#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NUP35	129401	hgsc.bcm.edu	37	2	183993068	183993069	+	Frame_Shift_Ins	INS	-	-	C	rs146685934		TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	-	-	-	C	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr2:183993068_183993069insC	ENST00000295119.4	+	2	197_198	c.94_95insC	c.(94-96)gccfs	p.A32fs	NUP35_ENST00000497330.1_3'UTR|NUP35_ENST00000409798.1_Frame_Shift_Ins_p.A15fs|NUP35_ENST00000541912.1_5'UTR	NM_138285.3	NP_612142.2	Q8NFH5	NUP53_HUMAN	nucleoporin 35kDa	32					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.Q33fs*23(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)	8						AGGAGTTAATGCCCAGTTCTTA	0.426																																					p.A32fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.94_95insC	2						.																																			183701314	SO:0001589	frameshift_variant	129401	exon2			AF514993	CCDS2290.1, CCDS74614.1	2q32	2008-02-05			ENSG00000163002	ENSG00000163002			29797	protein-coding gene	gene with protein product		608140					Standard	XM_005246284		Approved	MP44	uc002upf.3	Q8NFH5	OTTHUMG00000132621	ENST00000295119.4:c.97dupC	2.37:g.183993071_183993071dupC	ENSP00000295119:p.Ala32fs	Somatic		Capture	SOLID	Phase_I	183701313	NM_138285	B4DP57|B4DYB4|Q4ZFZ9|Q53S95|Q8TDJ1	Frame_Shift_Ins	INS	ENST00000295119.4	37	CCDS2290.1																																																																																				NUP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255865.1	NM_138285	
LOXL3	84695	hgsc.bcm.edu	37	2	74763923	74763924	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr2:74763923_74763924insC	ENST00000264094.3	-	5	895_896	c.824_825insG	c.(823-825)ggcfs	p.G275fs	LOXL3_ENST00000409249.1_Frame_Shift_Ins_p.G275fs|LOXL3_ENST00000393937.2_Intron|LOXL3_ENST00000409549.1_Frame_Shift_Ins_p.G275fs|LOXL3_ENST00000409986.1_Intron|LOXL3_ENST00000484369.1_5'Flank	NM_032603.2	NP_115992.1	P58215	LOXL3_HUMAN	lysyl oxidase-like 3	275	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.				epithelial to mesenchymal transition (GO:0001837)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)	p.A277fs*57(1)		endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30						CCACTGCAGGGCCCCCCCCAGG	0.649																																					p.G275fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.825_826insG	2						.																																			74617432	SO:0001589	frameshift_variant	84695	exon5			AF282619	CCDS1953.1, CCDS74527.1	2p13	2008-05-23			ENSG00000115318	ENSG00000115318			13869	protein-coding gene	gene with protein product		607163				11386757	Standard	NM_032603		Approved		uc002smp.1	P58215	OTTHUMG00000129953	ENST00000264094.3:c.825dupG	2.37:g.74763931_74763931dupC	ENSP00000264094:p.Gly275fs	None		Capture	SOLID	Phase_I	74617431	NM_032603	D6W5J1|Q2EHP2|Q6IPL7|Q96RS1	Frame_Shift_Ins	INS	ENST00000264094.3	37	CCDS1953.1																																																																																				LOXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252215.1	NM_032603	
SETX	23064	hgsc.bcm.edu	37	9	135140105	135140106	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr9:135140105_135140106insA	ENST00000224140.5	-	26	7736_7737	c.7554_7555insT	c.(7552-7557)attactfs	p.T2519fs	SETX_ENST00000393220.1_Frame_Shift_Ins_p.T2486fs|SETX_ENST00000477049.1_5'UTR|SETX_ENST00000372169.2_Frame_Shift_Ins_p.T2548fs	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	2519					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.T2519fs*10(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		ACAGTAAGAGTAATTTCCTTGG	0.505																																					p.T2519fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.7555_7556insT	9						.																																			134129927	SO:0001589	frameshift_variant	23064	exon26			AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.7555dupT	9.37:g.135140107_135140107dupA	ENSP00000224140:p.Thr2519fs	Somatic		Capture	SOLID	Phase_I	134129926	NM_015046	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Frame_Shift_Ins	INS	ENST00000224140.5	37	CCDS6947.1																																																																																				SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3	NM_015046	
TGM2	7052	hgsc.bcm.edu	37	20	36776426	36776426	+	Silent	SNP	G	G	A	rs369157574		TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr20:36776426G>A	ENST00000361475.2	-	5	791	c.618C>T	c.(616-618)aaC>aaT	p.N206N	TGM2_ENST00000536701.1_Silent_p.N125N|TGM2_ENST00000536724.1_Silent_p.N146N	NM_004613.2|NM_198951.1	NP_004604.2|NP_945189.1	P21980	TGM2_HUMAN	transglutaminase 2	206					apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|branching involved in salivary gland morphogenesis (GO:0060445)|isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein homooligomerization (GO:0051260)|salivary gland cavitation (GO:0060662)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.N206N(1)		endometrium(2)|large_intestine(11)|liver(1)|lung(7)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Myeloproliferative disorder(115;0.00878)			L-Glutamine(DB00130)	CACGGCCGGCGTTCTTCAGGA	0.602																																					p.N206N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C618T	20						.	G	,	1,4405	2.1+/-5.4	0,1,2202	43.0	40.0	41.0		618,618	-3.4	0.0	20		41	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	TGM2	NM_004613.2,NM_198951.1	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	206/688,206/549	36776426	1,13005	2203	4300	6503	36209840	SO:0001819	synonymous_variant	7052	exon5			M98478	CCDS13302.1	20q12	2013-05-02	2013-05-02		ENSG00000198959	ENSG00000198959	2.3.2.13	"""Transglutaminases"""	11778	protein-coding gene	gene with protein product	"""C polypeptide, protein-glutamine-gamma-glutamyltransferase"""	190196	"""transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)"""			7912692, 11390390	Standard	NM_004613		Approved	TGC	uc002xhr.3	P21980	OTTHUMG00000032437	ENST00000361475.2:c.618C>T	20.37:g.36776426G>A		Somatic		Capture	SOLID	Phase_I	36209840	NM_198951	E1P5V9|Q16436|Q6B838|Q9BTN7|Q9UH35	Silent	SNP	ENST00000361475.2	37	CCDS13302.1																																																																																				TGM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079151.2	NM_198951	
ANKEF1	63926	hgsc.bcm.edu	37	20	10023852	10023852	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr20:10023852C>A	ENST00000378380.3	+	3	758	c.429C>A	c.(427-429)aaC>aaA	p.N143K	SNAP25-AS1_ENST00000603542.1_RNA|ANKEF1_ENST00000488991.1_3'UTR|ANKEF1_ENST00000378392.1_Missense_Mutation_p.N143K|SNAP25-AS1_ENST00000421143.2_RNA	NM_198798.1	NP_942093.1	Q9NU02	ANKE1_HUMAN	ankyrin repeat and EF-hand domain containing 1	143							calcium ion binding (GO:0005509)	p.N143K(1)									CAGATGTCAACAATTCTACCT	0.408																																					p.N143K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C429A	20						.						190.0	169.0	176.0					20																	10023852		2203	4300	6503	9971852	SO:0001583	missense	63926	exon3			AK025322	CCDS13108.1	20p12.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000132623	ENSG00000132623		"""EF-hand domain containing"", ""Ankyrin repeat domain containing"""	15803	protein-coding gene	gene with protein product			"""ankyrin repeat domain 5"""	ANKRD5		17142250	Standard	NM_022096		Approved	FLJ21669, dJ839B4.6	uc002wnp.3	Q9NU02	OTTHUMG00000031860	ENST00000378380.3:c.429C>A	20.37:g.10023852C>A	ENSP00000367631:p.Asn143Lys	Somatic		Capture	SOLID	Phase_I	9971852	NM_198798	B3KUQ0|Q9H6Y9	Missense_Mutation	SNP	ENST00000378380.3	37	CCDS13108.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.053028	0.75960	.	.	ENSG00000132623	ENST00000378392;ENST00000378380	T;T	0.58797	0.31;0.31	5.63	2.5	0.30297	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.73265	0.3565	M	0.84082	2.675	0.53688	D	0.999977	D	0.89917	1.0	D	0.91635	0.999	T	0.70992	-0.4721	9	.	.	.	-0.0278	8.0573	0.30612	0.0:0.6665:0.0:0.3335	.	143	Q9NU02	ANKR5_HUMAN	K	143	ENSP00000367644:N143K;ENSP00000367631:N143K	.	N	+	3	2	ANKRD5	9971852	1.000000	0.71417	0.989000	0.46669	0.942000	0.58702	2.287000	0.43505	0.251000	0.21505	0.655000	0.94253	AAC		ANKEF1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077968.2	NM_022096	
NCOA3	8202	hgsc.bcm.edu	37	20	46255826	46255826	+	Silent	SNP	A	A	G	rs141875108		TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr20:46255826A>G	ENST00000371998.3	+	6	629	c.438A>G	c.(436-438)caA>caG	p.Q146Q	NCOA3_ENST00000341724.6_Silent_p.Q146Q|NCOA3_ENST00000372004.3_Silent_p.Q146Q|NCOA3_ENST00000371997.3_Silent_p.Q146Q|NCOA3_ENST00000497292.1_3'UTR			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	146	PAS. {ECO:0000255|PROSITE- ProRule:PRU00140}.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.Q146Q(1)		breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						AATACCTGCAATATAAGCAAG	0.343																																					p.Q146Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A438G	20						.	A	,,,	0,4406		0,0,2203	135.0	126.0	129.0		438,438,438,438	-5.0	0.8	20	dbSNP_134	129	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	NCOA3	NM_001174087.1,NM_001174088.1,NM_006534.3,NM_181659.2	,,,	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	,,,	146/1424,146/1416,146/1421,146/1425	46255826	1,13005	2203	4300	6503	45689233	SO:0001819	synonymous_variant	8202	exon6			AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.438A>G	20.37:g.46255826A>G		Somatic		Capture	SOLID	Phase_I	45689233	NM_001174087	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Silent	SNP	ENST00000371998.3	37	CCDS13407.1																																																																																				NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	
KCNH5	27133	hgsc.bcm.edu	37	14	63473136	63473136	+	Silent	SNP	A	A	G			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr14:63473136A>G	ENST00000322893.7	-	3	520	c.252T>C	c.(250-252)acT>acC	p.T84T	KCNH5_ENST00000394968.1_Silent_p.T26T|KCNH5_ENST00000394964.2_Silent_p.T26T|KCNH5_ENST00000420622.2_Silent_p.T84T	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	84	PAS.				potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.T84T(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		AGTTGTCAAAAGTTTGCCTGA	0.343																																					p.T26T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T78C	14						.						106.0	103.0	104.0					14																	63473136		2202	4299	6501	62542889	SO:0001819	synonymous_variant	27133	exon3			U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.252T>C	14.37:g.63473136A>G		Somatic		Capture	SOLID	Phase_I	62542889	NM_172376	C9JP98	Silent	SNP	ENST00000322893.7	37	CCDS9756.1																																																																																				KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	NM_139318	
PPP1R36	145376	hgsc.bcm.edu	37	14	65035069	65035069	+	Missense_Mutation	SNP	A	A	G	rs149616368	byFrequency	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr14:65035069A>G	ENST00000298705.1	+	7	533	c.437A>G	c.(436-438)aAt>aGt	p.N146S	RP11-973N13.3_ENST00000556634.1_RNA|RP11-973N13.3_ENST00000554454.1_RNA	NM_172365.1	NP_758953.1	Q96LQ0	PPR36_HUMAN	protein phosphatase 1, regulatory subunit 36	146					negative regulation of phosphatase activity (GO:0010923)		phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)	p.N146S(1)									CCCCATAGGAATAAGAATCTT	0.308																																					p.N146S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A437G	14						.						50.0	49.0	50.0					14																	65035069		2202	4293	6495	64104822	SO:0001583	missense	145376	exon7				CCDS9767.1	14q23.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000165807	ENSG00000165807		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20097	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 50"""	C14orf50			Standard	NM_172365		Approved		uc001xhl.1	Q96LQ0	OTTHUMG00000141316	ENST00000298705.1:c.437A>G	14.37:g.65035069A>G	ENSP00000298705:p.Asn146Ser	Somatic		Capture	SOLID	Phase_I	64104822	NM_172365	Q6NTH6	Missense_Mutation	SNP	ENST00000298705.1	37	CCDS9767.1	.	.	.	.	.	.	.	.	.	.	A	12.70	2.015687	0.35606	.	.	ENSG00000165807	ENST00000298705;ENST00000557202	T;T	0.29142	1.58;1.58	5.87	4.73	0.59995	.	0.147056	0.48286	N	0.000191	T	0.25044	0.0608	L	0.56769	1.78	0.33349	D	0.570835	B	0.25667	0.131	B	0.20955	0.032	T	0.29027	-1.0025	10	0.09590	T	0.72	-21.2003	8.6299	0.33913	0.9136:0.0:0.0864:0.0	.	146	Q96LQ0	PPR36_HUMAN	S	146;13	ENSP00000298705:N146S;ENSP00000452491:N13S	ENSP00000298705:N146S	N	+	2	0	C14orf50	64104822	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	1.801000	0.38843	1.045000	0.40225	0.533000	0.62120	AAT		PPP1R36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280667.1	NM_172365	
GOLGA5	9950	hgsc.bcm.edu	37	14	93290963	93290963	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr14:93290963G>A	ENST00000163416.2	+	9	1949	c.1693G>A	c.(1693-1695)Gaa>Aaa	p.E565K	GOLGA5_ENST00000355976.2_Missense_Mutation_p.E565K	NM_005113.2	NP_005104	Q8TBA6	GOGA5_HUMAN	golgin A5	565					Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)	p.E565K(2)		large_intestine(6)|lung(1)|ovary(2)	9		all_cancers(154;0.0934)		COAD - Colon adenocarcinoma(157;0.222)		AGATCGAGACGAAGAAATTCA	0.343			T	RET	papillary thyroid																																p.E565K			Dom	yes		14	14q	9950	"""golgi autoantigen, golgin subfamily a, 5  (PTC5)"""		E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1693A	14						.						80.0	78.0	79.0					14																	93290963		2203	4300	6503	92360716	SO:0001583	missense	9950	exon9			AF085199	CCDS9905.1	14q32.12	2012-05-04	2010-02-12		ENSG00000066455	ENSG00000066455			4428	protein-coding gene	gene with protein product	"""golgi integral membrane protein 5"""	606918	"""golgi autoantigen, golgin subfamily a, 5"""			2734021, 9443391, 15004235	Standard	NM_005113		Approved	ret-II, golgin-84, rfg5, GOLIM5	uc001yaz.1	Q8TBA6	OTTHUMG00000171217	ENST00000163416.2:c.1693G>A	14.37:g.93290963G>A	ENSP00000163416:p.Glu565Lys	Somatic		Capture	SOLID	Phase_I	92360716	NM_005113	C9JRU1|O95287|Q03962|Q2TS49|Q9UQQ7	Missense_Mutation	SNP	ENST00000163416.2	37	CCDS9905.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.317533	0.81469	.	.	ENSG00000066455	ENST00000163416;ENST00000355976;ENST00000439315	T;T	0.44083	0.93;0.93	5.66	5.66	0.87406	.	0.307474	0.22867	N	0.054669	T	0.37320	0.0999	L	0.36672	1.1	0.58432	D	0.999997	B	0.21452	0.056	B	0.19391	0.025	T	0.11036	-1.0604	10	0.19590	T	0.45	-15.0819	20.1253	0.97977	0.0:0.0:1.0:0.0	.	565	Q8TBA6	GOGA5_HUMAN	K	565;565;474	ENSP00000163416:E565K;ENSP00000348252:E565K	ENSP00000163416:E565K	E	+	1	0	GOLGA5	92360716	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.527000	0.90594	2.832000	0.97577	0.655000	0.94253	GAA		GOLGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412365.1		
RSPH14	27156	hgsc.bcm.edu	37	22	23404020	23404020	+	Missense_Mutation	SNP	C	C	T	rs199729382	byFrequency	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr22:23404020C>T	ENST00000216036.4	-	6	953	c.757G>A	c.(757-759)Ggt>Agt	p.G253S		NM_014433.2	NP_055248.1	Q9UHP6	RTDR1_HUMAN		253								p.G253S(1)		breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	18	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.175)		ATCAGGGCACCGGCAGCGTTA	0.577													C|||	2	0.000399361	0.0015	0.0	5008	,	,		18175	0.0		0.0	False		,,,				2504	0.0				p.G253S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G757A	22						.	C	SER/GLY	2,4404	4.2+/-10.8	0,2,2201	99.0	73.0	82.0		757	4.8	0.8	22		82	1,8599	1.2+/-3.3	0,1,4299	yes	missense	RTDR1	NM_014433.2	56	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	probably-damaging	253/349	23404020	3,13003	2203	4300	6503	21734020	SO:0001583	missense	27156	exon6																														ENST00000216036.4:c.757G>A	22.37:g.23404020C>T	ENSP00000216036:p.Gly253Ser	Somatic		Capture	SOLID	Phase_I	21734020	NM_014433		Missense_Mutation	SNP	ENST00000216036.4	37	CCDS13803.1	.	.	.	.	.	.	.	.	.	.	C	17.01	3.278417	0.59758	4.54E-4	1.16E-4	ENSG00000100218	ENST00000216036	T	0.15718	2.4	4.77	4.77	0.60923	Armadillo-like helical (1);Armadillo-type fold (1);	0.116572	0.56097	D	0.000027	T	0.36082	0.0954	M	0.64404	1.975	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.03121	-1.1070	10	0.22109	T	0.4	-43.5576	13.6483	0.62294	0.0:1.0:0.0:0.0	.	253	Q9UHP6	RTDR1_HUMAN	S	253	ENSP00000216036:G253S	ENSP00000216036:G253S	G	-	1	0	RTDR1	21734020	0.970000	0.33590	0.845000	0.33349	0.005000	0.04900	5.136000	0.64783	2.389000	0.81357	0.462000	0.41574	GGT		RTDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319049.1		
DRG1	4733	hgsc.bcm.edu	37	22	31799071	31799071	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr22:31799071G>A	ENST00000331457.4	+	3	384	c.223G>A	c.(223-225)Gtg>Atg	p.V75M	DRG1_ENST00000433341.1_3'UTR	NM_004147.3	NP_004138.1	Q9Y295	DRG1_HUMAN	developmentally regulated GTP binding protein 1	75	OBG-type G. {ECO:0000255|PROSITE- ProRule:PRU01047}.				multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|polysome (GO:0005844)	GTP binding (GO:0005525)|identical protein binding (GO:0042802)|transcription factor binding (GO:0008134)	p.V75M(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|urinary_tract(1)	11						TTTTCCATCTGTGGGGAAGTC	0.453																																					p.V75M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G223A	22						.						233.0	207.0	216.0					22																	31799071		2203	4300	6503	30129071	SO:0001583	missense	4733	exon3			AJ005940	CCDS13897.1	22q12.2	2010-02-26	2001-11-28		ENSG00000185721	ENSG00000185721			3029	protein-coding gene	gene with protein product		603952	"""developmentally regulated GTP-binding protein 1"""	NEDD3		7929244, 1449490	Standard	NM_004147		Approved		uc003aku.3	Q9Y295	OTTHUMG00000030792	ENST00000331457.4:c.223G>A	22.37:g.31799071G>A	ENSP00000329715:p.Val75Met	Somatic		Capture	SOLID	Phase_I	30129071	NM_004147	B2RDS8|Q6FGP8|Q8WW69|Q9UGF2	Missense_Mutation	SNP	ENST00000331457.4	37	CCDS13897.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.605132	0.87157	.	.	ENSG00000185721	ENST00000331457	T	0.30714	1.52	5.06	5.06	0.68205	Small GTP-binding protein domain (1);GTP1/OBG (1);	0.057868	0.64402	D	0.000002	T	0.66066	0.2752	M	0.93898	3.47	0.80722	D	1	D	0.64830	0.994	D	0.67900	0.954	T	0.75855	-0.3170	10	0.87932	D	0	-17.1015	18.314	0.90213	0.0:0.0:1.0:0.0	.	75	Q9Y295	DRG1_HUMAN	M	75	ENSP00000329715:V75M	ENSP00000329715:V75M	V	+	1	0	DRG1	30129071	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.856000	0.92245	2.734000	0.93682	0.655000	0.94253	GTG		DRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075680.5	NM_004147	
PLA2G6	8398	hgsc.bcm.edu	37	22	38541454	38541454	+	Missense_Mutation	SNP	C	C	T	rs141825182	byFrequency	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr22:38541454C>T	ENST00000332509.3	-	3	599	c.416G>A	c.(415-417)cGt>cAt	p.R139H	PLA2G6_ENST00000436218.1_Missense_Mutation_p.R139H|PLA2G6_ENST00000335539.3_Missense_Mutation_p.R139H|PLA2G6_ENST00000402064.1_Missense_Mutation_p.R139H	NM_003560.2	NP_003551.2	O60733	PLPL9_HUMAN	phospholipase A2, group VI (cytosolic, calcium-independent)	139					cardiolipin acyl-chain remodeling (GO:0035965)|cardiolipin biosynthetic process (GO:0032049)|cell death (GO:0008219)|chemotaxis (GO:0006935)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phospholipid metabolic process (GO:0006644)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of ceramide biosynthetic process (GO:2000304)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of exocytosis (GO:0045921)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of vasodilation (GO:0045909)|regulation of store-operated calcium channel activity (GO:1901339)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|urinary bladder smooth muscle contraction (GO:0014832)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipase A2 activity (GO:0004623)	p.R139H(1)		breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|liver(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	24	Melanoma(58;0.045)				Quinacrine(DB01103)	CCTGATGATACGGCTGTGATG	0.602																																					p.R139H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G416A	22						.	C	HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	68.0	44.0	52.0		416,416,416	2.1	0.6	22	dbSNP_134	52	8,8592	6.4+/-24.3	0,8,4292	yes	missense,missense,missense	PLA2G6	NM_001004426.1,NM_001199562.1,NM_003560.2	29,29,29	0,8,6495	TT,TC,CC		0.093,0.0,0.0615	benign,benign,benign	139/753,139/753,139/807	38541454	8,12998	2203	4300	6503	36871400	SO:0001583	missense	8398	exon3			AF064594	CCDS13967.1, CCDS33645.1	22q13.1	2013-01-10			ENSG00000184381	ENSG00000184381	3.1.1.4	"""Patatin-like phospholipase domain containing"", ""Parkinson disease"", ""Ankyrin repeat domain containing"""	9039	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 2"""	603604				9417066, 16799181, 19029121	Standard	NM_001199562		Approved	iPLA2, PNPLA9, PARK14, iPLA2beta, NBIA2	uc003aux.1	O60733	OTTHUMG00000151246	ENST00000332509.3:c.416G>A	22.37:g.38541454C>T	ENSP00000333142:p.Arg139His	Somatic		Capture	SOLID	Phase_I	36871400	NM_001199562	A8K597|B0QYE8|O75645|Q8N452|Q9UG29|Q9UIT0|Q9Y671	Missense_Mutation	SNP	ENST00000332509.3	37	CCDS13967.1	.	.	.	.	.	.	.	.	.	.	C	13.21	2.169377	0.38315	0.0	9.3E-4	ENSG00000184381	ENST00000332509;ENST00000335539;ENST00000402064;ENST00000396860;ENST00000451461	T;T;T	0.63580	-0.05;0.0;0.0	5.3	2.09	0.27110	Ankyrin repeat-containing domain (1);	0.411187	0.29948	N	0.010797	T	0.31670	0.0804	N	0.03608	-0.345	0.09310	N	0.999993	B;B;B	0.15719	0.014;0.003;0.0	B;B;B	0.08055	0.003;0.003;0.001	T	0.17349	-1.0372	10	0.15499	T	0.54	-19.2822	8.1041	0.30874	0.0:0.676:0.0:0.324	.	139;139;139	B7Z6K3;O60733-2;O60733	.;.;PA2G6_HUMAN	H	139	ENSP00000333142:R139H;ENSP00000335149:R139H;ENSP00000386100:R139H	ENSP00000333142:R139H	R	-	2	0	PLA2G6	36871400	0.547000	0.26465	0.633000	0.29310	0.911000	0.54048	0.835000	0.27531	0.620000	0.30215	0.655000	0.94253	CGT		PLA2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321860.1	NM_001004426	
