#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
VPS37B	79720	broad.mit.edu	37	12	123351891	123351892	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AG-3901-01	TCGA-AG-3901-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr12:123351891_123351892insG	ENST00000267202.2	-	4	1010_1011	c.629_630insC	c.(628-630)ccafs	p.P210fs	RP11-463O12.3_ENST00000537827.2_lincRNA	NM_024667.2	NP_078943.1	Q9H9H4	VP37B_HUMAN	vacuolar protein sorting 37 homolog B (S. cerevisiae)	210	Pro-rich.				endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)		p.P211fs*>76(1)		breast(1)|central_nervous_system(1)|large_intestine(1)|skin(1)|urinary_tract(1)	5	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.08e-05)|Epithelial(86;0.000197)|BRCA - Breast invasive adenocarcinoma(302;0.205)		CCGGGGGTGGTGGGGGGGGGAT	0.718																																					p.P210fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.630_631insC	12						.																																			121917845	SO:0001589	frameshift_variant	79720	exon4			AK022812	CCDS9239.1	12q24.31	2008-02-05	2006-04-04		ENSG00000139722	ENSG00000139722			25754	protein-coding gene	gene with protein product		610037	"""vacuolar protein sorting 37B (yeast)"""			15218037	Standard	NM_024667		Approved	FLJ12750	uc001udl.3	Q9H9H4	OTTHUMG00000168767	ENST00000267202.2:c.630dupC	12.37:g.123351900_123351900dupG	ENSP00000267202:p.Pro210fs	Somatic		Unspecified	Illumina	Phase_I	121917844	NM_024667		Frame_Shift_Ins	INS	ENST00000267202.2	37	CCDS9239.1																																																																																				VPS37B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400946.1	NM_024667	
IMPDH1	3614	broad.mit.edu	37	7	128033072	128033072	+	Missense_Mutation	SNP	G	G	A	rs530357590		TCGA-AG-3901-01	TCGA-AG-3901-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr7:128033072G>A	ENST00000480861.1	-	14	1596	c.1519C>T	c.(1519-1521)Cgg>Tgg	p.R507W	IMPDH1_ENST00000354269.5_Missense_Mutation_p.R587W|IMPDH1_ENST00000343214.4_Missense_Mutation_p.R487W|IMPDH1_ENST00000338791.6_Missense_Mutation_p.R597W|IMPDH1_ENST00000348127.6_Missense_Mutation_p.R561W|IMPDH1_ENST00000470772.1_Missense_Mutation_p.R511W|IMPDH1_ENST00000496200.1_Missense_Mutation_p.R487W|IMPDH1_ENST00000378717.4_Missense_Mutation_p.R528W|IMPDH1_ENST00000419067.2_Missense_Mutation_p.R564W	NM_001142574.1	NP_001136046.1			IMP (inosine 5'-monophosphate) dehydrogenase 1									p.R597W(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)	22						CAGTACAGCCGCTTTTCGTAA	0.602													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19139	0.0		0.0	False		,,,				2504	0.0				p.R597W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1789T	7						.						103.0	79.0	88.0					7																	128033072		2203	4300	6503	127820308	SO:0001583	missense	3614	exon17				CCDS34748.1, CCDS34749.1, CCDS43643.1, CCDS47699.1, CCDS47700.1, CCDS55161.1	7q31.3-q32	2013-01-08	2010-04-29		ENSG00000106348	ENSG00000106348	1.1.1.205		6052	protein-coding gene	gene with protein product		146690	"""retinitis pigmentosa 10 (autosomal dominant)"", ""IMP (inosine monophosphate) dehydrogenase 1"""	RP10		1969416, 11875049, 11875050	Standard	NM_000883		Approved	sWSS2608, LCA11	uc003vmu.2	P20839	OTTHUMG00000157713	ENST00000480861.1:c.1519C>T	7.37:g.128033072G>A	ENSP00000420185:p.Arg507Trp	Somatic		Unspecified	Illumina	Phase_I	127820308	NM_000883		Missense_Mutation	SNP	ENST00000480861.1	37	CCDS55161.1	.	.	.	.	.	.	.	.	.	.	G	15.96	2.985951	0.53934	.	.	ENSG00000106348	ENST00000419067;ENST00000338791;ENST00000496200;ENST00000354269;ENST00000378717;ENST00000348127;ENST00000343214;ENST00000470772;ENST00000480861	T;T;T;T;T;T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23;-1.23;-1.23;-1.23;-1.23;-1.23	5.16	5.16	0.70880	Aldolase-type TIM barrel (1);	0.131624	0.37178	U	0.002215	T	0.78786	0.4338	M	0.87097	2.86	0.58432	D	0.999996	B;B;B;B;B;B;B	0.31655	0.017;0.024;0.024;0.012;0.207;0.334;0.041	B;B;B;B;B;B;B	0.17433	0.002;0.0;0.0;0.005;0.018;0.008;0.007	T	0.81378	-0.0960	10	0.87932	D	0	-18.527	14.1242	0.65210	0.0:0.0:1.0:0.0	.	564;507;512;528;561;597;487	C9JV30;B4DE09;P20839;E7EQS0;P20839-3;A4D0Z6;P20839-2	.;.;IMDH1_HUMAN;.;.;.;.	W	564;597;487;587;528;561;487;511;507	ENSP00000399400:R564W;ENSP00000345096:R597W;ENSP00000420803:R487W;ENSP00000346219:R587W;ENSP00000367989:R528W;ENSP00000265385:R561W;ENSP00000342438:R487W;ENSP00000417296:R511W;ENSP00000420185:R507W	ENSP00000345096:R597W	R	-	1	2	IMPDH1	127820308	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	5.200000	0.65158	2.389000	0.81357	0.297000	0.19635	CGG		IMPDH1-009	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000349462.1	NM_000883	
HOXA5	3202	broad.mit.edu	37	7	27181483	27181483	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3901-01	TCGA-AG-3901-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr7:27181483C>A	ENST00000222726.3	-	2	844	c.784G>T	c.(784-786)Gcc>Tcc	p.A262S	HOXA5_ENST00000520854.1_5'UTR|HOXA-AS3_ENST00000521197.1_RNA|HOXA3_ENST00000521401.1_5'Flank|HOXA-AS3_ENST00000518848.1_RNA|RP1-170O19.22_ENST00000467897.2_RNA	NM_019102.3	NP_061975.2	P20719	HXA5_HUMAN	homeobox A5	262					anterior/posterior pattern specification (GO:0009952)|bronchiole development (GO:0060435)|cell migration (GO:0016477)|cell-cell signaling involved in mammary gland development (GO:0060764)|embryonic skeletal system morphogenesis (GO:0048704)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|intestinal epithelial cell maturation (GO:0060574)|lung alveolus development (GO:0048286)|lung goblet cell differentiation (GO:0060480)|lung-associated mesenchyme development (GO:0060484)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mesenchymal-epithelial cell signaling (GO:0060638)|multicellular organism growth (GO:0035264)|negative regulation of angiogenesis (GO:0016525)|negative regulation of erythrocyte differentiation (GO:0045647)|positive regulation of apoptotic process (GO:0043065)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|respiratory system process (GO:0003016)|thyroid gland development (GO:0030878)|trachea cartilage morphogenesis (GO:0060535)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A262S(1)		central_nervous_system(1)|large_intestine(2)|lung(12)|skin(1)	16						CCTGCCGCGGCCATGCTCATG	0.473											OREG0017911	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A262S	Colon(119;75 2200 7557 42868)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G784T	7						.						112.0	110.0	111.0					7																	27181483		2203	4300	6503	27148008	SO:0001583	missense	3202	exon2				CCDS5406.1	7p15.2	2011-06-20	2005-12-22		ENSG00000106004	ENSG00000106004		"""Homeoboxes / ANTP class : HOXL subclass"""	5106	protein-coding gene	gene with protein product		142952	"""homeo box A5"""	HOX1C, HOX1		1973146, 1358459	Standard	NM_019102		Approved		uc003syn.2	P20719	OTTHUMG00000023214	ENST00000222726.3:c.784G>T	7.37:g.27181483C>A	ENSP00000222726:p.Ala262Ser	Somatic	792	Unspecified	Illumina	Phase_I	27148008	NM_019102	A4D179|O43367|Q96CY6	Missense_Mutation	SNP	ENST00000222726.3	37	CCDS5406.1	.	.	.	.	.	.	.	.	.	.	C	15.72	2.916948	0.52546	.	.	ENSG00000106004	ENST00000222726	D	0.91843	-2.92	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	D	0.83036	0.5167	N	0.04203	-0.255	0.80722	D	1	P	0.39809	0.689	B	0.36378	0.223	D	0.84597	0.0670	10	0.37606	T	0.19	.	18.9046	0.92455	0.0:1.0:0.0:0.0	.	262	P20719	HXA5_HUMAN	S	262	ENSP00000222726:A262S	ENSP00000222726:A262S	A	-	1	0	HOXA5	27148008	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.424000	0.80242	2.548000	0.85928	0.543000	0.68304	GCC		HOXA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358705.1		
GRM3	2913	broad.mit.edu	37	7	86468760	86468760	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3901-01	TCGA-AG-3901-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr7:86468760C>T	ENST00000361669.2	+	4	3029	c.1930C>T	c.(1930-1932)Cgc>Tgc	p.R644C	GRM3_ENST00000536043.1_Missense_Mutation_p.R516C|GRM3_ENST00000394720.2_Intron|GRM3_ENST00000439827.1_Intron|GRM3_ENST00000546348.1_Missense_Mutation_p.R236C	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	644					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)	p.R644C(1)		NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					CTGTGCATTGCGCCGACTCGG	0.532																																					p.R644C	GBM(52;969 1098 3139 52280)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1930T	7						.						217.0	182.0	194.0					7																	86468760		2203	4300	6503	86306696	SO:0001583	missense	2913	exon4				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.1930C>T	7.37:g.86468760C>T	ENSP00000355316:p.Arg644Cys	Somatic		Unspecified	Illumina	Phase_I	86306696	NM_000840	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	ENST00000361669.2	37	CCDS5600.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.269599	0.80469	.	.	ENSG00000198822	ENST00000361669;ENST00000546348;ENST00000536043	D;D;D	0.90788	-2.73;-2.73;-2.73	5.95	5.95	0.96441	GPCR, family 3, C-terminal (2);	0.050608	0.85682	D	0.000000	D	0.96125	0.8737	M	0.87038	2.855	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.978;0.99;0.994	D	0.96138	0.9098	10	0.87932	D	0	.	19.3629	0.94448	0.0:1.0:0.0:0.0	.	236;516;644	B7Z204;F5GYZ2;Q14832	.;.;GRM3_HUMAN	C	644;236;516	ENSP00000355316:R644C;ENSP00000444064:R236C;ENSP00000441407:R516C	ENSP00000355316:R644C	R	+	1	0	GRM3	86306696	1.000000	0.71417	0.999000	0.59377	0.899000	0.52679	7.818000	0.86416	2.817000	0.96982	0.563000	0.77884	CGC		GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253362.2		
CASD1	64921	broad.mit.edu	37	7	94167097	94167097	+	Missense_Mutation	SNP	G	G	A	rs371554475		TCGA-AG-3901-01	TCGA-AG-3901-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr7:94167097G>A	ENST00000297273.4	+	9	1444	c.1157G>A	c.(1156-1158)cGt>cAt	p.R386H		NM_022900.4	NP_075051.4	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1	386			R -> S (in dbSNP:rs17855797). {ECO:0000269|PubMed:15489334}.			integral component of membrane (GO:0016021)		p.R386H(1)		NS(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	31	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			ATGTGTGACCGTGCAAATCTG	0.289													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18079	0.0		0.0	False		,,,				2504	0.0				p.R386H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1157A	7						.	G	HIS/ARG	0,4404		0,0,2202	97.0	108.0	104.0		1157	4.6	1.0	7		104	1,8599	1.2+/-3.3	0,1,4299	no	missense	CASD1	NM_022900.4	29	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	386/798	94167097	1,13003	2202	4300	6502	94005033	SO:0001583	missense	64921	exon9			AF355594	CCDS5636.1	7q22	2006-03-09			ENSG00000127995	ENSG00000127995			16014	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 12"""	611686				11703667, 11528394	Standard	NM_022900		Approved	FLJ21213, FLJ21879, C7orf12	uc003uni.4	Q96PB1	OTTHUMG00000023356	ENST00000297273.4:c.1157G>A	7.37:g.94167097G>A	ENSP00000297273:p.Arg386His	Somatic		Unspecified	Illumina	Phase_I	94005033	NM_022900	B3KW13|O14574|Q3LIE2|Q6P4R4|Q9H6T9|Q9H770	Missense_Mutation	SNP	ENST00000297273.4	37	CCDS5636.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.586622	0.86851	0.0	1.16E-4	ENSG00000127995	ENST00000297273	T	0.64438	-0.1	5.51	4.63	0.57726	.	0.049300	0.85682	N	0.000000	T	0.65933	0.2739	M	0.79693	2.465	0.58432	D	0.999998	B;B	0.17038	0.02;0.02	B;B	0.19946	0.027;0.027	T	0.67577	-0.5635	10	0.87932	D	0	.	14.4995	0.67711	0.0709:0.0:0.9291:0.0	.	386;386	Q8WZ77;Q96PB1	.;CASD1_HUMAN	H	386	ENSP00000297273:R386H	ENSP00000297273:R386H	R	+	2	0	CASD1	94005033	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.606000	0.98325	1.475000	0.48197	0.585000	0.79938	CGT		CASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255216.1	NM_022900	
ZNF425	155054	broad.mit.edu	37	7	148815402	148815402	+	Silent	SNP	C	C	T	rs560790723		TCGA-AG-3901-01	TCGA-AG-3901-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr7:148815402C>T	ENST00000378061.2	-	2	189	c.57G>A	c.(55-57)tcG>tcA	p.S19S		NM_001001661.2	NP_001001661.1	Q6IV72	ZN425_HUMAN	zinc finger protein 425	19	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S19S(1)		breast(6)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	50	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			ACTCTTGTTCCGAAAAATATA	0.393																																					p.S19S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G57A	7						.						216.0	200.0	205.0					7																	148815402		2203	4300	6503	148446335	SO:0001819	synonymous_variant	155054	exon2			AK056498	CCDS34773.1	7q36.1	2013-01-08			ENSG00000204947	ENSG00000204947		"""Zinc fingers, C2H2-type"", ""-"""	20690	protein-coding gene	gene with protein product							Standard	NM_001001661		Approved		uc003wfj.3	Q6IV72	OTTHUMG00000158971	ENST00000378061.2:c.57G>A	7.37:g.148815402C>T		Somatic		Unspecified	Illumina	Phase_I	148446335	NM_001001661	B3KPM1|Q08AG3	Silent	SNP	ENST00000378061.2	37	CCDS34773.1																																																																																				ZNF425-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352726.1	XM_088140	
DDX27	55661	broad.mit.edu	37	20	47851609	47851609	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3901-01	TCGA-AG-3901-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr20:47851609C>T	ENST00000371764.4	+	12	1513	c.1504C>T	c.(1504-1506)Cgg>Tgg	p.R502W	DDX27_ENST00000484427.1_3'UTR	NM_017895.7	NP_060365.7	Q96GQ7	DDX27_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27	502	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.R502W(1)		NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	45			BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			ACAGACGCAGCGGCTGGAGGC	0.602																																					p.R502W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1504T	20						.						54.0	51.0	52.0					20																	47851609		2203	4300	6503	47285016	SO:0001583	missense	55661	exon12			AL049766	CCDS13416.1	20q13.13	2010-07-06	2003-06-13		ENSG00000124228	ENSG00000124228		"""DEAD-boxes"""	15837	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 27"""				Standard	NM_017895		Approved	dJ686N3.1, DRS1	uc002xuh.3	Q96GQ7	OTTHUMG00000033072	ENST00000371764.4:c.1504C>T	20.37:g.47851609C>T	ENSP00000360828:p.Arg502Trp	Somatic		Unspecified	Illumina	Phase_I	47285016	NM_017895	A0AVB6|B7ZLY1|Q5VXM7|Q8WYG4|Q969N7|Q96F57|Q96L97|Q9BWY9|Q9BXF0|Q9H990|Q9NWU3|Q9P0C2|Q9UGD6	Missense_Mutation	SNP	ENST00000371764.4	37	CCDS13416.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.024379	0.75390	.	.	ENSG00000124228	ENST00000371764	D	0.82893	-1.66	5.18	5.18	0.71444	Helicase, C-terminal (3);	0.049847	0.85682	D	0.000000	D	0.95162	0.8432	H	0.99261	4.49	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97262	0.9905	10	0.87932	D	0	-10.0097	16.1918	0.81996	0.0:1.0:0.0:0.0	.	502	Q96GQ7	DDX27_HUMAN	W	502	ENSP00000360828:R502W	ENSP00000360828:R502W	R	+	1	2	DDX27	47285016	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	4.624000	0.61254	2.417000	0.82017	0.655000	0.94253	CGG		DDX27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080485.1		
SERPIND1	3053	broad.mit.edu	37	22	21133658	21133658	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3901-01	TCGA-AG-3901-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr22:21133658G>A	ENST00000215727.5	+	2	341	c.58G>A	c.(58-60)Ggg>Agg	p.G20R	PI4KA_ENST00000572273.1_Intron|SERPIND1_ENST00000406799.1_Missense_Mutation_p.G20R|PI4KA_ENST00000466162.1_Intron|PI4KA_ENST00000255882.6_Intron	NM_000185.3	NP_000176.2	P05546	HEP2_HUMAN	serpin peptidase inhibitor, clade D (heparin cofactor), member 1	20					blood coagulation (GO:0007596)|chemotaxis (GO:0006935)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.G20R(2)		breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(11;6.16e-25)|all_epithelial(7;1.02e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)		Ardeparin(DB00407)|Sulodexide(DB06271)	TGCGTGGGGTGGGAGCAAAGG	0.488																																					p.G20R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G58A	22						.						56.0	58.0	58.0					22																	21133658		2203	4300	6503	19463658	SO:0001583	missense	3053	exon2			M12849	CCDS13783.1	22q11.21	2014-02-18	2005-08-18		ENSG00000099937	ENSG00000099937		"""Serine (or cysteine) peptidase inhibitors"""	4838	protein-coding gene	gene with protein product	"""heparin cofactor II"""	142360	"""serine (or cysteine) proteinase inhibitor, clade D (heparin cofactor), member 1"""	HCF2		1671335, 24172014	Standard	XM_005261597		Approved	HC-II, HLS2, HC2, D22S673	uc002ztb.1	P05546	OTTHUMG00000150755	ENST00000215727.5:c.58G>A	22.37:g.21133658G>A	ENSP00000215727:p.Gly20Arg	Somatic		Unspecified	Illumina	Phase_I	19463658	NM_000185	B2RAI1|D3DX34|Q6IBZ5	Missense_Mutation	SNP	ENST00000215727.5	37	CCDS13783.1	.	.	.	.	.	.	.	.	.	.	G	15.59	2.877228	0.51801	.	.	ENSG00000099937	ENST00000215727;ENST00000406799	D;D	0.83419	-1.72;-1.72	5.54	1.98	0.26296	.	0.356504	0.35179	N	0.003383	T	0.64929	0.2643	N	0.08118	0	0.09310	N	1	B;B	0.15930	0.015;0.006	B;B	0.14578	0.011;0.011	T	0.61466	-0.7057	10	0.72032	D	0.01	.	9.1906	0.37197	0.1523:0.1258:0.7219:0.0	.	20;20	Q8IVC0;P05546	.;HEP2_HUMAN	R	20	ENSP00000215727:G20R;ENSP00000384050:G20R	ENSP00000215727:G20R	G	+	1	0	SERPIND1	19463658	0.174000	0.23070	0.002000	0.10522	0.002000	0.02628	1.554000	0.36266	1.347000	0.45714	0.655000	0.94253	GGG		SERPIND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319961.1	NM_000185	
