#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SH3TC1	54436	broad.mit.edu	37	4	8229684	8229685	+	Frame_Shift_Ins	INS	-	-	C	rs528908265|rs139040622	byFrequency	TCGA-AG-4015-01	TCGA-AG-4015-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr4:8229684_8229685insC	ENST00000245105.3	+	12	2330_2331	c.2263_2264insC	c.(2263-2265)gccfs	p.A755fs	SH3TC1_ENST00000539824.1_Frame_Shift_Ins_p.A679fs	NM_018986.3	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	755										NS(1)|breast(3)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33						GCTCCAGAACGCCCCCCAGCCC	0.703																																					p.A755fs	NSCLC(145;2298 2623 35616 37297)											.	.	0			c.2263_2264insC	4						.																																			8280585	SO:0001589	frameshift_variant	54436	exon12			AK074093	CCDS3399.1	4p16.1	2013-01-11			ENSG00000125089	ENSG00000125089		"""Tetratricopeptide (TTC) repeat domain containing"""	26009	protein-coding gene	gene with protein product							Standard	NM_018986		Approved	FLJ20356	uc003gkv.4	Q8TE82	OTTHUMG00000160934	ENST00000245105.3:c.2269dupC	4.37:g.8229690_8229690dupC	ENSP00000245105:p.Ala755fs	Somatic		Unspecified	Illumina	Phase_I	8280584	NM_018986	Q4W5G5	Frame_Shift_Ins	INS	ENST00000245105.3	37	CCDS3399.1																																																																																				SH3TC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206991.2	NM_018986	
ARL6IP6	151188	broad.mit.edu	37	2	153573896	153573897	+	5'Flank	INS	-	-	C			TCGA-AG-4015-01	TCGA-AG-4015-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr2:153573896_153573897insC	ENST00000326446.5	+	0	0				PRPF40A_ENST00000410080.1_Frame_Shift_Ins_p.T20fs|PRPF40A_ENST00000486100.1_5'UTR	NM_152522.5	NP_689735.1	Q8N6S5	AR6P6_HUMAN	ADP-ribosylation factor-like 6 interacting protein 6							integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|lung(2)|pancreas(1)	5						TCAGCTCCCGTCCCCGGCCTCA	0.653																																					p.T20fs												.	.	0			c.58_59insG	2						.																																			153282143	SO:0001631	upstream_gene_variant	55660	exon1			AK023109	CCDS2197.1	2q23	2014-05-12	2014-05-12		ENSG00000177917	ENSG00000177917			24048	protein-coding gene	gene with protein product							Standard	NM_152522		Approved	MGC33864	uc002tyn.3	Q8N6S5	OTTHUMG00000131901		2.37:g.153573900_153573900dupC	Exception_encountered	Somatic		Unspecified	Illumina	Phase_I	153282142	NM_017892	B2RDS6|Q7Z4G7	Frame_Shift_Ins	INS	ENST00000326446.5	37	CCDS2197.1																																																																																				ARL6IP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254852.3	NM_152522	
KBTBD2	25948	broad.mit.edu	37	7	32909120	32909120	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr7:32909120C>T	ENST00000304056.4	-	4	2408	c.1709G>A	c.(1708-1710)cGt>cAt	p.R570H	AVL9_ENST00000404479.1_Intron|KBTBD2_ENST00000485611.1_5'Flank	NM_015483.2	NP_056298.2	Q8IY47	KBTB2_HUMAN	kelch repeat and BTB (POZ) domain containing 2	570								p.R570H(1)		endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|urinary_tract(1)	17			GBM - Glioblastoma multiforme(11;0.0499)			CCACAGTACACGTTCAGATAT	0.463																																					p.R570H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1709A	7						.						142.0	132.0	135.0					7																	32909120		2203	4300	6503	32875645	SO:0001583	missense	25948	exon4			AB040922	CCDS34614.1	7p14.3	2013-01-08	2003-12-12	2003-12-12	ENSG00000170852	ENSG00000170852		"""BTB/POZ domain containing"""	21751	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 1"""	BKLHD1		10819331	Standard	NM_015483		Approved	DKFZP566C134	uc003tdb.2	Q8IY47	OTTHUMG00000152984	ENST00000304056.4:c.1709G>A	7.37:g.32909120C>T	ENSP00000302586:p.Arg570His	Somatic		Unspecified	Illumina	Phase_I	32875645	NM_015483	A8K9T7|Q86Y62|Q9P239|Q9UFM7|Q9Y382	Missense_Mutation	SNP	ENST00000304056.4	37	CCDS34614.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.971935	0.74246	.	.	ENSG00000170852	ENST00000304056	T	0.66815	-0.23	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.75657	0.3879	L	0.34521	1.04	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	T	0.77970	-0.2387	10	0.87932	D	0	.	19.4306	0.94762	0.0:1.0:0.0:0.0	.	570	Q8IY47	KBTB2_HUMAN	H	570	ENSP00000302586:R570H	ENSP00000302586:R570H	R	-	2	0	KBTBD2	32875645	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.610000	0.88304	0.591000	0.81541	CGT		KBTBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328890.1	XM_291224	
PILRB	29990	broad.mit.edu	37	7	99956630	99956630	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4015-01	TCGA-AG-4015-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr7:99956630G>A	ENST00000452089.1	+	7	1441	c.382G>A	c.(382-384)Gag>Aag	p.E128K	PILRB_ENST00000444073.1_Missense_Mutation_p.E128K|PILRB_ENST00000448382.1_Missense_Mutation_p.R180Q|PILRB_ENST00000610247.1_Missense_Mutation_p.E128K|PILRB_ENST00000609309.1_Missense_Mutation_p.E128K|STAG3L5P-PVRIG2P-PILRB_ENST00000310771.4_RNA			Q9UKJ0	PILRB_HUMAN	paired immunoglobin-like type 2 receptor beta	128	Ig-like V-type.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)		p.E128K(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CTGCCGAGTCGAGCTGGACAC	0.587																																					p.E128K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G382A	7						.						85.0	87.0	87.0					7																	99956630		2203	4300	6503	99794566	SO:0001583	missense	29990	exon2			AF161081, AJ400845	CCDS43622.1	7q22.1	2014-05-16			ENSG00000121716	ENSG00000121716		"""Immunoglobulin superfamily / V-set domain containing"""	18297	protein-coding gene	gene with protein product		605342				10660620	Standard	NM_178238		Approved	FDFACT1, FDFACT2	uc022ail.1	Q9UKJ0	OTTHUMG00000155363	ENST00000452089.1:c.382G>A	7.37:g.99956630G>A	ENSP00000391748:p.Glu128Lys	Somatic		Unspecified	Illumina	Phase_I	99794566	NM_178238	Q69YF9|Q9HBS0	Missense_Mutation	SNP	ENST00000452089.1	37	CCDS43622.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.021|2.021	-0.424737|-0.424737	0.04734|0.04734	.|.	.|.	ENSG00000121716|ENSG00000121716	ENST00000310771;ENST00000420688;ENST00000452089;ENST00000444073;ENST00000413850|ENST00000444874;ENST00000448382;ENST00000431140	T;T;T|.	0.64618|.	-0.11;-0.11;-0.11|.	2.76|2.76	-4.32|-4.32	0.03688|0.03688	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	3.377880|.	0.00628|.	N|.	0.000462|.	T|T	0.15305|0.15305	0.0369|0.0369	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	P|B	0.51240|0.24576	0.943|0.106	B|B	0.42422|0.18263	0.387|0.021	T|T	0.22103|0.22103	-1.0226|-1.0226	9|7	.|.	.|.	.|.	.|.	1.1418|1.1418	0.01767|0.01767	0.1573:0.2096:0.3736:0.2596|0.1573:0.2096:0.3736:0.2596	.|.	128|58	Q9UKJ0|Q9UKJ0-2	PILRB_HUMAN|.	K|Q	128;128;128;128;233|58;180;58	ENSP00000311153:E128K;ENSP00000391748:E128K;ENSP00000410764:E128K|.	.|.	E|R	+|+	1|2	0|0	PILRB|PILRB	99794566|99794566	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-0.535000|-0.535000	0.06142|0.06142	-0.906000|-0.906000	0.03866|0.03866	-1.238000|-1.238000	0.01547|0.01547	GAG|CGA		PILRB-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339923.2	NM_178238	
PARP12	64761	broad.mit.edu	37	7	139754515	139754515	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-4015-01	TCGA-AG-4015-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr7:139754515T>A	ENST00000263549.3	-	4	1682	c.809A>T	c.(808-810)gAg>gTg	p.E270V		NM_022750.2	NP_073587.1	Q9H0J9	PAR12_HUMAN	poly (ADP-ribose) polymerase family, member 12	270						nucleus (GO:0005634)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)	p.E270V(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	19	Melanoma(164;0.0142)					ATCACCCTCCTCCTGGCTAAG	0.443																																					p.E270V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A809T	7						.						148.0	129.0	136.0					7																	139754515		2203	4300	6503	139400984	SO:0001583	missense	64761	exon4			AL136766	CCDS5857.1	7q34	2014-01-28	2005-06-02	2005-06-02	ENSG00000059378	ENSG00000059378		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	21919	protein-coding gene	gene with protein product		612481	"""zinc finger CCCH-type domain containing 1"""	ZC3HDC1		11230166, 12851707	Standard	NM_022750		Approved	FLJ22693, PARP-12, ZC3H1	uc003vvl.1	Q9H0J9	OTTHUMG00000157315	ENST00000263549.3:c.809A>T	7.37:g.139754515T>A	ENSP00000263549:p.Glu270Val	Somatic		Unspecified	Illumina	Phase_I	139400984	NM_022750	Q9H610|Q9NP36|Q9NTI3	Missense_Mutation	SNP	ENST00000263549.3	37	CCDS5857.1	.	.	.	.	.	.	.	.	.	.	T	17.29	3.351706	0.61183	.	.	ENSG00000059378	ENST00000263549;ENST00000489809	T;T	0.49432	3.16;0.78	5.65	5.65	0.86999	Zinc finger, CCCH-type (2);	0.402745	0.26704	N	0.022922	T	0.44705	0.1306	M	0.62723	1.935	0.37412	D	0.913265	P	0.38078	0.617	B	0.32533	0.147	T	0.55927	-0.8063	10	0.49607	T	0.09	.	14.1166	0.65159	0.0:0.0:0.0:1.0	.	270	Q9H0J9	PAR12_HUMAN	V	270;62	ENSP00000263549:E270V;ENSP00000417606:E62V	ENSP00000263549:E270V	E	-	2	0	PARP12	139400984	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.674000	0.46867	2.157000	0.67596	0.523000	0.50628	GAG		PARP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348413.1	NM_022750	
TM9SF4	9777	broad.mit.edu	37	20	30753230	30753230	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4015-01	TCGA-AG-4015-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr20:30753230G>A	ENST00000398022.2	+	18	2147	c.1912G>A	c.(1912-1914)Gct>Act	p.A638T	TM9SF4_ENST00000217315.5_Missense_Mutation_p.A621T	NM_014742.3	NP_055557.2	Q92544	TM9S4_HUMAN	transmembrane 9 superfamily protein member 4	638						integral component of membrane (GO:0016021)		p.A621T(1)		central_nervous_system(2)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			GATCTATGCTGCTGTGAAGAT	0.542																																					p.A638T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1912A	20						.						164.0	130.0	141.0					20																	30753230		2203	4300	6503	30216891	SO:0001583	missense	9777	exon18			BC021107	CCDS13196.2	20q11.21	2004-04-19			ENSG00000101337	ENSG00000101337			30797	protein-coding gene	gene with protein product						9039502	Standard	NM_014742		Approved	KIAA0255, dJ836N17.2	uc002wxj.2	Q92544	OTTHUMG00000032206	ENST00000398022.2:c.1912G>A	20.37:g.30753230G>A	ENSP00000381104:p.Ala638Thr	Somatic		Unspecified	Illumina	Phase_I	30216891	NM_014742	B0QYT7|Q9NUA3	Missense_Mutation	SNP	ENST00000398022.2	37	CCDS13196.2	.	.	.	.	.	.	.	.	.	.	G	33	5.221940	0.95139	.	.	ENSG00000101337	ENST00000398022;ENST00000217315	T;T	0.44881	1.49;0.91	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.55065	0.1897	L	0.52573	1.65	0.80722	D	1	P;D	0.64830	0.633;0.994	B;P	0.58210	0.15;0.835	T	0.53753	-0.8394	10	0.45353	T	0.12	-9.3997	18.3035	0.90172	0.0:0.0:1.0:0.0	.	545;638	B4DH88;Q92544	.;TM9S4_HUMAN	T	638;621	ENSP00000381104:A638T;ENSP00000217315:A621T	ENSP00000217315:A621T	A	+	1	0	TM9SF4	30216891	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.542000	0.73869	2.556000	0.86216	0.561000	0.74099	GCT		TM9SF4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323568.1	NM_014742	
SGK2	10110	broad.mit.edu	37	20	42204996	42204996	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr20:42204996C>T	ENST00000341458.4	+	10	1225	c.1006C>T	c.(1006-1008)Cgg>Tgg	p.R336W	SGK2_ENST00000426287.1_Missense_Mutation_p.R302W|SGK2_ENST00000373077.1_Missense_Mutation_p.R275W|SGK2_ENST00000373100.1_Missense_Mutation_p.R276W|SGK2_ENST00000373092.3_Missense_Mutation_p.R276W|SGK2_ENST00000423407.3_Missense_Mutation_p.R276W	NM_016276.3	NP_057360.2	Q9HBY8	SGK2_HUMAN	serum/glucocorticoid regulated kinase 2	336	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|ion transmembrane transport (GO:0034220)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|response to oxidative stress (GO:0006979)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|sodium channel regulator activity (GO:0017080)	p.R336W(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			CCAGAGGCAGCGGCTGGGCTC	0.602																																					p.R276W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C826T	20						.						39.0	41.0	41.0					20																	42204996		2203	4300	6503	41638410	SO:0001583	missense	10110	exon11			AF169034	CCDS13320.1, CCDS13321.1	20q13.2	2008-07-04			ENSG00000101049	ENSG00000101049			13900	protein-coding gene	gene with protein product		607589				10548550	Standard	NM_016276		Approved		uc002xkv.3	Q9HBY8	OTTHUMG00000033054	ENST00000341458.4:c.1006C>T	20.37:g.42204996C>T	ENSP00000340608:p.Arg336Trp	Somatic		Unspecified	Illumina	Phase_I	41638410	NM_170693	Q52PK5|Q5H8Y6|Q5H8Z1|Q5TZR3|Q9UKG6	Missense_Mutation	SNP	ENST00000341458.4	37	CCDS13320.1	.	.	.	.	.	.	.	.	.	.	C	18.21	3.573509	0.65765	.	.	ENSG00000101049	ENST00000373100;ENST00000373092;ENST00000373077;ENST00000423407;ENST00000341458;ENST00000426287	T;T;T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62;-0.62;-0.62	4.65	-0.0418	0.13866	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.050719	0.85682	N	0.000000	D	0.88276	0.6393	H	0.99169	4.455	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.86256	0.1652	10	0.87932	D	0	.	7.7095	0.28669	0.4735:0.4443:0.0:0.0822	.	302;336;276	Q9HBY8-3;Q9HBY8;Q9HBY8-2	.;SGK2_HUMAN;.	W	276;276;275;276;336;302	ENSP00000362192:R276W;ENSP00000362184:R276W;ENSP00000362168:R275W;ENSP00000392795:R276W;ENSP00000340608:R336W;ENSP00000412214:R302W	ENSP00000340608:R336W	R	+	1	2	SGK2	41638410	0.847000	0.29606	1.000000	0.80357	0.725000	0.41563	-0.078000	0.11375	0.214000	0.20742	0.655000	0.94253	CGG		SGK2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080383.1		
PREX1	57580	broad.mit.edu	37	20	47267958	47267958	+	Silent	SNP	G	G	A	rs143006779	byFrequency	TCGA-AG-4015-01	TCGA-AG-4015-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr20:47267958G>A	ENST00000371941.3	-	22	2653	c.2631C>T	c.(2629-2631)cgC>cgT	p.R877R	PREX1_ENST00000396220.1_Silent_p.R877R	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	877					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R877R(2)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			CGAAGCAGCCGCGGGGCTCCA	0.602													G|||	2	0.000399361	0.0015	0.0	5008	,	,		20278	0.0		0.0	False		,,,				2504	0.0				p.R877R												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C2631T	20						.	G		5,4401	9.9+/-24.2	0,5,2198	49.0	42.0	44.0		2631	-9.4	0.6	20	dbSNP_134	44	0,8600		0,0,4300	no	coding-synonymous	PREX1	NM_020820.3		0,5,6498	AA,AG,GG		0.0,0.1135,0.0384		877/1660	47267958	5,13001	2203	4300	6503	46701365	SO:0001819	synonymous_variant	57580	exon22			AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.2631C>T	20.37:g.47267958G>A		Somatic		Unspecified	Illumina	Phase_I	46701365	NM_020820	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Silent	SNP	ENST00000371941.3	37	CCDS13410.1																																																																																				PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
DOK5	55816	broad.mit.edu	37	20	53208302	53208302	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4015-01	TCGA-AG-4015-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr20:53208302G>A	ENST00000262593.5	+	5	907	c.557G>A	c.(556-558)cGg>cAg	p.R186Q	DOK5_ENST00000395939.1_Missense_Mutation_p.R78Q	NM_018431.3	NP_060901.2	Q9P104	DOK5_HUMAN	docking protein 5	186	IRS-type PTB. {ECO:0000255|PROSITE- ProRule:PRU00389}.				MAPK cascade (GO:0000165)|nervous system development (GO:0007399)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)		receptor signaling protein activity (GO:0005057)	p.R186Q(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|skin(1)	19			Colorectal(105;0.202)			GCCCTGCGGCGGTATGGACGT	0.453																																					p.R186Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G557A	20						.						128.0	115.0	119.0					20																	53208302		2203	4300	6503	52641709	SO:0001583	missense	55816	exon5			AF132732	CCDS13446.1, CCDS13447.1	20q13.2	2013-01-10	2002-11-28	2002-11-29	ENSG00000101134	ENSG00000101134		"""Pleckstrin homology (PH) domain containing"""	16173	protein-coding gene	gene with protein product		608334	"""chromosome 20 open reading frame 180"""	C20orf180		11470823	Standard	XM_005260451		Approved	dJ805C22.1	uc002xwy.3	Q9P104	OTTHUMG00000032778	ENST00000262593.5:c.557G>A	20.37:g.53208302G>A	ENSP00000262593:p.Arg186Gln	Somatic		Unspecified	Illumina	Phase_I	52641709	NM_018431	Q5T7Y0|Q5TE53|Q8TEW7|Q96H13|Q9BZ24|Q9NQF4|Q9Y411	Missense_Mutation	SNP	ENST00000262593.5	37	CCDS13446.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.650920	0.87958	.	.	ENSG00000101134	ENST00000262593;ENST00000395939	T;T	0.80653	-1.4;-1.4	5.66	5.66	0.87406	Pleckstrin homology-type (1);Insulin receptor substrate-1, PTB (3);	0.000000	0.85682	D	0.000000	D	0.90899	0.7140	M	0.90082	3.085	0.54753	D	0.999987	D;D	0.67145	0.996;0.996	B;P	0.61722	0.428;0.893	D	0.92419	0.5944	10	0.87932	D	0	-8.162	18.3134	0.90208	0.0:0.0:1.0:0.0	.	78;186	Q9P104-2;Q9P104	.;DOK5_HUMAN	Q	186;78	ENSP00000262593:R186Q;ENSP00000379270:R78Q	ENSP00000262593:R186Q	R	+	2	0	DOK5	52641709	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.795000	0.99099	2.668000	0.90789	0.650000	0.86243	CGG		DOK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079777.2		
MYT1	4661	broad.mit.edu	37	20	62848458	62848458	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-4015-01	TCGA-AG-4015-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr20:62848458A>T	ENST00000328439.1	+	11	2034	c.1670A>T	c.(1669-1671)tAt>tTt	p.Y557F	MYT1_ENST00000360149.4_Missense_Mutation_p.Y259F|MYT1_ENST00000536311.1_Missense_Mutation_p.Y557F	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.Y557F(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					GTCCCTCCATATGGGAGCTAC	0.617																																					p.Y557F	GBM(59;481 1041 20555 21139 33705)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1670T	20						.						78.0	72.0	74.0					20																	62848458		2203	4300	6503	62318902	SO:0001583	missense	4661	exon11			M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.1670A>T	20.37:g.62848458A>T	ENSP00000327465:p.Tyr557Phe	Somatic		Unspecified	Illumina	Phase_I	62318902	NM_004535	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	ENST00000328439.1	37	CCDS13558.1	.	.	.	.	.	.	.	.	.	.	A	14.31	2.496381	0.44352	.	.	ENSG00000196132	ENST00000360149;ENST00000328439;ENST00000536311	T;T;T	0.48836	0.88;0.8;0.8	5.67	4.55	0.56014	.	0.063541	0.64402	N	0.000004	T	0.61148	0.2324	L	0.55481	1.735	0.47245	D	0.999361	D;B;D	0.76494	0.999;0.223;0.997	D;B;D	0.75020	0.958;0.235;0.985	T	0.58978	-0.7540	10	0.41790	T	0.15	-11.1292	11.9489	0.52944	0.8698:0.0:0.0:0.1302	.	557;557;259	F5H7M8;Q01538;Q6P6D5	.;MYT1_HUMAN;.	F	259;557;557	ENSP00000353269:Y259F;ENSP00000327465:Y557F;ENSP00000442412:Y557F	ENSP00000327465:Y557F	Y	+	2	0	MYT1	62318902	1.000000	0.71417	0.778000	0.31720	0.980000	0.70556	6.032000	0.70918	0.945000	0.37605	0.533000	0.62120	TAT		MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080297.1	NM_004535	
MYO18B	84700	broad.mit.edu	37	22	26422994	26422994	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4015-01	TCGA-AG-4015-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr22:26422994G>A	ENST00000407587.2	+	43	7226	c.7057G>A	c.(7057-7059)Gag>Aag	p.E2353K	MYO18B_ENST00000335473.7_Missense_Mutation_p.E2352K|MYO18B_ENST00000536101.1_Missense_Mutation_p.E2352K			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2352						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.E2353K(1)		NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CAGTTCCTGCGAGTCCCTCTT	0.567																																					p.E2352K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G7054A	22						.						81.0	90.0	87.0					22																	26422994		1935	4140	6075	24752994	SO:0001583	missense	84700	exon43			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.7057G>A	22.37:g.26422994G>A	ENSP00000386096:p.Glu2353Lys	Somatic		Unspecified	Illumina	Phase_I	24752994	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37		.	.	.	.	.	.	.	.	.	.	G	25.3	4.621415	0.87460	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.89050	-2.44;-2.44;-2.46	4.89	4.89	0.63831	.	0.194001	0.31257	N	0.007962	D	0.92861	0.7729	L	0.60455	1.87	0.35534	D	0.802536	D;D;D;D;D	0.89917	1.0;0.999;0.999;1.0;1.0	P;D;D;D;D	0.68765	0.9;0.912;0.912;0.96;0.96	D	0.95646	0.8702	10	0.66056	D	0.02	.	16.609	0.84838	0.0:0.0:1.0:0.0	.	1865;2354;2352;2353;2352	Q8IUG5-2;B0QYF5;Q8IUG5;F5GXR6;F5GYU7	.;.;MY18B_HUMAN;.;.	K	2352;2352;2353	ENSP00000441229:E2352K;ENSP00000334563:E2352K;ENSP00000386096:E2353K	ENSP00000334563:E2352K	E	+	1	0	MYO18B	24752994	1.000000	0.71417	0.985000	0.45067	0.823000	0.46562	4.943000	0.63554	2.246000	0.74042	0.462000	0.41574	GAG		MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
SEC14L3	266629	broad.mit.edu	37	22	30866514	30866514	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-4015-01	TCGA-AG-4015-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr22:30866514A>T	ENST00000215812.4	-	2	200	c.110T>A	c.(109-111)tTc>tAc	p.F37Y	SEC14L3_ENST00000415957.2_5'UTR|SEC14L3_ENST00000401751.1_5'UTR|SEC14L3_ENST00000540910.1_5'UTR|SEC14L3_ENST00000403066.1_5'UTR|SEC14L3_ENST00000539629.1_5'UTR|SEC14L3_ENST00000402286.1_5'UTR	NM_174975.4	NP_777635.1	Q9UDX4	S14L3_HUMAN	SEC14-like 3 (S. cerevisiae)	37						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)	p.F37Y(1)		NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(3)|pancreas(1)|skin(2)|urinary_tract(1)	19					Vitamin E(DB00163)	GCGTAGAAGGAAATAATCATC	0.562																																					p.F37Y	Esophageal Squamous(108;290 1516 3584 23771 37333)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T110A	22						.						128.0	109.0	115.0					22																	30866514		2203	4300	6503	29196514	SO:0001583	missense	266629	exon2			AY158086	CCDS13877.1, CCDS58800.1, CCDS58801.1	22q12.2	2013-09-23			ENSG00000100012	ENSG00000100012			18655	protein-coding gene	gene with protein product		612824					Standard	NM_174975		Approved	TAP2	uc003ahy.3	Q9UDX4	OTTHUMG00000151259	ENST00000215812.4:c.110T>A	22.37:g.30866514A>T	ENSP00000215812:p.Phe37Tyr	Somatic		Unspecified	Illumina	Phase_I	29196514	NM_174975	E7EN74|E9PE57|Q495V8|Q495W0|Q495W1	Missense_Mutation	SNP	ENST00000215812.4	37	CCDS13877.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.36|12.36	1.913549|1.913549	0.33815|0.33815	.|.	.|.	ENSG00000100012|ENSG00000100012	ENST00000435069|ENST00000215812	.|D	.|0.86562	.|-2.14	5.39|5.39	5.39|5.39	0.77823|0.77823	.|Phosphatidylinositol transfer protein-like, N-terminal (1);Cellular retinaldehyde-binding/triple function, N-terminal (1);	0.052433|0.052433	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.79375|0.79375	0.4435|0.4435	L|L	0.31476|0.31476	0.935|0.935	0.80722|0.80722	D|D	1|1	.|B	.|0.17268	.|0.021	.|B	.|0.28139	.|0.086	T|T	0.71659|0.71659	-0.4526|-0.4526	6|10	.|0.13853	.|T	.|0.58	-20.1348|-20.1348	10.1841|10.1841	0.42986|0.42986	0.8508:0.0:0.0:0.1492|0.8508:0.0:0.0:0.1492	.|.	.|37	.|Q9UDX4	.|S14L3_HUMAN	L|Y	17|37	.|ENSP00000215812:F37Y	.|ENSP00000215812:F37Y	F|F	-|-	3|2	2|0	SEC14L3|SEC14L3	29196514|29196514	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.886000|0.886000	0.51366|0.51366	1.269000|1.269000	0.33074|0.33074	2.027000|2.027000	0.59764|0.59764	0.528000|0.528000	0.53228|0.53228	TTT|TTC		SEC14L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321950.4	NM_174975	
