#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SGCE	8910	hgsc.bcm.edu	37	7	94257670	94257670	+	Splice_Site	SNP	G	G	A			TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr7:94257670G>A	ENST00000265735.7	-	3	344	c.234C>T	c.(232-234)ggC>ggT	p.G78G	SGCE_ENST00000445866.2_Splice_Site_p.G78G|SGCE_ENST00000415788.2_Splice_Site_p.G114G|SGCE_ENST00000447873.1_Splice_Site_p.G78G|SGCE_ENST00000428696.2_Splice_Site_p.G78G|SGCE_ENST00000437425.2_Splice_Site_p.G37G	NM_003919.2	NP_003910.1	O43556	SGCE_HUMAN	sarcoglycan, epsilon	78				G -> S (in Ref. 3; AAM64204). {ECO:0000305}.	cell-matrix adhesion (GO:0007160)|muscle organ development (GO:0007517)	cytoskeleton (GO:0005856)|dendrite membrane (GO:0032590)|dystrophin-associated glycoprotein complex (GO:0016010)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)	calcium ion binding (GO:0005509)	p.G78G(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(1)	14	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			TACTAATCTCGCCTAGATAAG	0.333																																					p.G78G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C234T	7						.						54.0	53.0	53.0					7																	94257670		2203	4299	6502	94095606	SO:0001630	splice_region_variant	8910	exon3			AF036364	CCDS5637.1, CCDS47642.1, CCDS47643.1, CCDS75634.1	7q21.3	2014-09-17			ENSG00000127990	ENSG00000127990			10808	protein-coding gene	gene with protein product		604149		DYT11		9475163, 9405466	Standard	NM_001099401		Approved		uc003unn.2	O43556	OTTHUMG00000022828	ENST00000265735.7:c.233-1C>T	7.37:g.94257670G>A		Somatic		Capture	SOLID	Phase_I	94095606	NM_003919	B2R8N2|D6W5Q8|E9PF60|G5E9K6|Q6L8P0|Q75MH8|Q8NFG8|Q8WW28	Silent	SNP	ENST00000265735.7	37	CCDS5637.1																																																																																				SGCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255251.2		Silent
SOX12	6666	hgsc.bcm.edu	37	20	306702	306702	+	Missense_Mutation	SNP	A	A	G			TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr20:306702A>G	ENST00000342665.2	+	1	464	c.134A>G	c.(133-135)aAc>aGc	p.N45S	RP5-1103G7.4_ENST00000442637.1_RNA|RP5-1103G7.4_ENST00000414676.1_RNA|SOX12_ENST00000544632.1_Missense_Mutation_p.N45S	NM_006943.2	NP_008874.2	O15370	SOX12_HUMAN	SRY (sex determining region Y)-box 12	45					cell fate commitment (GO:0045165)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein-DNA complex assembly (GO:0065004)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord development (GO:0021510)	nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.N45S(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		all_cancers(10;0.000331)|Lung NSC(37;0.0496)|all_lung(30;0.0831)|all_epithelial(17;0.0868)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			AGGCCGATGAACGCATTCATG	0.721																																					p.N45S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A134G	20						.						27.0	22.0	23.0					20																	306702		2202	4298	6500	254702	SO:0001583	missense	6666	exon1			U35612	CCDS12995.1	20p13	2008-07-28	2002-07-22	2002-07-26	ENSG00000177732	ENSG00000177732		"""SRY (sex determining region Y)-boxes"""	11198	protein-coding gene	gene with protein product		601947	"""SRY (sex determining region Y)-box 22"""	SOX22		9215677	Standard	NM_006943		Approved		uc002wdh.4	O15370	OTTHUMG00000031623	ENST00000342665.2:c.134A>G	20.37:g.306702A>G	ENSP00000347646:p.Asn45Ser	Somatic		Capture	SOLID	Phase_I	254702	NM_006943	Q5D038|Q9NUD4	Missense_Mutation	SNP	ENST00000342665.2	37	CCDS12995.1	.	.	.	.	.	.	.	.	.	.	A	19.35	3.811277	0.70797	.	.	ENSG00000177732	ENST00000544632;ENST00000342665	D;D	0.93426	-3.22;-3.22	3.63	3.63	0.41609	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.50627	U	0.000104	D	0.95326	0.8483	M	0.68317	2.08	0.58432	D	0.999994	D	0.76494	0.999	D	0.81914	0.995	D	0.95131	0.8255	10	0.87932	D	0	.	10.2285	0.43241	1.0:0.0:0.0:0.0	.	45	O15370	SOX12_HUMAN	S	45	ENSP00000441671:N45S;ENSP00000347646:N45S	ENSP00000347646:N45S	N	+	2	0	SOX12	254702	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	8.240000	0.89813	1.513000	0.48852	0.260000	0.18958	AAC		SOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077435.2	NM_006943	
TM9SF1	10548	hgsc.bcm.edu	37	14	24659659	24659659	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr14:24659659G>A	ENST00000261789.4	-	5	1712	c.1354C>T	c.(1354-1356)Cgg>Tgg	p.R452W	RP11-468E2.2_ENST00000561419.1_5'Flank|TM9SF1_ENST00000530611.1_Missense_Mutation_p.R661W|IPO4_ENST00000354464.6_5'Flank|TM9SF1_ENST00000524835.1_Missense_Mutation_p.R365W|TM9SF1_ENST00000556387.1_Missense_Mutation_p.R661W|TM9SF1_ENST00000396854.4_Missense_Mutation_p.R452W|TM9SF1_ENST00000528669.1_Missense_Mutation_p.R452W	NM_006405.5	NP_006396.2	O15321	TM9S1_HUMAN	transmembrane 9 superfamily member 1	452					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)		p.R452W(1)|p.R452R(1)		NS(1)|breast(4)|endometrium(3)|large_intestine(11)|lung(4)|ovary(1)	24				GBM - Glioblastoma multiforme(265;0.0183)		GGAATCTCCCGGGCGATGTTC	0.542																																					p.R452W												.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(1)|lung(1)	c.C1354T	14						.						132.0	111.0	118.0					14																	24659659		2203	4300	6503	23729499	SO:0001583	missense	10548	exon5			U94831	CCDS9617.1, CCDS41934.1, CCDS73623.1	14q11.2	2005-10-11			ENSG00000100926	ENSG00000100926			11864	protein-coding gene	gene with protein product						9332367	Standard	NM_006405		Approved	MP70, HMP70	uc010tob.1	O15321	OTTHUMG00000029322	ENST00000261789.4:c.1354C>T	14.37:g.24659659G>A	ENSP00000261789:p.Arg452Trp	Somatic		Capture	SOLID	Phase_I	23729499	NM_001014842	D3DS65|Q86SZ6|Q96FI8	Missense_Mutation	SNP	ENST00000261789.4	37	CCDS9617.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.411296	0.83340	.	.	ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000254692	ENST00000261789;ENST00000528669;ENST00000556387;ENST00000524835;ENST00000396854;ENST00000530611	T;T;T;T;T;T	0.58940	0.3;0.3;0.3;0.3;0.3;0.3	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	D	0.83889	0.5352	H	0.98388	4.22	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88545	0.3112	10	0.87932	D	0	-12.3352	11.0074	0.47641	0.0:0.0:0.8139:0.1861	.	452;452	Q86SZ6;O15321	.;TM9S1_HUMAN	W	452;452;661;365;452;661	ENSP00000261789:R452W;ENSP00000432997:R452W;ENSP00000451949:R661W;ENSP00000434387:R365W;ENSP00000380063:R452W;ENSP00000433967:R661W	ENSP00000433967:R661W	R	-	1	2	TM9SF1;RP11-468E2.1	23729499	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.409000	0.52657	2.317000	0.78254	0.655000	0.94253	CGG		TM9SF1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000073136.2	NM_006405	
NID2	22795	hgsc.bcm.edu	37	14	52520996	52520996	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr14:52520996C>T	ENST00000216286.5	-	4	810	c.811G>A	c.(811-813)Ggc>Agc	p.G271S	NID2_ENST00000541773.1_Missense_Mutation_p.G218S	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	271	NIDO. {ECO:0000255|PROSITE- ProRule:PRU00570}.				basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)	p.G271S(1)		NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					GAAGTGCTGCCGATATGGAAA	0.502																																					p.G271S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G811A	14						.						50.0	50.0	50.0					14																	52520996		2203	4300	6503	51590746	SO:0001583	missense	22795	exon4			AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.811G>A	14.37:g.52520996C>T	ENSP00000216286:p.Gly271Ser	Somatic		Capture	SOLID	Phase_I	51590746	NM_007361	A8K6I7|B4DU19|O43710	Missense_Mutation	SNP	ENST00000216286.5	37	CCDS9706.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.156747	0.78114	.	.	ENSG00000087303	ENST00000216286;ENST00000541773;ENST00000395707	T;T	0.73897	-0.79;-0.79	5.52	4.64	0.57946	Nidogen, extracellular domain (3);	0.044478	0.85682	N	0.000000	T	0.81851	0.4910	L	0.50847	1.595	0.44462	D	0.997394	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.983;1.0;0.979	T	0.80926	-0.1164	10	0.37606	T	0.19	.	14.306	0.66384	0.0:0.9278:0.0:0.0722	.	218;273;271	Q14112-2;Q5CZI2;Q14112	.;.;NID2_HUMAN	S	271;218;273	ENSP00000216286:G271S;ENSP00000443730:G218S	ENSP00000216286:G271S	G	-	1	0	NID2	51590746	0.995000	0.38212	0.888000	0.34837	0.442000	0.32017	3.382000	0.52463	1.466000	0.48025	0.655000	0.94253	GGC		NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1		
