#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
APC	324	broad.mit.edu	37	5	112175021	112175022	+	Frame_Shift_Ins	INS	-	-	A	rs79122263		TCGA-AG-A020-01	TCGA-AG-A020-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr5:112175021_112175022insA	ENST00000457016.1	+	16	4110_4111	c.3730_3731insA	c.(3730-3732)caafs	p.Q1244fs	APC_ENST00000508376.2_Frame_Shift_Ins_p.Q1244fs|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Frame_Shift_Ins_p.Q1244fs			P25054	APC_HUMAN	adenomatous polyposis coli	1244	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.A1246fs*10(1)|p.Q1244*(1)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TGGTCAGCCTCAAAAGGCTGCC	0.396		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q1244fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	4	Substitution - Nonsense(1)|Unknown(1)|Insertion - Frameshift(1)|Deletion - Frameshift(1)	large_intestine(2)|soft_tissue(1)|skin(1)	c.3730_3731insA	5	GRCh37	CM010756	APC	M	rs79122263	.																																			112202921	SO:0001589	frameshift_variant	324	exon16	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3734dupA	5.37:g.112175025_112175025dupA	ENSP00000413133:p.Gln1244fs	Somatic		Unspecified	Illumina	Phase_I	112202920	NM_000038	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Ins	INS	ENST00000457016.1	37	CCDS4107.1																																																																																				APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
HECW1	23072	broad.mit.edu	37	7	43484411	43484411	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A020-01	TCGA-AG-A020-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr7:43484411C>T	ENST00000395891.2	+	11	2245	c.1640C>T	c.(1639-1641)gCg>gTg	p.A547V	HECW1_ENST00000453890.1_Missense_Mutation_p.A547V	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	547					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.A526V(1)		NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						ACGGTGATCGCGTCAGCCTGC	0.687																																					p.A547V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1640T	7						.						41.0	51.0	48.0					7																	43484411		2101	4215	6316	43450936	SO:0001583	missense	23072	exon11			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.1640C>T	7.37:g.43484411C>T	ENSP00000379228:p.Ala547Val	Somatic		Unspecified	Illumina	Phase_I	43450936	NM_015052	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	ENST00000395891.2	37	CCDS5469.2	.	.	.	.	.	.	.	.	.	.	C	27.6	4.849118	0.91277	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.53857	1.13;0.6	5.32	5.32	0.75619	.	0.277160	0.41194	D	0.000921	T	0.69305	0.3096	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	T	0.64939	-0.6289	10	0.29301	T	0.29	.	19.0047	0.92846	0.0:1.0:0.0:0.0	.	547;547	B4DH42;Q76N89	.;HECW1_HUMAN	V	547	ENSP00000379228:A547V;ENSP00000407774:A547V	ENSP00000265522:A547V	A	+	2	0	HECW1	43450936	1.000000	0.71417	0.944000	0.38274	0.735000	0.41995	7.680000	0.84062	2.475000	0.83589	0.655000	0.94253	GCG		HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052	
SAMD9	54809	broad.mit.edu	37	7	92732616	92732616	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A020-01	TCGA-AG-A020-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr7:92732616G>C	ENST00000379958.2	-	3	3064	c.2795C>G	c.(2794-2796)aCc>aGc	p.T932S		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	932						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)		p.T932S(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			TAGTGAAATGGTGGTATCAGG	0.398																																					p.T932S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2795G	7						.						55.0	55.0	55.0					7																	92732616		2172	4289	6461	92570552	SO:0001583	missense	54809	exon2			AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.2795C>G	7.37:g.92732616G>C	ENSP00000369292:p.Thr932Ser	Somatic		Unspecified	Illumina	Phase_I	92570552	NM_001193307	A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	ENST00000379958.2	37	CCDS34680.1	.	.	.	.	.	.	.	.	.	.	G	11.26	1.585368	0.28268	.	.	ENSG00000205413	ENST00000379958;ENST00000446617	T;T	0.22134	1.97;2.77	4.68	1.74	0.24563	.	0.175400	0.35585	N	0.003113	T	0.16514	0.0397	L	0.59436	1.845	0.09310	N	1	B	0.22346	0.068	B	0.18561	0.022	T	0.21930	-1.0231	10	0.18710	T	0.47	-0.6752	6.4254	0.21766	0.1635:0.0:0.6908:0.1456	.	932	Q5K651	SAMD9_HUMAN	S	932	ENSP00000369292:T932S;ENSP00000414529:T932S	ENSP00000369292:T932S	T	-	2	0	SAMD9	92570552	0.923000	0.31300	0.456000	0.27044	0.861000	0.49209	1.861000	0.39438	0.600000	0.29862	-0.192000	0.12808	ACC		SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341761.1	NM_017654	
PEG10	23089	broad.mit.edu	37	7	94293392	94293392	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A020-01	TCGA-AG-A020-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr7:94293392G>A	ENST00000482108.1	+	2	1003	c.524G>A	c.(523-525)cGc>cAc	p.R175H	PEG10_ENST00000488574.1_Missense_Mutation_p.R175H	NM_001040152.1|NM_001172438.1|NM_001184962.1	NP_001035242.1|NP_001165909.1|NP_001171891.1	Q86TG7	PEG10_HUMAN	paternally expressed 10	175	Necessary for interaction with ALK1.				apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|placenta development (GO:0001890)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.R175H(1)|p.R175P(1)		NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(9)|prostate(3)|skin(1)	21	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			AGACGCCTGCGCCAAGGCATG	0.527																																					p.R175H												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G524A	7						.						140.0	146.0	144.0					7																	94293392		2020	4177	6197	94131328	SO:0001583	missense	23089	exon2			AB049834	CCDS55126.1, CCDS75636.1, CCDS75637.1	7q21	2007-12-07			ENSG00000242265	ENSG00000242265			14005	protein-coding gene	gene with protein product		609810				11318613, 15716091, 16093683	Standard	NM_001172437		Approved	KIAA1051, HB-1, MEF3L, RGAG3, Mar2, Mart2	uc011kie.2	Q86TG7	OTTHUMG00000155578	ENST00000482108.1:c.524G>A	7.37:g.94293392G>A	ENSP00000417587:p.Arg175His	Somatic		Unspecified	Illumina	Phase_I	94131328	NM_015068	Q96A68|Q9UPV1	Missense_Mutation	SNP	ENST00000482108.1	37	CCDS55126.1	.	.	.	.	.	.	.	.	.	.	G	16.55	3.154762	0.57259	.	.	ENSG00000242265	ENST00000482108;ENST00000488574	T;T	0.14022	2.54;2.54	4.05	4.05	0.47172	Retrotransposon gag protein (1);	.	.	.	.	T	0.15522	0.0374	L	0.58510	1.815	0.24211	N	0.995479	P;P	0.39250	0.665;0.665	B;B	0.33799	0.108;0.17	T	0.11251	-1.0595	9	0.52906	T	0.07	.	14.1258	0.65219	0.0:0.0:1.0:0.0	.	251;175	B4DSP0;Q86TG7	.;PEG10_HUMAN	H	175	ENSP00000417587:R175H;ENSP00000418944:R175H	ENSP00000417587:R175H	R	+	2	0	PEG10	94131328	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	2.305000	0.43664	2.276000	0.75962	0.555000	0.69702	CGC		PEG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340751.1	NM_015068	