LILRB1	10859	broad.mit.edu	37	19	55144588	55144588	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-4015-01	TCGA-AG-4015-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr19:55144588G>T	ENST00000396331.1	+	8	1437	c.1080G>T	c.(1078-1080)gaG>gaT	p.E360D	LILRB1_ENST00000427581.2_Missense_Mutation_p.E396D|LILRB1_ENST00000396315.1_Missense_Mutation_p.E360D|LILRB1_ENST00000418536.2_Missense_Mutation_p.E360D|LILRB1_ENST00000434867.2_Missense_Mutation_p.E360D|LILRB1_ENST00000396332.4_Missense_Mutation_p.E360D|LILRB1_ENST00000448689.1_Missense_Mutation_p.E360D|LILRB1_ENST00000396327.3_Missense_Mutation_p.E360D|LILRB1_ENST00000396321.2_Missense_Mutation_p.E360D|LILRB1_ENST00000324602.7_Missense_Mutation_p.E360D|LILRB1_ENST00000396317.1_Missense_Mutation_p.E360D	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	360	Ig-like C2-type 4.				cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)	p.E360D(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		TGACCAAGGAGGGGGCAGCTG	0.582										HNSCC(37;0.09)																											p.E360D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1080T	19						.						103.0	112.0	109.0					19																	55144588		2203	4300	6503	59836400	SO:0001583	missense	10859	exon7			AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.1080G>T	19.37:g.55144588G>T	ENSP00000379622:p.Glu360Asp	Somatic		Unspecified	Illumina	Phase_I	59836400	NM_001081639	A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Missense_Mutation	SNP	ENST00000396331.1	37	CCDS42617.1	.	.	.	.	.	.	.	.	.	.	g	8.251	0.808994	0.16537	.	.	ENSG00000104972	ENST00000396321;ENST00000418536;ENST00000448689;ENST00000396331;ENST00000396327;ENST00000324602;ENST00000434867;ENST00000396332;ENST00000427581;ENST00000396317;ENST00000396315	T;T;T;T;T;T;T;T;T;T;T	0.00705	5.81;5.81;5.81;5.81;5.81;5.81;5.81;5.81;5.81;5.81;5.81	2.25	-4.49	0.03504	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.785098	0.11056	N	0.604486	T	0.01421	0.0046	M	0.79343	2.45	0.09310	N	1	B;B;B;B;B	0.30068	0.137;0.008;0.267;0.016;0.004	B;B;B;B;B	0.39771	0.215;0.067;0.309;0.067;0.077	T	0.31586	-0.9938	10	0.62326	D	0.03	.	2.9992	0.06008	0.4252:0.0:0.2561:0.3187	.	360;360;360;360;360	A8MVE2;Q8NHL6-3;A2IXV4;Q8NHL6-2;Q8NHL6	.;.;.;.;LIRB1_HUMAN	D	360;360;360;360;360;360;360;360;396;360;360	ENSP00000379614:E360D;ENSP00000391514:E360D;ENSP00000409968:E360D;ENSP00000379622:E360D;ENSP00000379618:E360D;ENSP00000315997:E360D;ENSP00000405243:E360D;ENSP00000379623:E360D;ENSP00000395004:E396D;ENSP00000379610:E360D;ENSP00000379608:E360D	ENSP00000315997:E360D	E	+	3	2	LILRB1	59836400	0.005000	0.15991	0.005000	0.12908	0.000000	0.00434	-0.561000	0.05957	-1.502000	0.01814	-2.554000	0.00176	GAG		LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4		
ZNF544	27300	broad.mit.edu	37	19	58772536	58772536	+	Silent	SNP	C	C	T			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr19:58772536C>T	ENST00000596652.1	+	6	798	c.564C>T	c.(562-564)aaC>aaT	p.N188N	CTD-3138B18.5_ENST00000597230.1_RNA|ZNF544_ENST00000600220.1_Silent_p.N160N|ZNF544_ENST00000600044.1_Silent_p.N160N|ZNF544_ENST00000596929.1_Intron|CTD-3138B18.4_ENST00000600029.1_Intron|ZNF544_ENST00000415203.2_Silent_p.N160N|ZNF544_ENST00000269829.4_Silent_p.N188N|ZNF544_ENST00000599227.1_3'UTR|ZNF544_ENST00000596825.1_3'UTR|ZNF544_ENST00000595981.1_Intron|ZNF544_ENST00000599953.1_Silent_p.N46N			Q6NX49	ZN544_HUMAN	zinc finger protein 544	188					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N188N(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	18		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		CTAAGCCCAACTCACAAGTTA	0.403																																					p.N188N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C564T	19						.						67.0	62.0	64.0					19																	58772536		2203	4300	6503	63464348	SO:0001819	synonymous_variant	27300	exon7			AF020591	CCDS12973.1	19q13.43	2013-01-08				ENSG00000198131		"""Zinc fingers, C2H2-type"", ""-"""	16759	protein-coding gene	gene with protein product	"""zinc finger protein AF020591"""						Standard	NM_014480		Approved	AF020591	uc010euo.3	Q6NX49		ENST00000596652.1:c.564C>T	19.37:g.58772536C>T		Somatic		Unspecified	Illumina	Phase_I	63464348	NM_014480	A8K6J1|Q9UEX4	Silent	SNP	ENST00000596652.1	37	CCDS12973.1																																																																																				ZNF544-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466754.1	NM_014480	
RP1L1	94137	broad.mit.edu	37	8	10470749	10470749	+	Missense_Mutation	SNP	G	G	A	rs374360526		TCGA-AG-4015-01	TCGA-AG-4015-01	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr8:10470749G>A	ENST00000382483.3	-	4	1082	c.859C>T	c.(859-861)Cct>Tct	p.P287S		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	287					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CCAGGAGCAGGGCCCACCGGG	0.662																																					p.P287S												.	.	0			c.C859T	8						.						59.0	65.0	63.0					8																	10470749		1962	4139	6101	10508159	SO:0001583	missense	94137	exon4			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.859C>T	8.37:g.10470749G>A	ENSP00000371923:p.Pro287Ser	None		Unspecified	Illumina	Phase_I	10508159	NM_178857	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	G	16.07	3.018707	0.54576	.	.	ENSG00000183638	ENST00000382483	T	0.04917	3.53	4.92	2.08	0.27032	.	0.524577	0.14375	N	0.323503	T	0.12774	0.0310	L	0.38838	1.175	0.09310	N	1	D	0.76494	0.999	D	0.66716	0.946	T	0.14392	-1.0474	10	0.51188	T	0.08	-0.113	7.6102	0.28126	0.1345:0.1403:0.7252:0.0	.	287	A6NKC6	.	S	287	ENSP00000371923:P287S	ENSP00000371923:P287S	P	-	1	0	RP1L1	10508159	0.000000	0.05858	0.026000	0.17262	0.020000	0.10135	0.368000	0.20399	0.119000	0.18210	0.591000	0.81541	CCT		RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
CSMD3	114788	broad.mit.edu	37	8	113649165	113649165	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr8:113649165C>T	ENST00000297405.5	-	22	3840	c.3596G>A	c.(3595-3597)gGg>gAg	p.G1199E	CSMD3_ENST00000455883.2_Missense_Mutation_p.G1095E|CSMD3_ENST00000352409.3_Missense_Mutation_p.G1199E|CSMD3_ENST00000343508.3_Missense_Mutation_p.G1159E	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1199	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G1199E(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GTCACCAATCCCAAAGTTGAA	0.468										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.G1199E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3596A	8						.						218.0	180.0	193.0					8																	113649165		2203	4300	6503	113718341	SO:0001583	missense	114788	exon22			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.3596G>A	8.37:g.113649165C>T	ENSP00000297405:p.Gly1199Glu	Somatic		Unspecified	Illumina	Phase_I	113718341	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	18.51	3.640091	0.67244	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.62232	0.04;0.04;0.04;0.04;0.04	5.56	5.56	0.83823	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	T	0.64907	0.2641	N	0.13140	0.3	0.40241	D	0.97796	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.97110	1.0;1.0;0.984	T	0.60239	-0.7302	10	0.12430	T	0.62	.	19.5386	0.95266	0.0:1.0:0.0:0.0	.	1095;1199;1159	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	E	1159;1199;539;1095;1199	ENSP00000345799:G1159E;ENSP00000297405:G1199E;ENSP00000341558:G539E;ENSP00000412263:G1095E;ENSP00000343124:G1199E	ENSP00000297405:G1199E	G	-	2	0	CSMD3	113718341	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	4.973000	0.63763	2.610000	0.88304	0.650000	0.86243	GGG		CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
TRPS1	7227	broad.mit.edu	37	8	116616108	116616108	+	Silent	SNP	T	T	G	rs559562389		TCGA-AG-4015-01	TCGA-AG-4015-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr8:116616108T>G	ENST00000220888.5	-	3	2208	c.2049A>C	c.(2047-2049)cgA>cgC	p.R683R	TRPS1_ENST00000520276.1_Silent_p.R687R|TRPS1_ENST00000395715.3_Silent_p.R696R|TRPS1_ENST00000519076.1_Silent_p.R437R|TRPS1_ENST00000519674.1_Silent_p.R683R			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	683	Mediates interaction with GLI3.				chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R683R(1)		autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			ACCTGTAGTGTCGGGAAATCT	0.448									Langer-Giedion syndrome				T|||	1	0.000199681	0.0	0.0	5008	,	,		17550	0.0		0.0	False		,,,				2504	0.001				p.R696R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2088C	8						.						71.0	66.0	68.0					8																	116616108		1859	4094	5953	116685283	SO:0001819	synonymous_variant	7227	exon4	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.2049A>C	8.37:g.116616108T>G		Somatic		Unspecified	Illumina	Phase_I	116685283	NM_014112	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Silent	SNP	ENST00000220888.5	37																																																																																					TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	
DLGAP2	9228	broad.mit.edu	37	8	1626540	1626540	+	Missense_Mutation	SNP	G	G	A	rs377276862		TCGA-AG-4015-01	TCGA-AG-4015-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr8:1626540G>A	ENST00000421627.2	+	9	2343	c.2209G>A	c.(2209-2211)Gcg>Acg	p.A737T	DLGAP2_ENST00000524065.1_3'UTR	NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	816					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)		p.A745T(1)		breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		CCAGTACAGCGCGGTGAGAAC	0.632																																					p.A737T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2209A	8						.	G	THR/ALA	2,4026		0,2,2012	45.0	53.0	51.0		2209	5.3	0.5	8		51	0,8338		0,0,4169	no	missense	DLGAP2	NM_004745.3	58	0,2,6181	AA,AG,GG		0.0,0.0497,0.0162	possibly-damaging	737/976	1626540	2,12364	2014	4169	6183	1613947	SO:0001583	missense	9228	exon9			AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.2209G>A	8.37:g.1626540G>A	ENSP00000400258:p.Ala737Thr	Somatic		Unspecified	Illumina	Phase_I	1613947	NM_004745	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	ENST00000421627.2	37	CCDS47760.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.468291	0.84533	4.97E-4	0.0	ENSG00000198010	ENST00000356067;ENST00000421627	T	0.20069	2.1	5.32	5.32	0.75619	.	0.094982	0.64402	D	0.000001	T	0.45418	0.1341	M	0.74258	2.255	0.52501	D	0.999953	D;D	0.71674	0.997;0.998	P;D	0.63192	0.811;0.912	T	0.25222	-1.0138	10	0.29301	T	0.29	-8.3498	18.9967	0.92817	0.0:0.0:1.0:0.0	.	802;816	Q9P1A6-2;Q9P1A6	.;DLGP2_HUMAN	T	768;737	ENSP00000400258:A737T	ENSP00000348366:A768T	A	+	1	0	DLGAP2	1613947	1.000000	0.71417	0.495000	0.27527	0.512000	0.34134	7.328000	0.79160	2.475000	0.83589	0.650000	0.86243	GCG		DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745	
CSMD1	64478	broad.mit.edu	37	8	3224669	3224669	+	Silent	SNP	G	G	A			TCGA-AG-4015-01	TCGA-AG-4015-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr8:3224669G>A	ENST00000520002.1	-	21	3558	c.3003C>T	c.(3001-3003)acC>acT	p.T1001T	CSMD1_ENST00000400186.3_Silent_p.T1001T|CSMD1_ENST00000537824.1_Silent_p.T1000T|CSMD1_ENST00000602723.1_Silent_p.T1001T|CSMD1_ENST00000542608.1_Silent_p.T1000T|CSMD1_ENST00000539096.1_Silent_p.T1000T|CSMD1_ENST00000602557.1_Silent_p.T1001T			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1001	CUB 6. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)		p.T729T(1)|p.T1000T(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ACACCGACCCGGTGAGCCTGG	0.483																																					p.R1001W												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C3001T	8						.						63.0	64.0	64.0					8																	3224669		1864	4114	5978	3212076	SO:0001819	synonymous_variant	64478	exon20					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.3003C>T	8.37:g.3224669G>A		Somatic		Unspecified	Illumina	Phase_I	3212076	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	G	0.025	-1.379442	0.01204	.	.	ENSG00000183117	ENST00000335551	.	.	.	5.22	-10.4	0.00318	.	.	.	.	.	T	0.33177	0.0854	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59573	-0.7429	4	.	.	.	.	1.7777	0.03025	0.1409:0.3559:0.2116:0.2916	.	.	.	.	W	481	.	.	R	-	1	2	CSMD1	3212076	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-5.149000	0.00146	-5.432000	0.00014	-2.253000	0.00282	CGG		CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
CDH17	1015	broad.mit.edu	37	8	95142932	95142932	+	Missense_Mutation	SNP	G	G	A	rs199497492		TCGA-AG-4015-01	TCGA-AG-4015-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr8:95142932G>A	ENST00000027335.3	-	17	2444	c.2320C>T	c.(2320-2322)Cgg>Tgg	p.R774W	CDH17_ENST00000450165.2_Missense_Mutation_p.R774W|CDH17_ENST00000441892.2_Intron	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	774	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)	p.R774W(1)		NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			CCTGCTGGCCGGAAACAACTT	0.448																																					p.R774W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2320T	8						.						78.0	73.0	75.0					8																	95142932		2203	4300	6503	95212108	SO:0001583	missense	1015	exon17			X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.2320C>T	8.37:g.95142932G>A	ENSP00000027335:p.Arg774Trp	Somatic		Unspecified	Illumina	Phase_I	95212108	NM_001144663	Q15336|Q2M2E0	Missense_Mutation	SNP	ENST00000027335.3	37	CCDS6260.1	.	.	.	.	.	.	.	.	.	.	G	10.68	1.417426	0.25552	.	.	ENSG00000079112	ENST00000027335;ENST00000450165	T;T	0.58358	0.34;0.34	5.84	2.83	0.33086	Cadherin (1);	0.561125	0.16175	N	0.226091	T	0.46014	0.1371	L	0.56769	1.78	0.27273	N	0.95831	D	0.63046	0.992	B	0.40534	0.332	T	0.37549	-0.9701	10	0.37606	T	0.19	-0.1227	11.2752	0.49163	0.0:0.0:0.5163:0.4836	.	774	Q12864	CAD17_HUMAN	W	774	ENSP00000027335:R774W;ENSP00000401468:R774W	ENSP00000027335:R774W	R	-	1	2	CDH17	95212108	0.965000	0.33210	0.969000	0.41365	0.045000	0.14185	1.376000	0.34306	0.760000	0.33108	-0.282000	0.10007	CGG		CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378560.1	NM_004063	
FAM135B	51059	broad.mit.edu	37	8	139153530	139153530	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr8:139153530C>T	ENST00000395297.1	-	17	3871	c.3701G>A	c.(3700-3702)cGg>cAg	p.R1234Q		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	1234								p.R1234Q(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GAGGTAATACCGGAACCGGGG	0.527										HNSCC(54;0.14)																											p.R1234Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3701A	8						.						181.0	191.0	188.0					8																	139153530		2019	4189	6208	139222712	SO:0001583	missense	51059	exon17			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.3701G>A	8.37:g.139153530C>T	ENSP00000378710:p.Arg1234Gln	Somatic		Unspecified	Illumina	Phase_I	139222712	NM_015912	B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	37	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	C	35	5.463394	0.96257	.	.	ENSG00000147724	ENST00000395297	T	0.49139	0.79	5.83	5.83	0.93111	Domain of unknown function DUF676, lipase-like (1);	0.000000	0.85682	D	0.000000	T	0.52273	0.1724	N	0.19112	0.55	0.50632	D	0.999882	D	0.89917	1.0	D	0.75020	0.985	T	0.53802	-0.8387	10	0.54805	T	0.06	-19.2025	12.4236	0.55534	0.0:0.9238:0.0:0.0762	.	1234	Q49AJ0	F135B_HUMAN	Q	1234	ENSP00000378710:R1234Q	ENSP00000378710:R1234Q	R	-	2	0	FAM135B	139222712	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.892000	0.63193	2.750000	0.94351	0.655000	0.94253	CGG		FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912	
AMY2A	279	broad.mit.edu	37	1	104160213	104160213	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-4015-01	TCGA-AG-4015-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr1:104160213G>T	ENST00000414303.2	+	1	215	c.151G>T	c.(151-153)Gga>Tga	p.G51*		NM_000699.2	NP_000690.1	P04746	AMYP_HUMAN	amylase, alpha 2A (pancreatic)	51					carbohydrate catabolic process (GO:0016052)|carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|calcium ion binding (GO:0005509)|chloride ion binding (GO:0031404)	p.G51*(1)		endometrium(3)|kidney(1)|large_intestine(5)|liver(3)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)	Acarbose(DB00284)|Icodextrin(DB00702)|Miglitol(DB00491)	AGCTCCGAAGGGATTTGGAGG	0.423																																					p.G51X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G151T	1						.						297.0	245.0	263.0					1																	104160213		2201	4279	6480	103961736	SO:0001587	stop_gained	279	exon1			BC007060	CCDS783.1	1p21.1	2012-10-02	2007-05-03		ENSG00000243480	ENSG00000243480	3.2.1.1		477	protein-coding gene	gene with protein product		104650	"""amylase, alpha 2A; pancreatic"""	AMY2		3260028	Standard	NM_000699		Approved		uc001dut.3	P04746	OTTHUMG00000011023	ENST00000414303.2:c.151G>T	1.37:g.104160213G>T	ENSP00000397582:p.Gly51*	Somatic		Unspecified	Illumina	Phase_I	103961736	NM_000699	B9EJG1|Q9UBH3	Nonsense_Mutation	SNP	ENST00000414303.2	37	CCDS783.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	15.38|15.38	2.815229|2.815229	0.50527|0.50527	.|.	.|.	ENSG00000243480|ENSG00000243480	ENST00000423678|ENST00000414303;ENST00000393932	.|.	.|.	.|.	3.22|3.22	3.22|3.22	0.36961|0.36961	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|.	0.61664|.	0.2365|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.70146|.	-0.4952|.	4|.	.|0.87932	.|D	.|0	.|.	14.5293|14.5293	0.67912|0.67912	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	V|X	49|51	.|.	.|ENSP00000377509:G51X	G|G	+|+	2|1	0|0	AMY2A|AMY2A	103961736|103961736	1.000000|1.000000	0.71417|0.71417	0.579000|0.579000	0.28588|0.28588	0.019000|0.019000	0.09904|0.09904	8.935000|8.935000	0.92923|0.92923	1.784000|1.784000	0.52394|0.52394	0.455000|0.455000	0.32223|0.32223	GGG|GGA		AMY2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030315.1	NM_000699	
TCHH	7062	broad.mit.edu	37	1	152081237	152081237	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-4015-01	TCGA-AG-4015-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr1:152081237T>C	ENST00000368804.1	-	2	4455	c.4456A>G	c.(4456-4458)Aaa>Gaa	p.K1486E		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1486	23 X 26 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)	p.K1486E(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCAGGAATTTTCTGTCACGC	0.552																																					p.K1486E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4456G	1						.						97.0	97.0	97.0					1																	152081237		1898	4107	6005	150347861	SO:0001583	missense	7062	exon2			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.4456A>G	1.37:g.152081237T>C	ENSP00000357794:p.Lys1486Glu	Somatic		Unspecified	Illumina	Phase_I	150347861	NM_007113	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	N	7.748	0.702679	0.15172	.	.	ENSG00000159450	ENST00000368804	T	0.06849	3.25	3.24	0.307	0.15811	.	.	.	.	.	T	0.01976	0.0062	M	0.68593	2.085	0.09310	N	1	P	0.34724	0.465	B	0.30646	0.118	T	0.46091	-0.9216	9	0.08179	T	0.78	.	5.1129	0.14819	0.1612:0.0:0.4932:0.3457	.	1486	Q07283	TRHY_HUMAN	E	1486	ENSP00000357794:K1486E	ENSP00000357794:K1486E	K	-	1	0	TCHH	150347861	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-2.949000	0.00679	-0.047000	0.13423	0.164000	0.16699	AAA		TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
FCRL5	83416	broad.mit.edu	37	1	157514324	157514324	+	Missense_Mutation	SNP	C	C	T	rs140080936		TCGA-AG-4015-01	TCGA-AG-4015-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr1:157514324C>T	ENST00000361835.3	-	5	729	c.572G>A	c.(571-573)cGt>cAt	p.R191H	FCRL5_ENST00000368190.3_Missense_Mutation_p.R191H|FCRL5_ENST00000356953.4_Missense_Mutation_p.R191H|FCRL5_ENST00000368189.3_Missense_Mutation_p.R191H|FCRL5_ENST00000368191.3_Missense_Mutation_p.R106H	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	191	Ig-like C2-type 2.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)		p.R191H(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				CAGCACTGGACGTGTAAATGG	0.537																																					p.R191H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G572A	1						.	C	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	82.0	80.0	81.0		572,572	-5.3	0.0	1	dbSNP_134	81	4,8596	4.3+/-15.6	0,4,4296	yes	missense,missense	FCRL5	NM_001195388.1,NM_031281.2	29,29	0,5,6498	TT,TC,CC		0.0465,0.0227,0.0384	benign,benign	191/999,191/978	157514324	5,13001	2203	4300	6503	155780948	SO:0001583	missense	83416	exon5			AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.572G>A	1.37:g.157514324C>T	ENSP00000354691:p.Arg191His	Somatic		Unspecified	Illumina	Phase_I	155780948	NM_031281	A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	ENST00000361835.3	37	CCDS1165.1	.	.	.	.	.	.	.	.	.	.	C	5.974	0.363603	0.11296	2.27E-4	4.65E-4	ENSG00000143297	ENST00000361835;ENST00000356953;ENST00000368190;ENST00000368191;ENST00000368189	T;T;T;T;T	0.11930	2.73;2.73;2.73;2.73;2.73	4.17	-5.26	0.02772	Immunoglobulin-like (1);	.	.	.	.	T	0.02688	0.0081	L	0.34521	1.04	0.09310	N	1	B;B;P;D;P	0.53619	0.441;0.194;0.709;0.961;0.709	B;B;B;B;B	0.43194	0.038;0.042;0.216;0.411;0.216	T	0.19844	-1.0293	9	0.38643	T	0.18	.	3.4039	0.07333	0.1918:0.1433:0.4962:0.1687	.	106;191;191;191;191	F5GXJ2;Q96RD9-3;A6NJE8;Q96RD9-4;Q96RD9	.;.;.;.;FCRL5_HUMAN	H	191;191;191;106;191	ENSP00000354691:R191H;ENSP00000349434:R191H;ENSP00000357173:R191H;ENSP00000357174:R106H;ENSP00000357172:R191H	ENSP00000349434:R191H	R	-	2	0	FCRL5	155780948	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.266000	0.02842	-0.919000	0.03803	0.467000	0.42956	CGT		FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046263.1	NM_031281	
NUDC	10726	broad.mit.edu	37	1	27272144	27272144	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr1:27272144C>T	ENST00000321265.5	+	8	1034	c.911C>T	c.(910-912)tCa>tTa	p.S304L	NUDC_ENST00000484772.1_3'UTR	NM_006600.3	NP_006591.1	Q9Y266	NUDC_HUMAN	nudC nuclear distribution protein	304					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleoplasm (GO:0005654)		p.S304L(1)		cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|ovary(1)	8				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;6.1e-51)|OV - Ovarian serous cystadenocarcinoma(117;2.87e-29)|Colorectal(126;5.74e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000281)|STAD - Stomach adenocarcinoma(196;0.000604)|KIRC - Kidney renal clear cell carcinoma(1967;0.000739)|READ - Rectum adenocarcinoma(331;0.0421)		CTGCCAACTTCAGACGAACAG	0.552																																					p.S304L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C911T	1						.						96.0	97.0	96.0					1																	27272144		2203	4300	6503	27144731	SO:0001583	missense	10726	exon8				CCDS292.1	1p35-p34	2013-08-06	2013-08-06		ENSG00000090273	ENSG00000090273			8045	protein-coding gene	gene with protein product		610325	"""nuclear distribution gene C homolog (A. nidulans)"", ""nuclear distribution C homolog (A. nidulans)"""				Standard	NM_006600		Approved	NudC	uc001bng.2	Q9Y266	OTTHUMG00000004226	ENST00000321265.5:c.911C>T	1.37:g.27272144C>T	ENSP00000319664:p.Ser304Leu	Somatic		Unspecified	Illumina	Phase_I	27144731	NM_006600	Q5QP31|Q5QP35|Q9H0N2|Q9Y2B6	Missense_Mutation	SNP	ENST00000321265.5	37	CCDS292.1	.	.	.	.	.	.	.	.	.	.	C	34	5.343841	0.95807	.	.	ENSG00000090273	ENST00000321265	T	0.72051	-0.62	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	D	0.89901	0.6849	H	0.97051	3.93	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.93296	0.6672	10	0.87932	D	0	1.5853	18.8328	0.92148	0.0:1.0:0.0:0.0	.	304	Q9Y266	NUDC_HUMAN	L	304	ENSP00000319664:S304L	ENSP00000319664:S304L	S	+	2	0	NUDC	27144731	1.000000	0.71417	0.955000	0.39395	0.927000	0.56198	7.818000	0.86416	2.447000	0.82792	0.655000	0.94253	TCA		NUDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012172.2		
ZC3H12A	80149	broad.mit.edu	37	1	37947405	37947405	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr1:37947405C>T	ENST00000373087.6	+	4	903	c.787C>T	c.(787-789)Cgg>Tgg	p.R263W		NM_025079.2	NP_079355.2			zinc finger CCCH-type containing 12A									p.R263W(1)		NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CATCGAGGAGCGGCTGCTCAT	0.587																																					p.R263W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C787T	1						.						118.0	105.0	109.0					1																	37947405		2203	4300	6503	37719992	SO:0001583	missense	80149	exon4				CCDS417.1	1p34.3	2012-07-05			ENSG00000163874	ENSG00000163874		"""Zinc fingers, CCCH-type domain containing"""	26259	protein-coding gene	gene with protein product	"""MCP induced protein 1"""	610562				18178554, 22055188	Standard	NM_025079		Approved	FLJ23231, MCPIP1	uc001cbb.4	Q5D1E8	OTTHUMG00000004221	ENST00000373087.6:c.787C>T	1.37:g.37947405C>T	ENSP00000362179:p.Arg263Trp	Somatic		Unspecified	Illumina	Phase_I	37719992	NM_025079		Missense_Mutation	SNP	ENST00000373087.6	37	CCDS417.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.247399	0.80024	.	.	ENSG00000163874	ENST00000373087;ENST00000373082	T	0.53640	0.61	5.8	2.71	0.32032	Ribonuclease Zc3h12a-like (1);	0.000000	0.85682	D	0.000000	T	0.76793	0.4037	H	0.95328	3.655	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.84614	0.0680	10	0.87932	D	0	-36.0734	15.0422	0.71799	0.369:0.631:0.0:0.0	.	263	Q5D1E8	ZC12A_HUMAN	W	263	ENSP00000362179:R263W	ENSP00000362174:R263W	R	+	1	2	ZC3H12A	37719992	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	0.709000	0.25734	0.730000	0.32425	0.655000	0.94253	CGG		ZC3H12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012154.2	NM_025079	