RPS6KL1	83694	hgsc.bcm.edu	37	14	75378075	75378075	+	Silent	SNP	G	G	T			TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr14:75378075G>T	ENST00000555647.1	-	7	827	c.540C>A	c.(538-540)ccC>ccA	p.P180P	RPS6KL1_ENST00000557413.1_Silent_p.P180P|RPS6KL1_ENST00000354625.2_Silent_p.P149P|RPS6KL1_ENST00000358328.4_Silent_p.P180P|RPS6KL1_ENST00000554900.1_5'UTR			Q9Y6S9	RPKL1_HUMAN	ribosomal protein S6 kinase-like 1	180	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					ribosome (GO:0005840)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.P180P(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(234;0.00658)		TGTGGCACCTGGGTAGGCTCT	0.627																																					p.P149P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C447A	14						.						84.0	74.0	77.0					14																	75378075		2203	4300	6503	74447828	SO:0001819	synonymous_variant	83694	exon5			BC004540	CCDS9834.1, CCDS9834.2	14q24.2	2011-04-05				ENSG00000198208			20222	protein-coding gene	gene with protein product							Standard	NM_031464		Approved	MGC11287	uc010tux.2	Q9Y6S9		ENST00000555647.1:c.540C>A	14.37:g.75378075G>T		Somatic		Capture	SOLID	Phase_I	74447828	NM_031464	A6NGM9|Q69YT9|Q6ZMQ6|Q96NR9|Q9BSU9	Silent	SNP	ENST00000555647.1	37	CCDS9834.2																																																																																				RPS6KL1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413732.1		
CYP46A1	10858	hgsc.bcm.edu	37	14	100182494	100182494	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr14:100182494G>A	ENST00000261835.3	+	9	969	c.865G>A	c.(865-867)Gac>Aac	p.D289N	CYP46A1_ENST00000554176.1_Missense_Mutation_p.D136N|CYP46A1_ENST00000423126.2_Missense_Mutation_p.D192N	NM_006668.1	NP_006659.1	Q9Y6A2	CP46A_HUMAN	cytochrome P450, family 46, subfamily A, polypeptide 1	289					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cholesterol catabolic process (GO:0006707)|nervous system development (GO:0007399)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	cholesterol 24-hydroxylase activity (GO:0033781)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid hydroxylase activity (GO:0008395)	p.D289N(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|prostate(1)|skin(1)	25		Melanoma(154;0.0866)|all_epithelial(191;0.179)				AGCCCAGGACGACGAGGGTCT	0.512																																					p.D289N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G865A	14						.						112.0	110.0	110.0					14																	100182494		2203	4300	6503	99252247	SO:0001583	missense	10858	exon9			AF094480	CCDS9954.1	14q32.2	2013-05-03	2003-02-14	2003-02-28	ENSG00000036530	ENSG00000036530		"""Cytochrome P450s"""	2641	protein-coding gene	gene with protein product		604087	"""cytochrome P450, subfamily 46 (cholesterol 24-hydroxylase)"""	CYP46		10377398	Standard	NM_006668		Approved		uc001ygo.3	Q9Y6A2	OTTHUMG00000171510	ENST00000261835.3:c.865G>A	14.37:g.100182494G>A	ENSP00000261835:p.Asp289Asn	Somatic		Capture	SOLID	Phase_I	99252247	NM_006668	B4DHP8|E7EQG9|Q8N2B0	Missense_Mutation	SNP	ENST00000261835.3	37	CCDS9954.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.80|13.80	2.344361|2.344361	0.41498|0.41498	.|.	.|.	ENSG00000036530|ENSG00000036530	ENST00000261835;ENST00000423126;ENST00000554176;ENST00000556313|ENST00000380228	T;T;T;T|.	0.71222|.	-0.55;-0.55;-0.55;-0.55|.	4.77|4.77	4.77|4.77	0.60923|0.60923	.|.	0.393031|.	0.27604|.	N|.	0.018640|.	T|T	0.60650|0.60650	0.2285|0.2285	L|L	0.46885|0.46885	1.475|1.475	0.36038|0.36038	D|D	0.8399|0.8399	B;P|.	0.44344|.	0.104;0.833|.	B;B|.	0.39119|.	0.048;0.291|.	T|T	0.65957|0.65957	-0.6042|-0.6042	10|5	0.27785|.	T|.	0.31|.	.|.	13.6794|13.6794	0.62474|0.62474	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	136;289|.	Q8N2B0;Q9Y6A2|.	.;CP46A_HUMAN|.	N|Q	289;192;136;42|275	ENSP00000261835:D289N;ENSP00000405779:D192N;ENSP00000450553:D136N;ENSP00000451602:D42N|.	ENSP00000261835:D289N|.	D|R	+|+	1|2	0|0	CYP46A1|CYP46A1	99252247|99252247	1.000000|1.000000	0.71417|0.71417	0.729000|0.729000	0.30791|0.30791	0.626000|0.626000	0.37791|0.37791	6.110000|6.110000	0.71535|0.71535	2.371000|2.371000	0.80710|0.80710	0.561000|0.561000	0.74099|0.74099	GAC|CGA		CYP46A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413814.1		
USP29	57663	hgsc.bcm.edu	37	19	57641702	57641702	+	Silent	SNP	T	T	C			TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr19:57641702T>C	ENST00000254181.4	+	4	2113	c.1659T>C	c.(1657-1659)agT>agC	p.S553S	USP29_ENST00000598197.1_Silent_p.S553S	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	553	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)	p.S553S(1)		breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CCTTGAGCAGTAGTGCACCTG	0.423																																					p.S553S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1659C	19						.						130.0	140.0	136.0					19																	57641702		2203	4300	6503	62333514	SO:0001819	synonymous_variant	57663	exon4				CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.1659T>C	19.37:g.57641702T>C		Somatic		Capture	SOLID	Phase_I	62333514	NM_020903		Silent	SNP	ENST00000254181.4	37	CCDS33124.1																																																																																				USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465075.1		
PLEKHG5	57449	hgsc.bcm.edu	37	1	6529509	6529509	+	Splice_Site	SNP	C	C	G	rs147140763		TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr1:6529509C>G	ENST00000400915.3	-	19	2169	c.2103G>C	c.(2101-2103)ggG>ggC	p.G701G	PLEKHG5_ENST00000377740.3_Splice_Site_p.G722G|PLEKHG5_ENST00000377732.1_Splice_Site_p.G682G|PLEKHG5_ENST00000535355.1_Splice_Site_p.G714G|PLEKHG5_ENST00000377748.1_Splice_Site_p.G722G|PLEKHG5_ENST00000377737.2_Splice_Site_p.G645G|PLEKHG5_ENST00000400913.1_Splice_Site_p.G645G|PLEKHG5_ENST00000544978.1_Splice_Site_p.G645G|PLEKHG5_ENST00000377725.1_Splice_Site_p.G645G|PLEKHG5_ENST00000377728.3_Splice_Site_p.G645G|PLEKHG5_ENST00000340850.5_Splice_Site_p.G645G|PLEKHG5_ENST00000537245.1_Splice_Site_p.G724G	NM_001042663.1	NP_001036128.1	O94827	PKHG5_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 5	701	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|endothelial cell chemotaxis (GO:0035767)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)	p.G722G(1)		liver(1)	1	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)		GGAGGAAGGACCCTGGTTAGG	0.607																																					p.G645G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1935C	1						.						93.0	98.0	96.0					1																	6529509		2203	4300	6503	6452096	SO:0001630	splice_region_variant	57449	exon18			AK024676	CCDS79.1, CCDS41240.1, CCDS41241.1, CCDS57967.1, CCDS57968.1, CCDS57969.1	1p36.31	2014-09-17		2005-08-09	ENSG00000171680	ENSG00000171680		"""Pleckstrin homology (PH) domain containing"""	29105	protein-coding gene	gene with protein product	"""synectin-binding guanine exchange factor"""	611101				17564964	Standard	NM_001042663		Approved	KIAA0720, Syx, GEF720, Tech	uc010nzr.1	O94827	OTTHUMG00000000905	ENST00000400915.3:c.2102-1G>C	1.37:g.6529509C>G		Somatic		Capture	SOLID	Phase_I	6452096	NM_001042664	B3KU07|B7Z2M3|B7Z5X2|F5GZ21|F5H1I0|Q5SY17|Q5T8W5|Q5T8W9|Q6ZNM0|Q7Z436|Q86YD8|Q96BS1	Silent	SNP	ENST00000400915.3	37	CCDS41241.1																																																																																				PLEKHG5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000002631.1	NM_020631	Silent