ILVBL	10994	hgsc.bcm.edu	37	19	15226087	15226087	+	Silent	SNP	G	G	A			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr19:15226087G>A	ENST00000263383.3	-	16	2014	c.1875C>T	c.(1873-1875)ttC>ttT	p.F625F	ILVBL_ENST00000534378.1_Silent_p.F518F	NM_006844.3	NP_006835.2	A1L0T0	ILVBL_HUMAN	ilvB (bacterial acetolactate synthase)-like	625						integral component of membrane (GO:0016021)|membrane (GO:0016020)	magnesium ion binding (GO:0000287)|thiamine pyrophosphate binding (GO:0030976)|transferase activity (GO:0016740)	p.F625F(1)		NS(3)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(1)	26						AGCCATCGCGGAAGTCCGTCC	0.597																																					p.F625F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1875T	19						.						140.0	106.0	117.0					19																	15226087		2203	4300	6503	15087087	SO:0001819	synonymous_variant	10994	exon16			U61263	CCDS12325.1	19p13.1	2008-07-16			ENSG00000105135	ENSG00000105135			6041	protein-coding gene	gene with protein product	"""acetolactate synthase homolog"""	605770				8954801	Standard	NM_006844		Approved	209L8, AHAS, ILV2H, MGC1269, FLJ39061, MGC19535	uc002nam.3	A1L0T0	OTTHUMG00000165630	ENST00000263383.3:c.1875C>T	19.37:g.15226087G>A		Somatic		Capture	SOLID	Phase_I	15087087	NM_006844	O43341|Q96F08|Q99651|Q9BWN5|Q9UEB2	Silent	SNP	ENST00000263383.3	37	CCDS12325.1	.	.	.	.	.	.	.	.	.	.	G	9.240	1.037937	0.19669	.	.	ENSG00000105135	ENST00000269733	.	.	.	5.37	4.34	0.51931	.	.	.	.	.	T	0.65260	0.2674	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.66264	-0.5967	5	0.52906	T	0.07	-18.5732	10.1473	0.42771	0.0927:0.0:0.9073:0.0	.	.	.	.	S	186	.	ENSP00000269733:P186S	P	-	1	0	ILVBL	15087087	1.000000	0.71417	0.998000	0.56505	0.954000	0.61252	2.474000	0.45154	1.272000	0.44329	0.655000	0.94253	CCG		ILVBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385439.1	NM_006844	
PSG2	5670	hgsc.bcm.edu	37	19	43576062	43576062	+	Missense_Mutation	SNP	G	G	C	rs3207962		TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr19:43576062G>C	ENST00000406487.1	-	4	852	c.754C>G	c.(754-756)Cgt>Ggt	p.R252G		NM_031246.3	NP_112536.2	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2	252	Ig-like C2-type 2.				cell migration (GO:0016477)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.R252G(1)		central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(24)|ovary(1)|pancreas(2)|prostate(6)|stomach(2)|urinary_tract(2)	49		Prostate(69;0.00682)				TCTCCTGAACGGTAATTGGTG	0.478																																					p.R252G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C754G	19						.						166.0	177.0	173.0					19																	43576062		2203	4299	6502	48267902	SO:0001583	missense	5670	exon4				CCDS12616.1	19q13.1-q13.2	2013-01-29			ENSG00000242221	ENSG00000242221		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9519	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta-1-glycoprotein 7"", ""carcinoembryonic antigen SG8"""	176391		PSBG2		2377620	Standard	NM_031246		Approved	PSGGB, PSG1, CEA	uc002ovr.3	P11465	OTTHUMG00000151547	ENST00000406487.1:c.754C>G	19.37:g.43576062G>C	ENSP00000385706:p.Arg252Gly	Somatic		Capture	SOLID	Phase_I	48267902	NM_031246	Q8TCD9|Q9UEA4|Q9UQ78	Missense_Mutation	SNP	ENST00000406487.1	37	CCDS12616.1	.	.	.	.	.	.	.	.	.	.	g	0.504	-0.869597	0.02570	.	.	ENSG00000242221	ENST00000406487;ENST00000329509;ENST00000401942;ENST00000406917	T	0.13778	2.56	1.26	-2.53	0.06326	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.19927	0.0479	M	0.89163	3.01	0.09310	N	1	B;B	0.23591	0.088;0.0	B;B	0.32342	0.144;0.012	T	0.39313	-0.9620	9	0.56958	D	0.05	.	2.7042	0.05157	0.2045:0.0:0.5379:0.2577	.	252;252	B5MCM8;P11465	.;PSG2_HUMAN	G	252	ENSP00000385706:R252G	ENSP00000332984:R252G	R	-	1	0	PSG2	48267902	0.021000	0.18746	0.000000	0.03702	0.001000	0.01503	1.186000	0.32078	-1.642000	0.01521	-2.089000	0.00373	CGT		PSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323083.1	NM_031246	
NUCB1	4924	hgsc.bcm.edu	37	19	49407641	49407641	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr19:49407641T>C	ENST00000405315.4	+	3	507	c.173T>C	c.(172-174)gTc>gCc	p.V58A	NUCB1_ENST00000263273.5_Missense_Mutation_p.V58A|NUCB1_ENST00000407032.1_Missense_Mutation_p.V58A|NUCB1_ENST00000485798.1_Intron	NM_006184.5	NP_006175.2	Q02818	NUCB1_HUMAN	nucleobindin 1	58						endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)	p.V58A(1)		cervix(1)|endometrium(4)|large_intestine(4)|lung(8)	17		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)		CTCCAGGAGGTCATCGATGTA	0.617																																					p.V58A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T173C	19						.						97.0	70.0	79.0					19																	49407641		2203	4300	6503	54099453	SO:0001583	missense	4924	exon3			BC002356	CCDS12740.1	19q13.33	2013-01-10			ENSG00000104805	ENSG00000104805		"""EF-hand domain containing"""	8043	protein-coding gene	gene with protein product		601323				8661046	Standard	NM_006184		Approved	NUC, Calnuc	uc002plb.4	Q02818	OTTHUMG00000152514	ENST00000405315.4:c.173T>C	19.37:g.49407641T>C	ENSP00000385923:p.Val58Ala	Somatic		Capture	SOLID	Phase_I	54099453	NM_006184	B2RD64|Q15838|Q7Z4J7|Q9BUR1	Missense_Mutation	SNP	ENST00000405315.4	37	CCDS12740.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	18.25|18.25	3.583529|3.583529	0.65992|0.65992	.|.	.|.	ENSG00000104805|ENSG00000104805	ENST00000424608|ENST00000405315;ENST00000407032;ENST00000452087;ENST00000411700;ENST00000451312;ENST00000263273	.|T;T;T	.|0.36699	.|1.24;1.24;1.24	4.27|4.27	4.27|4.27	0.50696|0.50696	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.64438|0.64438	0.2598|0.2598	M|M	0.90542|0.90542	3.125|3.125	0.80722|0.80722	D|D	1|1	.|D;D	.|0.76494	.|0.999;0.999	.|D;D	.|0.77557	.|0.99;0.99	T|T	0.71899|0.71899	-0.4453|-0.4453	5|10	.|0.72032	.|D	.|0.01	.|.	11.6478|11.6478	0.51271|0.51271	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|58;58	.|Q02818;Q53GX6	.|NUCB1_HUMAN;.	P|A	58|58	.|ENSP00000385923:V58A;ENSP00000385211:V58A;ENSP00000263273:V58A	.|ENSP00000263273:V58A	S|V	+|+	1|2	0|0	NUCB1|NUCB1	54099453|54099453	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.383000|0.383000	0.30230|0.30230	7.626000|7.626000	0.83164|0.83164	1.722000|1.722000	0.51474|0.51474	0.241000|0.241000	0.17934|0.17934	TCA|GTC		NUCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326545.2	NM_006184	
KIR3DL1	3811	hgsc.bcm.edu	37	19	55333226	55333226	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr19:55333226G>T	ENST00000391728.4	+	5	895	c.862G>T	c.(862-864)Gga>Tga	p.G288*	KIR3DL1_ENST00000402254.2_Nonsense_Mutation_p.G288*|KIR3DL1_ENST00000358178.4_Nonsense_Mutation_p.G193*|KIR3DL1_ENST00000538269.1_Nonsense_Mutation_p.G288*|KIR3DL1_ENST00000326542.7_Nonsense_Mutation_p.G288*|KIR3DL1_ENST00000541392.1_Nonsense_Mutation_p.G288*	NM_013289.2	NP_037421.2	P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1	288	Ig-like C2-type 3.				immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)	p.G288*(2)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		TGCCACCCACGGAGGGACCTA	0.587																																					p.G288X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.G862T	19						.						4.0	4.0	4.0					19																	55333226		1614	3307	4921	60025038	SO:0001587	stop_gained	3811	exon5			L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000391728.4:c.862G>T	19.37:g.55333226G>T	ENSP00000375608:p.Gly288*	Somatic		Capture	SOLID	Phase_I	60025038	NM_013289	O43473|Q14946|Q16541	Nonsense_Mutation	SNP	ENST00000391728.4	37	CCDS42621.1	.	.	.	.	.	.	.	.	.	.	-	13.83	2.352992	0.41700	.	.	ENSG00000167633	ENST00000402254;ENST00000538269;ENST00000541392;ENST00000355608;ENST00000391728;ENST00000326542;ENST00000358178	.	.	.	1.33	-2.35	0.06684	.	3.077760	0.01985	U	0.045087	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	4.7833	0.13213	0.577:0.0:0.423:0.0	.	.	.	.	X	288;288;288;266;288;288;193	.	ENSP00000326868:G288X	G	+	1	0	KIR3DL1	60025038	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-0.599000	0.05700	-0.638000	0.05509	0.184000	0.17185	GGA		KIR3DL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000141238.1	NM_013289	
TUSC3	7991	hgsc.bcm.edu	37	8	15508246	15508246	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr8:15508246C>T	ENST00000503731.1	+	3	497	c.349C>T	c.(349-351)Cgc>Tgc	p.R117C	TUSC3_ENST00000509380.1_Missense_Mutation_p.R117C|TUSC3_ENST00000382020.4_Missense_Mutation_p.R117C|TUSC3_ENST00000503191.1_Intron|TUSC3_ENST00000506802.1_Missense_Mutation_p.R117C	NM_006765.3	NP_006756.2	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3	117	Thioredoxin.				cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|magnesium ion transport (GO:0015693)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|oligosaccharyltransferase complex (GO:0008250)	magnesium ion transmembrane transporter activity (GO:0015095)	p.R117C(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(10)|ovary(2)	28				Colorectal(111;0.113)		GAACTCCTGGCGCTATTCATC	0.398																																					p.R117C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C349T	8						.						232.0	225.0	228.0					8																	15508246		2203	4300	6503	15552617	SO:0001583	missense	7991	exon3			AK026149	CCDS5993.1, CCDS5994.1	8p22	2010-10-22			ENSG00000104723	ENSG00000104723			30242	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 3 homolog A (S. cerevisiae)"""	601385				8661104, 10097140	Standard	NM_178234		Approved	MGC13453, N33, OST3A, MRT7	uc003wwt.3	Q13454	OTTHUMG00000094803	ENST00000503731.1:c.349C>T	8.37:g.15508246C>T	ENSP00000424544:p.Arg117Cys	Somatic		Capture	SOLID	Phase_I	15552617	NM_178234	A8MSM0|D3DSP2|Q14911|Q14912|Q96FW0	Missense_Mutation	SNP	ENST00000503731.1	37	CCDS5994.1	.	.	.	.	.	.	.	.	.	.	C	33	5.219528	0.95139	.	.	ENSG00000104723	ENST00000382020;ENST00000506802;ENST00000509380;ENST00000503731	T;T;T;T	0.40756	1.02;1.02;1.02;1.02	5.6	5.6	0.85130	Thioredoxin domain (1);Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	T	0.69646	0.3134	M	0.85373	2.75	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.85130	0.99;0.985;0.992;0.993;0.993;0.997	T	0.70033	-0.4983	10	0.44086	T	0.13	-12.7594	18.9923	0.92798	0.0:1.0:0.0:0.0	.	117;117;117;117;117;117	D6RDV0;D6RIY7;Q13454-2;Q13454;D6RA37;A8MSM0	.;.;.;TUSC3_HUMAN;.;.	C	117	ENSP00000371450:R117C;ENSP00000425777:R117C;ENSP00000423426:R117C;ENSP00000424544:R117C	ENSP00000221167:R117C	R	+	1	0	TUSC3	15552617	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.644000	0.67902	2.805000	0.96524	0.655000	0.94253	CGC		TUSC3-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365367.1	NM_006765	
NRG1	3084	hgsc.bcm.edu	37	8	32616869	32616869	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr8:32616869A>G	ENST00000405005.3	+	10	976	c.976A>G	c.(976-978)Aga>Gga	p.R326G	NRG1_ENST00000519301.1_Missense_Mutation_p.R276G|NRG1_ENST00000287845.5_Missense_Mutation_p.R297G|NRG1_ENST00000521670.1_Missense_Mutation_p.R326G|NRG1_ENST00000539990.1_Missense_Mutation_p.R169G|NRG1_ENST00000356819.4_Missense_Mutation_p.R331G|NRG1_ENST00000523079.1_Missense_Mutation_p.R323G|NRG1_ENST00000338921.4_Missense_Mutation_p.R334G|NRG1_ENST00000287842.3_Missense_Mutation_p.R323G|NRG1_ENST00000341377.5_3'UTR			Q02297	NRG1_HUMAN	neuregulin 1	326					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.R331G(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		TATTGTTGAGAGAGAAGCAGA	0.413																																					p.R323G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A967G	8						.						198.0	167.0	177.0					8																	32616869		2203	4300	6503	32736411	SO:0001583	missense	3084	exon10			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.976A>G	8.37:g.32616869A>G	ENSP00000384620:p.Arg326Gly	Somatic		Capture	SOLID	Phase_I	32736411	NM_013957	A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	ENST00000405005.3	37	CCDS6085.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.977529	0.74360	.	.	ENSG00000157168	ENST00000518104;ENST00000519301;ENST00000523534;ENST00000523079;ENST00000338921;ENST00000356819;ENST00000287840;ENST00000287845;ENST00000287842;ENST00000405005;ENST00000521670;ENST00000539990	T;T;T;T;T;T;T;T;T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01;-0.01;-0.01;-0.01;-0.01;-0.01;-0.01;-0.01;-0.01	6.16	4.97	0.65823	Neuregulin 1-related, C-terminal (1);	0.101521	0.64402	D	0.000004	T	0.74481	0.3722	M	0.62723	1.935	0.44055	D	0.99679	D;D;D;D;D;D;P;P;P;D;D	0.63046	0.992;0.987;0.976;0.968;0.974;0.976;0.774;0.941;0.952;0.968;0.984	D;P;D;P;P;D;B;P;P;P;P	0.65684	0.937;0.855;0.932;0.669;0.777;0.932;0.236;0.669;0.842;0.669;0.888	T	0.77316	-0.2633	10	0.87932	D	0	2.7449	13.5076	0.61493	0.6912:0.3088:0.0:0.0	.	169;172;323;297;331;322;334;323;326;331;326	B7Z1E3;B7Z1D7;E9PHH4;F8W9E3;Q7RTW4;B0FYA9;Q02297-2;Q02297-7;Q02297;Q02297-6;Q02297-3	.;.;.;.;.;.;.;.;NRG1_HUMAN;.;.	G	293;276;399;323;334;331;326;297;323;326;326;169	ENSP00000430053:R293G;ENSP00000429582:R276G;ENSP00000429067:R399G;ENSP00000430120:R323G;ENSP00000343395:R334G;ENSP00000349275:R331G;ENSP00000287840:R326G;ENSP00000287845:R297G;ENSP00000287842:R323G;ENSP00000384620:R326G;ENSP00000428828:R326G;ENSP00000439276:R169G	ENSP00000287840:R326G	R	+	1	2	NRG1	32736411	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.107000	0.41844	2.367000	0.80283	0.528000	0.53228	AGA		NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472504.1		
TRPA1	8989	hgsc.bcm.edu	37	8	72964964	72964964	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr8:72964964C>T	ENST00000262209.4	-	14	1888	c.1681G>A	c.(1681-1683)Gcc>Acc	p.A561T	RP11-383H13.1_ENST00000457356.4_3'UTR|RP11-383H13.1_ENST00000537896.1_3'UTR	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	561					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)	p.A561T(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	ACGGCTTTGGCGTGGCCTTCC	0.468																																					p.A561T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1681A	8						.						144.0	122.0	129.0					8																	72964964		2203	4300	6503	73127518	SO:0001583	missense	8989	exon14			Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.1681G>A	8.37:g.72964964C>T	ENSP00000262209:p.Ala561Thr	Somatic		Capture	SOLID	Phase_I	73127518	NM_007332	A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	37	CCDS34908.1	.	.	.	.	.	.	.	.	.	.	C	19.29	3.799815	0.70567	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.63913	-0.07;-0.07	4.98	4.98	0.66077	Ankyrin repeat-containing domain (4);	0.047663	0.85682	D	0.000000	T	0.64571	0.2610	N	0.21324	0.655	0.44890	D	0.997905	D	0.89917	1.0	D	0.76071	0.987	T	0.57854	-0.7739	10	0.13108	T	0.6	-4.8061	15.0441	0.71813	0.0:0.8574:0.1426:0.0	.	561	O75762	TRPA1_HUMAN	T	413;561	ENSP00000428151:A413T;ENSP00000262209:A561T	ENSP00000262209:A561T	A	-	1	0	TRPA1	73127518	0.985000	0.35326	0.992000	0.48379	0.439000	0.31926	2.548000	0.45794	2.466000	0.83321	0.585000	0.79938	GCC		TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	
KCNA10	3744	hgsc.bcm.edu	37	1	111061227	111061227	+	Silent	SNP	C	C	T	rs543046084		TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr1:111061227C>T	ENST00000369771.2	-	1	570	c.183G>A	c.(181-183)acG>acA	p.T61T		NM_005549.2	NP_005540.1	Q16322	KCA10_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 10	61					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|intracellular cyclic nucleotide activated cation channel activity (GO:0005221)	p.T61T(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(3)|skin(1)|urinary_tract(1)	35		all_cancers(81;4.57e-06)|all_epithelial(167;1.52e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|all cancers(265;0.0874)|Colorectal(144;0.103)|Epithelial(280;0.116)|LUSC - Lung squamous cell carcinoma(189;0.134)	Dalfampridine(DB06637)	TGGAGAAGGCCGTCTCATGGT	0.582													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17159	0.0		0.0	False		,,,				2504	0.0				p.T61T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G183A	1						.						84.0	92.0	89.0					1																	111061227		2203	4300	6503	110862750	SO:0001819	synonymous_variant	3744	exon1			U96110	CCDS826.1	1p13.1	2012-07-05			ENSG00000143105	ENSG00000143105		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6219	protein-coding gene	gene with protein product		602420				16382104	Standard	NM_005549		Approved	Kv1.8	uc001dzt.1	Q16322	OTTHUMG00000022785	ENST00000369771.2:c.183G>A	1.37:g.111061227C>T		Somatic		Capture	SOLID	Phase_I	110862750	NM_005549		Silent	SNP	ENST00000369771.2	37	CCDS826.1																																																																																				KCNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059081.1	NM_005549	
ASTN1	460	hgsc.bcm.edu	37	1	176934332	176934332	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr1:176934332A>G	ENST00000367654.3	-	9	1800	c.1589T>C	c.(1588-1590)gTt>gCt	p.V530A	ASTN1_ENST00000361833.2_Missense_Mutation_p.V522A|ASTN1_ENST00000367657.3_Missense_Mutation_p.V522A|ASTN1_ENST00000424564.2_Missense_Mutation_p.V522A|ASTN1_ENST00000281881.3_5'UTR	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	530					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.V522A(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						CTCTCCCAAAACCAGGTCAAA	0.428																																					p.V522A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1565C	1						.						130.0	134.0	132.0					1																	176934332		2203	4300	6503	175200955	SO:0001583	missense	460	exon9			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.1589T>C	1.37:g.176934332A>G	ENSP00000356626:p.Val530Ala	Somatic		Capture	SOLID	Phase_I	175200955	NM_004319	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	37		.	.	.	.	.	.	.	.	.	.	A	19.01	3.744603	0.69418	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.23950	1.88;2.29;2.29;1.89	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.38453	0.1041	L	0.29908	0.895	0.80722	D	1	P;P;P	0.52577	0.954;0.954;0.954	D;D;D	0.67900	0.954;0.954;0.932	T	0.20306	-1.0279	10	0.59425	D	0.04	-9.9244	14.8608	0.70379	1.0:0.0:0.0:0.0	.	530;522;522	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	A	522;522;530;522;522	ENSP00000356629:V522A;ENSP00000354536:V522A;ENSP00000356626:V530A;ENSP00000395041:V522A	ENSP00000354536:V522A	V	-	2	0	ASTN1	175200955	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.400000	0.90200	2.036000	0.60181	0.454000	0.30748	GTT		ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319	
CENPF	1063	hgsc.bcm.edu	37	1	214825154	214825154	+	Silent	SNP	A	A	G			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr1:214825154A>G	ENST00000366955.3	+	15	8253	c.8085A>G	c.(8083-8085)gaA>gaG	p.E2695E	CENPF_ENST00000467765.1_3'UTR	NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	2791	Sufficient for centromere localization.|Sufficient for self-association.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.E2695E(1)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		TGAGAGAGGAAATAGCTGAAT	0.423																																					p.E2695E	Colon(80;575 1284 11000 14801 43496)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A8085G	1						.						106.0	109.0	108.0					1																	214825154		2203	4300	6503	212891777	SO:0001819	synonymous_variant	1063	exon15			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.8085A>G	1.37:g.214825154A>G		Somatic		Capture	SOLID	Phase_I	212891777	NM_016343	Q13171|Q13246|Q5VVM7	Silent	SNP	ENST00000366955.3	37	CCDS31023.1																																																																																				CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
LIN9	286826	hgsc.bcm.edu	37	1	226474076	226474076	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr1:226474076A>G	ENST00000328205.5	-	6	1075	c.530T>C	c.(529-531)gTa>gCa	p.V177A	LIN9_ENST00000366801.1_Missense_Mutation_p.V126A|LIN9_ENST00000481685.1_Missense_Mutation_p.V142A	NM_173083.3	NP_775106.2	Q5TKA1	LIN9_HUMAN	lin-9 DREAM MuvB core complex component	161	Sufficient for interaction with RB1.				DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|transcriptional repressor complex (GO:0017053)		p.V177A(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.131)		TCCCCATTCTACTCTTGTTAA	0.333																																					p.V177A	Ovarian(197;1696 2974 11248 14117)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T530C	1						.						68.0	75.0	72.0					1																	226474076		2201	4298	6499	224540699	SO:0001583	missense	286826	exon6			AY166858	CCDS1553.1	1q42	2014-07-17	2014-07-17		ENSG00000183814	ENSG00000183814			30830	protein-coding gene	gene with protein product	"""TUDOR gene similar"", ""rb related pathway actor"""	609375	"""lin-9 homolog (C. elegans)"""			15538385, 23667535	Standard	NM_173083		Approved	TGS	uc001hqa.3	Q5TKA1	OTTHUMG00000037557	ENST00000328205.5:c.530T>C	1.37:g.226474076A>G	ENSP00000329102:p.Val177Ala	Somatic		Capture	SOLID	Phase_I	224540699	NM_173083	Q5U5L8|Q5U7E1|Q6PI55|Q6ZTV4|Q7Z3J1	Missense_Mutation	SNP	ENST00000328205.5	37	CCDS1553.1	.	.	.	.	.	.	.	.	.	.	A	11.38	1.623090	0.28889	.	.	ENSG00000183814	ENST00000460719;ENST00000328205;ENST00000366808;ENST00000366801;ENST00000481685;ENST00000366807	.	.	.	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.62780	0.2456	N	0.21282	0.65	0.80722	D	1	B;B;D	0.69078	0.001;0.001;0.997	B;B;D	0.79108	0.002;0.003;0.992	T	0.59107	-0.7516	9	0.20519	T	0.43	.	16.2265	0.82298	1.0:0.0:0.0:0.0	.	142;161;311	C9J5J4;Q5TKA1;B1ANK3	.;LIN9_HUMAN;.	A	137;177;232;126;142;311	.	ENSP00000329102:V177A	V	-	2	0	LIN9	224540699	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.794000	0.91867	2.233000	0.73108	0.533000	0.62120	GTA		LIN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091523.2	NM_173083	