LEPR	3953	broad.mit.edu	37	1	66058425	66058425	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-4015-01	TCGA-AG-4015-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr1:66058425T>G	ENST00000349533.6	+	6	765	c.580T>G	c.(580-582)Tgt>Ggt	p.C194G	LEPR_ENST00000406510.3_Intron|LEPR_ENST00000462765.1_3'UTR|LEPR_ENST00000371060.3_Missense_Mutation_p.C194G|LEPR_ENST00000371059.3_Missense_Mutation_p.C194G|LEPR_ENST00000344610.8_Missense_Mutation_p.C194G|LEPR_ENST00000371058.1_Missense_Mutation_p.C194G	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)	p.C194G(2)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		TCATGAATGTTGTGAATGTCT	0.408																																					p.C194G												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T580G	1						.						152.0	137.0	142.0					1																	66058425		2203	4300	6503	65831013	SO:0001583	missense	3953	exon6			U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.580T>G	1.37:g.66058425T>G	ENSP00000330393:p.Cys194Gly	Somatic		Unspecified	Illumina	Phase_I	65831013	NM_001003679	Q6FHL5	Missense_Mutation	SNP	ENST00000349533.6	37	CCDS631.1	.	.	.	.	.	.	.	.	.	.	T	15.31	2.796356	0.50208	.	.	ENSG00000116678	ENST00000344610;ENST00000349533;ENST00000371060;ENST00000371059;ENST00000371058	T;T;T;T;T	0.60040	0.34;0.22;0.35;0.31;0.34	5.68	5.68	0.88126	.	0.252890	0.48286	D	0.000193	T	0.69223	0.3087	M	0.74258	2.255	0.80722	D	1	D;D;D	0.69078	0.991;0.995;0.997	P;D;D	0.67382	0.894;0.951;0.933	T	0.73736	-0.3889	10	0.62326	D	0.03	-7.4788	15.5869	0.76491	0.0:0.0:0.0:1.0	.	194;194;194	P48357;P48357-2;P48357-3	LEPR_HUMAN;.;.	G	194	ENSP00000340884:C194G;ENSP00000330393:C194G;ENSP00000360099:C194G;ENSP00000360098:C194G;ENSP00000360097:C194G	ENSP00000340884:C194G	C	+	1	0	LEPR	65831013	0.999000	0.42202	0.926000	0.36857	0.156000	0.22039	3.816000	0.55658	2.166000	0.68216	0.528000	0.53228	TGT		LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025275.1	NM_002303	
HHLA3	11147	broad.mit.edu	37	1	70832138	70832138	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4015-01	TCGA-AG-4015-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr1:70832138G>A	ENST00000359875.5	+	2	409	c.269G>A	c.(268-270)cGg>cAg	p.R90Q	HHLA3_ENST00000361764.4_Silent_p.T56T|HHLA3_ENST00000432224.1_Missense_Mutation_p.G91R|HHLA3_ENST00000370940.5_Missense_Mutation_p.G58R|HHLA3_ENST00000531950.1_Missense_Mutation_p.R90Q	NM_001036645.1	NP_001031722.1	Q9XRX5	HHLA3_HUMAN	HERV-H LTR-associating 3	90								p.R90Q(1)		large_intestine(3)|lung(1)	4						TCTtgtcaacggaaaggggtc	0.338																																					p.R90Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G269A	1						.						17.0	21.0	20.0					1																	70832138		2182	4283	6465	70604726	SO:0001583	missense	11147	exon2			AF126164	CCDS649.1, CCDS30752.1, CCDS30753.1	1p31.1	2008-02-05			ENSG00000197568	ENSG00000197568			4906	protein-coding gene	gene with protein product		604372				10444326	Standard	NR_027404		Approved		uc001dfa.3	Q9XRX5	OTTHUMG00000009346	ENST00000359875.5:c.269G>A	1.37:g.70832138G>A	ENSP00000352938:p.Arg90Gln	Somatic		Unspecified	Illumina	Phase_I	70604726	NM_001036645	D3DQ74|Q5VZP2|Q96FH5|Q9XRX4	Missense_Mutation	SNP	ENST00000359875.5	37	CCDS30753.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.029|0.029	-1.350342|-1.350342	0.01256|0.01256	.|.	.|.	ENSG00000197568|ENSG00000197568	ENST00000370940;ENST00000432224|ENST00000359875;ENST00000531950	.|.	.|.	.|.	0.137|0.137	-0.274|-0.274	0.12910|0.12910	.|.	.|.	.|.	.|.	.|.	T|T	0.05090|0.05090	0.0136|0.0136	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	B|B	0.30542|0.12630	0.284|0.006	B|B	0.12156|0.01281	0.007|0.0	T|T	0.41875|0.41875	-0.9484|-0.9484	6|6	0.87932|0.17369	D|T	0|0.5	.|.	.|.	.|.	.|.	.|.	58|90	Q9XRX5-2|Q9XRX5	.|HHLA3_HUMAN	R|Q	58;91|90	.|.	ENSP00000359978:G58R|ENSP00000352938:R90Q	G|R	+|+	1|2	0|0	HHLA3|HHLA3	70604726|70604726	0.001000|0.001000	0.12720|0.12720	0.049000|0.049000	0.19019|0.19019	0.059000|0.059000	0.15707|0.15707	-1.656000|-1.656000	0.01980|0.01980	-0.750000|-0.750000	0.04740|0.04740	-0.734000|-0.734000	0.03567|0.03567	GGA|CGG		HHLA3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000025911.2	NM_007071	
NAV1	89796	broad.mit.edu	37	1	201777611	201777611	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-4015-01	TCGA-AG-4015-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr1:201777611A>G	ENST00000367296.4	+	19	4331	c.3911A>G	c.(3910-3912)aAg>aGg	p.K1304R	NAV1_ENST00000367300.3_Missense_Mutation_p.K1244R|NAV1_ENST00000367302.1_Missense_Mutation_p.K1257R|MIR1231_ENST00000408101.1_RNA|NAV1_ENST00000295624.6_Missense_Mutation_p.K1301R|NAV1_ENST00000367295.1_Missense_Mutation_p.K910R|IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000367297.4_Missense_Mutation_p.K1296R	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	1304					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.K1301R(1)		breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						GAGCCAGAGAAGAAGGAGGTA	0.557																																					p.K910R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2729G	1						.						59.0	60.0	60.0					1																	201777611		2203	4300	6503	200044234	SO:0001583	missense	89796	exon16			AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.3911A>G	1.37:g.201777611A>G	ENSP00000356265:p.Lys1304Arg	Somatic		Unspecified	Illumina	Phase_I	200044234	NM_001167738	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Missense_Mutation	SNP	ENST00000367296.4	37	CCDS1414.2	.	.	.	.	.	.	.	.	.	.	a	15.18	2.758055	0.49468	.	.	ENSG00000134369	ENST00000367302;ENST00000367296;ENST00000295624;ENST00000367297;ENST00000367300;ENST00000367295	T;T;T;T;T;T	0.07114	3.23;3.22;3.22;3.22;3.23;3.22	5.53	4.4	0.53042	.	0.319150	0.33959	N	0.004388	T	0.06872	0.0175	N	0.22421	0.69	0.37557	D	0.918938	B;B	0.21147	0.019;0.052	B;B	0.18561	0.007;0.022	T	0.18178	-1.0345	10	0.66056	D	0.02	-24.0157	11.1622	0.48522	0.9265:0.0:0.0735:0.0	.	910;1301	Q8NEY1-5;Q8NEY1-3	.;.	R	1257;1304;1301;1296;1244;910	ENSP00000356271:K1257R;ENSP00000356265:K1304R;ENSP00000295624:K1301R;ENSP00000356266:K1296R;ENSP00000356269:K1244R;ENSP00000356264:K910R	ENSP00000295624:K1301R	K	+	2	0	NAV1	200044234	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	5.999000	0.70665	0.929000	0.37192	0.451000	0.29950	AAG		NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087013.1	NM_020443	
DYNC2H1	79659	broad.mit.edu	37	11	103106440	103106440	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-4015-01	TCGA-AG-4015-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr11:103106440A>G	ENST00000375735.2	+	62	9751	c.9607A>G	c.(9607-9609)Aga>Gga	p.R3203G	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.R3203G|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3203					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.R636G(1)		NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TCTTCCTAAAAGAGCTCAACT	0.378																																					p.R3203G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A9607G	11						.						71.0	68.0	69.0					11																	103106440		1847	4088	5935	102611650	SO:0001583	missense	79659	exon62			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.9607A>G	11.37:g.103106440A>G	ENSP00000364887:p.Arg3203Gly	Somatic		Unspecified	Illumina	Phase_I	102611650	NM_001377	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	37	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	A	14.02	2.409919	0.42715	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.73897	-0.79;-0.79	5.68	4.54	0.55810	Dynein heavy chain, coiled coil stalk (1);	0.000000	0.85682	D	0.000000	T	0.78207	0.4247	M	0.64170	1.965	0.54753	D	0.999986	P;B	0.38395	0.629;0.371	P;B	0.47251	0.542;0.217	T	0.78643	-0.2124	10	0.66056	D	0.02	.	13.021	0.58787	0.8653:0.1347:0.0:0.0	.	3203;3203	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	G	3203	ENSP00000364887:R3203G;ENSP00000381167:R3203G	ENSP00000364887:R3203G	R	+	1	2	DYNC2H1	102611650	1.000000	0.71417	0.992000	0.48379	0.988000	0.76386	2.937000	0.48979	0.964000	0.38108	0.524000	0.50904	AGA		DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
HTR3B	9177	broad.mit.edu	37	11	113816850	113816850	+	Silent	SNP	C	C	T	rs151164355	byFrequency	TCGA-AG-4015-01	TCGA-AG-4015-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr11:113816850C>T	ENST00000260191.2	+	9	1574	c.1317C>T	c.(1315-1317)ggC>ggT	p.G439G	HTR3B_ENST00000537778.1_Silent_p.G428G	NM_006028.4	NP_006019.1	O95264	5HT3B_HUMAN	5-hydroxytryptamine (serotonin) receptor 3B, ionotropic	439					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ion channel activity (GO:0005216)|serotonin receptor activity (GO:0004993)|serotonin-activated cation-selective channel activity (GO:0005232)	p.G439G(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(11)	20		all_cancers(61;6.81e-18)|all_epithelial(67;6.67e-11)|all_hematologic(158;4.67e-05)|Melanoma(852;0.000316)|Acute lymphoblastic leukemia(157;0.000976)|Breast(348;0.0101)|Prostate(24;0.0154)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.04e-06)|Epithelial(105;1.98e-05)|all cancers(92;0.000201)|OV - Ovarian serous cystadenocarcinoma(223;0.151)	Ergoloid mesylate(DB01049)	CACTGTGGGGCGGCGTGTGAA	0.527													C|||	17	0.00339457	0.0	0.0	5008	,	,		15373	0.0		0.0	False		,,,				2504	0.0174				p.G439G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1317T	11						.	C		1,4401	2.1+/-5.4	0,1,2200	63.0	59.0	60.0		1317	-4.8	0.0	11	dbSNP_134	60	0,8592		0,0,4296	no	coding-synonymous	HTR3B	NM_006028.4		0,1,6496	TT,TC,CC		0.0,0.0227,0.0077		439/442	113816850	1,12993	2201	4296	6497	113322060	SO:0001819	synonymous_variant	9177	exon9			AF080582	CCDS8364.1	11q23.1	2012-05-22	2012-02-03		ENSG00000149305	ENSG00000149305		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	5298	protein-coding gene	gene with protein product		604654	"""5-hydroxytryptamine (serotonin) receptor 3B"""			9950429, 10521471	Standard	NM_006028		Approved	5-HT3B	uc001pok.3	O95264	OTTHUMG00000168210	ENST00000260191.2:c.1317C>T	11.37:g.113816850C>T		Somatic		Unspecified	Illumina	Phase_I	113322060	NM_006028	B0YJ23|Q0VJC3	Silent	SNP	ENST00000260191.2	37	CCDS8364.1																																																																																				HTR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398842.1	NM_006028	
COPB1	1315	broad.mit.edu	37	11	14490905	14490905	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr11:14490905C>T	ENST00000249923.3	-	15	2242	c.1942G>A	c.(1942-1944)Gaa>Aaa	p.E648K	COPB1_ENST00000439561.2_Missense_Mutation_p.E648K	NM_016451.4	NP_057535.1	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	648					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|viral process (GO:0016032)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle (GO:0005798)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)	p.E648K(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	36						TTCTCTTCTTCTAGTTTAGCA	0.408																																					p.E648K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1942A	11						.						163.0	164.0	164.0					11																	14490905		2200	4294	6494	14447481	SO:0001583	missense	1315	exon15			BC037280	CCDS7815.1	11p15.2	2011-05-20	2006-06-30	2006-06-30	ENSG00000129083	ENSG00000129083			2231	protein-coding gene	gene with protein product		600959	"""coatomer protein complex, subunit beta"""	COPB		7982906	Standard	NM_016451		Approved		uc001mlg.2	P53618	OTTHUMG00000165824	ENST00000249923.3:c.1942G>A	11.37:g.14490905C>T	ENSP00000249923:p.Glu648Lys	Somatic		Unspecified	Illumina	Phase_I	14447481	NM_016451	D3DQX0|Q6GTT7|Q9NTK2|Q9UNW7	Missense_Mutation	SNP	ENST00000249923.3	37	CCDS7815.1	.	.	.	.	.	.	.	.	.	.	C	17.14	3.313429	0.60414	.	.	ENSG00000129083	ENST00000249923;ENST00000439561	T;T	0.44083	0.93;0.93	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.39572	0.1083	L	0.49640	1.575	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.31223	-0.9951	10	0.10902	T	0.67	.	19.8405	0.96681	0.0:1.0:0.0:0.0	.	648	P53618	COPB_HUMAN	K	648	ENSP00000249923:E648K;ENSP00000397873:E648K	ENSP00000249923:E648K	E	-	1	0	COPB1	14447481	1.000000	0.71417	0.977000	0.42913	0.985000	0.73830	7.535000	0.82014	2.692000	0.91855	0.655000	0.94253	GAA		COPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386410.1	NM_016451	
TPH1	7166	broad.mit.edu	37	11	18048169	18048169	+	Missense_Mutation	SNP	C	C	T	rs368665249		TCGA-AG-4015-01	TCGA-AG-4015-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr11:18048169C>T	ENST00000250018.2	-	6	1233	c.671G>A	c.(670-672)cGt>cAt	p.R224H	TPH1_ENST00000341556.2_Missense_Mutation_p.R224H	NM_004179.2	NP_004170.1	P17752	TPH1_HUMAN	tryptophan hydroxylase 1	224					aromatic amino acid family metabolic process (GO:0009072)|bone remodeling (GO:0046849)|cellular nitrogen compound metabolic process (GO:0034641)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|mammary gland alveolus development (GO:0060749)|negative regulation of ossification (GO:0030279)|response to immobilization stress (GO:0035902)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)	p.R224H(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(14)|prostate(1)|stomach(1)	25					L-Tryptophan(DB00150)|Tetrahydrobiopterin(DB00360)	AAAACCTGTACGCTCTGCAAA	0.418																																					p.R224H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G671A	11						.	C	HIS/ARG	1,4399	2.1+/-5.4	0,1,2199	67.0	67.0	67.0		671	5.4	1.0	11		67	0,8586		0,0,4293	no	missense	TPH1	NM_004179.2	29	0,1,6492	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	224/445	18048169	1,12985	2200	4293	6493	18004745	SO:0001583	missense	7166	exon6			X52836	CCDS7829.1	11p15.3-p14	2012-10-02	2008-07-31	2003-04-04	ENSG00000129167	ENSG00000129167	1.14.16.4		12008	protein-coding gene	gene with protein product	"""tryptophan 5-monooxygenase"""	191060	"""tryptophan hydroxylase (tryptophan 5-monooxygenase)"""	TPRH, TPH		1463016	Standard	NM_004179		Approved		uc001mnp.2	P17752	OTTHUMG00000166421	ENST00000250018.2:c.671G>A	11.37:g.18048169C>T	ENSP00000250018:p.Arg224His	Somatic		Unspecified	Illumina	Phase_I	18004745	NM_004179	D3DQX6|O95188|O95189|Q16736|Q3KPG8	Missense_Mutation	SNP	ENST00000250018.2	37	CCDS7829.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.881021	0.91740	2.27E-4	0.0	ENSG00000129167	ENST00000250018;ENST00000341556	D;D	0.99578	-6.21;-6.21	5.4	5.4	0.78164	Aromatic amino acid hydroxylase, C-terminal (3);	0.048980	0.85682	D	0.000000	D	0.99426	0.9797	M	0.77103	2.36	0.80722	D	1	D	0.60160	0.987	P	0.55087	0.768	D	0.99651	1.0991	10	0.37606	T	0.19	-5.0466	19.5398	0.95270	0.0:1.0:0.0:0.0	.	224	P17752	TPH1_HUMAN	H	224	ENSP00000250018:R224H;ENSP00000343550:R224H	ENSP00000250018:R224H	R	-	2	0	TPH1	18004745	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	4.907000	0.63300	2.694000	0.91930	0.467000	0.42956	CGT		TPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389696.1	NM_004179	
CCDC73	493860	broad.mit.edu	37	11	32674733	32674733	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr11:32674733C>T	ENST00000335185.5	-	12	918	c.875G>A	c.(874-876)cGg>cAg	p.R292Q	CCDC73_ENST00000534415.1_5'UTR	NM_001008391.2	NP_001008392.2	Q6ZRK6	CCD73_HUMAN	coiled-coil domain containing 73	292								p.R292Q(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	51	Breast(20;0.112)					AATTTGTTGCCGAAGTAACTG	0.318																																					p.R292Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G875A	11						.						150.0	139.0	142.0					11																	32674733		1860	4097	5957	32631309	SO:0001583	missense	493860	exon12			AK128159	CCDS41630.1	11p13	2006-02-11			ENSG00000186714	ENSG00000186714			23261	protein-coding gene	gene with protein product		612328					Standard	NM_001008391		Approved	NY-SAR-79	uc001mtv.4	Q6ZRK6	OTTHUMG00000166279	ENST00000335185.5:c.875G>A	11.37:g.32674733C>T	ENSP00000335325:p.Arg292Gln	Somatic		Unspecified	Illumina	Phase_I	32631309	NM_001008391	Q6P5Q7|Q6ZMW0|Q86WE7	Missense_Mutation	SNP	ENST00000335185.5	37	CCDS41630.1	.	.	.	.	.	.	.	.	.	.	C	5.233	0.228431	0.09916	.	.	ENSG00000186714	ENST00000335185	.	.	.	5.63	4.5	0.54988	.	0.241486	0.35040	N	0.003489	T	0.11665	0.0284	N	0.00210	-1.845	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.01281	0.0;0.0	T	0.30060	-0.9991	9	0.02654	T	1	.	10.1764	0.42941	0.0:0.0757:0.0:0.9243	.	282;292	Q6ZRK6-2;Q6ZRK6	.;CCD73_HUMAN	Q	292	.	ENSP00000335325:R292Q	R	-	2	0	CCDC73	32631309	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	2.342000	0.43992	0.975000	0.38392	-0.475000	0.04921	CGG		CCDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388874.2	NM_001008391	
FGF19	9965	broad.mit.edu	37	11	69514273	69514273	+	Silent	SNP	G	G	A			TCGA-AG-4015-01	TCGA-AG-4015-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr11:69514273G>A	ENST00000294312.3	-	3	1173	c.408C>T	c.(406-408)tcC>tcT	p.S136S		NM_005117.2	NP_005108.1	O95750	FGF19_HUMAN	fibroblast growth factor 19	136					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of bile acid biosynthetic process (GO:0070858)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glucose import (GO:0046326)|positive regulation of JNK cascade (GO:0046330)	extracellular region (GO:0005576)	fibroblast growth factor receptor binding (GO:0005104)	p.S136>F(1)|p.S136S(1)		large_intestine(2)|lung(2)|skin(2)	6	all_cancers(3;5.53e-114)|all_epithelial(3;1.34e-121)|Breast(3;9.28e-34)|all_lung(4;1.99e-21)|Lung NSC(4;4.65e-21)|Hepatocellular(3;6.15e-15)|Melanoma(5;1.89e-05)|Ovarian(3;0.0348)		Epithelial(3;3.05e-56)|all cancers(3;2.69e-50)|Lung(3;1.13e-16)|LUSC - Lung squamous cell carcinoma(11;3.74e-15)|STAD - Stomach adenocarcinoma(18;0.0278)|LUAD - Lung adenocarcinoma(13;0.0537)			GGTGCTTCTCGGATCGGTACA	0.557																																					p.S136S												FGF19,skin,NS,Complex - compound substitution,0	.	2	Substitution - coding silent(1)|Complex - compound substitution(1)	large_intestine(1)|skin(1)	c.C408T	11						.						76.0	71.0	72.0					11																	69514273		2200	4294	6494	69223454	SO:0001819	synonymous_variant	9965	exon3			AB018122	CCDS8193.1	11q13.1	2008-02-01			ENSG00000162344	ENSG00000162344			3675	protein-coding gene	gene with protein product		603891				9931477, 10525310	Standard	NM_005117		Approved		uc001opf.3	O95750	OTTHUMG00000167886	ENST00000294312.3:c.408C>T	11.37:g.69514273G>A		Somatic		Unspecified	Illumina	Phase_I	69223454	NM_005117		Silent	SNP	ENST00000294312.3	37	CCDS8193.1																																																																																				FGF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396833.1	NM_005117	
KMT2A	4297	broad.mit.edu	37	11	118343890	118343890	+	Silent	SNP	C	C	T	rs368516174		TCGA-AG-4015-01	TCGA-AG-4015-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr11:118343890C>T	ENST00000389506.5	+	3	2016	c.2016C>T	c.(2014-2016)acC>acT	p.T672T	KMT2A_ENST00000354520.4_Silent_p.T672T|KMT2A_ENST00000534358.1_Silent_p.T672T			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	672					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)	p.T672T(1)									CATCTGGTACCGCTGCTTCAG	0.468																																					p.T672T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2016T	11						.	C	,	1,4399	2.1+/-5.4	0,1,2199	74.0	76.0	75.0		2016,2016	0.4	0.7	11		75	0,8592		0,0,4296	no	coding-synonymous,coding-synonymous	MLL	NM_001197104.1,NM_005933.3	,	0,1,6495	TT,TC,CC		0.0,0.0227,0.0077	,	672/3973,672/3970	118343890	1,12991	2200	4296	6496	117849100	SO:0001819	synonymous_variant	4297	exon3			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.2016C>T	11.37:g.118343890C>T		Somatic		Unspecified	Illumina	Phase_I	117849100	NM_005933	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Silent	SNP	ENST00000389506.5	37	CCDS31686.1																																																																																				KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
CRISP2	7180	broad.mit.edu	37	6	49663583	49663583	+	Silent	SNP	G	G	A	rs371237410		TCGA-AG-4015-01	TCGA-AG-4015-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr6:49663583G>A	ENST00000339139.4	-	9	806	c.570C>T	c.(568-570)gcC>gcT	p.A190A		NM_001142407.2|NM_001142408.2|NM_001142417.2|NM_001142435.2|NM_001261822.1|NM_003296.3	NP_001135879.1|NP_001135880.1|NP_001135889.1|NP_001135907.1|NP_001248751.1|NP_003287.1	P16562	CRIS2_HUMAN	cysteine-rich secretory protein 2	190					single organismal cell-cell adhesion (GO:0016337)	extracellular space (GO:0005615)		p.A190A(1)		kidney(1)|large_intestine(2)|lung(10)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	19	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			CAGGGCAACCGGCACAAGGTG	0.308																																					p.A190A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C570T	6						.	G	,,,,	0,4406		0,0,2203	101.0	96.0	98.0		570,570,570,570,570	2.2	1.0	6		98	1,8599		0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CRISP2	NM_001142407.1,NM_001142408.1,NM_001142417.1,NM_001142435.1,NM_003296.2	,,,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,,	190/244,190/244,190/244,190/244,190/244	49663583	1,13005	2203	4300	6503	49771542	SO:0001819	synonymous_variant	7180	exon9			X95239	CCDS4928.1	6p12.3	2009-03-12	2003-09-03	2003-09-05	ENSG00000124490	ENSG00000124490			12024	protein-coding gene	gene with protein product	"""cancer/testis antigen 36"""	187430	"""testis specific protein 1 (probe H4-1 p3-1)"""	GAPDL5, TPX1		2613236, 8665901	Standard	NM_003296		Approved	CRISP-2, CT36	uc003ozo.3	P16562	OTTHUMG00000014822	ENST00000339139.4:c.570C>T	6.37:g.49663583G>A		Somatic		Unspecified	Illumina	Phase_I	49771542	NM_003296	A8K8M0|Q53FF2|Q5U8Z9|Q7Z7B2	Silent	SNP	ENST00000339139.4	37	CCDS4928.1																																																																																				CRISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040870.2	NM_003296	
TFAP2D	83741	broad.mit.edu	37	6	50683008	50683008	+	Silent	SNP	C	C	G			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr6:50683008C>G	ENST00000008391.3	+	2	447	c.219C>G	c.(217-219)tcC>tcG	p.S73S		NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)									p.S73S(1)		NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					ACCACCAGTCCTTCCATTACG	0.577																																					p.S73S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C219G	6						.						239.0	194.0	209.0					6																	50683008		2203	4300	6503	50790967	SO:0001819	synonymous_variant	83741	exon2			AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.219C>G	6.37:g.50683008C>G		Somatic		Unspecified	Illumina	Phase_I	50790967	NM_172238		Silent	SNP	ENST00000008391.3	37	CCDS4933.1																																																																																				TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040881.1	NM_172238	
FAM184A	79632	broad.mit.edu	37	6	119296268	119296268	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-4015-01	TCGA-AG-4015-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr6:119296268T>C	ENST00000338891.7	-	13	3132	c.2689A>G	c.(2689-2691)Ata>Gta	p.I897V	FAM184A_ENST00000352896.5_Missense_Mutation_p.I777V|FAM184A_ENST00000368475.4_Missense_Mutation_p.I777V|FAM184A_ENST00000521531.1_Missense_Mutation_p.I897V|RP11-351A11.1_ENST00000518570.1_RNA	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	897						extracellular space (GO:0005615)		p.I897V(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						AGGGCACTTATATTCTCATGA	0.383																																					p.I897V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2689G	6						.						144.0	126.0	132.0					6																	119296268		1857	4083	5940	119337967	SO:0001583	missense	79632	exon13			BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.2689A>G	6.37:g.119296268T>C	ENSP00000342604:p.Ile897Val	Somatic		Unspecified	Illumina	Phase_I	119337967	NM_024581	B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Missense_Mutation	SNP	ENST00000338891.7	37	CCDS43499.1	.	.	.	.	.	.	.	.	.	.	T	14.07	2.424979	0.43020	.	.	ENSG00000111879	ENST00000521043;ENST00000338891;ENST00000352896;ENST00000368475;ENST00000521531	T;T;T;T	0.24151	2.48;2.57;1.88;1.87	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.09949	0.0244	L	0.31664	0.95	0.80722	D	1	P;B;P	0.40000	0.514;0.063;0.698	B;B;B	0.36030	0.151;0.044;0.216	T	0.09185	-1.0686	10	0.24483	T	0.36	-16.95	15.7338	0.77827	0.0:0.0:0.0:1.0	.	897;777;897	Q8NB25-2;F8W8D6;Q8NB25	.;.;F184A_HUMAN	V	60;897;777;777;897	ENSP00000342604:I897V;ENSP00000326608:I777V;ENSP00000357460:I777V;ENSP00000430442:I897V	ENSP00000342604:I897V	I	-	1	0	FAM184A	119337967	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	7.655000	0.83696	2.185000	0.69588	0.528000	0.53228	ATA		FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042009.3	NM_024581	