LRWD1	222229	broad.mit.edu	37	7	102106371	102106371	+	Missense_Mutation	SNP	C	C	T	rs371342787		TCGA-AG-A020-01	TCGA-AG-A020-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr7:102106371C>T	ENST00000292616.5	+	2	340	c.188C>T	c.(187-189)cCg>cTg	p.P63L	ALKBH4_ENST00000292566.3_5'Flank|MIR5090_ENST00000582533.1_RNA	NM_152892.1	NP_690852.1	Q9UFC0	LRWD1_HUMAN	leucine-rich repeats and WD repeat domain containing 1	63					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|DNA replication initiation (GO:0006270)|establishment of protein localization to chromatin (GO:0071169)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|telomeric heterochromatin (GO:0031933)	chromatin binding (GO:0003682)|methyl-CpG binding (GO:0008327)|methylated histone binding (GO:0035064)	p.P63L(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|skin(1)|stomach(2)	20						GAGACGCTGCCGGACAACCTG	0.622																																					p.P63L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C188T	7						.	C	LEU/PRO	0,4406		0,0,2203	48.0	49.0	49.0		188	5.0	0.6	7		49	1,8599	1.2+/-3.3	0,1,4299	no	missense	LRWD1	NM_152892.1	98	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	63/648	102106371	1,13005	2203	4300	6503	101893376	SO:0001583	missense	222229	exon2			AL133057	CCDS34715.1	7q22.1	2013-01-10			ENSG00000161036	ENSG00000161036		"""WD repeat domain containing"""	21769	protein-coding gene	gene with protein product	"""origin recognition complex associated"", ""centromere protein 33"""	615167				20932478, 20850016, 20180869	Standard	NM_152892		Approved	DKFZp434K1815, ORCA, CENP-33	uc003uzn.3	Q9UFC0	OTTHUMG00000157718	ENST00000292616.5:c.188C>T	7.37:g.102106371C>T	ENSP00000292616:p.Pro63Leu	Somatic		Unspecified	Illumina	Phase_I	101893376	NM_152892	A8K4K2|B2R9G2|Q8N0T9|Q8WV43|Q96GJ2	Missense_Mutation	SNP	ENST00000292616.5	37	CCDS34715.1	.	.	.	.	.	.	.	.	.	.	C	33	5.218050	0.95104	0.0	1.16E-4	ENSG00000161036	ENST00000292616	T	0.28895	1.59	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.63343	0.2503	M	0.88310	2.945	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71932	-0.4443	10	0.87932	D	0	-11.7684	17.3718	0.87380	0.0:1.0:0.0:0.0	.	63	Q9UFC0	LRWD1_HUMAN	L	63	ENSP00000292616:P63L	ENSP00000292616:P63L	P	+	2	0	LRWD1	101893376	1.000000	0.71417	0.551000	0.28230	0.937000	0.57800	6.846000	0.75399	2.349000	0.79799	0.561000	0.74099	CCG		LRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349493.1	NM_152892	
OR4Q3	441669	broad.mit.edu	37	14	20215736	20215736	+	Silent	SNP	A	A	G			TCGA-AG-A020-01	TCGA-AG-A020-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr14:20215736A>G	ENST00000331723.1	+	1	150	c.150A>G	c.(148-150)caA>caG	p.Q50Q		NM_172194.1	NP_751944.1	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q, member 3	50						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q50Q(1)		NS(2)|breast(4)|endometrium(3)|kidney(2)|large_intestine(1)|lung(28)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TAACAGTGCAAGCCCATGCTC	0.398																																					p.Q50Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A150G	14						.						212.0	214.0	214.0					14																	20215736		2203	4300	6503	19285576	SO:0001819	synonymous_variant	441669	exon1			AF179768	CCDS32020.1	14p13	2012-08-09				ENSG00000182652		"""GPCR / Class A : Olfactory receptors"""	15426	protein-coding gene	gene with protein product				OR4Q4			Standard	NM_172194		Approved	C14orf13	uc010tkt.2	Q8NH05		ENST00000331723.1:c.150A>G	14.37:g.20215736A>G		Somatic		Unspecified	Illumina	Phase_I	19285576	NM_172194	Q6IEX4	Silent	SNP	ENST00000331723.1	37	CCDS32020.1																																																																																				OR4Q3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409818.2		
L3HYPDH	112849	broad.mit.edu	37	14	59942587	59942587	+	Splice_Site	SNP	C	C	T			TCGA-AG-A020-01	TCGA-AG-A020-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr14:59942587C>T	ENST00000247194.4	-	4	1052	c.939G>A	c.(937-939)agG>agA	p.R313R	L3HYPDH_ENST00000487285.1_Splice_Site_p.R142R|L3HYPDH_ENST00000543619.1_5'Flank	NM_144581.1	NP_653182.1	Q96EM0	T3HPD_HUMAN	L-3-hydroxyproline dehydratase (trans-)	313					metabolic process (GO:0008152)		hydro-lyase activity (GO:0016836)|trans-L-3-hydroxyproline dehydratase activity (GO:0050346)	p.R313R(1)								L-Proline(DB00172)	TGCCACTTACCCTCACAGCTT	0.448																																					p.R313R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G939A	14						.						83.0	82.0	82.0					14																	59942587		2203	4299	6502	59012340	SO:0001630	splice_region_variant	112849	exon4			AI762327	CCDS9739.1	14q23.1	2012-08-15	2012-08-15	2012-08-15	ENSG00000126790	ENSG00000126790	4.2.1.77		20488	protein-coding gene	gene with protein product	"""trans-L-3-hydroxyproline dehydratase"""	614811	"""chromosome 14 open reading frame 149"""	C14orf149		22528483	Standard	NM_144581		Approved	FLJ25436	uc001xee.1	Q96EM0	OTTHUMG00000028941	ENST00000247194.4:c.939+1G>A	14.37:g.59942587C>T		Somatic		Unspecified	Illumina	Phase_I	59012340	NM_144581	Q96LJ5	Silent	SNP	ENST00000247194.4	37	CCDS9739.1																																																																																				L3HYPDH-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072254.5	NM_144581	Silent
RTN1	6252	broad.mit.edu	37	14	60212675	60212675	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A020-01	TCGA-AG-A020-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr14:60212675C>G	ENST00000267484.5	-	2	1101	c.766G>C	c.(766-768)Gaa>Caa	p.E256Q		NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	256					neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)		p.E256Q(1)		central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		GTGGATTCTTCCAATAAATGG	0.438																																					p.E256Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G766C	14						.						181.0	177.0	179.0					14																	60212675		2203	4300	6503	59282428	SO:0001583	missense	6252	exon2			L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.766G>C	14.37:g.60212675C>G	ENSP00000267484:p.Glu256Gln	Somatic		Unspecified	Illumina	Phase_I	59282428	NM_021136	Q16800|Q16801|Q5BKZ4|Q9BQ59	Missense_Mutation	SNP	ENST00000267484.5	37	CCDS9740.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.047198	0.75846	.	.	ENSG00000139970	ENST00000267484;ENST00000433623	T	0.30981	1.51	5.16	5.16	0.70880	.	0.380677	0.29328	N	0.012466	T	0.46190	0.1380	M	0.69823	2.125	0.38375	D	0.944966	D	0.67145	0.996	P	0.51657	0.676	T	0.48410	-0.9038	10	0.30078	T	0.28	.	18.6522	0.91433	0.0:1.0:0.0:0.0	.	256	Q16799	RTN1_HUMAN	Q	256;182	ENSP00000267484:E256Q	ENSP00000267484:E256Q	E	-	1	0	RTN1	59282428	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	5.323000	0.65858	2.399000	0.81585	0.557000	0.71058	GAA		RTN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000072278.2		