DNAJC11	55735	hgsc.bcm.edu	37	1	6712917	6712917	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr1:6712917C>T	ENST00000377577.5	-	6	725	c.602G>A	c.(601-603)cGa>cAa	p.R201Q	DNAJC11_ENST00000349363.6_Missense_Mutation_p.R163Q|DNAJC11_ENST00000542246.1_Missense_Mutation_p.R163Q|DNAJC11_ENST00000377573.5_Missense_Mutation_p.R111Q|DNAJC11_ENST00000294401.7_Missense_Mutation_p.R201Q	NM_018198.3	NP_060668.2	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11	201						extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)		p.R201Q(1)		NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)|urinary_tract(1)	32	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		CGAAGTTACTCGTCTGAGCGC	0.473																																					p.R201Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G602A	1						.						146.0	138.0	140.0					1																	6712917		2203	4300	6503	6635504	SO:0001583	missense	55735	exon6			AF306695	CCDS87.1	1p36.23	2011-09-02			ENSG00000007923	ENSG00000007923		"""Heat shock proteins / DNAJ (HSP40)"""	25570	protein-coding gene	gene with protein product		614827				12964007	Standard	NM_018198		Approved	FLJ10737	uc001aof.2	Q9NVH1	OTTHUMG00000001443	ENST00000377577.5:c.602G>A	1.37:g.6712917C>T	ENSP00000366800:p.Arg201Gln	Somatic		Capture	SOLID	Phase_I	6635504	NM_018198	Q4VWF5|Q5VZN0|Q6PK20|Q6PK70|Q8NDM2|Q96CL7	Missense_Mutation	SNP	ENST00000377577.5	37	CCDS87.1	.	.	.	.	.	.	.	.	.	.	C	36	5.732264	0.96856	.	.	ENSG00000007923	ENST00000377577;ENST00000451196;ENST00000349363;ENST00000294401;ENST00000542246;ENST00000377573;ENST00000426784	T;T;T;T;T;T;T	0.36699	2.39;1.68;1.24;2.37;2.13;1.75;2.4	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.63792	0.2541	M	0.80183	2.485	0.80722	D	1	D;D;D;D	0.89917	1.0;0.977;1.0;1.0	D;P;D;D	0.74023	0.915;0.487;0.982;0.967	T	0.66988	-0.5784	10	0.62326	D	0.03	-4.9626	18.4511	0.90704	0.0:1.0:0.0:0.0	.	111;177;201;201	B4DGD5;Q5TH61;Q9NVH1-3;Q9NVH1	.;.;.;DJC11_HUMAN	Q	201;177;163;201;163;111;201	ENSP00000366800:R201Q;ENSP00000415871:R177Q;ENSP00000326304:R163Q;ENSP00000294401:R201Q;ENSP00000444020:R163Q;ENSP00000366796:R111Q;ENSP00000410194:R201Q	ENSP00000294401:R201Q	R	-	2	0	DNAJC11	6635504	0.969000	0.33509	0.995000	0.50966	0.995000	0.86356	7.374000	0.79633	2.666000	0.90696	0.655000	0.94253	CGA		DNAJC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004216.3	NM_018198	
TRIM62	55223	hgsc.bcm.edu	37	1	33612944	33612944	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr1:33612944T>C	ENST00000291416.5	-	5	1495	c.1262A>G	c.(1261-1263)gAc>gGc	p.D421G	TRIM62_ENST00000543586.1_Missense_Mutation_p.D300G	NM_018207.2	NP_060677.2	Q9BVG3	TRI62_HUMAN	tripartite motif containing 62	421	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				innate immune response (GO:0045087)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)|regulation of viral entry into host cell (GO:0046596)|regulation of viral release from host cell (GO:1902186)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.D421G(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0393)				TTGGTCATAGTCCAGGAAGAC	0.557																																					p.D421G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1262G	1						.						122.0	110.0	114.0					1																	33612944		2203	4300	6503	33385531	SO:0001583	missense	55223	exon5			BC007999	CCDS376.1	1p35.1	2013-10-11	2011-01-25		ENSG00000116525	ENSG00000116525		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	25574	protein-coding gene	gene with protein product	"""ductal epithelium-associated RING Chromosome 1"""		"""tripartite motif-containing 62"""			19536326	Standard	NM_018207		Approved	FLJ10759, DEAR1	uc001bxb.3	Q9BVG3	OTTHUMG00000004132	ENST00000291416.5:c.1262A>G	1.37:g.33612944T>C	ENSP00000291416:p.Asp421Gly	Somatic		Capture	SOLID	Phase_I	33385531	NM_018207	B3KVH5|B4DTE4|D3DPR1|Q9NVG0	Missense_Mutation	SNP	ENST00000291416.5	37	CCDS376.1	.	.	.	.	.	.	.	.	.	.	T	24.5	4.535596	0.85812	.	.	ENSG00000116525	ENST00000291416;ENST00000543586	T;T	0.81247	-1.47;-1.47	5.6	5.6	0.85130	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	D	0.92928	0.7750	H	0.97158	3.95	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94909	0.8063	10	0.87932	D	0	.	13.7214	0.62730	0.0:0.0:0.0:1.0	.	421	Q9BVG3	TRI62_HUMAN	G	421;300	ENSP00000291416:D421G;ENSP00000441173:D300G	ENSP00000291416:D421G	D	-	2	0	TRIM62	33385531	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	8.040000	0.89188	2.133000	0.65898	0.402000	0.26972	GAC		TRIM62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011890.1	NM_018207	
WDR78	79819	hgsc.bcm.edu	37	1	67306347	67306347	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr1:67306347T>G	ENST00000371026.3	-	9	1354	c.1299A>C	c.(1297-1299)gaA>gaC	p.E433D	WDR78_ENST00000371023.3_Missense_Mutation_p.E433D|WDR78_ENST00000431318.1_Missense_Mutation_p.E179D	NM_024763.4	NP_079039.4	Q5VTH9	WDR78_HUMAN	WD repeat domain 78	433	Glu-rich.				hematopoietic progenitor cell differentiation (GO:0002244)			p.E433D(1)		NS(1)|endometrium(3)|kidney(6)|large_intestine(6)|lung(10)|ovary(3)|skin(3)	32						GCTCTTCAGGTTCAGGTTCTA	0.393																																					p.E433D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1299C	1						.						90.0	95.0	93.0					1																	67306347		2203	4300	6503	67078935	SO:0001583	missense	79819	exon9			BX648840	CCDS635.1, CCDS44157.1	1p31.2	2014-02-21	2013-02-19	2013-02-19	ENSG00000152763	ENSG00000152763		"""WD repeat domain containing"""	26252	protein-coding gene	gene with protein product						21953912	Standard	NM_207014		Approved	DIC4, FLJ23129	uc001dcx.3	Q5VTH9	OTTHUMG00000009165	ENST00000371026.3:c.1299A>C	1.37:g.67306347T>G	ENSP00000360065:p.Glu433Asp	Somatic		Capture	SOLID	Phase_I	67078935	NM_207014	A8K9W5|B5MDT3|H7BY80|Q5VTI0|Q8N5G5|Q9H5R9|Q9UF44	Missense_Mutation	SNP	ENST00000371026.3	37	CCDS635.1	.	.	.	.	.	.	.	.	.	.	T	7.269	0.606760	0.14002	.	.	ENSG00000152763	ENST00000371026;ENST00000431318;ENST00000464352;ENST00000371023;ENST00000531552	T;T;T;T;T	0.68181	0.33;-0.27;-0.31;2.09;1.4	5.62	2.09	0.27110	.	0.725056	0.13701	N	0.368817	T	0.27697	0.0681	L	0.36672	1.1	0.24950	N	0.991795	B;B;B	0.11235	0.002;0.002;0.004	B;B;B	0.09377	0.004;0.003;0.004	T	0.22871	-1.0204	10	0.14656	T	0.56	-15.4052	7.1892	0.25816	0.0:0.251:0.0:0.749	.	179;433;433	Q5VTH9-3;A0AVI9;Q5VTH9	.;.;WDR78_HUMAN	D	433;179;199;433;55	ENSP00000360065:E433D;ENSP00000393182:E179D;ENSP00000433682:E199D;ENSP00000360062:E433D;ENSP00000433037:E55D	ENSP00000360062:E433D	E	-	3	2	WDR78	67078935	0.094000	0.21725	0.835000	0.33067	0.090000	0.18270	0.029000	0.13666	0.165000	0.19558	0.528000	0.53228	GAA		WDR78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025404.1	NM_024763	
OR11L1	391189	hgsc.bcm.edu	37	1	248004646	248004646	+	Missense_Mutation	SNP	T	T	A	rs375462936		TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr1:248004646T>A	ENST00000355784.2	-	1	608	c.553A>T	c.(553-555)Atg>Ttg	p.M185L		NM_001001959.1	NP_001001959.1	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L, member 1	185						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M185L(1)		NS(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GAGAGCTGCATGAGTGGCGGG	0.507																																					p.M185L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A553T	1						.						96.0	100.0	99.0					1																	248004646		2203	4300	6503	246071269	SO:0001583	missense	391189	exon1			AB065646	CCDS31098.1	1q44	2013-09-24			ENSG00000197591	ENSG00000197591		"""GPCR / Class A : Olfactory receptors"""	14998	protein-coding gene	gene with protein product							Standard	NM_001001959		Approved		uc001idn.1	Q8NGX0	OTTHUMG00000040193	ENST00000355784.2:c.553A>T	1.37:g.248004646T>A	ENSP00000348033:p.Met185Leu	Somatic		Capture	SOLID	Phase_I	246071269	NM_001001959		Missense_Mutation	SNP	ENST00000355784.2	37	CCDS31098.1	.	.	.	.	.	.	.	.	.	.	T	0.012	-1.673889	0.00758	.	.	ENSG00000197591	ENST00000355784	T	0.00010	9.41	4.27	4.27	0.50696	GPCR, rhodopsin-like superfamily (1);	0.333979	0.21349	U	0.075982	T	0.00039	0.0001	N	0.00424	-1.51	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.27400	-1.0075	10	0.02654	T	1	.	5.6055	0.17377	0.1524:0.0:0.2889:0.5587	.	185	Q8NGX0	O11L1_HUMAN	L	185	ENSP00000348033:M185L	ENSP00000348033:M185L	M	-	1	0	OR11L1	246071269	0.000000	0.05858	0.940000	0.37924	0.569000	0.35902	-0.184000	0.09698	1.922000	0.55676	0.443000	0.29094	ATG		OR11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096850.1	NM_001001959	
ATM	472	hgsc.bcm.edu	37	11	108218092	108218092	+	Splice_Site	SNP	G	G	C			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr11:108218092G>C	ENST00000452508.2	+	60	8860	c.8671G>C	c.(8671-8673)Ggt>Cgt	p.G2891R	ATM_ENST00000525178.1_3'UTR|C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Splice_Site_p.G2891R|C11orf65_ENST00000526725.1_Intron			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2891	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.G2891R(1)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TATAGATCTAGGTAAGTAATA	0.308			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.G2891R		yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G8671C	11						.						74.0	79.0	77.0					11																	108218092		2201	4297	6498	107723302	SO:0001630	splice_region_variant	472	exon59	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.8671+1G>C	11.37:g.108218092G>C		Somatic		Capture	SOLID	Phase_I	107723302	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	37	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	G	19.64	3.865212	0.71949	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	D;D	0.85702	-2.02;-2.02	5.52	5.52	0.82312	Protein kinase-like domain (1);Armadillo-type fold (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.85682	D	0.000000	D	0.95781	0.8627	H	0.98005	4.125	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97255	0.9900	10	0.87932	D	0	.	19.45	0.94862	0.0:0.0:1.0:0.0	.	2891	Q13315	ATM_HUMAN	R	2891	ENSP00000278616:G2891R;ENSP00000388058:G2891R	ENSP00000278616:G2891R	G	+	1	0	ATM	107723302	1.000000	0.71417	0.998000	0.56505	0.273000	0.26683	9.175000	0.94831	2.585000	0.87301	0.555000	0.69702	GGT		ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	Missense_Mutation
UBQLNL	143630	hgsc.bcm.edu	37	11	5536943	5536943	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr11:5536943T>G	ENST00000380184.1	-	1	992	c.729A>C	c.(727-729)caA>caC	p.Q243H	HBG2_ENST00000380259.2_Intron	NM_145053.4	NP_659490.4	Q8IYU4	UBQLN_HUMAN	ubiquilin-like	243								p.Q243H(1)		endometrium(1)|kidney(3)|large_intestine(9)|lung(13)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	33		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.136)		TTTGTGAAGGTTGTTGGATCT	0.463																																					p.Q243H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A729C	11						.						88.0	92.0	91.0					11																	5536943		2201	4297	6498	5493519	SO:0001583	missense	143630	exon1			AK127987	CCDS31385.1	11p15.4	2014-02-12			ENSG00000175518	ENSG00000175518		"""Ubiquilin family"""	28294	protein-coding gene	gene with protein product							Standard	NM_145053		Approved	MGC20470, MGC26958	uc001maz.4	Q8IYU4	OTTHUMG00000066903	ENST00000380184.1:c.729A>C	11.37:g.5536943T>G	ENSP00000369531:p.Gln243His	Somatic		Capture	SOLID	Phase_I	5493519	NM_145053	Q6ZRU1|Q96EK3|Q96MB0	Missense_Mutation	SNP	ENST00000380184.1	37	CCDS31385.1	.	.	.	.	.	.	.	.	.	.	T	8.063	0.768656	0.15983	.	.	ENSG00000175518	ENST00000380184	T	0.50813	0.73	4.19	-0.611	0.11601	.	0.164374	0.29046	N	0.013318	T	0.54581	0.1867	M	0.72894	2.215	0.22171	N	0.999318	D	0.67145	0.996	P	0.57371	0.819	T	0.49735	-0.8908	10	0.87932	D	0	.	7.1044	0.25356	0.0:0.4325:0.0:0.5675	.	243	Q8IYU4	UBQLN_HUMAN	H	243	ENSP00000369531:Q243H	ENSP00000369531:Q243H	Q	-	3	2	UBQLNL	5493519	0.221000	0.23642	0.171000	0.22900	0.012000	0.07955	-0.229000	0.09098	-0.115000	0.11915	-0.262000	0.10625	CAA		UBQLNL-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143386.1	NM_145053	
ST5	6764	hgsc.bcm.edu	37	11	8739381	8739381	+	Silent	SNP	T	T	C			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr11:8739381T>C	ENST00000534127.1	-	8	1921	c.1536A>G	c.(1534-1536)ggA>ggG	p.G512G	ST5_ENST00000526757.1_Silent_p.G92G|ST5_ENST00000530438.1_Silent_p.G92G|ST5_ENST00000313726.6_Silent_p.G512G|ST5_ENST00000526099.1_Silent_p.G25G|ST5_ENST00000357665.1_Silent_p.G512G|ST5_ENST00000530991.1_5'UTR	NM_005418.3	NP_005409.3	P78524	ST5_HUMAN	suppression of tumorigenicity 5	512					positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.G512G(1)		NS(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(13)|liver(1)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	39				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		GGGATTTTCGTCCTGCTCTTC	0.517																																					p.G512G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1536G	11						.						193.0	144.0	161.0					11																	8739381		2201	4296	6497	8695957	SO:0001819	synonymous_variant	6764	exon8			U15131	CCDS7791.1, CCDS7792.1	11p15	2012-10-04				ENSG00000166444		"""DENN/MADD domain containing"""	11350	protein-coding gene	gene with protein product	"""DENN/MADD domain containing 2B"""	140750				1390339	Standard	NM_005418		Approved	HTS1, DENND2B, p126	uc001mgt.3	P78524		ENST00000534127.1:c.1536A>G	11.37:g.8739381T>C		Somatic		Capture	SOLID	Phase_I	8695957	NM_005418	B2R6X7|B3KXQ6|P78523|Q16492|Q7KYY2|Q7KZ12|Q8NE12|Q9BQQ6	Silent	SNP	ENST00000534127.1	37	CCDS7791.1																																																																																				ST5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386518.1	NM_005418	
ACCS	84680	hgsc.bcm.edu	37	11	44098876	44098876	+	Missense_Mutation	SNP	G	G	A	rs375075014		TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr11:44098876G>A	ENST00000263776.8	+	7	1038	c.604G>A	c.(604-606)Gtg>Atg	p.V202M	ACCS_ENST00000432284.2_3'UTR|ACCS_ENST00000533208.1_3'UTR	NM_001127219.1|NM_032592.3	NP_001120691.1|NP_115981.1	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)	202					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)	p.V202M(2)		breast(4)|endometrium(3)|large_intestine(11)|lung(15)|ovary(1)|skin(1)	35						CACACAGCACGTGTGTCTCTA	0.577																																					p.V202M	Esophageal Squamous(158;148 1889 8077 23160 41213)											.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G604A	11						.	G	MET/VAL,MET/VAL	0,4406		0,0,2203	190.0	171.0	178.0		604,604	-1.0	0.9	11		178	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ACCS	NM_001127219.1,NM_032592.3	21,21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	202/502,202/502	44098876	1,13005	2203	4300	6503	44055452	SO:0001583	missense	84680	exon7			AY026508	CCDS7907.1	11p11	2008-03-12	2008-01-28		ENSG00000110455	ENSG00000110455			23989	protein-coding gene	gene with protein product		608405				11470512	Standard	NM_032592		Approved	PHACS, ACS	uc009yks.1	Q96QU6	OTTHUMG00000166427	ENST00000263776.8:c.604G>A	11.37:g.44098876G>A	ENSP00000263776:p.Val202Met	Somatic		Capture	SOLID	Phase_I	44055452	NM_032592	B4E219|Q8WUL4|Q96LX5	Missense_Mutation	SNP	ENST00000263776.8	37	CCDS7907.1	.	.	.	.	.	.	.	.	.	.	G	10.03	1.237682	0.22711	0.0	1.16E-4	ENSG00000110455	ENST00000263776	D	0.91351	-2.83	4.58	-0.992	0.10232	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.314579	0.29638	N	0.011592	T	0.78723	0.4328	N	0.20483	0.58	0.80722	D	1	P	0.44627	0.839	B	0.40375	0.327	T	0.70371	-0.4890	10	0.45353	T	0.12	-17.2656	4.6764	0.12713	0.352:0.0:0.505:0.143	.	202	Q96QU6	1A1L1_HUMAN	M	202	ENSP00000263776:V202M	ENSP00000263776:V202M	V	+	1	0	ACCS	44055452	0.273000	0.24181	0.859000	0.33776	0.171000	0.22731	0.282000	0.18829	0.125000	0.18397	-0.232000	0.12228	GTG		ACCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389721.1	NM_032592	
LRP4	4038	hgsc.bcm.edu	37	11	46880824	46880824	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr11:46880824C>T	ENST00000378623.1	-	38	5670	c.5428G>A	c.(5428-5430)Gta>Ata	p.V1810I	LRP4-AS1_ENST00000502049.2_RNA|LRP4-AS1_ENST00000531719.1_RNA	NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	1810					dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)	p.V1810I(1)		breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		ATTCCCTCTACGATCTTGATC	0.547																																					p.V1810I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5428A	11						.						151.0	141.0	144.0					11																	46880824		2201	4299	6500	46837400	SO:0001583	missense	4038	exon38			AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.5428G>A	11.37:g.46880824C>T	ENSP00000367888:p.Val1810Ile	Somatic		Capture	SOLID	Phase_I	46837400	NM_002334	B2RN39|Q4AC85|Q5KTZ5	Missense_Mutation	SNP	ENST00000378623.1	37	CCDS31478.1	.	.	.	.	.	.	.	.	.	.	C	18.76	3.693605	0.68386	.	.	ENSG00000134569	ENST00000378623	D	0.90261	-2.64	6.06	6.06	0.98353	.	0.069463	0.56097	N	0.000021	D	0.83027	0.5165	N	0.19112	0.55	0.51012	D	0.9999	B	0.34181	0.44	B	0.24394	0.053	T	0.83227	-0.0065	10	0.59425	D	0.04	.	16.0307	0.80574	0.0:0.8665:0.1335:0.0	.	1810	O75096	LRP4_HUMAN	I	1810	ENSP00000367888:V1810I	ENSP00000367888:V1810I	V	-	1	0	LRP4	46837400	1.000000	0.71417	0.979000	0.43373	0.872000	0.50106	5.672000	0.68102	2.882000	0.98803	0.655000	0.94253	GTA		LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391133.1	NM_002334	
OR8J3	81168	hgsc.bcm.edu	37	11	55904460	55904460	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr11:55904460C>G	ENST00000301529.1	-	1	734	c.735G>C	c.(733-735)atG>atC	p.M245I		NM_001004064.1	NP_001004064.1	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J, member 3	245						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M245I(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(38)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	59	Esophageal squamous(21;0.00693)					TGACTGCTATCATATGCGAAG	0.393																																					p.M245I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G735C	11						.						126.0	118.0	120.0					11																	55904460		2201	4296	6497	55661036	SO:0001583	missense	81168	exon1				CCDS31520.1	11q12.2	2012-08-09			ENSG00000167822	ENSG00000167822		"""GPCR / Class A : Olfactory receptors"""	15312	protein-coding gene	gene with protein product							Standard	NM_001004064		Approved		uc010riz.2	Q8NGG0	OTTHUMG00000166834	ENST00000301529.1:c.735G>C	11.37:g.55904460C>G	ENSP00000301529:p.Met245Ile	Somatic		Capture	SOLID	Phase_I	55661036	NM_001004064	Q6IFB6|Q96RC2	Missense_Mutation	SNP	ENST00000301529.1	37	CCDS31520.1	.	.	.	.	.	.	.	.	.	.	C	2.478	-0.320387	0.05386	.	.	ENSG00000167822	ENST00000301529	T	0.32988	1.43	2.75	0.634	0.17718	GPCR, rhodopsin-like superfamily (1);	0.378221	0.28730	N	0.014336	T	0.14485	0.0350	N	0.16307	0.4	0.09310	N	1	B	0.10296	0.003	B	0.17979	0.02	T	0.25745	-1.0123	10	0.17832	T	0.49	.	6.1247	0.20172	0.184:0.7088:0.0:0.1072	.	245	Q8NGG0	OR8J3_HUMAN	I	245	ENSP00000301529:M245I	ENSP00000301529:M245I	M	-	3	0	OR8J3	55661036	0.000000	0.05858	0.006000	0.13384	0.128000	0.20619	-1.102000	0.03332	0.032000	0.15435	0.297000	0.19635	ATG		OR8J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391542.1	NM_001004064	
ACRV1	56	hgsc.bcm.edu	37	11	125547721	125547721	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr11:125547721G>A	ENST00000533904.1	-	2	866	c.524C>T	c.(523-525)tCa>tTa	p.S175L	ACRV1_ENST00000353070.1_Intron|ACRV1_ENST00000348856.3_Missense_Mutation_p.S75L|ACRV1_ENST00000530048.1_Missense_Mutation_p.S120L|ACRV1_ENST00000345274.1_Missense_Mutation_p.S105L|ACRV1_ENST00000527795.1_Missense_Mutation_p.S105L|ACRV1_ENST00000315608.3_Intron|ACRV1_ENST00000425431.1_Intron|ACRV1_ENST00000445562.1_Missense_Mutation_p.S80L|ACRV1_ENST00000453509.1_Intron			P26436	ASPX_HUMAN	acrosomal vesicle protein 1	175					multicellular organismal development (GO:0007275)	acrosomal vesicle (GO:0001669)		p.S175L(1)		kidney(1)|large_intestine(3)|lung(2)	6	all_hematologic(175;0.177)	Breast(109;0.0021)|all_lung(97;0.0179)|Lung NSC(97;0.0185)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0713)		TGGTGCACCTGAAGCCTGTTC	0.537																																					p.S175L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C524T	11						.						126.0	108.0	114.0					11																	125547721		2201	4299	6500	125052931	SO:0001583	missense	56	exon2			AK223335	CCDS8460.1, CCDS8461.1, CCDS44759.1, CCDS44761.1	11q24.2	2012-05-16			ENSG00000134940	ENSG00000134940			127	protein-coding gene	gene with protein product	"""sperm protein 10"""	102525				1693291, 8288254	Standard	NM_001612		Approved	SPACA2, SP-10, D11S4365	uc001qcs.3	P26436	OTTHUMG00000165854	ENST00000533904.1:c.524C>T	11.37:g.125547721G>A	ENSP00000432816:p.Ser175Leu	Somatic		Capture	SOLID	Phase_I	125052931	NM_001612	Q53FF4	Missense_Mutation	SNP	ENST00000533904.1	37	CCDS8460.1	.	.	.	.	.	.	.	.	.	.	G	14.99	2.701492	0.48307	.	.	ENSG00000134940	ENST00000533904;ENST00000257382;ENST00000426183;ENST00000445562;ENST00000348856;ENST00000345274;ENST00000530048;ENST00000527795	T;T;T;T;T;T;T;T	0.24538	1.99;1.95;1.96;1.85;2.02;2.37;1.95;1.96	4.83	2.76	0.32466	.	1.086300	0.07215	N	0.859924	T	0.48429	0.1499	M	0.66939	2.045	0.25785	N	0.984684	P;B;B;P;D	0.89917	0.655;0.022;0.027;0.749;1.0	B;B;B;B;D	0.83275	0.231;0.054;0.019;0.393;0.996	T	0.16748	-1.0392	10	0.62326	D	0.03	0.851	8.1389	0.31071	0.2317:0.0:0.7683:0.0	.	175;105;80;120;105	P26436;P26436-8;P26436-6;P26436-3;P26436-4	ASPX_HUMAN;.;.;.;.	L	175;120;105;80;75;105;120;105	ENSP00000432816:S175L;ENSP00000257382:S120L;ENSP00000411583:S105L;ENSP00000412653:S80L;ENSP00000257385:S75L;ENSP00000257383:S105L;ENSP00000433720:S120L;ENSP00000436819:S105L	ENSP00000257382:S120L	S	-	2	0	ACRV1	125052931	0.015000	0.18098	0.003000	0.11579	0.030000	0.12068	1.847000	0.39299	0.577000	0.29470	0.650000	0.86243	TCA		ACRV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386722.1	NM_001612	
RREB1	6239	hgsc.bcm.edu	37	6	7248771	7248771	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr6:7248771G>A	ENST00000349384.6	+	12	4948	c.4634G>A	c.(4633-4635)tGc>tAc	p.C1545Y	RREB1_ENST00000379933.3_Missense_Mutation_p.C1545Y|RREB1_ENST00000379938.2_Missense_Mutation_p.C1600Y|RREB1_ENST00000334984.6_Missense_Mutation_p.C1334Y	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	1545					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C1545Y(1)		breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				TGTCAGACCTGCGAGCGAACC	0.537																																					p.C1334Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4001A	6						.						81.0	75.0	77.0					6																	7248771		2203	4300	6503	7193770	SO:0001583	missense	6239	exon12			U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.4634G>A	6.37:g.7248771G>A	ENSP00000305560:p.Cys1545Tyr	Somatic		Capture	SOLID	Phase_I	7193770	NM_001003700	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Missense_Mutation	SNP	ENST00000349384.6	37	CCDS34336.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.490235	0.84962	.	.	ENSG00000124782	ENST00000379933;ENST00000379938;ENST00000349384;ENST00000334984	D;D;D;D	0.99974	-2.04;-2.04;-2.04;-10.2	5.7	5.7	0.88788	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000002	D	0.99985	0.9996	H	0.95260	3.645	0.39188	D	0.962905	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.97110	0.999;1.0;0.997	D	0.98308	1.0522	10	0.87932	D	0	-31.3866	19.8411	0.96685	0.0:0.0:1.0:0.0	.	1334;1545;1600	Q92766-3;Q92766;Q92766-2	.;RREB1_HUMAN;.	Y	1545;1600;1545;1334	ENSP00000369265:C1545Y;ENSP00000369270:C1600Y;ENSP00000305560:C1545Y;ENSP00000335574:C1334Y	ENSP00000335574:C1334Y	C	+	2	0	RREB1	7193770	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	9.199000	0.95003	2.683000	0.91414	0.655000	0.94253	TGC		RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1		
