missense	9716			AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.1229G>C	15.37:g.35210572C>G	ENSP00000156471:p.Arg410Pro	Somatic		Capture	Illumina GAIIx	4	32997864	A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	superfamily_SSF52540	p.R410P	ENST00000156471.5	37	c.1229	CCDS42013.1	15	.	.	.	.	.	.	.	.	.	.	C	19.79	3.893146	0.72524	.	.	ENSG00000021776	ENST00000156471;ENST00000543879	D	0.93712	-3.27	4.74	4.74	0.60224	.	0.097598	0.64402	D	0.000001	D	0.95169	0.8434	M	0.66939	2.045	0.50632	D	0.999888	D	0.64830	0.994	P	0.58391	0.838	D	0.93850	0.7144	10	0.29301	T	0.29	-13.4226	17.925	0.88980	0.0:1.0:0.0:0.0	.	410	O60306	AQR_HUMAN	P	410	ENSP00000156471:R410P	ENSP00000156471:R410P	R	-	2	0	AQR	32997864	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.670000	0.61583	2.474000	0.83562	0.491000	0.48974	CGT	-	NULL		0.343	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQR	protein_coding	OTTHUMT00000417526.2	C	NM_014691		32997864	-1	no_errors	NM_014691	genbank	human	validated	54_36p	missense	SNP	1.000	G
SYNGAP1	8831	genome.wustl.edu	37	6	33408583	33408583	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr6:33408583C>T	ENST00000418600.2	+	11	1855	c.1754C>T	c.(1753-1755)gCa>gTa	p.A585V	MIR5004_ENST00000579078.1_RNA|SYNGAP1_ENST00000496374.1_3'UTR|SYNGAP1_ENST00000293748.5_Missense_Mutation_p.A585V|SYNGAP1_ENST00000428982.2_Missense_Mutation_p.A526V	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	585	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						GAGGACATCGCAGACAGGCTT	0.627																																																0			6											75.0	64.0	68.0					6																	33408583		2203	4300	6503	33516561	SO:0001583	missense	8831			AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.1754C>T	6.37:g.33408583C>T	ENSP00000403636:p.Ala585Val	Somatic		Capture	Illumina GAIIx	4	33516561	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Missense_Mutation	SNP	HMMSmart_SM00233,superfamily_PH domain-like,HMMSmart_SM00239,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMPfam_C2,HMMSmart_SM00323,superfamily_GTPase activation domain GAP,HMMPfam_RasGAP,PatternScan_RAS_GTPASE_ACTIV_1	p.A570V	ENST00000418600.2	37	c.1709	CCDS34434.2	6	.	.	.	.	.	.	.	.	.	.	C	29.0	4.964587	0.92791	.	.	ENSG00000197283	ENST00000293748;ENST00000418600;ENST00000449372;ENST00000428982	T;T;T	0.79454	-1.27;-1.27;-1.27	5.24	5.24	0.73138	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.000000	0.85682	D	0.000000	D	0.83083	0.5177	L	0.54323	1.7	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.994;0.99;0.99	D	0.84438	0.0581	10	0.87932	D	0	.	16.3526	0.83220	0.0:1.0:0.0:0.0	.	585;585;585	Q96PV0;Q96PV0-2;Q96PV0-4	SYGP1_HUMAN;.;.	V	585;585;585;526	ENSP00000293748:A585V;ENSP00000403636:A585V;ENSP00000412475:A526V	ENSP00000293748:A585V	A	+	2	0	SYNGAP1	33516561	0.082000	0.21442	0.966000	0.40874	0.989000	0.77384	0.919000	0.28692	2.733000	0.93635	0.655000	0.94253	GCA	-	HMMSmart_SM00323,superfamily_GTPase activation domain GAP,HMMPfam_RasGAP		0.627	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNGAP1	protein_coding	OTTHUMT00000076151.4	C	XM_166407		33516561	+1	no_errors	NM_006772	genbank	human	validated	54_36p	missense	SNP	0.960	T
ZMYM4	9202	genome.wustl.edu	37	1	35836216	35836216	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr1:35836216C>T	ENST00000314607.6	+	7	1249	c.1169C>T	c.(1168-1170)tCa>tTa	p.S390L	ZMYM4_ENST00000373297.2_Missense_Mutation_p.S390L|ZMYM4_ENST00000482131.1_3'UTR	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	390					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				AAAACTTGTTCAAGTTGCTCA	0.403																																																0			1											61.0	60.0	61.0					1																	35836216		2203	4300	6503	35608803	SO:0001583	missense	9202			AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.1169C>T	1.37:g.35836216C>T	ENSP00000322915:p.Ser390Leu	Somatic		Capture	Illumina GAIIx	4	35608803	A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Missense_Mutation	SNP	HMMPfam_zf-FCS,HMMSmart_SM00746,PatternScan_GLYCO_HORMONE_BETA_1	p.S390L	ENST00000314607.6	37	c.1169	CCDS389.1	1	.	.	.	.	.	.	.	.	.	.	C	16.21	3.059564	0.55325	.	.	ENSG00000146463	ENST00000314607;ENST00000373297	T;T	0.24538	1.88;1.85	5.48	5.48	0.80851	TRASH (1);Zinc finger, MYM-type (1);	0.218024	0.39909	N	0.001221	T	0.25082	0.0609	L	0.43152	1.355	0.35590	D	0.806991	B	0.15473	0.013	B	0.22152	0.038	T	0.15838	-1.0423	10	0.48119	T	0.1	-8.1622	13.6138	0.62094	0.0:0.926:0.0:0.074	.	390	Q5VZL5	ZMYM4_HUMAN	L	390	ENSP00000322915:S390L;ENSP00000362394:S390L	ENSP00000322915:S390L	S	+	2	0	ZMYM4	35608803	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.816000	0.48026	2.573000	0.86826	0.591000	0.81541	TCA	-	HMMPfam_zf-FCS,HMMSmart_SM00746		0.403	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM4	protein_coding	OTTHUMT00000012207.3	C	NM_005095		35608803	+1	no_errors	NM_005095	genbank	human	validated	54_36p	missense	SNP	1.000	T
NPR2	4882	genome.wustl.edu	37	9	35801954	35801954	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr9:35801954C>G	ENST00000342694.2	+	9	1844	c.1589C>G	c.(1588-1590)gCc>gGc	p.A530G		NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	530	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	CTCATGACAGCCCATGGGAAA	0.537																																																0			9											146.0	130.0	135.0					9																	35801954		2203	4300	6503	35791954	SO:0001583	missense	4882			AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.1589C>G	9.37:g.35801954C>G	ENSP00000341083:p.Ala530Gly	Somatic		Capture	Illumina GAIIx	4	35791954	B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Missense_Mutation	SNP	superfamily_Periplasmic binding protein-like I,HMMPfam_ANF_receptor,PatternScan_ANF_RECEPTORS,HMMSmart_SM00220,HMMSmart_SM00219,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase,HMMSmart_SM00044,superfamily_Adenylyl and guanylyl cyclase catalytic domain,HMMPfam_Guanylate_cyc,PatternScan_GUANYLATE_CYCLASE_1	p.A530G	ENST00000342694.2	37	c.1589	CCDS6590.1	9	.	.	.	.	.	.	.	.	.	.	C	13.58	2.278817	0.40294	.	.	ENSG00000159899	ENST00000342694	T	0.47177	0.85	5.51	5.51	0.81932	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.42964	D	0.000634	T	0.33527	0.0866	N	0.16233	0.39	0.54753	D	0.99998	B;B	0.21452	0.02;0.056	B;B	0.22152	0.012;0.038	T	0.12630	-1.0540	10	0.12103	T	0.63	.	18.3564	0.90358	0.0:1.0:0.0:0.0	.	530;530	P20594-2;P20594	.;ANPRB_HUMAN	G	530	ENSP00000341083:A530G	ENSP00000341083:A530G	A	+	2	0	NPR2	35791954	0.919000	0.31177	1.000000	0.80357	0.999000	0.98932	1.623000	0.37008	2.763000	0.94921	0.650000	0.86243	GCC	-	HMMSmart_SM00220,HMMSmart_SM00219,superfamily_Protein kinase-like (PK-like)		0.537	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPR2	protein_coding	OTTHUMT00000052345.1	C			35791954	+1	no_errors	NM_003995	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
DCLK3	85443	genome.wustl.edu	37	3	36779136	36779136	+	Missense_Mutation	SNP	C	C	T	rs368283858	byFrequency	TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr3:36779136C>T	ENST00000416516.2	-	2	1505	c.1015G>A	c.(1015-1017)Ggt>Agt	p.G339S		NM_033403.1	NP_208382.1	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	339						cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	48						GGCTTCCGACCGCTGGGCCGC	0.562													C|||	2	0.000399361	0.0015	0.0	5008	,	,		18707	0.0		0.0	False		,,,				2504	0.0															0			3						C	SER/GLY	2,4092		0,2,2045	76.0	80.0	79.0		1015	4.7	0.1	3		79	0,8362		0,0,4181	no	missense	DCLK3	NM_033403.1	56	0,2,6226	TT,TC,CC		0.0,0.0489,0.0161	benign	339/649	36779136	2,12454	2047	4181	6228	36754140	SO:0001583	missense	85443			AB051552	CCDS43064.1	3p22.3	2007-04-02	2007-04-02	2007-04-02	ENSG00000163673	ENSG00000163673			19005	protein-coding gene	gene with protein product		613167	"""doublecortin and CaM kinase-like 3"""	DCAMKL3		11214970, 16869982	Standard	NM_033403		Approved	KIAA1765, DCDC3C	uc003cgi.2	Q9C098	OTTHUMG00000155805	ENST00000416516.2:c.1015G>A	3.37:g.36779136C>T	ENSP00000394484:p.Gly339Ser	Somatic		Capture	Illumina GAIIx	4	36754140		Missense_Mutation	SNP	superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.G339S	ENST00000416516.2	37	c.1015	CCDS43064.1	3	.	.	.	.	.	.	.	.	.	.	C	4.651	0.121110	0.08881	4.89E-4	0.0	ENSG00000163673	ENST00000416516	T	0.66815	-0.23	5.52	4.65	0.58169	Protein kinase-like domain (1);	0.251419	0.20935	N	0.083031	T	0.44871	0.1314	N	0.24115	0.695	0.09310	N	1	B	0.28801	0.223	B	0.16289	0.015	T	0.21793	-1.0235	10	0.25751	T	0.34	.	5.7676	0.18235	0.1434:0.64:0.1387:0.0779	.	339	Q9C098	DCLK3_HUMAN	S	339	ENSP00000394484:G339S	ENSP00000394484:G339S	G	-	1	0	DCLK3	36754140	0.000000	0.05858	0.062000	0.19696	0.177000	0.22998	0.178000	0.16820	1.473000	0.48159	-0.169000	0.13324	GGT	-	superfamily_Kinase_like		0.562	DCLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCLK3	protein_coding	OTTHUMT00000341727.1	C	XM_047355		36754140	-1	no_errors	NM_033403	genbank	human	validated	54_36p	missense	SNP	0.001	T
ANKRD30A	91074	genome.wustl.edu	37	10	37433956	37433956	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr10:37433956A>T	ENST00000602533.1	+	8	1358	c.1259A>T	c.(1258-1260)gAa>gTa	p.E420V	ANKRD30A_ENST00000374660.1_Missense_Mutation_p.E420V|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.E420V			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	476					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						AAACAAGAGGAAGATGAAGAA	0.269																																																0			10											114.0	110.0	111.0					10																	37433956		1781	4065	5846	37473962	SO:0001583	missense	91074			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.1259A>T	10.37:g.37433956A>T	ENSP00000473551:p.Glu420Val	Somatic		Capture	Illumina GAIIx	4	37473962	Q5W025	Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank,PatternScan_ASP_PROTEASE	p.E420V	ENST00000602533.1	37	c.1259		10	.	.	.	.	.	.	.	.	.	.	.	11.49	1.654047	0.29425	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.35236	1.4;1.32	1.13	1.13	0.20643	.	.	.	.	.	T	0.45316	0.1336	L	0.46157	1.445	0.09310	N	1	P	0.51653	0.947	D	0.67231	0.95	T	0.19484	-1.0304	9	0.56958	D	0.05	.	4.5712	0.12210	1.0:0.0:0.0:0.0	.	476	Q9BXX3	AN30A_HUMAN	V	420	ENSP00000354432:E420V;ENSP00000363792:E420V	ENSP00000354432:E420V	E	+	2	0	ANKRD30A	37473962	0.984000	0.35163	0.002000	0.10522	0.261000	0.26267	2.460000	0.45031	0.803000	0.34113	0.076000	0.15429	GAA	-	NULL		0.269	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ANKRD30A	protein_coding	OTTHUMT00000047588.2	A	NM_052997		37473962	+1	no_errors	NM_052997	genbank	human	validated	54_36p	missense	SNP	0.011	T
DSCR4	10281	genome.wustl.edu	37	21	39427050	39427050	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr21:39427050C>T	ENST00000328264.3	-	3	360	c.256G>A	c.(256-258)Gca>Aca	p.A86T	DSCR4_ENST00000398948.1_Intron	NM_005867.2	NP_005858.1	P56555	DSCR4_HUMAN	Down syndrome critical region gene 4	86										large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	6						AGACATTTTGCCCAAAATTGC	0.438																																																0			21											194.0	170.0	178.0					21																	39427050		2203	4300	6503	38348920	SO:0001583	missense	10281			AB000099	CCDS33554.1	21q22.2	2012-04-19			ENSG00000184029	ENSG00000184029			3045	protein-coding gene	gene with protein product		604829				9455479	Standard	NM_005867		Approved	DCRB	uc002ywp.3	P56555	OTTHUMG00000086673	ENST00000328264.3:c.256G>A	21.37:g.39427050C>T	ENSP00000328676:p.Ala86Thr	Somatic		Capture	Illumina GAIIx	4	38348920	Q4VB31	Missense_Mutation	SNP	NULL	p.A86T	ENST00000328264.3	37	c.256	CCDS33554.1	21	.	.	.	.	.	.	.	.	.	.	C	6.393	0.440635	0.12104	.	.	ENSG00000184029	ENST00000328264	.	.	.	2.46	-0.573	0.11742	.	.	.	.	.	T	0.27798	0.0684	.	.	.	0.09310	N	1	B	0.20988	0.05	B	0.14023	0.01	T	0.25257	-1.0137	7	0.87932	D	0	.	4.9948	0.14233	0.0:0.4693:0.0:0.5307	.	86	P56555	DSCR4_HUMAN	T	86	.	ENSP00000328676:A86T	A	-	1	0	DSCR4	38348920	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.244000	0.08903	-0.173000	0.10761	0.563000	0.77884	GCA	-	NULL		0.438	DSCR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DSCR4	protein_coding	OTTHUMT00000194834.1	C	NM_005867		38348920	-1	no_errors	NM_005867	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
RICTOR	253260	genome.wustl.edu	37	5	39002639	39002639	+	Silent	SNP	A	A	G			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr5:39002639A>G	ENST00000357387.3	-	5	420	c.390T>C	c.(388-390)gcT>gcC	p.A130A	RICTOR_ENST00000296782.5_Silent_p.A130A	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					AAATTTACCTAGCTATTAAAT	0.368																																																0			5											85.0	95.0	92.0					5																	39002639		2203	4300	6503	39038396	SO:0001819	synonymous_variant	253260				CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.390T>C	5.37:g.39002639A>G		Somatic		Capture	Illumina GAIIx	4	39038396		Silent	SNP	superfamily_ARM repeat,HMMPfam_RasGEF_N	p.A130	ENST00000357387.3	37	c.390	CCDS34148.1	5																																																																																			-	superfamily_ARM repeat		0.368	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RICTOR	protein_coding	OTTHUMT00000366985.1	A	NM_152756		39038396	-1	no_errors	NM_152756	genbank	human	validated	54_36p	silent	SNP	0.998	G
MEI1	150365	genome.wustl.edu	37	22	42172135	42172135	+	Silent	SNP	A	A	C			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr22:42172135A>C	ENST00000401548.3	+	21	2614	c.2574A>C	c.(2572-2574)acA>acC	p.T858T	MEI1_ENST00000400107.1_Silent_p.T226T|MEI1_ENST00000540880.1_Silent_p.T176T|MEI1_ENST00000300398.4_5'UTR	NM_152513.3	NP_689726.3			meiosis inhibitor 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CAGTGGACACAGCTCACAAGG	0.522																																																0			22											80.0	78.0	79.0					22																	42172135		1951	4161	6112	40502081	SO:0001819	synonymous_variant	150365			AK092934	CCDS46718.1	22q13.2	2013-10-11			ENSG00000167077	ENSG00000167077			28613	protein-coding gene	gene with protein product	"""spermatogenesis associated 38"""	608797				16683055	Standard	XM_006724154		Approved	MGC40042, SPATA38	uc003baz.1	Q5TIA1	OTTHUMG00000030083	ENST00000401548.3:c.2574A>C	22.37:g.42172135A>C		Somatic		Capture	Illumina GAIIx	4	40502081		Silent	SNP	superfamily_ARM repeat	p.T858	ENST00000401548.3	37	c.2574	CCDS46718.1	22																																																																																			-	NULL		0.522	MEI1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MEI1	protein_coding	OTTHUMT00000074937.3	A	NM_152513		40502081	+1	no_errors	NM_152513	genbank	human	validated	54_36p	silent	SNP	0.555	C
SPG11	80208	genome.wustl.edu	37	15	44876154	44876154	+	Silent	SNP	G	G	A	rs369869911		TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr15:44876154G>A	ENST00000261866.7	-	30	5740	c.5724C>T	c.(5722-5724)gtC>gtT	p.V1908V	SPG11_ENST00000558253.1_5'Flank|SPG11_ENST00000427534.2_Silent_p.V1908V|SPG11_ENST00000535302.2_Silent_p.V1908V|SPG11_ENST00000558319.1_Silent_p.V1908V	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	1908					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		ATACCAAGGCGACATCTGGAT	0.483																																																0			15											104.0	95.0	98.0					15																	44876154		2198	4298	6496	42663446	SO:0001819	synonymous_variant	80208				CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.5724C>T	15.37:g.44876154G>A		Somatic		Capture	Illumina GAIIx	4	42663446	A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Silent	SNP	PatternScan_GLYCOSYL_HYDROL_F1_1	p.V1908	ENST00000261866.7	37	c.5724	CCDS10112.1	15																																																																																			-	NULL		0.483	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPG11	protein_coding	OTTHUMT00000253927.1	G			42663446	-1	no_errors	NM_025137	genbank	human	reviewed	54_36p	silent	SNP	0.106	A
CNTNAP3B	728577	genome.wustl.edu	37	9	43849828	43849828	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr9:43849828A>C	ENST00000377564.3	+	11	2126	c.1733A>C	c.(1732-1734)tAt>tCt	p.Y578S		NM_001201380.1	NP_001188309.1	Q96NU0	CNT3B_HUMAN	contactin associated protein-like 3B	578	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|lung(3)|pancreas(1)|prostate(3)	10						GGCACAGGCTATACGGGCGAG	0.483																																																0			9																																								43789824	SO:0001583	missense	728577			BX538190	CCDS75836.1	9p12	2007-12-14			ENSG00000154529	ENSG00000154529			32035	protein-coding gene	gene with protein product						15820314	Standard	XM_006716853		Approved		uc004abr.1	Q96NU0	OTTHUMG00000013174	ENST00000377564.3:c.1733A>C	9.37:g.43849828A>C	ENSP00000366787:p.Tyr578Ser	Somatic		Capture	Illumina GAIIx	4	43789824	B1B0V7|B1B0V8|B1B0V9|B1B0W0|B1B0X8|B1B162|Q4VXF0|Q9H7W3	Missense_Mutation	SNP	HMMSmart_SM00231,superfamily_Galactose-binding domain-like,HMMPfam_F5_F8_type_C,PatternScan_FA58C_1,PatternScan_FA58C_2,superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282,HMMPfam_Laminin_G_2,HMMSmart_SM00181,HMMPfam_EGF,superfamily_Fibrinogen C-terminal domain-like,PatternScan_GLYCO_HORMONE_BETA_1	p.Y578S	ENST00000377564.3	37	c.1733	CCDS55312.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	26.1|26.1	4.705126|4.705126	0.89018|0.89018	.|.	.|.	ENSG00000154529|ENSG00000154529	ENST00000377561|ENST00000377564;ENST00000341990	.|T	.|0.18960	.|2.18	3.14|3.14	3.14|3.14	0.36123|0.36123	.|.	.|.	.|.	.|.	.|.	T|T	0.59348|0.59348	0.2187|0.2187	H|H	0.98155|0.98155	4.16|4.16	0.41980|0.41980	D|D	0.990791|0.990791	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.72750|0.72750	-0.4199|-0.4199	5|7	.|0.87932	.|D	.|0	.|.	10.7492|10.7492	0.46198|0.46198	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|.	.|.	.|.	L|S	627|578	.|ENSP00000366787:Y578S	.|ENSP00000340890:Y578S	I|Y	+|+	1|2	0|0	CNTNAP3B|CNTNAP3B	43789824|43789824	1.000000|1.000000	0.71417|0.71417	0.018000|0.018000	0.16275|0.16275	0.953000|0.953000	0.61014|0.61014	7.917000|7.917000	0.87498|0.87498	1.456000|1.456000	0.47831|0.47831	0.338000|0.338000	0.21704|0.21704	ATA|TAT	-	HMMSmart_SM00181,HMMPfam_EGF,superfamily_Concanavalin A-like lectins/glucanases,superfamily_Fibrinogen C-terminal domain-like		0.483	CNTNAP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP3B	protein_coding	OTTHUMT00000036930.3	A			43789824	+1	no_errors	XM_001128489	genbank	human	model	54_36p	missense	SNP	0.998	C