SEL1L	6400	broad.mit.edu	37	14	81964374	81964374	+	Silent	SNP	C	C	T			TCGA-AG-A020-01	TCGA-AG-A020-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr14:81964374C>T	ENST00000336735.4	-	10	1106	c.990G>A	c.(988-990)tcG>tcA	p.S330S		NM_005065.5	NP_005056.3	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like (C. elegans)	330	Interaction with ERLEC1, OS9 and SYVN1.				Notch signaling pathway (GO:0007219)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.S330S(1)		breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	28				BRCA - Breast invasive adenocarcinoma(234;0.0299)		CTCCTGTTAGCGAGATATCAC	0.403																																					p.S330S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G990A	14						.						72.0	66.0	68.0					14																	81964374		2203	4300	6503	81034127	SO:0001819	synonymous_variant	6400	exon10				CCDS9876.1, CCDS58333.1	14q31	2011-03-31	2001-11-28		ENSG00000071537	ENSG00000071537			10717	protein-coding gene	gene with protein product	"""sel-1 suppressor of lin-12-like 1 (C. elegans)"""	602329	"""sel-1 (suppressor of lin-12, C.elegans)-like"""			9417916, 10051412, 16331677	Standard	NM_005065		Approved	IBD2, SEL1L1	uc010tvv.2	Q9UBV2		ENST00000336735.4:c.990G>A	14.37:g.81964374C>T		Somatic		Unspecified	Illumina	Phase_I	81034127	NM_005065	Q6UWT6|Q9P1T9|Q9UHK7	Silent	SNP	ENST00000336735.4	37	CCDS9876.1																																																																																				SEL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413325.1	NM_005065	
UNC79	57578	broad.mit.edu	37	14	94083506	94083506	+	Silent	SNP	C	C	G			TCGA-AG-A020-01	TCGA-AG-A020-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr14:94083506C>G	ENST00000393151.2	+	28	4080	c.4080C>G	c.(4078-4080)ctC>ctG	p.L1360L	UNC79_ENST00000555664.1_Silent_p.L1360L|UNC79_ENST00000256339.4_Silent_p.L1183L|UNC79_ENST00000553484.1_Silent_p.L1382L			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1360					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L1382L(1)|p.L1183L(1)		breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						AACACCTTCTCCCCTTAGTGG	0.423																																					p.L1183L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C3549G	14						.						112.0	109.0	110.0					14																	94083506		2203	4300	6503	93153259	SO:0001819	synonymous_variant	57578	exon28			AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.4080C>G	14.37:g.94083506C>G		Somatic		Unspecified	Illumina	Phase_I	93153259	NM_020818	B5MDL6|Q6ZUT7	Silent	SNP	ENST00000393151.2	37																																																																																					UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
GTPBP1	9567	broad.mit.edu	37	22	39124077	39124077	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A020-01	TCGA-AG-A020-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr22:39124077C>T	ENST00000216044.5	+	10	1860	c.1627C>T	c.(1627-1629)Cgc>Tgc	p.R543C		NM_004286.4	NP_004277.2	O00178	GTPB1_HUMAN	GTP binding protein 1	543					GTP catabolic process (GO:0006184)|immune response (GO:0006955)|positive regulation of mRNA catabolic process (GO:0061014)|signal transduction (GO:0007165)	cytoplasmic exosome (RNase complex) (GO:0000177)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.R543C(1)		endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	18	Melanoma(58;0.04)					TGTACACTTCCGCTTCATCAA	0.587																																					p.R543C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1627T	22						.						149.0	97.0	114.0					22																	39124077		2203	4300	6503	37454023	SO:0001583	missense	9567	exon10			U87964	CCDS13977.2	22q13.1	2008-07-01			ENSG00000100226	ENSG00000100226			4669	protein-coding gene	gene with protein product		602245				9070279	Standard	XM_005261857		Approved	GP-1, HSPC018	uc003awg.3	O00178	OTTHUMG00000151002	ENST00000216044.5:c.1627C>T	22.37:g.39124077C>T	ENSP00000216044:p.Arg543Cys	Somatic		Unspecified	Illumina	Phase_I	37454023	NM_004286	Q6IC67	Missense_Mutation	SNP	ENST00000216044.5	37	CCDS13977.2	.	.	.	.	.	.	.	.	.	.	C	34	5.408272	0.96051	.	.	ENSG00000100226	ENST00000216044;ENST00000458073	T	0.37235	1.21	5.75	5.75	0.90469	Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (1);Translation elongation factor EFTu/EF1A, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.71213	0.3313	M	0.92604	3.325	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.77485	-0.2570	10	0.66056	D	0.02	.	19.9421	0.97168	0.0:1.0:0.0:0.0	.	543	O00178	GTPB1_HUMAN	C	543;121	ENSP00000216044:R543C	ENSP00000216044:R543C	R	+	1	0	GTPBP1	37454023	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.681000	0.84073	2.714000	0.92807	0.561000	0.74099	CGC		GTPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075532.1	NM_004286	
LILRB5	10990	broad.mit.edu	37	19	54756400	54756400	+	Missense_Mutation	SNP	C	C	T	rs367690586		TCGA-AG-A020-01	TCGA-AG-A020-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr19:54756400C>T	ENST00000316219.5	-	10	1591	c.1484G>A	c.(1483-1485)cGt>cAt	p.R495H	CTD-2337J16.1_ENST00000595133.1_lincRNA|LILRB5_ENST00000450632.1_Missense_Mutation_p.R487H|LILRB5_ENST00000449561.2_Missense_Mutation_p.R496H|LILRB5_ENST00000345866.6_Missense_Mutation_p.R396H	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	495					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)	p.R495H(2)|p.R487H(2)		NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CCCTGCAGGACGGTAGAAATG	0.597																																					p.R496H												.	.	4	Substitution - Missense(4)	large_intestine(2)|prostate(2)	c.G1487A	19						.	C	HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	83.0	80.0	81.0		1487,1187,1484	-3.1	0.0	19		81	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense,missense	LILRB5	NM_001081442.1,NM_001081443.1,NM_006840.3	29,29,29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign,benign,benign	496/592,396/492,495/591	54756400	2,13004	2203	4300	6503	59448212	SO:0001583	missense	10990	exon10			AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.1484G>A	19.37:g.54756400C>T	ENSP00000320390:p.Arg495His	Somatic		Unspecified	Illumina	Phase_I	59448212	NM_001081442	Q8N760	Missense_Mutation	SNP	ENST00000316219.5	37	CCDS12885.1	.	.	.	.	.	.	.	.	.	.	C	4.006	-0.001534	0.07819	0.0	2.33E-4	ENSG00000105609	ENST00000316219;ENST00000450632;ENST00000449561;ENST00000345866	T;T;T;T	0.00479	7.12;7.13;7.12;7.16	1.57	-3.14	0.05250	.	.	.	.	.	T	0.00178	0.0005	N	0.16790	0.44	0.09310	N	1	B;B;B;P	0.46784	0.032;0.013;0.099;0.884	B;B;B;B	0.38056	0.013;0.013;0.015;0.264	T	0.40346	-0.9568	9	0.07644	T	0.81	.	0.9829	0.01440	0.2361:0.3953:0.1794:0.1893	.	487;396;496;495	C9JMK7;O75023-2;O75023-3;O75023	.;.;.;LIRB5_HUMAN	H	495;487;496;396	ENSP00000320390:R495H;ENSP00000414225:R487H;ENSP00000406478:R496H;ENSP00000263430:R396H	ENSP00000320390:R495H	R	-	2	0	LILRB5	59448212	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.670000	0.05256	-2.029000	0.00930	-0.745000	0.03516	CGT		LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142877.2		