LRFN2	57497	hgsc.bcm.edu	37	6	40400699	40400699	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr6:40400699G>A	ENST00000338305.6	-	2	696	c.154C>T	c.(154-156)Cgg>Tgg	p.R52W		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	52	LRRNT.					cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.R52W(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					ACTGTCCGCCGGTCAATATCA	0.617																																					p.R52W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C154T	6						.						46.0	51.0	50.0					6																	40400699		2203	4300	6503	40508677	SO:0001583	missense	57497	exon2			AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.154C>T	6.37:g.40400699G>A	ENSP00000345985:p.Arg52Trp	Somatic		Capture	SOLID	Phase_I	40508677	NM_020737	A5PKU3|Q5SYP9	Missense_Mutation	SNP	ENST00000338305.6	37	CCDS34443.1	.	.	.	.	.	.	.	.	.	.	G	17.09	3.301056	0.60195	.	.	ENSG00000156564	ENST00000338305	T	0.02631	4.22	5.76	5.76	0.90799	Leucine-rich repeat-containing N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.05868	0.0153	M	0.68317	2.08	0.80722	D	1	D	0.64830	0.994	P	0.55667	0.781	T	0.03193	-1.1062	10	0.87932	D	0	.	13.4862	0.61366	0.0:0.0:0.8436:0.1564	.	52	Q9ULH4	LRFN2_HUMAN	W	52	ENSP00000345985:R52W	ENSP00000345985:R52W	R	-	1	2	LRFN2	40508677	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.141000	0.50593	2.736000	0.93811	0.655000	0.94253	CGG		LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040488.1	XM_166372	
MDN1	23195	hgsc.bcm.edu	37	6	90421780	90421786	+	Frame_Shift_Del	DEL	TAAATGA	TAAATGA	-			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	TAAATGA	TAAATGA	TAAATGA	-	TAAATGA	TAAATGA	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr6:90421780_90421786delTAAATGA	ENST00000369393.3	-	49	7735_7741	c.7620_7626delTCATTTA	c.(7618-7626)tatcatttafs	p.YHL2540fs	MDN1_ENST00000428876.1_Frame_Shift_Del_p.YHL2540fs			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	2540					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)	p.Y2540fs*1(1)		NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TATTCTTGGCTAAATGATAAAGCCATT	0.401																																					p.2540_2542del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.7620_7626del	6						.																																			90478507	SO:0001589	frameshift_variant	23195	exon49			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.7620_7626delTCATTTA	6.37:g.90421780_90421786delTAAATGA	ENSP00000358400:p.Tyr2540fs	Somatic		Capture	SOLID	Phase_I	90478501	NM_014611	O15019|Q5T794	Frame_Shift_Del	DEL	ENST00000369393.3	37	CCDS5024.1																																																																																				MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
HEATR9	256957	hgsc.bcm.edu	37	17	34191815	34191815	+	Nonsense_Mutation	SNP	G	G	A	rs116191233		TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr17:34191815G>A	ENST00000311880.2	-	4	548	c.400C>T	c.(400-402)Cga>Tga	p.R134*	C17orf66_ENST00000592980.1_Intron|C17orf66_ENST00000587585.1_5'UTR	NM_152781.2	NP_689994.2	A2RTY3	HEAT9_HUMAN		134					hematopoietic progenitor cell differentiation (GO:0002244)			p.R134*(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(6)|lung(11)|skin(2)|stomach(4)	38		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		GGCCTGGATCGCATCTCAGAT	0.507													G|||	1	0.000199681	0.0	0.0	5008	,	,		20473	0.0		0.001	False		,,,				2504	0.0				p.R134X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C400T	17						.	G	stop/ARG	0,4406		0,0,2203	220.0	199.0	206.0		400	-3.3	0.0	17	dbSNP_132	206	7,8593	6.4+/-24.3	0,7,4293	yes	stop-gained	C17orf66	NM_152781.2		0,7,6496	AA,AG,GG		0.0814,0.0,0.0538		134/571	34191815	7,12999	2203	4300	6503	31215928	SO:0001587	stop_gained	256957	exon4																														ENST00000311880.2:c.400C>T	17.37:g.34191815G>A	ENSP00000309560:p.Arg134*	Somatic		Capture	SOLID	Phase_I	31215928	NM_152781	B4DX21|B4DXA4|B4DXF0|Q8N4R4|Q96M46	Nonsense_Mutation	SNP	ENST00000311880.2	37	CCDS11299.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	17.20	3.328541	0.60743	0.0	8.14E-4	ENSG00000172653	ENST00000311880	.	.	.	4.53	-3.27	0.05048	.	2.187690	0.01755	N	0.030215	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	.	4.9785	0.14153	0.0:0.2957:0.2948:0.4096	.	.	.	.	X	134	.	ENSP00000309560:R134X	R	-	1	2	C17orf66	31215928	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.361000	0.07612	-0.492000	0.06687	-0.171000	0.13296	CGA		C17orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256487.1		
SLC4A1	6521	hgsc.bcm.edu	37	17	42338114	42338114	+	Missense_Mutation	SNP	G	G	A	rs199535281		TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr17:42338114G>A	ENST00000262418.6	-	5	393	c.238C>T	c.(238-240)Cgc>Tgc	p.R80C	SLC4A1_ENST00000471005.1_5'UTR|AC003043.1_ENST00000597382.1_Intron	NM_000342.3	NP_000333.1	P02730	B3AT_HUMAN	solute carrier family 4 (anion exchanger), member 1 (Diego blood group)	80	Globular.				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular ion homeostasis (GO:0006873)|chloride transport (GO:0006821)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cortical cytoskeleton (GO:0030863)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	anion transmembrane transporter activity (GO:0008509)|anion:anion antiporter activity (GO:0015301)|ankyrin binding (GO:0030506)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)	p.R80C(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	40		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		TGCACCCAGCGCGCCGCCTCC	0.617																																					p.R80C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C238T	17						.						68.0	63.0	64.0					17																	42338114		2203	4300	6503	39693640	SO:0001583	missense	6521	exon5				CCDS11481.1	17q21.31	2014-07-19	2014-01-02		ENSG00000004939	ENSG00000004939		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	11027	protein-coding gene	gene with protein product	"""Froese blood group"", ""Swann blood group"", ""Wright blood group"""	109270	"""Waldner blood group"", ""erythrocyte membrane protein band 3"", ""Diego blood group"", ""solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)"", ""solute carrier family 4 (anion exchanger), member 1"""	EPB3, AE1, DI, WD		8434259	Standard	NM_000342		Approved	RTA1A, CD233, FR, SW, WR	uc002igf.4	P02730	OTTHUMG00000156843	ENST00000262418.6:c.238C>T	17.37:g.42338114G>A	ENSP00000262418:p.Arg80Cys	Somatic		Capture	SOLID	Phase_I	39693640	NM_000342	G4V2I6|P78487|Q1ZZ45|Q4KKW9|Q4VB84|Q9UCY7|Q9UDJ1	Missense_Mutation	SNP	ENST00000262418.6	37	CCDS11481.1	.	.	.	.	.	.	.	.	.	.	g	20.7	4.031257	0.75504	.	.	ENSG00000004939	ENST00000262418	D	0.86030	-2.06	5.51	5.51	0.81932	Bicarbonate transporter, cytoplasmic (1);Phosphotransferase/anion transporter (1);	0.327353	0.32314	N	0.006266	D	0.93038	0.7784	M	0.82517	2.595	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.98;1.0	D	0.93728	0.7039	10	0.87932	D	0	.	18.1867	0.89795	0.0:0.0:1.0:0.0	.	80;80	E2RVJ0;P02730	.;B3AT_HUMAN	C	80	ENSP00000262418:R80C	ENSP00000262418:R80C	R	-	1	0	SLC4A1	39693640	1.000000	0.71417	0.031000	0.17742	0.182000	0.23217	9.824000	0.99380	2.595000	0.87683	0.561000	0.74099	CGC		SLC4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346194.1	NM_000342	
MYL4	4635	hgsc.bcm.edu	37	17	45286835	45286835	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr17:45286835C>A	ENST00000354968.1	+	2	175	c.47C>A	c.(46-48)gCt>gAt	p.A16D	MYL4_ENST00000572316.1_Missense_Mutation_p.A16D|MYL4_ENST00000393450.1_Missense_Mutation_p.A16D	NM_001002841.1	NP_001002841.1	P12829	MYL4_HUMAN	myosin, light chain 4, alkali; atrial, embryonic	16					cardiac muscle contraction (GO:0060048)|muscle filament sliding (GO:0030049)|positive regulation of ATPase activity (GO:0032781)|regulation of the force of heart contraction (GO:0002026)	A band (GO:0031672)|cytosol (GO:0005829)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|calcium ion binding (GO:0005509)|myosin II heavy chain binding (GO:0032038)	p.A16D(1)		endometrium(2)|large_intestine(1)|lung(4)|ovary(3)|prostate(1)	11						GCCAAGccagctccagctcca	0.572																																					p.A16D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C47A	17						.						65.0	65.0	65.0					17																	45286835		2203	4300	6503	42641834	SO:0001583	missense	4635	exon2				CCDS11510.1	17q21.32	2013-09-19	2006-09-29		ENSG00000198336	ENSG00000198336		"""Myosins / Light chain"", ""EF-hand domain containing"""	7585	protein-coding gene	gene with protein product	"""myosin, atrial/fetal muscle, light chain"""	160770	"""myosin, light polypeptide 4, alkali; atrial, embryonic"""			3417683	Standard	NM_002476		Approved	ALC1, AMLC, GT1, PRO1957	uc002ilg.3	P12829	OTTHUMG00000178232	ENST00000354968.1:c.47C>A	17.37:g.45286835C>A	ENSP00000347055:p.Ala16Asp	Somatic		Capture	SOLID	Phase_I	42641834	NM_001002841	D3DXJ7|P11783	Missense_Mutation	SNP	ENST00000354968.1	37	CCDS11510.1	.	.	.	.	.	.	.	.	.	.	C	1.073	-0.669416	0.03403	.	.	ENSG00000198336	ENST00000354968;ENST00000393450	T;T	0.15017	2.46;2.46	5.09	3.07	0.35406	.	0.515048	0.18750	N	0.132213	T	0.11153	0.0272	L	0.34521	1.04	0.39901	D	0.97389	B	0.23058	0.079	B	0.17979	0.02	T	0.15867	-1.0422	10	0.20519	T	0.43	-8.6985	7.068	0.25164	0.0:0.7318:0.1737:0.0945	.	16	P12829	MYL4_HUMAN	D	16	ENSP00000347055:A16D;ENSP00000377096:A16D	ENSP00000347055:A16D	A	+	2	0	MYL4	42641834	0.446000	0.25665	0.467000	0.27180	0.020000	0.10135	0.776000	0.26704	0.543000	0.28864	-0.175000	0.13238	GCT		MYL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441059.1	NM_001002841	
NXPH3	11248	hgsc.bcm.edu	37	17	47656407	47656407	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr17:47656407G>T	ENST00000328741.5	+	2	866	c.504G>T	c.(502-504)aaG>aaT	p.K168N	RP5-1029K10.4_ENST00000503624.1_RNA|NXPH3_ENST00000513748.1_Missense_Mutation_p.K168N	NM_007225.2	NP_009156.2	O95157	NXPH3_HUMAN	neurexophilin 3	168	V (Cys-rich).				neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)		p.K168N(1)		endometrium(2)|large_intestine(3)|lung(4)|pancreas(1)|skin(2)	12	all_cancers(4;7.45e-14)|Breast(4;1.08e-27)|all_epithelial(4;2.27e-17)					TCGAAGCCAAGGCCTCCAAAA	0.577																																					p.K168N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G504T	17						.						109.0	99.0	102.0					17																	47656407		2203	4300	6503	45011406	SO:0001583	missense	11248	exon2			AF043468	CCDS11550.1	17q	2008-07-03				ENSG00000182575			8077	protein-coding gene	gene with protein product		604636				9570794	Standard	NM_007225		Approved	NPH3	uc002ipa.3	O95157		ENST00000328741.5:c.504G>T	17.37:g.47656407G>T	ENSP00000329295:p.Lys168Asn	Somatic		Capture	SOLID	Phase_I	45011406	NM_007225	Q8NDC3|Q8TBF6|Q9ULR1	Missense_Mutation	SNP	ENST00000328741.5	37	CCDS11550.1	.	.	.	.	.	.	.	.	.	.	g	17.11	3.305766	0.60305	.	.	ENSG00000182575	ENST00000328741;ENST00000513748	.	.	.	4.44	2.28	0.28536	.	0.000000	0.85682	D	0.000000	T	0.75874	0.3909	M	0.82517	2.595	0.50313	D	0.999862	D;D	0.89917	1.0;0.993	D;D	0.91635	0.999;0.909	T	0.75955	-0.3135	9	0.72032	D	0.01	-17.1607	6.7992	0.23742	0.3078:0.0:0.6922:0.0	.	168;168	D6RGW2;O95157	.;NXPH3_HUMAN	N	168	.	ENSP00000329295:K168N	K	+	3	2	NXPH3	45011406	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.518000	0.35877	1.093000	0.41377	0.556000	0.70494	AAG		NXPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365143.1		
RNF43	54894	hgsc.bcm.edu	37	17	56435547	56435547	+	Silent	SNP	A	A	G			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr17:56435547A>G	ENST00000584437.1	-	8	3545	c.1590T>C	c.(1588-1590)ccT>ccC	p.P530P	RNF43_ENST00000583753.1_Silent_p.P489P|RNF43_ENST00000577625.1_Silent_p.P403P|RNF43_ENST00000581868.1_Silent_p.P403P|BZRAP1-AS1_ENST00000583841.1_RNA|RNF43_ENST00000577716.1_Silent_p.P530P|RNF43_ENST00000407977.2_Silent_p.P530P|RNF43_ENST00000500597.2_Silent_p.P489P			Q68DV7	RNF43_HUMAN	ring finger protein 43	530					negative regulation of Wnt signaling pathway (GO:0030178)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|stem cell proliferation (GO:0072089)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P530P(1)		NS(1)|biliary_tract(5)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(14)|lung(9)|ovary(2)|pancreas(10)|prostate(1)|skin(4)	60	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CCAAGGAACGAGGCCGAGAGG	0.592																																					p.P530P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1590C	17						.						77.0	75.0	76.0					17																	56435547		2203	4300	6503	53790546	SO:0001819	synonymous_variant	54894	exon9				CCDS11607.1	17q23.2	2013-01-09						"""RING-type (C3HC4) zinc fingers"""	18505	protein-coding gene	gene with protein product		612482					Standard	NM_017763		Approved	FLJ20315, DKFZp781H0392, URCC	uc002iwh.4	Q68DV7		ENST00000584437.1:c.1590T>C	17.37:g.56435547A>G		Somatic		Capture	SOLID	Phase_I	53790546	NM_017763	A8K4R2|B7Z443|B7Z5D5|B7Z5J5|Q65ZA4|Q6AI04|Q9NXD0	Silent	SNP	ENST00000584437.1	37	CCDS11607.1																																																																																				RNF43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444713.1	NM_017763	
TTYH2	94015	hgsc.bcm.edu	37	17	72245194	72245194	+	Silent	SNP	C	C	T	rs371708540		TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr17:72245194C>T	ENST00000269346.4	+	7	923	c.849C>T	c.(847-849)aaC>aaT	p.N283N	TTYH2_ENST00000441391.2_5'UTR|TTYH2_ENST00000529107.1_Silent_p.N262N|TTYH2_ENST00000534346.1_3'UTR	NM_032646.5	NP_116035.5	Q9BSA4	TTYH2_HUMAN	tweety family member 2	283						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)	p.N283N(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(14)|ovary(3)|pancreas(1)|stomach(3)|upper_aerodigestive_tract(1)	36						TCATCCTGAACGTCACGGAGG	0.577																																					p.N283N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C849T	17						.	C	,	0,4406		0,0,2203	147.0	116.0	126.0		849,	0.8	0.7	17		126	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,utr-5	TTYH2	NM_032646.5,NM_052869.1	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	283/535,	72245194	1,13005	2203	4300	6503	69756789	SO:0001819	synonymous_variant	94015	exon7				CCDS32717.1, CCDS45770.1	17q25.1	2013-09-02	2013-09-02		ENSG00000141540	ENSG00000141540			13877	protein-coding gene	gene with protein product		608855	"""tweety (Drosophila) homolog 2"", ""tweety homolog 2 (Drosophila)"""			11597145	Standard	XM_005257824		Approved	C17orf29	uc002jkc.3	Q9BSA4	OTTHUMG00000166018	ENST00000269346.4:c.849C>T	17.37:g.72245194C>T		Somatic		Capture	SOLID	Phase_I	69756789	NM_032646	B3KX97|Q3B7H8|Q3B7R9|Q6AWB4|Q8NBB7|Q96PK1	Silent	SNP	ENST00000269346.4	37	CCDS32717.1																																																																																				TTYH2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387459.1		
KRTAP19-6	337973	hgsc.bcm.edu	37	21	31914112	31914112	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr21:31914112C>T	ENST00000334046.5	-	1	71	c.41G>A	c.(40-42)gGc>gAc	p.G14D		NM_181612.2	NP_853643.1	Q3LI70	KR196_HUMAN	keratin associated protein 19-6	14						intermediate filament (GO:0005882)		p.G14D(1)		breast(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	9						GCCTCCACAGCCATATCCCAG	0.517																																					p.G14D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G41A	21						.						101.0	105.0	104.0					21																	31914112		2203	4300	6503	30835983	SO:0001583	missense	337973	exon1			AP001708	CCDS13598.1	21q22.1	2010-09-30			ENSG00000186925	ENSG00000186925		"""Keratin associated proteins"""	18941	protein-coding gene	gene with protein product						12359730	Standard	NM_181612		Approved	KAP19.6	uc002yok.1	Q3LI70	OTTHUMG00000057779	ENST00000334046.5:c.41G>A	21.37:g.31914112C>T	ENSP00000375107:p.Gly14Asp	Somatic		Capture	SOLID	Phase_I	30835983	NM_181612	Q3LI71	Missense_Mutation	SNP	ENST00000334046.5	37	CCDS13598.1	.	.	.	.	.	.	.	.	.	.	c	3.197	-0.164647	0.06502	.	.	ENSG00000186925	ENST00000334046;ENST00000437381	T	0.27557	1.66	4.33	3.45	0.39498	.	0.451539	0.16460	U	0.213473	T	0.40322	0.1112	.	.	.	0.20764	N	0.999857	P	0.46952	0.887	P	0.52454	0.699	T	0.18398	-1.0338	9	0.87932	D	0	-1.3093	8.5138	0.33233	0.0:0.8884:0.0:0.1116	.	14	Q3LI70	KR196_HUMAN	D	14	ENSP00000375107:G14D	ENSP00000375107:G14D	G	-	2	0	KRTAP19-6	30835983	0.055000	0.20627	0.188000	0.23233	0.069000	0.16628	1.709000	0.37909	0.975000	0.38392	0.597000	0.82753	GGC		KRTAP19-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128231.4		
PDILT	204474	hgsc.bcm.edu	37	16	20410496	20410496	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr16:20410496G>A	ENST00000302451.4	-	2	375	c.127C>T	c.(127-129)Cgc>Tgc	p.R43C		NM_174924.1	NP_777584.1	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis expressed	43					cell migration (GO:0016477)|cell redox homeostasis (GO:0045454)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|spermatid development (GO:0007286)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)	p.R43C(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(33)|prostate(3)|skin(1)|urinary_tract(1)	61						AGGAGACTGCGTTCCTCCAGG	0.592																																					p.R43C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C127T	16						.						159.0	144.0	149.0					16																	20410496		2203	4300	6503	20317997	SO:0001583	missense	204474	exon2				CCDS10584.1	16p12.3	2011-11-10	2009-02-23		ENSG00000169340	ENSG00000169340		"""Protein disulfide isomerases"""	27338	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 7"", ""protein disulfide isomerase-like protein of the testis"""					15475357	Standard	NM_174924		Approved	PDIA7	uc002dhc.1	Q8N807	OTTHUMG00000131487	ENST00000302451.4:c.127C>T	16.37:g.20410496G>A	ENSP00000305465:p.Arg43Cys	Somatic		Capture	SOLID	Phase_I	20317997	NM_174924	Q8IVQ5	Missense_Mutation	SNP	ENST00000302451.4	37	CCDS10584.1	.	.	.	.	.	.	.	.	.	.	G	17.14	3.312419	0.60414	.	.	ENSG00000169340	ENST00000302451	T	0.03272	3.99	4.21	-8.41	0.00961	Thioredoxin-like fold (2);	2.670990	0.00877	N	0.002086	T	0.03053	0.0090	N	0.14661	0.345	0.09310	N	1	D	0.67145	0.996	B	0.43575	0.424	T	0.42241	-0.9463	10	0.72032	D	0.01	.	12.0005	0.53228	0.0:0.179:0.6609:0.1601	.	43	Q8N807	PDILT_HUMAN	C	43	ENSP00000305465:R43C	ENSP00000305465:R43C	R	-	1	0	PDILT	20317997	0.000000	0.05858	0.000000	0.03702	0.329000	0.28539	-1.517000	0.02248	-1.529000	0.01754	0.591000	0.81541	CGC		PDILT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254332.1	NM_174924	
PRSS54	221191	hgsc.bcm.edu	37	16	58325009	58325009	+	Silent	SNP	G	G	A			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr16:58325009G>A	ENST00000219301.4	-	4	511	c.117C>T	c.(115-117)taC>taT	p.Y39Y	PRSS54_ENST00000543437.1_Intron|PRSS54_ENST00000567164.1_Silent_p.Y39Y	NM_001080492.1	NP_001073961.1	Q6PEW0	PRS54_HUMAN	protease, serine, 54	39	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					cytoplasm (GO:0005737)|extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.Y39Y(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						GGTCAGGACCGTAGAAAACGG	0.632																																					p.Y39Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C117T	16						.						69.0	58.0	61.0					16																	58325009		2198	4300	6498	56882510	SO:0001819	synonymous_variant	221191	exon4			AK058068	CCDS32463.1	16q21	2010-05-07			ENSG00000103023	ENSG00000103023		"""Serine peptidases / Serine peptidases"""	26336	protein-coding gene	gene with protein product	"""cancer/testis antigen 67"""					17521433	Standard	NM_001080492		Approved	FLJ25339, KLKBL4, CT67	uc002enf.3	Q6PEW0		ENST00000219301.4:c.117C>T	16.37:g.58325009G>A		Somatic		Capture	SOLID	Phase_I	56882510	NM_001080492	Q96LN9|Q9NT77	Silent	SNP	ENST00000219301.4	37	CCDS32463.1																																																																																				PRSS54-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422556.1	NM_001080492	
CHP2	63928	hgsc.bcm.edu	37	16	23767170	23767170	+	Missense_Mutation	SNP	G	G	A	rs147617371	byFrequency	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr16:23767170G>A	ENST00000300113.2	+	3	566	c.143G>A	c.(142-144)cGc>cAc	p.R48H		NM_022097.2	NP_071380.1	O43745	CHP2_HUMAN	calcineurin-like EF-hand protein 2	48	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cellular response to calcium ion (GO:0071277)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatase activity (GO:0010922)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R48H(1)		central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(2)|stomach(1)	9				GBM - Glioblastoma multiforme(48;0.0144)		CTTTGCAGCCGCATGGATCTC	0.567													G|||	14	0.00279553	0.0106	0.0	5008	,	,		16873	0.0		0.0	False		,,,				2504	0.0				p.R48H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G143A	16						.	G	HIS/ARG	18,4376	25.3+/-52.1	0,18,2179	41.0	47.0	45.0		143	3.7	1.0	16	dbSNP_134	45	0,8600		0,0,4300	yes	missense	CHP2	NM_022097.2	29	0,18,6479	AA,AG,GG		0.0,0.4096,0.1385	probably-damaging	48/197	23767170	18,12976	2197	4300	6497	23674671	SO:0001583	missense	63928	exon3				CCDS10617.1	16p12.2	2013-01-11	2013-01-11		ENSG00000166869	ENSG00000166869		"""EF-hand domain containing"""	24927	protein-coding gene	gene with protein product						12226101	Standard	NM_022097		Approved		uc002dmb.1	O43745	OTTHUMG00000131611	ENST00000300113.2:c.143G>A	16.37:g.23767170G>A	ENSP00000300113:p.Arg48His	Somatic		Capture	SOLID	Phase_I	23674671	NM_022097	A8K2I8	Missense_Mutation	SNP	ENST00000300113.2	37	CCDS10617.1	4	0.0018315018315018315	4	0.008130081300813009	0	0.0	0	0.0	0	0.0	G	16.23	3.065810	0.55539	0.004096	0.0	ENSG00000166869	ENST00000300113	T	0.69561	-0.41	4.65	3.69	0.42338	EF-hand-like domain (1);	0.071753	0.56097	D	0.000035	T	0.60011	0.2236	M	0.77616	2.38	0.52501	D	0.999954	P	0.35774	0.519	B	0.40066	0.318	T	0.63014	-0.6731	10	0.30078	T	0.28	-13.3438	10.6331	0.45549	0.0946:0.0:0.9054:0.0	.	48	O43745	CHP2_HUMAN	H	48	ENSP00000300113:R48H	ENSP00000300113:R48H	R	+	2	0	AC130454.2	23674671	1.000000	0.71417	0.998000	0.56505	0.954000	0.61252	3.574000	0.53863	1.311000	0.45024	0.591000	0.81541	CGC		CHP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254498.1	NM_022097	