C17orf97	400566	broad.mit.edu	37	17	263324	263324	+	Missense_Mutation	SNP	G	G	C	rs202235370	byFrequency	TCGA-AG-4015-01	TCGA-AG-4015-01	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr17:263324G>C	ENST00000360127.6	+	2	706	c.690G>C	c.(688-690)gaG>gaC	p.E230D	C17orf97_ENST00000571106.1_Intron|AC108004.3_ENST00000466740.2_RNA	NM_001013672.4	NP_001013694.4	Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	230	20 X 10 AA approximative tandem repeat of A-L-K-G-F-H-P-D-P-E.									breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						CCGACCCCGAGGCCCTCAAGG	0.721													G|||	4	0.000798722	0.0	0.0	5008	,	,		7501	0.001		0.001	False		,,,				2504	0.002				p.E230D												.	.	0			c.G690C	17						.						6.0	11.0	9.0					17																	263324		1891	4035	5926	263670	SO:0001583	missense	400566	exon3			AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000360127.6:c.690G>C	17.37:g.263324G>C	ENSP00000353245:p.Glu230Asp	None		Unspecified	Illumina	Phase_I	263670	NM_001013672	A5D8T6|Q6NSI2|Q6PFW9	Missense_Mutation	SNP	ENST00000360127.6	37	CCDS32519.2	.	.	.	.	.	.	.	.	.	.	G	0	-2.624371	0.00117	.	.	ENSG00000187624	ENST00000360127	T	0.33216	1.42	0.799	-1.6	0.08426	.	.	.	.	.	T	0.10078	0.0247	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26087	-1.0113	9	0.16420	T	0.52	.	3.06	0.06196	0.2383:0.0:0.4872:0.2745	.	230	Q6ZQX7-4	.	D	230	ENSP00000353245:E230D	ENSP00000353245:E230D	E	+	3	2	C17orf97	263670	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-3.499000	0.00450	-1.566000	0.01673	-1.206000	0.01644	GAG		C17orf97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255648.4	NM_001013672	
HLF	3131	broad.mit.edu	37	17	53392723	53392723	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4015-01	TCGA-AG-4015-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr17:53392723G>A	ENST00000226067.5	+	3	1060	c.587G>A	c.(586-588)cGc>cAc	p.R196H	HLF_ENST00000430986.2_Missense_Mutation_p.R111H|HLF_ENST00000575345.1_Missense_Mutation_p.R111H|HLF_ENST00000573945.1_Missense_Mutation_p.R111H	NM_002126.4	NP_002117.1	Q16534	HLF_HUMAN	hepatic leukemia factor	196	Pro-rich (proline/acidic region (PAR)).				multicellular organismal development (GO:0007275)|rhythmic process (GO:0048511)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R196H(1)		large_intestine(1)|ovary(2)	3						TTTGACCCTCGCAAACGCAAG	0.517			T	TCF3	ALL																																p.R196H			Dom	yes		17	17q22	3131	hepatic leukemia factor		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G587A	17						.						100.0	93.0	95.0					17																	53392723		2203	4300	6503	50747722	SO:0001583	missense	3131	exon3				CCDS11585.1	17q22	2011-05-19			ENSG00000108924	ENSG00000108924			4977	protein-coding gene	gene with protein product		142385				1386162	Standard	XM_005257269		Approved	MGC33822	uc002iug.1	Q16534		ENST00000226067.5:c.587G>A	17.37:g.53392723G>A	ENSP00000226067:p.Arg196His	Somatic		Unspecified	Illumina	Phase_I	50747722	NM_002126	A8K1X8|Q6FHS9	Missense_Mutation	SNP	ENST00000226067.5	37	CCDS11585.1	.	.	.	.	.	.	.	.	.	.	G	35	5.525197	0.96431	.	.	ENSG00000108924	ENST00000226067;ENST00000430986	.	.	.	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.83885	0.5351	M	0.84326	2.69	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.962;0.996	D	0.85824	0.1387	9	0.87932	D	0	.	18.6178	0.91310	0.0:0.0:1.0:0.0	.	144;196	B4DIQ5;Q16534	.;HLF_HUMAN	H	196;111	.	ENSP00000226067:R196H	R	+	2	0	HLF	50747722	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.644000	0.89710	0.655000	0.94253	CGC		HLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439185.1	NM_002126	
TP53	7157	broad.mit.edu	37	17	7576855	7576855	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-4015-01	TCGA-AG-4015-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr17:7576855G>A	ENST00000269305.4	-	9	1180	c.991C>T	c.(991-993)Cag>Tag	p.Q331*	TP53_ENST00000455263.2_Nonsense_Mutation_p.Q331*|TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Nonsense_Mutation_p.Q331*|TP53_ENST00000445888.2_Nonsense_Mutation_p.Q331*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Nonsense_Mutation_p.Q331*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	331	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		Q -> H (in sporadic cancers; somatic mutation).|Q -> P (in sporadic cancers; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Q331*(23)|p.0?(8)|p.Q331fs*6(2)|p.?(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTTAGTACCTGAAGGGTGAAA	0.448		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.Q331X	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,lung,NS,Substitution - Nonsense,0	.	34	Substitution - Nonsense(23)|Whole gene deletion(8)|Insertion - Frameshift(2)|Unknown(1)	lung(6)|large_intestine(4)|urinary_tract(4)|bone(4)|upper_aerodigestive_tract(3)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|endometrium(2)|skin(2)|ovary(2)|stomach(1)|breast(1)|oesophagus(1)	c.C991T	17						.						115.0	108.0	110.0					17																	7576855		2203	4300	6503	7517580	SO:0001587	stop_gained	7157	exon9	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.991C>T	17.37:g.7576855G>A	ENSP00000269305:p.Gln331*	Somatic		Unspecified	Illumina	Phase_I	7517580	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.117678	0.77323	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	4.95	2.88	0.33553	.	0.253251	0.40469	N	0.001098	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	-17.7352	9.751	0.40475	0.0:0.0:0.4869:0.5131	.	.	.	.	X	331;331;331;331;331;320;199	.	ENSP00000269305:Q331X	Q	-	1	0	TP53	7517580	1.000000	0.71417	1.000000	0.80357	0.680000	0.39746	1.858000	0.39408	0.557000	0.29117	-0.314000	0.08810	CAG		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
ANKFN1	162282	broad.mit.edu	37	17	54431352	54431352	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr17:54431352C>A	ENST00000318698.2	+	5	590	c.555C>A	c.(553-555)aaC>aaA	p.N185K	ANKFN1_ENST00000566473.2_Missense_Mutation_p.N185K	NM_153228.2	NP_694960.2	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	185								p.N185K(1)		NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						TCATGACCAACAATGTGCCCA	0.473																																					p.N185K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C555A	17						.						159.0	118.0	132.0					17																	54431352		2203	4300	6503	51786351	SO:0001583	missense	162282	exon5			AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000318698.2:c.555C>A	17.37:g.54431352C>A	ENSP00000321627:p.Asn185Lys	Somatic		Unspecified	Illumina	Phase_I	51786351	NM_153228		Missense_Mutation	SNP	ENST00000318698.2	37	CCDS32686.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.194551	0.78902	.	.	ENSG00000153930	ENST00000318698	T	0.63913	-0.07	5.22	5.22	0.72569	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.78323	0.4265	M	0.84326	2.69	0.49582	D	0.999807	D	0.89917	1.0	D	0.87578	0.998	T	0.80876	-0.1186	10	0.87932	D	0	-15.7985	9.4991	0.39006	0.0:0.8436:0.0:0.1564	.	185	Q8N957	ANKF1_HUMAN	K	185	ENSP00000321627:N185K	ENSP00000321627:N185K	N	+	3	2	ANKFN1	51786351	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.750000	0.38329	2.426000	0.82243	0.655000	0.94253	AAC		ANKFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338043.1	NM_153228	
LGALS9	3965	broad.mit.edu	37	17	25967751	25967751	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AG-4015-01	TCGA-AG-4015-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr17:25967751delG	ENST00000395473.2	+	3	1753	c.285delG	c.(283-285)aagfs	p.K95fs	LGALS9_ENST00000413914.2_Frame_Shift_Del_p.K38fs|AC015688.3_ENST00000584605.1_3'UTR|LGALS9_ENST00000310394.5_Frame_Shift_Del_p.K95fs|LGALS9_ENST00000302228.5_Frame_Shift_Del_p.K95fs|LGALS9_ENST00000313648.6_Frame_Shift_Del_p.K95fs|LGALS9_ENST00000448970.2_3'UTR	NM_009587.2	NP_033665.1	O00182	LEG9_HUMAN	lectin, galactoside-binding, soluble, 9	95	Galectin 1. {ECO:0000255|PROSITE- ProRule:PRU00639}.				positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|galactose binding (GO:0005534)|signal transducer activity (GO:0004871)	p.M97fs*16(1)		endometrium(3)|large_intestine(2)|lung(12)|skin(1)	18	Lung NSC(42;0.0103)		BRCA - Breast invasive adenocarcinoma(3;0.0141)	UCEC - Uterine corpus endometrioid carcinoma (53;0.155)		CTTTCCAGAAGGGGATGCCCT	0.587																																					p.K95fs	Melanoma(106;677 1527 28724 29571 46552)|Ovarian(193;263 2088 2118 29005 43023)											.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.285delG	17						.						139.0	132.0	134.0					17																	25967751		2203	4300	6503	22991878	SO:0001589	frameshift_variant	3965	exon3			AB006782	CCDS11222.1, CCDS32592.1	17q11.2	2013-03-28	2008-07-25		ENSG00000168961	ENSG00000168961		"""Lectins, galactoside-binding"""	6570	protein-coding gene	gene with protein product	"""galectin 9"""	601879				9045665	Standard	NM_009587		Approved	LGALS9A	uc002gzp.3	O00182	OTTHUMG00000179831	ENST00000395473.2:c.285delG	17.37:g.25967751delG	ENSP00000378856:p.Lys95fs	Somatic		Unspecified	Illumina	Phase_I	22991878	NM_009587	A7VJG6|O14532|O75028|Q3B8N1|Q53FQ0|Q9NQ58	Frame_Shift_Del	DEL	ENST00000395473.2	37	CCDS11222.1																																																																																				LGALS9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255583.1	NM_009587	
RNF213	57674	broad.mit.edu	37	17	78328244	78328244	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr17:78328244C>T	ENST00000582970.1	+	36	10873	c.10730C>T	c.(10729-10731)tCt>tTt	p.S3577F	CTD-2047H16.4_ENST00000572151.1_RNA|CTD-2047H16.4_ENST00000575034.1_RNA|RNF213_ENST00000508628.2_Missense_Mutation_p.S3626F|RNF213_ENST00000336301.6_Missense_Mutation_p.S1650F	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3577					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S1650F(1)|p.S3626F(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			TGTACAGCCTCTTTCTTGCGG	0.547																																					p.S3626F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C10877T	17						.						95.0	89.0	91.0					17																	78328244		2203	4300	6503	75942839	SO:0001583	missense	57674	exon37			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.10730C>T	17.37:g.78328244C>T	ENSP00000464087:p.Ser3577Phe	Somatic		Unspecified	Illumina	Phase_I	75942839	NM_020914	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	C	2.145	-0.395896	0.04899	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T;T	0.24723	1.84;1.85	4.93	3.96	0.45880	.	0.500984	0.22481	N	0.059498	T	0.38348	0.1037	M	0.66939	2.045	0.09310	N	1	P;P	0.46220	0.874;0.49	P;B	0.51355	0.667;0.193	T	0.19484	-1.0304	10	0.66056	D	0.02	.	11.2159	0.48825	0.1437:0.7181:0.1383:0.0	.	3626;1650	C9JCP4;Q63HN8	.;RN213_HUMAN	F	3577;3626;1650	ENSP00000425956:S3577F;ENSP00000338218:S1650F	ENSP00000338218:S1650F	S	+	2	0	RNF213	75942839	0.000000	0.05858	0.002000	0.10522	0.038000	0.13279	0.609000	0.24238	1.091000	0.41335	-0.127000	0.14921	TCT		RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
NCAM2	4685	broad.mit.edu	37	21	22746210	22746210	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-4015-01	TCGA-AG-4015-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr21:22746210G>T	ENST00000400546.1	+	9	1321	c.1072G>T	c.(1072-1074)Ggg>Tgg	p.G358W	NCAM2_ENST00000535285.1_Missense_Mutation_p.G383W|NCAM2_ENST00000284894.7_Missense_Mutation_p.G216W	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	358	Ig-like C2-type 4.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G358W(1)		breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		CGAAGTCAAAGGGCAGCATGG	0.418																																					p.G358W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1072T	21						.						145.0	136.0	139.0					21																	22746210		1932	4124	6056	21668081	SO:0001583	missense	4685	exon9				CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.1072G>T	21.37:g.22746210G>T	ENSP00000383392:p.Gly358Trp	Somatic		Unspecified	Illumina	Phase_I	21668081	NM_004540	A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	ENST00000400546.1	37	CCDS42910.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.948052	0.92593	.	.	ENSG00000154654	ENST00000400546;ENST00000284894;ENST00000535285	T;T;T	0.66815	-0.23;-0.23;-0.23	5.54	5.54	0.83059	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.83202	0.5203	M	0.80422	2.495	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.999	D	0.85007	0.0903	10	0.72032	D	0.01	-14.2	18.1211	0.89572	0.0:0.0:1.0:0.0	.	383;216;358	B7Z841;B7Z5K2;O15394	.;.;NCAM2_HUMAN	W	358;216;383	ENSP00000383392:G358W;ENSP00000284894:G216W;ENSP00000441887:G383W	ENSP00000284894:G216W	G	+	1	0	NCAM2	21668081	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.226000	0.95229	2.618000	0.88619	0.644000	0.83932	GGG		NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540	
NOMO1	23420	broad.mit.edu	37	16	14976468	14976468	+	Silent	SNP	C	C	T			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr16:14976468C>T	ENST00000287667.7	+	26	3216	c.3045C>T	c.(3043-3045)caC>caT	p.H1015H		NM_014287.3	NP_055102.3	Q15155	NOMO1_HUMAN	NODAL modulator 1	1015						integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)	p.H1015H(1)		endometrium(6)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|skin(2)	30						GTGTGTACCACGTTCAGCTCA	0.577																																					p.H1015H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3045T	16						.						74.0	78.0	76.0					16																	14976468		2195	4298	6493	14883969	SO:0001819	synonymous_variant	23420	exon26			X57398	CCDS10556.1	16p13.11	2008-02-05			ENSG00000103512	ENSG00000103512			30060	protein-coding gene	gene with protein product		609157				1310294, 15257293	Standard	NM_014287		Approved	PM5	uc002dcv.3	Q15155	OTTHUMG00000090541	ENST00000287667.7:c.3045C>T	16.37:g.14976468C>T		Somatic		Unspecified	Illumina	Phase_I	14883969	NM_014287	P78421|Q8IW21|Q96DG0	Silent	SNP	ENST00000287667.7	37	CCDS10556.1																																																																																				NOMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207065.1		
PHKB	5257	broad.mit.edu	37	16	47723013	47723013	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-4015-01	TCGA-AG-4015-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr16:47723013G>T	ENST00000323584.5	+	27	2716	c.2692G>T	c.(2692-2694)Gac>Tac	p.D898Y	PHKB_ENST00000566044.1_Missense_Mutation_p.D891Y|PHKB_ENST00000299167.8_Missense_Mutation_p.D898Y|PHKB_ENST00000455779.1_Missense_Mutation_p.D891Y	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	898					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)	p.D898Y(2)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				GCCAGCCTTGGACTTGTATCA	0.463																																					p.D891Y												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2671T	16						.						113.0	100.0	104.0					16																	47723013		2201	4300	6501	46280514	SO:0001583	missense	5257	exon28				CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.2692G>T	16.37:g.47723013G>T	ENSP00000313504:p.Asp898Tyr	Somatic		Unspecified	Illumina	Phase_I	46280514	NM_001031835	Q8N4T5	Missense_Mutation	SNP	ENST00000323584.5	37	CCDS10729.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.963448	0.74016	.	.	ENSG00000102893	ENST00000299167;ENST00000455779;ENST00000323584	D;D	0.91237	-2.81;-2.81	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	D	0.93220	0.7840	L	0.38175	1.15	0.80722	D	1	D;D;D	0.89917	0.998;0.967;1.0	D;P;D	0.78314	0.942;0.851;0.991	D	0.93574	0.6906	10	0.62326	D	0.03	-26.1595	19.5522	0.95324	0.0:0.0:1.0:0.0	.	139;898;891	B3KVX5;Q93100;Q93100-4	.;KPBB_HUMAN;.	Y	891;891;898	ENSP00000414345:D891Y;ENSP00000313504:D898Y	ENSP00000299167:D891Y	D	+	1	0	PHKB	46280514	1.000000	0.71417	0.944000	0.38274	0.419000	0.31324	9.399000	0.97285	2.639000	0.89480	0.650000	0.86243	GAC		PHKB-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000430413.1		
CFAP20	29105	broad.mit.edu	37	16	58147932	58147932	+	Silent	SNP	T	T	C			TCGA-AG-4015-01	TCGA-AG-4015-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr16:58147932T>C	ENST00000262498.3	-	6	913	c.579A>G	c.(577-579)caA>caG	p.Q193Q	CTB-134F13.1_ENST00000564672.1_RNA|C16orf80_ENST00000562443.1_5'Flank	NM_013242.2	NP_037374.1												p.Q193Q(1)		kidney(1)|large_intestine(1)|lung(1)|prostate(1)	4						ATTCCAGTTATTGCTGAAGGG	0.423																																					p.Q193Q	Pancreas(103;1212 1612 18629 30162 52390)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A579G	16						.						149.0	148.0	148.0					16																	58147932		2198	4300	6498	56705433	SO:0001819	synonymous_variant	29105	exon6																														ENST00000262498.3:c.579A>G	16.37:g.58147932T>C		Somatic		Unspecified	Illumina	Phase_I	56705433	NM_013242		Silent	SNP	ENST00000262498.3	37	CCDS10793.1																																																																																				C16orf80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257388.2		
ALDH1L1	10840	broad.mit.edu	37	3	125824614	125824614	+	Missense_Mutation	SNP	C	C	T	rs200290145		TCGA-AG-4015-01	TCGA-AG-4015-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr3:125824614C>T	ENST00000393434.2	-	22	2957	c.2608G>A	c.(2608-2610)Gct>Act	p.A870T	ALDH1L1-AS1_ENST00000512384.1_RNA|ALDH1L1_ENST00000472186.1_Missense_Mutation_p.A870T|ALDH1L1_ENST00000393431.2_3'UTR|ALDH1L1_ENST00000452905.2_Missense_Mutation_p.A769T|ALDH1L1_ENST00000273450.3_Missense_Mutation_p.A880T	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	870	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)	p.A870T(2)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	CCGAAGGGAGCGGCCACGTCG	0.493													C|||	1	0.000199681	0.0	0.0	5008	,	,		18443	0.001		0.0	False		,,,				2504	0.0				p.A870T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2608A	3						.						193.0	184.0	187.0					3																	125824614		2203	4300	6503	127307304	SO:0001583	missense	10840	exon22			AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.2608G>A	3.37:g.125824614C>T	ENSP00000377083:p.Ala870Thr	Somatic		Unspecified	Illumina	Phase_I	127307304	NM_012190	B4DG36|E9PBX3|Q68CS1	Missense_Mutation	SNP	ENST00000393434.2	37	CCDS3034.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	19.67	3.871783	0.72180	.	.	ENSG00000144908	ENST00000273450;ENST00000472186;ENST00000452905;ENST00000393434	T;T;T;T	0.08634	3.07;3.07;3.07;3.07	4.53	4.53	0.55603	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.132430	0.49916	D	0.000126	T	0.21022	0.0506	L	0.45051	1.395	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.996	D;D;P	0.77004	0.973;0.989;0.905	T	0.00448	-1.1733	10	0.52906	T	0.07	.	14.7775	0.69740	0.0:1.0:0.0:0.0	.	769;405;870	E9PBX3;Q6ZV71;O75891	.;.;AL1L1_HUMAN	T	880;870;769;870	ENSP00000273450:A880T;ENSP00000420293:A870T;ENSP00000395881:A769T;ENSP00000377083:A870T	ENSP00000273450:A880T	A	-	1	0	ALDH1L1	127307304	0.859000	0.29813	0.813000	0.32504	0.875000	0.50365	1.695000	0.37763	2.329000	0.79093	0.591000	0.81541	GCT		ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354391.1	NM_012190	
TRIM42	287015	broad.mit.edu	37	3	140401766	140401766	+	Silent	SNP	G	G	A	rs114287544		TCGA-AG-4015-01	TCGA-AG-4015-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr3:140401766G>A	ENST00000286349.3	+	2	995	c.804G>A	c.(802-804)tcG>tcA	p.S268S		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	268						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.S268S(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						CCTTCCACTCGGATGTGGCCA	0.592													G|||	1	0.000199681	0.0	0.0	5008	,	,		20505	0.001		0.0	False		,,,				2504	0.0				p.S268S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G804A	3						.	G		3,4403	6.2+/-15.9	0,3,2200	123.0	108.0	113.0		804	3.6	1.0	3	dbSNP_132	113	0,8600		0,0,4300	no	coding-synonymous	TRIM42	NM_152616.4		0,3,6500	AA,AG,GG		0.0,0.0681,0.0231		268/724	140401766	3,13003	2203	4300	6503	141884456	SO:0001819	synonymous_variant	287015	exon2			AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.804G>A	3.37:g.140401766G>A		Somatic		Unspecified	Illumina	Phase_I	141884456	NM_152616	A1L4B4|Q8N832|Q8NDL3	Silent	SNP	ENST00000286349.3	37	CCDS3113.1																																																																																				TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359531.2	NM_152616	
RASA2	5922	broad.mit.edu	37	3	141272740	141272740	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4015-01	TCGA-AG-4015-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr3:141272740G>A	ENST00000452898.1	+	6	604	c.569G>A	c.(568-570)aGc>aAc	p.S190N	RASA2_ENST00000286364.3_Missense_Mutation_p.S190N	NM_006506.2	NP_006497.2	Q15283	RASA2_HUMAN	RAS p21 protein activator 2	190	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)	p.S190N(2)		NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	34						AATGGCCAAAGCTGTGACCCT	0.318																																					p.S190N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G569A	3						.						127.0	126.0	126.0					3																	141272740		2203	4300	6503	142755430	SO:0001583	missense	5922	exon6			AF115573	CCDS3117.1	3q22-q23	2013-01-10			ENSG00000155903	ENSG00000155903		"""Pleckstrin homology (PH) domain containing"""	9872	protein-coding gene	gene with protein product		601589				8699317	Standard	NM_006506		Approved	GAP1M	uc003etz.1	Q15283	OTTHUMG00000160221	ENST00000452898.1:c.569G>A	3.37:g.141272740G>A	ENSP00000391677:p.Ser190Asn	Somatic		Unspecified	Illumina	Phase_I	142755430	NM_006506	A8K7K1|G3V0F9|O00695|Q15284|Q92594|Q99577|Q9UEQ2	Missense_Mutation	SNP	ENST00000452898.1	37		.	.	.	.	.	.	.	.	.	.	G	12.14	1.849247	0.32699	.	.	ENSG00000155903	ENST00000286364;ENST00000452898	T;T	0.70045	-0.45;-0.45	5.54	5.54	0.83059	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.095290	0.64402	D	0.000001	T	0.55609	0.1931	L	0.45352	1.415	0.39107	D	0.96139	B;B;B	0.09022	0.002;0.002;0.002	B;B;B	0.16289	0.015;0.006;0.01	T	0.52064	-0.8625	10	0.19590	T	0.45	.	10.5818	0.45259	0.1173:0.0:0.8827:0.0	.	190;190;190	A8K7K1;G3V0F9;Q15283	.;.;RASA2_HUMAN	N	190	ENSP00000286364:S190N;ENSP00000391677:S190N	ENSP00000286364:S190N	S	+	2	0	RASA2	142755430	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.473000	0.53122	2.607000	0.88179	0.557000	0.71058	AGC		RASA2-201	KNOWN	basic	protein_coding	protein_coding		NM_006506	
ACKR2	1238	broad.mit.edu	37	3	42907078	42907078	+	Missense_Mutation	SNP	A	A	G	rs551444331		TCGA-AG-4015-01	TCGA-AG-4015-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr3:42907078A>G	ENST00000422265.1	+	3	1259	c.1084A>G	c.(1084-1086)Atg>Gtg	p.M362V	CYP8B1_ENST00000437102.1_Intron|RP11-141M3.5_ENST00000471537.1_RNA|ACKR2_ENST00000273145.2_Missense_Mutation_p.M362V|ACKR2_ENST00000442925.1_Missense_Mutation_p.M362V|KRBOX1_ENST00000426937.1_Intron	NM_001296.4	NP_001287.2	O00590	ACKR2_HUMAN	atypical chemokine receptor 2	362	C-terminal cytoplasmic tail.				chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|multicellular organismal development (GO:0007275)|neutrophil activation (GO:0042119)|receptor-mediated endocytosis (GO:0006898)	actin filament (GO:0005884)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|C-X-C chemokine receptor activity (GO:0016494)|chemokine receptor activity (GO:0004950)|scavenger receptor activity (GO:0005044)	p.M362V(1)									AATGACTGGCATGAATGACCT	0.522																																					p.M362V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1084G	3						.						88.0	84.0	86.0					3																	42907078		2203	4300	6503	42882082	SO:0001583	missense	1238	exon3			U94888	CCDS2706.1	3p21.3	2013-07-17	2013-07-16	2013-07-16	ENSG00000144648	ENSG00000144648		"""GPCR / Class A : Chemokine receptors : Atypical"""	1565	protein-coding gene	gene with protein product		602648	"""chemokine binding protein 2"""	CMKBR9, CCBP2		9364936, 9405404, 16148	Standard	NM_001296		Approved	CCR10, D6, CCR9	uc003cme.3	O00590	OTTHUMG00000133040	ENST00000422265.1:c.1084A>G	3.37:g.42907078A>G	ENSP00000416996:p.Met362Val	Somatic		Unspecified	Illumina	Phase_I	42882082	NM_001296	B2R8Y8|O00537|Q53YA1|Q86UN9|Q96A02	Missense_Mutation	SNP	ENST00000422265.1	37	CCDS2706.1	.	.	.	.	.	.	.	.	.	.	A	7.347	0.622155	0.14193	.	.	ENSG00000144648	ENST00000442925;ENST00000422265;ENST00000273145	T;T;T	0.70986	-0.53;-0.53;-0.53	4.43	1.87	0.25490	.	.	.	.	.	T	0.44477	0.1295	N	0.08118	0	0.25192	N	0.990126	B	0.18461	0.028	B	0.19148	0.024	T	0.25984	-1.0116	8	.	.	.	.	4.7446	0.13031	0.6106:0.1986:0.0:0.1908	.	362	O00590	CCBP2_HUMAN	V	362	ENSP00000396150:M362V;ENSP00000416996:M362V;ENSP00000273145:M362V	.	M	+	1	0	CCBP2	42882082	0.940000	0.31905	0.243000	0.24186	0.382000	0.30200	1.906000	0.39887	0.199000	0.20427	0.533000	0.62120	ATG		ACKR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256645.2	NM_001296	