ZIM3	114026	broad.mit.edu	37	19	57646816	57646816	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A020-01	TCGA-AG-A020-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr19:57646816G>A	ENST00000269834.1	-	5	1274	c.889C>T	c.(889-891)Cat>Tat	p.H297Y	U3_ENST00000516874.1_RNA	NM_052882.1	NP_443114.1	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	297					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H297Y(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(27)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	52		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		ACTTTTTTATGTTGAATGAGG	0.373																																					p.H297Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C889T	19						.						114.0	113.0	114.0					19																	57646816		2203	4300	6503	62338628	SO:0001583	missense	114026	exon5			AF365931	CCDS33125.1	19q13.4	2013-01-08				ENSG00000141946		"""Zinc fingers, C2H2-type"", ""-"""	16366	protein-coding gene	gene with protein product							Standard	NM_052882		Approved	ZNF657	uc002qnz.1	Q96PE6		ENST00000269834.1:c.889C>T	19.37:g.57646816G>A	ENSP00000269834:p.His297Tyr	Somatic		Unspecified	Illumina	Phase_I	62338628	NM_052882	Q14CA6	Missense_Mutation	SNP	ENST00000269834.1	37	CCDS33125.1	.	.	.	.	.	.	.	.	.	.	G	10.66	1.413521	0.25465	.	.	ENSG00000141946	ENST00000269834	D	0.86769	-2.17	2.53	2.53	0.30540	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94532	0.8239	M	0.94101	3.495	0.31567	N	0.656744	D	0.76494	0.999	D	0.85130	0.997	D	0.92854	0.6300	9	0.87932	D	0	.	12.1258	0.53917	0.0:0.0:1.0:0.0	.	297	Q96PE6	ZIM3_HUMAN	Y	297	ENSP00000269834:H297Y	ENSP00000269834:H297Y	H	-	1	0	ZIM3	62338628	1.000000	0.71417	0.579000	0.28588	0.238000	0.25445	7.542000	0.82095	1.392000	0.46585	0.313000	0.20887	CAT		ZIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465078.1		
CSMD1	64478	broad.mit.edu	37	8	3263696	3263696	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-A020-01	TCGA-AG-A020-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr8:3263696G>A	ENST00000520002.1	-	16	2677	c.2122C>T	c.(2122-2124)Cga>Tga	p.R708*	CSMD1_ENST00000537824.1_Nonsense_Mutation_p.R707*|CSMD1_ENST00000602723.1_Nonsense_Mutation_p.R708*|CSMD1_ENST00000400186.3_Nonsense_Mutation_p.R708*|CSMD1_ENST00000542608.1_Nonsense_Mutation_p.R707*|CSMD1_ENST00000539096.1_Nonsense_Mutation_p.R707*|CSMD1_ENST00000602557.1_Nonsense_Mutation_p.R708*			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	708	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.R436*(1)|p.R707*(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CCAAAACGTCGTCCGTTTATA	0.418																																					p.T707M												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C2120T	8						.						45.0	45.0	45.0					8																	3263696		1870	4108	5978	3251103	SO:0001587	stop_gained	64478	exon15					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.2122C>T	8.37:g.3263696G>A	ENSP00000430733:p.Arg708*	Somatic		Unspecified	Illumina	Phase_I	3251103	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Nonsense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	40|40	8.095341|8.095341	0.98651|0.98651	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096|ENST00000335551	.|.	.|.	.|.	5.46|5.46	3.45|3.45	0.39498|0.39498	.|.	0.078833|.	0.52532|.	D|.	0.000073|.	.|T	.|0.55065	.|0.1897	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.64605	.|-0.6368	.|3	0.09590|.	T|.	0.72|.	.|.	11.8581|11.8581	0.52451|0.52451	0.0:0.0:0.4028:0.5972|0.0:0.0:0.4028:0.5972	.|.	.|.	.|.	.|.	X|M	708;708;570;707;707;707|187	.|.	ENSP00000320445:R570X|.	R|T	-|-	1|2	2|0	CSMD1|CSMD1	3251103|3251103	0.917000|0.917000	0.31117|0.31117	0.803000|0.803000	0.32268|0.32268	0.013000|0.013000	0.08279|0.08279	2.425000|2.425000	0.44723|0.44723	1.255000|1.255000	0.44051|0.44051	0.655000|0.655000	0.94253|0.94253	CGA|ACG		CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
FZD3	7976	broad.mit.edu	37	8	28385090	28385090	+	Silent	SNP	A	A	G			TCGA-AG-A020-01	TCGA-AG-A020-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr8:28385090A>G	ENST00000240093.3	+	5	1291	c.813A>G	c.(811-813)caA>caG	p.Q271Q	RNA5SP259_ENST00000365541.1_RNA|FZD3_ENST00000537916.1_Silent_p.Q271Q	NM_017412.3	NP_059108.1	Q9NPG1	FZD3_HUMAN	frizzled class receptor 3	271					canonical Wnt signaling pathway (GO:0060070)|cell proliferation in midbrain (GO:0033278)|commissural neuron axon guidance (GO:0071679)|establishment of planar polarity (GO:0001736)|facial nucleus development (GO:0021754)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hair follicle development (GO:0001942)|inner ear morphogenesis (GO:0042472)|neural tube closure (GO:0001843)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|post-anal tail morphogenesis (GO:0036342)|vasculature development (GO:0001944)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|neuron projection membrane (GO:0032589)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.Q271Q(1)		central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(15)|ovary(1)|prostate(1)|skin(1)	41		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.109)|Kidney(114;0.13)|Colorectal(74;0.23)		TCCCTGCACAATATAAGGCTT	0.383																																					p.Q271Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A813G	8						.						88.0	90.0	89.0					8																	28385090		2203	4299	6502	28441009	SO:0001819	synonymous_variant	7976	exon4			AJ272427	CCDS6069.1	8p21	2014-06-27	2014-01-29		ENSG00000104290	ENSG00000104290		"""GPCR / Class F : Frizzled receptors"""	4041	protein-coding gene	gene with protein product		606143	"""frizzled (Drosophila) homolog 3"", ""frizzled homolog 3 (Drosophila)"", ""frizzled 3, seven transmembrane spanning receptor"", ""frizzled family receptor 3"""			10777673, 10873558	Standard	NM_145866		Approved		uc010lvb.3	Q9NPG1	OTTHUMG00000102145	ENST00000240093.3:c.813A>G	8.37:g.28385090A>G		Somatic		Unspecified	Illumina	Phase_I	28441009	NM_145866	A8K615	Silent	SNP	ENST00000240093.3	37	CCDS6069.1																																																																																				FZD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219986.2	NM_145866	