CNOT1	23019	hgsc.bcm.edu	37	16	58581144	58581144	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr16:58581144C>A	ENST00000317147.5	-	27	4028	c.3696G>T	c.(3694-3696)ttG>ttT	p.L1232F	CNOT1_ENST00000245138.4_Missense_Mutation_p.L83F|SNORA46_ENST00000384762.1_RNA|CNOT1_ENST00000569240.1_Missense_Mutation_p.L1227F|CNOT1_ENST00000441024.2_Missense_Mutation_p.L1232F	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	1232	Interaction with CNOT6, CNOT6L, CNOT7 and CNOT8.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)	p.L1232F(1)		breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		CTACATAGAGCAATTCTTGTT	0.358																																					p.L1232F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3696T	16						.						115.0	119.0	117.0					16																	58581144		2198	4300	6498	57138645	SO:0001583	missense	23019	exon27			AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.3696G>T	16.37:g.58581144C>A	ENSP00000320949:p.Leu1232Phe	Somatic		Capture	SOLID	Phase_I	57138645	NM_206999	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	37	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	C	19.00	3.742300	0.69418	.	.	ENSG00000125107	ENST00000317147;ENST00000245138;ENST00000394200;ENST00000441024	T;T	0.20598	2.06;2.06	5.65	5.65	0.86999	.	0.063154	0.64402	D	0.000007	T	0.50531	0.1621	M	0.85542	2.76	0.80722	D	1	D;P;D;D	0.71674	0.998;0.944;0.986;0.995	D;P;P;D	0.74348	0.983;0.646;0.87;0.971	T	0.55642	-0.8109	10	0.87932	D	0	.	14.5474	0.68041	0.1464:0.8536:0.0:0.0	.	83;1232;1232;1227	B5MDN3;A5YKK6-4;A5YKK6;A5YKK6-2	.;.;CNOT1_HUMAN;.	F	1232;83;1227;1232	ENSP00000320949:L1232F;ENSP00000413113:L1232F	ENSP00000245138:L83F	L	-	3	2	CNOT1	57138645	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	0.561000	0.23515	2.675000	0.91044	0.650000	0.86243	TTG		CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	
CTIF	9811	hgsc.bcm.edu	37	18	46197071	46197071	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr18:46197071G>C	ENST00000256413.3	+	6	758	c.463G>C	c.(463-465)Ggc>Cgc	p.G155R	RP11-426J5.2_ENST00000589818.1_RNA|CTIF_ENST00000382998.4_Missense_Mutation_p.G155R|MIR4743_ENST00000584576.1_RNA	NM_014772.2	NP_055587.1	O43310	CTIF_HUMAN	CBP80/20-dependent translation initiation factor	155	Interaction with NCBP1/CBP80.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational initiation (GO:0006446)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)	p.G155R(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(14)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	31						AGATGGGGATGGCATCAACCT	0.577																																					p.G155R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G463C	18						.						213.0	165.0	181.0					18																	46197071		2203	4300	6503	44451069	SO:0001583	missense	9811	exon7			AB007887	CCDS11935.1, CCDS45864.1	18q21.1	2011-01-20	2011-01-20	2011-01-20	ENSG00000134030	ENSG00000134030			23925	protein-coding gene	gene with protein product		613178	"""KIAA0427"""	KIAA0427		9455477, 19648179	Standard	NM_014772		Approved		uc002ldd.3	O43310	OTTHUMG00000132656	ENST00000256413.3:c.463G>C	18.37:g.46197071G>C	ENSP00000256413:p.Gly155Arg	Somatic		Capture	SOLID	Phase_I	44451069	NM_001142397	B3KTR8|Q8IVD5	Missense_Mutation	SNP	ENST00000256413.3	37	CCDS11935.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.096293	0.76870	.	.	ENSG00000134030	ENST00000256413;ENST00000382998;ENST00000420275	T;T	0.52754	0.65;0.65	5.11	4.19	0.49359	.	0.355965	0.27035	N	0.021255	T	0.50034	0.1592	L	0.43152	1.355	0.45995	D	0.9988	P;P	0.49783	0.928;0.883	P;B	0.51385	0.668;0.391	T	0.52373	-0.8584	10	0.87932	D	0	-14.7168	11.6303	0.51171	0.0939:0.0:0.9061:0.0	.	155;155	O43310-2;O43310	.;CTIF_HUMAN	R	155;155;107	ENSP00000256413:G155R;ENSP00000372459:G155R	ENSP00000256413:G155R	G	+	1	0	CTIF	44451069	1.000000	0.71417	0.983000	0.44433	0.950000	0.60333	2.489000	0.45285	1.068000	0.40764	-0.378000	0.06908	GGC		CTIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255907.1	NM_014772	
STAG1	10274	hgsc.bcm.edu	37	3	136141796	136141796	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr3:136141796T>C	ENST00000383202.2	-	17	1997	c.1741A>G	c.(1741-1743)Aag>Gag	p.K581E	STAG1_ENST00000236698.5_Missense_Mutation_p.K581E|STAG1_ENST00000536929.1_Missense_Mutation_p.K165E|STAG1_ENST00000434713.2_Missense_Mutation_p.K355E	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	581					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.K581E(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						AACTGTACCTTTGACAGTAAC	0.308																																					p.K581E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1741G	3						.						104.0	100.0	101.0					3																	136141796		2202	4299	6501	137624486	SO:0001583	missense	10274	exon17			Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.1741A>G	3.37:g.136141796T>C	ENSP00000372689:p.Lys581Glu	Somatic		Capture	SOLID	Phase_I	137624486	NM_005862	O00539|Q6P275	Missense_Mutation	SNP	ENST00000383202.2	37	CCDS3090.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.047868	0.75846	.	.	ENSG00000118007	ENST00000383202;ENST00000236698;ENST00000434713;ENST00000536929	T;T;T;T	0.15017	2.46;2.46;2.46;2.46	5.86	5.86	0.93980	Armadillo-like helical (1);Armadillo-type fold (1);	0.045892	0.85682	N	0.000000	T	0.27629	0.0679	M	0.67569	2.06	0.80722	D	1	P;B;P	0.41450	0.75;0.09;0.75	B;B;B	0.43360	0.417;0.076;0.417	T	0.02196	-1.1197	10	0.87932	D	0	.	16.2913	0.82755	0.0:0.0:0.0:1.0	.	598;581;581	Q4LE48;Q6P275;Q8WVM7	.;.;STAG1_HUMAN	E	581;581;355;165	ENSP00000372689:K581E;ENSP00000236698:K581E;ENSP00000404396:K355E;ENSP00000445787:K165E	ENSP00000236698:K581E	K	-	1	0	STAG1	137624486	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	8.040000	0.89188	2.248000	0.74166	0.529000	0.55759	AAG		STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357366.1	NM_005862	
RBMS3	27303	hgsc.bcm.edu	37	3	29910415	29910415	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr3:29910415A>C	ENST00000383767.2	+	7	1040	c.704A>C	c.(703-705)aAa>aCa	p.K235T	RBMS3_ENST00000445033.1_Missense_Mutation_p.K235T|RBMS3_ENST00000396583.3_Missense_Mutation_p.K235T|RBMS3_ENST00000452462.1_Missense_Mutation_p.K235T|RBMS3_ENST00000273139.9_Missense_Mutation_p.K235T|RBMS3_ENST00000434693.2_Missense_Mutation_p.K234T|RBMS3_ENST00000383766.2_Missense_Mutation_p.K234T|RBMS3_ENST00000456853.1_Missense_Mutation_p.K235T			Q6XE24	RBMS3_HUMAN	RNA binding motif, single stranded interacting protein 3	235					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)	p.K235T(1)		breast(1)|central_nervous_system(1)|large_intestine(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	11		Ovarian(412;0.0956)				AATCAAAGCAAATATACCCAG	0.463																																					p.K235T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A704C	3						.						65.0	58.0	60.0					3																	29910415		2203	4300	6503	29885419	SO:0001583	missense	27303	exon7			AF023259	CCDS33724.1, CCDS33725.1, CCDS33726.1, CCDS54557.1, CCDS54558.1	3p24-p23	2013-02-12	2010-04-20		ENSG00000144642	ENSG00000144642		"""RNA binding motif (RRM) containing"""	13427	protein-coding gene	gene with protein product	"""RNA-binding protein"""	605786	"""RNA binding motif, single stranded interacting protein"""			10675610	Standard	NM_001003793		Approved		uc003cel.3	Q6XE24	OTTHUMG00000155699	ENST00000383767.2:c.704A>C	3.37:g.29910415A>C	ENSP00000373277:p.Lys235Thr	Somatic		Capture	SOLID	Phase_I	29885419	NM_001003793	A8K9S4|B7ZL17|G5E9J9|O75876|Q17RI0|Q6XE23	Missense_Mutation	SNP	ENST00000383767.2	37	CCDS33724.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.339000	0.81911	.	.	ENSG00000144642	ENST00000434693;ENST00000396583;ENST00000383767;ENST00000445033;ENST00000273139;ENST00000383766;ENST00000452462;ENST00000456853	T;T;T;T;T;T;T;T	0.74002	-0.8;1.68;-0.8;-0.8;-0.8;1.79;-0.8;1.68	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	D	0.85869	0.5797	M	0.79805	2.47	0.80722	D	1	D;P;P;D	0.63046	0.991;0.935;0.575;0.992	D;P;B;D	0.65010	0.931;0.856;0.372;0.917	D	0.86635	0.1888	9	.	.	.	.	16.2762	0.82644	1.0:0.0:0.0:0.0	.	235;235;234;235	G5E9J9;Q6XE24-2;Q6XE24-3;Q6XE24	.;.;.;RBMS3_HUMAN	T	234;235;235;235;235;234;235;235	ENSP00000395592:K234T;ENSP00000379828:K235T;ENSP00000373277:K235T;ENSP00000391934:K235T;ENSP00000273139:K235T;ENSP00000373276:K234T;ENSP00000397926:K235T;ENSP00000400519:K235T	.	K	+	2	0	RBMS3	29885419	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.243000	0.73865	0.482000	0.46254	AAA		RBMS3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341306.1	NM_001003792	
UBP1	7342	hgsc.bcm.edu	37	3	33450220	33450220	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr3:33450220G>A	ENST00000283629.3	-	8	1418	c.889C>T	c.(889-891)Cca>Tca	p.P297S	UBP1_ENST00000283628.5_Missense_Mutation_p.P297S|UBP1_ENST00000486388.1_5'Flank|UBP1_ENST00000447368.2_Intron	NM_001128161.1|NM_014517.4	NP_001121633.1|NP_055332.3	Q9NZI7	UBIP1_HUMAN	upstream binding protein 1 (LBP-1a)	297				SSKRTLP -> VQQADFA (in Ref. 1). {ECO:0000305}.	angiogenesis (GO:0001525)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.P297S(2)		breast(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|urinary_tract(2)	23						TAGTCTGCTGGCAAAGTCCGC	0.448																																					p.P297S												.	.	2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	c.C889T	3						.						121.0	115.0	117.0					3																	33450220		2203	4300	6503	33425224	SO:0001583	missense	7342	exon9			AF198487	CCDS2659.1, CCDS46788.1	3p22.3	2004-03-02			ENSG00000153560	ENSG00000153560			12507	protein-coding gene	gene with protein product		609784				8114710	Standard	NM_014517		Approved	LBP-1a	uc010hga.3	Q9NZI7	OTTHUMG00000130749	ENST00000283629.3:c.889C>T	3.37:g.33450220G>A	ENSP00000283629:p.Pro297Ser	Somatic		Capture	SOLID	Phase_I	33425224	NM_001128161	Q68CT0|Q86Y57|Q9H8V0|Q9UD76|Q9UD78	Missense_Mutation	SNP	ENST00000283629.3	37	CCDS2659.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.011871	0.75046	.	.	ENSG00000153560	ENST00000283629;ENST00000283628	T;T	0.16897	2.31;2.31	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.33933	0.0880	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.00376	-1.1779	10	0.31617	T	0.26	-11.0023	18.833	0.92148	0.0:0.0:1.0:0.0	.	297	Q9NZI7	UBIP1_HUMAN	S	297	ENSP00000283629:P297S;ENSP00000283628:P297S	ENSP00000283628:P297S	P	-	1	0	UBP1	33425224	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.855000	0.92236	2.890000	0.99128	0.585000	0.79938	CCA		UBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253249.2	NM_014517	
ZNF502	91392	hgsc.bcm.edu	37	3	44763242	44763242	+	Silent	SNP	G	G	A			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr3:44763242G>A	ENST00000296091.4	+	4	1189	c.933G>A	c.(931-933)acG>acA	p.T311T	ZNF502_ENST00000449836.1_Silent_p.T311T|ZNF502_ENST00000436624.2_Silent_p.T311T	NM_001134440.1|NM_001282880.1|NM_033210.4	NP_001127912.1|NP_001269809.1|NP_149987.2	Q8TBZ5	ZN502_HUMAN	zinc finger protein 502	311					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T311T(1)		NS(1)|endometrium(4)|large_intestine(8)|lung(4)|prostate(1)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00855)|KIRC - Kidney renal clear cell carcinoma(197;0.0471)|Kidney(197;0.0589)		CAAATCTTACGCAACATCAGA	0.403																																					p.T311T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G933A	3						.						131.0	138.0	136.0					3																	44763242		2202	4300	6502	44738246	SO:0001819	synonymous_variant	91392	exon4			AK022577	CCDS2719.1	3p21.32	2013-01-08			ENSG00000196653	ENSG00000196653		"""Zinc fingers, C2H2-type"""	23718	protein-coding gene	gene with protein product							Standard	NM_033210		Approved	FLJ14855, FLJ12515	uc003cnt.3	Q8TBZ5	OTTHUMG00000133086	ENST00000296091.4:c.933G>A	3.37:g.44763242G>A		Somatic		Capture	SOLID	Phase_I	44738246	NM_033210		Silent	SNP	ENST00000296091.4	37	CCDS2719.1	.	.	.	.	.	.	.	.	.	.	A	4.482	0.089388	0.08632	.	.	ENSG00000196653	ENST00000427783	.	.	.	4.27	-4.48	0.03515	.	.	.	.	.	T	0.38799	0.1054	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.50004	-0.8878	5	0.56958	D	0.05	-0.2728	9.2112	0.37320	0.1566:0.6668:0.0777:0.0989	.	.	.	.	H	311	.	ENSP00000397812:R311H	R	+	2	0	ZNF502	44738246	0.000000	0.05858	0.004000	0.12327	0.931000	0.56810	-5.056000	0.00155	-0.801000	0.04427	-0.254000	0.11334	CGC		ZNF502-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256744.4	NM_033210	
IQCF2	389123	hgsc.bcm.edu	37	3	51897156	51897156	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr3:51897156C>T	ENST00000333127.3	+	3	294	c.265C>T	c.(265-267)Cgg>Tgg	p.R89W	IQCF2_ENST00000429548.1_3'UTR	NM_203424.1	NP_982248.1	Q8IXL9	IQCF2_HUMAN	IQ motif containing F2	89								p.R89W(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GGAGAAGAAACGGCAGGCAGC	0.612																																					p.R89W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C265T	3						.						99.0	95.0	97.0					3																	51897156		2203	4300	6503	51872196	SO:0001583	missense	389123	exon3			AK128883	CCDS2835.1	3p21.31	2008-02-05			ENSG00000184345	ENSG00000184345			31815	protein-coding gene	gene with protein product							Standard	NM_203424		Approved		uc003dbt.1	Q8IXL9	OTTHUMG00000156914	ENST00000333127.3:c.265C>T	3.37:g.51897156C>T	ENSP00000329904:p.Arg89Trp	Somatic		Capture	SOLID	Phase_I	51872196	NM_203424		Missense_Mutation	SNP	ENST00000333127.3	37	CCDS2835.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.160000	0.78226	.	.	ENSG00000184345	ENST00000333127	T	0.71461	-0.57	4.95	3.06	0.35304	.	0.148704	0.31392	N	0.007731	D	0.83238	0.5211	M	0.86502	2.82	0.09310	N	1	D	0.76494	0.999	D	0.69479	0.964	T	0.74856	-0.3522	10	0.87932	D	0	-25.0702	10.1516	0.42796	0.3886:0.6114:0.0:0.0	.	89	Q8IXL9	IQCF2_HUMAN	W	89	ENSP00000329904:R89W	ENSP00000329904:R89W	R	+	1	2	IQCF2	51872196	0.284000	0.24287	0.286000	0.24833	0.636000	0.38137	2.134000	0.42102	0.702000	0.31825	0.561000	0.74099	CGG		IQCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346594.1	NM_203424	
PDZRN3	23024	hgsc.bcm.edu	37	3	73433742	73433742	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr3:73433742C>T	ENST00000263666.4	-	10	2089	c.1975G>A	c.(1975-1977)Gcc>Acc	p.A659T	PDZRN3_ENST00000479530.1_Missense_Mutation_p.A376T|PDZRN3_ENST00000466780.1_Missense_Mutation_p.A316T|PDZRN3_ENST00000466348.1_5'Flank|PDZRN3_ENST00000535920.1_Missense_Mutation_p.A381T|PDZRN3_ENST00000462146.2_Missense_Mutation_p.A316T	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	659					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A659T(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		TAAGGGGTGGCGCTCTTCACC	0.652																																					p.A659T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1975A	3						.						46.0	50.0	49.0					3																	73433742		2203	4300	6503	73516432	SO:0001583	missense	23024	exon10			AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.1975G>A	3.37:g.73433742C>T	ENSP00000263666:p.Ala659Thr	Somatic		Capture	SOLID	Phase_I	73516432	NM_015009	A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Missense_Mutation	SNP	ENST00000263666.4	37	CCDS33789.1	.	.	.	.	.	.	.	.	.	.	C	2.462	-0.323797	0.05350	.	.	ENSG00000121440	ENST00000263666;ENST00000535920;ENST00000462146;ENST00000466780;ENST00000479530;ENST00000492909	T;T;T;T;T;T	0.09817	2.94;3.63;3.52;3.52;3.64;3.63	4.84	-0.324	0.12706	.	0.793883	0.11793	N	0.529012	T	0.08714	0.0216	L	0.51422	1.61	0.09310	N	1	B;B;B;B	0.12013	0.001;0.005;0.003;0.001	B;B;B;B	0.08055	0.003;0.002;0.001;0.001	T	0.38436	-0.9661	10	0.24483	T	0.36	.	4.8184	0.13378	0.1367:0.4536:0.0:0.4098	.	381;376;376;659	F5H8I9;B7ZAG0;B7Z5X9;Q9UPQ7	.;.;.;PZRN3_HUMAN	T	659;381;316;316;376;357	ENSP00000263666:A659T;ENSP00000442026:A381T;ENSP00000418168:A316T;ENSP00000418484:A316T;ENSP00000418624:A376T;ENSP00000419250:A357T	ENSP00000263666:A659T	A	-	1	0	PDZRN3	73516432	0.554000	0.26522	0.000000	0.03702	0.027000	0.11550	-0.071000	0.11505	-0.163000	0.10946	0.655000	0.94253	GCC		PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	XM_041363	
CNTN3	5067	hgsc.bcm.edu	37	3	74411158	74411158	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr3:74411158T>A	ENST00000263665.6	-	10	1274	c.1247A>T	c.(1246-1248)aAg>aTg	p.K416M		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	416	Ig-like C2-type 5.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.K416M(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		AACCAACTTCTTCATTGGATT	0.473																																					p.K416M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1247T	3						.						61.0	66.0	65.0					3																	74411158		2203	4300	6503	74493848	SO:0001583	missense	5067	exon10			AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.1247A>T	3.37:g.74411158T>A	ENSP00000263665:p.Lys416Met	Somatic		Capture	SOLID	Phase_I	74493848	NM_020872	B9EK50|Q9H039	Missense_Mutation	SNP	ENST00000263665.6	37	CCDS33790.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.022176	0.75275	.	.	ENSG00000113805	ENST00000263665	T	0.61040	0.14	5.71	3.33	0.38152	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.104953	0.64402	D	0.000004	T	0.67711	0.2922	M	0.72118	2.19	0.53005	D	0.999969	D	0.54207	0.965	P	0.57548	0.823	T	0.68104	-0.5497	10	0.87932	D	0	.	9.797	0.40742	0.0:0.141:0.0:0.859	.	416	Q9P232	CNTN3_HUMAN	M	416	ENSP00000263665:K416M	ENSP00000263665:K416M	K	-	2	0	CNTN3	74493848	1.000000	0.71417	0.917000	0.36280	0.987000	0.75469	1.784000	0.38674	0.442000	0.26555	0.482000	0.46254	AAG		CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352306.1	NM_020872	
EPHA3	2042	hgsc.bcm.edu	37	3	89468517	89468517	+	Missense_Mutation	SNP	G	G	C	rs372257039		TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr3:89468517G>C	ENST00000336596.2	+	11	2276	c.2051G>C	c.(2050-2052)cGa>cCa	p.R684P	EPHA3_ENST00000494014.1_Missense_Mutation_p.R684P	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	684	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.R684Q(1)|p.R684P(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		AATATCATTCGACTGGAAGGA	0.433										TSP Lung(6;0.00050)																											p.R684P												.	.	2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|large_intestine(1)	c.G2051C	3						.						104.0	98.0	100.0					3																	89468517		2203	4299	6502	89551207	SO:0001583	missense	2042	exon11			M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.2051G>C	3.37:g.89468517G>C	ENSP00000337451:p.Arg684Pro	Somatic		Capture	SOLID	Phase_I	89551207	NM_005233	Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	37	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.289774	0.80914	.	.	ENSG00000044524	ENST00000336596;ENST00000494014	T;T	0.64438	-0.1;-0.1	5.71	5.71	0.89125	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.75199	0.3817	L	0.47016	1.485	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71692	-0.4516	9	.	.	.	.	19.8493	0.96733	0.0:0.0:1.0:0.0	.	684	P29320	EPHA3_HUMAN	P	684	ENSP00000337451:R684P;ENSP00000419190:R684P	.	R	+	2	0	EPHA3	89551207	1.000000	0.71417	0.766000	0.31476	0.590000	0.36582	9.869000	0.99810	2.701000	0.92244	0.563000	0.77884	CGA		EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233	
VEPH1	79674	hgsc.bcm.edu	37	3	157081404	157081404	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr3:157081404T>G	ENST00000362010.2	-	9	1791	c.1484A>C	c.(1483-1485)aAg>aCg	p.K495T	RP11-550I24.2_ENST00000487238.1_RNA|VEPH1_ENST00000392832.2_Missense_Mutation_p.K495T|VEPH1_ENST00000543418.1_Missense_Mutation_p.K495T|VEPH1_ENST00000392833.2_Missense_Mutation_p.K495T	NM_001167912.1	NP_001161384.1	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain-containing 1	495						plasma membrane (GO:0005886)		p.K495T(1)		autonomic_ganglia(1)|breast(5)|cervix(1)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|pancreas(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			AGTGTCTGTCTTAAACGGCAG	0.428																																					p.K495T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1484C	3						.						102.0	108.0	106.0					3																	157081404		2203	4300	6503	158564098	SO:0001583	missense	79674	exon9			AL713656	CCDS3179.1, CCDS54661.1, CCDS54662.1, CCDS54663.1	3q24-q25	2013-01-10	2012-12-10		ENSG00000197415	ENSG00000197415		"""Pleckstrin homology (PH) domain containing"""	25735	protein-coding gene	gene with protein product		609594	"""ventricular zone expressed PH domain homolog 1 (zebrafish)"""			11214970, 15388229	Standard	NM_024621		Approved	FLJ12604, KIAA1692	uc003fbk.2	Q14D04	OTTHUMG00000158711	ENST00000362010.2:c.1484A>C	3.37:g.157081404T>G	ENSP00000354919:p.Lys495Thr	Somatic		Capture	SOLID	Phase_I	158564098	NM_001167911	D3DNL0|F5GZ91|Q2TAA9|Q3MIX2|Q6PEL3|Q86TL5|Q8TCR3|Q96SP7|Q9C0H1|Q9H9Q7	Missense_Mutation	SNP	ENST00000362010.2	37	CCDS3179.1	.	.	.	.	.	.	.	.	.	.	T	9.758	1.169232	0.21621	.	.	ENSG00000197415	ENST00000392833;ENST00000362010;ENST00000543418;ENST00000392832	T;T;T;T	0.11385	2.78;2.78;2.78;2.78	5.37	4.22	0.49857	.	0.604741	0.18000	N	0.154931	T	0.08537	0.0212	L	0.32530	0.975	0.09310	N	0.999995	B;B	0.22983	0.078;0.002	B;B	0.21708	0.036;0.006	T	0.29971	-0.9994	10	0.34782	T	0.22	-2.2986	7.406	0.26991	0.0:0.2168:0.0:0.7832	.	495;495	Q14D04-2;Q14D04	.;MELT_HUMAN	T	495	ENSP00000376578:K495T;ENSP00000354919:K495T;ENSP00000446258:K495T;ENSP00000376577:K495T	ENSP00000354919:K495T	K	-	2	0	VEPH1	158564098	0.003000	0.15002	0.017000	0.16124	0.724000	0.41520	1.138000	0.31491	0.887000	0.36136	0.528000	0.53228	AAG		VEPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351845.3	NM_024621	
UTP20	27340	hgsc.bcm.edu	37	12	101736764	101736764	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr12:101736764G>A	ENST00000261637.4	+	35	4516	c.4342G>A	c.(4342-4344)Gtt>Att	p.V1448I		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	1448					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.V1448I(1)		NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						CAACTTCGACGTTCGCTTTGA	0.328																																					p.V1448I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4342A	12						.						121.0	114.0	117.0					12																	101736764		2203	4300	6503	100260895	SO:0001583	missense	27340	exon35			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.4342G>A	12.37:g.101736764G>A	ENSP00000261637:p.Val1448Ile	Somatic		Capture	SOLID	Phase_I	100260895	NM_014503	Q9H3H4	Missense_Mutation	SNP	ENST00000261637.4	37	CCDS9081.1	.	.	.	.	.	.	.	.	.	.	G	11.65	1.702863	0.30232	.	.	ENSG00000120800	ENST00000261637	T	0.69435	-0.4	5.56	3.76	0.43208	Armadillo-type fold (1);	0.121365	0.56097	D	0.000033	T	0.58906	0.2155	L	0.53249	1.67	0.39380	D	0.966236	B	0.29232	0.238	B	0.21360	0.034	T	0.52320	-0.8591	10	0.26408	T	0.33	-7.6438	14.106	0.65091	0.0635:0.1115:0.825:0.0	.	1448	O75691	UTP20_HUMAN	I	1448	ENSP00000261637:V1448I	ENSP00000261637:V1448I	V	+	1	0	UTP20	100260895	1.000000	0.71417	0.597000	0.28824	0.662000	0.39071	3.941000	0.56607	0.328000	0.23435	-1.872000	0.00552	GTT		UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	NM_014503	