CSMD2	114784	hgsc.bcm.edu	37	1	34102147	34102147	+	Silent	SNP	C	C	T			TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr1:34102147C>T	ENST00000373380.1	-	9	1621	c.1401G>A	c.(1399-1401)ccG>ccA	p.P467P	CSMD2_ENST00000373381.4_Silent_p.P1594P|CSMD2_ENST00000373388.2_5'UTR			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1554	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P1554P(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				ATGACTCCCGCGGGTTTTCTG	0.562																																					p.P1554P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4662A	1						.						46.0	43.0	44.0					1																	34102147		2203	4300	6503	33874734	SO:0001819	synonymous_variant	114784	exon30			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.1401G>A	1.37:g.34102147C>T		Somatic		Capture	SOLID	Phase_I	33874734	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000373380.1	37																																																																																					CSMD2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000030635.4	NM_052896	
MMP3	4314	hgsc.bcm.edu	37	11	102713560	102713560	+	Nonsense_Mutation	SNP	G	G	A	rs143174783		TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr11:102713560G>A	ENST00000299855.5	-	2	449	c.193C>T	c.(193-195)Cga>Tga	p.R65*		NM_002422.3	NP_002413.1	P08254	MMP3_HUMAN	matrix metallopeptidase 3 (stromelysin 1, progelatinase)	65					cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|positive regulation of oxidative stress-induced cell death (GO:1903209)|proteolysis (GO:0006508)|regulation of cell migration (GO:0030334)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R65*(1)		endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0142)	Marimastat(DB00786)	TGCATTTCTCGGATTTTTTTA	0.448																																					p.R65X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C193T	11						.	G	stop/ARG	1,4405	2.1+/-5.4	0,1,2202	50.0	46.0	47.0		193	5.2	0.6	11	dbSNP_134	47	1,8597	1.2+/-3.3	0,1,4298	yes	stop-gained	MMP3	NM_002422.3		0,2,6500	AA,AG,GG		0.0116,0.0227,0.0154		65/478	102713560	2,13002	2203	4299	6502	102218770	SO:0001587	stop_gained	4314	exon2			X05232	CCDS8323.1	11q22.3	2012-10-02	2005-08-08		ENSG00000149968	ENSG00000149968	3.4.24.17		7173	protein-coding gene	gene with protein product		185250	"""matrix metalloproteinase 3 (stromelysin 1, progelatinase)"""	STMY1, STMY			Standard	NM_002422		Approved		uc001phj.1	P08254	OTTHUMG00000048254	ENST00000299855.5:c.193C>T	11.37:g.102713560G>A	ENSP00000299855:p.Arg65*	Somatic		Capture	SOLID	Phase_I	102218770	NM_002422	B2R8B8|Q3B7S0|Q6GRF8	Nonsense_Mutation	SNP	ENST00000299855.5	37	CCDS8323.1	.	.	.	.	.	.	.	.	.	.	G	38	7.053271	0.98029	2.27E-4	1.16E-4	ENSG00000149968	ENST00000299855	.	.	.	6.16	5.2	0.72013	.	1.509290	0.04732	N	0.421300	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.4284	0.55561	0.0:0.0:0.7472:0.2528	.	.	.	.	X	65	.	ENSP00000299855:R65X	R	-	1	2	MMP3	102218770	0.000000	0.05858	0.592000	0.28758	0.981000	0.71138	0.760000	0.26475	2.937000	0.99478	0.650000	0.86243	CGA		MMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109758.2	NM_002422	
PIK3C2A	5286	hgsc.bcm.edu	37	11	17191188	17191188	+	Missense_Mutation	SNP	A	A	T			TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr11:17191188A>T	ENST00000265970.7	-	1	100	c.101T>A	c.(100-102)aTg>aAg	p.M34K	PIK3C2A_ENST00000540361.1_Intron|PIK3C2A_ENST00000531428.1_Intron	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	34	Interaction with clathrin; sufficient to induce clathrin assemby.				clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)	p.M34K(1)		central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						CTCTGCTTCCATCTGTAATGC	0.423																																					p.M34K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T101A	11						.						194.0	188.0	190.0					11																	17191188		2200	4293	6493	17147764	SO:0001583	missense	5286	exon1			Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.101T>A	11.37:g.17191188A>T	ENSP00000265970:p.Met34Lys	Somatic		Capture	SOLID	Phase_I	17147764	NM_002645	B0LPH2|B4E2G4|Q14CQ9	Missense_Mutation	SNP	ENST00000265970.7	37	CCDS7824.1	.	.	.	.	.	.	.	.	.	.	A	19.86	3.905181	0.72868	.	.	ENSG00000011405	ENST00000265970;ENST00000544896;ENST00000532035	T	0.69040	-0.37	5.23	5.23	0.72850	.	0.094256	0.64402	D	0.000001	T	0.74869	0.3773	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	1.0;0.987	D;D	0.83275	0.996;0.942	T	0.78026	-0.2365	10	0.87932	D	0	-12.9962	15.112	0.72365	1.0:0.0:0.0:0.0	.	34;34	F5H5W9;O00443	.;P3C2A_HUMAN	K	34	ENSP00000265970:M34K	ENSP00000265970:M34K	M	-	2	0	PIK3C2A	17147764	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.519000	0.90563	1.980000	0.57719	0.397000	0.26171	ATG		PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387553.1	NM_002645	
SSRP1	6749	hgsc.bcm.edu	37	11	57100241	57100241	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr11:57100241G>A	ENST00000278412.2	-	6	892	c.626C>T	c.(625-627)aCt>aTt	p.T209I		NM_003146.2	NP_003137.1	Q08945	SSRP1_HUMAN	structure specific recognition protein 1	209					DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.T209I(1)		breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(4)	23						ACCACGAGGAGTCAGACACTG	0.537																																					p.T209I	Colon(89;1000 1340 6884 23013 41819)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C626T	11						.						84.0	80.0	81.0					11																	57100241		2201	4296	6497	56856817	SO:0001583	missense	6749	exon6			M86737	CCDS7952.1	11q12	2008-02-05			ENSG00000149136	ENSG00000149136			11327	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 80 kDa subunit"""	604328				1372440	Standard	NM_003146		Approved	FACT80	uc001njt.3	Q08945	OTTHUMG00000167024	ENST00000278412.2:c.626C>T	11.37:g.57100241G>A	ENSP00000278412:p.Thr209Ile	Somatic		Capture	SOLID	Phase_I	56856817	NM_003146	Q5BJG8	Missense_Mutation	SNP	ENST00000278412.2	37	CCDS7952.1	.	.	.	.	.	.	.	.	.	.	G	19.82	3.898389	0.72639	.	.	ENSG00000149136	ENST00000278412;ENST00000526696;ENST00000529002	T;T;T	0.58652	0.32;0.32;0.32	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.80380	0.4612	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.81346	-0.0974	10	0.62326	D	0.03	-18.3486	20.0291	0.97531	0.0:0.0:1.0:0.0	.	209	Q08945	SSRP1_HUMAN	I	209;112;112	ENSP00000278412:T209I;ENSP00000431154:T112I;ENSP00000434546:T112I	ENSP00000278412:T209I	T	-	2	0	SSRP1	56856817	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	9.103000	0.94232	2.838000	0.97847	0.561000	0.74099	ACT		SSRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392460.1	NM_003146	
TECTA	7007	hgsc.bcm.edu	37	11	121028731	121028731	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr11:121028731G>A	ENST00000392793.1	+	14	4758	c.4487G>A	c.(4486-4488)cGc>cAc	p.R1496H	TECTA_ENST00000264037.2_Missense_Mutation_p.R1496H			O75443	TECTA_HUMAN	tectorin alpha	1496	VWFD 4. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.R1496H(1)	TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		GGCGTCTTCCGCACCTTCGAC	0.642																																					p.R1496H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4487A	11						.						44.0	36.0	38.0					11																	121028731		2203	4299	6502	120533941	SO:0001583	missense	7007	exon13			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.4487G>A	11.37:g.121028731G>A	ENSP00000376543:p.Arg1496His	Somatic		Capture	SOLID	Phase_I	120533941	NM_005422		Missense_Mutation	SNP	ENST00000392793.1	37	CCDS8434.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.769826	0.90020	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.59772	0.24;0.24	5.54	4.57	0.56435	von Willebrand factor, type D domain (3);	0.000000	0.85682	D	0.000000	T	0.64159	0.2573	L	0.38175	1.15	0.46437	D	0.999047	D	0.89917	1.0	D	0.91635	0.999	T	0.55335	-0.8157	10	0.10902	T	0.67	.	15.8438	0.78871	0.0:0.1358:0.8642:0.0	.	1496	O75443	TECTA_HUMAN	H	1496	ENSP00000376543:R1496H;ENSP00000264037:R1496H	ENSP00000264037:R1496H	R	+	2	0	TECTA	120533941	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.457000	0.66672	2.618000	0.88619	0.462000	0.41574	CGC		TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422	