CHRNB3	1142	broad.mit.edu	37	8	42587324	42587324	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A020-01	TCGA-AG-A020-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr8:42587324G>A	ENST00000289957.2	+	5	1002	c.874G>A	c.(874-876)Gtc>Atc	p.V292I		NM_000749.3	NP_000740.1	Q05901	ACHB3_HUMAN	cholinergic receptor, nicotinic, beta 3 (neuronal)	292					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|protein heterooligomerization (GO:0051291)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)|drug binding (GO:0008144)	p.V292I(1)		endometrium(4)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	25	all_lung(13;5.7e-12)|Lung NSC(13;1.6e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00026)|Lung NSC(58;0.000992)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	Lung(22;0.0199)|LUSC - Lung squamous cell carcinoma(45;0.0869)		Galantamine(DB00674)|Nicotine(DB00184)	GTCTTCCAAAGTCATTCCTCT	0.403																																					p.V292I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G874A	8						.						270.0	245.0	254.0					8																	42587324		2203	4300	6503	42706481	SO:0001583	missense	1142	exon5			U62438	CCDS6134.1	8p11.21	2012-02-11	2012-02-07		ENSG00000147432	ENSG00000147432		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1963	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 3 (neuronal)"""	118508	"""cholinergic receptor, nicotinic, beta polypeptide 3"""			1505988	Standard	NM_000749		Approved		uc003xpi.1	Q05901	OTTHUMG00000165262	ENST00000289957.2:c.874G>A	8.37:g.42587324G>A	ENSP00000289957:p.Val292Ile	Somatic		Unspecified	Illumina	Phase_I	42706481	NM_000749	Q15827	Missense_Mutation	SNP	ENST00000289957.2	37	CCDS6134.1	.	.	.	.	.	.	.	.	.	.	g	32	5.160200	0.94727	.	.	ENSG00000147432	ENST00000289957	D	0.88124	-2.34	5.85	5.85	0.93711	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.95284	0.8470	M	0.91354	3.2	0.80722	D	1	D	0.71674	0.998	D	0.85130	0.997	D	0.95341	0.8438	10	0.66056	D	0.02	.	20.2225	0.98327	0.0:0.0:1.0:0.0	.	292	Q05901	ACHB3_HUMAN	I	292	ENSP00000289957:V292I	ENSP00000289957:V292I	V	+	1	0	CHRNB3	42706481	1.000000	0.71417	0.991000	0.47740	0.991000	0.79684	9.869000	0.99810	2.778000	0.95560	0.650000	0.86243	GTC		CHRNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383055.1		
CYP7B1	9420	broad.mit.edu	37	8	65528278	65528279	+	Missense_Mutation	DNP	AT	AT	TA			TCGA-AG-A020-01	TCGA-AG-A020-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr8:65528278_65528279AT>TA	ENST00000310193.3	-	3	992_993	c.819_820AT>TA	c.(817-822)aaATat>aaTAat	p.273_274KY>NN	CYP7B1_ENST00000523954.1_5'UTR	NM_004820.3	NP_004811.1	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B, polypeptide 1	273					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|cholesterol metabolic process (GO:0008203)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|positive regulation of epithelial cell proliferation (GO:0050679)|prostate gland epithelium morphogenesis (GO:0060740)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	25-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)	p.K273>?(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				TGCACATAATATTTCTCCAGGA	0.351																																					.												.	.	1	Complex(1)	large_intestine(1)	c.819_820TA	8						.																																			65690833	SO:0001583	missense	9420	exon3			AF029403	CCDS6180.1	8q21.3	2008-07-04	2003-01-14		ENSG00000172817	ENSG00000172817		"""Cytochrome P450s"""	2652	protein-coding gene	gene with protein product		603711	"""cytochrome P450, subfamily VIIB (oxysterol 7 alpha-hydroxylase), polypeptide 1"", ""spastic paraplegia 5A (autosomal recessive)"""	SPG5A		9802883, 18252231	Standard	NM_004820		Approved		uc003xvj.2	O75881	OTTHUMG00000164387	ENST00000310193.3:c.819_820delinsTA	8.37:g.65528278_65528279delinsTA	ENSP00000310721:p.K273_Y274delinsNN	Somatic		Unspecified	Illumina	Phase_I	65690832	NM_004820	B2RN07|Q9UNF5	Missense_Mutation	DNP	ENST00000310193.3	37	CCDS6180.1																																																																																				CYP7B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378550.1		
RIMS2	9699	broad.mit.edu	37	8	104898096	104898096	+	Silent	SNP	T	T	G			TCGA-AG-A020-01	TCGA-AG-A020-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr8:104898096T>G	ENST00000436393.2	+	2	844	c.603T>G	c.(601-603)tcT>tcG	p.S201S	RIMS2_ENST00000406091.3_Silent_p.S423S|RIMS2_ENST00000507740.1_Silent_p.S231S|RIMS2_ENST00000262231.10_Silent_p.S231S			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	454					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.S231S(3)|p.S459S(2)|p.S201S(2)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GACCAAGTTCTTATGCACAAA	0.478										HNSCC(12;0.0054)																											p.S423S												.	.	7	Substitution - coding silent(7)	large_intestine(7)	c.T1269G	8						.						85.0	80.0	81.0					8																	104898096		1935	4137	6072	104967272	SO:0001819	synonymous_variant	9699	exon4			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.603T>G	8.37:g.104898096T>G		Somatic		Unspecified	Illumina	Phase_I	104967272	NM_001100117	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Silent	SNP	ENST00000436393.2	37																																																																																					RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117	
CSF1	1435	broad.mit.edu	37	1	110466663	110466663	+	Missense_Mutation	SNP	G	G	A	rs548942397		TCGA-AG-A020-01	TCGA-AG-A020-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr1:110466663G>A	ENST00000329608.6	+	6	1811	c.1420G>A	c.(1420-1422)Gtt>Att	p.V474I	CSF1_ENST00000369801.1_Intron|CSF1_ENST00000344188.5_Intron|CSF1_ENST00000369802.3_Missense_Mutation_p.V474I|CSF1_ENST00000420111.2_Intron	NM_000757.5|NM_172211.3	NP_000748|NP_757350.1	P09603	CSF1_HUMAN	colony stimulating factor 1 (macrophage)	474					branching involved in mammary gland duct morphogenesis (GO:0060444)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|developmental process involved in reproduction (GO:0003006)|hemopoiesis (GO:0030097)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary duct terminal end bud growth (GO:0060763)|mammary gland fat development (GO:0060611)|monocyte activation (GO:0042117)|odontogenesis (GO:0042476)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|osteoclast proliferation (GO:0002158)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of monocyte differentiation (GO:0045657)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of macrophage derived foam cell differentiation (GO:0010743)|regulation of ossification (GO:0030278)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|macrophage colony-stimulating factor receptor binding (GO:0005157)|protein homodimerization activity (GO:0042803)	p.V474I(1)		breast(1)|endometrium(3)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	20		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Acute lymphoblastic leukemia(138;0.204)		Lung(183;0.0238)|Colorectal(144;0.112)|all cancers(265;0.117)|Epithelial(280;0.127)|LUSC - Lung squamous cell carcinoma(189;0.135)		TTTTAACTCCGTTCCTTTGAC	0.632													G|||	1	0.000199681	0.0	0.0	5008	,	,		17035	0.0		0.0	False		,,,				2504	0.001				p.V474I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1420A	1						.						