UPB1	51733	broad.mit.edu	37	22	24911250	24911250	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3901-01	TCGA-AG-3901-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr22:24911250G>A	ENST00000326010.5	+	6	1047	c.703G>A	c.(703-705)Ggg>Agg	p.G235R	AP000355.2_ENST00000432032.1_RNA|UPB1_ENST00000413389.2_Missense_Mutation_p.G167R	NM_016327.2	NP_057411.1	Q9UBR1	BUP1_HUMAN	ureidopropionase, beta	235	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	beta-ureidopropionase activity (GO:0003837)|metal ion binding (GO:0046872)	p.G235R(1)		endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	22	Colorectal(2;0.0339)					CATTTGCTACGGGCGGCACCA	0.557																																					p.G235R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G703A	22						.						128.0	102.0	111.0					22																	24911250		2203	4300	6503	23241250	SO:0001583	missense	51733	exon6			AB013885	CCDS13827.1	22q11.2	2008-04-11			ENSG00000100024	ENSG00000100024			16297	protein-coding gene	gene with protein product		606673				10542323	Standard	XR_244378		Approved	BUP1	uc003aaf.3	Q9UBR1	OTTHUMG00000150749	ENST00000326010.5:c.703G>A	22.37:g.24911250G>A	ENSP00000324343:p.Gly235Arg	Somatic		Unspecified	Illumina	Phase_I	23241250	NM_016327	A3KMF8|Q9UIR3	Missense_Mutation	SNP	ENST00000326010.5	37	CCDS13827.1	.	.	.	.	.	.	.	.	.	.	G	34	5.395696	0.96009	.	.	ENSG00000100024	ENST00000413389;ENST00000326010	D;D	0.85556	-2.0;-2.0	5.11	5.11	0.69529	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (4);	0.094539	0.64402	D	0.000001	D	0.94644	0.8273	H	0.94503	3.545	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95823	0.8851	10	0.87932	D	0	-7.9849	17.7088	0.88316	0.0:0.0:1.0:0.0	.	235;167	Q9UBR1;E7EUZ5	BUP1_HUMAN;.	R	167;235	ENSP00000406057:G167R;ENSP00000324343:G235R	ENSP00000324343:G235R	G	+	1	0	UPB1	23241250	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	9.007000	0.93597	2.663000	0.90544	0.650000	0.86243	GGG		UPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319869.1		
C22orf23	84645	broad.mit.edu	37	22	38343397	38343397	+	Silent	SNP	C	C	T			TCGA-AG-3901-01	TCGA-AG-3901-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr22:38343397C>T	ENST00000249079.2	-	4	496	c.240G>A	c.(238-240)tcG>tcA	p.S80S	C22orf23_ENST00000403026.1_Silent_p.S80S|C22orf23_ENST00000403305.1_Silent_p.S80S			Q9BZE7	EVG1_HUMAN	chromosome 22 open reading frame 23	80								p.S80S(1)		endometrium(3)|kidney(2)|large_intestine(7)	12	Melanoma(58;0.045)					GGTAGATGGGCGAGGCTATTT	0.607																																					p.S80S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G240A	22						.						146.0	125.0	132.0					22																	38343397		2203	4300	6503	36673343	SO:0001819	synonymous_variant	84645	exon4			AF324466	CCDS13962.1, CCDS74860.1	22q13.1	2013-10-11			ENSG00000128346	ENSG00000128346			18589	protein-coding gene	gene with protein product						11237012	Standard	NM_032561		Approved	FLJ32787, EVG1, LOC84645	uc003auj.2	Q9BZE7	OTTHUMG00000150672	ENST00000249079.2:c.240G>A	22.37:g.38343397C>T		Somatic		Unspecified	Illumina	Phase_I	36673343	NM_032561	Q5JYU9|Q96M68	Silent	SNP	ENST00000249079.2	37	CCDS13962.1																																																																																				C22orf23-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319564.1	NM_032561	
ZFP82	284406	broad.mit.edu	37	19	36884213	36884213	+	Silent	SNP	G	G	A	rs112210948		TCGA-AG-3901-01	TCGA-AG-3901-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr19:36884213G>A	ENST00000392161.3	-	5	1271	c.1029C>T	c.(1027-1029)tgC>tgT	p.C343C	ZFP82_ENST00000392171.1_Silent_p.C343C	NM_133466.2	NP_597723.1	Q8N141	ZFP82_HUMAN	ZFP82 zinc finger protein	343					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C343C(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AGGCCTTCCCGCATTCCTTAC	0.428																																					p.C343C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1029T	19						.						96.0	97.0	96.0					19																	36884213		2203	4300	6503	41576053	SO:0001819	synonymous_variant	284406	exon5			AL834267	CCDS12493.1	19q13.13	2013-01-08	2012-11-27	2008-07-01		ENSG00000181007		"""Zinc fingers, C2H2-type"", ""-"""	28682	protein-coding gene	gene with protein product			"""zinc finger protein 545"", ""zinc finger protein 82 homolog (mouse)"", ""zinc finger protein 82"""	ZNF545		11853319	Standard	NM_133466		Approved	MGC45380, KIAA1948	uc002ody.1	Q8N141		ENST00000392161.3:c.1029C>T	19.37:g.36884213G>A		Somatic		Unspecified	Illumina	Phase_I	41576053	NM_133466	Q8NC63|Q8TF53	Silent	SNP	ENST00000392161.3	37	CCDS12493.1																																																																																				ZFP82-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109552.2	NM_133466	
PAPPA2	60676	broad.mit.edu	37	1	176525833	176525833	+	Silent	SNP	G	G	A			TCGA-AG-3901-01	TCGA-AG-3901-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr1:176525833G>A	ENST00000367662.3	+	2	1539	c.375G>A	c.(373-375)ccG>ccA	p.P125P	PAPPA2_ENST00000367661.3_Silent_p.P125P	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	125					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.P125P(2)		NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						TTGAAGAGCCGGCTGCCCCAT	0.542																																					p.P125P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G375A	1						.						114.0	115.0	114.0					1																	176525833		2052	4198	6250	174792456	SO:0001819	synonymous_variant	60676	exon2			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.375G>A	1.37:g.176525833G>A		Somatic		Unspecified	Illumina	Phase_I	174792456	NM_020318	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Silent	SNP	ENST00000367662.3	37	CCDS41438.1																																																																																				PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1		
KCNT2	343450	broad.mit.edu	37	1	196227479	196227479	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3901-01	TCGA-AG-3901-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr1:196227479C>T	ENST00000294725.9	-	26	3971	c.3056G>A	c.(3055-3057)cGa>cAa	p.R1019Q	KCNT2_ENST00000367433.5_Missense_Mutation_p.R995Q|KCNT2_ENST00000367431.4_Missense_Mutation_p.R953Q|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000451324.2_3'UTR|KCNT2_ENST00000609185.1_Missense_Mutation_p.R952Q			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	1019					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)	p.R1019Q(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						GCTCAGTCTTCGGGCCCACTG	0.512																																					p.R1019Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3056A	1						.						147.0	127.0	134.0					1																	196227479		2203	4300	6503	194494102	SO:0001583	missense	343450	exon26			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.3056G>A	1.37:g.196227479C>T	ENSP00000294725:p.Arg1019Gln	Somatic		Unspecified	Illumina	Phase_I	194494102	NM_198503	Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	ENST00000294725.9	37	CCDS1384.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.444207	0.83993	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000294725	T;T;T	0.23950	1.88;1.93;2.23	5.74	4.83	0.62350	.	0.000000	0.49305	D	0.000152	T	0.49847	0.1581	M	0.78916	2.43	0.80722	D	1	D;D;D;D	0.76494	0.999;0.99;0.967;0.983	D;P;P;P	0.65443	0.935;0.674;0.556;0.474	T	0.51803	-0.8659	10	0.41790	T	0.15	-7.0387	14.7148	0.69259	0.0:0.9307:0.0:0.0693	.	984;995;952;1019	Q6UVM3-4;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;KCNT2_HUMAN	Q	995;953;1019	ENSP00000356403:R995Q;ENSP00000356401:R953Q;ENSP00000294725:R1019Q	ENSP00000294725:R1019Q	R	-	2	0	KCNT2	194494102	1.000000	0.71417	0.994000	0.49952	0.988000	0.76386	7.487000	0.81328	1.437000	0.47472	-0.148000	0.13756	CGA		KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503	
CRB1	23418	broad.mit.edu	37	1	197396689	197396689	+	Missense_Mutation	SNP	C	C	T	rs28939720		TCGA-AG-3901-01	TCGA-AG-3901-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr1:197396689C>T	ENST00000367400.3	+	7	2369	c.2234C>T	c.(2233-2235)aCg>aTg	p.T745M	CRB1_ENST00000543483.1_3'UTR|CRB1_ENST00000535699.1_Missense_Mutation_p.T676M|CRB1_ENST00000367399.2_Missense_Mutation_p.T633M|CRB1_ENST00000367397.1_Missense_Mutation_p.T126M|CRB1_ENST00000544212.1_Missense_Mutation_p.T226M|CRB1_ENST00000538660.1_Intron	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	745	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.		T -> M (in RP12 and LCA8; dbSNP:rs28939720). {ECO:0000269|PubMed:10508521, ECO:0000269|PubMed:15024725, ECO:0000269|PubMed:15459956, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17724218, ECO:0000269|PubMed:20591486, ECO:0000269|PubMed:20956273, ECO:0000269|PubMed:22334370}.		cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T745M(2)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						TTTGTCCGAACGCTTCAACCA	0.483																																					p.T745M												CRB1,large_intestine,colon,Substitution - Missense,0	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2234T	1	GRCh37	CM992150	CRB1	M	rs28939720	.	C	MET/THR,MET/THR	1,4405	2.1+/-5.4	0,1,2202	84.0	75.0	78.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	1898,2234	4.8	0.2	1	dbSNP_125	78	0,8600		0,0,4300	no	missense,missense	CRB1	NM_001193640.1,NM_201253.2	81,81	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	633/1295,745/1407	197396689	1,13005	2203	4300	6503	195663312	SO:0001583	missense	23418	exon7				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.2234C>T	1.37:g.197396689C>T	ENSP00000356370:p.Thr745Met	Somatic		Unspecified	Illumina	Phase_I	195663312	NM_201253	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	37	CCDS1390.1	.	.	.	.	.	.	.	.	.	.	C	15.07	2.723780	0.48728	2.27E-4	0.0	ENSG00000134376	ENST00000535699;ENST00000367400;ENST00000367399;ENST00000544212;ENST00000367397;ENST00000367401	D;D;D;D;D	0.89681	-2.55;-2.55;-2.55;-2.55;-2.55	5.75	4.85	0.62838	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	D	0.95004	0.8383	M	0.88906	2.99	0.80722	A	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.986;0.999	D	0.95323	0.8422	8	0.54805	T	0.06	.	14.531	0.67926	0.0:0.9302:0.0:0.0698	rs28939720	676;633;394;745	F5H0L2;P82279-3;P82279-4;P82279	.;.;.;CRUM1_HUMAN	M	676;745;633;226;126;394	ENSP00000438786:T676M;ENSP00000356370:T745M;ENSP00000356369:T633M;ENSP00000444556:T226M;ENSP00000356367:T126M	ENSP00000356367:T126M	T	+	2	0	CRB1	195663312	1.000000	0.71417	0.222000	0.23844	0.022000	0.10575	5.591000	0.67536	1.425000	0.47237	0.650000	0.86243	ACG		CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253	
PIGR	5284	broad.mit.edu	37	1	207110869	207110869	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3901-01	TCGA-AG-3901-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr1:207110869C>T	ENST00000356495.4	-	4	799	c.616G>A	c.(616-618)Gtc>Atc	p.V206I		NM_002644.3	NP_002635.2	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor	206	Ig-like V-type 2.				detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc receptor signaling pathway (GO:0038093)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|receptor clustering (GO:0043113)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	polymeric immunoglobulin receptor activity (GO:0001792)	p.V206I(1)		central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						TGGTTGATGACAACGCTGAAC	0.478																																					p.V206I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G616A	1						.						79.0	73.0	75.0					1																	207110869		2203	4300	6503	205177492	SO:0001583	missense	5284	exon4				CCDS1474.1	1q31-q41	2013-01-11			ENSG00000162896	ENSG00000162896		"""Immunoglobulin superfamily / V-set domain containing"""	8968	protein-coding gene	gene with protein product		173880					Standard	NM_002644		Approved		uc001hez.3	P01833	OTTHUMG00000036581	ENST00000356495.4:c.616G>A	1.37:g.207110869C>T	ENSP00000348888:p.Val206Ile	Somatic		Unspecified	Illumina	Phase_I	205177492	NM_002644	Q68D81|Q8IZY7	Missense_Mutation	SNP	ENST00000356495.4	37	CCDS1474.1	.	.	.	.	.	.	.	.	.	.	C	9.198	1.027709	0.19512	.	.	ENSG00000162896	ENST00000356495	T	0.64991	-0.13	6.08	-5.18	0.02840	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	1.516540	0.03262	N	0.183419	T	0.46795	0.1411	L	0.38175	1.15	0.09310	N	1	B	0.22080	0.064	B	0.16289	0.015	T	0.23940	-1.0174	10	0.35671	T	0.21	-24.8877	5.4409	0.16509	0.2062:0.272:0.0:0.5218	.	206	P01833	PIGR_HUMAN	I	206	ENSP00000348888:V206I	ENSP00000348888:V206I	V	-	1	0	PIGR	205177492	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.708000	0.01891	-0.833000	0.04245	-0.302000	0.09304	GTC		PIGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088975.1	NM_002644	
DLGAP3	58512	broad.mit.edu	37	1	35370070	35370070	+	Silent	SNP	C	C	T			TCGA-AG-3901-01	TCGA-AG-3901-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr1:35370070C>T	ENST00000373347.1	-	3	1183	c.915G>A	c.(913-915)tcG>tcA	p.S305S	DLGAP3_ENST00000495979.1_5'Flank|DLGAP3_ENST00000235180.4_Silent_p.S305S			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	305					cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)	p.S305S(2)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				CCGACCCGCCCGAGCGCCCCT	0.657																																					p.S305S												.	.	2	Substitution - coding silent(2)	urinary_tract(1)|large_intestine(1)	c.G915A	1						.						44.0	47.0	46.0					1																	35370070		2203	4300	6503	35142657	SO:0001819	synonymous_variant	58512	exon1			AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.915G>A	1.37:g.35370070C>T		Somatic		Unspecified	Illumina	Phase_I	35142657	NM_001080418	Q5TDD5|Q9H3X7	Silent	SNP	ENST00000373347.1	37	CCDS30670.1																																																																																				DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011554.1	NM_021234	
FOXJ3	22887	broad.mit.edu	37	1	42657097	42657097	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3901-01	TCGA-AG-3901-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr1:42657097G>A	ENST00000372572.1	-	11	1539	c.1228C>T	c.(1228-1230)Ctc>Ttc	p.L410F	FOXJ3_ENST00000545068.1_Missense_Mutation_p.L410F|FOXJ3_ENST00000372571.1_5'Flank|FOXJ3_ENST00000372573.1_Missense_Mutation_p.L410F|FOXJ3_ENST00000361776.1_Missense_Mutation_p.L376F|FOXJ3_ENST00000361346.1_Missense_Mutation_p.L410F	NM_001198851.1	NP_001185780.1	Q9UPW0	FOXJ3_HUMAN	forkhead box J3	410					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L410F(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GGGGACTGGAGCTGGCTGTGT	0.602																																					p.L410F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1228T	1						.						311.0	234.0	260.0					1																	42657097		2203	4300	6503	42429684	SO:0001583	missense	22887	exon11			AB028964	CCDS30689.1, CCDS55594.1	1p34.2	2008-04-10			ENSG00000198815	ENSG00000198815		"""Forkhead boxes"""	29178	protein-coding gene	gene with protein product							Standard	NM_014947		Approved	KIAA1041	uc001chf.3	Q9UPW0	OTTHUMG00000007026	ENST00000372572.1:c.1228C>T	1.37:g.42657097G>A	ENSP00000361653:p.Leu410Phe	Somatic		Unspecified	Illumina	Phase_I	42429684	NM_001198851	A7MBL7|A7MD18|D3DPW2|Q9NSS7	Missense_Mutation	SNP	ENST00000372572.1	37	CCDS30689.1	.	.	.	.	.	.	.	.	.	.	G	12.51	1.960604	0.34565	.	.	ENSG00000198815	ENST00000372573;ENST00000372572;ENST00000361346;ENST00000361776;ENST00000545068;ENST00000445886	T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82	5.31	5.31	0.75309	.	0.913255	0.08856	U	0.883748	T	0.31857	0.0810	N	0.08118	0	0.45567	D	0.998517	P;P	0.47677	0.899;0.838	B;B	0.41813	0.367;0.202	T	0.17715	-1.0360	10	0.10111	T	0.7	.	16.8252	0.85929	0.0:0.0:1.0:0.0	.	376;410	Q9UPW0-2;Q9UPW0	.;FOXJ3_HUMAN	F	410;410;410;376;410;376	ENSP00000361654:L410F;ENSP00000361653:L410F;ENSP00000354620:L410F;ENSP00000354449:L376F;ENSP00000439044:L410F;ENSP00000393408:L376F	ENSP00000354620:L410F	L	-	1	0	FOXJ3	42429684	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.983000	0.88140	2.646000	0.89796	0.555000	0.69702	CTC		FOXJ3-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000018310.1	NM_014947	