UTP20	27340	hgsc.bcm.edu	37	12	101760432	101760432	+	Silent	SNP	G	G	A			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr12:101760432G>A	ENST00000261637.4	+	47	6396	c.6222G>A	c.(6220-6222)gtG>gtA	p.V2074V		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	2074					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.V2074V(1)		NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						AAGCTGTTGTGAGCAGGAAAA	0.488																																					p.V2074V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G6222A	12						.						165.0	152.0	157.0					12																	101760432		2203	4300	6503	100284563	SO:0001819	synonymous_variant	27340	exon47			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.6222G>A	12.37:g.101760432G>A		Somatic		Capture	SOLID	Phase_I	100284563	NM_014503	Q9H3H4	Silent	SNP	ENST00000261637.4	37	CCDS9081.1																																																																																				UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	NM_014503	
PZP	5858	hgsc.bcm.edu	37	12	9307432	9307432	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr12:9307432T>G	ENST00000261336.2	-	29	3582	c.3554A>C	c.(3553-3555)aAc>aCc	p.N1185T	PZP_ENST00000381997.2_Missense_Mutation_p.N971T	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	1185					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.N971T(1)|p.N1185T(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						ATGGACGAGGTTGTCTTAAGG	0.448																																					p.N1185T	Melanoma(125;1402 1695 4685 34487 38571)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A3554C	12						.						48.0	49.0	48.0					12																	9307432		2203	4300	6503	9198699	SO:0001583	missense	5858	exon29			X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.3554A>C	12.37:g.9307432T>G	ENSP00000261336:p.Asn1185Thr	Somatic		Capture	SOLID	Phase_I	9198699	NM_002864	A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	ENST00000261336.2	37	CCDS8600.1	.	.	.	.	.	.	.	.	.	.	T	10.35	1.326510	0.24080	.	.	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.38401	1.14;1.14	4.03	1.6	0.23607	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	.	.	.	.	T	0.30634	0.0771	M	0.66506	2.035	0.09310	N	1	P;B	0.38020	0.615;0.167	B;B	0.35278	0.199;0.196	T	0.30995	-0.9959	9	0.54805	T	0.06	.	2.7001	0.05146	0.2172:0.194:0.0:0.5888	.	971;1185	P20742-2;P20742	.;PZP_HUMAN	T	1185;971	ENSP00000261336:N1185T;ENSP00000371427:N971T	ENSP00000261336:N1185T	N	-	2	0	PZP	9198699	0.004000	0.15560	0.002000	0.10522	0.076000	0.17211	1.743000	0.38258	0.622000	0.30249	0.460000	0.39030	AAC		PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337624.1	NM_002864	
PZP	5858	hgsc.bcm.edu	37	12	9312956	9312956	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr12:9312956C>A	ENST00000261336.2	-	24	3031	c.3003G>T	c.(3001-3003)caG>caT	p.Q1001H	PZP_ENST00000539983.1_5'Flank|PZP_ENST00000381997.2_Missense_Mutation_p.Q787H	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	1001					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.Q1001H(1)|p.Q787H(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						CCTGCGTCAGCTGCTGGGTTT	0.423																																					p.Q1001H	Melanoma(125;1402 1695 4685 34487 38571)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3003T	12						.						130.0	119.0	123.0					12																	9312956		2203	4300	6503	9204223	SO:0001583	missense	5858	exon24			X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.3003G>T	12.37:g.9312956C>A	ENSP00000261336:p.Gln1001His	Somatic		Capture	SOLID	Phase_I	9204223	NM_002864	A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	ENST00000261336.2	37	CCDS8600.1	.	.	.	.	.	.	.	.	.	.	C	11.61	1.689487	0.29962	.	.	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.40756	1.02;1.02	4.56	0.539	0.17156	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);	0.083862	0.47455	N	0.000231	T	0.69115	0.3075	H	0.97077	3.935	0.27109	N	0.962419	P;D	0.89917	0.933;1.0	P;D	0.91635	0.479;0.999	T	0.61013	-0.7148	10	0.87932	D	0	.	5.247	0.15502	0.0:0.5494:0.1372:0.3134	.	787;1001	P20742-2;P20742	.;PZP_HUMAN	H	1001;787	ENSP00000261336:Q1001H;ENSP00000371427:Q787H	ENSP00000261336:Q1001H	Q	-	3	2	PZP	9204223	0.979000	0.34478	0.022000	0.16811	0.013000	0.08279	0.265000	0.18515	-0.110000	0.12022	-0.244000	0.11960	CAG		PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337624.1	NM_002864	
LRRK2	120892	hgsc.bcm.edu	37	12	40753134	40753134	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr12:40753134T>C	ENST00000298910.7	+	47	6974	c.6916T>C	c.(6916-6918)Tcc>Ccc	p.S2306P		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2306					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)	p.S2313P(1)|p.S2306P(1)		NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TTTGAGTGAATCCACAAATTC	0.358																																					p.S2306P												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T6916C	12						.						104.0	100.0	102.0					12																	40753134		2203	4300	6503	39039401	SO:0001583	missense	120892	exon47			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.6916T>C	12.37:g.40753134T>C	ENSP00000298910:p.Ser2306Pro	Somatic		Capture	SOLID	Phase_I	39039401	NM_198578	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	37	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.433254	0.83776	.	.	ENSG00000188906	ENST00000298910	T	0.35973	1.28	5.92	5.92	0.95590	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.58424	0.2121	M	0.64997	1.995	0.50813	D	0.999892	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	T	0.58934	-0.7548	10	0.54805	T	0.06	.	16.371	0.83361	0.0:0.0:0.0:1.0	.	2306;2306	Q17RV3;Q5S007	.;LRRK2_HUMAN	P	2306	ENSP00000298910:S2306P	ENSP00000298910:S2306P	S	+	1	0	LRRK2	39039401	1.000000	0.71417	0.992000	0.48379	0.986000	0.74619	6.364000	0.73086	2.267000	0.75376	0.477000	0.44152	TCC		LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
ERBB3	2065	hgsc.bcm.edu	37	12	56491645	56491645	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr12:56491645G>T	ENST00000267101.3	+	21	2977	c.2537G>T	c.(2536-2538)aGt>aTt	p.S846I	ERBB3_ENST00000549832.1_5'Flank|ERBB3_ENST00000415288.2_Missense_Mutation_p.S787I|ERBB3_ENST00000553131.1_Missense_Mutation_p.S87I|ERBB3_ENST00000450146.2_Missense_Mutation_p.S203I	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	846	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)	p.S846I(1)		central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			AAGTCACCCAGTCAGGTTCAG	0.502																																					p.S846I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2537T	12						.						185.0	151.0	163.0					12																	56491645		2203	4300	6503	54777912	SO:0001583	missense	2065	exon21			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.2537G>T	12.37:g.56491645G>T	ENSP00000267101:p.Ser846Ile	Somatic		Capture	SOLID	Phase_I	54777912	NM_001982	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	ENST00000267101.3	37	CCDS31833.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.174093	0.78452	.	.	ENSG00000065361	ENST00000267101;ENST00000450146;ENST00000415288;ENST00000553131	T;T;T;T	0.61859	0.07;0.07;0.07;0.07	5.87	5.87	0.94306	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.064574	0.64402	D	0.000005	T	0.47619	0.1455	N	0.16833	0.445	0.40655	D	0.982077	D	0.54397	0.966	P	0.47346	0.544	T	0.52571	-0.8558	10	0.62326	D	0.03	.	12.6639	0.56830	0.0764:0.0:0.9236:0.0	.	846	P21860	ERBB3_HUMAN	I	846;203;787;87	ENSP00000267101:S846I;ENSP00000399178:S203I;ENSP00000408340:S787I;ENSP00000449129:S87I	ENSP00000267101:S846I	S	+	2	0	ERBB3	54777912	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.509000	0.53386	2.941000	0.99782	0.655000	0.94253	AGT		ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407619.3		
CLIP1	6249	hgsc.bcm.edu	37	12	122825559	122825559	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr12:122825559G>A	ENST00000540338.1	-	10	2233	c.2192C>T	c.(2191-2193)aCg>aTg	p.T731M	CLIP1_ENST00000361654.4_Missense_Mutation_p.T685M|CLIP1_ENST00000545889.1_Missense_Mutation_p.T421M|CLIP1_ENST00000302528.7_Missense_Mutation_p.T720M|CLIP1_ENST00000537178.1_Missense_Mutation_p.T685M|CLIP1_ENST00000358808.2_Missense_Mutation_p.T720M			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	731					microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.T720M(1)		NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		TTTGTTTAACGTGTCTTCCAT	0.373																																					p.T685M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2054T	12						.						272.0	266.0	268.0					12																	122825559		2203	4300	6503	121391512	SO:0001583	missense	6249	exon9				CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.2192C>T	12.37:g.122825559G>A	ENSP00000439093:p.Thr731Met	Somatic		Capture	SOLID	Phase_I	121391512	NM_198240	A0AVD3|Q17RS4|Q29RG0	Missense_Mutation	SNP	ENST00000540338.1	37	CCDS58285.1	.	.	.	.	.	.	.	.	.	.	G	10.14	1.269708	0.23221	.	.	ENSG00000130779	ENST00000545889;ENST00000302528;ENST00000358808;ENST00000542885;ENST00000537178;ENST00000540338;ENST00000540304	T;T;T;T;T;T	0.61627	2.6;0.64;0.64;0.68;0.69;0.09	5.87	3.06	0.35304	.	0.390391	0.31760	N	0.007105	T	0.49508	0.1561	L	0.54323	1.7	0.35316	D	0.784346	B;B;B;B	0.25743	0.133;0.116;0.116;0.07	B;B;B;B	0.28638	0.034;0.092;0.092;0.042	T	0.53450	-0.8437	10	0.44086	T	0.13	-2.3394	7.4886	0.27447	0.1898:0.0:0.6927:0.1175	.	421;685;720;731	F5H0N7;P30622-2;P30622-1;P30622	.;.;.;CLIP1_HUMAN	M	421;720;720;565;685;731;654	ENSP00000438743:T421M;ENSP00000303585:T720M;ENSP00000351665:T720M;ENSP00000445531:T685M;ENSP00000439093:T731M;ENSP00000437786:T654M	ENSP00000303585:T720M	T	-	2	0	CLIP1	121391512	0.612000	0.27000	0.023000	0.16930	0.599000	0.36880	3.518000	0.53451	0.480000	0.27534	0.655000	0.94253	ACG		CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401625.1	NM_002956	
UACA	55075	hgsc.bcm.edu	37	15	70961054	70961054	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr15:70961054G>T	ENST00000322954.6	-	16	2154	c.1969C>A	c.(1969-1971)Cat>Aat	p.H657N	UACA_ENST00000379983.2_Missense_Mutation_p.H644N|UACA_ENST00000560441.1_Missense_Mutation_p.H642N|UACA_ENST00000539319.1_Missense_Mutation_p.H548N	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	657					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)		p.H644N(1)		breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						GATTTTTCATGTTCTCTTTCC	0.363																																					p.H657N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1969A	15						.						92.0	90.0	91.0					15																	70961054		2199	4297	6496	68748108	SO:0001583	missense	55075	exon16			AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.1969C>A	15.37:g.70961054G>T	ENSP00000314556:p.His657Asn	Somatic		Capture	SOLID	Phase_I	68748108	NM_018003	G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Missense_Mutation	SNP	ENST00000322954.6	37	CCDS10235.1	.	.	.	.	.	.	.	.	.	.	G	8.748	0.920649	0.17982	.	.	ENSG00000137831	ENST00000322954;ENST00000379983;ENST00000539319	T;T;T	0.31769	1.48;1.5;1.97	5.4	1.84	0.25277	.	0.477477	0.19675	N	0.108646	T	0.17450	0.0419	N	0.14661	0.345	0.21105	N	0.99978	B;B;B;B	0.21452	0.056;0.013;0.013;0.023	B;B;B;B	0.22753	0.041;0.019;0.019;0.041	T	0.18178	-1.0345	10	0.38643	T	0.18	-1.7893	10.0172	0.42022	0.5609:0.0:0.4391:0.0	.	548;657;657;644	F5H2B9;B7ZKM6;Q9BZF9;G3XAG2	.;.;UACA_HUMAN;.	N	657;644;548	ENSP00000314556:H657N;ENSP00000369319:H644N;ENSP00000438667:H548N	ENSP00000314556:H657N	H	-	1	0	UACA	68748108	0.202000	0.23423	0.604000	0.28916	0.973000	0.67179	0.534000	0.23098	0.064000	0.16427	-0.339000	0.08088	CAT		UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257199.2		
TBC1D2B	23102	hgsc.bcm.edu	37	15	78322443	78322443	+	Silent	SNP	A	A	G			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr15:78322443A>G	ENST00000300584.3	-	4	752	c.753T>C	c.(751-753)aaT>aaC	p.N251N	TBC1D2B_ENST00000409931.3_Silent_p.N251N	NM_015079.5|NM_144572.1	NP_055894.6|NP_653173.1	Q9UPU7	TBD2B_HUMAN	TBC1 domain family, member 2B	251							Rab GTPase activator activity (GO:0005097)	p.N251N(2)		breast(3)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(2)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	26						CCCACTCTTCATTGGTATAAA	0.423																																					p.N251N												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T753C	15						.						96.0	79.0	85.0					15																	78322443		2196	4293	6489	76109498	SO:0001819	synonymous_variant	23102	exon4			AB028978	CCDS32301.2, CCDS45314.1	15q24.3-q25.1	2005-11-29			ENSG00000167202	ENSG00000167202			29183	protein-coding gene	gene with protein product						10470851	Standard	NM_015079		Approved	KIAA1055	uc002bcy.4	Q9UPU7	OTTHUMG00000152885	ENST00000300584.3:c.753T>C	15.37:g.78322443A>G		Somatic		Capture	SOLID	Phase_I	76109498	NM_144572	A7MD42|Q8N1F9|Q9NXM0	Silent	SNP	ENST00000300584.3	37	CCDS45314.1	.	.	.	.	.	.	.	.	.	.	A	5.890	0.348256	0.11126	.	.	ENSG00000167202	ENST00000418039	.	.	.	5.03	0.0265	0.14150	.	.	.	.	.	T	0.54854	0.1884	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44832	-0.9302	4	.	.	.	.	8.6127	0.33813	0.6896:0.0:0.3104:0.0	.	.	.	.	T	133	.	.	M	-	2	0	TBC1D2B	76109498	0.006000	0.16342	0.089000	0.20774	0.747000	0.42532	0.505000	0.22642	-0.252000	0.09528	0.378000	0.23410	ATG		TBC1D2B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000328369.3	NM_015079	
ALPK1	80216	hgsc.bcm.edu	37	4	113360884	113360884	+	Missense_Mutation	SNP	C	C	T	rs188598288	byFrequency	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr4:113360884C>T	ENST00000458497.1	+	14	3673	c.3394C>T	c.(3394-3396)Cct>Tct	p.P1132S	ALPK1_ENST00000177648.9_Missense_Mutation_p.P1132S|ALPK1_ENST00000504176.2_Missense_Mutation_p.P1054S	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	1132	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.P1132S(1)		NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		CAGTGTGGAGCCTTACATACT	0.373																																					p.P1132S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3394T	4						.						108.0	101.0	103.0					4																	113360884		2203	4300	6503	113580333	SO:0001583	missense	80216	exon14			AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.3394C>T	4.37:g.113360884C>T	ENSP00000398048:p.Pro1132Ser	Somatic		Capture	SOLID	Phase_I	113580333	NM_025144	B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	Missense_Mutation	SNP	ENST00000458497.1	37	CCDS3697.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.666898	0.88251	.	.	ENSG00000073331	ENST00000458497;ENST00000177648;ENST00000504176	T;T;T	0.14640	2.49;2.49;2.49	5.2	5.2	0.72013	MHCK/EF2 kinase (3);Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.38453	0.1041	M	0.66506	2.035	0.54753	D	0.999988	D;D;D	0.89917	0.998;1.0;0.998	D;D;D	0.97110	0.979;1.0;0.988	T	0.14476	-1.0471	10	0.66056	D	0.02	-20.2205	18.7346	0.91749	0.0:1.0:0.0:0.0	.	1054;1054;1132	F5H138;B4E3G1;Q96QP1	.;.;ALPK1_HUMAN	S	1132;1132;1054	ENSP00000398048:P1132S;ENSP00000177648:P1132S;ENSP00000426044:P1054S	ENSP00000177648:P1132S	P	+	1	0	ALPK1	113580333	1.000000	0.71417	0.896000	0.35187	0.959000	0.62525	7.186000	0.77722	2.415000	0.81967	0.544000	0.68410	CCT		ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256421.2	NM_025144	
USP38	84640	hgsc.bcm.edu	37	4	144119068	144119068	+	Silent	SNP	G	G	A	rs141985651		TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr4:144119068G>A	ENST00000307017.4	+	4	1547	c.1041G>A	c.(1039-1041)gcG>gcA	p.A347A	USP38_ENST00000510377.1_Silent_p.A347A	NM_032557.5	NP_115946.2	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38	347					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)	p.A347A(1)		breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	33	all_hematologic(180;0.158)					CTCCAGAGGCGTTCCATTTGG	0.348													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17995	0.0		0.0	False		,,,				2504	0.0				p.A347A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1041A	4						.						150.0	136.0	140.0					4																	144119068		2203	4300	6503	144338518	SO:0001819	synonymous_variant	84640	exon4			AF211481	CCDS3758.1	4q31.1	2008-02-05	2005-08-08		ENSG00000170185	ENSG00000170185		"""Ubiquitin-specific peptidases"""	20067	protein-coding gene	gene with protein product			"""ubiquitin specific protease 38"""			12838346	Standard	NM_032557		Approved	KIAA1891, HP43.8KD	uc003ijb.3	Q8NB14	OTTHUMG00000161420	ENST00000307017.4:c.1041G>A	4.37:g.144119068G>A		Somatic		Capture	SOLID	Phase_I	144338518	NM_032557	B3KX93|Q3ZCV1|Q8NDF5|Q96DK6|Q96PZ6|Q9BY55	Silent	SNP	ENST00000307017.4	37	CCDS3758.1																																																																																				USP38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364869.1	NM_032557	
ZFYVE28	57732	hgsc.bcm.edu	37	4	2341226	2341226	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr4:2341226C>T	ENST00000290974.2	-	4	814	c.475G>A	c.(475-477)Gaa>Aaa	p.E159K	ZFYVE28_ENST00000509171.1_Missense_Mutation_p.E112K|ZFYVE28_ENST00000503000.1_Missense_Mutation_p.E159K|ZFYVE28_ENST00000511071.1_Missense_Mutation_p.E159K|ZFYVE28_ENST00000515312.1_Missense_Mutation_p.E89K|ZFYVE28_ENST00000515169.1_Missense_Mutation_p.E89K	NM_020972.2	NP_066023.2	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	159					negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)	p.E159K(1)		NS(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	31						CTCAGCGCTTCCCTCATCTTC	0.647																																					p.E159K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G475A	4						.						101.0	80.0	87.0					4																	2341226		2203	4300	6503	2311024	SO:0001583	missense	57732	exon4			AK126692	CCDS33942.1, CCDS54708.1, CCDS54709.1, CCDS54710.1, CCDS54711.1, CCDS54712.1	4p16.3	2008-05-02			ENSG00000159733	ENSG00000159733		"""Zinc fingers, FYVE domain containing"""	29334	protein-coding gene	gene with protein product		614176				10997877	Standard	NM_020972		Approved	KIAA1643	uc003gex.2	Q9HCC9	OTTHUMG00000160292	ENST00000290974.2:c.475G>A	4.37:g.2341226C>T	ENSP00000290974:p.Glu159Lys	Somatic		Capture	SOLID	Phase_I	2311024	NM_001172656	B2RP83|B3KX50|B7Z1Q7|B7Z2G9|B7Z2M2|B7ZB19|E9PB54|E9PB64|E9PG77|Q7Z6J3	Missense_Mutation	SNP	ENST00000290974.2	37	CCDS33942.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.969920	0.92855	.	.	ENSG00000159733	ENST00000290974;ENST00000511071;ENST00000515312;ENST00000515169;ENST00000509171;ENST00000503000	T;T;T;T;T;T	0.36878	1.59;1.59;1.59;1.23;1.23;1.59	4.5	4.5	0.54988	.	0.177355	0.49305	D	0.000158	T	0.34513	0.0900	L	0.38175	1.15	0.80722	D	1	P;P;P	0.47762	0.827;0.787;0.9	B;B;B	0.44133	0.442;0.218;0.438	T	0.20739	-1.0266	10	0.51188	T	0.08	.	16.255	0.82510	0.0:1.0:0.0:0.0	.	159;112;159	Q9HCC9-2;E9PB54;Q9HCC9	.;.;LST2_HUMAN	K	159;159;89;89;112;159	ENSP00000290974:E159K;ENSP00000425706:E159K;ENSP00000426299:E89K;ENSP00000425766:E89K;ENSP00000422638:E112K;ENSP00000423694:E159K	ENSP00000290974:E159K	E	-	1	0	ZFYVE28	2311024	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.340000	0.65958	2.056000	0.61249	0.585000	0.79938	GAA		ZFYVE28-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360078.1	XM_035371	
EVC2	132884	hgsc.bcm.edu	37	4	5627563	5627563	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr4:5627563C>A	ENST00000344408.5	-	13	2012	c.1959G>T	c.(1957-1959)aaG>aaT	p.K653N	EVC2_ENST00000310917.2_Missense_Mutation_p.K573N|EVC2_ENST00000344938.1_Missense_Mutation_p.K653N	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	653					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.K653N(1)		NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						CCAACTTCTGCTTGATTGAAA	0.393																																					p.K573N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1719T	4						.						177.0	165.0	169.0					4																	5627563		2203	4300	6503	5678464	SO:0001583	missense	132884	exon13			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.1959G>T	4.37:g.5627563C>A	ENSP00000342144:p.Lys653Asn	Somatic		Capture	SOLID	Phase_I	5678464	NM_001166136	Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	ENST00000344408.5	37	CCDS3382.2	.	.	.	.	.	.	.	.	.	.	C	16.17	3.048302	0.55110	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	T;T;T	0.81078	-1.45;-1.45;-1.45	5.54	-1.13	0.09775	.	0.161694	0.56097	D	0.000040	D	0.84320	0.5446	M	0.67953	2.075	0.25771	N	0.984834	D	0.71674	0.998	D	0.66847	0.947	T	0.77094	-0.2715	10	0.36615	T	0.2	-13.4318	10.4079	0.44274	0.0:0.4326:0.0:0.5674	.	653	Q86UK5	LBN_HUMAN	N	653;573;653	ENSP00000339954:K653N;ENSP00000311683:K573N;ENSP00000342144:K653N	ENSP00000311683:K573N	K	-	3	2	EVC2	5678464	0.937000	0.31787	0.050000	0.19076	0.963000	0.63663	0.150000	0.16263	-0.435000	0.07264	-0.157000	0.13467	AAG		EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127	