73.0	81.0	78.0					1																	110466663		2203	4300	6503	110268186	SO:0001583	missense	1435	exon6			BC021117	CCDS816.1, CCDS817.1, CCDS30797.1	1p13.3	2012-09-20			ENSG00000184371	ENSG00000184371			2432	protein-coding gene	gene with protein product		120420				1540160	Standard	NM_172210		Approved	M-CSF, MCSF, MGC31930	uc001dyw.4	P09603	OTTHUMG00000011646	ENST00000329608.6:c.1420G>A	1.37:g.110466663G>A	ENSP00000327513:p.Val474Ile	Somatic		Unspecified	Illumina	Phase_I	110268186	NM_000757	A8K6J5|Q13130|Q14086|Q14806|Q5VVF3|Q5VVF4|Q9UQR8	Missense_Mutation	SNP	ENST00000329608.6	37	CCDS816.1	.	.	.	.	.	.	.	.	.	.	G	6.175	0.400558	0.11696	.	.	ENSG00000184371	ENST00000329608;ENST00000369802	T;T	0.11277	2.79;2.79	5.57	-1.29	0.09288	.	0.920311	0.09003	N	0.862624	T	0.00998	0.0033	N	0.10733	0.035	0.31008	N	0.719603	B	0.18610	0.029	B	0.12837	0.008	T	0.47674	-0.9099	10	0.08837	T	0.75	.	2.3246	0.04220	0.2426:0.2613:0.3864:0.1096	.	474	P09603	CSF1_HUMAN	I	474	ENSP00000327513:V474I;ENSP00000358817:V474I	ENSP00000327513:V474I	V	+	1	0	CSF1	110268186	0.012000	0.17670	0.781000	0.31783	0.976000	0.68499	-0.151000	0.10175	0.027000	0.15297	0.467000	0.42956	GTT		CSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032208.1	NM_000757	
SPTA1	6708	broad.mit.edu	37	1	158624492	158624492	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-A020-01	TCGA-AG-A020-01	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr1:158624492A>T	ENST00000368147.4	-	21	3125	c.2945T>A	c.(2944-2946)gTc>gAc	p.V982D		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	982	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.V982D(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TAAAGCCATGACCCTTTGTTC	0.488																																					p.V982D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2945A	1						.						77.0	76.0	76.0					1																	158624492		1951	4160	6111	156891116	SO:0001583	missense	6708	exon21			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.2945T>A	1.37:g.158624492A>T	ENSP00000357129:p.Val982Asp	Somatic		Unspecified	Illumina	Phase_I	156891116	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.957783	0.73902	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.35605	1.3;1.3	5.31	5.31	0.75309	Src homology-3 domain (3);Spectrin alpha chain, SH3 domain (1);	0.000000	0.29684	N	0.011478	T	0.63010	0.2475	M	0.93808	3.46	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	T	0.73304	-0.4025	10	0.62326	D	0.03	.	14.2542	0.66040	1.0:0.0:0.0:0.0	.	982	P02549	SPTA1_HUMAN	D	982	ENSP00000357130:V982D;ENSP00000357129:V982D	ENSP00000357129:V982D	V	-	2	0	SPTA1	156891116	1.000000	0.71417	0.904000	0.35570	0.555000	0.35460	8.213000	0.89758	2.243000	0.73865	0.482000	0.46254	GTC		SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
SELP	6403	broad.mit.edu	37	1	169572294	169572294	+	Missense_Mutation	SNP	G	G	A	rs144811959	byFrequency	TCGA-AG-A020-01	TCGA-AG-A020-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr1:169572294G>A	ENST00000263686.6	-	10	1712	c.1675C>T	c.(1675-1677)Cgc>Tgc	p.R559C	SELP_ENST00000367794.2_Missense_Mutation_p.R497C|SELP_ENST00000458599.2_Intron|SELP_ENST00000367793.2_Missense_Mutation_p.R497C|SELP_ENST00000367786.2_Missense_Mutation_p.R497C|SELP_ENST00000367791.2_Missense_Mutation_p.R435C|SELP_ENST00000367788.2_Missense_Mutation_p.R497C|SELP_ENST00000367792.2_Intron	NM_003005.3	NP_002996.2	P16109	LYAM3_HUMAN	selectin P (granule membrane protein 140kDa, antigen CD62)	559	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|defense response to Gram-negative bacterium (GO:0050829)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of platelet activation (GO:0010572)|regulation of integrin activation (GO:0033623)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|platelet dense granule membrane (GO:0031088)	fucose binding (GO:0042806)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|lipopolysaccharide binding (GO:0001530)|oligosaccharide binding (GO:0070492)|sialic acid binding (GO:0033691)	p.R559C(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(32)|ovary(4)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(923;0.208)				Dalteparin(DB06779)|Heparin(DB01109)|Nadroparin(DB08813)	TCTGTCCAGCGTCCCGATCGA	0.448																																					p.R559C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1675T	1						.	G	CYS/ARG	0,4406		0,0,2203	105.0	97.0	100.0		1675	5.0	0.1	1	dbSNP_134	100	4,8596	3.7+/-12.6	0,4,4296	yes	missense	SELP	NM_003005.3	180	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	possibly-damaging	559/831	169572294	4,13002	2203	4300	6503	167838918	SO:0001583	missense	6403	exon10			BC068533	CCDS1282.1	1q22-q25	2008-02-05	2002-08-29		ENSG00000174175	ENSG00000174175		"""CD molecules"""	10721	protein-coding gene	gene with protein product		173610	"""selectin P (granule membrane protein 140kD, antigen CD62)"""	GRMP		1375831	Standard	NM_003005		Approved	CD62, PSEL, PADGEM, GMP140, CD62P	uc001ggi.4	P16109	OTTHUMG00000034685	ENST00000263686.6:c.1675C>T	1.37:g.169572294G>A	ENSP00000263686:p.Arg559Cys	Somatic		Unspecified	Illumina	Phase_I	167838918	NM_003005	Q5R344|Q8IVD1	Missense_Mutation	SNP	ENST00000263686.6	37	CCDS1282.1	.	.	.	.	.	.	.	.	.	.	G	13.39	2.222295	0.39300	0.0	4.65E-4	ENSG00000174175	ENST00000367795;ENST00000367790;ENST00000426706;ENST00000263686;ENST00000544572;ENST00000367793;ENST00000367794;ENST00000367791;ENST00000367788;ENST00000367786;ENST00000458599	T;T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19;-0.19;-0.19	5.9	4.98	0.66077	Complement control module (2);Sushi/SCR/CCP (3);	0.957439	0.08697	N	0.906990	T	0.56877	0.2015	L	0.58354	1.805	0.22728	N	0.998801	P;P;P	0.52061	0.928;0.928;0.95	P;P;P	0.51453	0.67;0.601;0.471	T	0.52419	-0.8578	10	0.54805	T	0.06	-0.7352	12.5811	0.56391	0.0:0.0:0.8346:0.1654	.	559;559;559	Q6NUL9;P16109;G3V1U2	.;LYAM3_HUMAN;.	C	435;559;558;559;559;497;497;435;497;497;482	ENSP00000263686:R559C;ENSP00000356767:R497C;ENSP00000356768:R497C;ENSP00000356765:R435C;ENSP00000356762:R497C;ENSP00000356760:R497C	ENSP00000263686:R559C	R	-	1	0	SELP	167838918	0.520000	0.26250	0.134000	0.22075	0.169000	0.22640	0.678000	0.25277	1.464000	0.47987	0.650000	0.86243	CGC		SELP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083916.4	NM_003005	