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-AG-4015-01	TCGA-AG-4015-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.E545K	Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA,urinary_tract,bladder,Substitution - Missense,0	.	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)	c.G1633A	3						.						61.0	60.0	60.0					3																	178936091		1813	4072	5885	180418785	SO:0001583	missense	5290	exon10				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		Unspecified	Illumina	Phase_I	180418785	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG		PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
TCP11L2	255394	broad.mit.edu	37	12	106717424	106717424	+	Splice_Site	SNP	A	A	T			TCGA-AG-4015-01	TCGA-AG-4015-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr12:106717424A>T	ENST00000299045.3	+	6	946	c.772A>T	c.(772-774)Agt>Tgt	p.S258C	TCP11L2_ENST00000547153.1_Splice_Site_p.R258*|TCP11L2_ENST00000546625.1_Missense_Mutation_p.S258C|TCP11L2_ENST00000552690.1_3'UTR	NM_152772.1	NP_689985.1	Q8N4U5	T11L2_HUMAN	t-complex 11, testis-specific-like 2	258								p.S258C(1)		endometrium(2)|kidney(2)|large_intestine(5)|ovary(3)|prostate(1)|urinary_tract(2)	15						AGAAACTCCAAGTGAGTATAA	0.269																																					p.S258C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A772T	12						.						43.0	49.0	47.0					12																	106717424		2203	4298	6501	105241554	SO:0001630	splice_region_variant	255394	exon6			BC033617	CCDS9104.1, CCDS66456.1	12q23.3	2014-08-12	2012-09-20		ENSG00000166046	ENSG00000166046			28627	protein-coding gene	gene with protein product			"""t-complex 11 (mouse) like 2"", ""t-complex 11 (mouse)-like 2"""				Standard	XM_005268769		Approved	MGC40368	uc001tln.3	Q8N4U5	OTTHUMG00000170087	ENST00000299045.3:c.772+1A>T	12.37:g.106717424A>T		Somatic		Unspecified	Illumina	Phase_I	105241554	NM_152772	B2RA65|G3V1Y9	Nonsense_Mutation	SNP	ENST00000299045.3	37	CCDS9104.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	36|36	5.968119|5.968119	0.97156|0.97156	.|.	.|.	ENSG00000166046|ENSG00000166046	ENST00000547153|ENST00000299045;ENST00000546625	.|T;T	.|0.12569	.|2.67;2.67	5.76|5.76	3.22|3.22	0.36961|0.36961	.|.	.|0.402536	.|0.33670	.|N	.|0.004667	.|T	.|0.24547	.|0.0595	L|L	0.55990|0.55990	1.75|1.75	0.38068|0.38068	D|D	0.936292|0.936292	.|D;D	.|0.63046	.|0.985;0.992	.|P;P	.|0.61874	.|0.895;0.863	.|T	.|0.02417	.|-1.1162	.|10	0.59425|0.38643	D|T	0.04|0.18	-6.1535|-6.1535	7.795|7.795	0.29141|0.29141	0.7379:0.0:0.2621:0.0|0.7379:0.0:0.2621:0.0	.|.	.|258;258	.|Q8N4U5;G3V1Z2	.|T11L2_HUMAN;.	X|C	258|258	.|ENSP00000299045:S258C;ENSP00000449123:S258C	ENSP00000448952:R258X|ENSP00000299045:S258C	R|S	+|+	1|1	2|0	TCP11L2|TCP11L2	105241554|105241554	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	4.170000|4.170000	0.58229|0.58229	0.361000|0.361000	0.24292|0.24292	0.533000|0.533000	0.62120|0.62120	AGA|AGT		TCP11L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407206.1	NM_152772	Missense_Mutation
LRP6	4040	broad.mit.edu	37	12	12291420	12291420	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr12:12291420C>T	ENST00000261349.4	-	16	3522	c.3446G>A	c.(3445-3447)gGa>gAa	p.G1149E	BCL2L14_ENST00000396369.1_Intron|LRP6_ENST00000543091.1_Missense_Mutation_p.G1149E	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	1149	Beta-propeller 4.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.G1149E(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				CACAGTAAGTCCCACAGGCTG	0.398																																					p.G1149E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3446A	12						.						177.0	165.0	169.0					12																	12291420		2203	4300	6503	12182687	SO:0001583	missense	4040	exon16			AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.3446G>A	12.37:g.12291420C>T	ENSP00000261349:p.Gly1149Glu	Somatic		Unspecified	Illumina	Phase_I	12182687	NM_002336	Q17RZ2	Missense_Mutation	SNP	ENST00000261349.4	37	CCDS8647.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.883596	0.91740	.	.	ENSG00000070018	ENST00000261349;ENST00000543091	D;D	0.97731	-4.51;-4.51	5.47	5.47	0.80525	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.56097	U	0.000024	D	0.99052	0.9675	M	0.92268	3.29	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99180	1.0867	10	0.46703	T	0.11	.	19.3326	0.94297	0.0:1.0:0.0:0.0	.	1149;1149	F5H7J9;O75581	.;LRP6_HUMAN	E	1149	ENSP00000261349:G1149E;ENSP00000442472:G1149E	ENSP00000261349:G1149E	G	-	2	0	LRP6	12182687	1.000000	0.71417	0.999000	0.59377	0.970000	0.65996	7.487000	0.81328	2.561000	0.86390	0.591000	0.81541	GGA		LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1		
FGD4	121512	broad.mit.edu	37	12	32793313	32793313	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr12:32793313C>T	ENST00000427716.2	+	17	2571	c.2147C>T	c.(2146-2148)tCc>tTc	p.S716F	FGD4_ENST00000546442.1_Missense_Mutation_p.S623F|FGD4_ENST00000534526.2_Missense_Mutation_p.S853F|FGD4_ENST00000531134.1_Missense_Mutation_p.S801F|FGD4_ENST00000525053.1_Missense_Mutation_p.S828F	NM_139241.2	NP_640334.2	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	716	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|microspike assembly (GO:0030035)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.S716F(1)		breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	27	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					CAGTCTAAGTCCGTGCACAGC	0.527																																					p.S716F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2147T	12						.						134.0	116.0	122.0					12																	32793313		2203	4300	6503	32684580	SO:0001583	missense	121512	exon17			AK057294	CCDS8727.1	12p11.1	2014-09-17	2004-08-24		ENSG00000139132	ENSG00000139132		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19125	protein-coding gene	gene with protein product		611104	"""FGD1 family, member 4"""			11527409	Standard	NM_139241		Approved	FRABP, frabin, ZFYVE6, CMT4H	uc001rkz.3	Q96M96	OTTHUMG00000137374	ENST00000427716.2:c.2147C>T	12.37:g.32793313C>T	ENSP00000394487:p.Ser716Phe	Somatic		Unspecified	Illumina	Phase_I	32684580	NM_139241	Q6ULS2|Q8TCP6	Missense_Mutation	SNP	ENST00000427716.2	37	CCDS8727.1	.	.	.	.	.	.	.	.	.	.	C	14.89	2.670947	0.47781	.	.	ENSG00000139132	ENST00000534526;ENST00000531134;ENST00000427716;ENST00000546442;ENST00000525053	T;T;T;T;T	0.12465	2.68;2.68;2.68;2.68;2.68	5.31	4.41	0.53225	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.51477	D	0.000086	T	0.11281	0.0275	L	0.31294	0.92	0.80722	D	1	B;B;B	0.26195	0.126;0.126;0.144	B;B;B	0.32724	0.151;0.151;0.118	T	0.12066	-1.0562	10	0.11794	T	0.64	-13.1109	13.3561	0.60629	0.0:0.924:0.0:0.076	.	828;801;716	E9PJX4;B7Z493;Q96M96	.;.;FGD4_HUMAN	F	853;801;716;623;828	ENSP00000449273:S853F;ENSP00000431323:S801F;ENSP00000394487:S716F;ENSP00000446695:S623F;ENSP00000433666:S828F	ENSP00000394487:S716F	S	+	2	0	FGD4	32684580	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.627000	0.54252	2.470000	0.83445	0.563000	0.77884	TCC		FGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268017.1	NM_139241	
TUBA1B	10376	broad.mit.edu	37	12	49521781	49521781	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-4015-01	TCGA-AG-4015-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr12:49521781G>T	ENST00000336023.5	-	4	1410	c.1316C>A	c.(1315-1317)tCt>tAt	p.S439Y	RP11-386G11.10_ENST00000547387.1_RNA|RP11-386G11.10_ENST00000552893.1_RNA|RP11-386G11.10_ENST00000548149.1_RNA	NM_006082.2	NP_006073.2	P68363	TBA1B_HUMAN	tubulin, alpha 1b	439					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cellular response to interleukin-4 (GO:0071353)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule cytoskeleton organization (GO:0000226)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.S439Y(1)		breast(2)|cervix(1)|endometrium(3)|large_intestine(2)|lung(4)	12						TCCTTCAACAGAATCCACACC	0.498																																					p.S439Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1316A	12						.						137.0	144.0	142.0					12																	49521781		2203	4299	6502	47808048	SO:0001583	missense	10376	exon4			AF081484	CCDS31792.1	12q13.12	2007-02-12				ENSG00000123416		"""Tubulins"""	18809	protein-coding gene	gene with protein product	"""tubulin, alpha, ubiquitous"""	602530				12054644, 6646120	Standard	NM_006082		Approved	K-ALPHA-1	uc001rtm.3	P68363	OTTHUMG00000170410	ENST00000336023.5:c.1316C>A	12.37:g.49521781G>T	ENSP00000336799:p.Ser439Tyr	Somatic		Unspecified	Illumina	Phase_I	47808048	NM_006082	P04687|P05209|Q27I68|Q8WU19	Missense_Mutation	SNP	ENST00000336023.5	37	CCDS31792.1	.	.	.	.	.	.	.	.	.	.	G	12.24	1.879250	0.33162	.	.	ENSG00000123416	ENST00000336023;ENST00000429203	T	0.78595	-1.19	5.45	5.45	0.79879	Tubulin, C-terminal (1);Tubulin/FtsZ, C-terminal (1);	0.000000	0.46442	U	0.000282	D	0.86422	0.5929	M	0.72353	2.195	0.80722	D	1	P	0.52170	0.951	P	0.60012	0.867	D	0.87668	0.2539	10	0.87932	D	0	.	18.058	0.89368	0.0:0.0:1.0:0.0	.	439	P68363	TBA1B_HUMAN	Y	439;170	ENSP00000336799:S439Y	ENSP00000336799:S439Y	S	-	2	0	TUBA1B	47808048	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.467000	0.60155	2.571000	0.86741	0.650000	0.86243	TCT		TUBA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409005.1	NM_006082	
ATF1	466	broad.mit.edu	37	12	51174016	51174016	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr12:51174016C>A	ENST00000262053.3	+	2	110	c.88C>A	c.(88-90)Caa>Aaa	p.Q30K	ATF1_ENST00000539132.1_5'UTR	NM_005171.4	NP_005162.1	P18846	ATF1_HUMAN	activating transcription factor 1	30					cellular protein complex assembly (GO:0043623)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to cobalt ion (GO:0032025)|response to organic cyclic compound (GO:0014070)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q30K(1)	EWSR1/ATF1(347)|FUS/ATF1(4)	breast(1)|large_intestine(1)|ovary(2)	4					Pseudoephedrine(DB00852)	TCATATTGCTCAACAGGTAAG	0.393			T	"""EWSR1, FUS"""	"""malignant melanoma of soft parts , angiomatoid fibrous histiocytoma """																																p.Q30K			Dom	yes		12	12q13	466	activating transcription factor 1		"""E, M"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C88A	12						.						112.0	114.0	114.0					12																	51174016		2203	4300	6503	49460283	SO:0001583	missense	466	exon2			BC029619	CCDS8803.1	12q13	2014-05-13			ENSG00000123268	ENSG00000123268		"""basic leucine zipper proteins"""	783	protein-coding gene	gene with protein product		123803				8401579	Standard	NM_005171		Approved	TREB36	uc001rww.4	P18846		ENST00000262053.3:c.88C>A	12.37:g.51174016C>A	ENSP00000262053:p.Gln30Lys	Somatic		Unspecified	Illumina	Phase_I	49460283	NM_005171	B4DRF9|P25168|Q9H4A8	Missense_Mutation	SNP	ENST00000262053.3	37	CCDS8803.1	.	.	.	.	.	.	.	.	.	.	C	11.37	1.617499	0.28801	.	.	ENSG00000123268	ENST00000552510;ENST00000262053;ENST00000552487	T;T;T	0.78126	-1.15;0.48;0.46	5.47	5.47	0.80525	.	0.450874	0.21198	N	0.078506	T	0.56863	0.2014	N	0.08118	0	0.80722	D	1	B	0.19200	0.034	B	0.14023	0.01	T	0.54990	-0.8210	10	0.05959	T	0.93	-25.1398	15.1991	0.73120	0.0:1.0:0.0:0.0	.	30	P18846	ATF1_HUMAN	K	30	ENSP00000448592:Q30K;ENSP00000262053:Q30K;ENSP00000448921:Q30K	ENSP00000262053:Q30K	Q	+	1	0	ATF1	49460283	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	3.618000	0.54188	2.743000	0.94032	0.591000	0.81541	CAA		ATF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404285.1	NM_005171	
KRT6B	3854	broad.mit.edu	37	12	52844355	52844355	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-4015-01	TCGA-AG-4015-01	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr12:52844355A>G	ENST00000252252.3	-	2	637	c.590T>C	c.(589-591)cTg>cCg	p.L197P		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	197	Coil 1A.|Rod.				ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		CTCCTGCAGCAGGGTCCACTT	0.552																																					p.L197P												.	.	0			c.T590C	12						.						70.0	78.0	75.0					12																	52844355		2203	4297	6500	51130622	SO:0001583	missense	3854	exon2			BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.590T>C	12.37:g.52844355A>G	ENSP00000252252:p.Leu197Pro	None		Unspecified	Illumina	Phase_I	51130622	NM_005555	P48669	Missense_Mutation	SNP	ENST00000252252.3	37	CCDS8828.1	.	.	.	.	.	.	.	.	.	.	A	17.33	3.361157	0.61403	.	.	ENSG00000185479	ENST00000252252;ENST00000544607	T	0.75477	-0.94	2.91	1.76	0.24704	Filament (1);	0.000000	0.44688	D	0.000440	D	0.89993	0.6876	H	0.98849	4.35	0.58432	D	0.999998	D	0.89917	1.0	D	0.87578	0.998	D	0.89002	0.3422	10	0.87932	D	0	.	8.355	0.32324	0.9003:0.0:0.0997:0.0	.	197	P04259	K2C6B_HUMAN	P	197	ENSP00000252252:L197P	ENSP00000252252:L197P	L	-	2	0	KRT6B	51130622	1.000000	0.71417	0.994000	0.49952	0.996000	0.88848	5.031000	0.64134	0.532000	0.28657	0.373000	0.22412	CTG		KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404969.1	NM_005555	
ATF7	11016	broad.mit.edu	37	12	53931208	53931208	+	Silent	SNP	C	C	T			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr12:53931208C>T	ENST00000548446.2	-	5	538	c.426G>A	c.(424-426)ctG>ctA	p.L142L	ATF7_ENST00000456903.4_Silent_p.L131L|RP11-793H13.10_ENST00000591834.1_Silent_p.L131L|ATF7_ENST00000415113.1_Intron|ATF7_ENST00000328463.7_Silent_p.L142L|ATF7_ENST00000420353.2_Silent_p.L131L			P17544	ATF7_HUMAN	activating transcription factor 7	142	Transactivation domain.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mitogen-activated protein kinase binding (GO:0051019)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.L142L(2)		endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)|urinary_tract(1)	9					Pseudoephedrine(DB00852)	CCTTCTCCTTCAGTGGTGGGG	0.413																																					p.L131L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G393A	12						.						109.0	111.0	110.0					12																	53931208		1861	4108	5969	52217475	SO:0001819	synonymous_variant	11016	exon5			X52943	CCDS44906.1, CCDS58238.1	12q13	2013-01-10				ENSG00000170653		"""basic leucine zipper proteins"""	792	protein-coding gene	gene with protein product		606371				1694576, 11278933	Standard	NM_006856		Approved	ATFA	uc001sdz.3	P17544	OTTHUMG00000169776	ENST00000548446.2:c.426G>A	12.37:g.53931208C>T		Somatic		Unspecified	Illumina	Phase_I	52217475	NM_006856	A5D6Y4|B2RMP1|B4DQL4|Q13814|Q8IVR8|Q9UD83	Silent	SNP	ENST00000548446.2	37																																																																																					ATF7-007	KNOWN	NMD_exception|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000406302.2	NM_001130059	
PMEL	6490	broad.mit.edu	37	12	56350928	56350928	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-4015-01	TCGA-AG-4015-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr12:56350928T>C	ENST00000548747.1	-	6	1821	c.1159A>G	c.(1159-1161)Acc>Gcc	p.T387A	PMEL_ENST00000548689.1_5'Flank|PMEL_ENST00000449260.2_Missense_Mutation_p.T387A|PMEL_ENST00000539511.1_Missense_Mutation_p.T301A|PMEL_ENST00000552882.1_Missense_Mutation_p.T387A|PMEL_ENST00000550464.1_Missense_Mutation_p.T301A|PMEL_ENST00000536427.1_Intron|PMEL_ENST00000360714.4_Missense_Mutation_p.T387A|PMEL_ENST00000548493.1_Missense_Mutation_p.T387A|PMEL_ENST00000550447.1_Intron			P40967	PMEL_HUMAN	premelanosome protein	387	10 X 13 AA approximate tandem repeats, RPT domain.				melanin biosynthetic process (GO:0042438)|melanosome organization (GO:0032438)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|multivesicular body membrane (GO:0032585)|plasma membrane (GO:0005886)		p.T387A(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GCCAGTGTGGTACCCATGACC	0.517																																					p.T387A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1159G	12						.						134.0	106.0	116.0					12																	56350928		2203	4300	6503	54637195	SO:0001583	missense	6490	exon6			AK092881	CCDS8897.1, CCDS55833.1, CCDS55834.1	12q13-q14	2010-12-17	2010-12-17	2010-12-17	ENSG00000185664	ENSG00000185664			10880	protein-coding gene	gene with protein product		155550	"""silver (mouse homolog) like"", ""silver homolog (mouse)"""	SIL, SILV		8739560	Standard	NM_001200053		Approved	D12S53E, SI, Pmel17, gp100	uc001siq.3	P40967		ENST00000548747.1:c.1159A>G	12.37:g.56350928T>C	ENSP00000448828:p.Thr387Ala	Somatic		Unspecified	Illumina	Phase_I	54637195	NM_006928	B3KS57|B7Z6D7|Q12763|Q14448|Q14817|Q16565	Missense_Mutation	SNP	ENST00000548747.1	37	CCDS8897.1	.	.	.	.	.	.	.	.	.	.	T	17.97	3.518406	0.64634	.	.	ENSG00000185664	ENST00000449260;ENST00000552882;ENST00000550464;ENST00000548747;ENST00000548493;ENST00000360714;ENST00000539511;ENST00000547137	T;T;T;T;T;T;T;T	0.14893	3.0;3.04;3.03;3.04;3.04;3.0;3.03;2.47	5.66	4.52	0.55395	.	0.101050	0.43579	N	0.000555	T	0.31420	0.0796	L	0.52573	1.65	0.58432	D	0.999999	D;D;D	0.76494	0.998;0.999;0.998	D;D;D	0.81914	0.914;0.995;0.989	T	0.01899	-1.1251	10	0.37606	T	0.19	-10.315	8.8846	0.35396	0.0:0.0845:0.0:0.9155	.	301;387;387	P40967-3;P40967-2;P40967	.;.;PMEL_HUMAN	A	387;387;301;387;387;387;301;333	ENSP00000402758:T387A;ENSP00000449690:T387A;ENSP00000450036:T301A;ENSP00000448828:T387A;ENSP00000447374:T387A;ENSP00000353940:T387A;ENSP00000445005:T301A;ENSP00000448849:T333A	ENSP00000353940:T387A	T	-	1	0	PMEL	54637195	0.792000	0.28813	0.871000	0.34182	0.364000	0.29643	1.021000	0.30040	1.087000	0.41251	-0.264000	0.10439	ACC		PMEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409626.1	NM_006928	
EEA1	8411	broad.mit.edu	37	12	93192846	93192846	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-4015-01	TCGA-AG-4015-01	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr12:93192846T>G	ENST00000322349.8	-	21	3053	c.2789A>C	c.(2788-2790)aAa>aCa	p.K930T		NM_003566.3	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1	930					early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|synaptic vesicle to endosome fusion (GO:0016189)|vesicle fusion (GO:0006906)	axonal spine (GO:0044308)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|recycling endosome (GO:0055037)|serine-pyruvate aminotransferase complex (GO:0005969)	1-phosphatidylinositol binding (GO:0005545)|calmodulin binding (GO:0005516)|GTP-dependent protein binding (GO:0030742)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(11)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	36						GAGTTCCAATTTCAACTGATG	0.313																																					p.K930T												.	.	0			c.A2789C	12						.						63.0	56.0	58.0					12																	93192846		2203	4299	6502	91716977	SO:0001583	missense	8411	exon21			L40157	CCDS31874.1	12q22	2007-02-23	2007-02-23			ENSG00000102189		"""Zinc fingers, FYVE domain containing"""	3185	protein-coding gene	gene with protein product		605070	"""early endosome antigen 1, 162kD"""			7768953, 9697774	Standard	NM_003566		Approved	ZFYVE2	uc001tck.3	Q15075	OTTHUMG00000170110	ENST00000322349.8:c.2789A>C	12.37:g.93192846T>G	ENSP00000317955:p.Lys930Thr	None		Unspecified	Illumina	Phase_I	91716977	NM_003566	Q14221	Missense_Mutation	SNP	ENST00000322349.8	37	CCDS31874.1	.	.	.	.	.	.	.	.	.	.	T	11.70	1.717738	0.30413	.	.	ENSG00000102189	ENST00000322349	T	0.67865	-0.29	5.25	-0.632	0.11523	.	0.423527	0.19524	N	0.112206	T	0.43722	0.1260	N	0.19112	0.55	0.27526	N	0.951237	B	0.02656	0.0	B	0.04013	0.001	T	0.22208	-1.0223	10	0.22109	T	0.4	.	7.9492	0.30003	0.1319:0.0:0.5124:0.3556	.	930	Q15075	EEA1_HUMAN	T	930	ENSP00000317955:K930T	ENSP00000317955:K930T	K	-	2	0	EEA1	91716977	0.794000	0.28838	0.875000	0.34327	0.920000	0.55202	0.917000	0.28665	-0.033000	0.13736	0.482000	0.46254	AAA		EEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407304.1	NM_003566	
PTPN11	5781	broad.mit.edu	37	12	112891129	112891129	+	Missense_Mutation	SNP	G	G	T	rs398122858		TCGA-AG-4015-01	TCGA-AG-4015-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr12:112891129G>T	ENST00000351677.2	+	4	661	c.463G>T	c.(463-465)Gat>Tat	p.D155Y	PTPN11_ENST00000392597.1_Missense_Mutation_p.D155Y	NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	155	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)	p.D155Y(1)		NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						GCGCACTGGTGATGACAAAGG	0.433			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																												p.D155Y			Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G463T	12						.						131.0	126.0	128.0					12																	112891129		2203	4300	6503	111375512	SO:0001583	missense	5781	exon4	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.463G>T	12.37:g.112891129G>T	ENSP00000340944:p.Asp155Tyr	Somatic		Unspecified	Illumina	Phase_I	111375512	NM_002834	A8K1D9|Q96HD7	Missense_Mutation	SNP	ENST00000351677.2	37	CCDS9163.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.914121	0.92178	.	.	ENSG00000179295	ENST00000392597;ENST00000351677;ENST00000392596	T;T	0.78481	-1.18;-1.18	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.90092	0.6905	M	0.88512	2.96	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.68621	0.959;0.959	D	0.91520	0.5234	10	0.87932	D	0	.	19.5088	0.95132	0.0:0.0:1.0:0.0	.	155;155	Q06124-2;Q06124-3	.;.	Y	155	ENSP00000376376:D155Y;ENSP00000340944:D155Y	ENSP00000340944:D155Y	D	+	1	0	PTPN11	111375512	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.860000	0.99555	2.624000	0.88883	0.555000	0.69702	GAT		PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259496.2		
AQP9	366	broad.mit.edu	37	15	58465336	58465336	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr15:58465336C>T	ENST00000219919.4	+	3	678	c.308C>T	c.(307-309)cCa>cTa	p.P103L	ALDH1A2_ENST00000558231.1_Intron|AQP9_ENST00000536493.1_Missense_Mutation_p.P103L|AQP9_ENST00000558772.1_Missense_Mutation_p.P38L	NM_020980.3	NP_066190.2	O43315	AQP9_HUMAN	aquaporin 9	103					amine transport (GO:0015837)|canalicular bile acid transport (GO:0015722)|carboxylic acid transport (GO:0046942)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|glycerol transport (GO:0015793)|immune response (GO:0006955)|metabolic process (GO:0008152)|polyol transport (GO:0015791)|purine nucleobase transport (GO:0006863)|pyrimidine nucleobase transport (GO:0015855)|pyrimidine-containing compound transmembrane transport (GO:0072531)|response to mercury ion (GO:0046689)|response to organic substance (GO:0010033)|response to osmotic stress (GO:0006970)|transmembrane transport (GO:0055085)|transport (GO:0006810)|water homeostasis (GO:0030104)|water transport (GO:0006833)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carboxylic acid transmembrane transporter activity (GO:0046943)|glycerol channel activity (GO:0015254)|polyol transmembrane transporter activity (GO:0015166)|porin activity (GO:0015288)|purine nucleobase transmembrane transporter activity (GO:0005345)|pyrimidine nucleobase transmembrane transporter activity (GO:0005350)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)	p.P103L(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)	21				GBM - Glioblastoma multiforme(80;0.16)		TTCAAATTGCCATTTTATGTG	0.488																																					p.P103L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C308T	15						.						197.0	194.0	195.0					15																	58465336		2192	4292	6484	56252628	SO:0001583	missense	366	exon3			AF016495	CCDS10165.1	15q	2005-09-20			ENSG00000103569	ENSG00000103569		"""Ion channels / Aquaporins"""	643	protein-coding gene	gene with protein product		602914					Standard	NM_020980		Approved	SSC1, HsT17287	uc002aez.2	O43315	OTTHUMG00000132631	ENST00000219919.4:c.308C>T	15.37:g.58465336C>T	ENSP00000219919:p.Pro103Leu	Somatic		Unspecified	Illumina	Phase_I	56252628	NM_020980	Q9NP32	Missense_Mutation	SNP	ENST00000219919.4	37	CCDS10165.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.055814	0.76074	.	.	ENSG00000103569	ENST00000219919;ENST00000536493	D;D	0.84298	-1.83;-1.83	5.46	5.46	0.80206	Aquaporin-like (2);	0.000000	0.85682	D	0.000000	D	0.90235	0.6947	L	0.55990	1.75	0.80722	D	1	D	0.59357	0.985	D	0.63381	0.914	D	0.89555	0.3802	10	0.51188	T	0.08	.	19.5125	0.95148	0.0:1.0:0.0:0.0	.	103	O43315	AQP9_HUMAN	L	103	ENSP00000219919:P103L;ENSP00000441390:P103L	ENSP00000219919:P103L	P	+	2	0	AQP9	56252628	1.000000	0.71417	0.760000	0.31359	0.929000	0.56500	7.410000	0.80065	2.840000	0.97914	0.655000	0.94253	CCA		AQP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255878.2	NM_020980	