NLRP3	114548	broad.mit.edu	37	1	247593021	247593021	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3901-01	TCGA-AG-3901-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr1:247593021C>T	ENST00000336119.3	+	4	3037	c.2291C>T	c.(2290-2292)aCg>aTg	p.T764M	NLRP3_ENST00000391827.2_Intron|NLRP3_ENST00000391828.3_Missense_Mutation_p.T764M|NLRP3_ENST00000366496.2_Missense_Mutation_p.T764M|NLRP3_ENST00000366497.2_Missense_Mutation_p.T764M|NLRP3_ENST00000348069.2_Intron	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	764					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)	p.T764M(1)		NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			TTGTGTGAAACGCTCCAGCAT	0.512																																					p.T764M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2291T	1						.						98.0	91.0	93.0					1																	247593021		2203	4300	6503	245659644	SO:0001583	missense	114548	exon4			AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.2291C>T	1.37:g.247593021C>T	ENSP00000337383:p.Thr764Met	Somatic		Unspecified	Illumina	Phase_I	245659644	NM_004895	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	37	CCDS1632.1	.	.	.	.	.	.	.	.	.	.	C	3.108	-0.183351	0.06340	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000366496	D;D;D;D	0.88201	-2.35;-2.35;-2.35;-2.35	4.21	0.862	0.19056	.	0.886354	0.09463	N	0.798745	T	0.79845	0.4516	L	0.31926	0.97	0.09310	N	1	B;B;B	0.30542	0.092;0.069;0.284	B;B;B	0.26310	0.012;0.027;0.068	T	0.68176	-0.5478	10	0.49607	T	0.09	.	3.5037	0.07683	0.0:0.5216:0.211:0.2674	.	764;764;764	B7ZKS9;Q96P20-5;Q96P20	.;.;NALP3_HUMAN	M	764	ENSP00000375704:T764M;ENSP00000355453:T764M;ENSP00000337383:T764M;ENSP00000355452:T764M	ENSP00000337383:T764M	T	+	2	0	NLRP3	245659644	0.004000	0.15560	0.001000	0.08648	0.075000	0.17131	0.690000	0.25451	0.393000	0.25203	0.536000	0.68110	ACG		NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895	
KAT5	10524	broad.mit.edu	37	11	65482088	65482088	+	Silent	SNP	C	C	T			TCGA-AG-3901-01	TCGA-AG-3901-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr11:65482088C>T	ENST00000377046.3	+	8	986	c.714C>T	c.(712-714)ggC>ggT	p.G238G	KAT5_ENST00000341318.4_Silent_p.G271G|KAT5_ENST00000530446.1_Silent_p.G219G|KAT5_ENST00000534650.1_Silent_p.G27G|KAT5_ENST00000352980.4_Silent_p.G186G	NM_006388.3	NP_006379.2	Q92993	KAT5_HUMAN	K(lysine) acetyltransferase 5	238	MYST-type HAT.				androgen receptor signaling pathway (GO:0030521)|cellular response to estradiol stimulus (GO:0071392)|chromatin organization (GO:0006325)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|double-strand break repair (GO:0006302)|histone acetylation (GO:0016573)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of growth (GO:0040008)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)|Swr1 complex (GO:0000812)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|repressing transcription factor binding (GO:0070491)|transcription coactivator activity (GO:0003713)	p.G271G(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)	21						TTGAGCTGGGCCGGCACCGCC	0.582																																					p.G271G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C813T	11						.						154.0	126.0	136.0					11																	65482088		2201	4297	6498	65238664	SO:0001819	synonymous_variant	10524	exon7			U74667	CCDS8109.1, CCDS8110.1, CCDS31610.1, CCDS55771.1	11q13	2013-01-10	2008-07-04	2008-07-04	ENSG00000172977	ENSG00000172977		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	5275	protein-coding gene	gene with protein product	"""Tat interacting protein, 60kDa"", ""K-acetyltransferase 5"""	601409	"""HIV-1 Tat interactive protein, 60kDa"""	HTATIP		8607265	Standard	NM_006388		Approved	TIP60, PLIP, cPLA2, HTATIP1, ESA1, ZC2HC5	uc001ofk.3	Q92993	OTTHUMG00000166617	ENST00000377046.3:c.714C>T	11.37:g.65482088C>T		Somatic		Unspecified	Illumina	Phase_I	65238664	NM_182710	B4E3C7|C9JL99|O95624|Q13430|Q17RW5|Q561W3|Q6GSE8|Q9BWK7	Silent	SNP	ENST00000377046.3	37	CCDS31610.1																																																																																				KAT5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390866.2	NM_006388	
TYR	7299	broad.mit.edu	37	11	88911235	88911235	+	Silent	SNP	G	G	A	rs1939261	byFrequency	TCGA-AG-3901-01	TCGA-AG-3901-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr11:88911235G>A	ENST00000263321.5	+	1	616	c.114G>A	c.(112-114)ccG>ccA	p.P38P	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	38					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.P38P(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	GCTGTCCACCGTGGAGCGGGG	0.542													G|||	64	0.0127796	0.0484	0.0	5008	,	,		19065	0.0		0.0	False		,,,				2504	0.0				p.P38P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G114A	11						.	G		222,4180	132.9+/-169.3	8,206,1987	67.0	63.0	65.0		114	-12.1	0.0	11	dbSNP_92	65	2,8596	2.2+/-6.3	0,2,4297	no	coding-synonymous	TYR	NM_000372.4		8,208,6284	AA,AG,GG		0.0233,5.0432,1.7231		38/530	88911235	224,12776	2201	4299	6500	88550883	SO:0001819	synonymous_variant	7299	exon1			M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.114G>A	11.37:g.88911235G>A		Somatic		Unspecified	Illumina	Phase_I	88550883	NM_000372	Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Silent	SNP	ENST00000263321.5	37	CCDS8284.1																																																																																				TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394045.2	NM_000372	
DYNC2H1	79659	broad.mit.edu	37	11	103157020	103157020	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-3901-01	TCGA-AG-3901-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr11:103157020G>T	ENST00000375735.2	+	74	11071	c.10927G>T	c.(10927-10929)Gaa>Taa	p.E3643*	DYNC2H1_ENST00000398093.3_Nonsense_Mutation_p.E3650*|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3643					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.E1083*(1)		NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		CCTCTGCTTTGAAGATGCAGC	0.348																																					p.E3643X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G10927T	11						.						188.0	192.0	191.0					11																	103157020		1894	4142	6036	102662230	SO:0001587	stop_gained	79659	exon74			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.10927G>T	11.37:g.103157020G>T	ENSP00000364887:p.Glu3643*	Somatic		Unspecified	Illumina	Phase_I	102662230	NM_001377	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Nonsense_Mutation	SNP	ENST00000375735.2	37	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	G	52	19.475371	0.99920	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	.	.	.	5.41	5.41	0.78517	.	0.328595	0.36066	N	0.002815	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	.	15.2116	0.73227	0.0:0.1412:0.8588:0.0	.	.	.	.	X	3643;3650	.	ENSP00000364887:E3643X	E	+	1	0	DYNC2H1	102662230	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.185000	0.58330	2.530000	0.85305	0.655000	0.94253	GAA		DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
ATXN1	6310	broad.mit.edu	37	6	16327144	16327144	+	Silent	SNP	G	G	A	rs144916658		TCGA-AG-3901-01	TCGA-AG-3901-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr6:16327144G>A	ENST00000244769.4	-	8	2334	c.1398C>T	c.(1396-1398)agC>agT	p.S466S	ATXN1_ENST00000436367.1_Silent_p.S466S	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	466					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)	p.S466S(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				GCTGCTGGCCGCTCAGGTAGC	0.647																																					p.S466S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1398T	6						.	G	,	1,4405	2.1+/-5.4	0,1,2202	70.0	79.0	76.0		1398,1398	2.1	1.0	6	dbSNP_134	76	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	ATXN1	NM_000332.3,NM_001128164.1	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	466/816,466/816	16327144	1,13005	2203	4300	6503	16435123	SO:0001819	synonymous_variant	6310	exon8			X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.1398C>T	6.37:g.16327144G>A		Somatic		Unspecified	Illumina	Phase_I	16435123	NM_000332	Q17S02|Q9UJG2|Q9Y4J1	Silent	SNP	ENST00000244769.4	37	CCDS34342.1																																																																																				ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
TDRD6	221400	broad.mit.edu	37	6	46657943	46657943	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3901-01	TCGA-AG-3901-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr6:46657943C>T	ENST00000316081.6	+	1	2078	c.2078C>T	c.(2077-2079)aCg>aTg	p.T693M	RP11-446F17.3_ENST00000434329.2_RNA|TDRD6_ENST00000544460.1_Missense_Mutation_p.T693M|RP11-446F17.3_ENST00000422284.2_RNA|RP11-446F17.3_ENST00000571590.1_RNA	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	693					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)		p.T693R(1)|p.T693M(1)		NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			CACTTTACTACGGAGAGTAAC	0.418																																					p.T693M												.	.	2	Substitution - Missense(2)	large_intestine(1)|breast(1)	c.C2078T	6						.						49.0	50.0	50.0					6																	46657943		2203	4300	6503	46765902	SO:0001583	missense	221400	exon1			AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.2078C>T	6.37:g.46657943C>T	ENSP00000346065:p.Thr693Met	Somatic		Unspecified	Illumina	Phase_I	46765902	NM_001010870	B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	ENST00000316081.6	37	CCDS34470.1	.	.	.	.	.	.	.	.	.	.	C	9.935	1.215963	0.22373	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.15139	2.45;2.46	5.85	1.13	0.20643	.	1.246180	0.05029	N	0.474317	T	0.03871	0.0109	N	0.22421	0.69	0.09310	N	1	P;P	0.39181	0.663;0.592	B;B	0.32289	0.143;0.092	T	0.41324	-0.9515	10	0.48119	T	0.1	-1.759	9.7906	0.40704	0.0:0.6787:0.0:0.3213	.	693;693	F5H5M3;O60522	.;TDRD6_HUMAN	M	693	ENSP00000443299:T693M;ENSP00000346065:T693M	ENSP00000346065:T693M	T	+	2	0	TDRD6	46765902	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.055000	0.03493	-0.077000	0.12752	-0.782000	0.03352	ACG		TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040800.1	XM_166443	
OPRM1	4988	broad.mit.edu	37	6	154412611	154412611	+	Intron	SNP	C	C	T	rs79668187		TCGA-AG-3901-01	TCGA-AG-3901-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr6:154412611C>T	ENST00000330432.7	+	3	1401				OPRM1_ENST00000360422.4_Intron|OPRM1_ENST00000419506.2_Intron|OPRM1_ENST00000337049.4_Intron|OPRM1_ENST00000520708.1_Intron|OPRM1_ENST00000229768.5_Intron|OPRM1_ENST00000522555.1_Intron|OPRM1_ENST00000524163.1_Intron|OPRM1_ENST00000428397.2_Missense_Mutation_p.R390C|OPRM1_ENST00000452687.2_Intron|OPRM1_ENST00000414028.2_Intron|OPRM1_ENST00000435918.2_Intron|OPRM1_ENST00000522236.1_Intron|OPRM1_ENST00000434900.2_Intron|OPRM1_ENST00000518759.1_Intron	NM_000914.3	NP_000905.3	P35372	OPRM_HUMAN	opioid receptor, mu 1						adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral response to ethanol (GO:0048149)|calcium ion transmembrane transport (GO:0070588)|cellular response to stress (GO:0033554)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|locomotory behavior (GO:0007626)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of Wnt protein secretion (GO:0061358)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neurogenesis (GO:0050769)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-endorphin receptor activity (GO:0004979)|G-protein alpha-subunit binding (GO:0001965)|G-protein coupled receptor activity (GO:0004930)|morphine receptor activity (GO:0038047)|voltage-gated calcium channel activity (GO:0005245)	p.?(3)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	33		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Alvimopan(DB06274)|Amitriptyline(DB00321)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Ethylmorphine(DB01466)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Methylnaltrexone(DB06800)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Ondansetron(DB00904)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Pethidine(DB00454)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	TCATCAGGTACGCAGTCTCTA	0.408													C|||	1	0.000199681	0.0	0.0	5008	,	,		18905	0.001		0.0	False		,,,				2504	0.0				p.R390C												.	.	3	Unknown(3)	large_intestine(3)	c.C1168T	6						.	C	,,CYS/ARG,,,,,,,,,,	0,3560		0,0,1780	32.0	32.0	32.0		,,1168,,,,,,,,,,	-9.9	0.0	6	dbSNP_131	32	5,7725		0,5,3860	yes	intron,intron,missense,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron	OPRM1	NM_000914.3,NM_001008503.1,NM_001008504.2,NM_001008505.1,NM_001145279.2,NM_001145280.2,NM_001145281.1,NM_001145282.1,NM_001145283.1,NM_001145284.2,NM_001145285.1,NM_001145286.1,NM_001145287.1	,,180,,,,,,,,,,	0,5,5640	TT,TC,CC		0.0647,0.0,0.0443	,,,,,,,,,,,,	,,390/393,,,,,,,,,,	154412611	5,11285	1780	3865	5645	154454304	SO:0001627	intron_variant	4988	exon3			L29301	CCDS43517.1, CCDS43518.1, CCDS47503.1, CCDS47504.1, CCDS47505.1, CCDS47506.1, CCDS47507.1, CCDS47508.1, CCDS55071.1, CCDS55068.1, CCDS55069.1, CCDS55070.1	6q24-q25	2012-08-08			ENSG00000112038	ENSG00000112038		"""GPCR / Class A : Opioid receptors"""	8156	protein-coding gene	gene with protein product		600018					Standard	NM_001145285		Approved	MOR1	uc003qpo.1	P35372	OTTHUMG00000015870	ENST00000330432.7:c.1164+4C>T	6.37:g.154412611C>T		Somatic		Unspecified	Illumina	Phase_I	154454304	NM_001008504	B0FXJ1|B2R9S7|B8Q1L7|B8Q1L8|B8Q1L9|E7EWZ3|G8XRH6|G8XRH8|Q12930|Q4VWM1|Q4VWM2|Q4VWM3|Q4VWM4|Q4VWM6|Q4VWX6|Q5TDA1|Q6UPP1|Q6UQ80|Q7Z2D8|Q86V80|Q8IWW3|Q8IWW4|Q9UCZ4|Q9UN57	Missense_Mutation	SNP	ENST00000330432.7	37	CCDS55070.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	7.121	0.577903	0.13686	0.0	6.47E-4	ENSG00000112038	ENST00000428397	T	0.70986	-0.53	6.16	-9.95	0.00446	.	.	.	.	.	T	0.21590	0.0520	.	.	.	0.80722	D	1	B;B	0.23490	0.0;0.086	B;B	0.12156	0.0;0.007	T	0.04165	-1.0972	7	.	.	.	.	3.887	0.09102	0.0799:0.2197:0.164:0.5365	.	290;390	Q6UPP1;P35372-2	.;.	C	390	ENSP00000411903:R390C	.	R	+	1	0	OPRM1	154454304	.	.	0.003000	0.11579	0.052000	0.14988	.	.	-2.203000	0.00744	-1.128000	0.01989	CGC		OPRM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042786.2	NM_000914	
SLC5A10	125206	broad.mit.edu	37	17	18872425	18872425	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3901-01	TCGA-AG-3901-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr17:18872425T>C	ENST00000395645.3	+	6	532	c.514T>C	c.(514-516)Tcc>Ccc	p.S172P	SLC5A10_ENST00000395647.2_Missense_Mutation_p.S172P|SLC5A10_ENST00000417251.2_Missense_Mutation_p.S172P|SLC5A10_ENST00000395643.2_Missense_Mutation_p.S172P|SLC5A10_ENST00000395642.1_Missense_Mutation_p.S116P|SLC5A10_ENST00000317977.6_Missense_Mutation_p.S116P|FAM83G_ENST00000388995.6_3'UTR	NM_001042450.2	NP_001035915.1	A0PJK1	SC5AA_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 10	172					sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.S172P(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(3)|ovary(3)|prostate(3)|skin(3)	24						CTTCTACCTCTCCACCATCCT	0.602																																					p.S172P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T514C	17						.						156.0	117.0	130.0					17																	18872425		2203	4300	6503	18813150	SO:0001583	missense	125206	exon6				CCDS11201.2, CCDS42275.1, CCDS59277.1, CCDS59278.1, CCDS74008.1	17p11.2	2013-07-19	2013-07-19		ENSG00000154025	ENSG00000154025		"""Solute carriers"""	23155	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 10"""				Standard	NM_152351		Approved	SGLT5	uc002gut.2	A0PJK1	OTTHUMG00000178143	ENST00000395645.3:c.514T>C	17.37:g.18872425T>C	ENSP00000379007:p.Ser172Pro	Somatic		Unspecified	Illumina	Phase_I	18813150	NM_152351	A8MUC9|B4DPI0|B7WPR4|Q6P5X0|Q8IXM4|Q96LQ1	Missense_Mutation	SNP	ENST00000395645.3	37	CCDS42275.1	.	.	.	.	.	.	.	.	.	.	T	27.4	4.828449	0.90955	.	.	ENSG00000154025	ENST00000317977;ENST00000395647;ENST00000395642;ENST00000417251;ENST00000395645;ENST00000395643	D;D;D;D;D;D	0.91521	-2.86;-2.52;-2.86;-2.52;-2.52;-2.39	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	D	0.95162	0.8432	M	0.93854	3.465	0.80722	D	1	P;P;P;P;P	0.41848	0.584;0.72;0.763;0.72;0.694	P;P;P;P;P	0.51016	0.539;0.525;0.656;0.525;0.557	D	0.96145	0.9103	10	0.72032	D	0.01	.	14.3297	0.66548	0.0:0.0:0.0:1.0	.	172;172;172;172;116	B4DPI0;A0PJK1-2;A0PJK1;A0PJK1-4;A0PJK1-3	.;.;SC5AA_HUMAN;.;.	P	116;172;116;172;172;172	ENSP00000324346:S116P;ENSP00000379008:S172P;ENSP00000379004:S116P;ENSP00000401875:S172P;ENSP00000379007:S172P;ENSP00000379005:S172P	ENSP00000324346:S116P	S	+	1	0	SLC5A10	18813150	1.000000	0.71417	0.976000	0.42696	0.983000	0.72400	4.801000	0.62532	1.943000	0.56356	0.379000	0.24179	TCC		SLC5A10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132129.2	NM_152351	