SASH1	23328	hgsc.bcm.edu	37	6	148854992	148854992	+	Missense_Mutation	SNP	T	T	A			TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr6:148854992T>A	ENST00000367467.3	+	15	2295	c.1820T>A	c.(1819-1821)tTc>tAc	p.F607Y		NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	607	SH3.				positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)			breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		ACGTTCAAGTTCATCTACGTG	0.562																																					p.F607Y												.	.	0			c.T1820A	6						.						119.0	107.0	111.0					6																	148854992		2203	4300	6503	148896685	SO:0001583	missense	23328	exon15			AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.1820T>A	6.37:g.148854992T>A	ENSP00000356437:p.Phe607Tyr	None		Capture	SOLID	Phase_I	148896685	NM_015278	Q5TGN5|Q8TAI0|Q9H7R7	Missense_Mutation	SNP	ENST00000367467.3	37	CCDS5212.1	.	.	.	.	.	.	.	.	.	.	T	34	5.362869	0.95877	.	.	ENSG00000111961	ENST00000367467;ENST00000535767;ENST00000537769	T	0.08102	3.13	5.21	5.21	0.72293	Src homology-3 domain (2);Variant SH3 (1);	0.000000	0.85682	D	0.000000	T	0.22666	0.0547	M	0.79693	2.465	0.53005	D	0.999962	D;D	0.71674	0.998;0.998	D;D	0.80764	0.994;0.994	T	0.02150	-1.1205	10	0.87932	D	0	-25.6366	15.3748	0.74596	0.0:0.0:0.0:1.0	.	588;607	Q6P4R9;O94885	.;SASH1_HUMAN	Y	607;368;17	ENSP00000356437:F607Y	ENSP00000356437:F607Y	F	+	2	0	SASH1	148896685	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.997000	0.88414	2.080000	0.62538	0.533000	0.62120	TTC		SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042619.1	NM_015278	
GPR31	2853	hgsc.bcm.edu	37	6	167570514	167570514	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr6:167570514C>T	ENST00000366834.1	-	1	1303	c.806G>A	c.(805-807)aGc>aAc	p.S269N		NM_005299.2	NP_005290.2	O00270	GPR31_HUMAN	G protein-coupled receptor 31	269					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.S269N(1)		NS(1)|endometrium(4)|large_intestine(4)|lung(7)|prostate(1)	17		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;4.81e-20)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;0.00492)		GTAGGTGAGGCTGCCCGTGAC	0.607																																					p.S269N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G806A	6						.						87.0	85.0	86.0					6																	167570514		2203	4300	6503	167490504	SO:0001583	missense	2853	exon1			U65402	CCDS5299.1	6q27	2012-08-21				ENSG00000120436		"""GPCR / Class A : Orphans"""	4486	protein-coding gene	gene with protein product	"""hydroxyeicosatetraenoic (HETE) acid receptor 1"", ""12-(S)-HETE acid receptor"""	602043				9205127, 21712392	Standard	NM_005299		Approved	HETER1, 12-HETER	uc011egq.2	O00270		ENST00000366834.1:c.806G>A	6.37:g.167570514C>T	ENSP00000355799:p.Ser269Asn	Somatic		Capture	SOLID	Phase_I	167490504	NM_005299	B0M0K2|Q4VBL3|Q9NQ20	Missense_Mutation	SNP	ENST00000366834.1	37	CCDS5299.1	.	.	.	.	.	.	.	.	.	.	C	15.65	2.895753	0.52121	.	.	ENSG00000120436	ENST00000366834	T	0.72282	-0.64	3.54	3.54	0.40534	GPCR, rhodopsin-like superfamily (1);	0.164448	0.28958	N	0.013593	T	0.75162	0.3812	M	0.81112	2.525	0.24455	N	0.99447	D	0.63046	0.992	P	0.61477	0.889	T	0.67169	-0.5738	10	0.42905	T	0.14	-37.0518	13.854	0.63515	0.0:1.0:0.0:0.0	.	269	O00270	GPR31_HUMAN	N	269	ENSP00000355799:S269N	ENSP00000355799:S269N	S	-	2	0	GPR31	167490504	0.994000	0.37717	0.835000	0.33067	0.187000	0.23431	1.743000	0.38258	1.811000	0.52892	0.313000	0.20887	AGC		GPR31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043111.1	NM_005299	
PSME3	10197	hgsc.bcm.edu	37	17	40990741	40990741	+	Intron	SNP	C	C	A			TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr17:40990741C>A	ENST00000590720.1	+	7	638				PSME3_ENST00000541124.1_Intron|PSME3_ENST00000592169.1_Intron|PSME3_ENST00000545225.1_Intron|PSME3_ENST00000441946.2_Intron|PSME3_ENST00000293362.3_Missense_Mutation_p.D146E			P61289	PSME3_HUMAN	proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of endopeptidase activity (GO:0010950)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome activator complex (GO:0008537)|proteasome complex (GO:0000502)	endopeptidase activator activity (GO:0061133)|MDM2/MDM4 family protein binding (GO:0097371)|p53 binding (GO:0002039)	p.D146E(1)		NS(1)|cervix(1)|large_intestine(3)|lung(1)	6		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		TATGTTTTGACCTCCAGGTCA	0.453																																					p.D146E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C438A	17						.						81.0	83.0	82.0					17																	40990741		2203	4300	6503	38244267	SO:0001627	intron_variant	10197	exon7			U11292	CCDS11442.1, CCDS45689.1, CCDS59290.1	17q12-q21	2004-02-17				ENSG00000131467		"""Proteasome (prosome, macropain) subunits"""	9570	protein-coding gene	gene with protein product		605129				7951316	Standard	NM_005789		Approved	Ki, PA28-gamma, REG-GAMMA, PA28G	uc002ibq.4	P61289		ENST00000590720.1:c.406-7C>A	17.37:g.40990741C>A		Somatic		Capture	SOLID	Phase_I	38244267	NM_176863	A8K9A3|O35563|P97373|Q12920|Q13172|Q9BQD9	Missense_Mutation	SNP	ENST00000590720.1	37	CCDS45689.1	.	.	.	.	.	.	.	.	.	.	C	13.55	2.270662	0.40194	.	.	ENSG00000131467	ENST00000293362	T	0.21361	2.01	5.04	-0.551	0.11822	.	1.665370	0.03485	N	0.215691	T	0.11665	0.0284	.	.	.	0.09310	N	1	B	0.15141	0.012	B	0.11329	0.006	T	0.21999	-1.0229	9	0.24483	T	0.36	-23.7537	2.2556	0.04054	0.1154:0.4155:0.2486:0.2205	.	146	P61289-2	.	E	146	ENSP00000293362:D146E	ENSP00000293362:D146E	D	+	3	2	PSME3	38244267	0.000000	0.05858	0.000000	0.03702	0.330000	0.28571	0.046000	0.14035	0.044000	0.15775	0.655000	0.94253	GAC		PSME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452430.1	NM_176863	
TP53	7157	hgsc.bcm.edu	37	17	7578265	7578265	+	Missense_Mutation	SNP	A	A	G			TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr17:7578265A>G	ENST00000269305.4	-	6	773	c.584T>C	c.(583-585)aTc>aCc	p.I195T	TP53_ENST00000359597.4_Missense_Mutation_p.I195T|TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Missense_Mutation_p.I195T|TP53_ENST00000445888.2_Missense_Mutation_p.I195T|TP53_ENST00000455263.2_Missense_Mutation_p.I195T|TP53_ENST00000420246.2_Missense_Mutation_p.I195T	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	195	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		I -> F (in sporadic cancers; somatic mutation).|I -> L (in a sporadic cancer; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:9450901}.|I -> V (in a sporadic cancer; somatic mutation).|I -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.I195T(69)|p.I195N(12)|p.I195S(10)|p.0?(8)|p.I195fs*14(5)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.I102S(2)|p.I102T(2)|p.I63T(2)|p.I63S(2)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.I102fs*14(1)|p.I195fs*12(1)|p.I195fs*50(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I63fs*14(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCCACTCGGATAAGATGCTG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.I195T	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,0	.	