PPAT	5471	hgsc.bcm.edu	37	4	57272716	57272716	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr4:57272716T>G	ENST00000264220.2	-	3	484	c.347A>C	c.(346-348)aAg>aCg	p.K116T	PPAT_ENST00000507648.1_5'UTR	NM_002703.4	NP_002694.3	Q06203	PUR1_HUMAN	phosphoribosyl pyrophosphate amidotransferase	116	Glutamine amidotransferase type-2. {ECO:0000255|PROSITE-ProRule:PRU00609}.				'de novo' IMP biosynthetic process (GO:0006189)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|G1/S transition of mitotic cell cycle (GO:0000082)|glutamine catabolic process (GO:0006543)|kidney development (GO:0001822)|lactation (GO:0007595)|maternal process involved in female pregnancy (GO:0060135)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|organ regeneration (GO:0031100)|protein homotetramerization (GO:0051289)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|amidophosphoribosyltransferase activity (GO:0004044)|metal ion binding (GO:0046872)	p.K116T(1)		cervix(1)|endometrium(2)|large_intestine(6)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	20	Glioma(25;0.08)|all_neural(26;0.101)				Fluorouracil(DB00544)|L-Glutamine(DB00130)|Mercaptopurine(DB01033)	CACAGCTATCTTCCCATGAAG	0.393																																					p.K116T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A347C	4						.						165.0	138.0	147.0					4																	57272716		2203	4300	6503	56967473	SO:0001583	missense	5471	exon3				CCDS3505.1	4q12	2012-10-02			ENSG00000128059	ENSG00000128059	2.4.2.14		9238	protein-coding gene	gene with protein product		172450					Standard	NM_002703		Approved	GPAT, PRAT	uc003hbr.3	Q06203	OTTHUMG00000128842	ENST00000264220.2:c.347A>C	4.37:g.57272716T>G	ENSP00000264220:p.Lys116Thr	Somatic		Capture	SOLID	Phase_I	56967473	NM_002703		Missense_Mutation	SNP	ENST00000264220.2	37	CCDS3505.1	.	.	.	.	.	.	.	.	.	.	T	13.61	2.289934	0.40494	.	.	ENSG00000128059	ENST00000264220	T	0.76578	-1.03	5.62	5.62	0.85841	Glutamine amidotransferase, type II (1);Glutamine amidotransferase, class-II (1);	0.042317	0.85682	D	0.000000	T	0.58293	0.2112	N	0.03154	-0.405	0.80722	D	1	B	0.18166	0.026	B	0.25987	0.065	T	0.56523	-0.7965	10	0.14252	T	0.57	-33.0574	15.8261	0.78709	0.0:0.0:0.0:1.0	.	116	Q06203	PUR1_HUMAN	T	116	ENSP00000264220:K116T	ENSP00000264220:K116T	K	-	2	0	PPAT	56967473	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.639000	0.67868	2.138000	0.66242	0.477000	0.44152	AAG		PPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250781.2	NM_002703	
MUC7	4589	hgsc.bcm.edu	37	4	71346670	71346670	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr4:71346670G>C	ENST00000304887.5	+	3	399	c.209G>C	c.(208-210)tGt>tCt	p.C70S	MUC7_ENST00000514512.1_3'UTR|MUC7_ENST00000413702.1_Missense_Mutation_p.C70S|MUC7_ENST00000456088.1_Missense_Mutation_p.C70S	NM_152291.2	NP_689504.2	Q8TAX7	MUC7_HUMAN	mucin 7, secreted	70				C -> S (in Ref. 4; AA sequence). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.C70S(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(2)|lung(23)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42			Lung(101;0.211)			CACAAACGCTGTAGGCCTAAG	0.448																																					p.C70S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G209C	4						.						158.0	153.0	155.0					4																	71346670		2203	4300	6503	71381259	SO:0001583	missense	4589	exon3			BC025688	CCDS3541.1	4q13.3	2008-02-05	2006-03-14		ENSG00000171195	ENSG00000171195		"""Mucins"""	7518	protein-coding gene	gene with protein product		158375	"""mucin 7, salivary"""			8838308	Standard	NM_152291		Approved	FLJ27047, MG2	uc003hfj.3	Q8TAX7	OTTHUMG00000129916	ENST00000304887.5:c.209G>C	4.37:g.71346670G>C	ENSP00000302021:p.Cys70Ser	Somatic		Capture	SOLID	Phase_I	71381259	NM_152291	Q9UCD7|Q9UCD8	Missense_Mutation	SNP	ENST00000304887.5	37	CCDS3541.1	.	.	.	.	.	.	.	.	.	.	G	5.451	0.268263	0.10349	.	.	ENSG00000171195	ENST00000413702;ENST00000505411;ENST00000456088;ENST00000304887	T;T;T;T	0.54866	0.57;0.55;0.57;0.57	3.06	-3.31	0.04988	.	.	.	.	.	T	0.29749	0.0743	N	0.19112	0.55	0.09310	N	1	B	0.24823	0.112	B	0.23574	0.047	T	0.20907	-1.0261	9	0.19590	T	0.45	3.3226	6.1604	0.20360	0.4666:0.3683:0.1651:0.0	.	70	Q8TAX7	MUC7_HUMAN	S	70	ENSP00000407422:C70S;ENSP00000427594:C70S;ENSP00000400585:C70S;ENSP00000302021:C70S	ENSP00000302021:C70S	C	+	2	0	MUC7	71381259	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.136000	0.01305	-0.877000	0.04012	-0.345000	0.07892	TGT		MUC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252168.2	NM_152291	
PLAC8	51316	hgsc.bcm.edu	37	4	84029023	84029023	+	Missense_Mutation	SNP	C	C	T	rs374282306		TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr4:84029023C>T	ENST00000426923.2	-	2	130	c.52G>A	c.(52-54)Ggt>Agt	p.G18S	PLAC8_ENST00000411416.2_Missense_Mutation_p.G18S|PLAC8_ENST00000515389.1_Intron|PLAC8_ENST00000311507.4_Missense_Mutation_p.G18S|PLAC8_ENST00000505406.1_Missense_Mutation_p.G18S|PLAC8_ENST00000509973.1_Intron	NM_001130715.1	NP_001124187.1	Q9UHV8	PP13_HUMAN	placenta-specific 8	6	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.				apoptotic process (GO:0006915)|phospholipid metabolic process (GO:0006644)		carbohydrate binding (GO:0030246)|lysophospholipase activity (GO:0004622)	p.G18S(1)		large_intestine(2)|lung(3)|ovary(1)	6		Hepatocellular(203;0.114)				GGGGCCGGACCGGGACCGACT	0.562																																					p.G18S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G52A	4						.						35.0	33.0	34.0					4																	84029023		2203	4300	6503	84248047	SO:0001583	missense	51316	exon2			AF208846	CCDS3601.1	4q21.22	2006-05-20			ENSG00000145287	ENSG00000145287			19254	protein-coding gene	gene with protein product		607515				12758124, 12384430	Standard	NM_016619		Approved	onzin, C15	uc003hoe.3	Q9NZF1	OTTHUMG00000130294	ENST00000426923.2:c.52G>A	4.37:g.84029023C>T	ENSP00000399700:p.Gly18Ser	Somatic		Capture	SOLID	Phase_I	84248047	NM_001130715	C5HZ15	Missense_Mutation	SNP	ENST00000426923.2	37	CCDS3601.1	.	.	.	.	.	.	.	.	.	.	C	8.381	0.837626	0.16891	.	.	ENSG00000145287	ENST00000311507;ENST00000411416;ENST00000505406;ENST00000426923	.	.	.	0.0465	0.0465	0.14256	.	7739.210000	0.00166	N	0.000000	T	0.17746	0.0426	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.11036	-1.0604	6	0.17369	T	0.5	-6.066	.	.	.	.	18	Q9NZF1	PLAC8_HUMAN	S	18	.	ENSP00000309509:G18S	G	-	1	0	PLAC8	84248047	0.003000	0.15002	0.003000	0.11579	0.008000	0.06430	0.145000	0.16157	0.132000	0.18615	0.134000	0.15878	GGT		PLAC8-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363079.1	NM_016619	
WDFY3	23001	hgsc.bcm.edu	37	4	85708719	85708719	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr4:85708719C>G	ENST00000295888.4	-	23	4224	c.3817G>C	c.(3817-3819)Gaa>Caa	p.E1273Q	WDFY3_ENST00000322366.6_Missense_Mutation_p.E1273Q	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	1273					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)	p.E1273Q(1)		breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		GGTAAAACTTCTTCTAGAAAA	0.433																																					p.E1273Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3817C	4						.						73.0	71.0	72.0					4																	85708719		2203	4300	6503	85927743	SO:0001583	missense	23001	exon23			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.3817G>C	4.37:g.85708719C>G	ENSP00000295888:p.Glu1273Gln	Somatic		Capture	SOLID	Phase_I	85927743	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	37	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	C	17.65	3.441767	0.63067	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.74002	-0.8;-0.8	5.94	5.09	0.68999	Concanavalin A-like lectin/glucanase (1);	0.110926	0.64402	D	0.000003	T	0.75642	0.3877	M	0.80982	2.52	0.80722	D	1	B	0.31968	0.349	B	0.30179	0.112	T	0.76435	-0.2960	10	0.52906	T	0.07	.	15.0493	0.71854	0.0:0.932:0.0:0.068	.	1273	Q8IZQ1	WDFY3_HUMAN	Q	1273	ENSP00000318466:E1273Q;ENSP00000295888:E1273Q	ENSP00000295888:E1273Q	E	-	1	0	WDFY3	85927743	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.478000	0.81082	1.517000	0.48917	0.484000	0.47621	GAA		WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
FBXW7	55294	hgsc.bcm.edu	37	4	153247318	153247318	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr4:153247318T>G	ENST00000281708.4	-	10	2713	c.1484A>C	c.(1483-1485)cAt>cCt	p.H495P	FBXW7_ENST00000603841.1_Missense_Mutation_p.H495P|FBXW7_ENST00000603548.1_Missense_Mutation_p.H495P|FBXW7_ENST00000263981.5_Missense_Mutation_p.H415P|FBXW7_ENST00000296555.5_Missense_Mutation_p.H377P|FBXW7_ENST00000393956.3_Missense_Mutation_p.H319P	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	495					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.H495P(2)|p.H256P(1)|p.H415P(1)|p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				CATCAAAACATGTAAACACTG	0.443			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.H415P			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	.	.	5	Substitution - Missense(4)|Unknown(1)	large_intestine(4)|haematopoietic_and_lymphoid_tissue(1)	c.A1244C	4						.						144.0	135.0	138.0					4																	153247318		2203	4300	6503	153466768	SO:0001583	missense	55294	exon9			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1484A>C	4.37:g.153247318T>G	ENSP00000281708:p.His495Pro	Somatic		Capture	SOLID	Phase_I	153466768	NM_018315	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	T	15.44	2.835418	0.50951	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.60797	0.16;0.16;0.16;0.16	5.72	4.54	0.55810	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.043646	0.85682	D	0.000000	T	0.71204	0.3312	M	0.63428	1.95	0.80722	D	1	P;D;D;D	0.71674	0.89;0.998;0.985;0.991	P;D;P;D	0.75484	0.844;0.986;0.893;0.936	T	0.72083	-0.4397	10	0.54805	T	0.06	-19.3096	11.9002	0.52680	0.0:0.0681:0.0:0.9319	.	319;495;377;415	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	P	495;377;415;319	ENSP00000281708:H495P;ENSP00000296555:H377P;ENSP00000263981:H415P;ENSP00000377528:H319P	ENSP00000263981:H415P	H	-	2	0	FBXW7	153466768	1.000000	0.71417	0.977000	0.42913	0.162000	0.22319	7.965000	0.87945	1.101000	0.41535	-0.263000	0.10527	CAT		FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
ELF4	2000	hgsc.bcm.edu	37	X	129205113	129205113	+	Silent	SNP	G	G	A			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chrX:129205113G>A	ENST00000308167.5	-	7	1090	c.711C>T	c.(709-711)ggC>ggT	p.G237G	ELF4_ENST00000335997.7_Silent_p.G237G	NM_001421.3	NP_001412.1			E74-like factor 4 (ets domain transcription factor)									p.G237G(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	22						GTTTGAAGATGCCTTTCTCTC	0.522			T	ERG	AML																																p.G237G			Dom	yes		X	Xq26	2000	E74-like factor 4 (ets domain transcription factor)		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C711T	X						.						177.0	145.0	156.0					X																	129205113		2203	4300	6503	129032794	SO:0001819	synonymous_variant	2000	exon7			U32645	CCDS14617.1	Xq26	2014-09-17			ENSG00000102034	ENSG00000102034			3319	protein-coding gene	gene with protein product		300775				8895518	Standard	NM_001421		Approved	MEF, ELFR	uc004eve.4	Q99607	OTTHUMG00000022390	ENST00000308167.5:c.711C>T	X.37:g.129205113G>A		Somatic		Capture	SOLID	Phase_I	129032794	NM_001421		Silent	SNP	ENST00000308167.5	37	CCDS14617.1																																																																																				ELF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058243.1	NM_001421	
NHSL2	340527	hgsc.bcm.edu	37	X	71358766	71358766	+	Silent	SNP	C	C	A			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chrX:71358766C>A	ENST00000373677.1	+	2	1532	c.270C>A	c.(268-270)ggC>ggA	p.G90G	NHSL2_ENST00000540800.1_Silent_p.G456G|NHSL2_ENST00000510661.1_Silent_p.G225G|NHSL2_ENST00000535692.1_Silent_p.G90G			Q5HYW2	NHSL2_HUMAN	NHS-like 2	90								p.G456G(1)|p.G87G(1)		NS(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(10)|lung(7)|stomach(1)	28	Renal(35;0.156)					GGTCAGCTGGCTACCCTGAGC	0.582																																					p.G456G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1368A	X						.						37.0	30.0	32.0					X																	71358766		2203	4300	6503	71275491	SO:0001819	synonymous_variant	340527	exon6					Xq13.1	2009-02-18			ENSG00000204131	ENSG00000204131			33737	protein-coding gene	gene with protein product							Standard	NM_001013627		Approved		uc011mqa.2	Q5HYW2	OTTHUMG00000021807	ENST00000373677.1:c.270C>A	X.37:g.71358766C>A		Somatic		Capture	SOLID	Phase_I	71275491	NM_001013627	B2RN94	Silent	SNP	ENST00000373677.1	37																																																																																					NHSL2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000057170.1	NM_001013627	
KIAA2022	340533	hgsc.bcm.edu	37	X	73960927	73960927	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chrX:73960927G>C	ENST00000055682.6	-	3	4076	c.3465C>G	c.(3463-3465)tgC>tgG	p.C1155W		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	1155					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)	p.C1155W(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						ATGTTGACAGGCAAGGGTTTT	0.393																																					p.C1155W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3465G	X						.						98.0	94.0	96.0					X																	73960927		2203	4300	6503	73877652	SO:0001583	missense	340533	exon3				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.3465C>G	X.37:g.73960927G>C	ENSP00000055682:p.Cys1155Trp	Somatic		Capture	SOLID	Phase_I	73877652	NM_001008537	A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	ENST00000055682.6	37	CCDS35337.1	.	.	.	.	.	.	.	.	.	.	g	13.18	2.159279	0.38119	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.29655	1.56;1.56	4.74	3.88	0.44766	.	0.320987	0.38058	N	0.001838	T	0.40570	0.1122	L	0.29908	0.895	0.80722	D	1	D	0.76494	0.999	D	0.66847	0.947	T	0.31392	-0.9945	10	0.87932	D	0	-1.0573	12.3102	0.54924	0.0839:0.0:0.9161:0.0	.	1155	Q5QGS0	K2022_HUMAN	W	1155	ENSP00000362567:C1155W;ENSP00000055682:C1155W	ENSP00000055682:C1155W	C	-	3	2	KIAA2022	73877652	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	2.801000	0.47908	1.006000	0.39211	0.597000	0.82753	TGC		KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537	
SLITRK2	84631	hgsc.bcm.edu	37	X	144906081	144906081	+	Missense_Mutation	SNP	G	G	A	rs192056413		TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chrX:144906081G>A	ENST00000370490.1	+	1	6393	c.2138G>A	c.(2137-2139)cGa>cAa	p.R713Q	TMEM257_ENST00000408967.2_5'Flank|SLITRK2_ENST00000447897.2_Missense_Mutation_p.R713Q|SLITRK2_ENST00000428560.2_Missense_Mutation_p.R713Q|SLITRK2_ENST00000413937.2_Missense_Mutation_p.R713Q|SLITRK2_ENST00000434188.2_Missense_Mutation_p.R713Q			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	713					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.R713Q(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					GCCTATTACCGAAACCTGCAA	0.498													G|||	1	0.000264901	0.0	0.0014	3775	,	,		12788	0.0		0.0	False		,,,				2504	0.0				p.R713Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2138A	X						.						78.0	80.0	80.0					X																	144906081		2203	4300	6503	144713773	SO:0001583	missense	84631	exon3			Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.2138G>A	X.37:g.144906081G>A	ENSP00000359521:p.Arg713Gln	Somatic		Capture	SOLID	Phase_I	144713773	NM_001144006	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	37	CCDS14680.1	1	6.027727546714888E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	17.05	3.291022	0.59976	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.54479	0.57;0.7;0.7;0.7;0.7;0.7	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.45538	0.1347	L	0.54323	1.7	0.54753	D	0.99998	P	0.47409	0.895	B	0.35240	0.198	T	0.51012	-0.8759	10	0.41790	T	0.15	-4.5445	15.3882	0.74718	0.0:0.0:1.0:0.0	.	713	Q9H156	SLIK2_HUMAN	Q	713	ENSP00000334374:R713Q;ENSP00000411681:R713Q;ENSP00000359521:R713Q;ENSP00000397015:R713Q;ENSP00000407347:R713Q;ENSP00000412010:R713Q	ENSP00000334374:R713Q	R	+	2	0	SLITRK2	144713773	1.000000	0.71417	0.988000	0.46212	0.950000	0.60333	6.457000	0.73505	2.224000	0.72417	0.513000	0.50165	CGA		SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539	
ARHGAP15	55843	hgsc.bcm.edu	37	2	143986188	143986188	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr2:143986188G>A	ENST00000295095.6	+	5	502	c.335G>A	c.(334-336)cGa>cAa	p.R112Q	ARHGAP15_ENST00000409869.1_Missense_Mutation_p.R112Q	NM_018460.3	NP_060930.3	Q53QZ3	RHG15_HUMAN	Rho GTPase activating protein 15	112	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)	p.R112Q(1)		endometrium(1)|kidney(5)|large_intestine(8)|liver(2)|lung(15)|ovary(1)|skin(2)	34				BRCA - Breast invasive adenocarcinoma(221;0.151)		CTTTCTAGTCGAAGAATTGAA	0.303																																					p.R112Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G335A	2						.						87.0	93.0	91.0					2																	143986188		2203	4298	6501	143702658	SO:0001583	missense	55843	exon5			AY219338	CCDS2184.1	2q22.2-q22.3	2013-01-10			ENSG00000075884	ENSG00000075884		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	21030	protein-coding gene	gene with protein product		610578				12650940, 11042152	Standard	NM_018460		Approved	BM046	uc002tvm.4	Q53QZ3	OTTHUMG00000131845	ENST00000295095.6:c.335G>A	2.37:g.143986188G>A	ENSP00000295095:p.Arg112Gln	Somatic		Capture	SOLID	Phase_I	143702658	NM_018460	Q53R36|Q53RD7|Q53RT6|Q53SX9|Q584N9|Q6PJE6|Q86WP1|Q8IXX1|Q9NRL8|Q9NZ77|Q9NZ91	Missense_Mutation	SNP	ENST00000295095.6	37	CCDS2184.1	.	.	.	.	.	.	.	.	.	.	G	14.33	2.501846	0.44455	.	.	ENSG00000075884	ENST00000409869;ENST00000295095	T;T	0.75367	-0.93;-0.93	5.6	-0.35	0.12606	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.778678	0.12196	N	0.490747	T	0.57607	0.2065	N	0.24115	0.695	0.23174	N	0.998173	B;B	0.09022	0.002;0.0	B;B	0.10450	0.005;0.002	T	0.40496	-0.9560	10	0.34782	T	0.22	.	9.3426	0.38089	0.411:0.0:0.589:0.0	.	112;112	B4E0R3;Q53QZ3	.;RHG15_HUMAN	Q	112	ENSP00000386560:R112Q;ENSP00000295095:R112Q	ENSP00000295095:R112Q	R	+	2	0	ARHGAP15	143702658	0.026000	0.19158	0.603000	0.28903	0.993000	0.82548	-0.207000	0.09384	-0.392000	0.07751	-0.157000	0.13467	CGA		ARHGAP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254793.2	NM_018460	
KCNJ3	3760	hgsc.bcm.edu	37	2	155555806	155555806	+	Silent	SNP	C	C	T			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr2:155555806C>T	ENST00000295101.2	+	1	996	c.519C>T	c.(517-519)gaC>gaT	p.D173D	AC061961.2_ENST00000443901.1_RNA|KCNJ3_ENST00000544049.1_Silent_p.D173D	NM_001260509.1|NM_002239.3	NP_001247438.1|NP_002230.1	P48549	KCNJ3_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 3	173		Role in the control of polyamine-mediated channel gating and in the blocking by intracellular magnesium. {ECO:0000250}.			potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to electrical stimulus (GO:0051602)|synaptic transmission (GO:0007268)	external side of plasma membrane (GO:0009897)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)	p.D173D(1)		breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(30)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	54					Halothane(DB01159)	CCATCGTGGACGCCTTCCTCA	0.597																																					p.D173D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C519T	2						.						92.0	77.0	82.0					2																	155555806		2203	4300	6503	155264052	SO:0001819	synonymous_variant	3760	exon1			U50964	CCDS2200.1, CCDS58733.1	2q24.1	2011-07-05			ENSG00000162989	ENSG00000162989		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6264	protein-coding gene	gene with protein product		601534				8088798, 16382105	Standard	NM_002239		Approved	Kir3.1, GIRK1, KGA	uc002tyv.2	P48549	OTTHUMG00000131937	ENST00000295101.2:c.519C>T	2.37:g.155555806C>T		Somatic		Capture	SOLID	Phase_I	155264052	NM_002239	B4DEW7|Q8TBI0	Silent	SNP	ENST00000295101.2	37	CCDS2200.1																																																																																				KCNJ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254890.2	NM_002239	
ZNF385B	151126	hgsc.bcm.edu	37	2	180383311	180383311	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr2:180383311G>C	ENST00000410066.1	-	5	1054	c.451C>G	c.(451-453)Cca>Gca	p.P151A	ZNF385B_ENST00000336917.5_Missense_Mutation_p.P49A|ZNF385B_ENST00000409343.1_Missense_Mutation_p.P75A|ZNF385B_ENST00000466398.1_5'UTR|ZNF385B_ENST00000409692.1_Missense_Mutation_p.P49A	NM_152520.4	NP_689733.3	Q569K4	Z385B_HUMAN	zinc finger protein 385B	151	Interaction with p53/TP53.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|p53 binding (GO:0002039)|zinc ion binding (GO:0008270)	p.P151A(1)		breast(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	26			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			TTCTTCTTTGGGGGAATGGAT	0.343																																					p.P75A	Colon(155;204 2491 32774 51842)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C223G	2						.						117.0	121.0	120.0					2																	180383311		2203	4300	6503	180091556	SO:0001583	missense	151126	exon3			AK057999	CCDS33339.1, CCDS46463.1, CCDS46464.1	2q31.3-q32.1	2012-10-05	2007-12-06	2007-12-06	ENSG00000144331	ENSG00000144331			26332	protein-coding gene	gene with protein product		612344	"""zinc finger protein 533"""	ZNF533		12477932	Standard	NM_152520		Approved	FLJ25270	uc002unn.4	Q569K4	OTTHUMG00000154559	ENST00000410066.1:c.451C>G	2.37:g.180383311G>C	ENSP00000386845:p.Pro151Ala	Somatic		Capture	SOLID	Phase_I	180091556	NM_001113397	Q49A04|Q6ZMZ7|Q8IY01|Q8N8H2|Q96DK4	Missense_Mutation	SNP	ENST00000410066.1	37	CCDS33339.1	.	.	.	.	.	.	.	.	.	.	G	13.86	2.363625	0.41902	.	.	ENSG00000144331	ENST00000410066;ENST00000336917;ENST00000409343;ENST00000409692;ENST00000457304;ENST00000439340	T;T;T;T;T;T	0.43294	1.54;1.54;1.53;1.54;1.51;0.95	5.87	5.87	0.94306	.	0.047288	0.85682	D	0.000000	T	0.60650	0.2285	L	0.53249	1.67	0.51767	D	0.999938	D;D	0.69078	0.996;0.997	P;D	0.66716	0.883;0.946	T	0.51608	-0.8684	10	0.32370	T	0.25	2.3982	20.2119	0.98289	0.0:0.0:1.0:0.0	.	151;75	Q569K4;Q569K4-2	Z385B_HUMAN;.	A	151;49;75;49;49;82	ENSP00000386845:P151A;ENSP00000338225:P49A;ENSP00000386379:P75A;ENSP00000386507:P49A;ENSP00000394038:P49A;ENSP00000399198:P82A	ENSP00000338225:P49A	P	-	1	0	ZNF385B	180091556	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.377000	0.66184	2.784000	0.95788	0.585000	0.79938	CCA		ZNF385B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335972.1	NM_152520	
XDH	7498	hgsc.bcm.edu	37	2	31588407	31588407	+	Silent	SNP	G	G	A	rs143539472	byFrequency	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr2:31588407G>A	ENST00000379416.3	-	23	2508	c.2460C>T	c.(2458-2460)acC>acT	p.T820T		NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	820					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)	p.T820T(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	CAGGGCGGCCGGTCCTGGGGG	0.552																																					p.T820T	Colon(66;682 1445 30109 40147)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2460T	2						.	G		4,4402	8.1+/-20.4	0,4,2199	89.0	81.0	84.0		2460	-12.3	0.0	2	dbSNP_134	84	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	XDH	NM_000379.3		0,5,6498	AA,AG,GG		0.0116,0.0908,0.0384		820/1334	31588407	5,13001	2203	4300	6503	31441911	SO:0001819	synonymous_variant	7498	exon23			D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.2460C>T	2.37:g.31588407G>A		Somatic		Capture	SOLID	Phase_I	31441911	NM_000379	Q16681|Q16712|Q4PJ16	Silent	SNP	ENST00000379416.3	37	CCDS1775.1																																																																																				XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216840.1	NM_000379	