HECTD3	79654	genome.wustl.edu	37	1	45469606	45469606	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr1:45469606C>A	ENST00000372172.4	-	19	2421	c.2350G>T	c.(2350-2352)Gac>Tac	p.D784Y	HECTD3_ENST00000486132.1_5'UTR|HECTD3_ENST00000372168.3_Missense_Mutation_p.D394Y	NM_024602.5	NP_078878.3	Q5T447	HECD3_HUMAN	HECT domain containing E3 ubiquitin protein ligase 3	784	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|stomach(1)	28	Acute lymphoblastic leukemia(166;0.155)					CGGCTCCGGTCCTCTGGAGGG	0.607																																																0			1											46.0	55.0	52.0					1																	45469606		2072	4190	6262	45242193	SO:0001583	missense	79654			BC019105	CCDS41318.1	1p34.1	2012-02-23	2012-02-23		ENSG00000126107	ENSG00000126107			26117	protein-coding gene	gene with protein product			"""HECT domain containing 3"""			12477932	Standard	NM_024602		Approved	FLJ21156	uc009vxk.3	Q5T447	OTTHUMG00000008587	ENST00000372172.4:c.2350G>T	1.37:g.45469606C>A	ENSP00000361245:p.Asp784Tyr	Somatic		Capture	Illumina GAIIx	4	45242193	B3KPV7|B3KRH4|Q5T448|Q9H783	Missense_Mutation	SNP	superfamily_Galactose-binding domain-like,HMMPfam_APC10,HMMSmart_SM00119,superfamily_Hect E3 ligase catalytic domain,HMMPfam_HECT	p.D784Y	ENST00000372172.4	37	c.2350	CCDS41318.1	1	.	.	.	.	.	.	.	.	.	.	.	25.1	4.599300	0.87055	.	.	ENSG00000126107	ENST00000372172;ENST00000372168	T;T	0.46819	0.86;0.86	5.68	4.77	0.60923	HECT (4);	0.044730	0.85682	D	0.000000	T	0.63058	0.2479	M	0.87038	2.855	0.80722	D	1	B;D	0.56968	0.438;0.978	P;P	0.49999	0.613;0.628	T	0.72484	-0.4279	10	0.87932	D	0	.	14.3799	0.66905	0.0:0.9291:0.0:0.0709	.	784;394	Q5T447;Q5T447-2	HECD3_HUMAN;.	Y	784;394	ENSP00000361245:D784Y;ENSP00000361241:D394Y	ENSP00000361241:D394Y	D	-	1	0	HECTD3	45242193	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.485000	0.81204	1.407000	0.46875	0.544000	0.68410	GAC	-	HMMSmart_SM00119,superfamily_Hect E3 ligase catalytic domain,HMMPfam_HECT		0.607	HECTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECTD3	protein_coding	OTTHUMT00000023734.1	C	NM_024602		45242193	-1	no_errors	NM_024602	genbank	human	validated	54_36p	missense	SNP	1.000	A
LRCH1	23143	genome.wustl.edu	37	13	47303052	47303052	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr13:47303052T>C	ENST00000389798.3	+	17	2032	c.1835T>C	c.(1834-1836)cTc>cCc	p.L612P	LRCH1_ENST00000389797.3_Missense_Mutation_p.L647P|LRCH1_ENST00000311191.6_Missense_Mutation_p.L612P	NM_015116.2	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 1	612	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.									breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		GGTGTCGTCCTCTGCCATCTG	0.517																																																0			13											143.0	127.0	133.0					13																	47303052		2203	4300	6503	46201053	SO:0001583	missense	23143			AB023233	CCDS31972.1, CCDS53865.1, CCDS53866.1	13q14.11	2008-02-05	2004-05-27	2004-05-28	ENSG00000136141	ENSG00000136141			20309	protein-coding gene	gene with protein product		610368	"""calponin homology (CH) domain containing 1"""	CHDC1		10231032	Standard	NM_015116		Approved	KIAA1016	uc001vbk.3	Q9Y2L9	OTTHUMG00000016877	ENST00000389798.3:c.1835T>C	13.37:g.47303052T>C	ENSP00000374448:p.Leu612Pro	Somatic		Capture	Illumina GAIIx	4	46201053	B7ZLL5|F8W6F0|Q17R43|Q2KHR1|Q5TBU9|Q7Z5F6|Q7Z5F7	Missense_Mutation	SNP	superfamily_L domain-like,HMMSmart_SM00369,HMMPfam_LRR_1,HMMSmart_SM00364,PatternScan_PTS_HPR_SER,superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,HMMSmart_SM00033	p.L612P	ENST00000389798.3	37	c.1835	CCDS31972.1	13	.	.	.	.	.	.	.	.	.	.	T	23.7	4.441684	0.83993	.	.	ENSG00000136141	ENST00000311191;ENST00000389798;ENST00000389797	D;D;D	0.97811	-4.55;-4.55;-4.55	5.81	5.81	0.92471	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.99124	0.9698	H	0.96301	3.8	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99257	1.0889	10	0.87932	D	0	-0.4072	14.1039	0.65075	0.0:0.0:0.0:1.0	.	612;647;612	Q9Y2L9-2;F8W6F0;Q9Y2L9	.;.;LRCH1_HUMAN	P	612;612;647	ENSP00000308493:L612P;ENSP00000374448:L612P;ENSP00000374447:L647P	ENSP00000308493:L612P	L	+	2	0	LRCH1	46201053	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	7.361000	0.79497	2.216000	0.71823	0.533000	0.62120	CTC	-	superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,HMMSmart_SM00033		0.517	LRCH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LRCH1	protein_coding	OTTHUMT00000044824.2	T	NM_015116		46201053	+1	no_errors	NM_015116	genbank	human	provisional	54_36p	missense	SNP	1.000	C
PTPN23	25930	genome.wustl.edu	37	3	47450465	47450465	+	Silent	SNP	C	C	T			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr3:47450465C>T	ENST00000265562.4	+	16	1607	c.1530C>T	c.(1528-1530)ttC>ttT	p.F510F	PTPN23_ENST00000431726.1_Silent_p.F384F	NM_015466.2	NP_056281.1	Q9H3S7	PTN23_HUMAN	protein tyrosine phosphatase, non-receptor type 23	510					cilium morphogenesis (GO:0060271)|negative regulation of epithelial cell migration (GO:0010633)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of adherens junction organization (GO:1903393)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of homophilic cell adhesion (GO:1903387)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|central_nervous_system(1)|large_intestine(5)|lung(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		AGGCCTCCTTCACCAACAGTG	0.647																																																0			3											122.0	109.0	113.0					3																	47450465		2203	4300	6503	47425469	SO:0001819	synonymous_variant	25930			AB025194	CCDS2754.1	3p21.3	2011-06-09			ENSG00000076201	ENSG00000076201		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	14406	protein-coding gene	gene with protein product		606584				11095967	Standard	NM_015466		Approved	DKFZP564F0923, KIAA1471, HD-PTP	uc003crf.1	Q9H3S7	OTTHUMG00000133520	ENST00000265562.4:c.1530C>T	3.37:g.47450465C>T		Somatic		Capture	Illumina GAIIx	4	47425469	A8K0D7|Q7KZF8|Q8N6Z5|Q9BSR5|Q9P257|Q9UG03|Q9UMZ4	Silent	SNP	HMMPfam_BRO1,superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00194,HMMPfam_Y_phosphatase,HMMSmart_SM00404,PatternScan_TYR_PHOSPHATASE_1	p.F510	ENST00000265562.4	37	c.1530	CCDS2754.1	3																																																																																			-	NULL		0.647	PTPN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN23	protein_coding	OTTHUMT00000257492.2	C	NM_015466		47425469	+1	no_errors	NM_015466	genbank	human	validated	54_36p	silent	SNP	1.000	T
ADCY6	112	genome.wustl.edu	37	12	49167414	49167414	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr12:49167414A>G	ENST00000307885.4	-	15	3153	c.2459T>C	c.(2458-2460)aTg>aCg	p.M820T	ADCY6_ENST00000550422.1_Missense_Mutation_p.M767T|ADCY6_ENST00000357869.3_Missense_Mutation_p.M767T|MIR4701_ENST00000583094.1_RNA|ADCY6_ENST00000552090.1_5'Flank	NM_015270.3	NP_056085.1	O43306	ADCY6_HUMAN	adenylate cyclase 6	820					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|dopamine receptor signaling pathway (GO:0007212)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|negative regulation of neuron projection development (GO:0010977)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(16)|prostate(1)|skin(1)|urinary_tract(1)	29						ACTCAGCAGCATGTTCCCGAT	0.587																																																0			12											83.0	75.0	78.0					12																	49167414		2203	4300	6503	47453681	SO:0001583	missense	112				CCDS8767.1, CCDS8768.1	12q12-q13	2013-02-04				ENSG00000174233	4.6.1.1	"""Adenylate cyclases"""	237	protein-coding gene	gene with protein product		600294					Standard	NM_015270		Approved	AC6	uc001rsh.4	O43306		ENST00000307885.4:c.2459T>C	12.37:g.49167414A>G	ENSP00000311405:p.Met820Thr	Somatic		Capture	Illumina GAIIx	4	47453681	Q9NR75|Q9UDB0	Missense_Mutation	SNP	HMMSmart_SM00044,superfamily_Adenylyl and guanylyl cyclase catalytic domain,HMMPfam_Guanylate_cyc,PatternScan_GUANYLATE_CYCLASE_1,HMMPfam_DUF1053	p.M820T	ENST00000307885.4	37	c.2459	CCDS8767.1	12	.	.	.	.	.	.	.	.	.	.	A	9.683	1.149912	0.21371	.	.	ENSG00000174233	ENST00000357869;ENST00000550422;ENST00000307885	D;D;T	0.88277	-2.36;-2.36;-1.14	5.42	4.28	0.50868	.	0.416822	0.25897	N	0.027593	T	0.80989	0.4730	N	0.24115	0.695	0.26138	N	0.980321	B;B;B	0.30584	0.286;0.015;0.004	B;B;B	0.31290	0.127;0.016;0.007	T	0.71213	-0.4659	10	0.39692	T	0.17	.	10.6208	0.45478	0.923:0.0:0.077:0.0	.	51;767;820	B4DG74;O43306-2;O43306	.;.;ADCY6_HUMAN	T	767;767;820	ENSP00000350536:M767T;ENSP00000446730:M767T;ENSP00000311405:M820T	ENSP00000311405:M820T	M	-	2	0	ADCY6	47453681	0.994000	0.37717	0.853000	0.33588	0.239000	0.25481	5.105000	0.64591	1.020000	0.39573	-0.315000	0.08773	ATG	-	NULL		0.587	ADCY6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY6	protein_coding	OTTHUMT00000408863.1	A	NM_020983		47453681	-1	no_errors	NM_015270	genbank	human	reviewed	54_36p	missense	SNP	0.989	G
B4GALT5	9334	genome.wustl.edu	37	20	48256272	48256272	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr20:48256272T>C	ENST00000371711.4	-	7	1047	c.860A>G	c.(859-861)aAt>aGt	p.N287S		NM_004776.3	NP_004767.1	O43286	B4GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5	287					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20			BRCA - Breast invasive adenocarcinoma(9;2.51e-06)			AGGAAAGCCATTGATTTTCCG	0.478																																																0			20											171.0	158.0	162.0					20																	48256272		2203	4300	6503	47689679	SO:0001583	missense	9334			AB004550	CCDS13420.1	20q13.1-q13.2	2013-02-19			ENSG00000158470	ENSG00000158470		"""Beta 4-glycosyltransferases"""	928	protein-coding gene	gene with protein product	"""beta4-GalT IV"""	604016				9597550, 9435216	Standard	NM_004776		Approved	beta4GalT-V	uc002xuu.4	O43286	OTTHUMG00000033086	ENST00000371711.4:c.860A>G	20.37:g.48256272T>C	ENSP00000360776:p.Asn287Ser	Somatic		Capture	Illumina GAIIx	4	47689679	E1P625|Q2M394|Q9UJQ8	Missense_Mutation	SNP	superfamily_SSF53448,HMMPfam_Galactosyl_T_2	p.N287S	ENST00000371711.4	37	c.860	CCDS13420.1	20	.	.	.	.	.	.	.	.	.	.	T	27.0	4.791094	0.90367	.	.	ENSG00000158470	ENST00000371711	T	0.37411	1.2	5.21	5.21	0.72293	.	0.041659	0.85682	D	0.000000	T	0.70378	0.3217	H	0.94620	3.56	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.80204	-0.1479	10	0.87932	D	0	-24.0121	15.0878	0.72167	0.0:0.0:0.0:1.0	.	287	O43286	B4GT5_HUMAN	S	287	ENSP00000360776:N287S	ENSP00000360776:N287S	N	-	2	0	B4GALT5	47689679	1.000000	0.71417	0.999000	0.59377	0.889000	0.51656	8.040000	0.89188	1.975000	0.57531	0.459000	0.35465	AAT	-	superfamily_SSF53448,HMMPfam_Galactosyl_T_2		0.478	B4GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALT5	protein_coding	OTTHUMT00000080543.3	T	NM_004776		47689679	-1	no_errors	NM_004776	genbank	human	validated	54_36p	missense	SNP	1.000	C
TMEM189-UBE2V1	387522	genome.wustl.edu	37	20	48760077	48760077	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr20:48760077G>A	ENST00000341698.2	-	2	202	c.203C>T	c.(202-204)gCc>gTc	p.A68V	TMEM189_ENST00000557021.1_Missense_Mutation_p.A68V|TMEM189_ENST00000371652.4_Missense_Mutation_p.A68V|TMEM189_ENST00000371650.5_Missense_Mutation_p.A68V	NM_001257399.1	NP_001244328.1			TMEM189-UBE2V1 readthrough											breast(1)|endometrium(4)|large_intestine(6)|lung(6)	17			BRCA - Breast invasive adenocarcinoma(9;8.29e-07)			CTCCCAGCGGGCCAGCAGCAG	0.647																																																0			20											81.0	60.0	67.0					20																	48760077		2202	4300	6502	48193484	SO:0001583	missense	387522			U39361	CCDS13424.1	20q13.13	2011-05-31			ENSG00000124208	ENSG00000124208			33521	other	readthrough						11076860	Standard	NM_199203		Approved	Kua-UEV, CROC-1B	uc002xvf.3		OTTHUMG00000033085	ENST00000341698.2:c.203C>T	20.37:g.48760077G>A	ENSP00000344166:p.Ala68Val	Somatic		Capture	Illumina GAIIx	4	48193484		Missense_Mutation	SNP	HMMPfam_Kua-UEV1_localn,superfamily_UBC-like,HMMSmart_SM00212,HMMPfam_UQ_con	p.A68V	ENST00000341698.2	37	c.203	CCDS13424.1	20	.	.	.	.	.	.	.	.	.	.	G	18.07	3.542663	0.65198	.	.	ENSG00000124208;ENSG00000240849;ENSG00000240849;ENSG00000240849	ENST00000341698;ENST00000557021;ENST00000371650;ENST00000371652	T;T;T;T	0.51574	0.7;0.7;0.97;0.97	5.44	5.44	0.79542	.	.	.	.	.	T	0.58935	0.2157	L	0.43152	1.355	0.26718	N	0.970839	B;B;D	0.67145	0.004;0.004;0.996	B;B;D	0.70935	0.008;0.008;0.971	T	0.50849	-0.8779	9	0.21014	T	0.42	.	14.7489	0.69511	0.0:0.0:1.0:0.0	.	68;68;68	Q5TGE1;A5PLL7;G3V2F7	.;TM189_HUMAN;.	V	68	ENSP00000344166:A68V;ENSP00000450635:A68V;ENSP00000360713:A68V;ENSP00000360715:A68V	ENSP00000360713:A68V	A	-	2	0	TMEM189-UBE2V1;TMEM189	48193484	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.404000	0.52623	2.565000	0.86533	0.561000	0.74099	GCC	-	NULL		0.647	TMEM189-UBE2V1-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	TMEM189-UBE2V1	protein_coding	OTTHUMT00000080532.5	G			48193484	-1	no_errors	NM_199203	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
SPPL2A	84888	genome.wustl.edu	37	15	51032026	51032026	+	Splice_Site	SNP	C	C	T			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr15:51032026C>T	ENST00000261854.5	-	6	859		c.e6-1			NM_032802.3	NP_116191.2	Q8TCT8	SPP2A_HUMAN	signal peptide peptidase like 2A						membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|regulation of immune response (GO:0050776)	extracellular vesicular exosome (GO:0070062)|Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15				all cancers(107;0.000712)|GBM - Glioblastoma multiforme(94;0.00314)		CAAGTTTTCCCTGTACAAACA	0.308																																					Melanoma(50;790 1209 4069 22965 33125)											0			15											82.0	82.0	82.0					15																	51032026		2195	4291	6486	48819318	SO:0001630	splice_region_variant	84888				CCDS10138.1	15q21.2	2012-02-21			ENSG00000138600	ENSG00000138600			30227	protein-coding gene	gene with protein product	"""intramembrane protease 3"", ""presenilin-like protein 2"""	608238				12077416, 12139484	Standard	NM_032802		Approved	IMP3, PSL2	uc001zyv.3	Q8TCT8	OTTHUMG00000131647	ENST00000261854.5:c.585-1G>A	15.37:g.51032026C>T		Somatic		Capture	Illumina GAIIx	4	48819318	B2RDS0|Q8TAW1|Q96SZ8	Splice_Site	SNP	-	e6-1	ENST00000261854.5	37	c.585-1	CCDS10138.1	15	.	.	.	.	.	.	.	.	.	.	C	13.22	2.171690	0.38315	.	.	ENSG00000138600	ENST00000261854	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6017	0.95566	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	AC012100.1	48819318	1.000000	0.71417	1.000000	0.80357	0.364000	0.29643	3.938000	0.56583	2.622000	0.88805	0.655000	0.94253	.	-	-		0.308	SPPL2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPPL2A	protein_coding	OTTHUMT00000254543.3	C	NM_032802	Intron	48819318	-1	no_errors	NM_032802	genbank	human	reviewed	54_36p	splice_site	SNP	0.946	T
BSN	8927	genome.wustl.edu	37	3	49691218	49691218	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr3:49691218C>G	ENST00000296452.4	+	5	4343	c.4229C>G	c.(4228-4230)cCt>cGt	p.P1410R		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	1410					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		GAGCGTAGTCCTTCACCATCT	0.617																																																0			3											147.0	154.0	152.0					3																	49691218		2203	4300	6503	49666222	SO:0001583	missense	8927			AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.4229C>G	3.37:g.49691218C>G	ENSP00000296452:p.Pro1410Arg	Somatic		Capture	Illumina GAIIx	4	49666222	O43161|Q7LGH3	Missense_Mutation	SNP	HMMPfam_zf-piccolo,superfamily_FYVE_PHD_ZnF	p.P1410R	ENST00000296452.4	37	c.4229	CCDS2800.1	3	.	.	.	.	.	.	.	.	.	.	C	6.558	0.471242	0.12461	.	.	ENSG00000164061	ENST00000296452	T	0.18174	2.23	4.78	2.97	0.34412	.	0.876740	0.09896	N	0.741719	T	0.12518	0.0304	L	0.36672	1.1	0.09310	N	1	P	0.40476	0.718	B	0.33042	0.157	T	0.15150	-1.0447	10	0.35671	T	0.21	.	9.5254	0.39160	0.0:0.8238:0.0:0.1762	.	1410	Q9UPA5	BSN_HUMAN	R	1410	ENSP00000296452:P1410R	ENSP00000296452:P1410R	P	+	2	0	BSN	49666222	0.000000	0.05858	0.024000	0.17045	0.391000	0.30476	0.146000	0.16180	1.016000	0.39470	0.462000	0.41574	CCT	-	NULL		0.617	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	BSN	protein_coding	OTTHUMT00000258164.1	C	NM_003458		49666222	+1	no_errors	NM_003458	genbank	human	validated	54_36p	missense	SNP	0.008	G
ITGA2	3673	genome.wustl.edu	37	5	52370263	52370263	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr5:52370263G>C	ENST00000296585.5	+	21	2763	c.2620G>C	c.(2620-2622)Gtt>Ctt	p.V874L		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	874					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				TCAGAAGTCTGTTGCCTGCGA	0.443																																																0			5											204.0	158.0	174.0					5																	52370263		2203	4300	6503	52406020	SO:0001583	missense	3673				CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.2620G>C	5.37:g.52370263G>C	ENSP00000296585:p.Val874Leu	Somatic		Capture	Illumina GAIIx	4	52406020	Q14595	Missense_Mutation	SNP	superfamily_Integrin alpha N-terminal domain,HMMSmart_SM00191,superfamily_vWA-like,HMMSmart_SM00327,HMMPfam_VWA,HMMPfam_FG-GAP,HMMPfam_Integrin_alpha2,superfamily_Integrin domains,PatternScan_INTEGRIN_ALPHA,HMMPfam_Integrin_alpha	p.V874L	ENST00000296585.5	37	c.2620	CCDS3957.1	5	.	.	.	.	.	.	.	.	.	.	G	12.23	1.874688	0.33069	.	.	ENSG00000164171	ENST00000296585	T	0.43688	0.94	5.01	4.07	0.47477	Integrin alpha-2 (1);	0.118882	0.56097	D	0.000027	T	0.31734	0.0806	L	0.29908	0.895	0.39584	D	0.969481	B;B	0.17667	0.023;0.009	B;B	0.26969	0.075;0.032	T	0.08472	-1.0720	10	0.16896	T	0.51	.	14.5278	0.67900	0.0:0.1463:0.8537:0.0	.	874;874	E7ESP4;P17301	.;ITA2_HUMAN	L	874	ENSP00000296585:V874L	ENSP00000296585:V874L	V	+	1	0	ITGA2	52406020	0.994000	0.37717	0.997000	0.53966	0.891000	0.51852	2.646000	0.46630	2.755000	0.94549	0.650000	0.86243	GTT	-	HMMPfam_Integrin_alpha2,superfamily_Integrin domains		0.443	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA2	protein_coding	OTTHUMT00000253857.2	G	NM_002203		52406020	+1	no_errors	NM_002203	genbank	human	reviewed	54_36p	missense	SNP	0.219	C