DUSP10	11221	broad.mit.edu	37	1	221875849	221875849	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A020-01	TCGA-AG-A020-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr1:221875849T>A	ENST00000366899.3	-	4	1592	c.1354A>T	c.(1354-1356)Atg>Ttg	p.M452L	DUSP10_ENST00000544095.1_Missense_Mutation_p.M110L|DUSP10_ENST00000468085.1_5'UTR|DUSP10_ENST00000323825.3_Missense_Mutation_p.M110L	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10	452	Tyrosine-protein phosphatase.				inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.M452L(1)		NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		AACTGCCCCATGAAGTTAAGG	0.468																																					p.M110L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A328T	1						.						226.0	207.0	213.0					1																	221875849		2203	4300	6503	219942472	SO:0001583	missense	11221	exon3			AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.1354A>T	1.37:g.221875849T>A	ENSP00000355866:p.Met452Leu	Somatic		Unspecified	Illumina	Phase_I	219942472	NM_144728	D3DTB4|Q6GSI4|Q9H9Z5	Missense_Mutation	SNP	ENST00000366899.3	37	CCDS1528.1	.	.	.	.	.	.	.	.	.	.	T	25.9	4.683432	0.88542	.	.	ENSG00000143507	ENST00000366899;ENST00000418487;ENST00000323825;ENST00000544095	T;T;T	0.57595	0.39;0.39;0.39	5.72	5.72	0.89469	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.000000	0.85682	D	0.000000	T	0.62696	0.2449	L	0.35723	1.085	0.80722	D	1	D	0.63880	0.993	D	0.66084	0.941	T	0.62253	-0.6893	10	0.45353	T	0.12	.	16.2988	0.82793	0.0:0.0:0.0:1.0	.	452	Q9Y6W6	DUS10_HUMAN	L	452;397;110;110	ENSP00000355866:M452L;ENSP00000322015:M110L;ENSP00000441302:M110L	ENSP00000322015:M110L	M	-	1	0	DUSP10	219942472	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.997000	0.88414	2.311000	0.77944	0.533000	0.62120	ATG		DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090716.1	NM_007207	
KIAA0754	643314	broad.mit.edu	37	1	39879055	39879055	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A020-01	TCGA-AG-A020-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr1:39879055A>G	ENST00000530275.1	+	1	2905	c.2710A>G	c.(2710-2712)Acc>Gcc	p.T904A	MACF1_ENST00000539005.1_Intron|MACF1_ENST00000372915.3_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000564288.1_Intron|MACF1_ENST00000289893.4_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000567887.1_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	904	Ala-rich.							p.T904A(1)		central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AGAGGAGCCCACCTCCCCAGC	0.721																																					p.T1040A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3118G	1						.						3.0	4.0	4.0					1																	39879055		1652	3673	5325	39651642	SO:0001583	missense	643314	exon1					1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.2710A>G	1.37:g.39879055A>G	ENSP00000431179:p.Thr904Ala	Somatic		Unspecified	Illumina	Phase_I	39651642	NM_015038	E9PMC2|Q6ZSB2	Missense_Mutation	SNP	ENST00000530275.1	37		.	.	.	.	.	.	.	.	.	.	a	0.018	-1.486764	0.01018	.	.	ENSG00000255103	ENST00000530275	T	0.21543	2.0	4.34	-4.58	0.03410	.	.	.	.	.	T	0.06234	0.0161	N	0.05124	-0.11	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.39035	-0.9633	9	0.08381	T	0.77	.	2.8824	0.05652	0.3663:0.1097:0.4125:0.1114	.	904	O94854	K0754_HUMAN	A	904	ENSP00000431179:T904A	ENSP00000431179:T904A	T	+	1	0	RP4-562N20.1	39651642	0.023000	0.18921	0.000000	0.03702	0.001000	0.01503	0.349000	0.20055	-0.695000	0.05105	-2.895000	0.00094	ACC		KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000392100.1	NM_015038	
HYI	81888	broad.mit.edu	37	1	43913916	43913916	+	IGR	SNP	C	C	T			TCGA-AG-A020-01	TCGA-AG-A020-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr1:43913916C>T	ENST00000372425.4	-	0	1115				SZT2_ENST00000372442.1_Missense_Mutation_p.P2345S|SZT2-AS1_ENST00000396885.2_RNA|SZT2_ENST00000562955.1_Missense_Mutation_p.P3187S			Q5T013	HYI_HUMAN	hydroxypyruvate isomerase (putative)								hydroxypyruvate isomerase activity (GO:0008903)	p.P2345S(2)		large_intestine(1)|lung(2)|ovary(1)|urinary_tract(2)	6	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				AGCGCCTGGACCGGCTCCTCT	0.687																																					p.P2345S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C7033T	1						.						9.0	11.0	10.0					1																	43913916		2196	4291	6487	43686503	SO:0001628	intergenic_variant	23334	exon54				CCDS488.1, CCDS488.2, CCDS53309.1, CCDS72771.1	1p34.2	2010-06-24	2010-06-24		ENSG00000178922	ENSG00000178922	5.3.1.22		26948	protein-coding gene	gene with protein product			"""hydroxypyruvate isomerase homolog (E. coli)"""			10561547	Standard	NM_031207		Approved	HT036	uc001cjo.3	Q5T013	OTTHUMG00000007502		1.37:g.43913916C>T		Somatic		Unspecified	Illumina	Phase_I	43686503	NM_015284	D3DPX4|D3DPX5|Q5Q9A2|Q7Z778|Q96S83|Q9BZR3|Q9BZR4	Missense_Mutation	SNP	ENST00000372425.4	37	CCDS53309.1	.	.	.	.	.	.	.	.	.	.	C	6.065	0.380342	0.11466	.	.	ENSG00000198198	ENST00000372442	.	.	.	5.65	3.74	0.42951	.	0.190773	0.38058	N	0.001822	T	0.36054	0.0953	L	0.43152	1.355	0.09310	N	1	B;B	0.22683	0.001;0.073	B;B	0.21151	0.005;0.033	T	0.20107	-1.0285	9	0.14252	T	0.57	.	10.6749	0.45781	0.2667:0.6047:0.1286:0.0	.	3244;3187	Q5T011;Q5T011-5	SZT2_HUMAN;.	S	2345	.	ENSP00000361519:P2345S	P	+	1	0	SZT2	43686503	0.034000	0.19679	0.103000	0.21229	0.043000	0.13939	1.964000	0.40462	0.710000	0.31997	-0.311000	0.09066	CCG		HYI-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_031207	
BRDT	676	broad.mit.edu	37	1	92445134	92445134	+	Silent	SNP	C	C	T			TCGA-AG-A020-01	TCGA-AG-A020-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr1:92445134C>T	ENST00000362005.3	+	9	1525	c.1107C>T	c.(1105-1107)ttC>ttT	p.F369F	BRDT_ENST00000399546.2_Silent_p.F369F|BRDT_ENST00000394530.3_Silent_p.F323F|BRDT_ENST00000370389.2_Silent_p.F296F|BRDT_ENST00000402388.1_Silent_p.F369F|BRDT_ENST00000484781.1_3'UTR	NM_001242805.1	NP_001229734	Q58F21	BRDT_HUMAN	bromodomain, testis-specific	369					cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|histone displacement (GO:0001207)|male meiosis (GO:0007140)|male meiosis I (GO:0007141)|mRNA processing (GO:0006397)|positive regulation of transcription during meiosis (GO:0051039)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|transcription coactivator activity (GO:0003713)	p.F369F(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(24)|ovary(1)|prostate(4)|skin(2)|stomach(2)|urinary_tract(2)	56		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		AGGATGTTTTCGAAACGCATT	0.323																																					p.F369F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1107T	1						.						72.0	73.0	73.0					1																	92445134		2203	4300	6503	92217722	SO:0001819	synonymous_variant	676	exon8			AF019085	CCDS735.1, CCDS55615.1, CCDS55616.1, CCDS72820.1	1p22.1	2010-12-23			ENSG00000137948	ENSG00000137948			1105	protein-coding gene	gene with protein product	"""cancer/testis antigen 9"""	602144				9367677	Standard	NM_001726		Approved	BRD6, CT9	uc010osz.2	Q58F21	OTTHUMG00000010113	ENST00000362005.3:c.1107C>T	1.37:g.92445134C>T		Somatic		Unspecified	Illumina	Phase_I	92217722	NM_207189	A6NF68|B7Z811|B7Z890|B7ZAX7|D3DT32|O14789|Q05DQ4|Q6P5T1|Q7Z4A6|Q8IWI6	Silent	SNP	ENST00000362005.3	37	CCDS735.1																																																																																				BRDT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027980.2	NM_207189	