134	Substitution - Missense(99)|Whole gene deletion(8)|Insertion - Frameshift(7)|Deletion - In frame(6)|Complex - deletion inframe(6)|Unknown(5)|Deletion - Frameshift(2)|Complex - frameshift(1)	ovary(37)|breast(21)|large_intestine(18)|lung(10)|central_nervous_system(8)|biliary_tract(6)|haematopoietic_and_lymphoid_tissue(5)|skin(5)|stomach(4)|oesophagus(4)|bone(4)|endometrium(3)|urinary_tract(3)|upper_aerodigestive_tract(2)|liver(2)|pancreas(2)	c.T584C	17						.						100.0	89.0	93.0					17																	7578265		2203	4300	6503	7518990	SO:0001583	missense	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.584T>C	17.37:g.7578265A>G	ENSP00000269305:p.Ile195Thr	Somatic		Capture	SOLID	Phase_I	7518990	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	13.73	2.324656	0.41197	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99823	-6.95;-6.95;-6.95;-6.95;-6.95;-6.95;-6.95;-6.95	5.41	3.21	0.36854	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.103171	0.64402	N	0.000004	D	0.99785	0.9910	M	0.90019	3.08	0.52099	D	0.999943	D;D;D;D;D;D;D	0.89917	1.0;0.999;0.991;0.989;0.998;0.997;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.995;0.953;0.979;0.995;0.993;0.996	D	0.98429	1.0581	10	0.87932	D	0	-18.4587	8.2743	0.31864	0.8356:0.0:0.1644:0.0	.	156;195;195;102;195;195;195	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	T	195;195;195;195;195;195;184;102;63;102;63	ENSP00000410739:I195T;ENSP00000352610:I195T;ENSP00000269305:I195T;ENSP00000398846:I195T;ENSP00000391127:I195T;ENSP00000391478:I195T;ENSP00000425104:I63T;ENSP00000423862:I102T	ENSP00000269305:I195T	I	-	2	0	TP53	7518990	1.000000	0.71417	0.946000	0.38457	0.026000	0.11368	9.287000	0.95975	0.456000	0.26937	-0.256000	0.11100	ATC		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
RUNDC1	146923	hgsc.bcm.edu	37	17	41142452	41142452	+	Splice_Site	SNP	A	A	G			TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr17:41142452A>G	ENST00000361677.1	+	4	987	c.975A>G	c.(973-975)aaA>aaG	p.K325K		NM_173079.2	NP_775102	Q96C34	RUND1_HUMAN	RUN domain containing 1	325								p.K325K(1)		breast(1)|large_intestine(2)|lung(4)|prostate(1)	8		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.161)		GAAACAGCAAAAGTAAGTGCA	0.522																																					p.K325K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A975G	17						.						63.0	64.0	64.0					17																	41142452		2203	4300	6503	38395978	SO:0001630	splice_region_variant	146923	exon4			AL831813	CCDS11448.1	17q21.31	2004-02-27				ENSG00000198863			25418	protein-coding gene	gene with protein product						12477932	Standard	NM_173079		Approved	DKFZp761H0421	uc002ici.1	Q96C34		ENST00000361677.1:c.976+1A>G	17.37:g.41142452A>G		Somatic		Capture	SOLID	Phase_I	38395978	NM_173079	Q6Y2K8|Q8IXT9|Q8N3W1	Silent	SNP	ENST00000361677.1	37	CCDS11448.1																																																																																				RUNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452464.1	NM_173079	Silent
NDE1	54820	hgsc.bcm.edu	37	16	15790583	15790583	+	Silent	SNP	C	C	T	rs534864382		TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr16:15790583C>T	ENST00000396353.2	+	9	1639	c.813C>T	c.(811-813)ctC>ctT	p.L271L	NDE1_ENST00000396355.1_Silent_p.L271L|NDE1_ENST00000396354.1_Silent_p.L271L|NDE1_ENST00000342673.5_Silent_p.L271L			Q9NXR1	NDE1_HUMAN	nudE neurodevelopment protein 1	271	Interaction with CENPF. {ECO:0000250}.				centrosome duplication (GO:0051298)|cerebral cortex development (GO:0021987)|establishment of chromosome localization (GO:0051303)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|neuroblast proliferation (GO:0007405)|neuron migration (GO:0001764)|vesicle transport along microtubule (GO:0047496)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole centrosome (GO:0031616)	microtubule binding (GO:0008017)	p.L271L(1)		endometrium(3)|kidney(3)|large_intestine(1)|lung(5)|ovary(1)	13						AGTCCAAACTCGCTTCCTGCC	0.542																																					p.L271L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C813T	16						.						82.0	83.0	83.0					16																	15790583		2197	4300	6497	15698084	SO:0001819	synonymous_variant	54820	exon8			AF124431	CCDS10564.1	16p13.11	2013-08-06	2013-08-06		ENSG00000072864	ENSG00000072864			17619	protein-coding gene	gene with protein product		609449	"""nudE nuclear distribution gene E homolog 1 (A. nidulans)"", ""nudE nuclear distribution E homolog 1 (A. nidulans)"""			10940388, 12427674	Standard	NM_017668		Approved	nudE, FLJ20101, NDE	uc002dds.3	Q9NXR1	OTTHUMG00000129885	ENST00000396353.2:c.813C>T	16.37:g.15790583C>T		Somatic		Capture	SOLID	Phase_I	15698084	NM_017668	Q49AQ2	Silent	SNP	ENST00000396353.2	37																																																																																					NDE1-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017668	
CES5A	221223	hgsc.bcm.edu	37	16	55907805	55907805	+	Missense_Mutation	SNP	G	G	A	rs570591787	byFrequency	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr16:55907805G>A	ENST00000290567.9	-	2	339	c.218C>T	c.(217-219)aCg>aTg	p.T73M	CES5A_ENST00000521992.1_Missense_Mutation_p.T102M|CES5A_ENST00000319165.9_Missense_Mutation_p.T73M|CES5A_ENST00000518005.1_De_novo_Start_OutOfFrame|CES5A_ENST00000520435.1_Missense_Mutation_p.T73M|CES5A_ENST00000541580.1_Intron	NM_001143685.1	NP_001137157.1	Q6NT32	EST5A_HUMAN	carboxylesterase 5A	73						extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)	p.T73M(1)		breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						CTGCGGGTTCGTAAATCGCAG	0.587													G|||	4	0.000798722	0.0	0.0	5008	,	,		18885	0.0		0.0	False		,,,				2504	0.0041				p.T73M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C218T	16						.						75.0	69.0	71.0					16																	55907805		2198	4300	6498	54465306	SO:0001583	missense	221223	exon2			AK090997	CCDS10755.1, CCDS45490.1, CCDS54012.1	16q13	2010-10-12	2010-10-12	2010-10-12	ENSG00000159398	ENSG00000159398	3.1.1.1	"""Carboxylesterases"""	26459	protein-coding gene	gene with protein product			"""carboxylesterase 7"""	CES7		20931200	Standard	NM_145024		Approved	FLJ31547, CES4C1, CES5, CAUXIN	uc021tir.1	Q6NT32	OTTHUMG00000133236	ENST00000290567.9:c.218C>T	16.37:g.55907805G>A	ENSP00000290567:p.Thr73Met	Somatic		Capture	SOLID	Phase_I	54465306	NM_001143685	B7Z252|B7ZLB6|Q8NBC8|Q96DN9	Missense_Mutation	SNP	ENST00000290567.9	37	CCDS45490.1	.	.	.	.	.	.	.	.	.	.	g	16.13	3.037076	0.54896	.	.	ENSG00000159398	ENST00000521992;ENST00000319165;ENST00000290567;ENST00000520435	T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24	5.7	2.6	0.31112	Carboxylesterase, type B (1);	1.461070	0.04463	N	0.374715	T	0.62356	0.2421	N	0.11154	0.105	0.09310	N	1	D;D	0.65815	0.995;0.964	P;B	0.55545	0.778;0.417	T	0.55464	-0.8137	10	0.62326	D	0.03	.	8.3591	0.32348	0.0738:0.0:0.6368:0.2894	.	73;73	Q6NT32;Q6NT32-2	EST5A_HUMAN;.	M	102;73;73;73	ENSP00000428864:T102M;ENSP00000324271:T73M;ENSP00000290567:T73M;ENSP00000428887:T73M	ENSP00000290567:T73M	T	-	2	0	CES5A	54465306	0.769000	0.28531	0.001000	0.08648	0.001000	0.01503	2.418000	0.44662	0.394000	0.25230	-0.119000	0.15052	ACG		CES5A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256975.3	NM_145024	