KCNH4	23415	broad.mit.edu	37	17	40328102	40328102	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3901-01	TCGA-AG-3901-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr17:40328102C>T	ENST00000264661.3	-	5	1131	c.799G>A	c.(799-801)Gac>Aac	p.D267N	KCNH4_ENST00000607371.1_Missense_Mutation_p.D267N	NM_012285.2	NP_036417.1	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 4	267					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.D267N(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|urinary_tract(1)	32		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		ACGGCGATGTCGCTGACAAGG	0.597																																					p.D267N	NSCLC(117;707 1703 2300 21308 31858)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G799A	17						.						137.0	122.0	127.0					17																	40328102		2203	4300	6503	37581628	SO:0001583	missense	23415	exon5			AB022698	CCDS11420.1	17q21	2012-07-05				ENSG00000089558		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6253	protein-coding gene	gene with protein product		604528				10455180, 16382104	Standard	NM_012285		Approved	Kv12.3, elk1	uc002hzb.2	Q9UQ05		ENST00000264661.3:c.799G>A	17.37:g.40328102C>T	ENSP00000264661:p.Asp267Asn	Somatic		Unspecified	Illumina	Phase_I	37581628	NM_012285		Missense_Mutation	SNP	ENST00000264661.3	37	CCDS11420.1	.	.	.	.	.	.	.	.	.	.	C	36	5.968645	0.97156	.	.	ENSG00000089558	ENST00000264661	D	0.97752	-4.52	5.53	5.53	0.82687	Ion transport (1);	0.000000	0.43260	D	0.000600	D	0.98723	0.9571	M	0.79693	2.465	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	D	0.99548	1.0965	10	0.87932	D	0	.	19.6556	0.95837	0.0:1.0:0.0:0.0	.	267	Q9UQ05	KCNH4_HUMAN	N	267	ENSP00000264661:D267N	ENSP00000264661:D267N	D	-	1	0	KCNH4	37581628	1.000000	0.71417	0.987000	0.45799	0.985000	0.73830	7.617000	0.83032	2.882000	0.98803	0.655000	0.94253	GAC		KCNH4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449791.2	NM_012285	
ABCA8	10351	broad.mit.edu	37	17	66873754	66873754	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3901-01	TCGA-AG-3901-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr17:66873754C>T	ENST00000269080.2	-	31	4122	c.3985G>A	c.(3985-3987)Gcg>Acg	p.A1329T	ABCA8_ENST00000586539.1_Missense_Mutation_p.A1369T|ABCA8_ENST00000430352.2_Missense_Mutation_p.A1369T	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	1329	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.A1329T(2)		breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					GGCCACAGCGCGTTCTCCTGA	0.597																																					p.A1329T												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G3985A	17						.						138.0	118.0	125.0					17																	66873754		2203	4300	6503	64385349	SO:0001583	missense	10351	exon31			AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.3985G>A	17.37:g.66873754C>T	ENSP00000269080:p.Ala1329Thr	Somatic		Unspecified	Illumina	Phase_I	64385349	NM_007168	A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	ENST00000269080.2	37	CCDS11680.1	.	.	.	.	.	.	.	.	.	.	C	12.20	1.867711	0.32977	.	.	ENSG00000141338	ENST00000269080;ENST00000430352	D;D	0.93426	-3.22;-3.22	4.34	2.17	0.27698	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.455820	0.18056	N	0.153094	D	0.85673	0.5751	L	0.28192	0.835	0.26055	N	0.981424	B;B;B	0.18166	0.026;0.024;0.026	B;B;B	0.21917	0.037;0.024;0.025	T	0.76780	-0.2833	10	0.66056	D	0.02	.	3.1347	0.06435	0.1493:0.4633:0.2869:0.1006	.	1369;1369;1329	A1L3U3;C9JQE6;O94911	.;.;ABCA8_HUMAN	T	1329;1369	ENSP00000269080:A1329T;ENSP00000402814:A1369T	ENSP00000269080:A1329T	A	-	1	0	ABCA8	64385349	0.052000	0.20516	0.012000	0.15200	0.600000	0.36913	0.695000	0.25527	1.192000	0.43071	0.637000	0.83480	GCG		ABCA8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450172.1	NM_007168	
SDK2	54549	broad.mit.edu	37	17	71389755	71389755	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3901-01	TCGA-AG-3901-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr17:71389755C>T	ENST00000392650.3	-	27	3842	c.3842G>A	c.(3841-3843)cGc>cAc	p.R1281H	SDK2_ENST00000388726.3_Missense_Mutation_p.R1281H	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1281	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.R1281H(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						GTCCCCGATGCGTGTGAAGGC	0.637																																					p.R1281H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3842A	17						.						61.0	55.0	57.0					17																	71389755		2203	4300	6503	68901350	SO:0001583	missense	54549	exon27			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.3842G>A	17.37:g.71389755C>T	ENSP00000376421:p.Arg1281His	Somatic		Unspecified	Illumina	Phase_I	68901350	NM_001144952	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	37	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	C	33	5.215483	0.95104	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893	T;T;T	0.57595	0.39;0.39;0.39	5.41	5.41	0.78517	Fibronectin, type III (5);Immunoglobulin-like fold (1);	0.058360	0.64402	D	0.000002	T	0.76856	0.4046	M	0.85099	2.735	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.994;0.997;0.994	T	0.79364	-0.1834	10	0.54805	T	0.06	.	19.1974	0.93695	0.0:1.0:0.0:0.0	.	1281;1281;1281	Q58EX2-2;Q58EX2;Q58EX2-3	.;SDK2_HUMAN;.	H	905;1281;1281;457;1281	ENSP00000376421:R1281H;ENSP00000373378:R1281H;ENSP00000407098:R457H	ENSP00000324967:R1281H	R	-	2	0	SDK2	68901350	1.000000	0.71417	1.000000	0.80357	0.777000	0.43975	7.324000	0.79115	2.527000	0.85204	0.563000	0.77884	CGC		SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064	
CPPED1	55313	broad.mit.edu	37	16	12798724	12798724	+	Missense_Mutation	SNP	C	C	T	rs145004672	byFrequency	TCGA-AG-3901-01	TCGA-AG-3901-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr16:12798724C>T	ENST00000381774.4	-	3	712	c.472G>A	c.(472-474)Gtc>Atc	p.V158I	CPPED1_ENST00000261660.4_Intron|CPPED1_ENST00000433677.2_Intron	NM_018340.2	NP_060810.2	Q9BRF8	CPPED_HUMAN	calcineurin-like phosphoesterase domain containing 1	158	Catalytic.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)	p.V158I(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|urinary_tract(1)	18						AGGAACAGGACGCCCCCGACC	0.612													C|||	42	0.00838658	0.0272	0.0029	5008	,	,		17716	0.003		0.0	False		,,,				2504	0.001				p.V158I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G472A	16						.	C	,ILE/VAL	69,3929		1,67,1931	57.0	62.0	60.0		,472	4.4	0.8	16	dbSNP_134	60	1,8319		0,1,4159	yes	intron,missense	CPPED1	NM_001099455.1,NM_018340.2	,29	1,68,6090	TT,TC,CC		0.012,1.7259,0.5683	,possibly-damaging	,158/315	12798724	70,12248	1999	4160	6159	12706225	SO:0001583	missense	55313	exon3			AK022710	CCDS42119.1, CCDS42120.1	16p13.12	2014-02-12	2009-03-13		ENSG00000103381	ENSG00000103381			25632	protein-coding gene	gene with protein product	"""complete S transactivated protein 1"""	615603				12477932	Standard	NM_018340		Approved	CSTP1, FLJ11151	uc002dca.4	Q9BRF8	OTTHUMG00000167711	ENST00000381774.4:c.472G>A	16.37:g.12798724C>T	ENSP00000371193:p.Val158Ile	Somatic		Unspecified	Illumina	Phase_I	12706225	NM_018340	B4DQ68|Q6MZY9|Q9H9M9|Q9NUT6	Missense_Mutation	SNP	ENST00000381774.4	37	CCDS42120.1	27	0.012362637362637362	23	0.046747967479674794	1	0.0027624309392265192	3	0.005244755244755245	0	0.0	C	16.61	3.171078	0.57584	0.017259	1.2E-4	ENSG00000103381	ENST00000381774	T	0.72505	-0.66	5.32	4.37	0.52481	Metallophosphoesterase domain (1);	0.053983	0.64402	D	0.000001	T	0.29882	0.0747	M	0.67397	2.05	0.80722	D	1	P	0.47191	0.891	B	0.43194	0.411	T	0.56165	-0.8024	10	0.46703	T	0.11	-31.751	12.0777	0.53653	0.0:0.9163:0.0:0.0837	.	158	Q9BRF8	CPPED_HUMAN	I	158	ENSP00000371193:V158I	ENSP00000371193:V158I	V	-	1	0	CPPED1	12706225	0.998000	0.40836	0.840000	0.33206	0.315000	0.28087	3.848000	0.55903	1.256000	0.44068	-0.128000	0.14901	GTC		CPPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395795.2	NM_018340	
LCMT1	51451	broad.mit.edu	37	16	25180479	25180479	+	Missense_Mutation	SNP	G	G	T	rs35016949	byFrequency	TCGA-AG-3901-01	TCGA-AG-3901-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr16:25180479G>T	ENST00000399069.3	+	8	892	c.737G>T	c.(736-738)cGg>cTg	p.R246L	LCMT1_ENST00000572869.1_3'UTR|LCMT1_ENST00000380966.4_Missense_Mutation_p.R191L	NM_016309.2	NP_057393.2	Q9UIC8	LCMT1_HUMAN	leucine carboxyl methyltransferase 1	246					C-terminal protein methylation (GO:0006481)|cellular protein modification process (GO:0006464)|negative regulation of protein complex assembly (GO:0031333)|protein methylation (GO:0006479)|regulation of apoptotic process (GO:0042981)|regulation of glucose metabolic process (GO:0010906)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)	cytosol (GO:0005829)	protein C-terminal carboxyl O-methyltransferase activity (GO:0003880)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)	p.R246L(1)							GBM - Glioblastoma multiforme(48;0.0336)	L-Leucine(DB00149)	GAAAACCTGCGGAGACGCCAG	0.488																																					p.R246L	Colon(200;565 2072 24396 47922 50898)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G737T	16						.						118.0	119.0	118.0					16																	25180479		1925	4132	6057	25087980	SO:0001583	missense	51451	exon8			AF037601	CCDS45445.1, CCDS45446.1	16p12.1	2014-08-01			ENSG00000205629	ENSG00000205629			17557	protein-coding gene	gene with protein product	"""protein phosphatase methyltransferase 1"""	610286				10810093	Standard	XM_005255354		Approved	CGI-68, PPMT1	uc002dnx.1	Q9UIC8	OTTHUMG00000177182	ENST00000399069.3:c.737G>T	16.37:g.25180479G>T	ENSP00000382021:p.Arg246Leu	Somatic		Unspecified	Illumina	Phase_I	25087980	NM_016309	A6NL89|A8K770|Q53FC5|Q96CI5|Q9H6I9|Q9NTG4|Q9Y378	Missense_Mutation	SNP	ENST00000399069.3	37	CCDS45445.1	.	.	.	.	.	.	.	.	.	.	G	17.60	3.428959	0.62844	.	.	ENSG00000205629	ENST00000399069;ENST00000380966;ENST00000380962	T;T	0.25912	1.77;1.77	5.97	5.97	0.96955	.	0.195654	0.46145	D	0.000301	T	0.27349	0.0671	L	0.55990	1.75	0.39913	D	0.97405	B;B	0.15141	0.012;0.005	B;B	0.24394	0.053;0.006	T	0.05937	-1.0855	10	0.59425	D	0.04	-17.0698	11.2276	0.48892	0.0823:0.0:0.9177:0.0	.	191;246	Q9UIC8-3;Q9UIC8	.;LCMT1_HUMAN	L	246;191;263	ENSP00000382021:R246L;ENSP00000370353:R191L	ENSP00000370349:R263L	R	+	2	0	LCMT1	25087980	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.622000	0.61240	2.836000	0.97738	0.655000	0.94253	CGG		LCMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435747.4	NM_016309	
GSG1L	146395	broad.mit.edu	37	16	27840214	27840214	+	Silent	SNP	G	G	T			TCGA-AG-3901-01	TCGA-AG-3901-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr16:27840214G>T	ENST00000447459.2	-	5	810	c.726C>A	c.(724-726)acC>acA	p.T242T	GSG1L_ENST00000380898.2_Silent_p.T87T|GSG1L_ENST00000569166.1_Silent_p.T87T|GSG1L_ENST00000395724.3_Silent_p.T191T|GSG1L_ENST00000380897.3_Silent_p.T87T	NM_001109763.1	NP_001103233.1	Q6UXU4	GSG1L_HUMAN	GSG1-like	242					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)	asymmetric synapse (GO:0032279)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T87T(1)|p.T242T(1)		endometrium(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(4)	17						TGACCGTCTTGGTGTAGGAGT	0.587																																					p.T87T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C261A	16						.						88.0	65.0	73.0					16																	27840214		2197	4300	6497	27747715	SO:0001819	synonymous_variant	146395	exon4			AK128775	CCDS10631.1, CCDS45450.1	16p11.2	2014-01-20			ENSG00000169181	ENSG00000169181			28283	protein-coding gene	gene with protein product						22813734	Standard	NM_001109763		Approved	MGC18079, PRO19651, KTSR5831	uc002doz.2	Q6UXU4	OTTHUMG00000131676	ENST00000447459.2:c.726C>A	16.37:g.27840214G>T		Somatic		Unspecified	Illumina	Phase_I	27747715	NM_144675	Q7Z6F8|Q8TB81	Silent	SNP	ENST00000447459.2	37	CCDS45450.1																																																																																				GSG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433832.2	NM_144675	
PKD1L2	114780	broad.mit.edu	37	16	81253925	81253925	+	RNA	SNP	G	G	T			TCGA-AG-3901-01	TCGA-AG-3901-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr16:81253925G>T	ENST00000525539.1	-	0	50				PKD1L2_ENST00000337114.4_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)	p.A17A(2)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						TAACAGTGGTGGCCCTAAGCC	0.562																																					p.A17A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C51A	16						.						66.0	66.0	66.0					16																	81253925		2035	4194	6229	79811426			114780	exon1			AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81253925G>T		Somatic		Unspecified	Illumina	Phase_I	79811426	NM_052892	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Silent	SNP	ENST00000525539.1	37																																																																																					PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2		
ZNF521	25925	broad.mit.edu	37	18	22804983	22804983	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3901-01	TCGA-AG-3901-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr18:22804983G>A	ENST00000361524.3	-	4	3047	c.2899C>T	c.(2899-2901)Cgg>Tgg	p.R967W	ZNF521_ENST00000538137.2_Missense_Mutation_p.R967W|ZNF521_ENST00000584787.1_Missense_Mutation_p.R747W|ZNF521_ENST00000579111.1_5'Flank	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	967					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)	p.R967W(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					GAGGGAAACCGCTCTCCGCAA	0.498			T	PAX5	ALL																																p.R967W			Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2899T	18						.						89.0	84.0	85.0					18																	22804983		2203	4300	6503	21058981	SO:0001583	missense	25925	exon4			AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.2899C>T	18.37:g.22804983G>A	ENSP00000354794:p.Arg967Trp	Somatic		Unspecified	Illumina	Phase_I	21058981	NM_015461	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	ENST00000361524.3	37	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	G	10.61	1.398830	0.25291	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.19938	2.11;2.11	5.97	5.97	0.96955	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.44201	0.1282	L	0.60845	1.875	0.41388	D	0.987597	D	0.89917	1.0	D	0.97110	1.0	T	0.17653	-1.0362	10	0.62326	D	0.03	-30.0479	15.968	0.79987	0.0:0.0:0.8646:0.1353	.	967	Q96K83	ZN521_HUMAN	W	967;1001;967	ENSP00000354794:R967W;ENSP00000382352:R967W	ENSP00000354794:R967W	R	-	1	2	ZNF521	21058981	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	3.628000	0.54259	2.828000	0.97474	0.655000	0.94253	CGG		ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461	
SMAD4	4089	broad.mit.edu	37	18	48591904	48591904	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3901-01	TCGA-AG-3901-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr18:48591904C>T	ENST00000342988.3	+	9	1605	c.1067C>T	c.(1066-1068)cCt>cTt	p.P356L	SMAD4_ENST00000588745.1_Missense_Mutation_p.P260L|SMAD4_ENST00000398417.2_Missense_Mutation_p.P356L	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	356	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.P356L(2)|p.?(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		TACGTGGACCCTTCTGGAGGA	0.433																																					p.P356L												SMAD4,large_intestine,NS,Substitution - Missense,+2	.	40	Whole gene deletion(36)|Substitution - Missense(2)|Unknown(2)	pancreas(26)|large_intestine(5)|breast(3)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)	c.C1067T	18						.						208.0	173.0	185.0					18																	48591904		2203	4300	6503	46845902	SO:0001583	missense	4089	exon9			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1067C>T	18.37:g.48591904C>T	ENSP00000341551:p.Pro356Leu	Somatic		Unspecified	Illumina	Phase_I	46845902	NM_005359	A8K405	Missense_Mutation	SNP	ENST00000342988.3	37	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	C	34	5.405615	0.96051	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	D;D	0.97114	-4.25;-4.25	5.86	5.86	0.93980	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.98213	0.9409	M	0.67397	2.05	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99016	1.0816	10	0.87932	D	0	.	18.9646	0.92691	0.0:1.0:0.0:0.0	.	356	Q13485	SMAD4_HUMAN	L	356	ENSP00000341551:P356L;ENSP00000381452:P356L	ENSP00000341551:P356L	P	+	2	0	SMAD4	46845902	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.672000	0.83956	2.771000	0.95319	0.563000	0.77884	CCT		SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359	