NCKAP1L	3071	genome.wustl.edu	37	12	54894409	54894409	+	Splice_Site	SNP	G	G	T			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr12:54894409G>T	ENST00000293373.6	+	3	385	c.306G>T	c.(304-306)cgG>cgT	p.R102R	RP11-753H16.3_ENST00000550474.1_RNA|NCKAP1L_ENST00000545638.2_Splice_Site_p.R52R	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	102					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						TGGAATTTCGGGTGAGCTCTC	0.393																																																0			12											142.0	132.0	135.0					12																	54894409		2203	4300	6503	53180676	SO:0001630	splice_region_variant	3071			AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.306+1G>T	12.37:g.54894409G>T		Somatic		Capture	Illumina GAIIx	4	53180676	B4DUT5|Q52LW0	Silent	SNP	HMMPfam_Nckap1	p.R102	ENST00000293373.6	37	c.306	CCDS31813.1	12																																																																																			-	HMMPfam_Nckap1		0.393	NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCKAP1L	protein_coding	OTTHUMT00000406195.1	G	NM_005337	Silent	53180676	+1	no_errors	NM_005337	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
DHX29	54505	genome.wustl.edu	37	5	54579235	54579235	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr5:54579235C>G	ENST00000251636.5	-	11	1909	c.1761G>C	c.(1759-1761)agG>agC	p.R587S	RP11-506H20.1_ENST00000506435.1_RNA	NM_019030.2	NP_061903.2	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	587	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					eukaryotic 43S preinitiation complex (GO:0016282)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation initiation factor activity (GO:0003743)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|lung(6)|ovary(4)|prostate(1)|skin(3)|urinary_tract(2)	46		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				CTACCCGATGCCTTTTAAGAG	0.403																																																0			5											127.0	134.0	132.0					5																	54579235		2203	4300	6503	54614992	SO:0001583	missense	54505			AY036974	CCDS34158.1	5q11.2	2008-02-05	2003-06-13	2003-06-20	ENSG00000067248	ENSG00000067248		"""DEAH-boxes"""	15815	protein-coding gene	gene with protein product		612720	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 29"""	DDX29			Standard	XM_005248544		Approved		uc003jpx.3	Q7Z478	OTTHUMG00000162313	ENST00000251636.5:c.1761G>C	5.37:g.54579235C>G	ENSP00000251636:p.Arg587Ser	Somatic		Capture	Illumina GAIIx	4	54614992	O75549|Q63HN0|Q63HN3|Q8IWW2|Q8N3A1|Q9UMH2	Missense_Mutation	SNP	superfamily_SSF52540,HMMSmart_DEXDc,HMMPfam_DEAD,PatternScan_DEAH_ATP_HELICASE,HMMSmart_HELICc,HMMPfam_Helicase_C,HMMPfam_HA2,HMMPfam_DUF1605	p.R587S	ENST00000251636.5	37	c.1761	CCDS34158.1	5	.	.	.	.	.	.	.	.	.	.	C	10.58	1.390873	0.25118	.	.	ENSG00000067248	ENST00000251636	T	0.07567	3.18	5.74	2.61	0.31194	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.088663	0.85682	D	0.000000	T	0.03348	0.0097	N	0.04387	-0.21	0.46028	D	0.998825	B	0.14012	0.009	B	0.18561	0.022	T	0.45411	-0.9263	10	0.16896	T	0.51	.	7.1408	0.25554	0.0:0.5578:0.0:0.4422	.	587	Q7Z478	DHX29_HUMAN	S	587	ENSP00000251636:R587S	ENSP00000251636:R587S	R	-	3	2	DHX29	54614992	0.990000	0.36364	1.000000	0.80357	0.944000	0.59088	0.172000	0.16704	0.781000	0.33589	0.591000	0.81541	AGG	-	superfamily_SSF52540,HMMSmart_DEXDc,HMMPfam_DEAD		0.403	DHX29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX29	protein_coding	OTTHUMT00000368532.1	C	NM_019030		54614992	-1	no_errors	NM_019030	genbank	human	validated	54_36p	missense	SNP	1.000	G
BBS2	583	genome.wustl.edu	37	16	56530881	56530881	+	Silent	SNP	G	G	A			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr16:56530881G>A	ENST00000245157.5	-	15	2328	c.1908C>T	c.(1906-1908)gaC>gaT	p.D636D	BBS2_ENST00000568104.1_Silent_p.D590D	NM_031885.3	NP_114091	Q9BXC9	BBS2_HUMAN	Bardet-Biedl syndrome 2	636					adult behavior (GO:0030534)|artery smooth muscle contraction (GO:0014824)|brain morphogenesis (GO:0048854)|cartilage development (GO:0051216)|cerebral cortex development (GO:0021987)|cilium morphogenesis (GO:0060271)|fat cell differentiation (GO:0045444)|Golgi to plasma membrane protein transport (GO:0043001)|hippocampus development (GO:0021766)|melanosome transport (GO:0032402)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|positive regulation of multicellular organism growth (GO:0040018)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|sperm axoneme assembly (GO:0007288)|striatum development (GO:0021756)|vasodilation (GO:0042311)|visual perception (GO:0007601)	BBSome (GO:0034464)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)	26						ATACTCACATGTCCCTCATCA	0.413									Bardet-Biedl syndrome																																							0			16											133.0	111.0	118.0					16																	56530881		2198	4300	6498	55088382	SO:0001819	synonymous_variant	583	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AF342736	CCDS32451.1	16q21	2013-01-08				ENSG00000125124			967	protein-coding gene	gene with protein product		606151		BBS		11285252	Standard	NM_031885		Approved		uc002ejd.2	Q9BXC9		ENST00000245157.5:c.1908C>T	16.37:g.56530881G>A		Somatic		Capture	Illumina GAIIx	4	55088382	Q96CM0|Q96SN9	Silent	SNP	superfamily_WD40 repeat-like,HMMPfam_FG-GAP	p.D636	ENST00000245157.5	37	c.1908	CCDS32451.1	16																																																																																			-	NULL		0.413	BBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBS2	protein_coding	OTTHUMT00000434386.2	G	NM_031885		55088382	-1	no_errors	NM_031885	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
IL31RA	133396	genome.wustl.edu	37	5	55204453	55204453	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr5:55204453G>C	ENST00000396836.2	+	11	1907	c.1715G>C	c.(1714-1716)aGg>aCg	p.R572T	IL31RA_ENST00000354961.4_Intron|IL31RA_ENST00000396834.1_Intron|IL31RA_ENST00000297015.3_Missense_Mutation_p.R430T|IL31RA_ENST00000359040.5_Intron|IL31RA_ENST00000447346.2_Intron|IL31RA_ENST00000490985.1_Intron			Q8NI17	IL31R_HUMAN	interleukin 31 receptor A	0					cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|homeostatic process (GO:0042592)|JAK-STAT cascade (GO:0007259)|macrophage differentiation (GO:0030225)|MAPK cascade (GO:0000165)|monocyte differentiation (GO:0030224)|negative regulation of apoptotic process (GO:0043066)|negative regulation of macrophage activation (GO:0043031)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cytokine binding (GO:0019955)|cytokine receptor activity (GO:0004896)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|stomach(1)	21		Lung NSC(810;6.93e-05)|Prostate(74;0.00741)|Breast(144;0.0544)|Ovarian(174;0.223)				gtacctgagaggagagtcctg	0.488																																																0			5																																								55240210	SO:0001583	missense	133396			AY499339	CCDS3970.2, CCDS56365.1, CCDS56366.1, CCDS56367.1, CCDS75244.1, CCDS75245.1	5q11.2	2013-02-11			ENSG00000164509	ENSG00000164509		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	18969	protein-coding gene	gene with protein product		609510				15184896, 11877449	Standard	NM_139017		Approved	CRL3, GLM-R, CRL, Glmr, IL-31RA	uc003jql.3	Q8NI17	OTTHUMG00000097045	ENST00000396836.2:c.1715G>C	5.37:g.55204453G>C	ENSP00000380048:p.Arg572Thr	Somatic		Capture	Illumina GAIIx	4	55240210	A6NIF8|Q2TBA1|Q6EBC3|Q6EBC4|Q6EBC5|Q6EBC6|Q6UWL8|Q8WYJ0	Missense_Mutation	SNP	HMMSmart_FN3,superfamily_FN_III-like,HMMPfam_fn3	p.R572T	ENST00000396836.2	37	c.1715		5	.	.	.	.	.	.	.	.	.	.	G	0.307	-0.970506	0.02232	.	.	ENSG00000164509	ENST00000396836;ENST00000297015	T;T	0.44083	1.13;0.93	0.235	-0.47	0.12131	.	.	.	.	.	T	0.27349	0.0671	.	.	.	0.09310	N	1	B	0.17667	0.023	B	0.12156	0.007	T	0.23940	-1.0174	7	0.87932	D	0	.	.	.	.	.	572	Q8NI17-8	.	T	572;430	ENSP00000380048:R572T;ENSP00000297015:R430T	ENSP00000297015:R430T	R	+	2	0	IL31RA	55240210	0.021000	0.18746	0.004000	0.12327	0.190000	0.23558	-0.569000	0.05902	-0.671000	0.05274	-0.657000	0.03884	AGG	-	NULL		0.488	IL31RA-004	KNOWN	basic	protein_coding	IL31RA	protein_coding	OTTHUMT00000313798.1	G	NM_139017		55240210	+1	no_errors	ENST00000396836	ensembl	human	known	54_36p	missense	SNP	0.004	C
EFEMP1	2202	genome.wustl.edu	37	2	56145357	56145357	+	Nonsense_Mutation	SNP	T	T	A	rs371658999		TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr2:56145357T>A	ENST00000394555.2	-	3	562	c.127A>T	c.(127-129)Aaa>Taa	p.K43*	EFEMP1_ENST00000394554.1_Nonsense_Mutation_p.K43*|EFEMP1_ENST00000424836.2_5'UTR|EFEMP1_ENST00000355426.3_Nonsense_Mutation_p.K43*	NM_001039348.2|NM_001039349.2	NP_001034437.1|NP_001034438.1	Q12805	FBLN3_HUMAN	EGF containing fibulin-like extracellular matrix protein 1	43	EGF-like 1; atypical. {ECO:0000255|PROSITE-ProRule:PRU00076}.				epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|negative regulation of chondrocyte differentiation (GO:0032331)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|epidermal growth factor-activated receptor activity (GO:0005006)			NS(1)|breast(2)|endometrium(4)|large_intestine(6)|lung(5)|ovary(5)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GGCTCACCTTTGCATTGCTGT	0.463																																					GBM(92;934 1319 7714 28760 40110)											0			2											212.0	180.0	191.0					2																	56145357		2203	4300	6503	55998861	SO:0001587	stop_gained	2202			U03877	CCDS1857.1	2p16	2013-01-08	2011-01-25		ENSG00000115380	ENSG00000115380		"""Fibulins"""	3218	protein-coding gene	gene with protein product	"""fibulin 3"""	601548	"""fibrillin-like"", ""EGF-containing fibulin-like extracellular matrix protein 1"""	DHRD, FBNL		8812496, 7799918	Standard	NM_001039348		Approved	S1-5, FBLN3, MTLV	uc002rzi.3	Q12805	OTTHUMG00000129343	ENST00000394555.2:c.127A>T	2.37:g.56145357T>A	ENSP00000378058:p.Lys43*	Somatic		Capture	Illumina GAIIx	4	55998861	A8K3I4|B4DW75|D6W5D2|Q541U7	Nonsense_Mutation	SNP	superfamily_EGF/Laminin,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_SM00179,HMMSmart_SM00181,PatternScan_ASX_HYDROXYL,PatternScan_EGF_2	p.K43*	ENST00000394555.2	37	c.127	CCDS1857.1	2	.	.	.	.	.	.	.	.	.	.	T	39	7.445563	0.98289	.	.	ENSG00000115380	ENST00000394555;ENST00000394554;ENST00000355426;ENST00000438672;ENST00000439193;ENST00000440439;ENST00000429909;ENST00000452337;ENST00000421664	.	.	.	5.41	5.41	0.78517	.	0.087685	0.49305	D	0.000157	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	.	15.4275	0.75065	0.0:0.0:0.0:1.0	.	.	.	.	X	43	.	ENSP00000347596:K43X	K	-	1	0	EFEMP1	55998861	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.763000	0.68818	2.060000	0.61445	0.460000	0.39030	AAA	-	superfamily_EGF/Laminin		0.463	EFEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFEMP1	protein_coding	OTTHUMT00000251491.2	T			55998861	-1	no_errors	NM_001039348	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	A
CNGB1	1258	genome.wustl.edu	37	16	57921795	57921795	+	Silent	SNP	C	C	T	rs540706326		TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr16:57921795C>T	ENST00000251102.8	-	32	3486	c.3426G>A	c.(3424-3426)ctG>ctA	p.L1142L	CNGB1_ENST00000564448.1_Silent_p.L1136L	NM_001297.4	NP_001288.3	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1	1142					cation transport (GO:0006812)|cytosolic calcium ion homeostasis (GO:0051480)|detection of light stimulus involved in visual perception (GO:0050908)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|protein heterotetramerization (GO:0051290)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina homeostasis (GO:0001895)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of smell (GO:0007608)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|intracellular cyclic nucleotide activated cation channel complex (GO:0017071)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)|transmembrane transporter complex (GO:1902495)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(7)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(11)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	54						CAGCCGCCTCCAGCGCGGCCA	0.582													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18002	0.0		0.0	False		,,,				2504	0.0				Colon(156;1293 1853 16336 28962 38659)											0			16											81.0	86.0	84.0					16																	57921795		1889	4108	5997	56479296	SO:0001819	synonymous_variant	1258			AF042498	CCDS42169.1, CCDS45495.1, CCDS67042.1	16q13	2013-02-14			ENSG00000070729	ENSG00000070729		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2151	protein-coding gene	gene with protein product	"""glutamic acid-rich protein"""	600724		CNCG2, CNCG3L		8766832, 7590744, 16382102	Standard	NM_001297		Approved	RCNC2, RCNCb, GARP, GAR1, CNGB1B, RP45	uc002emt.2	Q14028	OTTHUMG00000154810	ENST00000251102.8:c.3426G>A	16.37:g.57921795C>T		Somatic		Capture	Illumina GAIIx	4	56479296	H3BN09|O43636|Q13059|Q14029|Q9UMG2	Silent	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,superfamily_cAMP-binding domain-like,HMMSmart_SM00100,HMMPfam_cNMP_binding,PatternScan_CNMP_BINDING_1,PatternScan_CNMP_BINDING_2	p.L1142	ENST00000251102.8	37	c.3426	CCDS42169.1	16																																																																																			-	NULL		0.582	CNGB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNGB1	protein_coding	OTTHUMT00000337167.2	C	NM_001297		56479296	-1	no_errors	NM_001297	genbank	human	validated	54_36p	silent	SNP	0.871	T
TNFRSF11A	8792	genome.wustl.edu	37	18	60025544	60025544	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr18:60025544C>T	ENST00000586569.1	+	5	529	c.491C>T	c.(490-492)tCc>tTc	p.S164F	TNFRSF11A_ENST00000269485.7_Missense_Mutation_p.S164F	NM_001270949.1|NM_003839.3	NP_001257878.1|NP_003830.1	Q9Y6Q6	TNR11_HUMAN	tumor necrosis factor receptor superfamily, member 11a, NFKB activator	164					adaptive immune response (GO:0002250)|cell-cell signaling (GO:0007267)|circadian temperature homeostasis (GO:0060086)|lymph node development (GO:0048535)|mammary gland alveolus development (GO:0060749)|monocyte chemotaxis (GO:0002548)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling (GO:0071848)|positive regulation of fever generation by positive regulation of prostaglandin secretion (GO:0071812)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|response to cytokine (GO:0034097)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to radiation (GO:0009314)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|TNFSF11-mediated signaling pathway (GO:0071847)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(13)|skin(3)|upper_aerodigestive_tract(1)	29		Colorectal(73;0.188)				GATGCCTTTTCCTCCACGGAC	0.448																																																0			18											138.0	131.0	133.0					18																	60025544		2203	4300	6503	58176524	SO:0001583	missense	8792			AF018253	CCDS11980.1, CCDS59324.1, CCDS74227.1, CCDS74228.1	18q22.1	2014-09-17			ENSG00000141655	ENSG00000141655		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11908	protein-coding gene	gene with protein product		603499	"""tumor necrosis factor receptor superfamily, member 11a, activator of NFKB"", ""Paget disease of bone 2"", ""loss of heterozygosity, 18, chromosomal region 1"""	PDB2, LOH18CR1		9367155, 10615125	Standard	NM_001270951		Approved	RANK, CD265, FEO	uc002lin.4	Q9Y6Q6	OTTHUMG00000132779	ENST00000586569.1:c.491C>T	18.37:g.60025544C>T	ENSP00000465500:p.Ser164Phe	Somatic		Capture	Illumina GAIIx	4	58176524	I4EC36|I4EC38|I4EC39|I7JE63|N0GVH0|Q59EP9	Missense_Mutation	SNP	superfamily_SSF57586,HMMPfam_TNFR_c6,HMMSmart_TNFR,PatternScan_TNFR_NGFR_1	p.S164F	ENST00000586569.1	37	c.491	CCDS11980.1	18	.	.	.	.	.	.	.	.	.	.	C	15.85	2.955347	0.53293	.	.	ENSG00000141655	ENST00000382790;ENST00000269485	T	0.71934	-0.61	5.84	5.84	0.93424	TNFR/CD27/30/40/95 cysteine-rich region (1);	0.000000	0.64402	D	0.000001	D	0.88396	0.6425	M	0.92219	3.285	0.48511	D	0.999669	D;D	0.89917	1.0;1.0	D;D	0.72625	0.967;0.978	D	0.90064	0.4158	9	.	.	.	-19.6756	19.7297	0.96177	0.0:1.0:0.0:0.0	.	186;164	Q59EP9;Q9Y6Q6	.;TNR11_HUMAN	F	186;164	ENSP00000269485:S164F	.	S	+	2	0	TNFRSF11A	58176524	0.997000	0.39634	0.454000	0.27019	0.107000	0.19398	4.759000	0.62227	2.763000	0.94921	0.557000	0.71058	TCC	-	superfamily_SSF57586,HMMSmart_TNFR		0.448	TNFRSF11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF11A	protein_coding	OTTHUMT00000256186.2	C			58176524	+1	no_errors	NM_003839	genbank	human	reviewed	54_36p	missense	SNP	0.088	T
INTS5	80789	genome.wustl.edu	37	11	62414729	62414729	+	Silent	SNP	C	C	G	rs551521257		TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr11:62414729C>G	ENST00000330574.2	-	2	2875	c.2823G>C	c.(2821-2823)ctG>ctC	p.L941L	GANAB_ENST00000540933.1_5'Flank|GANAB_ENST00000346178.4_5'Flank|GANAB_ENST00000534779.1_5'Flank|GANAB_ENST00000356638.3_5'Flank	NM_030628.1	NP_085131.1	Q6P9B9	INT5_HUMAN	integrator complex subunit 5	941					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				breast(1)|endometrium(4)|large_intestine(6)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	36						TGAGCAGCAGCAGACGCACCT	0.567													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19281	0.0		0.0	False		,,,				2504	0.0															0			11											147.0	163.0	158.0					11																	62414729		2202	4299	6501	62171305	SO:0001819	synonymous_variant	80789			AK123587	CCDS8027.1	11q12.3	2006-04-26	2006-03-15	2006-03-15	ENSG00000185085	ENSG00000185085			29352	protein-coding gene	gene with protein product		611349	"""KIAA1698"""	KIAA1698		16239144	Standard	NM_030628		Approved	INT5	uc001nud.3	Q6P9B9	OTTHUMG00000167605	ENST00000330574.2:c.2823G>C	11.37:g.62414729C>G		Somatic		Capture	Illumina GAIIx	4	62171305	Q8N6W5|Q9C0G5	Silent	SNP	NULL	p.L941	ENST00000330574.2	37	c.2823	CCDS8027.1	11																																																																																			-	NULL		0.567	INTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS5	protein_coding	OTTHUMT00000395327.1	C	NM_030628		62171305	-1	no_errors	NM_030628	genbank	human	provisional	54_36p	silent	SNP	1.000	G