MYL6B	140465	hgsc.bcm.edu	37	12	56549214	56549214	+	Silent	SNP	C	C	A	rs149424698		TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr12:56549214C>A	ENST00000553066.1	+	5	780	c.358C>A	c.(358-360)Cgg>Agg	p.R120R	MYL6_ENST00000536128.1_5'Flank|MYL6B_ENST00000550443.1_Silent_p.R120R|MYL6_ENST00000293422.5_5'Flank|MYL6B_ENST00000207437.5_Silent_p.R120R|MYL6_ENST00000548580.1_5'Flank|MYL6_ENST00000548293.1_5'Flank|MYL6_ENST00000551589.1_5'Flank|MYL6_ENST00000348108.4_5'Flank|MYL6_ENST00000547408.1_5'Flank|MYL6_ENST00000549017.1_5'Flank|MYL6_ENST00000549566.1_5'Flank|MYL6_ENST00000550697.1_5'Flank|MYL6_ENST00000548400.1_5'Flank|MYL6B_ENST00000550152.1_3'UTR|MYL6B_ENST00000552568.1_Silent_p.R120R|RP11-603J24.14_ENST00000548731.1_RNA|MYL6_ENST00000547649.1_5'Flank			P14649	MYL6B_HUMAN	myosin, light chain 6B, alkali, smooth muscle and non-muscle	120					metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle tissue development (GO:0007519)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|unconventional myosin complex (GO:0016461)	calcium ion binding (GO:0005509)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)	p.R120R(1)		endometrium(2)|kidney(1)|large_intestine(4)	7			OV - Ovarian serous cystadenocarcinoma(18;0.0979)			GCTGAAGTCGCGGCGTGTGGA	0.522																																					p.R120R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C358A	12						.						100.0	98.0	99.0					12																	56549214		2203	4300	6503	54835481	SO:0001819	synonymous_variant	140465	exon5			M31211	CCDS8905.1	12q13.2	2013-01-10	2006-09-29			ENSG00000196465		"""Myosins / Light chain"", ""EF-hand domain containing"""	29823	protein-coding gene	gene with protein product	"""myosin light chain 1 slow a"""	609930	"""myosin, light polypeptide 6B, alkali, smooth muscle and non-muscle"""			2602161, 2304459	Standard	NM_002475		Approved	MLC1SA	uc001sjs.3	P14649		ENST00000553066.1:c.358C>A	12.37:g.56549214C>A		Somatic		Capture	SOLID	Phase_I	54835481	NM_001199629		Silent	SNP	ENST00000553066.1	37	CCDS8905.1																																																																																				MYL6B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407920.2	NM_002475	
ADAMTS17	170691	hgsc.bcm.edu	37	15	100594247	100594247	+	Missense_Mutation	SNP	G	G	A	rs143817747	byFrequency	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr15:100594247G>A	ENST00000268070.4	-	16	2255	c.2150C>T	c.(2149-2151)tCg>tTg	p.S717L		NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	717	Spacer.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.S717L(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		CCCCTTACCCGAGTCTTTGAG	0.532													G|||	3	0.000599042	0.0	0.0	5008	,	,		17330	0.0		0.003	False		,,,				2504	0.0				p.S717L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2150T	15						.	G	LEU/SER	0,4406		0,0,2203	106.0	111.0	109.0		2150	5.0	0.4	15	dbSNP_134	109	8,8592	5.7+/-21.5	0,8,4292	yes	missense	ADAMTS17	NM_139057.2	145	0,8,6495	AA,AG,GG		0.093,0.0,0.0615	benign	717/1096	100594247	8,12998	2203	4300	6503	98411770	SO:0001583	missense	170691	exon16			AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.2150C>T	15.37:g.100594247G>A	ENSP00000268070:p.Ser717Leu	Somatic		Capture	SOLID	Phase_I	98411770	NM_139057	Q2I7G4|Q6ZN75	Missense_Mutation	SNP	ENST00000268070.4	37	CCDS10383.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	G	19.53	3.844130	0.71488	0.0	9.3E-4	ENSG00000140470	ENST00000268070	T	0.52983	0.64	5.97	5.04	0.67666	ADAM-TS Spacer 1 (1);	0.147808	0.44902	D	0.000403	T	0.39226	0.1070	L	0.33668	1.02	0.50039	D	0.999847	D	0.53151	0.958	B	0.41917	0.37	T	0.15492	-1.0435	10	0.27785	T	0.31	.	16.5202	0.84312	0.0:0.0:0.868:0.132	.	717	Q8TE56	ATS17_HUMAN	L	717	ENSP00000268070:S717L	ENSP00000268070:S717L	S	-	2	0	ADAMTS17	98411770	1.000000	0.71417	0.435000	0.26784	0.881000	0.50899	9.235000	0.95353	1.511000	0.48818	0.655000	0.94253	TCG		ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313595.1	NM_139057	
NOP14	8602	hgsc.bcm.edu	37	4	2940562	2940562	+	Missense_Mutation	SNP	T	T	C			TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr4:2940562T>C	ENST00000314262.6	-	18	2618	c.2570A>G	c.(2569-2571)aAa>aGa	p.K857R	NOP14_ENST00000502735.1_Intron|NOP14_ENST00000416614.2_Missense_Mutation_p.K857R|NOP14_ENST00000398071.4_Intron|NOP14-AS1_ENST00000507702.1_RNA|NOP14-AS1_ENST00000515194.1_RNA|NOP14_ENST00000507120.1_Intron|NOP14-AS1_ENST00000512802.1_RNA|NOP14-AS1_ENST00000505731.1_RNA|NOP14-AS1_ENST00000503709.1_RNA|NOP14-AS1_ENST00000512712.2_RNA|NOP14-AS1_ENST00000507999.1_RNA	NM_003703.1	NP_003694.1	P78316	NOP14_HUMAN	NOP14 nucleolar protein	857					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|membrane (GO:0016020)|mitochondrion (GO:0005739)|Noc4p-Nop14p complex (GO:0030692)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			NS(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	30						TGTAATTTATTTTTTGAACTT	0.433																																					p.K857R												.	.	0			c.A2570G	4						.						96.0	105.0	102.0					4																	2940562		2203	4300	6503	2910360	SO:0001583	missense	8602	exon18			AB000467	CCDS33945.1	4p16.3	2012-12-10	2012-12-10	2008-10-13	ENSG00000087269	ENSG00000087269			16821	protein-coding gene	gene with protein product	"""NOP14 homolog (S. cerevisiae)"""	611526	"""chromosome 4 open reading frame 9"", ""nucleolar protein 14"", ""nucleolar protein 14 homolog (yeast)"", ""NOP14 nucleolar protein homolog (yeast)"""	C4orf9, NOL14		9734812, 11694595	Standard	XR_241655		Approved	RES4-25, UTP2	uc003ggj.1	P78316	OTTHUMG00000159911	ENST00000314262.6:c.2570A>G	4.37:g.2940562T>C	ENSP00000315674:p.Lys857Arg	Somatic		Capture	SOLID	Phase_I	2910360	NM_003703	D3DVR6|Q7LGI5|Q7Z6K0|Q8TBR6	Missense_Mutation	SNP	ENST00000314262.6	37	CCDS33945.1	.	.	.	.	.	.	.	.	.	.	T	11.25	1.583320	0.28268	.	.	ENSG00000087269	ENST00000416614;ENST00000314262	T;T	0.32988	1.43;1.43	5.16	1.42	0.22433	.	0.314985	0.29900	N	0.010909	T	0.16896	0.0406	N	0.21282	0.65	0.53688	D	0.999973	B	0.09022	0.002	B	0.09377	0.004	T	0.06917	-1.0800	10	0.87932	D	0	.	3.9293	0.09278	0.1453:0.2407:0.0:0.614	.	857	P78316	NOP14_HUMAN	R	857	ENSP00000405068:K857R;ENSP00000315674:K857R	ENSP00000315674:K857R	K	-	2	0	NOP14	2910360	0.601000	0.26907	0.078000	0.20375	0.409000	0.31022	0.378000	0.20569	0.024000	0.15214	0.533000	0.62120	AAA		NOP14-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000358135.2	NM_003703	
CAPN6	827	hgsc.bcm.edu	37	X	110496397	110496397	+	Missense_Mutation	SNP	T	T	G			TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chrX:110496397T>G	ENST00000324068.1	-	4	512	c.345A>C	c.(343-345)gaA>gaC	p.E115D	CAPN6_ENST00000541758.1_5'UTR	NM_014289.3	NP_055104.2	Q9Y6Q1	CAN6_HUMAN	calpain 6	115	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				microtubule bundle formation (GO:0001578)|proteolysis (GO:0006508)|regulation of cytoskeleton organization (GO:0051493)	perinuclear region of cytoplasm (GO:0048471)|spindle microtubule (GO:0005876)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|microtubule binding (GO:0008017)	p.E115D(1)		cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(25)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	47						CAGCGTATTTTTCTGTTTTTT	0.408																																					p.E115D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A345C	X						.						106.0	102.0	103.0					X																	110496397		2203	4300	6503	110383053	SO:0001583	missense	827	exon4			AF029232	CCDS14555.1	Xq23	2008-07-29			ENSG00000077274	ENSG00000077274			1483	protein-coding gene	gene with protein product		300146				9503024, 9339374	Standard	NM_014289		Approved	CAPNX, CalpM, CANPX	uc004epc.2	Q9Y6Q1	OTTHUMG00000022203	ENST00000324068.1:c.345A>C	X.37:g.110496397T>G	ENSP00000317214:p.Glu115Asp	Somatic		Capture	SOLID	Phase_I	110383053	NM_014289	D3DUY7|Q9UEQ1|Q9UJA8	Missense_Mutation	SNP	ENST00000324068.1	37	CCDS14555.1	.	.	.	.	.	.	.	.	.	.	t	3.849	-0.032208	0.07543	.	.	ENSG00000077274	ENST00000324068	D	0.88975	-2.45	5.97	-2.76	0.05896	Peptidase C2, calpain, catalytic domain (3);	0.461885	0.25101	N	0.033121	T	0.73598	0.3607	L	0.28115	0.83	0.44012	D	0.996723	B	0.06786	0.001	B	0.12156	0.007	T	0.50947	-0.8767	10	0.15499	T	0.54	.	2.8905	0.05675	0.1811:0.4832:0.1541:0.1816	.	115	Q9Y6Q1	CAN6_HUMAN	D	115	ENSP00000317214:E115D	ENSP00000317214:E115D	E	-	3	2	CAPN6	110383053	0.989000	0.36119	0.987000	0.45799	0.941000	0.58515	0.363000	0.20301	-0.545000	0.06224	-0.320000	0.08662	GAA		CAPN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057922.1		