PIK3CA	5290	broad.mit.edu	37	3	178921549	178921549	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3901-01	TCGA-AG-3901-01	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr3:178921549T>G	ENST00000263967.3	+	5	1188	c.1031T>G	c.(1030-1032)gTg>gGg	p.V344G		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	344	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.V344G(8)|p.V344A(5)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	GCAACCTACGTGAATGTAAAT	0.303		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.V344G	Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA,central_nervous_system,brain,Substitution - Missense,0	.	13	Substitution - Missense(13)	endometrium(6)|large_intestine(4)|cervix(2)|central_nervous_system(1)	c.T1031G	3						.						68.0	67.0	67.0					3																	178921549		1808	4073	5881	180404243	SO:0001583	missense	5290	exon5				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1031T>G	3.37:g.178921549T>G	ENSP00000263967:p.Val344Gly	Somatic		Unspecified	Illumina	Phase_I	180404243	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.391827	0.83011	.	.	ENSG00000121879	ENST00000263967	T	0.71103	-0.54	5.41	5.41	0.78517	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (1);	0.000000	0.85682	D	0.000000	D	0.83367	0.5239	M	0.77103	2.36	0.80722	D	1	D	0.76494	0.999	D	0.68353	0.957	D	0.84581	0.0661	10	0.49607	T	0.09	-22.945	15.721	0.77710	0.0:0.0:0.0:1.0	.	344	P42336	PK3CA_HUMAN	G	344	ENSP00000263967:V344G	ENSP00000263967:V344G	V	+	2	0	PIK3CA	180404243	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.606000	0.82863	2.166000	0.68216	0.402000	0.26972	GTG		PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
KCNMB3	27094	broad.mit.edu	37	3	178968641	178968641	+	Silent	SNP	T	T	C			TCGA-AG-3901-01	TCGA-AG-3901-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr3:178968641T>C	ENST00000314235.5	-	2	661	c.150A>G	c.(148-150)ccA>ccG	p.P50P	KCNMB3_ENST00000485523.1_Silent_p.P28P|KCNMB3_ENST00000497599.1_Silent_p.P48P|KCNMB3_ENST00000392685.2_Silent_p.P46P|KCNMB3_ENST00000349697.2_Silent_p.P48P	NM_014407.3	NP_055222.3	Q9NPA1	KCMB3_HUMAN	potassium large conductance calcium-activated channel, subfamily M beta member 3	50					action potential (GO:0001508)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|neuronal action potential (GO:0019228)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)	p.P50P(1)		NS(1)|large_intestine(1)|lung(2)|stomach(1)	5	all_cancers(143;5.6e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;2.41e-27)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.03)		Miconazole(DB01110)|Procaine(DB00721)	CAGCACTGGATGGCAGCCTCT	0.527																																					p.P48P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A144G	3						.						107.0	99.0	102.0					3																	178968641		2203	4300	6503	180451335	SO:0001819	synonymous_variant	27094	exon2			AF139471	CCDS3225.1, CCDS3226.1, CCDS43172.1, CCDS43173.1, CCDS54683.1	3q26.3-q27	2010-09-30			ENSG00000171121	ENSG00000171121		"""Potassium channels"""	6287	protein-coding gene	gene with protein product		605222		KCNMB2, KCNMBL		10585773	Standard	NM_001163677		Approved		uc003fjm.3	Q9NPA1	OTTHUMG00000157337	ENST00000314235.5:c.150A>G	3.37:g.178968641T>C		Somatic		Unspecified	Illumina	Phase_I	180451335	NM_001163677	B7Z9C9|D3DNR2|E9PER5|Q9NPG7|Q9NRM9|Q9UHN3	Silent	SNP	ENST00000314235.5	37	CCDS3226.1																																																																																				KCNMB3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000348484.1		
DGKG	1608	broad.mit.edu	37	3	185986590	185986590	+	Splice_Site	SNP	C	C	T	rs533768857		TCGA-AG-3901-01	TCGA-AG-3901-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr3:185986590C>T	ENST00000265022.3	-	12	1655	c.1116G>A	c.(1114-1116)acG>acA	p.T372T	DGKG_ENST00000544847.1_Intron|DGKG_ENST00000344484.4_Splice_Site_p.T372T|DGKG_ENST00000382164.4_Intron	NM_001080744.1|NM_001080745.1|NM_001346.2	NP_001074213.1|NP_001074214.1|NP_001337.2	P49619	DGKG_HUMAN	diacylglycerol kinase, gamma 90kDa	372					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|neuron development (GO:0048666)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)	p.T372T(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	42	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	GCCAACCCACCGTCATCCGGC	0.597																																					p.T372T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1116A	3						.						58.0	50.0	53.0					3																	185986590		2203	4300	6503	187469284	SO:0001630	splice_region_variant	1608	exon12			AF020945	CCDS3274.1, CCDS43181.1, CCDS43182.1	3q27-q28	2013-01-10	2002-08-29		ENSG00000058866	ENSG00000058866	2.7.1.107	"""EF-hand domain containing"""	2853	protein-coding gene	gene with protein product		601854	"""diacylglycerol kinase, gamma (90kD)"""	DAGK3		8034597	Standard	NM_001080744		Approved		uc003fqa.3	P49619	OTTHUMG00000156617	ENST00000265022.3:c.1116+1G>A	3.37:g.185986590C>T		Somatic		Unspecified	Illumina	Phase_I	187469284	NM_001080744	B2RAH4|Q2M1H4|Q5FWG1	Silent	SNP	ENST00000265022.3	37	CCDS3274.1																																																																																				DGKG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344800.3		Silent
KRAS	3845	broad.mit.edu	37	12	25378562	25378562	+	Missense_Mutation	SNP	C	C	T	rs121913527		TCGA-AG-3901-01	TCGA-AG-3901-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr12:25378562C>T	ENST00000256078.4	-	4	499	c.436G>A	c.(436-438)Gca>Aca	p.A146T	KRAS_ENST00000311936.3_Missense_Mutation_p.A146T|KRAS_ENST00000557334.1_Intron|AC087239.1_ENST00000594112.1_5'Flank	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	146			A -> T (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.A146T(75)|p.A146P(7)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CTTGTCTTTGCTGATGTTTCA	0.323	A146T(AMO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|A146T(LS1034_LARGE_INTESTINE)|A146T(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.A146T	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,large_intestine,NS,Substitution - Missense,0	.	82	Substitution - Missense(82)	large_intestine(69)|haematopoietic_and_lymphoid_tissue(11)|lung(2)	c.G436A	12						.						207.0	188.0	195.0					12																	25378562		2203	4300	6503	25269829	SO:0001583	missense	3845	exon4	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.436G>A	12.37:g.25378562C>T	ENSP00000256078:p.Ala146Thr	Somatic		Unspecified	Illumina	Phase_I	25269829	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	33	5.234460	0.95207	.	.	ENSG00000133703	ENST00000311936;ENST00000256078	D;D	0.88741	-2.42;-2.42	5.52	5.52	0.82312	Small GTP-binding protein domain (1);	0.045975	0.85682	D	0.000000	D	0.96639	0.8903	H	0.97131	3.945	0.80722	D	1	D;D	0.89917	1.0;0.963	D;P	0.76071	0.987;0.876	D	0.97524	1.0075	10	0.72032	D	0.01	.	18.7849	0.91951	0.0:1.0:0.0:0.0	.	146;146	P01116-2;P01116	.;RASK_HUMAN	T	146	ENSP00000308495:A146T;ENSP00000256078:A146T	ENSP00000256078:A146T	A	-	1	0	KRAS	25269829	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.762000	0.85270	2.757000	0.94681	0.585000	0.79938	GCA		KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
PML	5371	broad.mit.edu	37	15	74326969	74326969	+	Intron	SNP	G	G	A			TCGA-AG-3901-01	TCGA-AG-3901-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr15:74326969G>A	ENST00000268058.3	+	7	1806				PML_ENST00000268059.6_Intron|PML_ENST00000565898.1_Intron|PML_ENST00000569477.1_Intron|PML_ENST00000436891.3_Intron|PML_ENST00000569965.1_Intron|PML_ENST00000395132.2_Intron|PML_ENST00000354026.6_Intron|PML_ENST00000395135.3_Intron|PML_ENST00000563500.1_3'UTR|PML_ENST00000359928.4_Intron|PML_ENST00000564428.1_Intron|PML_ENST00000435786.2_Missense_Mutation_p.R603H	NM_033238.2	NP_150241.2	P29590	PML_HUMAN	promyelocytic leukemia						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to interleukin-4 (GO:0071353)|cellular senescence (GO:0090398)|circadian regulation of gene expression (GO:0032922)|common-partner SMAD protein phosphorylation (GO:0007182)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|entrainment of circadian clock by photoperiod (GO:0043153)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|maintenance of protein location in nucleus (GO:0051457)|myeloid cell differentiation (GO:0030099)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation in response to oxidative stress (GO:0032938)|negative regulation of viral release from host cell (GO:1902187)|PML body organization (GO:0030578)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of histone deacetylation (GO:0031065)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)|regulation of calcium ion transport into cytosol (GO:0010522)|regulation of circadian rhythm (GO:0042752)|regulation of double-strand break repair (GO:2000779)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of protein phosphorylation (GO:0001932)|regulation of transcription, DNA-templated (GO:0006355)|response to cytokine (GO:0034097)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|retinoic acid receptor signaling pathway (GO:0048384)|SMAD protein import into nucleus (GO:0007184)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	cobalt ion binding (GO:0050897)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|SUMO binding (GO:0032183)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R603H(1)|p.R603L(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	31						CTTGCCTTGCGCCTGGGGAAT	0.602			T	"""RARA, PAX5"""	"""APL, ALL"""																																p.R603H			Dom	yes		15	15q22	5371	promyelocytic leukemia		L	.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G1808A	15						.						53.0	51.0	52.0					15																	74326969		1322	2306	3628	72114022	SO:0001627	intron_variant	5371	exon7			AB208950	CCDS10255.1, CCDS10256.1, CCDS10257.1, CCDS10258.1, CCDS45297.1, CCDS45298.1, CCDS45299.1, CCDS45300.1, CCDS58386.1	15q24.1	2011-04-21			ENSG00000140464	ENSG00000140464		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9113	protein-coding gene	gene with protein product		102578					Standard	NM_033244		Approved	MYL, TRIM19, RNF71	uc002awv.3	P29590	OTTHUMG00000137607	ENST00000268058.3:c.1710+98G>A	15.37:g.74326969G>A		Somatic		Unspecified	Illumina	Phase_I	72114022	NM_033240	E9PBR7|P29591|P29592|P29593|Q00755|Q15959|Q59FP9|Q8WUA0|Q96S41|Q9BPW2|Q9BWP7|Q9BZX6|Q9BZX7|Q9BZX8|Q9BZX9|Q9BZY0|Q9BZY2|Q9BZY3	Missense_Mutation	SNP	ENST00000268058.3	37	CCDS10255.1	.	.	.	.	.	.	.	.	.	.	G	3.157	-0.172854	0.06421	.	.	ENSG00000140464	ENST00000435786	.	.	.	3.18	-6.35	0.01975	.	.	.	.	.	T	0.29126	0.0724	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22765	-1.0207	6	.	.	.	.	13.3877	0.60805	0.6699:0.0:0.3301:0.0	.	603	P29590-2	.	H	603	.	.	R	+	2	0	PML	72114022	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.955000	0.01523	-2.553000	0.00478	-2.069000	0.00389	CGC		PML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269021.3	NM_002675	
TNIP2	79155	broad.mit.edu	37	4	2749534	2749534	+	Missense_Mutation	SNP	C	C	T	rs545493843		TCGA-AG-3901-01	TCGA-AG-3901-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr4:2749534C>T	ENST00000315423.7	-	2	501	c.415G>A	c.(415-417)Gcc>Acc	p.A139T	TNIP2_ENST00000505186.1_5'Flank|TNIP2_ENST00000510267.1_Missense_Mutation_p.A32T|TNIP2_ENST00000503235.1_Missense_Mutation_p.A139T	NM_024309.3	NP_077285.3			TNFAIP3 interacting protein 2									p.A139T(2)		breast(2)|central_nervous_system(1)|large_intestine(4)|lung(6)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ACGTCACTGGCGGCCCGGGCG	0.657													c|||	1	0.000199681	0.0	0.0	5008	,	,		15662	0.0		0.0	False		,,,				2504	0.001				p.A139T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G415A	4						.						96.0	94.0	95.0					4																	2749534		2203	4300	6503	2719332	SO:0001583	missense	79155	exon2			BC002740	CCDS3362.1, CCDS54714.1, CCDS75093.1	4p16.3	2008-08-01			ENSG00000168884	ENSG00000168884			19118	protein-coding gene	gene with protein product		610669				11390377, 12933576	Standard	NM_024309		Approved	ABIN-2, MGC4289, KLIP, FLIP1	uc003gfg.2	Q8NFZ5	OTTHUMG00000090267	ENST00000315423.7:c.415G>A	4.37:g.2749534C>T	ENSP00000321203:p.Ala139Thr	Somatic		Unspecified	Illumina	Phase_I	2719332	NM_024309		Missense_Mutation	SNP	ENST00000315423.7	37	CCDS3362.1	.	.	.	.	.	.	.	.	.	.	c	6.971	0.549043	0.13312	.	.	ENSG00000168884	ENST00000510267;ENST00000315423;ENST00000503235	T;T;T	0.28454	1.61;1.71;1.75	3.81	2.43	0.29744	.	0.196706	0.42548	D	0.000683	T	0.11239	0.0274	N	0.17345	0.48	0.30654	N	0.755072	P;B	0.36354	0.549;0.2	B;B	0.29176	0.099;0.019	T	0.13388	-1.0511	10	0.07990	T	0.79	-10.2482	4.1522	0.10244	0.0:0.5588:0.0:0.4412	.	139;139	D6RGJ2;Q8NFZ5	.;TNIP2_HUMAN	T	32;139;139	ENSP00000427613:A32T;ENSP00000321203:A139T;ENSP00000426314:A139T	ENSP00000321203:A139T	A	-	1	0	TNIP2	2719332	1.000000	0.71417	0.143000	0.22291	0.719000	0.41307	2.535000	0.45685	0.962000	0.38057	0.550000	0.68814	GCC		TNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206589.5	NM_024309	
CLNK	116449	broad.mit.edu	37	4	10560059	10560059	+	Silent	SNP	G	G	A	rs371671172		TCGA-AG-3901-01	TCGA-AG-3901-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr4:10560059G>A	ENST00000226951.6	-	8	656	c.417C>T	c.(415-417)tcC>tcT	p.S139S	CLNK_ENST00000442825.2_Silent_p.S97S|CLNK_ENST00000507719.1_Silent_p.S97S	NM_052964.2	NP_443196.2	Q7Z7G1	CLNK_HUMAN	cytokine-dependent hematopoietic cell linker	139					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|positive regulation of signal transduction (GO:0009967)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	intracellular (GO:0005622)	SH3/SH2 adaptor activity (GO:0005070)	p.S139S(2)		NS(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(1)	17						TGACGTCCTTGGAAATGGGTT	0.383													g|||	1	0.000199681	0.0	0.0	5008	,	,		22046	0.0		0.001	False		,,,				2504	0.0				p.S139S	GBM(87;402 1286 6949 13902 35851)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C417T	4						.	A		0,3838		0,0,1919	215.0	201.0	205.0		417	0.5	0.3	4		205	1,8271		0,1,4135	no	coding-synonymous	CLNK	NM_052964.2		0,1,6054	AA,AG,GG		0.0121,0.0,0.0083		139/429	10560059	1,12109	1919	4136	6055	10169157	SO:0001819	synonymous_variant	116449	exon8			AB032369	CCDS47024.1	4p16.1	2013-02-14			ENSG00000109684	ENSG00000109684		"""SH2 domain containing"""	17438	protein-coding gene	gene with protein product	"""mast cell immunoreceptor signal transducer"""	611434				10562326, 10744659	Standard	NM_052964		Approved	MIST	uc003gmo.4	Q7Z7G1	OTTHUMG00000160062	ENST00000226951.6:c.417C>T	4.37:g.10560059G>A		Somatic		Unspecified	Illumina	Phase_I	10169157	NM_052964	Q05C27|Q9P2U9	Silent	SNP	ENST00000226951.6	37	CCDS47024.1																																																																																				CLNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359047.1	NM_052964	
AFAP1	60312	broad.mit.edu	37	4	7770717	7770717	+	Missense_Mutation	SNP	G	G	A	rs149064401		TCGA-AG-3901-01	TCGA-AG-3901-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr4:7770717G>A	ENST00000360265.4	-	15	2254	c.2020C>T	c.(2020-2022)Cgg>Tgg	p.R674W	AFAP1_ENST00000513842.1_5'UTR|AFAP1_ENST00000420658.1_Missense_Mutation_p.R758W|AFAP1_ENST00000358461.2_Missense_Mutation_p.R674W|AFAP1_ENST00000382543.3_Missense_Mutation_p.R758W|AFAP1-AS1_ENST00000608442.1_RNA			Q8N556	AFAP1_HUMAN	actin filament associated protein 1	674						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)		p.R674W(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|skin(4)|stomach(2)	32						TCCAGGGTCCGGTGCCGGAAC	0.572																																					p.R758W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2272T	4						.	G	TRP/ARG,TRP/ARG	0,4406		0,0,2203	80.0	95.0	90.0		2272,2020	3.6	1.0	4	dbSNP_134	90	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	AFAP1	NM_001134647.1,NM_198595.2	101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	758/815,674/731	7770717	1,13005	2203	4300	6503	7821617	SO:0001583	missense	60312	exon17			AB209676	CCDS3397.1, CCDS47010.1	4p16	2014-02-12	2007-02-07		ENSG00000196526	ENSG00000196526		"""Pleckstrin homology (PH) domain containing"""	24017	protein-coding gene	gene with protein product		608252				14755689, 11641786, 11607843	Standard	NM_198595		Approved	AFAP-110, AFAP	uc011bwk.1	Q8N556	OTTHUMG00000125515	ENST00000360265.4:c.2020C>T	4.37:g.7770717G>A	ENSP00000353402:p.Arg674Trp	Somatic		Unspecified	Illumina	Phase_I	7821617	NM_001134647	A8K442|B4DMU2|E9PDT7|Q59EY5|Q9HBY1	Missense_Mutation	SNP	ENST00000360265.4	37	CCDS3397.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.176272	0.78564	0.0	1.16E-4	ENSG00000196526	ENST00000360265;ENST00000420658;ENST00000358461;ENST00000382543	T;T;T;T	0.15834	2.41;2.39;2.41;2.39	4.48	3.59	0.41128	.	0.074746	0.56097	D	0.000035	T	0.28499	0.0705	L	0.60455	1.87	0.58432	D	0.999993	D;D	0.76494	0.999;0.998	P;P	0.53185	0.72;0.634	T	0.09596	-1.0667	10	0.87932	D	0	-37.4538	13.6873	0.62524	0.0:0.0:0.845:0.155	.	758;674	E9PDT7;Q8N556	.;AFAP1_HUMAN	W	674;758;674;758	ENSP00000353402:R674W;ENSP00000410689:R758W;ENSP00000351245:R674W;ENSP00000371983:R758W	ENSP00000351245:R674W	R	-	1	2	AFAP1	7821617	1.000000	0.71417	0.989000	0.46669	0.770000	0.43624	3.888000	0.56204	2.030000	0.59900	0.561000	0.74099	CGG		AFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246842.2	NM_021638	