STX5	6811	genome.wustl.edu	37	11	62592559	62592559	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr11:62592559G>A	ENST00000294179.3	-	8	781	c.628C>T	c.(628-630)Cag>Tag	p.Q210*	STX5_ENST00000394690.1_Nonsense_Mutation_p.Q156*|STX5_ENST00000541317.1_Nonsense_Mutation_p.Q114*|STX5_ENST00000377897.4_Nonsense_Mutation_p.Q210*	NM_001244666.1|NM_003164.4	NP_001231595.1|NP_003155.2	Q13190	STX5_HUMAN	syntaxin 5	210					ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)|vesicle fusion with Golgi apparatus (GO:0048280)|vesicle targeting (GO:0006903)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|SNARE complex (GO:0031201)	protein N-terminus binding (GO:0047485)|SNAP receptor activity (GO:0005484)			breast(2)|endometrium(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	18						CGGGAGAACTGCTCTCTCCGG	0.567																																																0			11											46.0	52.0	50.0					11																	62592559		2201	4299	6500	62349135	SO:0001587	stop_gained	6811			U26648	CCDS8038.2, CCDS58140.1	11q12.3	2008-02-05	2006-04-25	2006-04-25	ENSG00000162236	ENSG00000162236			11440	protein-coding gene	gene with protein product		603189	"""syntaxin 5A"""	STX5A		9188044, 11959998	Standard	NM_003164		Approved	SED5	uc001nvh.3	Q13190	OTTHUMG00000143864	ENST00000294179.3:c.628C>T	11.37:g.62592559G>A	ENSP00000294179:p.Gln210*	Somatic		Capture	Illumina GAIIx	4	62349135	B2R8T2|F8W8Q9|Q5U0D4|Q7Z3T6|Q9BUG1	Nonsense_Mutation	SNP	superfamily_t-snare proteins,HMMPfam_Syntaxin,HMMSmart_SM00397,HMMPfam_SNARE,PatternScan_SYNTAXIN	p.Q210*	ENST00000294179.3	37	c.628	CCDS8038.2	11	.	.	.	.	.	.	.	.	.	.	G	35	5.437918	0.96168	.	.	ENSG00000162236	ENST00000377897;ENST00000294179;ENST00000394690;ENST00000541317	.	.	.	5.41	5.41	0.78517	.	0.280574	0.42548	D	0.000683	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	-21.5768	16.7371	0.85449	0.0:0.0:1.0:0.0	.	.	.	.	X	210;210;156;114	.	ENSP00000294179:Q210X	Q	-	1	0	STX5	62349135	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.141000	0.94612	2.826000	0.97356	0.655000	0.94253	CAG	-	superfamily_t-snare proteins		0.567	STX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX5	protein_coding	OTTHUMT00000290113.1	G	NM_003164		62349135	-1	no_errors	NM_003164	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
MALAT1	378938	genome.wustl.edu	37	11	65269655	65269655	+	lincRNA	SNP	C	C	G			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr11:65269655C>G	ENST00000534336.1	+	0	4423					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		AAGTATTGAACTGGGGGTTGG	0.388																																																0			11											57.0	57.0	57.0					11																	65269655		874	1988	2862	65026231			378938			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65269655C>G		Somatic		Capture	Illumina GAIIx	4	65026231		RNA	SNP	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			-	-		0.388	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	lincRNA	OTTHUMT00000389143.1	C	NR_002819		65026231	+1	no_errors	NR_002819	genbank	human	provisional	54_36p	rna	SNP	0.008	G
LTBP3	4054	genome.wustl.edu	37	11	65310999	65310999	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr11:65310999C>G	ENST00000301873.5	-	17	2643	c.2375G>C	c.(2374-2376)gGg>gCg	p.G792A	LTBP3_ENST00000536982.1_Missense_Mutation_p.G418A|LTBP3_ENST00000322147.4_Missense_Mutation_p.G792A|LTBP3_ENST00000530785.1_5'UTR|LTBP3_ENST00000532932.1_Missense_Mutation_p.G222A|LTBP3_ENST00000529189.1_5'UTR	NM_001130144.2	NP_001123616.1	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding protein 3	792	Cys-rich.|EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|extracellular matrix organization (GO:0030198)|lung saccule development (GO:0060430)|negative regulation of bone mineralization (GO:0030502)|negative regulation of chondrocyte differentiation (GO:0032331)|positive regulation of bone resorption (GO:0045780)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of mesenchymal stem cell proliferation (GO:1902462)|transforming growth factor beta activation (GO:0036363)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(3)	23						ACACACGTCCCCAGCCTCACA	0.577																																																0			11											159.0	131.0	140.0					11																	65310999		2201	4297	6498	65067575	SO:0001583	missense	4054			AF135960	CCDS8103.1, CCDS44647.1	11q12	2011-10-20			ENSG00000168056	ENSG00000168056		"""Latent transforming growth factor, beta binding proteins"""	6716	protein-coding gene	gene with protein product		602090		LTBP2		7719025	Standard	NM_001164266		Approved		uc001oej.3	Q9NS15	OTTHUMG00000166575	ENST00000301873.5:c.2375G>C	11.37:g.65310999C>G	ENSP00000301873:p.Gly792Ala	Somatic		Capture	Illumina GAIIx	4	65067575	O15107|Q96HB9|Q9H7K2|Q9UFN4	Missense_Mutation	SNP	superfamily_SSF57196,HMMSmart_EGF,HMMPfam_EGF,PatternScan_EGF_1,superfamily_Fibril-assoc,HMMPfam_TB,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_EGF_CA,PatternScan_ASX_HYDROXYL,PatternScan_EGF_2	p.G792A	ENST00000301873.5	37	c.2375	CCDS44647.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.54|12.54	1.967681|1.967681	0.34754|0.34754	.|.	.|.	ENSG00000168056|ENSG00000168056	ENST00000322147;ENST00000301873;ENST00000532932;ENST00000536982;ENST00000530866|ENST00000526927	D;D;D;D;D|.	0.92249|.	-3.0;-3.0;-3.0;-3.0;-3.0|.	4.39|4.39	4.39|4.39	0.52855|0.52855	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);|.	0.448650|.	0.23575|.	N|.	0.046701|.	T|T	0.55893|0.55893	0.1949|0.1949	L|L	0.50993|0.50993	1.605|1.605	0.32454|0.32454	N|N	0.545004|0.545004	P;P;P;P;P;B|.	0.52692|.	0.819;0.955;0.679;0.863;0.629;0.197|.	B;P;B;P;B;B|.	0.45712|.	0.433;0.491;0.266;0.484;0.173;0.068|.	T|T	0.63808|0.63808	-0.6553|-0.6553	10|5	0.26408|.	T|.	0.33|.	.|.	12.4632|12.4632	0.55743|0.55743	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	703;418;675;792;792;222|.	E9PKW1;F5GWC4;B9EG76;Q9NS15;Q9NS15-2;E9PJR2|.	.;.;.;LTBP3_HUMAN;.;.|.	A|C	792;792;222;418;703|442	ENSP00000326647:G792A;ENSP00000301873:G792A;ENSP00000435530:G222A;ENSP00000441912:G418A;ENSP00000435276:G703A|.	ENSP00000301873:G792A|.	G|W	-|-	2|3	0|0	LTBP3|LTBP3	65067575|65067575	0.002000|0.002000	0.14202|0.14202	0.487000|0.487000	0.27428|0.27428	0.016000|0.016000	0.09150|0.09150	1.784000|1.784000	0.38674|0.38674	1.974000|1.974000	0.57490|0.57490	0.557000|0.557000	0.71058|0.71058	GGG|TGG	-	PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_EGF_CA,superfamily_SSF57196		0.577	LTBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LTBP3	protein_coding	OTTHUMT00000390538.1	C	NM_021070		65067575	-1	no_errors	NM_021070	genbank	human	validated	54_36p	missense	SNP	0.006	G
RLTPR	146206	genome.wustl.edu	37	16	67680615	67680615	+	Splice_Site	SNP	A	A	T			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr16:67680615A>T	ENST00000334583.6	+	7	794		c.e7-1		RLTPR_ENST00000545661.1_Splice_Site	NM_001013838.1	NP_001013860.1	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing						cell migration (GO:0016477)|establishment of protein localization (GO:0045184)|homeostasis of number of cells (GO:0048872)|maintenance of cell polarity (GO:0030011)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|F-actin capping protein complex (GO:0008290)|immunological synapse (GO:0001772)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(4)|kidney(1)|lung(9)|urinary_tract(2)	18		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		TCCCCTCCCCAGGTGGCTTCT	0.552																																																0			16											100.0	101.0	101.0					16																	67680615		2007	4206	6213	66238116	SO:0001630	splice_region_variant	146206			AB113647	CCDS45513.1	16q22.1	2010-09-10				ENSG00000159753			27089	protein-coding gene	gene with protein product	"""RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein"", ""leucine rich repeat containing 16C"""	610859				15588584, 19846667	Standard	XM_005255807		Approved	LRRC16C, CARMIL2	uc002etn.3	Q6F5E8		ENST00000334583.6:c.467-1A>T	16.37:g.67680615A>T		Somatic		Capture	Illumina GAIIx	4	66238116	B8X2Z3	Splice_Site	SNP	-	e7-2	ENST00000334583.6	37	c.467-2	CCDS45513.1	16	.	.	.	.	.	.	.	.	.	.	A	20.6	4.025520	0.75390	.	.	ENSG00000159753	ENST00000334583;ENST00000545661	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0156	0.64523	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RLTPR	66238116	1.000000	0.71417	0.997000	0.53966	0.878000	0.50629	8.601000	0.90864	2.118000	0.64928	0.459000	0.35465	.	-	-		0.552	RLTPR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RLTPR	protein_coding	OTTHUMT00000467858.1	A	NM_001013838	Intron	66238116	+1	no_errors	NM_001013838	genbank	human	provisional	54_36p	splice_site	SNP	0.998	T
KDM2A	22992	genome.wustl.edu	37	11	67021790	67021790	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr11:67021790G>A	ENST00000529006.2	+	20	3654	c.3208G>A	c.(3208-3210)Gac>Aac	p.D1070N	KDM2A_ENST00000398645.2_3'UTR|KDM2A_ENST00000526258.1_3'UTR|KDM2A_ENST00000308783.5_Missense_Mutation_p.D528N|KDM2A_ENST00000530342.1_Missense_Mutation_p.D631N	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	1070					histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						GTCTCGACTCGACCTCAGTCA	0.562																																																0			11											160.0	157.0	158.0					11																	67021790		2190	4275	6465	66778366	SO:0001583	missense	22992			BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.3208G>A	11.37:g.67021790G>A	ENSP00000432786:p.Asp1070Asn	Somatic		Capture	Illumina GAIIx	4	66778366	D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Missense_Mutation	SNP	superfamily_Clavaminate synthase-like,HMMSmart_SM00558,HMMPfam_JmjC,HMMPfam_zf-CXXC,PatternScan_2FE2S_FER_1,HMMSmart_SM00249,PatternScan_ZF_PHD_1,HMMPfam_F-box,superfamily_RNI-like,HMMSmart_SM00367	p.D1070N	ENST00000529006.2	37	c.3208	CCDS44657.1	11	.	.	.	.	.	.	.	.	.	.	G	34	5.298223	0.95574	.	.	ENSG00000173120	ENST00000529006;ENST00000530342;ENST00000308783	T;T;T	0.61510	0.1;0.1;0.1	5.17	5.17	0.71159	.	0.045466	0.85682	D	0.000000	T	0.71592	0.3358	L	0.58428	1.81	0.80722	D	1	P;D;D	0.89917	0.899;1.0;0.999	P;D;P	0.66602	0.49;0.945;0.894	T	0.67581	-0.5634	10	0.31617	T	0.26	-19.3866	18.8464	0.92209	0.0:0.0:1.0:0.0	.	631;528;1070	E9PIL6;D4QA03;Q9Y2K7	.;.;KDM2A_HUMAN	N	1070;631;528	ENSP00000432786:D1070N;ENSP00000435776:D631N;ENSP00000309302:D528N	ENSP00000309302:D528N	D	+	1	0	KDM2A	66778366	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.780000	0.85658	2.674000	0.91012	0.655000	0.94253	GAC	-	superfamily_RNI-like,HMMSmart_SM00367		0.562	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL11	protein_coding	OTTHUMT00000393140.2	G	NM_012308		66778366	+1	no_errors	NM_012308	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CTNNA3	29119	genome.wustl.edu	37	10	68381515	68381515	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr10:68381515T>C	ENST00000433211.2	-	10	1483	c.1309A>G	c.(1309-1311)Aca>Gca	p.T437A	CTNNA3_ENST00000373744.4_Missense_Mutation_p.T437A	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						TCTTCATTTGTTGACATGGAA	0.318																																																0			10											86.0	81.0	83.0					10																	68381515		2203	4299	6502	68051521	SO:0001583	missense	29119			AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.1309A>G	10.37:g.68381515T>C	ENSP00000389714:p.Thr437Ala	Somatic		Capture	Illumina GAIIx	4	68051521		Missense_Mutation	SNP	HMMPfam_Vinculin,superfamily_alpha-catenin/vinculin	p.T437A	ENST00000433211.2	37	c.1309	CCDS7269.1	10	.	.	.	.	.	.	.	.	.	.	T	11.62	1.693770	0.30052	.	.	ENSG00000183230	ENST00000433211;ENST00000373744	T;T	0.33865	1.39;1.39	5.49	1.46	0.22682	.	0.128686	0.34067	N	0.004289	T	0.23572	0.0570	L	0.33485	1.01	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.09377	0.001;0.004	T	0.05022	-1.0911	10	0.39692	T	0.17	-11.5592	7.432	0.27132	0.0:0.2956:0.0:0.7044	.	437;437	Q9UI47-2;Q9UI47	.;CTNA3_HUMAN	A	437	ENSP00000389714:T437A;ENSP00000362849:T437A	ENSP00000362849:T437A	T	-	1	0	CTNNA3	68051521	0.997000	0.39634	1.000000	0.80357	0.995000	0.86356	1.394000	0.34509	0.383000	0.24910	-0.263000	0.10527	ACA	-	HMMPfam_Vinculin,superfamily_alpha-catenin/vinculin		0.318	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA3	protein_coding	OTTHUMT00000048282.2	T	NM_013266		68051521	-1	no_errors	NM_013266	genbank	human	validated	54_36p	missense	SNP	0.995	C
SMG1P7	100506060	genome.wustl.edu	37	16	70260675	70260675	+	IGR	SNP	T	T	A			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr16:70260675T>A	ENST00000594734.1	+	0	381				RP11-296I10.6_ENST00000581050.1_RNA																							AGCCTTACTTTATATAGTTGA	0.353																																																0			16																																								68818176	SO:0001628	intergenic_variant	0																															16.37:g.70260675T>A		Somatic		Capture	Illumina GAIIx	4	68818176		Silent	SNP	NULL	p.I600	ENST00000594734.1	37	c.1800		16																																																																																			-	NULL		0.353	FKSG63-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000205152	protein_coding		T			68818176	-1	no_errors	ENST00000378955	ensembl	human	known	54_36p	silent	SNP	1.000	A
CALB2	794	genome.wustl.edu	37	16	71406134	71406134	+	Splice_Site	SNP	T	T	A			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr16:71406134T>A	ENST00000302628.4	+	2	248		c.e2+2		CALB2_ENST00000349553.5_Splice_Site	NM_001740.4	NP_001731.2	P22676	CALB2_HUMAN	calbindin 2						cytosolic calcium ion homeostasis (GO:0051480)	cytoplasm (GO:0005737)|gap junction (GO:0005921)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18		Ovarian(137;0.125)				TCTGGCATGGTAAGCCCAGCC	0.453																																																0			16											73.0	78.0	76.0					16																	71406134		2198	4300	6498	69963635	SO:0001630	splice_region_variant	794			X56667	CCDS10899.1	16q22.2	2013-01-10	2008-05-19		ENSG00000172137	ENSG00000172137		"""EF-hand domain containing"""	1435	protein-coding gene	gene with protein product	"""calretinin"""	114051	"""calbindin 2, 29kDa (calretinin)"""			1906795	Standard	NM_001740		Approved	CAL2	uc002faa.4	P22676	OTTHUMG00000137589	ENST00000302628.4:c.171+2T>A	16.37:g.71406134T>A		Somatic		Capture	Illumina GAIIx	4	69963635	A8K4Y1|Q53HD2|Q96BK4	Splice_Site	SNP	-	e2+2	ENST00000302628.4	37	c.171+2	CCDS10899.1	16	.	.	.	.	.	.	.	.	.	.	T	22.3	4.268002	0.80469	.	.	ENSG00000172137	ENST00000349553;ENST00000302628	.	.	.	5.79	5.79	0.91817	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1052	0.72315	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	CALB2	69963635	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.528000	0.73807	2.186000	0.69663	0.533000	0.62120	.	-	-		0.453	CALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALB2	protein_coding	OTTHUMT00000268988.1	T	NM_001740	Intron	69963635	+1	no_errors	NM_001740	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	A
RNF157	114804	genome.wustl.edu	37	17	74222231	74222231	+	Intron	SNP	A	A	T			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr17:74222231A>T	ENST00000269391.6	-	2	221				RNF157_ENST00000592271.1_Intron|RNF157_ENST00000319945.6_Intron	NM_052916.2	NP_443148.1	Q96PX1	RN157_HUMAN	ring finger protein 157								zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	25			LUSC - Lung squamous cell carcinoma(166;0.187)			TACAGATGCCACTATCATTAT	0.517																																					GBM(186;507 2120 27388 27773 52994)											0			17																																								71733826	SO:0001627	intron_variant	643159			AK091467	CCDS32740.1	17q25.3	2004-02-27			ENSG00000141576	ENSG00000141576		"""RING-type (C3HC4) zinc fingers"""	29402	protein-coding gene	gene with protein product						11572484	Standard	NM_052916		Approved	KIAA1917	uc002jqz.3	Q96PX1	OTTHUMG00000132627	ENST00000269391.6:c.89-13668T>A	17.37:g.74222231A>T		Somatic		Capture	Illumina GAIIx	4	71733826	Q8NB72|Q96N56	Missense_Mutation	SNP	HMMPfam_bZIP_1,HMMSmart_SM00338,PatternScan_BZIP_BASIC	p.S219R	ENST00000269391.6	37	c.657	CCDS32740.1	17																																																																																			-	NULL		0.517	RNF157-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC643159	protein_coding	OTTHUMT00000255874.2	A	XM_290732		71733826	-1	pseudogene	XM_928637	genbank	human	model	54_36p	missense	SNP	1.000	T