RFTN2	130132	hgsc.bcm.edu	37	2	198495825	198495825	+	Missense_Mutation	SNP	G	G	C			TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr2:198495825G>C	ENST00000295049.4	-	5	1374	c.838C>G	c.(838-840)Ctt>Gtt	p.L280V		NM_144629.2	NP_653230.2	Q52LD8	RFTN2_HUMAN	raftlin family member 2	280					dsRNA transport (GO:0033227)|response to exogenous dsRNA (GO:0043330)	plasma membrane (GO:0005886)		p.L280V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(13)|urinary_tract(3)	30						TCAGCATCAAGTGTACTAATG	0.358																																					p.L280V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C838G	2						.						95.0	83.0	87.0					2																	198495825		2203	4300	6503	198204070	SO:0001583	missense	130132	exon5			AK055136	CCDS2323.1	2q33.1	2008-02-05	2006-09-28	2006-09-28	ENSG00000162944	ENSG00000162944			26402	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 11"""	C2orf11			Standard	NM_144629		Approved	FLJ30574, Raftlin-2	uc002uuo.4	Q52LD8	OTTHUMG00000132746	ENST00000295049.4:c.838C>G	2.37:g.198495825G>C	ENSP00000295049:p.Leu280Val	Somatic		Capture	SOLID	Phase_I	198204070	NM_144629	Q14DH4|Q2TA69|Q53QE0|Q53SE1|Q96NM3	Missense_Mutation	SNP	ENST00000295049.4	37	CCDS2323.1	.	.	.	.	.	.	.	.	.	.	G	16.95	3.263837	0.59431	.	.	ENSG00000162944	ENST00000295049	T	0.58652	0.32	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.69160	0.3080	L	0.60455	1.87	0.53688	D	0.999979	D	0.69078	0.997	D	0.64042	0.921	T	0.71404	-0.4603	10	0.87932	D	0	-19.4651	12.1565	0.54081	0.0786:0.0:0.9214:0.0	.	280	Q52LD8	RFTN2_HUMAN	V	280	ENSP00000295049:L280V	ENSP00000295049:L280V	L	-	1	0	RFTN2	198204070	1.000000	0.71417	0.954000	0.39281	0.734000	0.41952	5.566000	0.67372	2.691000	0.91804	0.655000	0.94253	CTT		RFTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256106.2	NM_144629	
PTPRN	5798	hgsc.bcm.edu	37	2	220159774	220159774	+	Silent	SNP	C	C	T			TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr2:220159774C>T	ENST00000295718.2	-	19	2838	c.2598G>A	c.(2596-2598)acG>acA	p.T866T	MIR153-1_ENST00000384914.1_RNA|PTPRN_ENST00000409251.3_Silent_p.T837T|PTPRN_ENST00000497977.1_Intron|PTPRN_ENST00000423636.2_Silent_p.T776T	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	866	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.T866T(1)		breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		ACTGCGTGAGCGTGCGCGTCT	0.682																																					p.T776T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2328A	2						.						45.0	50.0	48.0					2																	220159774		2203	4300	6503	219868018	SO:0001819	synonymous_variant	5798	exon19				CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.2598G>A	2.37:g.220159774C>T		Somatic		Capture	SOLID	Phase_I	219868018	NM_001199764	B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Silent	SNP	ENST00000295718.2	37	CCDS2440.1	.	.	.	.	.	.	.	.	.	.	C	12.12	1.843079	0.32606	.	.	ENSG00000054356	ENST00000443981	.	.	.	5.2	-1.51	0.08664	.	.	.	.	.	T	0.42517	0.1206	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.29027	-1.0025	4	.	.	.	.	3.37	0.07217	0.197:0.1932:0.4605:0.1494	.	.	.	.	H	69	.	.	R	-	2	0	PTPRN	219868018	0.745000	0.28261	0.995000	0.50966	0.998000	0.95712	-0.232000	0.09055	-0.153000	0.11137	0.650000	0.86243	CGC		PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256819.2		
UBAC1	10422	hgsc.bcm.edu	37	9	138836916	138836916	+	Silent	SNP	G	G	A			TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr9:138836916G>A	ENST00000371756.3	-	7	1051	c.834C>T	c.(832-834)ttC>ttT	p.F278F	UBAC1_ENST00000465873.1_5'UTR	NM_016172.2	NP_057256.2	Q9BSL1	UBAC1_HUMAN	UBA domain containing 1	278					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)		p.F278F(1)		NS(1)|biliary_tract(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(6)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	25		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.1e-06)|Epithelial(140;7.79e-06)		GGATCTTCTTGAAGATTTCCG	0.627																																					p.F278F	NSCLC(78;973 1398 27381 29552 42415)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C834T	9						.						155.0	137.0	143.0					9																	138836916		2203	4300	6503	137976737	SO:0001819	synonymous_variant	10422	exon7			AF176796	CCDS35177.1	9q34.3	2008-02-05	2007-04-20	2007-04-20	ENSG00000130560	ENSG00000130560			30221	protein-coding gene	gene with protein product		608129	"""ubiquitin associated domain containing 1"""	UBADC1		10857748, 8619474	Standard	NM_016172		Approved	GBDR1	uc004cgt.3	Q9BSL1	OTTHUMG00000020920	ENST00000371756.3:c.834C>T	9.37:g.138836916G>A		Somatic		Capture	SOLID	Phase_I	137976737	NM_016172	O75500|Q9UMW7	Silent	SNP	ENST00000371756.3	37	CCDS35177.1																																																																																				UBAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055034.1	NM_016172	
UBAC1	10422	hgsc.bcm.edu	37	9	138836919	138836919	+	Silent	SNP	G	G	A			TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr9:138836919G>A	ENST00000371756.3	-	7	1048	c.831C>T	c.(829-831)atC>atT	p.I277I	UBAC1_ENST00000465873.1_5'UTR	NM_016172.2	NP_057256.2	Q9BSL1	UBAC1_HUMAN	UBA domain containing 1	277					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)		p.I277I(1)		NS(1)|biliary_tract(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(6)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	25		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.1e-06)|Epithelial(140;7.79e-06)		TCTTCTTGAAGATTTCCGTCA	0.617																																					p.I277I	NSCLC(78;973 1398 27381 29552 42415)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C831T	9						.						158.0	139.0	145.0					9																	138836919		2203	4300	6503	137976740	SO:0001819	synonymous_variant	10422	exon7			AF176796	CCDS35177.1	9q34.3	2008-02-05	2007-04-20	2007-04-20	ENSG00000130560	ENSG00000130560			30221	protein-coding gene	gene with protein product		608129	"""ubiquitin associated domain containing 1"""	UBADC1		10857748, 8619474	Standard	NM_016172		Approved	GBDR1	uc004cgt.3	Q9BSL1	OTTHUMG00000020920	ENST00000371756.3:c.831C>T	9.37:g.138836919G>A		Somatic		Capture	SOLID	Phase_I	137976740	NM_016172	O75500|Q9UMW7	Silent	SNP	ENST00000371756.3	37	CCDS35177.1																																																																																				UBAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055034.1	NM_016172	
CLN5	1203	hgsc.bcm.edu	37	13	77570154	77570154	+	Missense_Mutation	SNP	A	A	G			TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr13:77570154A>G	ENST00000377453.3	+	3	1896	c.604A>G	c.(604-606)Atg>Gtg	p.M202V	CLN5_ENST00000485938.1_3'UTR	NM_006493.2	NP_006484.1	O75503	CLN5_HUMAN	ceroid-lipofuscinosis, neuronal 5	153					brain development (GO:0007420)|cell death (GO:0008219)|glycosylation (GO:0070085)|lysosomal lumen acidification (GO:0007042)|neurogenesis (GO:0022008)|neuron maturation (GO:0042551)|protein catabolic process (GO:0030163)|signal peptide processing (GO:0006465)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|vacuolar lumen (GO:0005775)	mannose binding (GO:0005537)	p.M202V(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	16		Acute lymphoblastic leukemia(28;0.205)		GBM - Glioblastoma multiforme(99;0.0503)		CCGACCTGAAATGGATGCCCC	0.428																																					p.M202V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A604G	13						.						180.0	164.0	169.0					13																	77570154		2203	4300	6503	76468155	SO:0001583	missense	1203	exon3				CCDS9456.1	13q21.2-q32	2014-09-17			ENSG00000102805	ENSG00000102805			2076	protein-coding gene	gene with protein product		608102				7942847, 8661106	Standard	NM_006493		Approved		uc001vkc.3	O75503	OTTHUMG00000017100	ENST00000377453.3:c.604A>G	13.37:g.77570154A>G	ENSP00000366673:p.Met202Val	Somatic		Capture	SOLID	Phase_I	76468155	NM_006493	B3KQK7	Missense_Mutation	SNP	ENST00000377453.3	37	CCDS9456.1	.	.	.	.	.	.	.	.	.	.	A	8.491	0.862124	0.17178	.	.	ENSG00000102805	ENST00000377453;ENST00000541907;ENST00000535238	D	0.87809	-2.3	5.54	4.33	0.51752	.	0.320592	0.41396	N	0.000889	T	0.77315	0.4112	L	0.38838	1.175	0.80722	D	1	B	0.13594	0.008	B	0.12156	0.007	T	0.65129	-0.6243	10	0.08179	T	0.78	-4.5739	8.2022	0.31432	0.7958:0.1338:0.0705:0.0	.	153	O75503	CLN5_HUMAN	V	202;153;68	ENSP00000366673:M202V	ENSP00000366673:M202V	M	+	1	0	CLN5	76468155	0.437000	0.25593	0.995000	0.50966	0.974000	0.67602	1.111000	0.31159	0.901000	0.36495	0.460000	0.39030	ATG		CLN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045318.1	NM_006493	