HMG20A	10363	broad.mit.edu	37	15	77771527	77771527	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-4015-01	TCGA-AG-4015-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr15:77771527G>T	ENST00000381714.3	+	10	1342	c.914G>T	c.(913-915)gGa>gTa	p.G305V	HMG20A_ENST00000336216.4_Missense_Mutation_p.G305V	NM_018200.2	NP_060670.1	Q9NP66	HM20A_HUMAN	high mobility group 20A	305					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G305V(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18						TCAGGAAGTGGAGAGACACCT	0.368																																					p.G305V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G914T	15						.						130.0	131.0	131.0					15																	77771527		2196	4294	6490	75558582	SO:0001583	missense	10363	exon10			AF146222	CCDS10295.1	15q24	2011-07-01	2011-04-05		ENSG00000140382	ENSG00000140382		"""High mobility group / Non-canonical"""	5001	protein-coding gene	gene with protein product	"""HMG box domain containing 1"""	605534	"""high-mobility group 20A"""			10773667	Standard	NM_018200		Approved	HMGX1, FLJ10739, HMGXB1	uc002bcr.3	Q9NP66	OTTHUMG00000143729	ENST00000381714.3:c.914G>T	15.37:g.77771527G>T	ENSP00000371133:p.Gly305Val	Somatic		Unspecified	Illumina	Phase_I	75558582	NM_018200	A6NHY3|D3DW78|Q53G31|Q9NSF6	Missense_Mutation	SNP	ENST00000381714.3	37	CCDS10295.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.321104	0.81580	.	.	ENSG00000140382	ENST00000336216;ENST00000381714	T;T	0.68765	-0.35;-0.35	6.04	6.04	0.98038	.	0.151278	0.64402	N	0.000011	T	0.76162	0.3949	M	0.69823	2.125	0.80722	D	1	D	0.55172	0.97	P	0.53809	0.735	T	0.77435	-0.2589	10	0.59425	D	0.04	-12.4166	16.0072	0.80372	0.0:0.1336:0.8664:0.0	.	305	Q9NP66	HM20A_HUMAN	V	305	ENSP00000336856:G305V;ENSP00000371133:G305V	ENSP00000336856:G305V	G	+	2	0	HMG20A	75558582	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.513000	0.81739	2.873000	0.98535	0.563000	0.77884	GGA		HMG20A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419512.2	NM_018200	
LRRK1	79705	broad.mit.edu	37	15	101605592	101605592	+	Silent	SNP	G	G	A			TCGA-AG-4015-01	TCGA-AG-4015-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr15:101605592G>A	ENST00000388948.3	+	32	5309	c.4950G>A	c.(4948-4950)ggG>ggA	p.G1650G	RP11-505E24.2_ENST00000559857.1_RNA|LRRK1_ENST00000532145.1_3'UTR|LRRK1_ENST00000284395.5_Silent_p.G1647G	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1									p.G1662G(1)|p.G1650G(1)		breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TCGCCGATGGGCTTGTGGCTG	0.562																																					p.G1650G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G4950A	15						.						80.0	92.0	88.0					15																	101605592		2085	4217	6302	99423115	SO:0001819	synonymous_variant	79705	exon32			AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.4950G>A	15.37:g.101605592G>A		Somatic		Unspecified	Illumina	Phase_I	99423115	NM_024652		Silent	SNP	ENST00000388948.3	37	CCDS42086.1																																																																																				LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652	
CENPE	1062	broad.mit.edu	37	4	104030086	104030086	+	Missense_Mutation	SNP	G	G	A	rs187303852	byFrequency	TCGA-AG-4015-01	TCGA-AG-4015-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr4:104030086G>A	ENST00000265148.3	-	48	7974	c.7885C>T	c.(7885-7887)Cgg>Tgg	p.R2629W	CENPE_ENST00000380026.3_Missense_Mutation_p.R2508W	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	2629	Globular autoinhibitory domain. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)	p.R2592W(1)		NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TGTAAATTCCGTTCCTTGCAT	0.388													G|||	3	0.000599042	0.0	0.0	5008	,	,		17838	0.001		0.0	False		,,,				2504	0.002				p.R2629W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C7885T	4						.	G	TRP/ARG	0,4406		0,0,2203	190.0	187.0	188.0		7885	0.3	0.0	4		188	1,8599	1.2+/-3.3	0,1,4299	no	missense	CENPE	NM_001813.2	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	2629/2702	104030086	1,13005	2203	4300	6503	104249535	SO:0001583	missense	1062	exon48			Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.7885C>T	4.37:g.104030086G>A	ENSP00000265148:p.Arg2629Trp	Somatic		Unspecified	Illumina	Phase_I	104249535	NM_001813	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	ENST00000265148.3	37	CCDS34042.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	13.38	2.218621	0.39201	0.0	1.16E-4	ENSG00000138778	ENST00000265148;ENST00000380026	T;T	0.69561	-0.41;-0.4	5.19	0.266	0.15617	.	.	.	.	.	T	0.51398	0.1672	L	0.44542	1.39	0.09310	N	1	B;B	0.17465	0.022;0.013	B;B	0.12156	0.007;0.003	T	0.46133	-0.9213	9	0.62326	D	0.03	.	1.4703	0.02414	0.1657:0.1422:0.3994:0.2926	.	2508;2629	Q02224-3;Q02224	.;CENPE_HUMAN	W	2629;2508	ENSP00000265148:R2629W;ENSP00000369365:R2508W	ENSP00000265148:R2629W	R	-	1	2	CENPE	104249535	0.000000	0.05858	0.000000	0.03702	0.475000	0.33008	0.277000	0.18734	-0.306000	0.08818	-0.150000	0.13652	CGG		CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
TRPC3	7222	broad.mit.edu	37	4	122853894	122853894	+	Silent	SNP	C	C	T	rs201407818		TCGA-AG-4015-01	TCGA-AG-4015-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr4:122853894C>T	ENST00000379645.3	-	2	592	c.519G>A	c.(517-519)gcG>gcA	p.A173A	TRPC3_ENST00000264811.5_Silent_p.A100A|TRPC3_ENST00000513531.1_Silent_p.A100A	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	88					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.A100A(1)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						CGCCAATGCGCGCCAGGTTCT	0.637																																					p.A100A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G300A	4						.						63.0	54.0	57.0					4																	122853894		2203	4300	6503	123073344	SO:0001819	synonymous_variant	7222	exon1			Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.519G>A	4.37:g.122853894C>T		Somatic		Unspecified	Illumina	Phase_I	123073344	NM_003305	A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Silent	SNP	ENST00000379645.3	37	CCDS47130.1																																																																																				TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364252.1	NM_003305	
KDR	3791	broad.mit.edu	37	4	55964966	55964966	+	Silent	SNP	G	G	A			TCGA-AG-4015-01	TCGA-AG-4015-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr4:55964966G>A	ENST00000263923.4	-	16	2566	c.2271C>T	c.(2269-2271)gcC>gcT	p.A757A		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	757					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.A757A(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCTTTTCCTGGGCACCTGGAA	0.403			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																											p.A757A			Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2271T	4						.						88.0	87.0	87.0					4																	55964966		2203	4300	6503	55659723	SO:0001819	synonymous_variant	3791	exon16			AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.2271C>T	4.37:g.55964966G>A		Somatic		Unspecified	Illumina	Phase_I	55659723	NM_002253	A2RRS0|B5A925|C5IFA0|O60723|Q14178	Silent	SNP	ENST00000263923.4	37	CCDS3497.1																																																																																				KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1		
CCDC158	339965	broad.mit.edu	37	4	77244562	77244563	+	Splice_Site	DNP	TC	TC	AG			TCGA-AG-4015-01	TCGA-AG-4015-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr4:77244562_77244563TC>AG	ENST00000388914.3	-	23	3310	c.3158_3158GA>CT	c.(3157-3159)gGAa>gCTaa	p.G1053A		NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	1053	Ser-rich.							p.?(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						AGACTGTGAATCTATTAGAAAA	0.327																																					.												.	.	1	Unknown(1)	large_intestine(1)	c.3158_3158CT	4						.																																			77463587	SO:0001630	splice_region_variant	339965	exon23			BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.3158_3158delinsAG	4.37:g.77244562_77244563delinsAG		Somatic		Unspecified	Illumina	Phase_I	77463586	NM_001042784	Q8IYQ1|Q8N7D4|Q8N7E3	Splice_Site	DNP	ENST00000388914.3	37	CCDS43242.1																																																																																				CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362694.2	NM_001042784	Missense_Mutation
GRID2	2895	broad.mit.edu	37	4	94436464	94436464	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-4015-01	TCGA-AG-4015-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr4:94436464T>C	ENST00000282020.4	+	13	2353	c.2095T>C	c.(2095-2097)Ttt>Ctt	p.F699L	GRID2_ENST00000510992.1_Missense_Mutation_p.F604L	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	699					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)	p.F699L(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		ACTGAATCCTTTTGAGAGGGA	0.483																																					p.F699L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2095C	4						.						119.0	105.0	110.0					4																	94436464		2203	4300	6503	94655487	SO:0001583	missense	2895	exon13			AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.2095T>C	4.37:g.94436464T>C	ENSP00000282020:p.Phe699Leu	Somatic		Unspecified	Illumina	Phase_I	94655487	NM_001510	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	ENST00000282020.4	37	CCDS3637.1	.	.	.	.	.	.	.	.	.	.	T	9.382	1.073197	0.20147	.	.	ENSG00000152208	ENST00000282020;ENST00000510992	T;T	0.14516	2.52;2.5	5.1	5.1	0.69264	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.05960	0.0155	N	0.02916	-0.46	0.58432	D	0.999997	B;B	0.09022	0.002;0.001	B;B	0.06405	0.002;0.001	T	0.27673	-1.0067	10	0.08381	T	0.77	.	15.1709	0.72872	0.0:0.0:0.0:1.0	.	604;699	E9PH24;O43424	.;GRID2_HUMAN	L	699;604	ENSP00000282020:F699L;ENSP00000421257:F604L	ENSP00000282020:F699L	F	+	1	0	GRID2	94655487	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	3.456000	0.53000	2.045000	0.60652	0.477000	0.44152	TTT		GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253588.2		
TKTL2	84076	broad.mit.edu	37	4	164394816	164394816	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr4:164394816C>T	ENST00000280605.3	-	1	231	c.71G>A	c.(70-72)cGg>cAg	p.R24Q		NM_032136.4	NP_115512.3	Q9H0I9	TKTL2_HUMAN	transketolase-like 2	24						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)	p.R24Q(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(42)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	70	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				GGAATGGATCCGCAGGCGGTT	0.602																																					p.R24Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G71A	4						.						54.0	45.0	48.0					4																	164394816		2203	4300	6503	164614266	SO:0001583	missense	84076	exon1			BC028707	CCDS3805.1	4q32.2	2009-10-06			ENSG00000151005	ENSG00000151005			25313	protein-coding gene	gene with protein product	"""similar to transketolase"""					11230166	Standard	NM_032136		Approved	FLJ32975, DKFZP434L1717	uc003iqp.4	Q9H0I9	OTTHUMG00000161527	ENST00000280605.3:c.71G>A	4.37:g.164394816C>T	ENSP00000280605:p.Arg24Gln	Somatic		Unspecified	Illumina	Phase_I	164614266	NM_032136	A4FVB4|Q8NCT0|Q96M82	Missense_Mutation	SNP	ENST00000280605.3	37	CCDS3805.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.697334	0.88830	.	.	ENSG00000151005	ENST00000280605	T	0.56941	0.43	4.22	4.22	0.49857	Transketolase, N-terminal (1);	0.000000	0.64402	U	0.000005	T	0.81484	0.4832	H	0.97659	4.05	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	D	0.88018	0.2767	10	0.87932	D	0	-8.4083	14.4807	0.67579	0.0:1.0:0.0:0.0	.	24	Q9H0I9	TKTL2_HUMAN	Q	24	ENSP00000280605:R24Q	ENSP00000280605:R24Q	R	-	2	0	TKTL2	164614266	1.000000	0.71417	0.963000	0.40424	0.758000	0.43043	4.253000	0.58791	2.353000	0.79882	0.491000	0.48974	CGG		TKTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365207.1	NM_032136	
ATXN3L	92552	broad.mit.edu	37	X	13337039	13337039	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chrX:13337039C>T	ENST00000380622.2	-	1	1479	c.1015G>A	c.(1015-1017)Gac>Aac	p.D339N	GS1-600G8.3_ENST00000431486.1_RNA	NM_001135995.1	NP_001129467.1	Q9H3M9	ATX3L_HUMAN	ataxin 3-like	339					protein deubiquitination (GO:0016579)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	omega peptidase activity (GO:0008242)|ubiquitin-specific protease activity (GO:0004843)	p.D339N(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	28						AAAATGGTGTCGACAGCGGCC	0.378																																					p.D339N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1015A	X						.						158.0	138.0	144.0					X																	13337039		1568	3582	5150	13246960	SO:0001583	missense	92552	exon1				CCDS48080.1	Xp22	2010-09-30			ENSG00000123594	ENSG00000123594			24173	protein-coding gene	gene with protein product		300920					Standard	NM_001135995		Approved	MJDL	uc010ned.3	Q9H3M9	OTTHUMG00000021146	ENST00000380622.2:c.1015G>A	X.37:g.13337039C>T	ENSP00000369996:p.Asp339Asn	Somatic		Unspecified	Illumina	Phase_I	13246960	NM_001135995	B2RNY8	Missense_Mutation	SNP	ENST00000380622.2	37	CCDS48080.1	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.956769	0.00465	.	.	ENSG00000123594	ENST00000380622	T	0.15256	2.44	0.657	-0.517	0.11947	.	0.218405	0.38548	N	0.001643	T	0.04907	0.0132	N	0.04508	-0.205	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.39375	-0.9617	9	0.07175	T	0.84	.	.	.	.	.	339	Q9H3M9	ATX3L_HUMAN	N	339	ENSP00000369996:D339N	ENSP00000369996:D339N	D	-	1	0	ATXN3L	13246960	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	-0.901000	0.04093	-0.292000	0.08999	0.284000	0.19432	GAC		ATXN3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055785.2	NM_001135995	
RGAG1	57529	broad.mit.edu	37	X	109696416	109696416	+	Silent	SNP	G	G	A			TCGA-AG-4015-01	TCGA-AG-4015-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chrX:109696416G>A	ENST00000465301.2	+	3	2817	c.2571G>A	c.(2569-2571)ggG>ggA	p.G857G	RGAG1_ENST00000540313.1_Silent_p.G857G	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	857								p.G857G(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						CCTCTGGAGGGATGTCCATGC	0.532																																					p.G857G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2571A	X						.						174.0	161.0	165.0					X																	109696416		2203	4300	6503	109583072	SO:0001819	synonymous_variant	57529	exon3			AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.2571G>A	X.37:g.109696416G>A		Somatic		Unspecified	Illumina	Phase_I	109583072	NM_020769	Q9P2M8	Silent	SNP	ENST00000465301.2	37	CCDS14552.1																																																																																				RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769	
MAGEC3	139081	broad.mit.edu	37	X	140983314	140983314	+	Silent	SNP	C	C	T	rs188167309		TCGA-AG-4015-01	TCGA-AG-4015-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chrX:140983314C>T	ENST00000298296.1	+	6	1092	c.1092C>T	c.(1090-1092)acC>acT	p.T364T	MAGEC3_ENST00000544766.1_Intron|MAGEC3_ENST00000409007.1_5'Flank|MAGEC3_ENST00000443323.2_Intron|MAGEC3_ENST00000448920.1_3'UTR|MAGEC3_ENST00000536088.1_Intron|MAGEC3_ENST00000483584.1_Intron	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	364	MAGE 1. {ECO:0000255|PROSITE- ProRule:PRU00127}.			GLTEASPQQKKGG -> SSPLPSTLILGVP (in Ref. 3). {ECO:0000305}.				p.T364T(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					GAGGGCTGACCGAGGCGTCCC	0.612													G|||	1	0.000264901	0.0	0.0	3775	,	,		7247	0.001		0.0	False		,,,				2504	0.0				p.T364T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1092T	X						.						34.0	35.0	35.0					X																	140983314		2201	4296	6497	140810980	SO:0001819	synonymous_variant	139081	exon6			AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.1092C>T	X.37:g.140983314C>T		Somatic		Unspecified	Illumina	Phase_I	140810980	NM_138702	Q3SYA7|Q5JZ43|Q9BZ80	Silent	SNP	ENST00000298296.1	37	CCDS14676.1																																																																																				MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058606.1	NM_138702	
RP2	6102	broad.mit.edu	37	X	46713275	46713275	+	Missense_Mutation	SNP	C	C	A	rs35565082		TCGA-AG-4015-01	TCGA-AG-4015-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chrX:46713275C>A	ENST00000218340.3	+	2	628	c.467C>A	c.(466-468)gCt>gAt	p.A156D		NM_006915.2	NP_008846.2	O75695	XRP2_HUMAN	retinitis pigmentosa 2 (X-linked recessive)	156	C-CAP/cofactor C-like. {ECO:0000255|PROSITE-ProRule:PRU00659}.				cell morphogenesis (GO:0000902)|CTP biosynthetic process (GO:0006241)|cytoskeleton organization (GO:0007010)|GTP biosynthetic process (GO:0006183)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein transport (GO:0015031)|UTP biosynthetic process (GO:0006228)|visual perception (GO:0007601)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|periciliary membrane compartment (GO:1990075)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|nucleoside diphosphate kinase activity (GO:0004550)|unfolded protein binding (GO:0051082)	p.A156D(1)		NS(1)|large_intestine(4)|lung(5)|stomach(1)	11						CCTGAATTAGCTTTCCAGTTC	0.393																																					p.A156D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C467A	X						.						111.0	100.0	103.0					X																	46713275		2203	4300	6503	46598219	SO:0001583	missense	6102	exon2			AJ007590	CCDS14270.1	Xp11.3	2013-01-08			ENSG00000102218	ENSG00000102218			10274	protein-coding gene	gene with protein product		300757				6325945, 9697692, 19852809	Standard	NM_006915		Approved	TBCCD2, NME10, NM23-H10	uc004dgw.4	O75695	OTTHUMG00000021430	ENST00000218340.3:c.467C>A	X.37:g.46713275C>A	ENSP00000218340:p.Ala156Asp	Somatic		Unspecified	Illumina	Phase_I	46598219	NM_006915	Q86XJ7|Q9NU67	Missense_Mutation	SNP	ENST00000218340.3	37	CCDS14270.1	.	.	.	.	.	.	.	.	.	.	C	16.13	3.037099	0.54896	.	.	ENSG00000102218	ENST00000218340	D	0.86297	-2.1	5.62	5.62	0.85841	Tubulin binding cofactor C (1);C-CAP/cofactor C-like domain (1);	0.000000	0.85682	D	0.000000	T	0.80491	0.4633	L	0.28504	0.86	0.80722	D	1	B	0.30361	0.277	B	0.20384	0.029	T	0.76879	-0.2796	10	0.25106	T	0.35	-18.004	18.6553	0.91450	0.0:1.0:0.0:0.0	.	156	O75695	XRP2_HUMAN	D	156	ENSP00000218340:A156D	ENSP00000218340:A156D	A	+	2	0	RP2	46598219	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.371000	0.79600	2.349000	0.79799	0.513000	0.50165	GCT		RP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056375.1	NM_006915	
WDR13	64743	broad.mit.edu	37	X	48460237	48460237	+	Silent	SNP	C	C	T			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chrX:48460237C>T	ENST00000218056.5	+	6	1402	c.897C>T	c.(895-897)ggC>ggT	p.G299G	WDR13_ENST00000376729.5_Silent_p.G299G	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13	299						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.G299G(1)		endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						TGAAGGGGGGCTCCAGCAAGC	0.577																																					p.G207G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C621T	X						.						79.0	57.0	65.0					X																	48460237		2203	4300	6503	48345181	SO:0001819	synonymous_variant	64743	exon5			AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.897C>T	X.37:g.48460237C>T		Somatic		Unspecified	Illumina	Phase_I	48345181	NM_001166426	Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	Silent	SNP	ENST00000218056.5	37	CCDS14302.1																																																																																				WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060743.2		
RPS6KA6	27330	broad.mit.edu	37	X	83389795	83389795	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AG-4015-01	TCGA-AG-4015-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chrX:83389795A>T	ENST00000262752.2	-	8	648	c.641T>A	c.(640-642)tTa>tAa	p.L214*	RPS6KA6_ENST00000543399.1_Nonsense_Mutation_p.L214*	NM_014496.4	NP_055311.1	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 6	214	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|central nervous system development (GO:0007417)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation of embryonic development (GO:0045992)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of mesoderm development (GO:2000381)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.L214*(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(26)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	46						CATACCTGTTAATTTGATATG	0.239																																					p.L214X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.T641A	X						.						36.0	35.0	36.0					X																	83389795		2181	4237	6418	83276451	SO:0001587	stop_gained	27330	exon8			AF184965	CCDS14451.1	Xq21.1	2011-04-05	2002-08-29		ENSG00000072133	ENSG00000072133			10435	protein-coding gene	gene with protein product		300303	"""ribosomal protein S6 kinase, 90kD, polypeptide 6"""			10644430	Standard	NM_014496		Approved	RSK4	uc004eej.2	Q9UK32	OTTHUMG00000021923	ENST00000262752.2:c.641T>A	X.37:g.83389795A>T	ENSP00000262752:p.Leu214*	Somatic		Unspecified	Illumina	Phase_I	83276451	NM_014496	B2R854|B7ZL90|Q6FHX2|Q8WX28|Q9H4S6	Nonsense_Mutation	SNP	ENST00000262752.2	37	CCDS14451.1	.	.	.	.	.	.	.	.	.	.	A	34	5.405613	0.96051	.	.	ENSG00000072133	ENST00000262752;ENST00000543399	.	.	.	4.62	3.41	0.39046	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.5844	0.45273	0.8401:0.1599:0.0:0.0	.	.	.	.	X	214	.	ENSP00000262752:L214X	L	-	2	0	RPS6KA6	83276451	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	8.524000	0.90579	0.445000	0.26639	0.425000	0.28330	TTA		RPS6KA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057372.1	NM_014496	
MAGEC2	51438	broad.mit.edu	37	X	141290933	141290933	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chrX:141290933C>T	ENST00000247452.3	-	3	1188	c.841G>A	c.(841-843)Gga>Aga	p.G281R		NM_016249.3	NP_057333.1	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	281	Interaction with TRIM28.|MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				cellular protein catabolic process (GO:0044257)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)	p.G281R(1)		NS(2)|breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)	47	Acute lymphoblastic leukemia(192;6.56e-05)					AGGTAATGTCCCTGCACCCAA	0.522										HNSCC(46;0.14)																											p.G281R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G841A	X						.						91.0	91.0	91.0					X																	141290933		2203	4300	6503	141118599	SO:0001583	missense	51438	exon3			AF116195	CCDS14678.1	Xq27	2009-03-25	2004-06-08	2004-06-09	ENSG00000046774	ENSG00000046774			13574	protein-coding gene	gene with protein product	"""cancer/testis antigen 10"""	300468	"""melanoma antigen, family E, 1, cancer/testis specific"""	MAGEE1		10699956	Standard	NM_016249		Approved	CT10, MAGE-C2	uc004fbu.2	Q9UBF1	OTTHUMG00000022574	ENST00000247452.3:c.841G>A	X.37:g.141290933C>T	ENSP00000354660:p.Gly281Arg	Somatic		Unspecified	Illumina	Phase_I	141118599	NM_016249	Q5JZ00|Q96D45|Q9P1M6|Q9P1M7	Missense_Mutation	SNP	ENST00000247452.3	37	CCDS14678.1	.	.	.	.	.	.	.	.	.	.	-	6.733	0.504024	0.12822	.	.	ENSG00000046774	ENST00000247452	T	0.04317	3.65	0.988	-0.145	0.13436	.	0.228439	0.36066	U	0.002814	T	0.01523	0.0049	N	0.01352	-0.895	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.43410	-0.9393	10	0.49607	T	0.09	.	4.4166	0.11459	0.0:0.5759:0.4241:0.0	.	281	Q9UBF1	MAGC2_HUMAN	R	281	ENSP00000354660:G281R	ENSP00000354660:G281R	G	-	1	0	MAGEC2	141118599	0.000000	0.05858	0.002000	0.10522	0.119000	0.20118	-0.794000	0.04584	-0.093000	0.12396	0.284000	0.19432	GGA		MAGEC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058611.1	NM_016249	