RCN2	5955	genome.wustl.edu	37	15	77239811	77239811	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr15:77239811G>A	ENST00000394885.3	+	5	834	c.611G>A	c.(610-612)gGa>gAa	p.G204E	RCN2_ENST00000394883.3_Missense_Mutation_p.G103E|RCN2_ENST00000320963.5_Missense_Mutation_p.G222E	NM_002902.2	NP_002893.1	Q14257	RCN2_HUMAN	reticulocalbin 2, EF-hand calcium binding domain	204	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.					endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(2)|large_intestine(2)|lung(1)	7						AATGGTGATGGATTTGTTAGT	0.333																																																0			15											136.0	140.0	138.0					15																	77239811		2196	4294	6490	75026866	SO:0001583	missense	5955			X78669	CCDS10291.1, CCDS61719.1	15q22.33-q24.1	2013-01-10			ENSG00000117906	ENSG00000117906		"""EF-hand domain containing"""	9935	protein-coding gene	gene with protein product	"""Reticulocalbin 2, EF-hand calcium binding domain (endoplasmic reticulum calcium-binding protein, 55kD)"""	602584				9533013, 7624774	Standard	NM_002902		Approved	ERC-55, E6BP, ERC55, TCBP49	uc002bcd.3	Q14257	OTTHUMG00000143730	ENST00000394885.3:c.611G>A	15.37:g.77239811G>A	ENSP00000378349:p.Gly204Glu	Somatic		Capture	Illumina GAIIx	4	75026866	A8MTG6|F8WCY5|Q53XN8	Missense_Mutation	SNP	HMMSmart_SM00054,HMMPfam_efhand,PatternScan_EF_HAND_1,superfamily_EF-hand	p.G204E	ENST00000394885.3	37	c.611	CCDS10291.1	15	.	.	.	.	.	.	.	.	.	.	G	27.5	4.839933	0.91117	.	.	ENSG00000117906	ENST00000394885;ENST00000320963;ENST00000394883	D;D;D	0.96992	-4.2;-4.2;-4.2	5.18	5.18	0.71444	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.98137	0.9385	M	0.80508	2.5	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;1.0	D	0.99174	1.0865	10	0.87932	D	0	-24.4384	18.6864	0.91565	0.0:0.0:1.0:0.0	.	103;222;204	A8MXP8;F8WCY5;Q14257	.;.;RCN2_HUMAN	E	204;222;103	ENSP00000378349:G204E;ENSP00000319739:G222E;ENSP00000378347:G103E	ENSP00000319739:G222E	G	+	2	0	RCN2	75026866	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.534000	0.90620	2.422000	0.82143	0.585000	0.79938	GGA	-	superfamily_EF-hand,HMMPfam_efhand,HMMSmart_SM00054,PatternScan_EF_HAND_1		0.333	RCN2-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	RCN2	protein_coding	OTTHUMT00000289795.1	G	NM_002902		75026866	+1	no_errors	NM_002902	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CYSLTR1	10800	genome.wustl.edu	37	X	77528320	77528320	+	Silent	SNP	T	T	C			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chrX:77528320T>C	ENST00000373304.3	-	3	1216	c.924A>G	c.(922-924)acA>acG	p.T308T		NM_001282187.1|NM_001282188.1|NM_006639.3	NP_001269116.1|NP_001269117.1|NP_006630.1	Q9Y271	CLTR1_HUMAN	cysteinyl leukotriene receptor 1	308					defense response (GO:0006952)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|respiratory gaseous exchange (GO:0007585)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	leukotriene receptor activity (GO:0004974)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	14					Cinalukast(DB00587)|Montelukast(DB00471)|Nedocromil(DB00716)|Pranlukast(DB01411)|Zafirlukast(DB00549)	GCTTTCTGAATGTAGACAGCC	0.413																																																0			X											63.0	60.0	61.0					X																	77528320		2202	4299	6501	77414976	SO:0001819	synonymous_variant	10800			AF119711	CCDS14439.1	Xq13-q21	2012-08-10			ENSG00000173198	ENSG00000173198		"""GPCR / Class A : Leukotriene receptors"""	17451	protein-coding gene	gene with protein product		300201				10391245, 10462554	Standard	NM_006639		Approved	CysLT1, CysLT(1), CYSLT1R	uc004edb.3	Q9Y271	OTTHUMG00000021889	ENST00000373304.3:c.924A>G	X.37:g.77528320T>C		Somatic		Capture	Illumina GAIIx	4	77414976	B2R954|D3DTE4|Q5JS94|Q8IV19	Silent	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1	p.T308	ENST00000373304.3	37	c.924	CCDS14439.1	X																																																																																			-	superfamily_Family A G protein-coupled receptor-like		0.413	CYSLTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYSLTR1	protein_coding	OTTHUMT00000057315.1	T			77414976	-1	no_errors	NM_006639	genbank	human	reviewed	54_36p	silent	SNP	1.000	C
SATL1	340562	genome.wustl.edu	37	X	84362525	84362525	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chrX:84362525G>A	ENST00000395409.3	-	1	1449	c.889C>T	c.(889-891)Ccg>Tcg	p.P297S	SATL1_ENST00000509231.1_Missense_Mutation_p.P484S|SATL1_ENST00000332921.5_Missense_Mutation_p.P297S			Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1	297	Gln-rich.						N-acetyltransferase activity (GO:0008080)			NS(1)|breast(5)|endometrium(2)|large_intestine(3)|lung(13)|skin(3)|stomach(1)|urinary_tract(1)	29						CTCGGCCCCGGTTCCCATATG	0.577																																																0			X											116.0	94.0	101.0					X																	84362525		2203	4300	6503	84249181	SO:0001583	missense	340562			BC043215	CCDS35343.1, CCDS35343.2	Xq21	2008-02-05			ENSG00000184788	ENSG00000184788			27992	protein-coding gene	gene with protein product						12477932	Standard	NM_001012980		Approved		uc004een.3	Q86VE3	OTTHUMG00000021931	ENST00000395409.3:c.889C>T	X.37:g.84362525G>A	ENSP00000378804:p.Pro297Ser	Somatic		Capture	Illumina GAIIx	4	84249181	A0AVK7|E9PB72|Q5H8V9	Missense_Mutation	SNP	superfamily_Acyl_CoA_acyltransferase	p.P297S	ENST00000395409.3	37	c.889		X	.	.	.	.	.	.	.	.	.	.	G	3.030	-0.199834	0.06219	.	.	ENSG00000184788	ENST00000395409;ENST00000332921;ENST00000509231	T;T;T	0.39787	1.06;1.06;1.06	3.48	-4.7	0.03288	.	.	.	.	.	T	0.31670	0.0804	M	0.62723	1.935	0.09310	N	1	B;B	0.32573	0.001;0.376	B;B	0.26614	0.001;0.071	T	0.20638	-1.0269	9	0.62326	D	0.03	0.0697	5.7204	0.17985	0.5334:0.0:0.3343:0.1323	.	297;484	Q86VE3;E9PB72	SATL1_HUMAN;.	S	297;297;484	ENSP00000378804:P297S;ENSP00000329115:P297S;ENSP00000425421:P484S	ENSP00000329115:P297S	P	-	1	0	SATL1	84249181	0.014000	0.17966	0.000000	0.03702	0.001000	0.01503	0.923000	0.28757	-1.085000	0.03088	-0.190000	0.12839	CCG	-	NULL		0.577	SATL1-202	KNOWN	basic|appris_principal	protein_coding	SATL1	protein_coding		G	XM_291339		84249181	-1	no_errors	NM_001012980	genbank	human	provisional	54_36p	missense	SNP	0.001	A
LRIT2	340745	genome.wustl.edu	37	10	85981766	85981766	+	Silent	SNP	A	A	G			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr10:85981766A>G	ENST00000372113.4	-	3	1568	c.1563T>C	c.(1561-1563)ttT>ttC	p.F521F	LRIT2_ENST00000538192.1_Silent_p.F531F	NM_001017924.2	NP_001017924.1	A6NDA9	LRIT2_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 2	521						integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|prostate(6)|urinary_tract(1)	32						GATGTTCTCTAAAGGAGCCAT	0.597																																																0			10											102.0	96.0	98.0					10																	85981766		2203	4300	6503	85971746	SO:0001819	synonymous_variant	340745				CCDS31234.1, CCDS60581.1	10q23.2	2013-01-11	2007-06-19	2007-06-19	ENSG00000204033	ENSG00000204033		"""Immunoglobulin superfamily / I-set domain containing"""	23443	protein-coding gene	gene with protein product			"""leucine rich repeat containing 22"""	LRRC22			Standard	NM_001017924		Approved	AC022389.4	uc001kcy.3	A6NDA9	OTTHUMG00000018633	ENST00000372113.4:c.1563T>C	10.37:g.85981766A>G		Somatic		Capture	Illumina GAIIx	4	85971746	B7ZME6	Silent	SNP	HMMPfam_LRRNT,superfamily_SSF52058,HMMPfam_LRR_1,HMMSmart_LRR_TYP,HMMSmart_LRRCT,superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IGc2	p.F521	ENST00000372113.4	37	c.1563	CCDS31234.1	10																																																																																			-	NULL		0.597	LRIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIT2	protein_coding	OTTHUMT00000049110.4	A	XM_291697		85971746	-1	no_errors	NM_001017924	genbank	human	validated	54_36p	silent	SNP	0.189	G
ATP6V0D2	245972	genome.wustl.edu	37	8	87111222	87111222	+	Silent	SNP	G	G	A	rs201771660		TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr8:87111222G>A	ENST00000285393.3	+	1	157	c.15G>A	c.(13-15)gcG>gcA	p.A5A	CTD-3118D11.2_ENST00000522679.1_RNA	NM_152565.1	NP_689778.1	Q8N8Y2	VA0D2_HUMAN	ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d2	5					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	hydrogen ion transmembrane transporter activity (GO:0015078)			breast(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(9)|prostate(1)	27						TCGAAGGTGCGGAGCTGTACT	0.557													g|||	1	0.000199681	0.0	0.0	5008	,	,		16445	0.001		0.0	False		,,,				2504	0.0															0			8											135.0	103.0	114.0					8																	87111222		2203	4300	6503	87180338	SO:0001819	synonymous_variant	245972			AY079172	CCDS6241.1	8q21.3	2014-01-28	2006-01-20	2002-05-24	ENSG00000147614	ENSG00000147614		"""ATPases / V-type"""	18266	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal 38kD, V0 subunit d isoform 2"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 2"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit D2"""			12384298	Standard	NM_152565		Approved	FLJ38708, VMA6, ATP6D2	uc003ydp.1	Q8N8Y2	OTTHUMG00000163637	ENST00000285393.3:c.15G>A	8.37:g.87111222G>A		Somatic		Capture	Illumina GAIIx	4	87180338		Silent	SNP	superfamily_ATPase_V0/A0_c/d,HMMPfam_vATP-synt_AC39	p.A5	ENST00000285393.3	37	c.15	CCDS6241.1	8																																																																																			-	NULL		0.557	ATP6V0D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V0D2	protein_coding	OTTHUMT00000374651.1	G	NM_152565		87180338	+1	no_errors	NM_152565	genbank	human	validated	54_36p	silent	SNP	0.590	A
VWA3B	200403	genome.wustl.edu	37	2	98709598	98709598	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr2:98709598C>G	ENST00000477737.1	+	2	247	c.43C>G	c.(43-45)Ctg>Gtg	p.L15V	VWA3B_ENST00000451075.2_5'UTR|VWA3B_ENST00000435344.1_Missense_Mutation_p.L15V	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	15										NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TGAGCAGCAGCTGCAGAGGCA	0.458																																																0			2											82.0	78.0	79.0					2																	98709598		1946	4164	6110	98076030	SO:0001583	missense	200403			AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.43C>G	2.37:g.98709598C>G	ENSP00000417955:p.Leu15Val	Somatic		Capture	Illumina GAIIx	4	98076030	B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	HMMSmart_SM00327,superfamily_vWA-like,HMMPfam_VWA	p.L15V	ENST00000477737.1	37	c.43	CCDS42718.1	2	.	.	.	.	.	.	.	.	.	.	C	10.61	1.397996	0.25205	.	.	ENSG00000168658	ENST00000435344;ENST00000477737	T;T	0.59364	0.27;0.27	5.22	3.39	0.38822	.	1.282000	0.05506	N	0.559342	T	0.42539	0.1207	L	0.36672	1.1	0.20196	N	0.999929	P;P	0.38078	0.483;0.617	B;B	0.28011	0.057;0.085	T	0.30937	-0.9961	10	0.32370	T	0.25	.	5.3683	0.16125	0.0:0.6444:0.1763:0.1793	.	15;15	Q502W6;Q502W6-8	VWA3B_HUMAN;.	V	15	ENSP00000401959:L15V;ENSP00000417955:L15V	ENSP00000411168:L15V	L	+	1	2	VWA3B	98076030	0.232000	0.23762	0.490000	0.27465	0.829000	0.46940	0.630000	0.24553	0.850000	0.35239	0.650000	0.86243	CTG	-	NULL		0.458	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA3B	protein_coding	OTTHUMT00000353469.2	C	NM_144992		98076030	+1	no_errors	NM_144992	genbank	human	provisional	54_36p	missense	SNP	0.018	G
OR5H7P	79291	genome.wustl.edu	37	3	97957370	97957370	+	lincRNA	SNP	A	A	G			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr3:97957370A>G	ENST00000508616.1	+	0	26																											TCATATCCCAATGTATTTATT	0.428																																																0			3																																								99440060			0																															3.37:g.97957370A>G		Somatic		Capture	Illumina GAIIx	4	99440060		Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1	p.M20V	ENST00000508616.1	37	c.58		3																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.428	RP11-325B23.2-001	KNOWN	basic	lincRNA	ENSG00000187900	lincRNA	OTTHUMT00000359282.1	A			99440060	+1	no_errors	ENST00000341450	ensembl	human	known	54_36p	missense	SNP	1.000	G
RAB40AL	282808	genome.wustl.edu	37	X	102192279	102192279	+	Silent	SNP	C	C	T	rs374307480		TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chrX:102192279C>T	ENST00000218249.5	+	1	80	c.33C>T	c.(31-33)taC>taT	p.Y11Y	LL0XNC01-237H1.3_ENST00000413528.1_RNA	NM_001031834.1	NP_001027004.1	P0C0E4	RB40L_HUMAN	RAB40A, member RAS oncogene family-like	11					protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			endometrium(4)|large_intestine(2)|lung(3)|ovary(3)	12						ACCAGGCCTACGACTTCCTGC	0.692																																																0			X						C		1,3834		0,1,1631,571	41.0	46.0	44.0		33	-1.5	0.3	X		44	0,6728		0,0,2428,1872	no	coding-synonymous	RAB40AL	NM_001031834.1		0,1,4059,2443	TT,TC,CC,C		0.0,0.0261,0.0095		11/279	102192279	1,10562	2203	4300	6503	102078935	SO:0001819	synonymous_variant	0			BC101169	CCDS35353.1	Xq22.2	2008-02-05			ENSG00000102128	ENSG00000102128			25410	protein-coding gene	gene with protein product	"""Ras like GTPase"""	300405					Standard	NM_001031834		Approved	RAR2, RLGP	uc004ejs.3	P0C0E4	OTTHUMG00000022084	ENST00000218249.5:c.33C>T	X.37:g.102192279C>T		Somatic		Capture	Illumina GAIIx	4	102078935	Q495H3	Silent	SNP	superfamily_SSF52540,HMMSmart_RAB,HMMPfam_Ras,HMMSmart_SOCS,HMMPfam_SOCS_box	p.Y11	ENST00000218249.5	37	c.33	CCDS35353.1	X																																																																																			-	superfamily_SSF52540		0.692	RAB40AL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB40AL	protein_coding	OTTHUMT00000057679.1	C	NM_001031834		102078935	+1	no_errors	NM_001031834	genbank	human	provisional	54_36p	silent	SNP	1.000	T
MMP13	4322	genome.wustl.edu	37	11	102818678	102818678	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr11:102818678C>A	ENST00000260302.3	-	8	1181	c.1153G>T	c.(1153-1155)Gct>Tct	p.A385S	MMP13_ENST00000340273.4_Missense_Mutation_p.A385S	NM_002427.3	NP_002418.1	P45452	MMP13_HUMAN	matrix metallopeptidase 13 (collagenase 3)	385	Interaction with collagen.				bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cartilage development (GO:0051216)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|skin(1)|stomach(1)	27		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)	Marimastat(DB00786)	AAGTGAACAGCTGCACTTATC	0.433																																																0			11											134.0	112.0	119.0					11																	102818678		2202	4299	6501	102323888	SO:0001583	missense	4322			X75308	CCDS8324.1	11q22.3	2014-01-30	2005-08-08		ENSG00000137745	ENSG00000137745		"""Endogenous ligands"""	7159	protein-coding gene	gene with protein product	"""collagenase 3"""	600108	"""matrix metalloproteinase 13 (collagenase 3)"""			8207000	Standard	NM_002427		Approved	CLG3	uc001phl.3	P45452	OTTHUMG00000165850	ENST00000260302.3:c.1153G>T	11.37:g.102818678C>A	ENSP00000260302:p.Ala385Ser	Somatic		Capture	Illumina GAIIx	4	102323888	A8K846|B2RCZ3|Q6NWN6	Missense_Mutation	SNP	HMMPfam_PG_binding_1,superfamily_PGBD_like,PatternScan_CYSTEINE_SWITCH,HMMSmart_ZnMc,superfamily_SSF55486,HMMPfam_Peptidase_M10,PatternScan_ZINC_PROTEASE,superfamily_Hemopexin,HMMPfam_Hemopexin,HMMSmart_HX,PatternScan_HEMOPEXIN	p.A385S	ENST00000260302.3	37	c.1153	CCDS8324.1	11	.	.	.	.	.	.	.	.	.	.	c	26.7	4.761730	0.89932	.	.	ENSG00000137745	ENST00000260302;ENST00000340273	T;T	0.38722	1.12;3.31	5.82	4.91	0.64330	Hemopexin/matrixin (2);	0.094101	0.64402	D	0.000001	T	0.68495	0.3007	M	0.87328	2.875	0.58432	D	0.999999	D	0.57899	0.981	D	0.69824	0.966	T	0.75181	-0.3408	10	0.66056	D	0.02	.	15.1696	0.72862	0.0:0.9326:0.0:0.0674	.	385	P45452	MMP13_HUMAN	S	385	ENSP00000260302:A385S;ENSP00000339672:A385S	ENSP00000260302:A385S	A	-	1	0	MMP13	102323888	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	6.046000	0.71029	1.482000	0.48325	-0.119000	0.15052	GCT	-	superfamily_Hemopexin,HMMPfam_Hemopexin,HMMSmart_HX		0.433	MMP13-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MMP13	protein_coding	OTTHUMT00000386648.1	C	NM_002427		102323888	-1	no_errors	NM_002427	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ARL3	403	genome.wustl.edu	37	10	104465190	104465190	+	Silent	SNP	T	T	G			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr10:104465190T>G	ENST00000260746.5	-	2	191	c.60A>C	c.(58-60)atA>atC	p.I20I		NM_004311.3	NP_004302.1	P36405	ARL3_HUMAN	ADP-ribosylation factor-like 3	20					cilium morphogenesis (GO:0060271)|cytokinesis (GO:0000910)|intraciliary transport (GO:0042073)|kidney development (GO:0001822)|photoreceptor cell development (GO:0042461)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)|spindle microtubule (GO:0005876)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|microtubule binding (GO:0008017)			large_intestine(2)	2		Colorectal(252;0.122)		Epithelial(162;4.88e-09)|all cancers(201;1.29e-07)|BRCA - Breast invasive adenocarcinoma(275;0.22)		CCAGGAGAAGTATTCTCACCT	0.502																																																0			10											139.0	112.0	121.0					10																	104465190		2203	4300	6503	104455180	SO:0001819	synonymous_variant	403			U07151	CCDS7538.1	10q23.3	2014-05-09			ENSG00000138175	ENSG00000138175		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	694	protein-coding gene	gene with protein product		604695				8034651, 10072593	Standard	NM_004311		Approved	ARFL3	uc001kwa.3	P36405	OTTHUMG00000018965	ENST00000260746.5:c.60A>C	10.37:g.104465190T>G		Somatic		Capture	Illumina GAIIx	4	104455180	B2R6C7|Q53X83|Q5JSM2	Silent	SNP	HMMSmart_ARF,superfamily_SSF52540,HMMPfam_Arf,PatternScan_ARF	p.I20	ENST00000260746.5	37	c.60	CCDS7538.1	10																																																																																			-	HMMSmart_ARF,superfamily_SSF52540,HMMPfam_Arf		0.502	ARL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL3	protein_coding	OTTHUMT00000050088.2	T	NM_004311		104455180	-1	no_errors	NM_004311	genbank	human	reviewed	54_36p	silent	SNP	0.996	G
FRMPD3	84443	genome.wustl.edu	37	X	106843794	106843794	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chrX:106843794T>C	ENST00000276185.4	+	16	2624	c.2624T>C	c.(2623-2625)cTc>cCc	p.L875P				Q5JV73	FRPD3_HUMAN	FERM and PDZ domain containing 3	875						cytoskeleton (GO:0005856)				breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(16)|ovary(2)|urinary_tract(1)	28						AACCCATCTCTCCAACCCATT	0.642																																																0			X											27.0	26.0	26.0					X																	106843794		876	1990	2866	106730450	SO:0001583	missense	84443			AB058720	CCDS76006.1	Xq22	2008-02-05			ENSG00000147234	ENSG00000147234			29382	protein-coding gene	gene with protein product						11347906	Standard	NM_032428		Approved	RP5-1070B1.1, KIAA1817		Q5JV73	OTTHUMG00000022165	ENST00000276185.4:c.2624T>C	X.37:g.106843794T>C	ENSP00000276185:p.Leu875Pro	Somatic		Capture	Illumina GAIIx	4	106730450	Q96JK8	Missense_Mutation	SNP	PatternScan_FERM_1,PatternScan_FERM_2,superfamily_PDZ,HMMPfam_PDZ,HMMSmart_PDZ,HMMSmart_B41,superfamily_FERM_3-hlx,HMMPfam_FERM_M	p.L875P	ENST00000276185.4	37	c.2624		X	.	.	.	.	.	.	.	.	.	.	T	4.416	0.076941	0.08485	.	.	ENSG00000147234	ENST00000276185;ENST00000439554	T;T	0.16597	2.33;2.33	4.54	0.386	0.16254	.	0.347331	0.25458	N	0.030529	T	0.10766	0.0263	N	0.19112	0.55	0.09310	N	0.999999	.	.	.	.	.	.	T	0.23655	-1.0182	8	0.37606	T	0.19	.	7.293	0.26376	0.0:0.0864:0.2795:0.6341	.	.	.	.	P	875;823	ENSP00000276185:L875P;ENSP00000398668:L823P	ENSP00000276185:L875P	L	+	2	0	FRMPD3	106730450	0.267000	0.24122	0.923000	0.36655	0.272000	0.26649	1.620000	0.36976	0.102000	0.17638	0.308000	0.20428	CTC	-	NULL		0.642	FRMPD3-201	KNOWN	basic|appris_principal	protein_coding	FRMPD3	protein_coding		T	XM_042978		106730450	+1	no_errors	XM_042978	genbank	human	model	54_36p	missense	SNP	0.000	C