APC	324	hgsc.bcm.edu	37	5	112175171	112175171	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr5:112175171C>T	ENST00000457016.1	+	16	4260	c.3880C>T	c.(3880-3882)Cag>Tag	p.Q1294*	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.Q1294*|APC_ENST00000508376.2_Nonsense_Mutation_p.Q1294*			P25054	APC_HUMAN	adenomatous polyposis coli	1294	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q1294*(11)|p.T1293fs*2(1)|p.Q1294fs*6(1)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCAGACGACACAGGAAGCAGA	0.383		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q1276X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,right,Substitution - Nonsense,0	.	15	Substitution - Nonsense(11)|Deletion - Frameshift(3)|Unknown(1)	large_intestine(13)|soft_tissue(1)|skin(1)	c.C3826T	5	GRCh37	CM930027	APC	M		.						55.0	57.0	56.0					5																	112175171		2202	4300	6502	112203070	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3880C>T	5.37:g.112175171C>T	ENSP00000413133:p.Gln1294*	Somatic		Capture	SOLID	Phase_I	112203070	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	38	6.839479	0.97877	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.73	4.85	0.62838	.	0.122222	0.53938	D	0.000054	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-3.559	13.8243	0.63342	0.2784:0.7216:0.0:0.0	.	.	.	.	X	1294	.	.	Q	+	1	0	APC	112203070	0.993000	0.37304	1.000000	0.80357	0.962000	0.63368	2.731000	0.47343	1.533000	0.49186	0.655000	0.94253	CAG		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
SPARC	6678	hgsc.bcm.edu	37	5	151045924	151045924	+	Silent	SNP	G	G	A			TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr5:151045924G>A	ENST00000231061.4	-	8	1045	c.732C>T	c.(730-732)gaC>gaT	p.D244D	SPARC_ENST00000537849.1_5'Flank	NM_003118.3	NP_003109.1	P09486	SPRC_HUMAN	secreted protein, acidic, cysteine-rich (osteonectin)	244					blood coagulation (GO:0007596)|bone development (GO:0060348)|cellular response to growth factor stimulus (GO:0071363)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|inner ear development (GO:0048839)|lung development (GO:0030324)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of endothelial cell migration (GO:0010595)|regulation of cell morphogenesis (GO:0022604)|response to cadmium ion (GO:0046686)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to gravity (GO:0009629)|response to L-ascorbic acid (GO:0033591)|response to lead ion (GO:0010288)|response to lipopolysaccharide (GO:0032496)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nuclear matrix (GO:0016363)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|platelet alpha granule membrane (GO:0031092)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)	p.D244D(1)		central_nervous_system(3)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	15		Medulloblastoma(196;0.109)|all_hematologic(541;0.122)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)	OV - Ovarian serous cystadenocarcinoma(192;0.00118)		GGTCTTACCCGTCAATGGGGT	0.572																																					p.D244D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C732T	5						.						77.0	72.0	74.0					5																	151045924		2203	4300	6503	151026117	SO:0001819	synonymous_variant	6678	exon8				CCDS4318.1	5q31-q33	2012-10-02			ENSG00000113140	ENSG00000113140			11219	protein-coding gene	gene with protein product	"""cysteine-rich protein"", ""osteonectin"""	182120		ON		2838412, 3410046	Standard	NM_003118		Approved		uc003lui.4	P09486	OTTHUMG00000130122	ENST00000231061.4:c.732C>T	5.37:g.151045924G>A		Somatic		Capture	SOLID	Phase_I	151026117	NM_003118	D3DQH9|Q6IBK4	Silent	SNP	ENST00000231061.4	37	CCDS4318.1																																																																																				SPARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252430.1	NM_003118	
SH3TC2	79628	hgsc.bcm.edu	37	5	148407482	148407482	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr5:148407482G>A	ENST00000515425.1	-	11	1914	c.1813C>T	c.(1813-1815)Cgt>Tgt	p.R605C	SH3TC2_ENST00000512049.1_Missense_Mutation_p.R598C|SH3TC2_ENST00000394358.2_Missense_Mutation_p.R490C|SH3TC2_ENST00000538184.1_Missense_Mutation_p.R152C|SH3TC2_ENST00000513340.1_5'Flank	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	605					cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)		p.R490C(1)|p.R605C(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTAGACTCACGGTCAGGCAGG	0.602																																					p.R605C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1813T	5						.						58.0	56.0	57.0					5																	148407482		2203	4300	6503	148387675	SO:0001583	missense	79628	exon11			AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.1813C>T	5.37:g.148407482G>A	ENSP00000423660:p.Arg605Cys	Somatic		Capture	SOLID	Phase_I	148387675	NM_024577	B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Missense_Mutation	SNP	ENST00000515425.1	37	CCDS4293.1	.	.	.	.	.	.	.	.	.	.	G	13.27	2.187842	0.38609	.	.	ENSG00000169247	ENST00000538184;ENST00000515425;ENST00000512049;ENST00000394358	T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25	6.04	3.18	0.36537	Tetratricopeptide-like helical (1);	0.499855	0.22258	N	0.062451	T	0.61837	0.2379	L	0.27053	0.805	0.24165	N	0.995649	B;D;D;D	0.69078	0.176;0.997;0.997;0.997	B;P;P;P	0.53360	0.01;0.614;0.724;0.614	T	0.55237	-0.8172	10	0.62326	D	0.03	.	10.6601	0.45698	0.1334:0.1211:0.7455:0.0	.	490;598;605;605	C9JLC3;Q14CC0;E9PDF1;Q8TF17	.;.;.;S3TC2_HUMAN	C	152;605;598;490	ENSP00000441427:R152C;ENSP00000423660:R605C;ENSP00000421860:R598C;ENSP00000377886:R490C	ENSP00000377886:R490C	R	-	1	0	SH3TC2	148387675	1.000000	0.71417	0.621000	0.29145	0.380000	0.30137	6.560000	0.73950	1.568000	0.49683	0.563000	0.77884	CGT		SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252186.2	NM_024577	
GPRIN1	114787	hgsc.bcm.edu	37	5	176026146	176026146	+	Silent	SNP	C	C	T	rs79403503|rs386695335	byFrequency	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AF-3400-01A-01W-0831-10	TCGA-AF-3400-10A-01W-0831-10	g.chr5:176026146C>T	ENST00000303991.4	-	2	867	c.690G>A	c.(688-690)ccG>ccA	p.P230P		NM_052899.2	NP_443131.2	Q7Z2K8	GRIN1_HUMAN	G protein regulated inducer of neurite outgrowth 1	230					neuron projection development (GO:0031175)	cell projection (GO:0042995)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCTCCTTCCTCGGTGACACTG	0.498																																					p.P230P												.	.	0			c.G690A	5						.						98.0	99.0	99.0					5																	176026146		2203	4299	6502	175958752	SO:0001819	synonymous_variant	114787	exon2			AB067480	CCDS4405.1	5q35.2	2008-02-05			ENSG00000169258	ENSG00000169258			24835	protein-coding gene	gene with protein product		611239				11572484	Standard	NM_052899		Approved	GRIN1, KIAA1893	uc003meo.1	Q7Z2K8	OTTHUMG00000130659	ENST00000303991.4:c.690G>A	5.37:g.176026146C>T		Somatic		Capture	SOLID	Phase_I	175958752	NM_052899	C9JM70|Q8ND74|Q96PZ4	Silent	SNP	ENST00000303991.4	37	CCDS4405.1																																																																																				GPRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253149.1	NM_052899	