CHRNA9	55584	broad.mit.edu	37	4	40356303	40356303	+	Silent	SNP	C	C	T	rs144758556	byFrequency	TCGA-AG-3901-01	TCGA-AG-3901-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr4:40356303C>T	ENST00000310169.2	+	5	1345	c.1206C>T	c.(1204-1206)aaC>aaT	p.N402N		NM_017581.3	NP_060051.2	Q9UGM1	ACHA9_HUMAN	cholinergic receptor, nicotinic, alpha 9 (neuronal)	402					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|inner ear morphogenesis (GO:0042472)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|synaptic transmission (GO:0007268)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine-activated cation-selective channel activity (GO:0004889)|calcium channel activity (GO:0005262)	p.N402N(1)		breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(4)|stomach(1)	33					Galantamine(DB00674)|Nicotine(DB00184)	GCTTAAAGAACGACCTGGGCT	0.483																																					p.N402N	Esophageal Squamous(115;1297 1602 22235 25158 43327)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1206T	4						.	C		2,4404	4.2+/-10.8	0,2,2201	84.0	74.0	78.0		1206	-3.0	1.0	4	dbSNP_134	78	0,8600		0,0,4300	no	coding-synonymous	CHRNA9	NM_017581.2		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		402/480	40356303	2,13004	2203	4300	6503	40051060	SO:0001819	synonymous_variant	55584	exon5			AF227732	CCDS3459.1	4p14	2012-02-11	2012-02-07		ENSG00000174343	ENSG00000174343		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	14079	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 9 (neuronal)"""	605116	"""cholinergic receptor, nicotinic, alpha polypeptide 9"""				Standard	NM_017581		Approved	NACHRA9	uc003gva.2	Q9UGM1	OTTHUMG00000099375	ENST00000310169.2:c.1206C>T	4.37:g.40356303C>T		Somatic		Unspecified	Illumina	Phase_I	40051060	NM_017581	Q14CY7|Q4W5A2|Q9NYV2	Silent	SNP	ENST00000310169.2	37	CCDS3459.1																																																																																				CHRNA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216822.1		
IL1RAPL2	26280	broad.mit.edu	37	X	104984642	104984642	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3901-01	TCGA-AG-3901-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chrX:104984642C>T	ENST00000372582.1	+	8	1762	c.1006C>T	c.(1006-1008)Cga>Tga	p.R336*	IL1RAPL2_ENST00000344799.4_Nonsense_Mutation_p.R336*|IL1RAPL2_ENST00000485671.1_3'UTR	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	336	Ig-like C2-type 3.				central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)	p.R336*(2)		breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						TGTTGAAAACCGAAATGGACG	0.378																																					p.R336X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C1006T	X						.						76.0	67.0	70.0					X																	104984642		2203	4300	6503	104871298	SO:0001587	stop_gained	26280	exon8			AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.1006C>T	X.37:g.104984642C>T	ENSP00000361663:p.Arg336*	Somatic		Unspecified	Illumina	Phase_I	104871298	NM_017416	Q2M3U3|Q9NZN0	Nonsense_Mutation	SNP	ENST00000372582.1	37	CCDS14517.1	.	.	.	.	.	.	.	.	.	.	C	39	7.831195	0.98513	.	.	ENSG00000189108	ENST00000372582;ENST00000344799	.	.	.	5.61	3.59	0.41128	.	0.000000	0.53938	D	0.000052	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	.	14.7819	0.69774	0.3377:0.6623:0.0:0.0	.	.	.	.	X	336	.	ENSP00000344976:R336X	R	+	1	2	IL1RAPL2	104871298	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.084000	0.30828	1.077000	0.40990	0.600000	0.82982	CGA		IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057785.1	NM_017416	
DOCK11	139818	broad.mit.edu	37	X	117744321	117744321	+	Silent	SNP	G	G	A			TCGA-AG-3901-01	TCGA-AG-3901-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chrX:117744321G>A	ENST00000276202.7	+	28	3099	c.3036G>A	c.(3034-3036)cgG>cgA	p.R1012R	DOCK11_ENST00000276204.6_Silent_p.R1012R	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1012					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R1012R(1)		breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						TGACTATTCGGTATGCGGAGA	0.448																																					p.R1012R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3036A	X						.						135.0	110.0	119.0					X																	117744321		2203	4300	6503	117628349	SO:0001819	synonymous_variant	139818	exon28			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.3036G>A	X.37:g.117744321G>A		Somatic		Unspecified	Illumina	Phase_I	117628349	NM_144658	A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Silent	SNP	ENST00000276202.7	37	CCDS35373.1																																																																																				DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000356002.1	NM_144658	
CXorf21	80231	broad.mit.edu	37	X	30578217	30578217	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3901-01	TCGA-AG-3901-01	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chrX:30578217T>G	ENST00000378962.3	-	3	578	c.256A>C	c.(256-258)Aca>Cca	p.T86P		NM_025159.2	NP_079435.1	Q9HAI6	CX021_HUMAN	chromosome X open reading frame 21	86								p.T86P(1)		kidney(1)|large_intestine(3)|lung(13)|ovary(1)|stomach(1)|urinary_tract(1)	20						TTGGGGTTTGTCTGCAGCACT	0.453																																					p.T86P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A256C	X						.						159.0	156.0	157.0					X																	30578217		2202	4300	6502	30488138	SO:0001583	missense	80231	exon3			BC020611	CCDS14224.1	Xp21.3	2006-04-12			ENSG00000120280	ENSG00000120280			25667	protein-coding gene	gene with protein product						12477932	Standard	NM_025159		Approved	FLJ11577	uc004dcg.2	Q9HAI6	OTTHUMG00000021325	ENST00000378962.3:c.256A>C	X.37:g.30578217T>G	ENSP00000368245:p.Thr86Pro	Somatic		Unspecified	Illumina	Phase_I	30488138	NM_025159		Missense_Mutation	SNP	ENST00000378962.3	37	CCDS14224.1	.	.	.	.	.	.	.	.	.	.	T	7.894	0.732966	0.15507	.	.	ENSG00000120280	ENST00000378962	.	.	.	5.11	2.6	0.31112	.	0.763914	0.12002	N	0.508749	T	0.25269	0.0614	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.17684	-1.0361	9	0.31617	T	0.26	-0.112	1.6743	0.02818	0.2329:0.097:0.1325:0.5376	.	86	Q9HAI6	CX021_HUMAN	P	86	.	ENSP00000368245:T86P	T	-	1	0	CXorf21	30488138	0.015000	0.18098	0.924000	0.36721	0.994000	0.84299	0.102000	0.15272	0.790000	0.33803	0.381000	0.24937	ACA		CXorf21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056164.1	NM_025159	
FGD1	2245	broad.mit.edu	37	X	54496875	54496875	+	Silent	SNP	G	G	A	rs149366519		TCGA-AG-3901-01	TCGA-AG-3901-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chrX:54496875G>A	ENST00000375135.3	-	4	1408	c.675C>T	c.(673-675)gtC>gtT	p.V225V		NM_004463.2	NP_004454.2	P98174	FGD1_HUMAN	FYVE, RhoGEF and PH domain containing 1	225	Pro-rich.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.V225V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						TATCCGAGGCGACAATCACAG	0.627																																					p.V225V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C675T	X						.	G		0,3827		0,0,1628,571	30.0	36.0	34.0		675	-4.8	0.2	X	dbSNP_134	34	1,6711		0,1,2424,1862	no	coding-synonymous	FGD1	NM_004463.2		0,1,4052,2433	AA,AG,GG,G		0.0149,0.0,0.0095		225/962	54496875	1,10538	2199	4287	6486	54513600	SO:0001819	synonymous_variant	2245	exon4			U11690	CCDS14359.1	Xp11.21	2013-01-10	2008-08-01		ENSG00000102302	ENSG00000102302		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3663	protein-coding gene	gene with protein product		300546	"""faciogenital dysplasia (Aarskog-Scott syndrome)"""	FGDY			Standard	NM_004463		Approved	ZFYVE3	uc004dtg.3	P98174	OTTHUMG00000021627	ENST00000375135.3:c.675C>T	X.37:g.54496875G>A		Somatic		Unspecified	Illumina	Phase_I	54513600	NM_004463	Q5H999|Q8N4D9	Silent	SNP	ENST00000375135.3	37	CCDS14359.1																																																																																				FGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056801.1	NM_004463	
BRWD3	254065	broad.mit.edu	37	X	79945323	79945323	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3901-01	TCGA-AG-3901-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chrX:79945323G>C	ENST00000373275.4	-	33	3967	c.3751C>G	c.(3751-3753)Ctg>Gtg	p.L1251V	BRWD3_ENST00000473691.1_5'UTR	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	1251					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)			p.L1251V(1)		breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						TAAGTATCCAGTATATCAGTA	0.279																																					p.L1251V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3751G	X						.						99.0	79.0	86.0					X																	79945323		2199	4298	6497	79831979	SO:0001583	missense	254065	exon33				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.3751C>G	X.37:g.79945323G>C	ENSP00000362372:p.Leu1251Val	Somatic		Unspecified	Illumina	Phase_I	79831979	NM_153252	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	ENST00000373275.4	37	CCDS14447.1	.	.	.	.	.	.	.	.	.	.	G	10.55	1.382646	0.25031	.	.	ENSG00000165288	ENST00000373275	T	0.55588	0.51	5.27	0.2	0.15181	.	0.000000	0.85682	D	0.000000	T	0.48589	0.1508	M	0.69823	2.125	0.36990	D	0.894758	P	0.37985	0.613	B	0.41466	0.358	T	0.45411	-0.9263	9	.	.	.	-5.6635	6.1556	0.20335	0.5312:0.1326:0.3361:0.0	.	1251	Q6RI45	BRWD3_HUMAN	V	1251	ENSP00000362372:L1251V	.	L	-	1	2	BRWD3	79831979	1.000000	0.71417	0.992000	0.48379	0.996000	0.88848	1.120000	0.31271	-0.111000	0.12001	0.594000	0.82650	CTG		BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	NM_153252	
CYLC1	1538	broad.mit.edu	37	X	83128791	83128791	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3901-01	TCGA-AG-3901-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chrX:83128791A>G	ENST00000329312.4	+	4	1112	c.1075A>G	c.(1075-1077)Aag>Gag	p.K359E		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	359					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.K358E(1)		NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						gaaagatgacaagaaaaagga	0.353																																					p.K359E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1075G	X						.						36.0	32.0	33.0					X																	83128791		2191	4289	6480	83015447	SO:0001583	missense	1538	exon4			Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.1075A>G	X.37:g.83128791A>G	ENSP00000331556:p.Lys359Glu	Somatic		Unspecified	Illumina	Phase_I	83015447	NM_021118	A0AVQ8|Q5JQQ9	Missense_Mutation	SNP	ENST00000329312.4	37	CCDS35341.1	.	.	.	.	.	.	.	.	.	.	a	3.960	-0.010548	0.07727	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	T	0.28255	1.62	3.08	1.88	0.25563	.	.	.	.	.	T	0.24044	0.0582	L	0.47016	1.485	0.09310	N	1	B;B	0.34181	0.44;0.221	B;B	0.35240	0.198;0.133	T	0.16689	-1.0394	9	0.27082	T	0.32	.	5.6714	0.17725	0.721:0.279:0.0:0.0	.	359;359	P35663;F5H4V5	CYLC1_HUMAN;.	E	359	ENSP00000331556:K359E	ENSP00000331556:K359E	K	+	1	0	CYLC1	83015447	0.019000	0.18553	0.095000	0.20976	0.094000	0.18550	1.019000	0.30014	0.422000	0.26005	0.451000	0.29950	AAG		CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057371.1	NM_021118	
BCORL1	63035	broad.mit.edu	37	X	129150016	129150016	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3901-01	TCGA-AG-3901-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chrX:129150016C>T	ENST00000218147.7	+	4	3465	c.3268C>T	c.(3268-3270)Cga>Tga	p.R1090*	BCORL1_ENST00000540052.1_Nonsense_Mutation_p.R1090*|BCORL1_ENST00000303743.5_Nonsense_Mutation_p.R1090*|BCORL1_ENST00000359304.2_Nonsense_Mutation_p.R1090*			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	1090					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.R1090*(1)		breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						CGGGCAGGCTCGAGTGAAACA	0.572																																					p.R1090X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3268T	X						.						75.0	67.0	70.0					X																	129150016		2203	4300	6503	128977697	SO:0001587	stop_gained	63035	exon3			AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.3268C>T	X.37:g.129150016C>T	ENSP00000218147:p.Arg1090*	Somatic		Unspecified	Illumina	Phase_I	128977697	NM_021946	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Nonsense_Mutation	SNP	ENST00000218147.7	37	CCDS14616.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	40|40	8.399452|8.399452	0.98794|0.98794	.|.	.|.	ENSG00000085185|ENSG00000085185	ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052;ENST00000456822|ENST00000441294	.|.	.|.	.|.	5.3|5.3	5.3|5.3	0.74995|0.74995	.|.	0.000000|.	0.30134|.	N|.	0.010337|.	.|T	.|0.74359	.|0.3706	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73949	.|-0.3821	.|3	0.06365|.	T|.	0.9|.	-2.9752|-2.9752	18.0554|18.0554	0.89363|0.89363	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|L	1090;1090;1090;1090;690|525	.|.	ENSP00000218147:R1090X|.	R|S	+|+	1|2	2|0	BCORL1|BCORL1	128977697|128977697	0.997000|0.997000	0.39634|0.39634	0.973000|0.973000	0.42090|0.42090	0.924000|0.924000	0.55760|0.55760	5.080000|5.080000	0.64437|0.64437	2.200000|2.200000	0.70718|0.70718	0.600000|0.600000	0.82982|0.82982	CGA|TCG		BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946	
SCN1A	6323	broad.mit.edu	37	2	166868748	166868748	+	Silent	SNP	C	C	T			TCGA-AG-3901-01	TCGA-AG-3901-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr2:166868748C>T	ENST00000303395.4	-	19	3749	c.3750G>A	c.(3748-3750)acG>acA	p.T1250T	AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000409050.1_Silent_p.T1222T|SCN1A_ENST00000423058.2_Silent_p.T1250T|SCN1A_ENST00000375405.3_Silent_p.T1239T|AC010127.3_ENST00000597623.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1250					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.T1239T(1)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATTCCAACATCGTCTTAATCG	0.318																																					p.T1222T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3666A	2						.						80.0	75.0	77.0					2																	166868748		2202	4299	6501	166576994	SO:0001819	synonymous_variant	6323	exon19			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.3750G>A	2.37:g.166868748C>T		Somatic		Unspecified	Illumina	Phase_I	166576994	NM_001165964	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Silent	SNP	ENST00000303395.4	37	CCDS54413.1																																																																																				SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
RBM45	129831	broad.mit.edu	37	2	178990777	178990777	+	Silent	SNP	C	C	T			TCGA-AG-3901-01	TCGA-AG-3901-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr2:178990777C>T	ENST00000286070.5	+	9	1391	c.1299C>T	c.(1297-1299)gcC>gcT	p.A433A		NM_152945.2	NP_694453.2	Q8IUH3	RBM45_HUMAN	RNA binding motif protein 45	435	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.A433A(2)		endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.00957)|all cancers(119;0.037)			CCAAGTATGCCGATAGAATAA	0.388																																					p.A433A												.	.	2	Substitution - coding silent(2)	large_intestine(1)|kidney(1)	c.C1299T	2						.						159.0	144.0	149.0					2																	178990777		2203	4300	6503	178699023	SO:0001819	synonymous_variant	129831	exon9			AF526533	CCDS33335.1	2q31.2	2013-02-12			ENSG00000155636	ENSG00000155636		"""RNA binding motif (RRM) containing"""	24468	protein-coding gene	gene with protein product	"""developmentally regulated RNA binding protein 1"""	608888				12220514	Standard	XM_005246287		Approved	DRB1, FLJ44612	uc002ulv.3	Q8IUH3	OTTHUMG00000154202	ENST00000286070.5:c.1299C>T	2.37:g.178990777C>T		Somatic		Unspecified	Illumina	Phase_I	178699023	NM_152945	Q6NYL0|Q8NFC9	Silent	SNP	ENST00000286070.5	37	CCDS33335.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.565|9.565	1.119453|1.119453	0.20877|0.20877	.|.	.|.	ENSG00000155636|ENSG00000155636	ENST00000455903|ENST00000424099	.|.	.|.	.|.	5.74|5.74	-2.19|-2.19	0.07015|0.07015	.|.	.|.	.|.	.|.	.|.	T|.	0.41026|.	0.1141|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.27400|.	-1.0075|.	4|.	.|.	.|.	.|.	-18.3773|-18.3773	2.3916|2.3916	0.04379|0.04379	0.2966:0.2297:0.0646:0.4091|0.2966:0.2297:0.0646:0.4091	.|.	.|.	.|.	.|.	L|X	94|32	.|.	.|.	P|R	+|+	2|1	0|2	RBM45|RBM45	178699023|178699023	0.990000|0.990000	0.36364|0.36364	0.986000|0.986000	0.45419|0.45419	0.947000|0.947000	0.59692|0.59692	0.419000|0.419000	0.21247|0.21247	-0.648000|-0.648000	0.05437|0.05437	-1.072000|-1.072000	0.02254|0.02254	CCG|CGA		RBM45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334375.2	NM_152945	