PID1	55022	hgsc.bcm.edu	37	2	229890815	229890815	+	Silent	SNP	G	G	A			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr2:229890815G>A	ENST00000354069.6	-	3	316	c.286C>T	c.(286-288)Ctg>Ttg	p.L96L	PID1_ENST00000392054.3_Silent_p.L94L|PID1_ENST00000392055.3_Silent_p.L63L|PID1_ENST00000482518.2_Intron|PID1_ENST00000409462.1_Silent_p.L14L			Q7Z2X4	PCLI1_HUMAN	phosphotyrosine interaction domain containing 1	96	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				cellular response to cytokine stimulus (GO:0071345)|cellular response to fatty acid (GO:0071398)|cellular response to interleukin-6 (GO:0071354)|cellular response to leptin stimulus (GO:0044320)|cellular response to tumor necrosis factor (GO:0071356)|energy reserve metabolic process (GO:0006112)|mitochondrion morphogenesis (GO:0070584)|negative regulation of ATP biosynthetic process (GO:2001170)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of glucose import in response to insulin stimulus (GO:2001274)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of mitochondrial DNA replication (GO:0090298)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of fat cell proliferation (GO:0070346)|positive regulation of gene expression (GO:0010628)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of mitochondrial fusion (GO:0010635)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.L94L(1)		breast(4)|endometrium(3)|large_intestine(5)|lung(8)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	26		Renal(207;0.0112)|all_lung(227;0.0191)|Lung NSC(271;0.0851)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.171)		Epithelial(121;3.08e-11)|all cancers(144;2.28e-08)|LUSC - Lung squamous cell carcinoma(224;0.0145)|Lung(261;0.0189)		ACTTTGCCCAGGTAGGTAACC	0.502																																					p.L63L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C187T	2						.						61.0	60.0	60.0					2																	229890815		2203	4300	6503	229599059	SO:0001819	synonymous_variant	55022	exon3			AK096636	CCDS2471.1, CCDS42830.1	2q36.3	2007-02-02			ENSG00000153823	ENSG00000153823			26084	protein-coding gene	gene with protein product		612930				17124247, 16815647, 15221005	Standard	NM_001100818		Approved	NYGGF4, FLJ20701	uc002vps.4	Q7Z2X4	OTTHUMG00000133191	ENST00000354069.6:c.286C>T	2.37:g.229890815G>A		Somatic		Capture	SOLID	Phase_I	229599059	NM_001100818	B3KU82|Q68CJ2|Q6ZUS3|Q8IXL0|Q9NWP6	Silent	SNP	ENST00000354069.6	37																																																																																					PID1-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000331810.2	NM_017933	
PAPPA	5069	hgsc.bcm.edu	37	9	118989765	118989765	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr9:118989765G>T	ENST00000328252.3	+	6	2536	c.2167G>T	c.(2167-2169)Gct>Tct	p.A723S	PAPPA_ENST00000534838.1_Intron	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	723					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.A723S(1)		NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						GGTGCAGTATGCTTCCAACGC	0.537																																					p.A723S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2167T	9						.						172.0	150.0	158.0					9																	118989765		2203	4300	6503	118029586	SO:0001583	missense	5069	exon6				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.2167G>T	9.37:g.118989765G>T	ENSP00000330658:p.Ala723Ser	Somatic		Capture	SOLID	Phase_I	118029586	NM_002581	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	37	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	G	34	5.323596	0.95708	.	.	ENSG00000182752	ENST00000328252;ENST00000443904	T	0.02763	4.17	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.13884	0.0336	M	0.79475	2.455	0.80722	D	1	D;D	0.65815	0.995;0.994	P;P	0.56700	0.793;0.804	T	0.00035	-1.2260	10	0.59425	D	0.04	-11.9823	20.1624	0.98139	0.0:0.0:1.0:0.0	.	167;723	E7EMD3;Q13219	.;PAPP1_HUMAN	S	723;167	ENSP00000330658:A723S	ENSP00000330658:A723S	A	+	1	0	PAPPA	118029586	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.701000	0.98710	2.764000	0.94973	0.591000	0.81541	GCT		PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
PTCH1	5727	hgsc.bcm.edu	37	9	98232133	98232133	+	Silent	SNP	G	G	A	rs145690756	byFrequency	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr9:98232133G>A	ENST00000331920.6	-	13	2108	c.1809C>T	c.(1807-1809)cgC>cgT	p.R603R	PTCH1_ENST00000429896.2_Silent_p.R452R|PTCH1_ENST00000418258.1_Silent_p.R452R|PTCH1_ENST00000375274.2_Silent_p.R602R|PTCH1_ENST00000430669.2_Silent_p.R537R|PTCH1_ENST00000421141.1_Silent_p.R452R|PTCH1_ENST00000437951.1_Silent_p.R537R	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	603					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)	p.R602R(2)|p.R603R(2)		NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				TCCTGTCCTCGCGTCGATATA	0.438													G|||	3	0.000599042	0.0	0.0	5008	,	,		20000	0.003		0.0	False		,,,				2504	0.0				p.R452R												.	.	4	Substitution - coding silent(4)	large_intestine(4)	c.C1356T	9						.	G	,,,,,,	2,4404	4.2+/-10.8	0,2,2201	148.0	143.0	145.0		1809,1611,1806,1356,1356,1356,1356	-10.4	0.9	9	dbSNP_134	145	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PTCH1	NM_000264.3,NM_001083602.1,NM_001083603.1,NM_001083604.1,NM_001083605.1,NM_001083606.1,NM_001083607.1	,,,,,,	0,3,6500	AA,AG,GG		0.0116,0.0454,0.0231	,,,,,,	603/1448,537/1382,602/1447,452/1297,452/1297,452/1297,452/1297	98232133	3,13003	2203	4300	6503	97271954	SO:0001819	synonymous_variant	5727	exon13			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.1809C>T	9.37:g.98232133G>A		Somatic		Capture	SOLID	Phase_I	97271954	NM_001083605	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Silent	SNP	ENST00000331920.6	37	CCDS6714.1																																																																																				PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2	NM_000264	
C5	727	hgsc.bcm.edu	37	9	123719634	123719634	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr9:123719634C>G	ENST00000223642.1	-	39	4720	c.4691G>C	c.(4690-4692)aGc>aCc	p.S1564T		NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	1564	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)	p.S1564T(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	GGATGTGATGCTAACTTTATA	0.358																																					p.S1564T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4691C	9						.						171.0	165.0	167.0					9																	123719634		2203	4300	6503	122759455	SO:0001583	missense	727	exon39			M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.4691G>C	9.37:g.123719634C>G	ENSP00000223642:p.Ser1564Thr	Somatic		Capture	SOLID	Phase_I	122759455	NM_001735	Q14CJ0|Q27I61	Missense_Mutation	SNP	ENST00000223642.1	37	CCDS6826.1	.	.	.	.	.	.	.	.	.	.	C	0.181	-1.062212	0.01950	.	.	ENSG00000106804	ENST00000223642	T	0.20738	2.05	5.86	-1.92	0.07618	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);Netrin module, non-TIMP type (2);	1.682700	0.02491	N	0.089439	T	0.10465	0.0256	N	0.08118	0	0.09310	N	1	B	0.15719	0.014	B	0.21151	0.033	T	0.22138	-1.0225	10	0.19590	T	0.45	.	5.2408	0.15471	0.1575:0.2482:0.0:0.5943	.	1564	P01031	CO5_HUMAN	T	1564	ENSP00000223642:S1564T	ENSP00000223642:S1564T	S	-	2	0	C5	122759455	0.005000	0.15991	0.001000	0.08648	0.200000	0.23975	0.217000	0.17603	-0.205000	0.10219	-0.122000	0.15005	AGC		C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053844.1	NM_001735	
PCDH9	5101	hgsc.bcm.edu	37	13	66878829	66878829	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr13:66878829T>G	ENST00000377865.2	-	4	3806	c.3672A>C	c.(3670-3672)caA>caC	p.Q1224H	PCDH9_ENST00000544246.1_Missense_Mutation_p.Q1224H|PCDH9_ENST00000456367.1_Missense_Mutation_p.Q1190H|PCDH9-AS1_ENST00000430861.1_RNA|PCDH9_ENST00000328454.5_Missense_Mutation_p.Q1190H			Q9HC56	PCDH9_HUMAN	protocadherin 9	1224					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Q1224H(1)|p.Q1224Q(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		CACCTCCTGCTTGCTTATAAG	0.438																																					p.Q1190H												.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(1)|stomach(1)	c.A3570C	13						.						120.0	112.0	114.0					13																	66878829		2203	4300	6503	65776830	SO:0001583	missense	5101	exon4			AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.3672A>C	13.37:g.66878829T>G	ENSP00000367096:p.Gln1224His	Somatic		Capture	SOLID	Phase_I	65776830	NM_020403	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	37	CCDS9444.1	.	.	.	.	.	.	.	.	.	.	T	12.83	2.054451	0.36277	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454	T;T;T;T	0.55930	0.57;0.57;0.49;0.49	6.05	4.91	0.64330	.	0.000000	0.45606	D	0.000344	T	0.31857	0.0810	N	0.19112	0.55	0.29867	N	0.827155	P;B;P	0.36616	0.561;0.289;0.561	B;B;B	0.31946	0.066;0.138;0.066	T	0.38802	-0.9644	10	0.87932	D	0	.	5.6712	0.17723	0.0:0.1792:0.0:0.8208	.	1182;1190;1224	B7ZM79;Q9HC56-2;Q9HC56	.;.;PCDH9_HUMAN	H	1224;1224;1190;1190	ENSP00000442186:Q1224H;ENSP00000367096:Q1224H;ENSP00000401699:Q1190H;ENSP00000332060:Q1190H	ENSP00000332060:Q1190H	Q	-	3	2	PCDH9	65776830	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.115000	0.31209	2.320000	0.78422	0.528000	0.53228	CAA		PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487	
ITGA8	8516	hgsc.bcm.edu	37	10	15617579	15617579	+	Missense_Mutation	SNP	G	G	C	rs147383371		TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr10:15617579G>C	ENST00000378076.3	-	24	2740	c.2387C>G	c.(2386-2388)cCg>cGg	p.P796R		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	796					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)	p.P796R(1)		NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						AACAATCTGCGGAGGGTGTGA	0.443													G|||	1	0.000199681	0.0	0.0	5008	,	,		17937	0.001		0.0	False		,,,				2504	0.0				p.P796R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2387G	10						.						121.0	107.0	112.0					10																	15617579		2203	4300	6503	15657585	SO:0001583	missense	8516	exon24			L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.2387C>G	10.37:g.15617579G>C	ENSP00000367316:p.Pro796Arg	Somatic		Capture	SOLID	Phase_I	15657585	NM_003638	B0YJ31|Q5VX94	Missense_Mutation	SNP	ENST00000378076.3	37	CCDS31155.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	12.36	1.915891	0.33815	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	T	0.43294	0.95	5.5	2.58	0.30949	Integrin alpha-2 (1);	0.153629	0.64402	D	0.000011	T	0.43722	0.1260	M	0.64997	1.995	0.37815	D	0.928187	B;B	0.33857	0.376;0.429	B;P	0.44597	0.325;0.454	T	0.31336	-0.9947	10	0.22109	T	0.4	.	7.4146	0.27036	0.1475:0.0:0.7161:0.1364	.	781;796	F5H818;P53708	.;ITA8_HUMAN	R	796;781	ENSP00000367316:P796R	ENSP00000367316:P796R	P	-	2	0	ITGA8	15657585	1.000000	0.71417	0.520000	0.27837	0.372000	0.29890	3.000000	0.49481	0.346000	0.23899	0.650000	0.86243	CCG		ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1	NM_003638	
MYO3A	53904	hgsc.bcm.edu	37	10	26355942	26355942	+	Missense_Mutation	SNP	G	G	A	rs564946468		TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr10:26355942G>A	ENST00000265944.5	+	11	1158	c.992G>A	c.(991-993)cGa>cAa	p.R331Q	MYO3A_ENST00000543632.1_Missense_Mutation_p.R331Q	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	331					ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.R331Q(1)		NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						AACTTCAACCGACCTCTAATA	0.348													G|||	1	0.000199681	0.0	0.0	5008	,	,		17660	0.001		0.0	False		,,,				2504	0.0				p.R331Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G992A	10						.						99.0	92.0	94.0					10																	26355942		2203	4300	6503	26395948	SO:0001583	missense	53904	exon11			AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.992G>A	10.37:g.26355942G>A	ENSP00000265944:p.Arg331Gln	Somatic		Capture	SOLID	Phase_I	26395948	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	37	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	G	8.015	0.758356	0.15846	.	.	ENSG00000095777	ENST00000265944;ENST00000543632	T;T	0.77229	-1.08;-0.84	5.56	1.15	0.20763	Protein kinase-like domain (1);	0.294555	0.41396	N	0.000894	T	0.63462	0.2513	L	0.51422	1.61	0.09310	N	1	P;B;B	0.36027	0.533;0.398;0.169	B;B;B	0.28553	0.091;0.038;0.019	T	0.50583	-0.8811	10	0.23891	T	0.37	.	8.0642	0.30651	0.5156:0.0:0.4844:0.0	.	331;331;331	F5H0U9;Q0VD65;Q8NEV4	.;.;MYO3A_HUMAN	Q	331	ENSP00000265944:R331Q;ENSP00000445909:R331Q	ENSP00000265944:R331Q	R	+	2	0	MYO3A	26395948	0.019000	0.18553	0.002000	0.10522	0.028000	0.11728	1.050000	0.30404	0.330000	0.23485	0.650000	0.86243	CGA		MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
CCDC172	374355	hgsc.bcm.edu	37	10	118101627	118101627	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr10:118101627T>C	ENST00000333254.3	+	5	613	c.362T>C	c.(361-363)aTa>aCa	p.I121T	CCDC172_ENST00000497093.1_3'UTR	NM_198515.2	NP_940917.1	P0C7W6	CC172_HUMAN	coiled-coil domain containing 172	121								p.I121T(1)									GATTATGAAATAACAAAGAAA	0.264																																					p.I121T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T362C	10						.						35.0	40.0	38.0					10																	118101627		2186	4250	6436	118091617	SO:0001583	missense	374355	exon5			BC044830	CCDS31291.1	10q26.11-q26.12	2012-05-31	2012-05-31	2012-05-31	ENSG00000182645	ENSG00000182645			30524	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 96"""	C10orf96		12477932	Standard	NM_198515		Approved	MGC35062	uc001lck.3	P0C7W6	OTTHUMG00000019098	ENST00000333254.3:c.362T>C	10.37:g.118101627T>C	ENSP00000329860:p.Ile121Thr	Somatic		Capture	SOLID	Phase_I	118091617	NM_198515		Missense_Mutation	SNP	ENST00000333254.3	37	CCDS31291.1	.	.	.	.	.	.	.	.	.	.	T	14.22	2.471523	0.43942	.	.	ENSG00000182645	ENST00000333254;ENST00000423072	.	.	.	5.41	4.28	0.50868	.	0.420430	0.25227	N	0.032196	T	0.42381	0.1200	L	0.51422	1.61	0.24154	N	0.995688	B	0.17667	0.023	B	0.15052	0.012	T	0.41875	-0.9484	9	0.72032	D	0.01	-17.191	11.1923	0.48691	0.0:0.0722:0.0:0.9277	.	121	P0C7W6	CJ096_HUMAN	T	121	.	ENSP00000329860:I121T	I	+	2	0	C10orf96	118091617	1.000000	0.71417	0.967000	0.41034	0.960000	0.62799	3.982000	0.56909	1.005000	0.39183	0.533000	0.62120	ATA		CCDC172-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050516.2	NM_198515	
MRPL22	29093	hgsc.bcm.edu	37	5	154320684	154320684	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr5:154320684T>G	ENST00000523037.1	+	1	55	c.14T>G	c.(13-15)gTa>gGa	p.V5G	MRPL22_ENST00000522038.1_Missense_Mutation_p.V5G|MRPL22_ENST00000265229.8_5'UTR|MRPL22_ENST00000439747.3_Missense_Mutation_p.V5G|GEMIN5_ENST00000285873.7_5'Flank	NM_014180.3	NP_054899.2	Q9NWU5	RM22_HUMAN	mitochondrial ribosomal protein L22	5					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.V5G(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(2)	10	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GCGGCGGCAGTACTGGGACAG	0.552																																					p.V5G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T14G	5						.						145.0	147.0	146.0					5																	154320684		2203	4300	6503	154300877	SO:0001583	missense	29093	exon1			AB051622	CCDS4331.1, CCDS43391.1	5q33.2	2012-09-13			ENSG00000082515	ENSG00000082515		"""Mitochondrial ribosomal proteins / large subunits"""	14480	protein-coding gene	gene with protein product		611835					Standard	NM_014180		Approved	MRP-L25, RPML25, HSPC158	uc003lvy.4	Q9NWU5	OTTHUMG00000130190	ENST00000523037.1:c.14T>G	5.37:g.154320684T>G	ENSP00000431040:p.Val5Gly	Somatic		Capture	SOLID	Phase_I	154300877	NM_014180	A6NGJ8|Q5H9Q1|Q96Q51|Q9P006	Missense_Mutation	SNP	ENST00000523037.1	37	CCDS4331.1	.	.	.	.	.	.	.	.	.	.	T	12.50	1.957767	0.34565	.	.	ENSG00000082515	ENST00000523037;ENST00000439747;ENST00000522038	T;T;T	0.53206	0.78;0.63;0.79	4.79	3.62	0.41486	.	1.561580	0.03406	N	0.203983	T	0.39835	0.1093	L	0.29908	0.895	0.09310	N	1	B	0.23058	0.079	B	0.19391	0.025	T	0.33007	-0.9885	10	0.87932	D	0	-7.0518	6.6955	0.23197	0.0:0.1116:0.0:0.8884	.	5	Q9NWU5	RM22_HUMAN	G	5	ENSP00000431040:V5G;ENSP00000411177:V5G;ENSP00000429039:V5G	ENSP00000411177:V5G	V	+	2	0	MRPL22	154300877	0.000000	0.05858	0.001000	0.08648	0.019000	0.09904	0.072000	0.14617	0.948000	0.37687	0.528000	0.53228	GTA		MRPL22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252508.2		
LIFR	3977	hgsc.bcm.edu	37	5	38504163	38504163	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr5:38504163A>G	ENST00000263409.4	-	10	1514	c.1352T>C	c.(1351-1353)cTt>cCt	p.L451P	LIFR_ENST00000503088.1_5'UTR|LIFR_ENST00000453190.2_Missense_Mutation_p.L451P	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	451	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)	p.L451P(1)		NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					ATGCCAAGAAAGTTTAACAGC	0.279			T	PLAG1	salivary adenoma																																p.L451P	Melanoma(13;4 730 6426 9861 34751)		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1352C	5						.						55.0	61.0	59.0					5																	38504163		2202	4292	6494	38539920	SO:0001583	missense	3977	exon10			X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.1352T>C	5.37:g.38504163A>G	ENSP00000263409:p.Leu451Pro	Somatic		Capture	SOLID	Phase_I	38539920	NM_001127671	Q6LCD9	Missense_Mutation	SNP	ENST00000263409.4	37	CCDS3927.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.958729	0.74016	.	.	ENSG00000113594	ENST00000263409;ENST00000453190	T;T	0.66995	-0.24;-0.24	5.65	5.65	0.86999	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.637724	0.17132	N	0.185789	T	0.82181	0.4981	M	0.78801	2.425	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.83781	0.0225	10	0.87932	D	0	-22.4314	14.7008	0.69154	1.0:0.0:0.0:0.0	.	451	P42702	LIFR_HUMAN	P	451	ENSP00000263409:L451P;ENSP00000398368:L451P	ENSP00000263409:L451P	L	-	2	0	LIFR	38539920	1.000000	0.71417	0.989000	0.46669	0.978000	0.69477	5.634000	0.67833	2.139000	0.66308	0.528000	0.53228	CTT		LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253823.1	NM_002310	
FAT2	2196	hgsc.bcm.edu	37	5	150947634	150947634	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr5:150947634C>G	ENST00000261800.5	-	1	871	c.859G>C	c.(859-861)Gag>Cag	p.E287Q		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	287					epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E287Q(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCCACTGACTCCACTTCAGCT	0.507																																					p.E287Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G859C	5						.						79.0	80.0	80.0					5																	150947634		2203	4300	6503	150927827	SO:0001583	missense	2196	exon1			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.859G>C	5.37:g.150947634C>G	ENSP00000261800:p.Glu287Gln	Somatic		Capture	SOLID	Phase_I	150927827	NM_001447	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	C	5.004	0.186486	0.09495	.	.	ENSG00000086570	ENST00000261800	T	0.71103	-0.54	4.99	4.11	0.48088	.	0.701517	0.13727	N	0.366993	T	0.61135	0.2323	L	0.38175	1.15	0.28370	N	0.920024	B	0.27559	0.181	B	0.28638	0.092	T	0.48490	-0.9031	10	0.12766	T	0.61	.	15.3962	0.74794	0.0:0.8601:0.1399:0.0	.	287	Q9NYQ8	FAT2_HUMAN	Q	287	ENSP00000261800:E287Q	ENSP00000261800:E287Q	E	-	1	0	FAT2	150927827	0.997000	0.39634	0.230000	0.23976	0.174000	0.22865	4.904000	0.63279	1.305000	0.44909	-0.494000	0.04653	GAG		FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
DOCK2	1794	hgsc.bcm.edu	37	5	169423160	169423160	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr5:169423160G>T	ENST00000256935.8	+	30	3144	c.3064G>T	c.(3064-3066)Gag>Tag	p.E1022*	DOCK2_ENST00000520908.1_Nonsense_Mutation_p.E514*|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_Nonsense_Mutation_p.E83*	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1022	Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.E1022*(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CACGAACTTTGAGTTCCAGGT	0.502																																					p.E1022X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G3064T	5						.						85.0	78.0	80.0					5																	169423160		2203	4300	6503	169355738	SO:0001587	stop_gained	1794	exon30			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3064G>T	5.37:g.169423160G>T	ENSP00000256935:p.Glu1022*	Somatic		Capture	SOLID	Phase_I	169355738	NM_004946	Q2M3I0|Q96AK7	Nonsense_Mutation	SNP	ENST00000256935.8	37	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	G	48	14.694421	0.99806	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	.	.	.	5.5	5.5	0.81552	.	0.170777	0.51477	D	0.000090	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	16.9036	0.86119	0.0:0.0:1.0:0.0	.	.	.	.	X	1022;514;83	.	ENSP00000256935:E1022X	E	+	1	0	DOCK2	169355738	1.000000	0.71417	1.000000	0.80357	0.439000	0.31926	7.136000	0.77285	2.588000	0.87417	0.643000	0.83706	GAG		DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
OFCC1	266553	hgsc.bcm.edu	37	6	9903644	9903644	+	5'UTR	SNP	G	G	A			TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3600-01A-01W-0833-10	TCGA-AG-3600-10A-01W-0833-10	g.chr6:9903644G>A	ENST00000472329.1	-	0	538				OFCC1_ENST00000316020.6_Intron			Q8IZS5	OFCC1_HUMAN	orofacial cleft 1 candidate 1									p.T125M(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|stomach(1)	11	Ovarian(93;0.0473)|Breast(50;0.201)	all_hematologic(90;0.124)				AAAAAGCTTCGTTAATCGATT	0.313																																					.												.	.	1	Substitution - Missense(1)	large_intestine(1)	.	6						.						118.0	118.0	118.0					6																	9903644		2202	4298	6500	10011630	SO:0001623	5_prime_UTR_variant	266553	.			AF548113		6p24.3	2010-11-23			ENSG00000181355	ENSG00000181355			21017	protein-coding gene	gene with protein product		614287					Standard	XM_003119969		Approved	MRDS1	uc003myh.1	Q8IZS5	OTTHUMG00000159104	ENST00000472329.1:c.-496C>T	6.37:g.9903644G>A		Somatic		Capture	SOLID	Phase_I	10011630	.	Q7Z2X5|Q8IUL6|Q8IUM1|Q8IZR9|Q8IZS1|Q8IZS3	Missense_Mutation	SNP	ENST00000472329.1	37																																																																																					OFCC1-003	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000353310.2	NM_153003	