MCC	4163	genome.wustl.edu	37	5	112437451	112437451	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr5:112437451G>T	ENST00000302475.4	-	6	1376	c.813C>A	c.(811-813)gaC>gaA	p.D271E	MCC_ENST00000514701.3_5'UTR|MCC_ENST00000515367.2_Missense_Mutation_p.D208E|MCC_ENST00000408903.3_Missense_Mutation_p.D461E	NM_002387.2	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers	271					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		TCCGGAGCCGGTCCCGCTCTT	0.592																																																0			5											115.0	109.0	111.0					5																	112437451		2202	4300	6502	112465350	SO:0001583	missense	4163				CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000302475.4:c.813C>A	5.37:g.112437451G>T	ENSP00000305617:p.Asp271Glu	Somatic		Capture	Illumina GAIIx	4	112465350	D3DT05|Q6ZR04	Missense_Mutation	SNP	superfamily_EF-hand,HMMSmart_SM00054,HMMPfam_efhand,PatternScan_EF_HAND_1,HMMPfam_MCC-bdg_PDZ	p.D461E	ENST00000302475.4	37	c.1383	CCDS4111.1	5	.	.	.	.	.	.	.	.	.	.	G	22.1	4.249133	0.80024	.	.	ENSG00000171444	ENST00000302475;ENST00000515367;ENST00000408903	T;T;T	0.32988	1.43;1.43;1.43	5.4	5.4	0.78164	Usher syndrome type-1C protein-binding protein 1, PDZ domain (1);	0.000000	0.85682	D	0.000000	T	0.35856	0.0946	L	0.27053	0.805	0.53688	D	0.999973	D;D;D;D	0.63046	0.992;0.992;0.99;0.992	D;D;D;D	0.74348	0.983;0.983;0.98;0.983	T	0.05068	-1.0908	10	0.06365	T	0.9	-38.365	12.844	0.57819	0.0749:0.0:0.9251:0.0	.	271;233;461;271	B7Z6G0;B3KTX0;P23508-2;P23508	.;.;.;CRCM_HUMAN	E	271;208;461	ENSP00000305617:D271E;ENSP00000421615:D208E;ENSP00000386227:D461E	ENSP00000305617:D271E	D	-	3	2	MCC	112465350	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.076000	0.71267	2.684000	0.91462	0.655000	0.94253	GAC	-	HMMPfam_MCC-bdg_PDZ		0.592	MCC-001	KNOWN	basic|CCDS	protein_coding	MCC	protein_coding	OTTHUMT00000250736.3	G	NM_001085377		112465350	-1	no_errors	NM_001085377	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
ZNF618	114991	genome.wustl.edu	37	9	116778428	116778428	+	Intron	SNP	G	G	C			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr9:116778428G>C	ENST00000374126.5	+	10	853				ZNF618_ENST00000288466.7_Missense_Mutation_p.E232Q			Q5T7W0	ZN618_HUMAN	zinc finger protein 618						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|lung(10)|urinary_tract(1)	16						TAAGAAGAAAGAAGTTAGGCA	0.393																																																0			9											61.0	62.0	62.0					9																	116778428		1818	4070	5888	115818249	SO:0001627	intron_variant	114991			BC012922	CCDS48008.1	9q33.1	2010-04-21			ENSG00000157657	ENSG00000157657		"""Zinc fingers, C2H2-type"""	29416	protein-coding gene	gene with protein product	"""neural precursor cell expressed, developmentally down-regulated 10"""					11853319	Standard	NM_133374		Approved	KIAA1952, NEDD10	uc004bic.3	Q5T7W0	OTTHUMG00000020532	ENST00000374126.5:c.755-547G>C	9.37:g.116778428G>C		Somatic		Capture	Illumina GAIIx	4	115818249	B9EG82|Q4G0X6|Q5T7W1|Q6ZT53|Q7Z6B9|Q8TF49|Q96E49	Missense_Mutation	SNP	HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,superfamily_SSF57667,HMMPfam_hATC	p.E232Q	ENST00000374126.5	37	c.694		9	.	.	.	.	.	.	.	.	.	.	G	9.499	1.102592	0.20632	.	.	ENSG00000157657	ENST00000288466;ENST00000452710;ENST00000374124	T;T;T	0.18810	4.4;2.68;2.19	4.41	4.41	0.53225	.	.	.	.	.	T	0.23171	0.0560	N	0.08118	0	0.22213	N	0.999288	P	0.42039	0.769	P	0.61397	0.888	T	0.22277	-1.0221	9	0.15952	T	0.53	.	12.806	0.57614	0.0:0.0:1.0:0.0	.	232	Q5T7W0-2	.	Q	232;220;232	ENSP00000288466:E232Q;ENSP00000395400:E220Q;ENSP00000363239:E232Q	ENSP00000288466:E232Q	E	+	1	0	ZNF618	115818249	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.396000	0.44468	2.734000	0.93682	0.655000	0.94253	GAA	-	NULL		0.393	ZNF618-004	KNOWN	basic|appris_candidate_longest	protein_coding	ZNF618	protein_coding	OTTHUMT00000053749.1	G	XM_054983		115818249	+1	no_errors	NM_133374	genbank	human	validated	54_36p	missense	SNP	1.000	C
TLR4	7099	genome.wustl.edu	37	9	120476761	120476761	+	Silent	SNP	G	G	C			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr9:120476761G>C	ENST00000355622.6	+	3	2456	c.2355G>C	c.(2353-2355)ctG>ctC	p.L785L	TLR4_ENST00000472304.1_3'UTR|TLR4_ENST00000394487.4_Silent_p.L745L	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	785	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	AGGTGGAGCTGTACCGCCTTC	0.557																																																0			9											73.0	71.0	72.0					9																	120476761		2203	4300	6503	119516582	SO:0001819	synonymous_variant	7099			U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.2355G>C	9.37:g.120476761G>C		Somatic		Capture	Illumina GAIIx	4	119516582	A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Silent	SNP	superfamily_L domain-like,HMMSmart_SM00369,HMMPfam_LRR_1,HMMSmart_SM00365,HMMSmart_SM00082,HMMPfam_LRRCT,superfamily_Toll/Interleukin receptor TIR domain,HMMSmart_SM00255,HMMPfam_TIR	p.L785	ENST00000355622.6	37	c.2355	CCDS6818.1	9																																																																																			-	superfamily_Toll/Interleukin receptor TIR domain,HMMSmart_SM00255,HMMPfam_TIR		0.557	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR4	protein_coding	OTTHUMT00000055549.3	G	NM_138554		119516582	+1	no_errors	NM_138554	genbank	human	reviewed	54_36p	silent	SNP	0.987	C
IQUB	154865	genome.wustl.edu	37	7	123104951	123104951	+	Missense_Mutation	SNP	G	G	A	rs180949404		TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr7:123104951G>A	ENST00000466202.1	-	10	2270	c.1694C>T	c.(1693-1695)gCg>gTg	p.A565V	IQUB_ENST00000434450.1_Missense_Mutation_p.A565V|IQUB_ENST00000324698.6_Missense_Mutation_p.A565V	NM_001282855.1	NP_001269784.1	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	565					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	acrosomal vesicle (GO:0001669)|motile cilium (GO:0031514)				breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(3)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)	45						AAAGAGTGTCGCAATTCTTTT	0.328													G|||	1	0.000199681	0.0	0.0	5008	,	,		15804	0.0		0.001	False		,,,				2504	0.0															0			7											127.0	138.0	134.0					7																	123104951		2202	4298	6500	122892187	SO:0001583	missense	154865			AK093153	CCDS5787.1	7q31.32	2010-03-19			ENSG00000164675	ENSG00000164675			21995	protein-coding gene	gene with protein product							Standard	NM_178827		Approved	FLJ35834	uc003vko.3	Q8NA54	OTTHUMG00000157347	ENST00000466202.1:c.1694C>T	7.37:g.123104951G>A	ENSP00000417769:p.Ala565Val	Somatic		Capture	Illumina GAIIx	4	122892187	A4D0X0|Q49AL6|Q4G189|Q5BJD9|Q6NUH6|Q8N9Y2	Missense_Mutation	SNP	HMMPfam_DUF2021,superfamily_Ubiquitin-like	p.A565V	ENST00000466202.1	37	c.1694	CCDS5787.1	7	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	16.77	3.215145	0.58452	.	.	ENSG00000164675	ENST00000466202;ENST00000324698;ENST00000434450	T;T;T	0.46451	1.88;1.88;0.87	5.32	5.32	0.75619	.	0.463650	0.25704	N	0.028860	T	0.36110	0.0955	L	0.43152	1.355	0.25802	N	0.984492	D;P	0.53745	0.962;0.87	B;B	0.40256	0.324;0.129	T	0.38520	-0.9657	10	0.42905	T	0.14	.	15.2552	0.73579	0.0:0.1802:0.8198:0.0	.	565;565	Q8NA54-2;Q8NA54	.;IQUB_HUMAN	V	565	ENSP00000417769:A565V;ENSP00000324882:A565V;ENSP00000388498:A565V	ENSP00000324882:A565V	A	-	2	0	IQUB	122892187	0.994000	0.37717	1.000000	0.80357	0.995000	0.86356	4.203000	0.58453	2.654000	0.90174	0.579000	0.79373	GCG	-	NULL		0.328	IQUB-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IQUB	protein_coding	OTTHUMT00000348529.1	G	NM_178827		122892187	-1	no_errors	NM_178827	genbank	human	validated	54_36p	missense	SNP	0.967	A
GPR37	2861	genome.wustl.edu	37	7	124387343	124387343	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr7:124387343A>T	ENST00000303921.2	-	2	1728	c.1078T>A	c.(1078-1080)Ttc>Atc	p.F360I		NM_005302.3	NP_005293.1	O15354	GPR37_HUMAN	G protein-coupled receptor 37 (endothelin receptor type B-like)	360					dopamine biosynthetic process (GO:0042416)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotion involved in locomotory behavior (GO:0031987)|positive regulation of dopamine metabolic process (GO:0045964)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ubiquitin ligase complex (GO:0000151)	G-protein coupled receptor activity (GO:0004930)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						GCAGCACGGAAGCGGTCTATG	0.488																																																0			7											70.0	70.0	70.0					7																	124387343		2203	4300	6503	124174579	SO:0001583	missense	2861				CCDS5792.1	7q31	2012-08-21			ENSG00000170775	ENSG00000170775		"""GPCR / Class A : Orphans"""	4494	protein-coding gene	gene with protein product		602583				9339362	Standard	NM_005302		Approved	EDNRBL, hET(B)R-LP, PAELR	uc003vli.4	O15354	OTTHUMG00000157197	ENST00000303921.2:c.1078T>A	7.37:g.124387343A>T	ENSP00000306449:p.Phe360Ile	Somatic		Capture	Illumina GAIIx	4	124174579	A4D0Y6|O00348|O14768|Q8TD39	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1	p.F360I	ENST00000303921.2	37	c.1078	CCDS5792.1	7	.	.	.	.	.	.	.	.	.	.	A	20.5	3.998336	0.74818	.	.	ENSG00000170775	ENST00000303921	T	0.73681	-0.77	5.64	5.64	0.86602	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000002	D	0.84897	0.5574	M	0.75085	2.285	0.58432	D	0.999999	D	0.54601	0.967	D	0.64687	0.928	D	0.86781	0.1979	10	0.87932	D	0	-31.9548	15.0346	0.71734	1.0:0.0:0.0:0.0	.	360	O15354	GPR37_HUMAN	I	360	ENSP00000306449:F360I	ENSP00000306449:F360I	F	-	1	0	GPR37	124174579	1.000000	0.71417	1.000000	0.80357	0.561000	0.35649	9.339000	0.96797	2.148000	0.66965	0.460000	0.39030	TTC	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.488	GPR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR37	protein_coding	OTTHUMT00000347873.1	A	NM_005302		124174579	-1	no_errors	NM_005302	genbank	human	provisional	54_36p	missense	SNP	1.000	T
ACTRT1	139741	genome.wustl.edu	37	X	127185330	127185330	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chrX:127185330A>C	ENST00000371124.3	-	1	1052	c.856T>G	c.(856-858)Tgt>Ggt	p.C286G		NM_138289.3	NP_612146.1	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	286						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	34						TCAGTGTCACACTTCATGATG	0.527																																																0			X											105.0	100.0	102.0					X																	127185330		2203	4300	6503	127013011	SO:0001583	missense	139741			AF440739	CCDS14611.1	Xq25	2008-02-05	2005-11-22		ENSG00000123165	ENSG00000123165			24027	protein-coding gene	gene with protein product		300487				12243744	Standard	NM_138289		Approved	AIP1, KIAA0705, ARIP1, Arp-T1	uc004eum.3	Q8TDG2	OTTHUMG00000022359	ENST00000371124.3:c.856T>G	X.37:g.127185330A>C	ENSP00000360165:p.Cys286Gly	Somatic		Capture	Illumina GAIIx	4	127013011	Q6X7C1|Q96L10	Missense_Mutation	SNP	HMMPfam_Actin,superfamily_SSF53067,HMMSmart_ACTIN	p.C286G	ENST00000371124.3	37	c.856	CCDS14611.1	X	.	.	.	.	.	.	.	.	.	.	A	11.50	1.658089	0.29425	.	.	ENSG00000123165	ENST00000371124	D	0.95412	-3.7	3.58	3.58	0.41010	.	0.000000	0.64402	D	0.000003	D	0.98134	0.9384	H	0.96239	3.79	0.45979	D	0.998797	D	0.89917	1.0	D	0.97110	1.0	D	0.98166	1.0449	10	0.87932	D	0	.	9.6661	0.39986	1.0:0.0:0.0:0.0	.	286	Q8TDG2	ACTT1_HUMAN	G	286	ENSP00000360165:C286G	ENSP00000360165:C286G	C	-	1	0	ACTRT1	127013011	1.000000	0.71417	0.984000	0.44739	0.174000	0.22865	5.212000	0.65225	1.637000	0.50538	0.486000	0.48141	TGT	-	HMMPfam_Actin,HMMSmart_ACTIN,superfamily_SSF53067		0.527	ACTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTRT1	protein_coding	OTTHUMT00000058192.1	A	NM_138289		127013011	-1	no_errors	NM_138289	genbank	human	provisional	54_36p	missense	SNP	1.000	C
SAP130	79595	genome.wustl.edu	37	2	128757702	128757702	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr2:128757702C>T	ENST00000259235.3	-	9	1243	c.1114G>A	c.(1114-1116)Ggc>Agc	p.G372S	SAP130_ENST00000259234.6_Missense_Mutation_p.G346S|SAP130_ENST00000357702.5_Missense_Mutation_p.G372S	NM_024545.3	NP_078821.2	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa	372					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			NS(4)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	45	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		ACTGGCGTGCCAGTACTGAAG	0.493																																																0			2											107.0	107.0	107.0					2																	128757702		2203	4300	6503	128474172	SO:0001583	missense	79595			BC017453	CCDS2153.1, CCDS54397.1	2q14.3	2008-02-05	2006-02-02		ENSG00000136715	ENSG00000136715			29813	protein-coding gene	gene with protein product		609697	"""sin3A-associated protein, 130kDa"""			11230166, 12724404	Standard	NM_001145928		Approved	FLJ12761	uc010fmd.2	Q9H0E3	OTTHUMG00000131571	ENST00000259235.3:c.1114G>A	2.37:g.128757702C>T	ENSP00000259235:p.Gly372Ser	Somatic		Capture	Illumina GAIIx	4	128474172	B7ZLM3|C9K0X9|Q4ZFV4|Q53T46|Q8WVW4|Q9H9G8	Missense_Mutation	SNP	NULL	p.G372S	ENST00000259235.3	37	c.1114	CCDS2153.1	2	.	.	.	.	.	.	.	.	.	.	C	15.16	2.750563	0.49257	.	.	ENSG00000136715	ENST00000357702;ENST00000259235;ENST00000259234	.	.	.	5.79	5.79	0.91817	.	0.160023	0.56097	D	0.000031	T	0.60051	0.2239	N	0.14661	0.345	0.80722	D	1	D;D;D;D	0.76494	0.988;0.999;0.999;0.986	P;D;D;P	0.69479	0.844;0.964;0.935;0.844	T	0.54050	-0.8351	9	0.12766	T	0.61	-14.3038	20.04	0.97581	0.0:1.0:0.0:0.0	.	372;345;372;10	B7ZLM3;Q96DP1;Q9H0E3;B3KRT9	.;.;SP130_HUMAN;.	S	372;372;346	.	ENSP00000259234:G346S	G	-	1	0	SAP130	128474172	1.000000	0.71417	0.990000	0.47175	0.659000	0.38960	7.161000	0.77505	2.733000	0.93635	0.655000	0.94253	GGC	-	NULL		0.493	SAP130-001	KNOWN	basic|CCDS	protein_coding	SAP130	protein_coding	OTTHUMT00000254436.3	C	NM_024545		128474172	-1	no_errors	NM_024545	genbank	human	validated	54_36p	missense	SNP	1.000	T
MEST	4232	genome.wustl.edu	37	7	130138289	130138289	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr7:130138289C>G	ENST00000223215.4	+	6	727	c.506C>G	c.(505-507)aCc>aGc	p.T169S	MEST_ENST00000437945.1_Missense_Mutation_p.T169S|MEST_ENST00000393187.1_Missense_Mutation_p.T160S|MEST_ENST00000378576.4_Missense_Mutation_p.T160S|MEST_ENST00000341441.5_Missense_Mutation_p.T160S|MIR335_ENST00000362173.1_RNA|hsa-mir-335_ENST00000604666.1_RNA|MEST_ENST00000416162.2_Missense_Mutation_p.T160S|MEST_ENST00000462132.1_3'UTR	NM_001253900.1|NM_002402.3	NP_001240829.1|NP_002393.2	Q5EB52	MEST_HUMAN	mesoderm specific transcript	169					mesoderm development (GO:0007498)|regulation of lipid storage (GO:0010883)|response to retinoic acid (GO:0032526)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(2)	12	Melanoma(18;0.0435)					GGTCGGCTTACCATAAAGAGT	0.473																																					Colon(126;2182 2305 6517 35181)											0			7											122.0	101.0	108.0					7																	130138289		2203	4300	6503	129925525	SO:0001583	missense	4232				CCDS5822.1, CCDS5823.1, CCDS59081.1	7q32	2014-08-22	2012-12-07		ENSG00000106484	ENSG00000106484			7028	protein-coding gene	gene with protein product	"""Paternally-expressed gene 1"""	601029	"""mesoderm specific transcript (mouse) homolog"", ""mesoderm specific transcript homolog (mouse)"""			8884280	Standard	NM_002402		Approved	PEG1	uc003vqg.3	Q5EB52	OTTHUMG00000156661	ENST00000223215.4:c.506C>G	7.37:g.130138289C>G	ENSP00000223215:p.Thr169Ser	Somatic		Capture	Illumina GAIIx	4	129925525	B2R6S1|O14973|O15007|Q6AI49|Q92571	Missense_Mutation	SNP	superfamily_alpha/beta-Hydrolases,HMMPfam_Abhydrolase_1	p.T169S	ENST00000223215.4	37	c.506	CCDS5822.1	7	.	.	.	.	.	.	.	.	.	.	C	9.678	1.148476	0.21288	.	.	ENSG00000106484	ENST00000341441;ENST00000427521;ENST00000416162;ENST00000378576;ENST00000433159;ENST00000393187;ENST00000421001;ENST00000223215;ENST00000437945;ENST00000458161	T;T;T;T;T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23;0.86;-0.23;-0.23;-0.23;-0.23	5.88	4.9	0.64082	.	0.523451	0.22051	N	0.065317	T	0.43700	0.1259	N	0.25201	0.72	0.29721	N	0.838644	B;P;B;B	0.34462	0.004;0.454;0.089;0.082	B;B;B;B	0.34931	0.044;0.192;0.098;0.037	T	0.39781	-0.9597	10	0.09843	T	0.71	-19.6661	3.585	0.07967	0.2517:0.5983:0.0:0.15	.	155;169;169;160	B4DQW6;C9JW74;Q5EB52;Q5EB52-3	.;.;MEST_HUMAN;.	S	160;160;160;160;160;160;160;169;169;160	ENSP00000342749:T160S;ENSP00000409505:T160S;ENSP00000408933:T160S;ENSP00000367839:T160S;ENSP00000409768:T160S;ENSP00000376884:T160S;ENSP00000407222:T160S;ENSP00000223215:T169S;ENSP00000401657:T169S	ENSP00000223215:T169S	T	+	2	0	MEST	129925525	0.994000	0.37717	1.000000	0.80357	0.972000	0.66771	1.447000	0.35101	2.785000	0.95823	0.655000	0.94253	ACC	-	superfamily_alpha/beta-Hydrolases,HMMPfam_Abhydrolase_1		0.473	MEST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEST	protein_coding	OTTHUMT00000345183.2	C	NM_002402		129925525	+1	no_errors	NM_002402	genbank	human	reviewed	54_36p	missense	SNP	0.968	G
CREB3L2	64764	genome.wustl.edu	37	7	137600629	137600629	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr7:137600629G>A	ENST00000330387.6	-	3	800	c.449C>T	c.(448-450)tCc>tTc	p.S150F	CREB3L2_ENST00000456390.1_Missense_Mutation_p.S150F|CREB3L2_ENST00000458726.1_Missense_Mutation_p.S87F|CREB3L2_ENST00000452463.1_Missense_Mutation_p.S150F	NM_194071.3	NP_919047.2	Q70SY1	CR3L2_HUMAN	cAMP responsive element binding protein 3-like 2	150					cartilage development (GO:0051216)|chondrocyte differentiation (GO:0002062)|ER to Golgi vesicle-mediated transport (GO:0006888)|positive regulation of transcription, DNA-templated (GO:0045893)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cAMP response element binding (GO:0035497)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)		FUS/CREB3L2(158)	breast(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19						CAACGGGGTGGAGATGGCTGT	0.473			T	FUS	fibromyxoid sarcoma																																		Dom	yes		7	7q34	64764	cAMP responsive element binding protein 3-like 2		M	0			7											155.0	144.0	148.0					7																	137600629		2203	4300	6503	137251169	SO:0001583	missense	64764			AJ549092	CCDS34760.1, CCDS59083.1	7q34	2013-01-10			ENSG00000182158	ENSG00000182158		"""basic leucine zipper proteins"""	23720	protein-coding gene	gene with protein product		608834					Standard	NM_194071		Approved	BBF2H7, TCAG_1951439	uc003vtw.3	Q70SY1	OTTHUMG00000155744	ENST00000330387.6:c.449C>T	7.37:g.137600629G>A	ENSP00000329140:p.Ser150Phe	Somatic		Capture	Illumina GAIIx	4	137251169	Q6P454|Q6ZMR6	Missense_Mutation	SNP	superfamily_A DNA-binding domain in eukaryotic transcription factors,HMMPfam_bZIP_1,HMMSmart_SM00338,PatternScan_BZIP_BASIC	p.S150F	ENST00000330387.6	37	c.449	CCDS34760.1	7	.	.	.	.	.	.	.	.	.	.	G	22.3	4.274620	0.80580	.	.	ENSG00000182158	ENST00000330387;ENST00000417785;ENST00000456390;ENST00000452463;ENST00000458726;ENST00000420629	T;T;T;T;T	0.66099	0.22;-0.19;0.8;0.78;0.46	6.17	6.17	0.99709	.	0.555091	0.18335	N	0.144343	T	0.76321	0.3971	L	0.53249	1.67	0.58432	D	0.999993	D;D;D	0.63880	0.993;0.986;0.976	D;P;P	0.63113	0.911;0.814;0.656	T	0.74746	-0.3561	10	0.62326	D	0.03	-1.4956	20.4745	0.99168	0.0:0.0:1.0:0.0	.	150;150;150	Q70SY1-3;Q70SY1-2;Q70SY1	.;.;CR3L2_HUMAN	F	150;150;150;150;87;143	ENSP00000329140:S150F;ENSP00000403550:S150F;ENSP00000410314:S150F;ENSP00000388917:S87F;ENSP00000402889:S143F	ENSP00000329140:S150F	S	-	2	0	CREB3L2	137251169	1.000000	0.71417	0.994000	0.49952	0.713000	0.41058	6.367000	0.73099	2.941000	0.99782	0.655000	0.94253	TCC	-	NULL		0.473	CREB3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREB3L2	protein_coding	OTTHUMT00000341462.1	G	NM_194071		137251169	-1	no_errors	NM_194071	genbank	human	validated	54_36p	missense	SNP	0.792	A