BCL2L11	10018	broad.mit.edu	37	2	111881594	111881594	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4015-01	TCGA-AG-4015-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr2:111881594G>A	ENST00000393256.3	+	2	545	c.272G>A	c.(271-273)cGa>cAa	p.R91Q	BCL2L11_ENST00000308659.8_Intron|BCL2L11_ENST00000357757.2_Missense_Mutation_p.R91Q|BCL2L11_ENST00000337565.5_Intron|BCL2L11_ENST00000393253.2_Intron|BCL2L11_ENST00000405953.1_Intron	NM_001204106.1|NM_006538.4|NM_138621.4|NM_138627.3	NP_001191035.1|NP_006529.1|NP_619527.1|NP_619533.1	O43521	B2L11_HUMAN	BCL2-like 11 (apoptosis facilitator)	91					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|apoptotic signaling pathway (GO:0097190)|B cell apoptotic process (GO:0001783)|B cell homeostasis (GO:0001782)|brain development (GO:0007420)|cell-matrix adhesion (GO:0007160)|cellular process regulating host cell cycle in response to virus (GO:0060154)|developmental pigmentation (GO:0048066)|ear development (GO:0043583)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|kidney development (GO:0001822)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|myeloid cell homeostasis (GO:0002262)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic process by virus (GO:0060139)|positive regulation of cell cycle (GO:0045787)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902110)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|post-embryonic organ morphogenesis (GO:0048563)|regulation of developmental pigmentation (GO:0048070)|regulation of organ growth (GO:0046620)|response to endoplasmic reticulum stress (GO:0034976)|spermatogenesis (GO:0007283)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|thymocyte apoptotic process (GO:0070242)|thymus development (GO:0048538)|tube formation (GO:0035148)	BIM-BCL-2 complex (GO:0097141)|BIM-BCL-xl complex (GO:0097140)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|mitochondrial outer membrane (GO:0005741)		p.R91Q(2)		endometrium(4)|large_intestine(3)|lung(2)|prostate(2)	11						CTGCTGTCTCGATCCTCCAGT	0.567																																					p.R91Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G272A	2						.						85.0	91.0	89.0					2																	111881594		2203	4300	6503	111598065	SO:0001583	missense	10018	exon2			AF032458	CCDS2089.1, CCDS2092.1, CCDS42731.1, CCDS56131.1, CCDS56132.1, CCDS56133.1, CCDS56134.1, CCDS56135.1, CCDS56136.1, CCDS74560.1, CCDS74561.1, CCDS74559.1	2q13	2014-09-17			ENSG00000153094	ENSG00000153094			994	protein-coding gene	gene with protein product		603827				9731710, 9430630	Standard	NM_006538		Approved	BOD, BimL, BimEL, BimS, BIM	uc002tgv.1	O43521	OTTHUMG00000131256	ENST00000393256.3:c.272G>A	2.37:g.111881594G>A	ENSP00000376943:p.Arg91Gln	Somatic		Unspecified	Illumina	Phase_I	111598065	NM_138621	A8K2W2|O43522|Q0MSE7|Q0MSE8|Q0MSE9|Q53R28|Q6JTU6|Q6T851|Q6TE14|Q6TE15|Q6TE16|Q6V402|Q8WYL6|Q8WYL7|Q8WYL8|Q8WYL9|Q8WYM0|Q8WYM1	Missense_Mutation	SNP	ENST00000393256.3	37	CCDS2089.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.418394	0.83559	.	.	ENSG00000153094	ENST00000432179;ENST00000357757;ENST00000393256	T;T;T	0.43688	0.94;0.94;0.94	5.5	5.5	0.81552	.	0.000000	0.52532	D	0.000079	T	0.37237	0.0996	N	0.24115	0.695	0.80722	D	1	D;D	0.61697	0.976;0.99	P;P	0.50049	0.592;0.629	T	0.19224	-1.0312	10	0.72032	D	0.01	-9.7219	10.6716	0.45762	0.0873:0.0:0.9127:0.0	.	91;91	O43521-11;O43521	.;B2L11_HUMAN	Q	91	ENSP00000411870:R91Q;ENSP00000350398:R91Q;ENSP00000376943:R91Q	ENSP00000350398:R91Q	R	+	2	0	BCL2L11	111598065	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.250000	0.51445	2.755000	0.94549	0.655000	0.94253	CGA		BCL2L11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254022.3		
LRP2	4036	broad.mit.edu	37	2	170007505	170007505	+	Missense_Mutation	SNP	G	G	A	rs570499038		TCGA-AG-4015-01	TCGA-AG-4015-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr2:170007505G>A	ENST00000263816.3	-	68	12778	c.12493C>T	c.(12493-12495)Cgc>Tgc	p.R4165C		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	4165					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.R4165C(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	ACCTCAATGCGTTTATTCTTG	0.428													G|||	1	0.000199681	0.0008	0.0	5008	,	,		21127	0.0		0.0	False		,,,				2504	0.0				p.R4165C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C12493T	2						.						180.0	159.0	166.0					2																	170007505		2203	4300	6503	169715751	SO:0001583	missense	4036	exon68				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.12493C>T	2.37:g.170007505G>A	ENSP00000263816:p.Arg4165Cys	Somatic		Unspecified	Illumina	Phase_I	169715751	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	G	17.36	3.369471	0.61624	.	.	ENSG00000081479	ENST00000263816	D	0.84370	-1.84	5.86	4.97	0.65823	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.92270	0.7548	M	0.76838	2.35	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93204	0.6594	10	0.72032	D	0.01	.	16.4444	0.83913	0.0:0.0:0.8676:0.1324	.	4165	P98164	LRP2_HUMAN	C	4165	ENSP00000263816:R4165C	ENSP00000263816:R4165C	R	-	1	0	LRP2	169715751	1.000000	0.71417	0.788000	0.31933	0.490000	0.33462	1.609000	0.36858	1.468000	0.48064	0.655000	0.94253	CGC		LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
HNRNPA3	220988	broad.mit.edu	37	2	178080348	178080348	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr2:178080348C>T	ENST00000392524.2	+	2	391	c.154C>T	c.(154-156)Cga>Tga	p.R52*	MIR4444-1_ENST00000581696.1_RNA|HNRNPA3_ENST00000411529.2_Nonsense_Mutation_p.R30*|AC079305.8_ENST00000455416.1_RNA|HNRNPA3_ENST00000435711.1_Nonsense_Mutation_p.R52*			P51991	ROA3_HUMAN	heterogeneous nuclear ribonucleoprotein A3	52	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R52*(3)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|urinary_tract(1)	16						TGATAGTTTACGAGAACATTT	0.428																																					p.R52X												.	.	3	Substitution - Nonsense(3)	large_intestine(1)|lung(1)|breast(1)	c.C154T	2						.						66.0	66.0	66.0					2																	178080348		2203	4295	6498	177788594	SO:0001587	stop_gained	220988	exon2			AF517524	CCDS2273.1	2q31.2	2013-02-12		2008-04-18	ENSG00000170144	ENSG00000170144		"""RNA binding motif (RRM) containing"""	24941	protein-coding gene	gene with protein product		605372		HNRPA3		11886857, 15776420	Standard	XM_005246380		Approved		uc002ulc.1	P51991	OTTHUMG00000132529	ENST00000392524.2:c.154C>T	2.37:g.178080348C>T	ENSP00000376309:p.Arg52*	Somatic		Unspecified	Illumina	Phase_I	177788594	NM_194247	D3DPF4|Q53RW7|Q6URK5	Nonsense_Mutation	SNP	ENST00000392524.2	37	CCDS2273.1	.	.	.	.	.	.	.	.	.	.	A	37	6.504984	0.97620	.	.	ENSG00000170144	ENST00000392524;ENST00000411529;ENST00000416446;ENST00000420139;ENST00000435711	.	.	.	4.22	4.22	0.49857	.	0.000000	0.50627	U	0.000108	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.1344	0.48367	0.8447:0.1553:0.0:0.0	.	.	.	.	X	52;30;30;30;52	.	ENSP00000376309:R52X	R	+	1	2	HNRNPA3	177788594	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	2.529000	0.45632	0.615000	0.30124	-0.824000	0.03097	CGA		HNRNPA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255729.3	NM_194247	
GTF3C3	9330	broad.mit.edu	37	2	197645302	197645302	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-4015-01	TCGA-AG-4015-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr2:197645302T>C	ENST00000263956.3	-	9	1288	c.1199A>G	c.(1198-1200)aAc>aGc	p.N400S	GTF3C3_ENST00000409364.3_Missense_Mutation_p.N400S	NM_012086.4	NP_036218.1	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide 3, 102kDa	400					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)	p.N400S(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						TTCAAGAATGTTGAGATGTAC	0.383																																					p.N400S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1199G	2						.						163.0	138.0	146.0					2																	197645302		2203	4300	6503	197353547	SO:0001583	missense	9330	exon9			AF133123	CCDS2316.1, CCDS56153.1	2q33.1	2013-01-10	2002-08-29		ENSG00000119041	ENSG00000119041		"""General transcription factors"", ""Tetratricopeptide (TTC) repeat domain containing"""	4666	protein-coding gene	gene with protein product		604888	"""general transcription factor IIIC, polypeptide 3 (102kD)"""			10373544	Standard	NM_001206774		Approved	TFiiiC2-102, TFIIIC102	uc002uts.3	Q9Y5Q9	OTTHUMG00000154633	ENST00000263956.3:c.1199A>G	2.37:g.197645302T>C	ENSP00000263956:p.Asn400Ser	Somatic		Unspecified	Illumina	Phase_I	197353547	NM_012086	Q4ZG48|Q86XJ8|Q8WX84|Q96B44|Q9H5I8|Q9NT97	Missense_Mutation	SNP	ENST00000263956.3	37	CCDS2316.1	.	.	.	.	.	.	.	.	.	.	T	17.79	3.476106	0.63737	.	.	ENSG00000119041	ENST00000263956;ENST00000448087;ENST00000409364	T;T	0.46451	0.87;0.88	5.41	5.41	0.78517	Tetratricopeptide-like helical (1);	0.053247	0.64402	D	0.000001	T	0.37945	0.1022	L	0.43152	1.355	0.50171	D	0.999856	P;B	0.36465	0.554;0.084	B;B	0.35550	0.205;0.024	T	0.26677	-1.0096	10	0.48119	T	0.1	-22.5105	15.612	0.76733	0.0:0.0:0.0:1.0	.	400;400	Q9Y5Q9-2;Q9Y5Q9	.;TF3C3_HUMAN	S	400;85;400	ENSP00000263956:N400S;ENSP00000386465:N400S	ENSP00000263956:N400S	N	-	2	0	GTF3C3	197353547	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	3.362000	0.52314	2.281000	0.76405	0.533000	0.62120	AAC		GTF3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256104.1		
NRXN1	9378	broad.mit.edu	37	2	50149357	50149357	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-4015-01	TCGA-AG-4015-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr2:50149357A>G	ENST00000406316.2	-	22	5635	c.4159T>C	c.(4159-4161)Tat>Cat	p.Y1387H	NRXN1_ENST00000401669.2_Missense_Mutation_p.Y1417H|NRXN1_ENST00000405472.3_Missense_Mutation_p.Y1409H|NRXN1_ENST00000401710.1_Missense_Mutation_p.Y405H|NRXN1_ENST00000402717.3_Missense_Mutation_p.Y1409H|NRXN1_ENST00000406859.3_Missense_Mutation_p.Y1387H|NRXN1_ENST00000404971.1_Missense_Mutation_p.Y1457H|NRXN1_ENST00000342183.5_Missense_Mutation_p.Y352H	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1387					adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.Y1458H(1)|p.Y1387H(1)|p.Y352H(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			GAGCCTGGATACGGCTCTCTG	0.527																																					p.Y352H												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.T1054C	2						.						49.0	42.0	45.0					2																	50149357		2203	4300	6503	50002861	SO:0001583	missense	9378	exon6			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.4159T>C	2.37:g.50149357A>G	ENSP00000384311:p.Tyr1387His	Somatic		Unspecified	Illumina	Phase_I	50002861	NM_138735	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	CCDS54360.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.75|12.75	2.030550|2.030550	0.35797|0.35797	.|.	.|.	ENSG00000179915|ENSG00000179915	ENST00000378262|ENST00000342183;ENST00000536347;ENST00000401710;ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	.|T;T;T;T;T;T;T;T	.|0.71698	.|0.92;2.13;0.11;0.1;-0.59;-0.48;-0.18;-0.04	5.95|5.95	4.81|4.81	0.61882|0.61882	.|.	.|0.310755	.|0.20291	.|U	.|0.095252	T|T	0.69468|0.69468	0.3114|0.3114	L|L	0.44542|0.44542	1.39|1.39	0.26483|0.26483	N|N	0.975075|0.975075	.|B;D;P;P;P;P	.|0.54601	.|0.003;0.967;0.944;0.904;0.836;0.589	.|B;P;P;B;B;B	.|0.52066	.|0.003;0.689;0.492;0.243;0.285;0.179	T|T	0.62105|0.62105	-0.6924|-0.6924	5|10	.|0.37606	.|T	.|0.19	.|.	10.1757|10.1757	0.42937|0.42937	0.9255:0.0:0.0745:0.0|0.9255:0.0:0.0745:0.0	.|.	.|52;1457;352;1387;1406;49	.|B4DIT5;Q9ULB1-3;P58400;F8WB18;A7E294;Q5HYI0	.|.;.;NRX1B_HUMAN;.;.;.	A|H	53|352;306;405;1457;1387;1409;1417;1458;1409;1387	.|ENSP00000341184:Y352H;ENSP00000385580:Y405H;ENSP00000385142:Y1457H;ENSP00000384311:Y1387H;ENSP00000434015:Y1409H;ENSP00000385017:Y1417H;ENSP00000385434:Y1409H;ENSP00000385681:Y1387H	.|ENSP00000341184:Y352H	V|Y	-|-	2|1	0|0	NRXN1|NRXN1	50002861|50002861	1.000000|1.000000	0.71417|0.71417	0.918000|0.918000	0.36340|0.36340	0.806000|0.806000	0.45545|0.45545	4.863000|4.863000	0.62983|0.62983	2.272000|2.272000	0.75746|0.75746	0.460000|0.460000	0.39030|0.39030	GTA|TAT		NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
SFXN5	94097	broad.mit.edu	37	2	73268005	73268005	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr2:73268005C>T	ENST00000272433.2	-	3	357	c.227G>A	c.(226-228)cGc>cAc	p.R76H	SFXN5_ENST00000410065.1_Missense_Mutation_p.R76H|SFXN5_ENST00000474528.1_5'UTR	NM_144579.2	NP_653180.1	Q8TD22	SFXN5_HUMAN	sideroflexin 5	76					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)|citrate transmembrane transporter activity (GO:0015137)	p.R76H(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9						GACCCCCGGGCGCAGGGTCCC	0.562																																					p.R76H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G227A	2						.						45.0	45.0	45.0					2																	73268005		2203	4300	6503	73121513	SO:0001583	missense	94097	exon3			AY044437	CCDS1922.1	2p13	2008-05-21			ENSG00000144040	ENSG00000144040		"""Sideroflexins"""	16073	protein-coding gene	gene with protein product		615572				12039050, 12150972	Standard	XM_005264648		Approved	BBG-TCC	uc002siq.3	Q8TD22	OTTHUMG00000129775	ENST00000272433.2:c.227G>A	2.37:g.73268005C>T	ENSP00000272433:p.Arg76His	Somatic		Unspecified	Illumina	Phase_I	73121513	NM_144579	A8K116|Q494Y3|Q53T29	Missense_Mutation	SNP	ENST00000272433.2	37	CCDS1922.1	.	.	.	.	.	.	.	.	.	.	C	13.88	2.369455	0.42003	.	.	ENSG00000144040	ENST00000272433;ENST00000410065;ENST00000442582	T;T;T	0.30182	1.54;1.54;1.54	5.36	1.11	0.20524	.	0.152130	0.64402	N	0.000017	T	0.13884	0.0336	N	0.12746	0.255	0.31737	N	0.636299	B;B	0.17667	0.023;0.001	B;B	0.14023	0.01;0.001	T	0.05937	-1.0855	10	0.45353	T	0.12	-0.9481	4.6624	0.12648	0.0:0.5233:0.1985:0.2783	.	76;76	B8ZZJ6;Q8TD22	.;SFXN5_HUMAN	H	76	ENSP00000272433:R76H;ENSP00000387076:R76H;ENSP00000396825:R76H	ENSP00000272433:R76H	R	-	2	0	SFXN5	73121513	0.998000	0.40836	0.950000	0.38849	0.862000	0.49288	1.220000	0.32491	0.360000	0.24265	0.655000	0.94253	CGC		SFXN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251991.1	NM_144579	
SP140	11262	broad.mit.edu	37	2	231112704	231112704	+	Silent	SNP	G	G	A			TCGA-AG-4015-01	TCGA-AG-4015-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr2:231112704G>A	ENST00000392045.3	+	8	930	c.816G>A	c.(814-816)gaG>gaA	p.E272E	SP140_ENST00000486687.2_Intron|SP140_ENST00000343805.6_Silent_p.E246E|SP140_ENST00000420434.3_Silent_p.E272E|SP140_ENST00000417495.3_Intron|SP140_ENST00000350136.5_Intron	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	272					defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.E272E(1)		NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		AGGGAGAGGAGGAAGGCAGGA	0.488																																					p.E272E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G816A	2						.						148.0	154.0	152.0					2																	231112704		1995	4162	6157	230820948	SO:0001819	synonymous_variant	11262	exon8			U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.816G>A	2.37:g.231112704G>A		Somatic		Unspecified	Illumina	Phase_I	230820948	NM_007237	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Silent	SNP	ENST00000392045.3	37	CCDS42831.1																																																																																				SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000332015.1	NM_007237	
KIAA0368	23392	broad.mit.edu	37	9	114134760	114134760	+	Missense_Mutation	SNP	C	C	T	rs201047834		TCGA-AG-4015-01	TCGA-AG-4015-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr9:114134760C>T	ENST00000338205.5	-	41	4696	c.4477G>A	c.(4477-4479)Gaa>Aaa	p.E1493K	KIAA0368_ENST00000259335.4_Missense_Mutation_p.E1671K|KIAA0368_ENST00000374378.3_5'UTR|KIAA0368_ENST00000465499.1_5'Flank			Q5VYK3	ECM29_HUMAN	KIAA0368	1499					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	centrosome (GO:0005813)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|late endosome (GO:0005770)|membrane (GO:0016020)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|proteasome complex (GO:0000502)		p.E1671K(1)		NS(2)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(23)|prostate(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	65						TCTTCTTTTTCGGATTTCTCC	0.418																																					p.E1671K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5011A	9						.						117.0	110.0	112.0					9																	114134760		1865	4098	5963	113174581	SO:0001583	missense	23392	exon43			AK025689	CCDS48006.1	9q32	2012-11-29	2006-11-23	2006-11-23	ENSG00000136813	ENSG00000136813			29020	protein-coding gene	gene with protein product	"""ECM29 homolog (S. cerevisiae)"""					9205841, 15496406, 20682791	Standard	NM_001080398		Approved	FLJ22036, ECM29	uc004bfe.1	Q5VYK3	OTTHUMG00000020489	ENST00000338205.5:c.4477G>A	9.37:g.114134760C>T	ENSP00000339889:p.Glu1493Lys	Somatic		Unspecified	Illumina	Phase_I	113174581	NM_001080398	O15074|Q8WU82	Missense_Mutation	SNP	ENST00000338205.5	37		.	.	.	.	.	.	.	.	.	.	C	16.97	3.269823	0.59540	.	.	ENSG00000136813	ENST00000338205;ENST00000259335;ENST00000543827	T	0.48201	0.82	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.43211	0.1237	L	0.42245	1.32	0.80722	D	1	P	0.49090	0.919	B	0.39876	0.312	T	0.21075	-1.0256	10	0.23891	T	0.37	.	20.3932	0.98965	0.0:1.0:0.0:0.0	.	968	B3KXF2	.	K	1493;1671;968	ENSP00000259335:E1671K	ENSP00000259335:E1671K	E	-	1	0	KIAA0368	113174581	1.000000	0.71417	0.982000	0.44146	0.584000	0.36387	5.660000	0.68018	2.824000	0.97209	0.655000	0.94253	GAA		KIAA0368-001	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000053637.2	NM_014686	
TRPM6	140803	broad.mit.edu	37	9	77431819	77431819	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4015-01	TCGA-AG-4015-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr9:77431819G>A	ENST00000360774.1	-	10	1433	c.1196C>T	c.(1195-1197)gCt>gTt	p.A399V	TRPM6_ENST00000361255.3_Missense_Mutation_p.A394V|TRPM6_ENST00000376871.3_Missense_Mutation_p.A399V|TRPM6_ENST00000376864.4_Missense_Mutation_p.A399V|TRPM6_ENST00000451710.3_Missense_Mutation_p.A399V|TRPM6_ENST00000376872.3_Missense_Mutation_p.A399V|TRPM6_ENST00000449912.2_Missense_Mutation_p.A394V	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	399					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.A399V(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						CTTCAGCAAAGCTGTTAGGAT	0.423																																					p.A394V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1181T	9						.						198.0	181.0	187.0					9																	77431819		2203	4300	6503	76621639	SO:0001583	missense	140803	exon10			AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.1196C>T	9.37:g.77431819G>A	ENSP00000354006:p.Ala399Val	Somatic		Unspecified	Illumina	Phase_I	76621639	NM_001177310	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	37	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.970530	0.92919	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000376872;ENST00000376871;ENST00000449912;ENST00000361255;ENST00000376864;ENST00000312449;ENST00000448641	T;T;T;T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29;-0.29;-0.29;-0.29	5.93	5.04	0.67666	.	0.194312	0.56097	D	0.000040	D	0.86389	0.5921	H	0.94306	3.52	0.54753	D	0.999988	B;B;D;D	0.89917	0.082;0.082;0.999;1.0	B;B;D;D	0.76071	0.04;0.058;0.96;0.987	D	0.90330	0.4351	10	0.87932	D	0	.	15.1024	0.72292	0.0676:0.0:0.9324:0.0	.	399;399;399;394	Q9BX84-6;Q9BX84-5;Q9BX84;Q9BX84-3	.;.;TRPM6_HUMAN;.	V	399;399;399;399;394;394;399;62;62	ENSP00000354006:A399V;ENSP00000407341:A399V;ENSP00000366068:A399V;ENSP00000366067:A399V;ENSP00000396672:A394V;ENSP00000354962:A394V;ENSP00000366060:A399V	ENSP00000309693:A62V	A	-	2	0	TRPM6	76621639	1.000000	0.71417	0.988000	0.46212	0.938000	0.57974	7.945000	0.87732	1.524000	0.49035	0.561000	0.74099	GCT		TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662	
CAMSAP1	157922	broad.mit.edu	37	9	138713964	138713964	+	Missense_Mutation	SNP	C	C	G	rs76232173		TCGA-AG-4015-01	TCGA-AG-4015-01	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr9:138713964C>G	ENST00000389532.4	-	11	2607	c.2543G>C	c.(2542-2544)tGc>tCc	p.C848S	CAMSAP1_ENST00000483991.1_5'UTR|CAMSAP1_ENST00000312405.6_Missense_Mutation_p.C570S|CAMSAP1_ENST00000409386.3_Missense_Mutation_p.C859S	NM_015447.3	NP_056262.3	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein 1	848					cytoskeleton organization (GO:0007010)|neuron projection development (GO:0031175)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|spectrin binding (GO:0030507)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(11)|lung(16)|ovary(3)|pancreas(1)|skin(1)	47				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		AGGGGCTGGGCAGCTCTCAGA	0.617																																					p.C848S												.	.	0			c.G2543C	9						.						24.0	25.0	25.0					9																	138713964		2203	4300	6503	137853785	SO:0001583	missense	157922	exon11			AJ519841	CCDS35176.2	9q34.3	2008-02-05			ENSG00000130559	ENSG00000130559			19946	protein-coding gene	gene with protein product		613774				12477932	Standard	NM_015447		Approved	FLJ31228, DKFZp434F195	uc004cgr.4	Q5T5Y3	OTTHUMG00000020918	ENST00000389532.4:c.2543G>C	9.37:g.138713964C>G	ENSP00000374183:p.Cys848Ser	None		Unspecified	Illumina	Phase_I	137853785	NM_015447	A1L4L2|B2REB2|B2REB3|Q70W33|Q8NCY0|Q96E80|Q96FM3|Q9UFJ5	Missense_Mutation	SNP	ENST00000389532.4	37	CCDS35176.2	.	.	.	.	.	.	.	.	.	.	C	2.545	-0.305299	0.05495	.	.	ENSG00000130559	ENST00000389532;ENST00000312405;ENST00000409386	T;T;T	0.68765	-0.35;-0.35;-0.35	5.01	4.11	0.48088	.	0.042303	0.85682	D	0.000000	T	0.65365	0.2684	M	0.61703	1.905	0.49483	D	0.999797	B;B	0.28933	0.168;0.228	B;B	0.28385	0.018;0.089	T	0.68021	-0.5519	10	0.87932	D	0	-15.65	15.7474	0.77955	0.0:0.863:0.137:0.0	.	848;859	Q5T5Y3;Q5T5Y3-3	CAMP1_HUMAN;.	S	848;570;859	ENSP00000374183:C848S;ENSP00000312463:C570S;ENSP00000386420:C859S	ENSP00000312463:C570S	C	-	2	0	CAMSAP1	137853785	1.000000	0.71417	1.000000	0.80357	0.295000	0.27426	4.774000	0.62339	1.226000	0.43582	0.655000	0.94253	TGC		CAMSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055024.2	XM_351857	
SACS	26278	broad.mit.edu	37	13	23914699	23914699	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr13:23914699C>A	ENST00000382292.3	-	9	3589	c.3316G>T	c.(3316-3318)Gtg>Ttg	p.V1106L	SACS_ENST00000382298.3_Missense_Mutation_p.V1106L|SACS_ENST00000402364.1_Missense_Mutation_p.V356L			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	1106					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)	p.V959L(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TTTTTTGCCACTTGCACAACA	0.388																																					p.V1106L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3316T	13						.						189.0	199.0	196.0					13																	23914699		2203	4300	6503	22812699	SO:0001583	missense	26278	exon10			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.3316G>T	13.37:g.23914699C>A	ENSP00000371729:p.Val1106Leu	Somatic		Unspecified	Illumina	Phase_I	22812699	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	C	13.77	2.336964	0.41398	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.87179	-2.09;-2.22;-2.09	6.16	6.16	0.99307	.	0.059735	0.64402	D	0.000003	D	0.85652	0.5746	M	0.62723	1.935	0.45554	D	0.998507	B	0.06786	0.001	B	0.06405	0.002	T	0.79167	-0.1915	10	0.26408	T	0.33	.	17.0356	0.86474	0.0:0.8732:0.1268:0.0	.	1106	Q9NZJ4	SACS_HUMAN	L	1106;356;1106	ENSP00000371729:V1106L;ENSP00000385844:V356L;ENSP00000371735:V1106L	ENSP00000371729:V1106L	V	-	1	0	SACS	22812699	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	5.727000	0.68523	2.937000	0.99478	0.650000	0.86243	GTG		SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