TTN	7273	broad.mit.edu	37	2	179452756	179452756	+	Silent	SNP	T	T	A			TCGA-AG-3901-01	TCGA-AG-3901-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr2:179452756T>A	ENST00000591111.1	-	255	58679	c.58455A>T	c.(58453-58455)gtA>gtT	p.V19485V	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Silent_p.V12253V|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN_ENST00000359218.5_Silent_p.V12186V|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000342992.6_Silent_p.V18558V|TTN_ENST00000460472.2_Silent_p.V12061V|TTN_ENST00000589042.1_Silent_p.V21126V|TTN-AS1_ENST00000456053.1_RNA			Q8WZ42	TITIN_HUMAN	titin	19485	Fibronectin type-III 41. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.V12253V(1)|p.V12186V(1)|p.V18556V(1)|p.V12061V(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATTCCTTGCGTACAAGCTGTG	0.478																																					p.Y12061F												.	.	4	Substitution - coding silent(4)	large_intestine(4)	c.A36182T	2						.						92.0	87.0	89.0					2																	179452756		1961	4158	6119	179161002	SO:0001819	synonymous_variant	7273	exon133			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.58455A>T	2.37:g.179452756T>A		Somatic		Unspecified	Illumina	Phase_I	179161002	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																					TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
DIRC1	116093	broad.mit.edu	37	2	189599428	189599428	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3901-01	TCGA-AG-3901-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr2:189599428G>C	ENST00000308100.4	-	2	490	c.220C>G	c.(220-222)Caa>Gaa	p.Q74E	AC079613.1_ENST00000431708.1_RNA	NM_052952.2	NP_443184.1	Q969H9	DIRC1_HUMAN	disrupted in renal carcinoma 1	74								p.Q74E(1)		large_intestine(1)|lung(6)	7			OV - Ovarian serous cystadenocarcinoma(117;0.00842)|Epithelial(96;0.102)			GAAGAAAGTTGATCCTTTGTT	0.378																																					p.Q74E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C220G	2						.						155.0	154.0	155.0					2																	189599428		2203	4300	6503	189307673	SO:0001583	missense	116093	exon2			AY039011	CCDS2296.1	2q33	2008-05-22			ENSG00000174325	ENSG00000174325			15760	protein-coding gene	gene with protein product		606423				11587072	Standard	NM_052952		Approved		uc002uqi.1	Q969H9	OTTHUMG00000132646	ENST00000308100.4:c.220C>G	2.37:g.189599428G>C	ENSP00000307860:p.Gln74Glu	Somatic		Unspecified	Illumina	Phase_I	189307673	NM_052952	Q08AK1	Missense_Mutation	SNP	ENST00000308100.4	37	CCDS2296.1	.	.	.	.	.	.	.	.	.	.	G	2.034	-0.421666	0.04734	.	.	ENSG00000174325	ENST00000308100	T	0.32023	1.47	2.27	-2.2	0.06994	.	.	.	.	.	T	0.12603	0.0306	N	0.08118	0	0.09310	N	1	P	0.35481	0.504	B	0.29598	0.104	T	0.14924	-1.0455	9	0.87932	D	0	.	6.7864	0.23675	0.4825:0.0:0.5175:0.0	.	74	Q969H9	DIRC1_HUMAN	E	74	ENSP00000307860:Q74E	ENSP00000307860:Q74E	Q	-	1	0	DIRC1	189307673	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-0.353000	0.07691	-0.665000	0.05317	0.655000	0.94253	CAA		DIRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255897.2	NM_052952	
PSMD1	5707	broad.mit.edu	37	2	231943382	231943382	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3901-01	TCGA-AG-3901-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr2:231943382C>T	ENST00000308696.6	+	10	1243	c.1081C>T	c.(1081-1083)Cgg>Tgg	p.R361W	PSMD1_ENST00000373635.4_Missense_Mutation_p.R361W|PSMD1_ENST00000409643.1_Missense_Mutation_p.R361W	NM_002807.3	NP_002798.2	Q99460	PSMD1_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 1	361					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)	p.R361W(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)	31		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	GGATGCAGTACGGAATTCTGT	0.398																																					p.R361W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1081T	2						.						121.0	113.0	116.0					2																	231943382		2203	4300	6503	231651626	SO:0001583	missense	5707	exon10			D44466	CCDS2482.1, CCDS54436.1	2q37.1	2008-05-22			ENSG00000173692	ENSG00000173692		"""Proteasome (prosome, macropain) subunits"""	9554	protein-coding gene	gene with protein product						8816993	Standard	NM_002807		Approved	S1, P112, Rpn2	uc002vrn.2	Q99460	OTTHUMG00000133223	ENST00000308696.6:c.1081C>T	2.37:g.231943382C>T	ENSP00000309474:p.Arg361Trp	Somatic		Unspecified	Illumina	Phase_I	231651626	NM_002807	B8ZZH9|Q24JU0|Q53TI2|Q6GMU5|Q6P2P4|Q6PJM7|Q6PKG9|Q86VU1|Q8IV79	Missense_Mutation	SNP	ENST00000308696.6	37	CCDS2482.1	.	.	.	.	.	.	.	.	.	.	C	19.36	3.812542	0.70912	.	.	ENSG00000173692	ENST00000308696;ENST00000373635;ENST00000409643	.	.	.	5.68	4.79	0.61399	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85089	0.5617	M	0.92691	3.335	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.984	D	0.88549	0.3115	9	0.87932	D	0	-11.8035	13.7724	0.63034	0.4187:0.5813:0.0:0.0	.	361;361	Q99460;Q99460-2	PSMD1_HUMAN;.	W	361	.	ENSP00000309474:R361W	R	+	1	2	PSMD1	231651626	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	1.985000	0.40668	1.362000	0.46000	0.585000	0.79938	CGG		PSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256958.2		
SLC24A2	25769	broad.mit.edu	37	9	19619585	19619585	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3901-01	TCGA-AG-3901-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr9:19619585C>T	ENST00000341998.2	-	3	1136	c.1075G>A	c.(1075-1077)Gaa>Aaa	p.E359K	SLC24A2_ENST00000286344.3_Missense_Mutation_p.E359K	NM_001193288.2|NM_020344.3	NP_001180217.1|NP_065077.1	Q9UI40	NCKX2_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 2	359					cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	cadmium ion binding (GO:0046870)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium, potassium:sodium antiporter activity (GO:0008273)|manganese ion binding (GO:0030145)|nickel cation binding (GO:0016151)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|symporter activity (GO:0015293)	p.E359K(1)		endometrium(3)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		TGTTTACCTTCGGCGAGTGGG	0.517																																					p.E359K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1075A	9						.						204.0	188.0	193.0					9																	19619585		2203	4300	6503	19609585	SO:0001583	missense	25769	exon4			AF097366	CCDS6493.1, CCDS55297.1	9p22.1	2013-05-22			ENSG00000155886	ENSG00000155886		"""Solute carriers"""	10976	protein-coding gene	gene with protein product		609838				10662833	Standard	NM_020344		Approved	NCKX2	uc003zoa.2	Q9UI40	OTTHUMG00000019646	ENST00000341998.2:c.1075G>A	9.37:g.19619585C>T	ENSP00000344801:p.Glu359Lys	Somatic		Unspecified	Illumina	Phase_I	19609585	NM_020344	B7ZLL8|Q9NTN5|Q9NZQ4	Missense_Mutation	SNP	ENST00000341998.2	37	CCDS6493.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.257455	0.80246	.	.	ENSG00000155886	ENST00000341998;ENST00000286344	T;T	0.77098	-1.07;-1.0	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.85164	0.5634	M	0.80183	2.485	0.80722	D	1	D;D	0.57571	0.976;0.98	P;P	0.51324	0.457;0.666	D	0.85408	0.1135	9	.	.	.	.	19.6614	0.95875	0.0:1.0:0.0:0.0	.	359;359	Q9UI40-2;Q9UI40	.;NCKX2_HUMAN	K	359	ENSP00000344801:E359K;ENSP00000286344:E359K	.	E	-	1	0	SLC24A2	19609585	1.000000	0.71417	0.997000	0.53966	0.407000	0.30961	5.834000	0.69361	2.740000	0.93945	0.650000	0.86243	GAA		SLC24A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051866.2	NM_020344	
CBWD3	445571	broad.mit.edu	37	9	70871837	70871837	+	Splice_Site	SNP	G	G	A			TCGA-AG-3901-01	TCGA-AG-3901-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr9:70871837G>A	ENST00000360171.6	+	5	982	c.431G>A	c.(430-432)gGt>gAt	p.G144D	CBWD3_ENST00000377342.5_Intron	NM_201453.2	NP_958861.2	Q5JTY5	CBWD3_HUMAN	COBW domain containing 3	144							ATP binding (GO:0005524)	p.G144D(1)		kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5				all cancers(8;0.00136)|Epithelial(8;0.0288)|GBM - Glioblastoma multiforme(74;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		ATATTTTCACGTGCAGTGGCT	0.284																																					p.G144D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G431A	9						.						25.0	31.0	29.0					9																	70871837		2190	4253	6443	70061657	SO:0001630	splice_region_variant	445571	exon5			BC069006	CCDS35038.1, CCDS35038.2	9q13	2014-05-06			ENSG00000196873	ENSG00000196873			18519	protein-coding gene	gene with protein product		611080				15233989, 12421752	Standard	XM_005277637		Approved	bA561O23.1	uc004aga.4	Q5JTY5	OTTHUMG00000184383	ENST00000360171.6:c.431-1G>A	9.37:g.70871837G>A		Somatic		Unspecified	Illumina	Phase_I	70061657	NM_201453	B4DNG9|Q6VB91	Missense_Mutation	SNP	ENST00000360171.6	37	CCDS35038.1	.	.	.	.	.	.	.	.	.	.	.	17.89	3.499164	0.64298	.	.	ENSG00000196873	ENST00000360171;ENST00000447896;ENST00000455061;ENST00000455820;ENST00000377344	T	0.43294	0.95	3.38	3.38	0.38709	Cobalamin (vitamin B12) biosynthesis CobW-like (1);	0.000000	0.85682	D	0.000000	T	0.63271	0.2497	M	0.88979	2.995	0.80722	D	1	D	0.57899	0.981	P	0.56823	0.807	T	0.72669	-0.4223	9	.	.	.	.	13.8697	0.63610	0.0:0.0:1.0:0.0	.	144	Q5JTY5	CBWD3_HUMAN	D	144;144;144;144;108	ENSP00000353295:G144D	.	G	+	2	0	CBWD3	70061657	1.000000	0.71417	0.991000	0.47740	0.822000	0.46500	8.848000	0.92172	1.602000	0.50124	0.305000	0.20034	GGT		CBWD3-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052526.1	NM_201453	Missense_Mutation
SHC3	53358	broad.mit.edu	37	9	91667023	91667023	+	Silent	SNP	G	G	A			TCGA-AG-3901-01	TCGA-AG-3901-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr9:91667023G>A	ENST00000375835.4	-	7	1197	c.891C>T	c.(889-891)atC>atT	p.I297I	SHC3_ENST00000375830.1_5'UTR	NM_016848.5	NP_058544.3	Q92529	SHC3_HUMAN	SHC (Src homology 2 domain containing) transforming protein 3	297	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				central nervous system development (GO:0007417)|epidermal growth factor receptor signaling pathway (GO:0007173)|insulin receptor signaling pathway (GO:0008286)|learning or memory (GO:0007611)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)|synaptic transmission, glutamatergic (GO:0035249)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)	signal transducer activity (GO:0004871)	p.I297I(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|skin(3)	28						AGGCTTGTCCGATGGAGCCGA	0.498																																					p.I297I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C891T	9						.						91.0	85.0	87.0					9																	91667023		2203	4300	6503	90856843	SO:0001819	synonymous_variant	53358	exon7			D84361	CCDS6681.1	9q22.1	2013-02-14	2005-05-24		ENSG00000148082	ENSG00000148082		"""SH2 domain containing"""	18181	protein-coding gene	gene with protein product		605263	"""src homology 2 domain containing transforming protein C3"""			8808684	Standard	NM_016848		Approved	N-Shc, NSHC, SHCC	uc004aqf.2	Q92529	OTTHUMG00000020179	ENST00000375835.4:c.891C>T	9.37:g.91667023G>A		Somatic		Unspecified	Illumina	Phase_I	90856843	NM_016848	Q5T7I7|Q8TAP2|Q9UCX5	Silent	SNP	ENST00000375835.4	37	CCDS6681.1																																																																																				SHC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052986.1	NM_016848	
SLC35D2	11046	broad.mit.edu	37	9	99084293	99084293	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3901-01	TCGA-AG-3901-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr9:99084293C>T	ENST00000253270.7	-	11	963	c.901G>A	c.(901-903)Ggg>Agg	p.G301R	SLC35D2_ENST00000375259.4_Missense_Mutation_p.G213R	NM_007001.2	NP_008932.2	Q76EJ3	S35D2_HUMAN	solute carrier family 35 (UDP-GlcNAc/UDP-glucose transporter), member D2	301					carbohydrate derivative transport (GO:1901264)|carbohydrate metabolic process (GO:0005975)|carbohydrate transport (GO:0008643)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|nucleotide transmembrane transport (GO:1901679)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	nucleotide-sugar transmembrane transporter activity (GO:0005338)	p.G301R(1)		endometrium(3)|large_intestine(3)|lung(4)|skin(2)	12		Acute lymphoblastic leukemia(62;0.0167)				ATATTTAACCCTACAAAGTTT	0.363																																					p.G301R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G901A	9						.						73.0	79.0	77.0					9																	99084293		2203	4300	6503	98124114	SO:0001583	missense	11046	exon11			AB122077	CCDS6717.1, CCDS69625.1	9q22.33	2013-07-17	2013-07-17		ENSG00000130958	ENSG00000130958		"""Solute carriers"""	20799	protein-coding gene	gene with protein product		609182	"""solute carrier family 35, member D2"""			15607426	Standard	NM_007001		Approved	UGTrel8, SQV7L	uc004awc.3	Q76EJ3	OTTHUMG00000020293	ENST00000253270.7:c.901G>A	9.37:g.99084293C>T	ENSP00000253270:p.Gly301Arg	Somatic		Unspecified	Illumina	Phase_I	98124114	NM_007001	O95454|Q498C1|Q75W21|Q7Z5X5	Missense_Mutation	SNP	ENST00000253270.7	37	CCDS6717.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.185579	0.78677	.	.	ENSG00000130958	ENST00000253270;ENST00000375259	T;T	0.80123	-1.34;-1.34	4.84	4.84	0.62591	Domain of unknown function DUF250 (1);	0.000000	0.85682	D	0.000000	D	0.91181	0.7222	M	0.90019	3.08	0.33749	D	0.620376	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94993	0.8136	10	0.87932	D	0	.	15.4797	0.75514	0.0:1.0:0.0:0.0	.	213;301	Q76EJ3-2;Q76EJ3	.;S35D2_HUMAN	R	301;213	ENSP00000253270:G301R;ENSP00000364408:G213R	ENSP00000253270:G301R	G	-	1	0	SLC35D2	98124114	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	5.904000	0.69886	2.522000	0.85027	0.563000	0.77884	GGG		SLC35D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053261.1		
NCBP1	4686	broad.mit.edu	37	9	100407910	100407910	+	Silent	SNP	T	T	C			TCGA-AG-3901-01	TCGA-AG-3901-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr9:100407910T>C	ENST00000375147.3	+	6	763	c.507T>C	c.(505-507)taT>taC	p.Y169Y		NM_002486.4	NP_002477.1	Q09161	NCBP1_HUMAN	nuclear cap binding protein subunit 1, 80kDa	169	MIF4G.				7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of viral transcription (GO:0050434)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|mRNA cap binding complex (GO:0005845)|nuclear cap binding complex (GO:0005846)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA cap binding (GO:0000339)	p.Y169Y(1)		NS(1)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)	19		Acute lymphoblastic leukemia(62;0.158)				GAGATTGGTATGTGTATGCAT	0.338																																					p.Y169Y	Ovarian(36;879 898 2893 44212 50307)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T507C	9						.						131.0	118.0	122.0					9																	100407910		2203	4300	6503	99447731	SO:0001819	synonymous_variant	4686	exon6			BC001450	CCDS6728.1	9q34.1	2010-01-26	2002-08-29		ENSG00000136937	ENSG00000136937			7658	protein-coding gene	gene with protein product		600469	"""nuclear cap binding protein subunit 1, 80kD"""	NCBP		7937105, 8812508	Standard	NM_002486		Approved	CBP80, Sto1	uc004axq.3	Q09161	OTTHUMG00000020332	ENST00000375147.3:c.507T>C	9.37:g.100407910T>C		Somatic		Unspecified	Illumina	Phase_I	99447731	NM_002486	B2R718|Q59G76|Q5T1V0|Q5T7X2	Silent	SNP	ENST00000375147.3	37	CCDS6728.1																																																																																				NCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053337.1	NM_002486	