RBM27	54439	genome.wustl.edu	37	5	145616964	145616964	+	Silent	SNP	A	A	G			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr5:145616964A>G	ENST00000265271.5	+	8	1414	c.1248A>G	c.(1246-1248)ttA>ttG	p.L416L	RBM27_ENST00000506502.1_Silent_p.L416L	NM_018989.1	NP_061862.1	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	416	Pro-rich.				mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(4)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTCCTCCTTTACCCCAGAACC	0.428																																																0			5											199.0	164.0	175.0					5																	145616964		1568	3582	5150	145597157	SO:0001819	synonymous_variant	54439			AL833706	CCDS43378.1	5q32	2013-01-09				ENSG00000091009		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	29243	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 1"""					10718198, 15741184	Standard	NM_018989		Approved	KIAA1311, ARRS1, Psc1, ZC3H18	uc003lnz.4	Q9P2N5		ENST00000265271.5:c.1248A>G	5.37:g.145616964A>G		Somatic		Capture	Illumina GAIIx	4	145597157	Q8IYW9	Silent	SNP	superfamily_SSF101233,HMMPfam_zf-CCCH,superfamily_SSF54928,HMMSmart_RRM	p.L416	ENST00000265271.5	37	c.1248	CCDS43378.1	5																																																																																			-	NULL		0.428	RBM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM27	protein_coding	OTTHUMT00000373420.1	A	XM_291128		145597157	+1	no_errors	ENST00000265271	ensembl	human	known	54_36p	silent	SNP	1.000	G
CHRNB2	1141	genome.wustl.edu	37	1	154544393	154544393	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr1:154544393G>A	ENST00000368476.3	+	5	1358	c.1094G>A	c.(1093-1095)cGa>cAa	p.R365Q		NM_000748.2	NP_000739.1	P17787	ACHB2_HUMAN	cholinergic receptor, nicotinic, beta 2 (neuronal)	365					action potential (GO:0001508)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|central nervous system projection neuron axonogenesis (GO:0021952)|cognition (GO:0050890)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|lateral geniculate nucleus development (GO:0021771)|learning (GO:0007612)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|neurological system process (GO:0050877)|optic nerve morphogenesis (GO:0021631)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|protein heterooligomerization (GO:0051291)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of circadian sleep/wake cycle, REM sleep (GO:0042320)|regulation of dendrite morphogenesis (GO:0048814)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine secretion (GO:0014059)|regulation of synapse assembly (GO:0051963)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|sensory perception of pain (GO:0019233)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)|vestibulocochlear nerve development (GO:0021562)|visual learning (GO:0008542)|visual perception (GO:0007601)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)|ligand-gated ion channel activity (GO:0015276)	p.R365Q(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|skin(1)|urinary_tract(3)	28	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Dextromethorphan(DB00514)|Galantamine(DB00674)|Nicotine(DB00184)	CGCCTGCGGCGACGCCAGCGT	0.706																																																1	Substitution - Missense(1)	skin(1)	1											11.0	8.0	9.0					1																	154544393		2157	4209	6366	152811017	SO:0001583	missense	1141			U62437	CCDS1070.1	1q21.3	2012-02-11	2006-02-01		ENSG00000160716	ENSG00000160716		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1962	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 2 (neuronal)"""	118507	"""cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)"""			1505988	Standard	NM_000748		Approved		uc001ffg.3	P17787	OTTHUMG00000037262	ENST00000368476.3:c.1094G>A	1.37:g.154544393G>A	ENSP00000357461:p.Arg365Gln	Somatic		Capture	Illumina GAIIx	4	152811017	Q9UEH9	Missense_Mutation	SNP	superfamily_Nicotinic receptor ligand binding domain-like,HMMPfam_Neur_chan_LBD,PatternScan_NEUROTR_ION_CHANNEL,superfamily_Neurotransmitter-gated ion-channel transmembrane pore,HMMPfam_Neur_chan_memb	p.R365Q	ENST00000368476.3	37	c.1094	CCDS1070.1	1	.	.	.	.	.	.	.	.	.	.	G	10.19	1.281146	0.23392	.	.	ENSG00000160716	ENST00000368476	D	0.85339	-1.97	3.97	3.97	0.46021	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.438446	0.24766	N	0.035763	T	0.60196	0.2250	N	0.17764	0.52	0.31474	N	0.668051	P	0.47545	0.897	B	0.39503	0.301	T	0.60342	-0.7282	10	0.13108	T	0.6	.	15.8078	0.78527	0.0:0.0:1.0:0.0	.	365	P17787	ACHB2_HUMAN	Q	365	ENSP00000357461:R365Q	ENSP00000357461:R365Q	R	+	2	0	CHRNB2	152811017	0.000000	0.05858	0.029000	0.17559	0.032000	0.12392	0.622000	0.24433	2.024000	0.59613	0.313000	0.20887	CGA	-	superfamily_Neurotransmitter-gated ion-channel transmembrane pore,HMMPfam_Neur_chan_memb		0.706	CHRNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNB2	protein_coding	OTTHUMT00000090697.1	G	NM_000748		152811017	+1	no_errors	NM_000748	genbank	human	reviewed	54_36p	missense	SNP	0.707	A
SYT11	23208	genome.wustl.edu	37	1	155837924	155837924	+	Missense_Mutation	SNP	C	C	A	rs371162872		TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr1:155837924C>A	ENST00000368324.4	+	2	456	c.203C>A	c.(202-204)aCc>aAc	p.T68N	SYT11_ENST00000539162.1_Intron	NM_152280.4	NP_689493.3	Q9BT88	SYT11_HUMAN	synaptotagmin XI	68					negative regulation of neurotransmitter secretion (GO:0046929)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|endometrium(1)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;0.000162)			TACCCAGAGACCCTCAGCAAC	0.502																																																0			1						C	ASN/THR	0,4406		0,0,2203	154.0	140.0	145.0		203	5.8	1.0	1		145	1,8599	1.2+/-3.3	0,1,4299	no	missense	SYT11	NM_152280.4	65	0,1,6502	AA,AC,CC		0.0116,0.0,0.0077	possibly-damaging	68/432	155837924	1,13005	2203	4300	6503	154104548	SO:0001583	missense	23208			D38522	CCDS1122.1	1q22	2013-01-21			ENSG00000132718	ENSG00000132718		"""Synaptotagmins"""	19239	protein-coding gene	gene with protein product		608741				11543631	Standard	NM_152280		Approved	KIAA0080, MGC10881, MGC17226, DKFZp781D015	uc001fmg.3	Q9BT88	OTTHUMG00000014105	ENST00000368324.4:c.203C>A	1.37:g.155837924C>A	ENSP00000357307:p.Thr68Asn	Somatic		Capture	Illumina GAIIx	4	154104548	Q14998|Q5W0D4|Q68CT5|Q8IXU3|Q96SU2	Missense_Mutation	SNP	superfamily_C2_CaLB,HMMSmart_C2,HMMPfam_C2	p.T68N	ENST00000368324.4	37	c.203	CCDS1122.1	1	.	.	.	.	.	.	.	.	.	.	C	5.318	0.244058	0.10077	0.0	1.16E-4	ENSG00000132718	ENST00000368324	T	0.42513	0.97	5.76	5.76	0.90799	.	0.112533	0.64402	D	0.000008	T	0.10380	0.0254	N	0.08118	0	0.80722	D	1	P	0.38922	0.651	B	0.30251	0.113	T	0.10268	-1.0637	10	0.19147	T	0.46	.	15.095	0.72226	0.0:0.8586:0.1414:0.0	.	68	Q9BT88	SYT11_HUMAN	N	68	ENSP00000357307:T68N	ENSP00000357307:T68N	T	+	2	0	SYT11	154104548	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.902000	0.63266	2.718000	0.92993	0.655000	0.94253	ACC	-	NULL		0.502	SYT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT11	protein_coding	OTTHUMT00000039597.1	C	NM_152280		154104548	+1	no_errors	NM_152280	genbank	human	validated	54_36p	missense	SNP	1.000	A
PAXIP1	22976	genome.wustl.edu	37	7	154767999	154767999	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr7:154767999C>T	ENST00000404141.1	-	6	635	c.481G>A	c.(481-483)Gtg>Atg	p.V161M	PAXIP1_ENST00000473219.1_5'UTR|PAXIP1_ENST00000397192.1_Missense_Mutation_p.V161M			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	161	BRCT 2. {ECO:0000255|PROSITE- ProRule:PRU00033}.|Interaction with PAGR1. {ECO:0000250}.				adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		TCAGGAGTCACAATTTTAATA	0.373																																																0			7											79.0	76.0	77.0					7																	154767999		1858	4122	5980	154398932	SO:0001583	missense	22976			U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.481G>A	7.37:g.154767999C>T	ENSP00000384048:p.Val161Met	Somatic		Capture	Illumina GAIIx	4	154398932	O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Missense_Mutation	SNP	superfamily_BRCT domain,HMMPfam_BRCT,HMMSmart_SM00292	p.V161M	ENST00000404141.1	37	c.481	CCDS47753.1	7	.	.	.	.	.	.	.	.	.	.	C	25.5	4.649462	0.87958	.	.	ENSG00000157212	ENST00000404141;ENST00000397192;ENST00000357094;ENST00000323199;ENST00000419436	D;D;D	0.93859	-3.3;-3.3;-3.3	4.98	4.98	0.66077	BRCT (3);	0.000000	0.49916	U	0.000139	D	0.96787	0.8951	M	0.80422	2.495	0.51012	D	0.999907	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.97110	0.999;0.994;0.999;1.0	D	0.97476	1.0044	10	0.87932	D	0	-8.1862	18.2489	0.89996	0.0:1.0:0.0:0.0	.	114;70;127;161	B4DEQ6;Q6ZW49-3;Q6ZW49-1;Q6ZW49	.;.;.;PAXI1_HUMAN	M	161;161;109;114;119	ENSP00000384048:V161M;ENSP00000380376:V161M;ENSP00000389849:V119M	ENSP00000319149:V114M	V	-	1	0	PAXIP1	154398932	1.000000	0.71417	0.907000	0.35723	0.934000	0.57294	5.335000	0.65929	2.301000	0.77427	0.305000	0.20034	GTG	-	HMMPfam_BRCT,superfamily_BRCT domain,HMMSmart_SM00292		0.373	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PAXIP1	protein_coding	OTTHUMT00000322223.1	C	NM_007349		154398932	-1	no_errors	NM_007349	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
SLC22A2	6582	genome.wustl.edu	37	6	160666552	160666552	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr6:160666552C>G	ENST00000366953.3	-	6	1241	c.983G>C	c.(982-984)gGc>gCc	p.G328A	SLC22A2_ENST00000491092.1_5'UTR|SLC22A2_ENST00000366952.1_Missense_Mutation_p.G307A	NM_003058.3	NP_003049.2	O15244	S22A2_HUMAN	solute carrier family 22 (organic cation transporter), member 2	328					body fluid secretion (GO:0007589)|drug transmembrane transport (GO:0006855)|histamine transport (GO:0051608)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|organic cation transport (GO:0015695)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|steroid binding (GO:0005496)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(16)|prostate(2)|skin(1)	27		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.28e-17)|BRCA - Breast invasive adenocarcinoma(81;6.29e-06)	Amantadine(DB00915)|Amiloride(DB00594)|Aminohippurate(DB00345)|Chlorphenamine(DB01114)|Choline(DB00122)|Cimetidine(DB00501)|Cisplatin(DB00515)|Cladribine(DB00242)|Cocaine(DB00907)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Desipramine(DB01151)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Diphenhydramine(DB01075)|Disopyramide(DB00280)|Dopamine(DB00988)|Epinephrine(DB00668)|Estradiol(DB00783)|Famotidine(DB00927)|Flurazepam(DB00690)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imatinib(DB00619)|Imipramine(DB00458)|Lamivudine(DB00709)|Levofloxacin(DB01137)|Memantine(DB01043)|Metformin(DB00331)|Metoprolol(DB00264)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Oxprenolol(DB01580)|Pancuronium(DB01337)|Phenformin(DB00914)|Phenoxybenzamine(DB00925)|Pramipexole(DB00413)|Prazosin(DB00457)|Probenecid(DB01032)|Procainamide(DB01035)|Progesterone(DB00396)|Propranolol(DB00571)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Reserpine(DB00206)|Thiamine(DB00152)|Tubocurarine(DB01199)|Vinblastine(DB00570)|Zidovudine(DB00495)	CAATTTCTTGCCAGTTTCCTC	0.378																																																0			6											85.0	80.0	82.0					6																	160666552		2203	4300	6503	160586542	SO:0001583	missense	6582			X98333	CCDS5276.1	6q25.3	2013-05-22			ENSG00000112499	ENSG00000112499		"""Solute carriers"""	10966	protein-coding gene	gene with protein product		602608				9605850	Standard	NM_003058		Approved	OCT2	uc003qtf.3	O15244	OTTHUMG00000015950	ENST00000366953.3:c.983G>C	6.37:g.160666552C>G	ENSP00000355920:p.Gly328Ala	Somatic		Capture	Illumina GAIIx	4	160586542	Q5T7Q6|Q6PIQ8|Q8NG62|Q9NQB9	Missense_Mutation	SNP	superfamily_MFS general substrate transporter,HMMPfam_Sugar_tr,PatternScan_SUGAR_TRANSPORT_1	p.G328A	ENST00000366953.3	37	c.983	CCDS5276.1	6	.	.	.	.	.	.	.	.	.	.	C	0.757	-0.770603	0.02974	.	.	ENSG00000112499	ENST00000366953;ENST00000366952	T;T	0.73469	-0.75;-0.75	5.17	0.919	0.19392	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.587363	0.17668	N	0.166079	T	0.25865	0.0630	N	0.17594	0.5	0.09310	N	1	B;B	0.23249	0.011;0.082	B;B	0.25614	0.062;0.053	T	0.34428	-0.9829	10	0.06757	T	0.87	.	5.4322	0.16460	0.1274:0.5573:0.0:0.3153	.	328;328	O15244;O15244-2	S22A2_HUMAN;.	A	328;307	ENSP00000355920:G328A;ENSP00000355919:G307A	ENSP00000355919:G307A	G	-	2	0	SLC22A2	160586542	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.305000	0.19254	0.221000	0.20879	-0.345000	0.07892	GGC	-	superfamily_MFS general substrate transporter,HMMPfam_Sugar_tr		0.378	SLC22A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A2	protein_coding	OTTHUMT00000042943.1	C	NM_003058		160586542	-1	no_errors	NM_003058	genbank	human	reviewed	54_36p	missense	SNP	0.000	G
B3GALNT1	8706	genome.wustl.edu	37	3	160804272	160804272	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr3:160804272C>T	ENST00000392781.2	-	8	1018	c.271G>A	c.(271-273)Gtg>Atg	p.V91M	B3GALNT1_ENST00000488170.1_Missense_Mutation_p.V91M|B3GALNT1_ENST00000392779.2_Missense_Mutation_p.V91M|B3GALNT1_ENST00000392780.1_Missense_Mutation_p.V91M|B3GALNT1_ENST00000417187.1_Intron|B3GALNT1_ENST00000473285.1_Missense_Mutation_p.V91M|B3GALNT1_ENST00000320474.4_Missense_Mutation_p.V91M	NM_001038628.1	NP_001033717.1	O75752	B3GL1_HUMAN	beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group)	91					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	galactosylgalactosylglucosylceramide beta-D-acetylgalactosaminyltransferase activity (GO:0047273)|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13			LUSC - Lung squamous cell carcinoma(72;4.41e-05)|Lung(72;4.61e-05)			CTGGCTTTCACATCTGAAGGG	0.428																																																0			3											81.0	85.0	84.0					3																	160804272		2203	4300	6503	162286966	SO:0001583	missense	8706			Y15062	CCDS3193.1	3q25	2014-07-18	2006-06-14	2006-05-09	ENSG00000169255	ENSG00000169255	2.4.1.79	"""Blood group antigens"", ""Beta 3-glycosyltransferases"""	918	protein-coding gene	gene with protein product	"""globoside synthase"", ""P antigen synthase"""	603094	"""UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 3 (Globoside blood group)"", ""UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 1 (Globoside blood group)"""	B3GALT3		9582303, 10993897	Standard	XM_005247861		Approved	beta3Gal-T3, galT3, P1, GLOB	uc003fdv.3	O75752	OTTHUMG00000159064	ENST00000392781.2:c.271G>A	3.37:g.160804272C>T	ENSP00000376532:p.Val91Met	Somatic		Capture	Illumina GAIIx	4	162286966	D3DNM4|Q3Y531|Q6IAI5|Q8NFM8|Q8NFM9|Q9HA06	Missense_Mutation	SNP	HMMPfam_Galactosyl_T	p.V91M	ENST00000392781.2	37	c.271	CCDS3193.1	3	.	.	.	.	.	.	.	.	.	.	C	16.50	3.140936	0.56936	.	.	ENSG00000169255	ENST00000320474;ENST00000392779;ENST00000392780;ENST00000392781;ENST00000473285;ENST00000488170;ENST00000468268	T;T;T;T;T;T;T	0.51071	1.12;1.12;1.12;1.12;1.12;1.12;0.72	5.73	5.73	0.89815	.	0.000000	0.64402	D	0.000012	T	0.40448	0.1117	N	0.24115	0.695	0.30742	N	0.746109	P	0.45902	0.868	P	0.45195	0.473	T	0.38972	-0.9636	10	0.33141	T	0.24	.	15.9837	0.80133	0.0:0.8655:0.1345:0.0	.	91	O75752	B3GL1_HUMAN	M	91	ENSP00000323479:V91M;ENSP00000376530:V91M;ENSP00000376531:V91M;ENSP00000376532:V91M;ENSP00000418226:V91M;ENSP00000420163:V91M;ENSP00000419476:V91M	ENSP00000323479:V91M	V	-	1	0	B3GALNT1	162286966	0.048000	0.20356	1.000000	0.80357	0.995000	0.86356	0.472000	0.22116	2.701000	0.92244	0.561000	0.74099	GTG	-	NULL		0.428	B3GALNT1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	B3GALNT1	protein_coding	OTTHUMT00000353125.1	C	NM_033167		162286966	-1	no_errors	NM_001038628	genbank	human	reviewed	54_36p	missense	SNP	0.983	T
TTN	7273	genome.wustl.edu	37	2	179448534	179448534	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr2:179448534T>G	ENST00000591111.1	-	262	60676	c.60452A>C	c.(60451-60453)tAt>tCt	p.Y20151S	TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000585451.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.Y12852S|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.Y12919S|TTN_ENST00000460472.2_Missense_Mutation_p.Y12727S|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.Y21792S|TTN_ENST00000342992.6_Missense_Mutation_p.Y19224S			Q8WZ42	TITIN_HUMAN	titin	20151	Fibronectin type-III 46. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCTACGAAATAGCCAATAAT	0.468																																																0			2											59.0	58.0	58.0					2																	179448534		1907	4114	6021	179156780	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.60452A>C	2.37:g.179448534T>G	ENSP00000465570:p.Tyr20151Ser	Somatic		Capture	Illumina GAIIx	4	179156780	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,superfamily_Concanavalin A-like lectins/glucanases,superfamily_vWA-like,superfamily_WD40 repeat-like,superfamily_Positive stranded ssRNA viruses,HMMPfam_Titin_Z,HMMSmart_SM00406,PatternScan_IG_MHC,HMMPfam_PPAK,HMMPfam_ig,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,PatternScan_FGGY_KINASES_1,PatternScan_PEROXIDASE_1,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_TYR	p.Y17773S	ENST00000591111.1	37	c.53318		2	.	.	.	.	.	.	.	.	.	.	T	14.61	2.587701	0.46110	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	6.11	6.11	0.99139	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.93096	0.7802	H	0.98577	4.27	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.95578	0.8644	9	0.87932	D	0	.	16.7021	0.85357	0.0:0.0:0.0:1.0	.	12727;12852;12919;20151	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	19224;12727;12919;12852;12725	ENSP00000343764:Y19224S;ENSP00000434586:Y12727S;ENSP00000340554:Y12919S;ENSP00000352154:Y12852S	ENSP00000340554:Y12919S	Y	-	2	0	TTN	179156780	1.000000	0.71417	0.970000	0.41538	0.451000	0.32288	8.040000	0.89188	2.343000	0.79666	0.533000	0.62120	TAT	-	superfamily_Concanavalin A-like lectins/glucanases,superfamily_vWA-like,superfamily_WD40 repeat-like,superfamily_Positive stranded ssRNA viruses,superfamily_Fibronectin type III,HMMPfam_fn3,HMMSmart_SM00060		0.468	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	T	NM_133378		179156780	-1	no_errors	ENST00000375038	ensembl	human	known	54_36p	missense	SNP	1.000	G