DCLK1	9201	broad.mit.edu	37	13	36385094	36385094	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-4015-01	TCGA-AG-4015-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr13:36385094G>T	ENST00000360631.3	-	12	1777	c.1566C>A	c.(1564-1566)caC>caA	p.H522Q	DCLK1_ENST00000255448.4_Missense_Mutation_p.H522Q|DCLK1_ENST00000379893.1_Missense_Mutation_p.H215Q			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	522	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)	p.H522Q(2)		breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		TGCCATCTTGGTGCTCATACA	0.453																																					p.H215Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C645A	13						.						134.0	123.0	127.0					13																	36385094		2203	4300	6503	35283094	SO:0001583	missense	9201	exon8			AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.1566C>A	13.37:g.36385094G>T	ENSP00000353846:p.His522Gln	Somatic		Unspecified	Illumina	Phase_I	35283094	NM_001195416	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Missense_Mutation	SNP	ENST00000360631.3	37		.	.	.	.	.	.	.	.	.	.	G	16.37	3.103620	0.56291	.	.	ENSG00000133083	ENST00000399319;ENST00000255448;ENST00000360631;ENST00000379893;ENST00000539451	T;T;T	0.63913	-0.07;-0.07;-0.07	5.28	5.28	0.74379	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.50292	0.1607	N	0.11845	0.185	0.80722	D	1	P;P;P;P	0.41188	0.647;0.741;0.696;0.647	B;P;B;B	0.45610	0.377;0.487;0.355;0.377	T	0.49113	-0.8973	10	0.28530	T	0.3	.	14.514	0.67807	0.0726:0.0:0.9274:0.0	.	215;522;522;215	O15075-4;O15075;O15075-2;O15075-3	.;DCLK1_HUMAN;.;.	Q	214;522;522;215;504	ENSP00000255448:H522Q;ENSP00000353846:H522Q;ENSP00000369223:H215Q	ENSP00000255448:H522Q	H	-	3	2	DCLK1	35283094	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.589000	0.46145	2.630000	0.89119	0.655000	0.94253	CAC		DCLK1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000044487.1	NM_004734	
TRPC4	7223	broad.mit.edu	37	13	38248384	38248384	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-4015-01	TCGA-AG-4015-01	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr13:38248384T>G	ENST00000379705.3	-	5	2212	c.1355A>C	c.(1354-1356)aAa>aCa	p.K452T	TRPC4_ENST00000426868.2_Missense_Mutation_p.K452T|TRPC4_ENST00000379679.1_Missense_Mutation_p.K279T|TRPC4_ENST00000379681.3_Missense_Mutation_p.K452T|TRPC4_ENST00000358477.2_Missense_Mutation_p.K452T|TRPC4_ENST00000338947.5_Missense_Mutation_p.K279T|TRPC4_ENST00000447043.1_Missense_Mutation_p.K452T|TRPC4_ENST00000494529.1_5'UTR|TRPC4_ENST00000379673.2_Missense_Mutation_p.K452T|TRPC4_ENST00000355779.2_Missense_Mutation_p.K452T			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	452					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.K452T(2)		NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		TGCAACAATTTTCAAGGAGAT	0.303																																					p.K452T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1355C	13						.						53.0	52.0	53.0					13																	38248384		2203	4300	6503	37146384	SO:0001583	missense	7223	exon5			U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.1355A>C	13.37:g.38248384T>G	ENSP00000369027:p.Lys452Thr	Somatic		Unspecified	Illumina	Phase_I	37146384	NM_001135957	B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Missense_Mutation	SNP	ENST00000379705.3	37	CCDS9365.1	.	.	.	.	.	.	.	.	.	.	T	19.91	3.914611	0.72983	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000338947;ENST00000379679;ENST00000426868;ENST00000355779;ENST00000358477;ENST00000379673;ENST00000447043	D;D;D;D;D;D;D;D;D	0.98512	-4.97;-4.97;-4.97;-4.97;-4.97;-4.97;-4.97;-4.97;-4.97	5.31	5.31	0.75309	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98741	0.9577	M	0.73962	2.25	0.58432	D	0.999995	D;D;D;D;P;D	0.76494	0.993;0.996;0.999;0.999;0.941;0.996	D;D;D;D;P;D	0.80764	0.936;0.931;0.994;0.986;0.892;0.978	D	0.99866	1.1090	10	0.87932	D	0	-34.4696	15.5566	0.76200	0.0:0.0:0.0:1.0	.	452;452;452;279;452;452	Q9UBN4-3;Q9UBN4-4;Q9UBN4-5;Q9UBN4-6;Q9UBN4-2;Q9UBN4	.;.;.;.;.;TRPC4_HUMAN	T	452;452;279;279;452;452;452;452;452	ENSP00000369027:K452T;ENSP00000369003:K452T;ENSP00000342580:K279T;ENSP00000369001:K279T;ENSP00000410133:K452T;ENSP00000348025:K452T;ENSP00000351264:K452T;ENSP00000368995:K452T;ENSP00000414316:K452T	ENSP00000342580:K279T	K	-	2	0	TRPC4	37146384	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	7.997000	0.88414	2.122000	0.65172	0.482000	0.46254	AAA		TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	NM_003306	
KLHL1	57626	broad.mit.edu	37	13	70535466	70535466	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr13:70535466C>A	ENST00000377844.4	-	3	1550	c.791G>T	c.(790-792)tGg>tTg	p.W264L	KLHL1_ENST00000545028.1_Missense_Mutation_p.W71L	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	264	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)	p.W264*(1)|p.W264L(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		GACAAGGTCCCAGAGAGCATT	0.378																																					p.W264L												.	.	2	Substitution - Nonsense(1)|Substitution - Missense(1)	large_intestine(1)|lung(1)	c.G791T	13						.						148.0	131.0	137.0					13																	70535466		2203	4300	6503	69433467	SO:0001583	missense	57626	exon3			AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.791G>T	13.37:g.70535466C>A	ENSP00000367075:p.Trp264Leu	Somatic		Unspecified	Illumina	Phase_I	69433467	NM_020866	A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Missense_Mutation	SNP	ENST00000377844.4	37	CCDS9445.1	.	.	.	.	.	.	.	.	.	.	C	12.98	2.100044	0.37048	.	.	ENSG00000150361	ENST00000377844;ENST00000545028	T;T	0.66099	-0.19;-0.19	5.08	5.08	0.68730	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.243063	0.32134	N	0.006535	T	0.48003	0.1476	N	0.17278	0.47	0.32778	N	0.502838	P;B	0.38395	0.629;0.322	B;B	0.40009	0.316;0.222	T	0.61973	-0.6952	10	0.45353	T	0.12	.	12.2399	0.54536	0.0:0.9218:0.0:0.0782	.	264;264	Q8TBJ7;Q9NR64	.;KLHL1_HUMAN	L	264;71	ENSP00000367075:W264L;ENSP00000439602:W71L	ENSP00000367075:W264L	W	-	2	0	KLHL1	69433467	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.272000	0.51616	2.531000	0.85337	0.563000	0.77884	TGG		KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3	NM_020866	
NALCN	259232	broad.mit.edu	37	13	101936303	101936303	+	Missense_Mutation	SNP	C	C	T	rs75772824		TCGA-AG-4015-01	TCGA-AG-4015-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr13:101936303C>T	ENST00000251127.6	-	10	1196	c.1115G>A	c.(1114-1116)cGc>cAc	p.R372H	NALCN_ENST00000376196.3_Missense_Mutation_p.R372H|NALCN_ENST00000470333.1_5'UTR	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	372					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.R372H(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GGCTGGGGCGCGTCCCTGGGG	0.473													C|||	1	0.000199681	0.0	0.0	5008	,	,		14627	0.0		0.001	False		,,,				2504	0.0				p.R372H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1115A	13						.	C	HIS/ARG	0,4406		0,0,2203	41.0	42.0	42.0		1115	5.4	1.0	13	dbSNP_131	42	12,8588	9.1+/-34.3	0,12,4288	yes	missense	NALCN	NM_052867.2	29	0,12,6491	TT,TC,CC		0.1395,0.0,0.0923	benign	372/1739	101936303	12,12994	2203	4300	6503	100734304	SO:0001583	missense	259232	exon10			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.1115G>A	13.37:g.101936303C>T	ENSP00000251127:p.Arg372His	Somatic		Unspecified	Illumina	Phase_I	100734304	NM_052867	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	CCDS9498.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	13.51	2.259409	0.39995	0.0	0.001395	ENSG00000102452	ENST00000251127;ENST00000376196	D;D	0.98732	-4.68;-5.1	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.96626	0.8899	N	0.08118	0	0.80722	D	1	B;D;B	0.71674	0.198;0.998;0.134	B;P;B	0.53649	0.026;0.731;0.026	D	0.95536	0.8608	10	0.15499	T	0.54	.	19.2799	0.94048	0.0:1.0:0.0:0.0	.	372;372;372	F2Z323;B3KSZ6;Q8IZF0	.;.;NALCN_HUMAN	H	372	ENSP00000251127:R372H;ENSP00000365367:R372H	ENSP00000251127:R372H	R	-	2	0	NALCN	100734304	1.000000	0.71417	0.979000	0.43373	0.998000	0.95712	7.450000	0.80656	2.568000	0.86640	0.543000	0.68304	CGC		NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867	
BMS1	9790	broad.mit.edu	37	10	43282631	43282631	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-4015-01	TCGA-AG-4015-01	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr10:43282631T>G	ENST00000374518.5	+	4	446	c.383T>G	c.(382-384)cTc>cGc	p.L128R		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	128	Bms1-type G.				ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.L128R(1)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						AAGCGCAGACTCACCATTATT	0.378																																					p.L128R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T383G	10						.						16.0	22.0	20.0					10																	43282631		1221	2197	3418	42602637	SO:0001583	missense	9790	exon4			BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.383T>G	10.37:g.43282631T>G	ENSP00000363642:p.Leu128Arg	Somatic		Unspecified	Illumina	Phase_I	42602637	NM_014753	Q5QPT5|Q86XJ9	Missense_Mutation	SNP	ENST00000374518.5	37	CCDS7199.1	.	.	.	.	.	.	.	.	.	.	t	16.24	3.067790	0.55539	.	.	ENSG00000165733	ENST00000374518	T	0.11930	2.73	4.81	4.81	0.61882	.	0.067431	0.64402	D	0.000010	T	0.38585	0.1046	M	0.80616	2.505	0.49213	D	0.999764	D	0.89917	1.0	D	0.81914	0.995	T	0.33007	-0.9885	10	0.72032	D	0.01	.	12.9738	0.58527	0.0:0.0:0.0:1.0	.	128	Q14692	BMS1_HUMAN	R	128	ENSP00000363642:L128R	ENSP00000363642:L128R	L	+	2	0	BMS1	42602637	1.000000	0.71417	0.994000	0.49952	0.416000	0.31233	7.743000	0.85020	1.804000	0.52760	0.163000	0.16589	CTC		BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047690.2	NM_014753	
ZNF488	118738	broad.mit.edu	37	10	48370641	48370641	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-4015-01	TCGA-AG-4015-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr10:48370641A>C	ENST00000395702.2	+	2	336	c.109A>C	c.(109-111)Agc>Cgc	p.S37R	ZNF488_ENST00000586537.1_5'UTR|ZNF488_ENST00000494156.1_Missense_Mutation_p.S37R			Q96MN9	ZN488_HUMAN	zinc finger protein 488	37					negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte development (GO:0014003)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.S37R(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|ovary(2)	14						ATGGCGACTTAGCGAACCTGA	0.667																																					p.S37R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A109C	10						.						49.0	57.0	54.0					10																	48370641		2202	4299	6501	47990647	SO:0001583	missense	118738	exon2			AK056666	CCDS73120.1	10q11.22	2014-04-10			ENSG00000165388	ENSG00000265763		"""Zinc fingers, C2H2-type"""	23535	protein-coding gene	gene with protein product							Standard	NM_153034		Approved	FLJ32104	uc001jex.3	Q96MN9	OTTHUMG00000188322	ENST00000395702.2:c.109A>C	10.37:g.48370641A>C	ENSP00000379054:p.Ser37Arg	Somatic		Unspecified	Illumina	Phase_I	47990647	NM_153034	Q05CE0	Missense_Mutation	SNP	ENST00000395702.2	37	CCDS7217.1	.	.	.	.	.	.	.	.	.	.	A	11.97	1.796204	0.31777	.	.	ENSG00000165388	ENST00000395702;ENST00000433077;ENST00000442001;ENST00000436850;ENST00000412534;ENST00000444585;ENST00000425196	T;T;T;T;T;T	0.53423	1.93;0.82;0.69;0.62;1.45;1.45	4.9	2.59	0.31030	.	1.429690	0.04130	U	0.317847	T	0.42743	0.1216	L	0.51422	1.61	0.09310	N	0.999992	B	0.09022	0.002	B	0.06405	0.002	T	0.23084	-1.0198	10	0.38643	T	0.18	.	5.2495	0.15515	0.6905:0.0:0.3095:0.0	.	37	Q96MN9	ZN488_HUMAN	R	37	ENSP00000379054:S37R;ENSP00000401469:S37R;ENSP00000415923:S37R;ENSP00000406508:S37R;ENSP00000410326:S37R;ENSP00000412898:S37R	ENSP00000379054:S37R	S	+	1	0	ZNF488	47990647	0.097000	0.21791	0.001000	0.08648	0.013000	0.08279	0.881000	0.28173	0.719000	0.32188	0.459000	0.35465	AGC		ZNF488-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314632.1	NM_153034	
APC	324	broad.mit.edu	37	5	112175419	112175419	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AG-4015-01	TCGA-AG-4015-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr5:112175419T>A	ENST00000457016.1	+	16	4508	c.4128T>A	c.(4126-4128)taT>taA	p.Y1376*	APC_ENST00000508376.2_Nonsense_Mutation_p.Y1376*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.Y1376*			P25054	APC_HUMAN	adenomatous polyposis coli	1376	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Y1376*(6)|p.Y1376fs*9(2)|p.Y1376fs*1(2)|p.Y1376fs*41(1)|p.?(1)|p.K1192fs*3(1)|p.Y1376fs*5(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CTGAACACTATGTTCAGGAGA	0.463		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Y1358X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,colon,Substitution - Nonsense,0	.	14	Substitution - Nonsense(6)|Deletion - Frameshift(6)|Unknown(1)|Complex - frameshift(1)	large_intestine(12)|soft_tissue(1)|skin(1)	c.T4074A	5						.						89.0	85.0	86.0					5																	112175419		2202	4300	6502	112203318	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4128T>A	5.37:g.112175419T>A	ENSP00000413133:p.Tyr1376*	Somatic		Unspecified	Illumina	Phase_I	112203318	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	T	38	6.976126	0.97975	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	-7.8	0.01214	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-15.8733	16.6751	0.85276	0.0:0.555:0.0:0.445	.	.	.	.	X	1376	.	.	Y	+	3	2	APC	112203318	0.969000	0.33509	0.756000	0.31282	0.791000	0.44710	0.067000	0.14510	-1.475000	0.01876	-1.044000	0.02363	TAT		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PCDHA12	56137	broad.mit.edu	37	5	140256741	140256741	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4015-01	TCGA-AG-4015-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr5:140256741G>A	ENST00000398631.2	+	1	1684	c.1684G>A	c.(1684-1686)Gcg>Acg	p.A562T	PCDHA8_ENST00000531613.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA9_ENST00000532602.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	562	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A562T(1)		NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAACGACAACGCGCCGGCACT	0.701																																					p.A562T	Pancreas(113;759 1672 13322 24104 50104)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1684A	5						.						147.0	152.0	150.0					5																	140256741		2203	4299	6502	140236925	SO:0001583	missense	56137	exon1			AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.1684G>A	5.37:g.140256741G>A	ENSP00000381628:p.Ala562Thr	Somatic		Unspecified	Illumina	Phase_I	140236925	NM_031864	O75278|Q2M1N8	Missense_Mutation	SNP	ENST00000398631.2	37	CCDS47285.1	.	.	.	.	.	.	.	.	.	.	G	9.970	1.225084	0.22457	.	.	ENSG00000251664	ENST00000398631	T	0.43294	0.95	4.92	3.02	0.34903	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	T	0.51160	0.1658	L	0.50333	1.59	0.25271	N	0.989517	P;P	0.52692	0.955;0.609	P;B	0.53912	0.737;0.135	T	0.45629	-0.9248	9	0.49607	T	0.09	.	14.8554	0.70332	0.0:0.2712:0.7287:0.0	.	562;562	Q9UN75-2;Q9UN75	.;PCDAC_HUMAN	T	562	ENSP00000381628:A562T	ENSP00000381628:A562T	A	+	1	0	PCDHA12	140236925	0.000000	0.05858	0.403000	0.26384	0.008000	0.06430	0.753000	0.26376	1.034000	0.39945	0.561000	0.74099	GCG		PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372882.2	NM_018903	
CDH12	1010	broad.mit.edu	37	5	21802319	21802319	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr5:21802319C>T	ENST00000382254.1	-	10	2299	c.1213G>A	c.(1213-1215)Gct>Act	p.A405T	CDH12_ENST00000522262.1_Missense_Mutation_p.A365T|CDH12_ENST00000521384.1_5'UTR|CDH12_ENST00000504376.2_Missense_Mutation_p.A405T	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	405	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A405T(1)		NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						GCAGTGACAGCGCCAATGATG	0.463										HNSCC(59;0.17)																											p.A405T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1213A	5						.						102.0	77.0	85.0					5																	21802319		2203	4300	6503	21838076	SO:0001583	missense	1010	exon10			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.1213G>A	5.37:g.21802319C>T	ENSP00000371689:p.Ala405Thr	Somatic		Unspecified	Illumina	Phase_I	21838076	NM_004061	B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	ENST00000382254.1	37	CCDS3890.1	.	.	.	.	.	.	.	.	.	.	C	9.742	1.165171	0.21538	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.47528	0.84;0.84;0.84	5.84	5.84	0.93424	Cadherin (3);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.37237	0.0996	N	0.03029	-0.43	0.80722	D	1	B;D	0.69078	0.021;0.997	B;P	0.57057	0.051;0.812	T	0.26326	-1.0106	10	0.02654	T	1	.	20.1346	0.98019	0.0:1.0:0.0:0.0	.	365;405	B7Z2U6;P55289	.;CAD12_HUMAN	T	405;405;365	ENSP00000423577:A405T;ENSP00000371689:A405T;ENSP00000428786:A365T	ENSP00000371689:A405T	A	-	1	0	CDH12	21838076	0.998000	0.40836	0.575000	0.28536	0.688000	0.40055	3.759000	0.55227	2.765000	0.95021	0.655000	0.94253	GCT		CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061	
DMGDH	29958	broad.mit.edu	37	5	78359590	78359590	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-4015-01	TCGA-AG-4015-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr5:78359590G>T	ENST00000255189.3	-	2	150	c.122C>A	c.(121-123)tCt>tAt	p.S41Y	DMGDH_ENST00000540686.1_De_novo_Start_InFrame|DMGDH_ENST00000380311.4_De_novo_Start_OutOfFrame|DMGDH_ENST00000520388.1_Intron	NM_013391.2	NP_037523.2	Q9UI17	M2GD_HUMAN	dimethylglycine dehydrogenase	41					amino-acid betaine catabolic process (GO:0006579)|choline metabolic process (GO:0019695)|glycine catabolic process (GO:0006546)|glycine metabolic process (GO:0006544)	mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|dimethylglycine dehydrogenase activity (GO:0047865)|electron carrier activity (GO:0009055)|poly(A) RNA binding (GO:0044822)	p.S41Y(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	34		all_lung(232;0.000638)|Lung NSC(167;0.00173)|Ovarian(174;0.0262)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;6.52e-45)|Epithelial(54;5.96e-40)|all cancers(79;3.56e-35)		TGTTTCTGCAGATAAGGGTGG	0.463																																					p.S41Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C122A	5						.						238.0	201.0	213.0					5																	78359590		2203	4300	6503	78395346	SO:0001583	missense	29958	exon2			AF111858	CCDS4044.1	5q14.1	2008-02-05			ENSG00000132837	ENSG00000132837	1.5.99.2		24475	protein-coding gene	gene with protein product		605849				10767172, 11231903	Standard	NM_013391		Approved		uc003kfs.3	Q9UI17	OTTHUMG00000108159	ENST00000255189.3:c.122C>A	5.37:g.78359590G>T	ENSP00000255189:p.Ser41Tyr	Somatic		Unspecified	Illumina	Phase_I	78395346	NM_013391	B2RBN0|B4E1J9	Missense_Mutation	SNP	ENST00000255189.3	37	CCDS4044.1	.	.	.	.	.	.	.	.	.	.	G	6.097	0.386219	0.11524	.	.	ENSG00000132837	ENST00000255189	T	0.75154	-0.91	5.25	3.35	0.38373	.	1.238380	0.05342	N	0.530281	T	0.53286	0.1787	N	0.08118	0	0.18873	N	0.999981	B	0.09022	0.002	B	0.08055	0.003	T	0.41502	-0.9505	10	0.25751	T	0.34	.	5.0967	0.14737	0.2073:0.0:0.6268:0.1659	.	41	Q9UI17	M2GD_HUMAN	Y	41	ENSP00000255189:S41Y	ENSP00000255189:S41Y	S	-	2	0	DMGDH	78395346	0.001000	0.12720	0.008000	0.14137	0.067000	0.16453	0.667000	0.25112	2.610000	0.88304	0.561000	0.74099	TCT		DMGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226963.3	NM_013391	
ZFYVE16	9765	broad.mit.edu	37	5	79768737	79768737	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-4015-01	TCGA-AG-4015-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr5:79768737C>G	ENST00000338008.5	+	15	4362	c.4182C>G	c.(4180-4182)aaC>aaG	p.N1394K	ZFYVE16_ENST00000510158.1_Missense_Mutation_p.N1394K|ZFYVE16_ENST00000505560.1_Missense_Mutation_p.N1394K	NM_001284236.1|NM_014733.3	NP_001271165.1|NP_055548	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16	1394					BMP signaling pathway (GO:0030509)|endosomal transport (GO:0016197)|protein targeting to lysosome (GO:0006622)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|early endosome membrane (GO:0031901)|intracellular membrane-bounded organelle (GO:0043231)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein transporter activity (GO:0008565)	p.N1394K(1)		breast(4)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|liver(1)|lung(6)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)		AAAAAGGAAACAAAGGGTAGG	0.299																																					p.N1394K	Melanoma(150;1452 1854 16018 17851 37292)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4182G	5						.						60.0	62.0	61.0					5																	79768737		2203	4300	6503	79804493	SO:0001583	missense	9765	exon16			AB002303	CCDS4050.1	5q14.1	2012-09-20			ENSG00000039319	ENSG00000039319		"""Zinc fingers, FYVE domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20756	protein-coding gene	gene with protein product	"""endofin"", ""protein phosphatase 1, regulatory subunit 69"""	608880				11546807	Standard	NM_014733		Approved	KIAA0305, PPP1R69	uc003kgq.4	Q7Z3T8	OTTHUMG00000108178	ENST00000338008.5:c.4182C>G	5.37:g.79768737C>G	ENSP00000337159:p.Asn1394Lys	Somatic		Unspecified	Illumina	Phase_I	79804493	NM_001105251	O15023|Q5H9U2|Q7LAU7|Q86T69|Q8N5L3|Q8NEK3	Missense_Mutation	SNP	ENST00000338008.5	37	CCDS4050.1	.	.	.	.	.	.	.	.	.	.	C	19.40	3.820813	0.71028	.	.	ENSG00000039319	ENST00000338008;ENST00000510158;ENST00000505560	T;T;T	0.50001	0.76;0.76;0.76	5.93	3.93	0.45458	Domain of unknown function DUF3480 (1);	0.000000	0.64402	D	0.000005	T	0.66752	0.2821	M	0.81942	2.565	0.58432	D	0.999994	D;D	0.67145	0.993;0.996	D;D	0.75484	0.955;0.986	T	0.67818	-0.5572	10	0.87932	D	0	-15.2725	9.2882	0.37771	0.0:0.74:0.0:0.26	.	204;1394	B3KXA7;Q7Z3T8	.;ZFY16_HUMAN	K	1394	ENSP00000337159:N1394K;ENSP00000423663:N1394K;ENSP00000426848:N1394K	ENSP00000337159:N1394K	N	+	3	2	ZFYVE16	79804493	0.998000	0.40836	0.992000	0.48379	0.989000	0.77384	1.228000	0.32588	0.651000	0.30788	0.655000	0.94253	AAC		ZFYVE16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226982.2	NM_014733	
VCAN	1462	broad.mit.edu	37	5	82834349	82834349	+	Missense_Mutation	SNP	G	G	A	rs140580494		TCGA-AG-4015-01	TCGA-AG-4015-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr5:82834349G>A	ENST00000265077.3	+	8	6092	c.5527G>A	c.(5527-5529)Gac>Aac	p.D1843N	VCAN_ENST00000343200.5_Missense_Mutation_p.D856N|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000513016.1_3'UTR|VCAN-AS1_ENST00000513899.1_RNA|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000512590.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1843	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.D1843N(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	AGCTGCTGCCGACCCAGAAAC	0.507																																					p.D856N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2566A	5						.	G	,ASN/ASP,,ASN/ASP	1,4405	2.1+/-5.4	0,1,2202	93.0	104.0	100.0		,2566,,5527	2.1	0.0	5	dbSNP_134	100	1,8597	1.2+/-3.3	0,1,4298	no	intron,missense,intron,missense	VCAN	NM_001126336.2,NM_001164097.1,NM_001164098.1,NM_004385.4	,23,,23	0,2,6500	AA,AG,GG		0.0116,0.0227,0.0154	,benign,,benign	,856/2410,,1843/3397	82834349	2,13002	2203	4299	6502	82870105	SO:0001583	missense	1462	exon7			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.5527G>A	5.37:g.82834349G>A	ENSP00000265077:p.Asp1843Asn	Somatic		Unspecified	Illumina	Phase_I	82870105	NM_001164097	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	G	2.205	-0.382149	0.04966	2.27E-4	1.16E-4	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000513960	D;D;T	0.85013	-1.91;-1.93;3.2	5.81	2.06	0.26882	.	0.886526	0.09842	N	0.748728	T	0.77903	0.4200	L	0.56769	1.78	0.09310	N	1	B;B	0.28605	0.007;0.217	B;B	0.22152	0.007;0.038	T	0.59397	-0.7462	10	0.15066	T	0.55	.	5.378	0.16176	0.3318:0.1385:0.5297:0.0	.	856;1843	P13611-2;P13611	.;CSPG2_HUMAN	N	1843;856;856	ENSP00000265077:D1843N;ENSP00000340062:D856N;ENSP00000426251:D856N	ENSP00000265077:D1843N	D	+	1	0	VCAN	82870105	0.001000	0.12720	0.000000	0.03702	0.040000	0.13550	0.563000	0.23547	0.389000	0.25086	-0.834000	0.03071	GAC		VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
PCDHB12	56124	broad.mit.edu	37	5	140590534	140590534	+	Silent	SNP	G	G	T	rs543195348		TCGA-AG-4015-01	TCGA-AG-4015-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4015-01	TCGA-AG-4015-01	g.chr5:140590534G>T	ENST00000239450.2	+	1	2244	c.2055G>T	c.(2053-2055)tcG>tcT	p.S685S	PCDHB13_ENST00000341948.4_5'Flank|PCDHB12_ENST00000541609.1_Silent_p.S348S	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	685					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.S685S(1)		NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGGCCGACTCGCTCACTGTCT	0.701													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15830	0.0		0.0	False		,,,				2504	0.0				p.S685S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2055T	5						.						70.0	75.0	74.0					5																	140590534		2203	4296	6499	140570718	SO:0001819	synonymous_variant	56124	exon1			AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.2055G>T	5.37:g.140590534G>T		Somatic		Unspecified	Illumina	Phase_I	140570718	NM_018932	B4DDU1	Silent	SNP	ENST00000239450.2	37	CCDS4254.1																																																																																				PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932	