DIAPH3	81624	broad.mit.edu	37	13	60240857	60240857	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3901-01	TCGA-AG-3901-01	C	C	C	T	C	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr13:60240857C>T	ENST00000400324.4	-	28	3663	c.3443G>A	c.(3442-3444)aGg>aAg	p.R1148K	DIAPH3_ENST00000400330.1_Missense_Mutation_p.R1148K|DIAPH3_ENST00000400320.1_Missense_Mutation_p.R1102K|DIAPH3_ENST00000377908.2_Missense_Mutation_p.R1137K|DIAPH3_ENST00000400319.1_Missense_Mutation_p.R1078K	NM_001042517.1|NM_001258366.1	NP_001035982.1|NP_001245295.1	Q9NSV4	DIAP3_HUMAN	diaphanous-related formin 3	1148					actin cytoskeleton organization (GO:0030036)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|liver(1)|lung(20)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		TGCCTTGATCCTCCCAGTAGA	0.418																																					p.R1148K												.	.	0			c.G3443A	13						.						190.0	177.0	181.0					13																	60240857		1908	4126	6034	59138858	SO:0001583	missense	81624	exon28			AL137718	CCDS41898.1, CCDS58294.1, CCDS58295.1, CCDS58296.1, CCDS58297.1, CCDS73579.1, CCDS73580.1	13q21.2	2013-05-24	2013-05-24		ENSG00000139734	ENSG00000139734			15480	protein-coding gene	gene with protein product		614567	"""diaphanous (Drosophila, homolog) 3"", ""auditory neuropathy, autosomal dominant 1"", ""diaphanous homolog 3 (Drosophila)"""	AUNA1		14767582, 20624953	Standard	NM_030932		Approved	DRF3, FLJ34705, AN, NSDAN	uc001vht.4	Q9NSV4	OTTHUMG00000017004	ENST00000400324.4:c.3443G>A	13.37:g.60240857C>T	ENSP00000383178:p.Arg1148Lys	Germline		Unspecified	Illumina	Phase_I	59138858	NM_001042517	A2A3B8|A2A3B9|A2A3C0|Q18P99|Q18PA0|Q18PA1|Q2KPB6|Q3ZK23|Q5JTP8|Q5T2S7|Q5XKF6|Q6MZF0|Q6NUP0|Q86VS4|Q8NAV4	Missense_Mutation	SNP	ENST00000400324.4	37	CCDS41898.1	.	.	.	.	.	.	.	.	.	.	C	14.88	2.666602	0.47677	.	.	ENSG00000139734	ENST00000400324;ENST00000400330;ENST00000400327;ENST00000413168;ENST00000400329;ENST00000377908;ENST00000400319;ENST00000400320	T;T;T;T;T	0.80653	-1.4;-1.4;-1.4;-1.39;-1.39	5.46	4.6	0.57074	.	0.221905	0.21779	U	0.069229	T	0.63628	0.2527	N	0.19112	0.55	0.22745	N	0.998782	B	0.06786	0.001	B	0.04013	0.001	T	0.43702	-0.9375	10	0.20046	T	0.44	.	7.597	0.28054	0.1429:0.721:0.0:0.1361	.	1148	Q9NSV4	DIAP3_HUMAN	K	1148;1148;1137;1102;1078;1137;1078;1102	ENSP00000383178:R1148K;ENSP00000383184:R1148K;ENSP00000367141:R1137K;ENSP00000383173:R1078K;ENSP00000383174:R1102K	ENSP00000367141:R1137K	R	-	2	0	DIAPH3	59138858	0.993000	0.37304	1.000000	0.80357	0.992000	0.81027	0.636000	0.24644	2.546000	0.85860	0.655000	0.94253	AGG		DIAPH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045166.3	NM_001042517	
UGGT2	55757	broad.mit.edu	37	13	96684169	96684169	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3901-01	TCGA-AG-3901-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr13:96684169T>C	ENST00000376747.3	-	2	285	c.215A>G	c.(214-216)cAa>cGa	p.Q72R	UGGT2_ENST00000397618.3_Missense_Mutation_p.Q72R|UGGT2_ENST00000376712.4_Missense_Mutation_p.Q72R|UGGT2_ENST00000376714.3_Missense_Mutation_p.Q72R	NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	72					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)	p.Q72R(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						TGCTAATTCTTGCACAGTTTC	0.249																																					p.Q72R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A215G	13						.						60.0	63.0	62.0					13																	96684169		2198	4280	6478	95482170	SO:0001583	missense	55757	exon2			AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.215A>G	13.37:g.96684169T>C	ENSP00000365938:p.Gln72Arg	Somatic		Unspecified	Illumina	Phase_I	95482170	NM_020121	A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Missense_Mutation	SNP	ENST00000376747.3	37	CCDS9480.1	.	.	.	.	.	.	.	.	.	.	T	10.90	1.481689	0.26598	.	.	ENSG00000102595	ENST00000376747;ENST00000376722;ENST00000376714;ENST00000397618;ENST00000376712	T;T	0.30448	3.13;1.53	5.93	-2.12	0.07165	.	0.722577	0.14026	N	0.346490	T	0.14743	0.0356	N	0.20685	0.6	0.20489	N	0.999897	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.06405	0.002;0.002;0.001	T	0.16041	-1.0416	10	0.87932	D	0	-9.0E-4	2.748	0.05273	0.1157:0.3733:0.1173:0.3937	.	72;72;72	Q2TAA6;E7EMU6;Q9NYU1	.;.;UGGG2_HUMAN	R	72	ENSP00000365938:Q72R;ENSP00000380743:Q72R	ENSP00000365902:Q72R	Q	-	2	0	UGGT2	95482170	0.070000	0.21116	0.215000	0.23724	0.991000	0.79684	0.235000	0.17948	-0.241000	0.09681	0.533000	0.62120	CAA		UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045507.1	NM_020121	
DOCK9	23348	broad.mit.edu	37	13	99479090	99479090	+	Missense_Mutation	SNP	G	G	A	rs371892069		TCGA-AG-3901-01	TCGA-AG-3901-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr13:99479090G>A	ENST00000376460.1	-	44	5028	c.4948C>T	c.(4948-4950)Cgg>Tgg	p.R1650W	DOCK9_ENST00000448493.2_3'UTR|DOCK9_ENST00000339416.2_Missense_Mutation_p.R1651W	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	1651	DHR-2.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R1651W(1)		breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TTACCTTTCCGTGTGAGATAT	0.403																																					p.R1651W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4951T	13						.	G	TRP/ARG,TRP/ARG	1,3823		0,1,1911	104.0	93.0	97.0		4948,4951	4.1	1.0	13		97	0,8268		0,0,4134	no	missense,missense	DOCK9	NM_001130048.1,NM_015296.2	101,101	0,1,6045	AA,AG,GG		0.0,0.0262,0.0083	probably-damaging,probably-damaging	1650/2069,1651/2070	99479090	1,12091	1912	4134	6046	98277091	SO:0001583	missense	23348	exon44			AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.4948C>T	13.37:g.99479090G>A	ENSP00000365643:p.Arg1650Trp	Somatic		Unspecified	Illumina	Phase_I	98277091	NM_015296	B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Missense_Mutation	SNP	ENST00000376460.1	37	CCDS45062.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.96|17.96	3.516310|3.516310	0.64634|0.64634	2.62E-4|2.62E-4	0.0|0.0	ENSG00000088387|ENSG00000088387	ENST00000376460;ENST00000357329;ENST00000376455;ENST00000400235;ENST00000428223;ENST00000400220;ENST00000339416;ENST00000376453;ENST00000451563;ENST00000340449|ENST00000400228	T;T;T;T|T	0.46819|0.23552	2.33;2.41;0.97;0.86|1.9	5.1|5.1	4.12|4.12	0.48240|0.48240	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.49474|0.49474	0.1559|0.1559	M|M	0.83852|0.83852	2.665|2.665	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D;D|.	0.89917|.	1.0;0.999;1.0;1.0;1.0;0.999;1.0;1.0|.	D;D;D;D;D;D;D;D|.	0.85130|.	0.997;0.991;0.991;0.994;0.967;0.937;0.986;0.996|.	T|T	0.52931|0.52931	-0.8509|-0.8509	10|7	0.66056|0.46703	D|T	0.02|0.11	.|.	14.9842|14.9842	0.71332|0.71332	0.0:0.0:0.8138:0.1862|0.0:0.0:0.8138:0.1862	.|.	1651;370;294;1650;294;1651;343;293|.	A8MWZ5;B7Z6H5;B7Z2J2;Q9BZ29-5;Q5JUD8;Q9BZ29;B7Z6G9;F5H1Q4|.	.;.;.;.;.;DOCK9_HUMAN;.;.|.	W|M	1650;1651;1643;1651;1650;581;1651;293;38;294|237	ENSP00000365643:R1650W;ENSP00000341086:R1651W;ENSP00000407610:R38W;ENSP00000344702:R294W|ENSP00000383087:T237M	ENSP00000341086:R1651W|ENSP00000383087:T237M	R|T	-|-	1|2	2|0	DOCK9|DOCK9	98277091|98277091	0.996000|0.996000	0.38824|0.38824	1.000000|1.000000	0.80357|0.80357	0.676000|0.676000	0.39594|0.39594	2.040000|2.040000	0.41203|0.41203	2.512000|2.512000	0.84698|0.84698	0.460000|0.460000	0.39030|0.39030	CGG|ACG		DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045566.1	NM_015296	
MCM10	55388	broad.mit.edu	37	10	13234299	13234299	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3901-01	TCGA-AG-3901-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr10:13234299C>A	ENST00000484800.2	+	12	1667	c.1564C>A	c.(1564-1566)Ctg>Atg	p.L522M	MCM10_ENST00000378694.1_Missense_Mutation_p.L521M|MCM10_ENST00000378714.3_Missense_Mutation_p.L521M			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	522					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)	p.L522M(1)		central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						GTTCAAGGAACTGATGGACCT	0.507																																					p.L521M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1561A	10						.						116.0	98.0	104.0					10																	13234299		2203	4300	6503	13274305	SO:0001583	missense	55388	exon12			AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.1564C>A	10.37:g.13234299C>A	ENSP00000418268:p.Leu522Met	Somatic		Unspecified	Illumina	Phase_I	13274305	NM_018518	A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Missense_Mutation	SNP	ENST00000484800.2	37	CCDS7096.1	.	.	.	.	.	.	.	.	.	.	C	18.84	3.710072	0.68730	.	.	ENSG00000065328	ENST00000378714;ENST00000361282;ENST00000484800;ENST00000378694	T;T;T	0.28454	1.65;1.65;1.61	5.52	-8.72	0.00845	.	0.000000	0.85682	D	0.000000	T	0.35480	0.0933	L	0.32530	0.975	0.45216	D	0.99822	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.994;0.987	T	0.62784	-0.6781	10	0.36615	T	0.2	-10.436	16.184	0.81934	0.0:0.4046:0.0:0.5954	.	521;521;522	Q5T670;Q7L590-2;Q7L590	.;.;MCM10_HUMAN	M	521;522;522;521	ENSP00000367986:L521M;ENSP00000418268:L522M;ENSP00000367966:L521M	ENSP00000354945:L522M	L	+	1	2	MCM10	13274305	0.620000	0.27068	0.163000	0.22734	0.992000	0.81027	0.014000	0.13333	-1.981000	0.00989	-0.152000	0.13540	CTG		MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356853.1	NM_182751	
PTEN	5728	broad.mit.edu	37	10	89685307	89685307	+	Missense_Mutation	SNP	T	T	A	rs398123317		TCGA-AG-3901-01	TCGA-AG-3901-01	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr10:89685307T>A	ENST00000371953.3	+	3	1559	c.202T>A	c.(202-204)Tac>Aac	p.Y68N		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	68	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.		Y -> H (in CWS1 and BRRS; loss of phosphatase activity towards Ins(1,3,4,5)P4 and PtdIns(3,4,5)P3; retains the ability to bind phospholipid membranes). {ECO:0000269|PubMed:10400993, ECO:0000269|PubMed:11494117, ECO:0000269|PubMed:9600246}.		activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.Y68H(8)|p.?(6)|p.R55fs*1(5)|p.Y68N(2)|p.Y68fs*5(2)|p.Y27fs*1(2)|p.I67_Y68insY(1)|p.V54fs*29(1)|p.R55_L70>S(1)|p.F56fs*2(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TTACAAGATATACAATCTGTA	0.274		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																											p.Y68N		yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	PTEN,haematopoietic_and_lymphoid_tissue,lymph_node,Substitution - Missense,0	.	66	Whole gene deletion(37)|Deletion - Frameshift(11)|Substitution - Missense(10)|Unknown(6)|Insertion - In frame(1)|Complex - deletion inframe(1)	prostate(16)|central_nervous_system(15)|skin(7)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|lung(5)|ovary(4)|urinary_tract(2)|breast(2)|large_intestine(1)|soft_tissue(1)|kidney(1)|pancreas(1)	c.T202A	10	GRCh37	CM061927|CM981667	PTEN	M		.						41.0	42.0	42.0					10																	89685307		2186	4275	6461	89675287	SO:0001583	missense	5728	exon3	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.202T>A	10.37:g.89685307T>A	ENSP00000361021:p.Tyr68Asn	Somatic		Unspecified	Illumina	Phase_I	89675287	NM_000314	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Missense_Mutation	SNP	ENST00000371953.3	37	CCDS31238.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.443705	0.83993	.	.	ENSG00000171862	ENST00000371953	D	0.98666	-5.06	5.46	5.46	0.80206	Phosphatase tensin type (1);	0.000000	0.85682	D	0.000000	D	0.99211	0.9726	M	0.89163	3.01	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99331	1.0909	9	.	.	.	-6.2149	15.5246	0.75894	0.0:0.0:0.0:1.0	.	68	P60484	PTEN_HUMAN	N	68	ENSP00000361021:Y68N	.	Y	+	1	0	PTEN	89675287	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.448000	0.80631	2.072000	0.62099	0.533000	0.62120	TAC		PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
TCTN3	26123	broad.mit.edu	37	10	97423975	97423975	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3901-01	TCGA-AG-3901-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr10:97423975C>G	ENST00000371217.5	-	14	1696	c.1673G>C	c.(1672-1674)gGc>gCc	p.G558A	TCTN3_ENST00000265993.9_Missense_Mutation_p.G576A|TCTN3_ENST00000430368.2_Missense_Mutation_p.G410A			Q6NUS6	TECT3_HUMAN	tectonic family member 3	558					apoptotic process (GO:0006915)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.G380A(1)|p.G558A(1)		breast(3)|endometrium(1)|large_intestine(2)|lung(8)|urinary_tract(1)	15		Colorectal(252;0.0815)		Epithelial(162;1.69e-07)|all cancers(201;5.63e-06)		TTTGGGTTGGCCCCTTGGAGG	0.458																																					p.G410A												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1229C	10						.						263.0	263.0	263.0					10																	97423975		2203	4300	6503	97413965	SO:0001583	missense	26123	exon10			AK098295	CCDS31258.2, CCDS44461.1	10q24.1	2014-01-28	2007-08-20	2007-08-20	ENSG00000119977	ENSG00000119977		"""Tectonic proteins"""	24519	protein-coding gene	gene with protein product		613847	"""chromosome 10 open reading frame 61"""	C10orf61		12975309	Standard	NM_015631		Approved	DKFZP564D116, TECT3, JBTS18	uc001klb.4	Q6NUS6	OTTHUMG00000018814	ENST00000371217.5:c.1673G>C	10.37:g.97423975C>G	ENSP00000360261:p.Gly558Ala	Somatic		Unspecified	Illumina	Phase_I	97413965	NM_001143973	A6NIC8|B0QZ90|B4DR81|Q6P7P3|Q6UW27|Q6ZQQ0|Q8N7K1|Q8NBQ0|Q96GF7|Q9Y3U1	Missense_Mutation	SNP	ENST00000371217.5	37	CCDS31258.2	.	.	.	.	.	.	.	.	.	.	C	16.07	3.018249	0.54576	.	.	ENSG00000119977	ENST00000265993;ENST00000430368;ENST00000371217;ENST00000343162	T	0.80994	-1.44	6.04	4.17	0.49024	.	0.150322	0.43919	D	0.000504	T	0.75975	0.3923	L	0.33485	1.01	0.26455	N	0.975532	D;P;P	0.63880	0.993;0.78;0.956	P;B;P	0.58331	0.837;0.265;0.78	T	0.65907	-0.6054	10	0.02654	T	1	-25.9825	8.8988	0.35481	0.0:0.8234:0.0:0.1766	.	410;558;380	B4DR81;Q6NUS6;Q6NUS6-3	.;TECT3_HUMAN;.	A	558;410;576;380	ENSP00000265993:G558A	ENSP00000265993:G558A	G	-	2	0	TCTN3	97413965	0.994000	0.37717	1.000000	0.80357	0.987000	0.75469	1.195000	0.32186	1.539000	0.49286	0.563000	0.77884	GGC		TCTN3-009	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000471858.1	NM_015631	
GFRA1	2674	broad.mit.edu	37	10	117884958	117884958	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3901-01	TCGA-AG-3901-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr10:117884958C>T	ENST00000355422.6	-	6	1094	c.544G>A	c.(544-546)Gtg>Atg	p.V182M	GFRA1_ENST00000369236.1_Missense_Mutation_p.V177M|GFRA1_ENST00000439649.3_Missense_Mutation_p.V177M|GFRA1_ENST00000544592.1_Missense_Mutation_p.V61M	NM_005264.4	NP_005255.1	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1	182					axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)|receptor binding (GO:0005102)	p.V177M(1)		endometrium(2)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(174;0.21)		all cancers(201;0.0337)		TCGTTGGACACGCTGGTGGTG	0.587																																					p.V177M	Ovarian(128;329 1725 45498 46808 50759)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G529A	10						.						79.0	65.0	70.0					10																	117884958		2203	4300	6503	117874948	SO:0001583	missense	2674	exon5			AF038421	CCDS7593.1, CCDS44481.1	10q25-q26	2011-01-25			ENSG00000151892	ENSG00000151892			4243	protein-coding gene	gene with protein product		601496		GDNFRA		9465905, 9545641	Standard	NM_005264		Approved	RETL1, GDNFR, GFR-ALPHA-1, RET1L, TRNR1	uc001lcj.3	P56159	OTTHUMG00000019097	ENST00000355422.6:c.544G>A	10.37:g.117884958C>T	ENSP00000347591:p.Val182Met	Somatic		Unspecified	Illumina	Phase_I	117874948	NM_001145453	A8KA21|O15507|O43912	Missense_Mutation	SNP	ENST00000355422.6	37	CCDS44481.1	.	.	.	.	.	.	.	.	.	.	C	5.955	0.360260	0.11296	.	.	ENSG00000151892	ENST00000439649;ENST00000369236;ENST00000355422;ENST00000544592;ENST00000369234	T;T	0.63255	-0.03;-0.03	5.74	3.29	0.37713	GDNF/GAS1 (2);	0.304234	0.40908	N	0.000986	T	0.44664	0.1304	L	0.28740	0.885	0.29512	N	0.854152	B;B	0.24533	0.105;0.068	B;B	0.21151	0.033;0.014	T	0.35425	-0.9789	10	0.30854	T	0.27	-17.6791	7.414	0.27034	0.0:0.147:0.1323:0.7207	.	182;177	P56159;P56159-2	GFRA1_HUMAN;.	M	182;177;177;61;177	ENSP00000358239:V177M;ENSP00000442179:V61M	ENSP00000347591:V177M	V	-	1	0	GFRA1	117874948	1.000000	0.71417	1.000000	0.80357	0.222000	0.24845	1.370000	0.34238	1.020000	0.39573	-0.367000	0.07326	GTG		GFRA1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050512.2	NM_145793	
NIPBL	25836	broad.mit.edu	37	5	37044545	37044545	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3901-01	TCGA-AG-3901-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3901-01	TCGA-AG-3901-01	g.chr5:37044545A>G	ENST00000282516.8	+	35	6704	c.6205A>G	c.(6205-6207)Att>Gtt	p.I2069V	NIPBL_ENST00000448238.2_Missense_Mutation_p.I2069V	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	2069					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)	p.I2069V(2)		autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TCTTGCCACTATTGAGGAAGA	0.348																																					p.I2069V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A6205G	5						.						90.0	88.0	89.0					5																	37044545		2203	4300	6503	37080302	SO:0001583	missense	25836	exon35			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.6205A>G	5.37:g.37044545A>G	ENSP00000282516:p.Ile2069Val	Somatic		Unspecified	Illumina	Phase_I	37080302	NM_015384	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	ENST00000282516.8	37	CCDS3920.1	.	.	.	.	.	.	.	.	.	.	A	16.37	3.103020	0.56183	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	T;T	0.66815	-0.23;-0.23	5.58	5.58	0.84498	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.51109	0.1655	N	0.14661	0.345	0.54753	D	0.999984	B;B	0.17852	0.014;0.024	B;B	0.20384	0.013;0.029	T	0.45614	-0.9249	10	0.28530	T	0.3	-12.0682	15.4716	0.75443	1.0:0.0:0.0:0.0	.	2069;2069	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	V	2069	ENSP00000282516:I2069V;ENSP00000406266:I2069V	ENSP00000282516:I2069V	I	+	1	0	NIPBL	37080302	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.958000	0.93099	2.124000	0.65301	0.477000	0.44152	ATT		NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	