ASNSD1	54529	genome.wustl.edu	37	2	190531054	190531054	+	Nonsense_Mutation	SNP	G	G	T			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr2:190531054G>T	ENST00000260952.4	+	4	609	c.196G>T	c.(196-198)Gaa>Taa	p.E66*	ASNSD1_ENST00000607535.1_3'UTR|ASNSD1_ENST00000607829.1_3'UTR|ASNSD1_ENST00000607062.1_Intron|ASNSD1_ENST00000607690.1_3'UTR	NM_019048.2	NP_061921	Q9NWL6	ASND1_HUMAN	asparagine synthetase domain containing 1	66	Glutamine amidotransferase type-2. {ECO:0000255|PROSITE-ProRule:PRU00609}.				asparagine biosynthetic process (GO:0006529)|glutamine metabolic process (GO:0006541)		asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(3)	25			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0449)|all cancers(119;0.118)			CCAGCCTGTGGAAGATGAAAG	0.358																																																0			2											138.0	143.0	142.0					2																	190531054		2203	4300	6503	190239299	SO:0001587	stop_gained	54529			AY116969	CCDS2300.1	2q32.2	2012-09-20			ENSG00000138381	ENSG00000138381			24910	protein-coding gene	gene with protein product							Standard	NM_019048		Approved	NS3TP1, FLJ20752, NBLA00058	uc002uqt.3	Q9NWL6	OTTHUMG00000132665	ENST00000260952.4:c.196G>T	2.37:g.190531054G>T	ENSP00000260952:p.Glu66*	Somatic		Capture	Illumina GAIIx	4	190239299	D3DPH6|Q3LIC3|Q4ZG45	Nonsense_Mutation	SNP	superfamily_N-terminal nucleophile aminohydrolases (Ntn hydrolases),superfamily_Adenine nucleotide alpha hydrolases-like,HMMPfam_Asn_synthase	p.E66*	ENST00000260952.4	37	c.196	CCDS2300.1	2	.	.	.	.	.	.	.	.	.	.	G	32	5.159487	0.94686	.	.	ENSG00000138381	ENST00000260952;ENST00000425590;ENST00000420250	.	.	.	5.87	4.07	0.47477	.	0.143808	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	-26.9021	8.2583	0.31769	0.1345:0.1296:0.7359:0.0	.	.	.	.	X	66	.	ENSP00000260952:E66X	E	+	1	0	ASNSD1	190239299	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.122000	0.50446	0.928000	0.37168	0.655000	0.94253	GAA	-	superfamily_N-terminal nucleophile aminohydrolases (Ntn hydrolases)		0.358	ASNSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASNSD1	protein_coding	OTTHUMT00000255919.3	G	NM_019048		190239299	+1	no_errors	NM_019048	genbank	human	validated	54_36p	nonsense	SNP	1.000	T
USH2A	7399	genome.wustl.edu	37	1	216420003	216420003	+	Silent	SNP	G	G	T	rs375996450		TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr1:216420003G>T	ENST00000307340.3	-	13	3119	c.2733C>A	c.(2731-2733)acC>acA	p.T911T	USH2A_ENST00000366943.2_Silent_p.T911T|USH2A_ENST00000366942.3_Silent_p.T911T	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	911	Laminin EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00460}.		T -> N (in RP39; unknown pathological significance). {ECO:0000269|PubMed:15325563}.		hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GGTCACAAATGGTCCCAGGTA	0.443										HNSCC(13;0.011)																																						0			1											204.0	191.0	196.0					1																	216420003		2203	4300	6503	214486626	SO:0001819	synonymous_variant	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.2733C>A	1.37:g.216420003G>T		Somatic		Capture	Illumina GAIIx	4	214486626	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00560,HMMSmart_SM00136,HMMPfam_Laminin_N,HMMPfam_Laminin_EGF,HMMSmart_SM00180,superfamily_EGF/Laminin,PatternScan_EGF_LAM_1,PatternScan_EGF_1,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,HMMSmart_SM00282,HMMPfam_Laminin_G_2	p.T911	ENST00000307340.3	37	c.2733	CCDS31025.1	1																																																																																			-	superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_Laminin_EGF,HMMSmart_SM00180,superfamily_EGF/Laminin		0.443	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	protein_coding	OTTHUMT00000128138.1	G	NM_007123		214486626	-1	no_errors	NM_206933	genbank	human	reviewed	54_36p	silent	SNP	0.001	T
EXOC8	149371	genome.wustl.edu	37	1	231471869	231471869	+	Silent	SNP	G	G	A			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr1:231471869G>A	ENST00000360394.2	-	1	1709	c.1623C>T	c.(1621-1623)ttC>ttT	p.F541F	SPRTN_ENST00000008440.9_5'Flank|SPRTN_ENST00000391858.4_5'Flank|EXOC8_ENST00000366645.1_Silent_p.F537F|SPRTN_ENST00000295050.7_5'Flank	NM_175876.3	NP_787072.2	Q8IYI6	EXOC8_HUMAN	exocyst complex component 8	541					cellular protein localization (GO:0034613)|cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				cervix(2)|endometrium(1)|large_intestine(2)|liver(1)|lung(5)|prostate(1)|skin(1)|stomach(1)	14	Breast(184;0.0871)	all_cancers(173;0.151)|Prostate(94;0.183)				CATGGATGATGAAGGTGAGAT	0.463																																																0			1											126.0	109.0	115.0					1																	231471869		2203	4300	6503	229538492	SO:0001819	synonymous_variant	149371			AL117352	CCDS1593.1	1q42.2	2013-01-22			ENSG00000116903	ENSG00000116903			24659	protein-coding gene	gene with protein product		615283				12477932	Standard	NM_175876		Approved	SEC84, EXO84, Exo84p	uc001huq.3	Q8IYI6	OTTHUMG00000038025	ENST00000360394.2:c.1623C>T	1.37:g.231471869G>A		Somatic		Capture	Illumina GAIIx	4	229538492	B3KU33|Q5TE82	Silent	SNP	HMMPfam_Vps51,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233	p.F541	ENST00000360394.2	37	c.1623	CCDS1593.1	1																																																																																			-	NULL		0.463	EXOC8-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EXOC8	protein_coding		G	NM_175876		229538492	-1	no_errors	NM_175876	genbank	human	validated	54_36p	silent	SNP	1.000	A
RYR2	6262	genome.wustl.edu	37	1	237870248	237870248	+	Splice_Site	SNP	G	G	A			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr1:237870248G>A	ENST00000366574.2	+	68	9897		c.e68-1		RYR2_ENST00000609119.1_Splice_Site|RYR2_ENST00000542537.1_Splice_Site|RYR2_ENST00000360064.6_Splice_Site	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)						BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TACTTCTCCAGCTCTCAGTTT	0.388																																																0			1											101.0	100.0	100.0					1																	237870248		1877	4123	6000	235936871	SO:0001630	splice_region_variant	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.9581-1G>A	1.37:g.237870248G>A		Somatic		Capture	Illumina GAIIx	4	235936871	Q15411|Q546N8|Q5T3P2	Splice_Site	SNP	-	e68-1	ENST00000366574.2	37	c.9581-1	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.507224	0.85282	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288;ENST00000540213	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5784	0.95453	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RYR2	235936871	1.000000	0.71417	0.998000	0.56505	0.966000	0.64601	9.414000	0.97362	2.706000	0.92434	0.650000	0.86243	.	-	-		0.388	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	protein_coding	OTTHUMT00000095402.2	G	NM_001035	Intron	235936871	+1	no_errors	NM_001035	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	A
MKL2	57496	genome.wustl.edu	37	16	14340848	14340849	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	AG	AG					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr16:14340848_14340849delAG	ENST00000341243.5	+	10	1698_1699	c.1698_1699delAG	c.(1696-1701)aaagagfs	p.E567fs	MKL2_ENST00000318282.5_Frame_Shift_Del_p.E578fs|MKL2_ENST00000571589.1_Frame_Shift_Del_p.E578fs|MKL2_ENST00000574045.1_Frame_Shift_Del_p.E578fs			Q9ULH7	MKL2_HUMAN	MKL/myocardin-like 2	567	Required for interaction with itself and with MKL1.				blood vessel morphogenesis (GO:0048514)|cardiac muscle tissue development (GO:0048738)|embryonic organ development (GO:0048568)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|muscle organ development (GO:0007517)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(6)|liver(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TTCAGGAGAAAGAGAAGCAAAT	0.475																																																0			16																																								14248350	SO:0001589	frameshift_variant	57496			AB033069	CCDS32391.1	16p13.12	2012-11-29			ENSG00000186260	ENSG00000186260			29819	protein-coding gene	gene with protein product		609463				10574462	Standard	NM_014048		Approved	MRTF-B, FLJ31823	uc002dcg.3	Q9ULH7	OTTHUMG00000177379	ENST00000341243.5:c.1698_1699delAG	16.37:g.14340850_14340851delAG	ENSP00000345841:p.Glu567fs	Somatic		Capture	Illumina GAIIx	4	14248349	A6ND53|B4DGT8|Q68CT1|Q6UB16|Q86WW2|Q8N226	Frame_Shift_Del	DEL	HMMSmart_RPEL,superfamily_SSF68906,HMMPfam_SAP,HMMSmart_SAP	p.K579fs	ENST00000341243.5	37	c.1731_1732		16																																																																																			(deletion:cds_exon[14247831,14248715])	NULL		0.475	MKL2-202	KNOWN	basic	protein_coding	MKL2	protein_coding		AG	NM_014048		14248350	+1	no_errors	NM_014048	genbank	human	validated	54_36p	frame_shift_del	DEL	0.980:1.000	-
IGHV4OR15-8	28317	genome.wustl.edu	37	15	22473015	22473024	+	RNA	DEL	GACTCTTGAG	GACTCTTGAG	-			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	GACTCTTGAG	GACTCTTGAG					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr15:22473015_22473024delGACTCTTGAG	ENST00000557788.2	-	0	246_255							A6NJ16	IV4F8_HUMAN	immunoglobulin heavy variable 4/OR15-8 (non-functional)							extracellular region (GO:0005576)											ATGGTGACTCGACTCTTGAGGGACGGGTTG	0.571																																																0			15																																								19974388			0			Z29598		15q11.2	2012-02-20	2008-09-15		ENSG00000259261	ENSG00000259261		"""Immunoglobulins / IGH orphons"""	5658	other	immunoglobulin gene			"""immunoglobulin heavy variable 4/OR15-8"", ""V-set and immunoglobulin domain containing 6"""	VSIG6		7951227	Standard			Approved	IGHV4/OR15-8, IGHV4OR158		A6NJ16	OTTHUMG00000171934		15.37:g.22473015_22473024delGACTCTTGAG		Somatic		Capture	Illumina GAIIx	4	19974379		Frame_Shift_Del	DEL	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00406	p.L90fs	ENST00000557788.2	37	c.277_268		15																																																																																			(deletion:cds_exon[19974025,19974588])	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00406		0.571	IGHV4OR15-8-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	LOC642131	IG_V_gene	OTTHUMT00000415968.2	GACTCTTGAG			19974388	-1	no_errors	XM_001716834	genbank	human	model	54_36p	frame_shift_del	DEL	0.066:0.002:0.001:0.002:0.034:0.115:0.111:0.126:0.181:0.163	-
TBC1D22B	55633	genome.wustl.edu	37	6	37247165	37247165	+	Frame_Shift_Del	DEL	A	A	-			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr6:37247165delA	ENST00000373491.3	+	3	345	c.199delA	c.(199-201)agtfs	p.S67fs		NM_017772.2	NP_060242.2	Q9NU19	TB22B_HUMAN	TBC1 domain family, member 22B	67							Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|prostate(1)	15			OV - Ovarian serous cystadenocarcinoma(102;0.241)			ACGGAATACCAGTGATGCTTG	0.428																																																0			6											155.0	146.0	149.0					6																	37247165		2203	4300	6503	37355143	SO:0001589	frameshift_variant	55633			AK096340	CCDS4832.1	6p21.2	2005-01-05	2005-01-05	2005-01-05	ENSG00000065491	ENSG00000065491			21602	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 197"""	C6orf197			Standard	NM_017772		Approved	FLJ20337, dJ744I24.2	uc003onn.3	Q9NU19	OTTHUMG00000014619	ENST00000373491.3:c.199delA	6.37:g.37247165delA	ENSP00000362590:p.Ser67fs	Somatic		Capture	Illumina GAIIx	4	37355143	A8KA28|Q32MQ8|Q5VUK9|Q6P4C3|Q7Z6P7|Q9BPV6|Q9BUT5|Q9NXB6	Frame_Shift_Del	DEL	superfamily_Ypt/Rab-GAP domain of gyp1p,HMMPfam_TBC,HMMSmart_SM00164	p.S67fs	ENST00000373491.3	37	c.199	CCDS4832.1	6																																																																																			(deletion:cds_exon[37355058,37355365])	NULL		0.428	TBC1D22B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D22B	protein_coding	OTTHUMT00000040402.1	A	NM_017772		37355143	+1	no_errors	NM_017772	genbank	human	validated	54_36p	frame_shift_del	DEL	1.000	-
COL9A2	1298	genome.wustl.edu	37	1	40768483	40768484	+	Splice_Site	INS	-	-	GGAG	rs3831927|rs547665409|rs369338511|rs144651070|rs563535301	byFrequency	TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr1:40768483_40768484insGGAG	ENST00000372748.3	-	30	1700		c.e30-2		COL9A2_ENST00000466267.1_Splice_Site	NM_001852.3	NP_001843.1	Q14055	CO9A2_HUMAN	collagen, type IX, alpha 2						axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(4)|stomach(2)|urinary_tract(2)	22	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.08e-17)			CCAGTTGCTCTggagggaggga	0.649																																																0			1																																								40541071	SO:0001630	splice_region_variant	1298			M95610	CCDS450.1	1p33-p32	2013-01-16			ENSG00000049089	ENSG00000049089		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2218	protein-coding gene	gene with protein product		120260		EDM2		8454052, 8528240, 1429648	Standard	NM_001852		Approved	MED	uc001cfh.1	Q14055	OTTHUMG00000005761	ENST00000372748.3:c.1604-2->CTCC	1.37:g.40768488_40768491dupGGAG		Somatic		Capture	Illumina GAIIx	4	40541070	B2RMP9	Splice_Site	INS	-	e30-2	ENST00000372748.3	37	c.1604-3_1604-2	CCDS450.1	1																																																																																			-	-		0.649	COL9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL9A2	protein_coding	OTTHUMT00000015764.3	-	NM_001852	Intron	40541071	-1	no_errors	NM_001852	genbank	human	reviewed	54_36p	splice_site_ins	INS	1.000:0.994	GGAG
FSCN3	29999	genome.wustl.edu	37	7	127238516	127238516	+	Frame_Shift_Del	DEL	G	G	-			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr7:127238516delG	ENST00000265825.5	+	4	1207	c.988delG	c.(988-990)gggfs	p.G330fs	FSCN3_ENST00000420086.2_Frame_Shift_Del_p.G196fs	NM_020369.2	NP_065102.1	Q9NQT6	FSCN3_HUMAN	fascin actin-bundling protein 3, testicular	330						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(2)|large_intestine(3)|liver(2)|lung(17)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30						AATGGCTGATGGGCACCCCCT	0.532																																																0			7											76.0	74.0	74.0					7																	127238516		2203	4300	6503	127025752	SO:0001589	frameshift_variant	29999				CCDS34746.1	7q31.3	2014-02-03	2014-02-03		ENSG00000106328	ENSG00000106328		"""Fascins"""	3961	protein-coding gene	gene with protein product		615800	"""fascin (Strongylocentrotus purpuratus) homolog 3 (actin-bundling protein, testicular)"", ""fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus)"""			11925108	Standard	NM_020369		Approved		uc003vmd.2	Q9NQT6	OTTHUMG00000022935	ENST00000265825.5:c.988delG	7.37:g.127238516delG	ENSP00000265825:p.Gly330fs	Somatic		Capture	Illumina GAIIx	4	127025752	A4D0Z2|A6NLL7|B2RA62|B4DU68	Frame_Shift_Del	DEL	superfamily_Actin_crosslink,HMMPfam_Fascin	p.H331fs	ENST00000265825.5	37	c.988	CCDS34746.1	7																																																																																			(deletion:cds_exon[127025725,127025884])	superfamily_Actin_crosslink,HMMPfam_Fascin		0.532	FSCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCN3	protein_coding	OTTHUMT00000059256.2	G	NM_020369		127025752	+1	no_errors	NM_020369	genbank	human	provisional	54_36p	frame_shift_del	DEL	0.303	-
ZNF687	57592	genome.wustl.edu	37	1	151259480	151259491	+	In_Frame_Del	DEL	GCTCAGGCTCCA	GCTCAGGCTCCA	-			TCGA-61-1915-01A-01W-0639-09	TCGA-61-1915-11A-01W-0640-09	GCTCAGGCTCCA	GCTCAGGCTCCA					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8d0d915b-e84b-437a-88ad-c5b913bd54fe	940e219f-21f2-4ef6-bc8e-f0c382d0a6c2	g.chr1:151259480_151259491delGCTCAGGCTCCA	ENST00000368879.2	+	2	811_822	c.713_724delGCTCAGGCTCCA	c.(712-726)ggctcaggctccagc>ggc	p.SGSS239del		NM_020832.1	NP_065883.1	Q8N1G0	ZN687_HUMAN	zinc finger protein 687	239	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(2)	32	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GCCCAACAAGGCTCAGGCTCCAGCCCTAAGGC	0.637																																																0			1																																								149526115	SO:0001651	inframe_deletion	57592				CCDS992.1	1q21.2	2008-05-02			ENSG00000143373	ENSG00000143373			29277	protein-coding gene	gene with protein product		610568				10718198	Standard	NM_020832		Approved	KIAA1441	uc001exq.3	Q8N1G0	OTTHUMG00000012347	ENST00000368879.2:c.713_724delGCTCAGGCTCCA	1.37:g.151259480_151259491delGCTCAGGCTCCA	ENSP00000357874:p.Ser239_Ser242del	Somatic		Capture	Illumina GAIIx	4	149526104	D3DV17|Q68DQ8|Q9H937|Q9P2A7	In_Frame_Del	DEL	superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_zf-C2H2	p.SGSS239in_frame_del	ENST00000368879.2	37	c.713_724		1																																																																																			(deletion:cds_exon[149525392,149527506])	NULL		0.637	ZNF687-201	KNOWN	basic	protein_coding	ZNF687	protein_coding		GCTCAGGCTCCA	NM_020832		149526115	+1	no_errors	NM_020832	genbank	human	provisional	54_36p	in_frame_del	DEL	0.000:0.000:0.001:0.003:0.001:0.007:0.012:0.011:0.006:0.003:0.001:0.002	-