OR2L8	391190	broad.mit.edu	37	1	248112888	248112888	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A020-01	TCGA-AG-A020-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr1:248112888C>A	ENST00000357191.3	+	1	729	c.729C>A	c.(727-729)caC>caA	p.H243Q	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	243						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H243Q(1)		endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			GCAGCACCCACCTCACTGTAG	0.458																																					p.H243Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C729A	1						.						165.0	118.0	134.0					1																	248112888		2203	4300	6503	246179511	SO:0001583	missense	391190	exon1			BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.729C>A	1.37:g.248112888C>A	ENSP00000349719:p.His243Gln	Somatic		Unspecified	Illumina	Phase_I	246179511	NM_001001963	Q6IF03	Missense_Mutation	SNP	ENST00000357191.3	37	CCDS31101.1	.	.	.	.	.	.	.	.	.	.	.	9.892	1.204532	0.22205	.	.	ENSG00000196936	ENST00000357191	T	0.00307	8.17	1.8	0.829	0.18847	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33040	U	0.005352	T	0.00784	0.0026	H	0.96048	3.76	0.27477	N	0.952695	D	0.89917	1.0	D	0.83275	0.996	T	0.31530	-0.9940	10	0.87932	D	0	.	5.1303	0.14907	0.0:0.6581:0.0:0.3419	.	243	Q8NGY9	OR2L8_HUMAN	Q	243	ENSP00000349719:H243Q	ENSP00000349719:H243Q	H	+	3	2	OR2L8	246179511	0.000000	0.05858	0.996000	0.52242	0.287000	0.27160	-1.351000	0.02622	1.010000	0.39314	0.485000	0.47835	CAC		OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096853.2		
OR10W1	81341	broad.mit.edu	37	11	58034657	58034657	+	Missense_Mutation	SNP	C	C	T	rs200070425		TCGA-AG-A020-01	TCGA-AG-A020-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr11:58034657C>T	ENST00000395079.2	-	1	1075	c.674G>A	c.(673-675)cGc>cAc	p.R225H		NM_207374.3	NP_997257.2	Q8NGF6	O10W1_HUMAN	olfactory receptor, family 10, subfamily W, member 1	225						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R225H(1)		kidney(2)|large_intestine(2)|lung(19)|ovary(2)|skin(1)	26		Breast(21;0.0589)				GGCCCGGTGGCGGCCAGCAGC	0.587																																					p.R225H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G674A	11						.						76.0	75.0	75.0					11																	58034657		2201	4295	6496	57791233	SO:0001583	missense	81341	exon1			AB065850	CCDS7968.1	11q12.1	2012-08-09	2004-03-04	2004-03-05		ENSG00000172772		"""GPCR / Class A : Olfactory receptors"""	15139	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily W, member 1 pseudogene"""	OR10W1P			Standard	NM_207374		Approved		uc001nmq.1	Q8NGF6		ENST00000395079.2:c.674G>A	11.37:g.58034657C>T	ENSP00000378516:p.Arg225His	Somatic		Unspecified	Illumina	Phase_I	57791233	NM_207374	A2RUD2|A8MTE1|Q6UXQ2	Missense_Mutation	SNP	ENST00000395079.2	37	CCDS7968.1	.	.	.	.	.	.	.	.	.	.	C	14.70	2.614247	0.46631	.	.	ENSG00000172772	ENST00000395079	T	0.00333	8.07	6.01	5.1	0.69264	GPCR, rhodopsin-like superfamily (1);	0.128295	0.36167	N	0.002749	T	0.00468	0.0015	M	0.90019	3.08	0.09310	N	1	P	0.42337	0.776	B	0.36186	0.219	T	0.35025	-0.9805	10	0.87932	D	0	.	15.2235	0.73333	0.0:0.9318:0.0:0.0682	.	225	Q8NGF6	O10W1_HUMAN	H	225	ENSP00000378516:R225H	ENSP00000378516:R225H	R	-	2	0	OR10W1	57791233	0.000000	0.05858	0.907000	0.35723	0.837000	0.47467	0.291000	0.18994	1.548000	0.49413	0.655000	0.94253	CGC		OR10W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394704.1	NM_207374	
P2RY2	5029	broad.mit.edu	37	11	72945385	72945385	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A020-01	TCGA-AG-A020-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr11:72945385C>T	ENST00000311131.2	+	3	648	c.181C>T	c.(181-183)Cgc>Tgc	p.R61C	P2RY2_ENST00000393597.2_Missense_Mutation_p.R61C|P2RY2_ENST00000393596.2_Missense_Mutation_p.R61C	NM_002564.2|NM_176072.1	NP_002555|NP_788086	P41231	P2RY2_HUMAN	purinergic receptor P2Y, G-protein coupled, 2	61					cellular ion homeostasis (GO:0006873)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of mucus secretion (GO:0070257)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)	p.R61C(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	25					Suramin(DB04786)	CTTCTTGTGCCGCCTCAAGAC	0.582																																					p.R61C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C181T	11						.						225.0	185.0	199.0					11																	72945385		2200	4293	6493	72623033	SO:0001583	missense	5029	exon3			U07225	CCDS8219.1	11q13.5-q14.1	2012-08-08				ENSG00000175591		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8541	protein-coding gene	gene with protein product		600041				8159738, 9286708	Standard	NM_002564		Approved	P2U	uc001otj.4	P41231		ENST00000311131.2:c.181C>T	11.37:g.72945385C>T	ENSP00000310305:p.Arg61Cys	Somatic		Unspecified	Illumina	Phase_I	72623033	NM_176072	B2R9W3|Q96EM8	Missense_Mutation	SNP	ENST00000311131.2	37	CCDS8219.1	.	.	.	.	.	.	.	.	.	.	C	18.03	3.532794	0.64972	.	.	ENSG00000175591	ENST00000393597;ENST00000311131;ENST00000393596	T;T;T	0.72615	-0.67;-0.67;-0.67	5.28	4.37	0.52481	GPCR, rhodopsin-like superfamily (1);	0.056303	0.64402	N	0.000001	D	0.82416	0.5032	M	0.79805	2.47	0.58432	D	0.999992	D	0.89917	1.0	D	0.87578	0.998	T	0.83306	-0.0025	10	0.72032	D	0.01	.	8.9489	0.35776	0.1558:0.7643:0.0:0.0799	.	61	P41231	P2RY2_HUMAN	C	61	ENSP00000377222:R61C;ENSP00000310305:R61C;ENSP00000377221:R61C	ENSP00000310305:R61C	R	+	1	0	P2RY2	72623033	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.076000	0.50081	1.241000	0.43820	-0.194000	0.12790	CGC		P2RY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397336.1	NM_176072	
PAAF1	80227	broad.mit.edu	37	11	73610216	73610218	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-AG-A020-01	TCGA-AG-A020-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr11:73610216_73610218delGAG	ENST00000310571.3	+	5	361_363	c.308_310delGAG	c.(307-312)agagga>aga	p.G105del	PAAF1_ENST00000544909.1_In_Frame_Del_p.G106del|PAAF1_ENST00000536003.1_In_Frame_Del_p.G88del|PAAF1_ENST00000535604.1_5'UTR|PAAF1_ENST00000543079.1_3'UTR|PAAF1_ENST00000541951.1_5'UTR|PAAF1_ENST00000544552.1_In_Frame_Del_p.G88del|PAAF1_ENST00000376384.5_In_Frame_Del_p.G88del	NM_025155.2	NP_079431.1	Q9BRP4	PAAF1_HUMAN	proteasomal ATPase-associated factor 1	105					viral process (GO:0016032)	proteasome complex (GO:0000502)		p.G105delG(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(11;7.42e-05)					ATTTCCAGCAGAGGAGGTCTTGG	0.384																																					p.103_104del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.308_310del	11						.																																			73287866	SO:0001651	inframe_deletion	80227	exon5			BC006142	CCDS8226.1, CCDS58157.1, CCDS58158.1	11q13.4	2013-05-21	2007-08-16	2007-08-16	ENSG00000175575	ENSG00000175575		"""WD repeat domain containing"""	25687	protein-coding gene	gene with protein product			"""WD repeat domain 71"""	WDR71		15831487, 17317272, 17289585	Standard	NM_001267803		Approved	FLJ11848, Rpn14	uc001ouk.2	Q9BRP4	OTTHUMG00000168062	ENST00000310571.3:c.308_310delGAG	11.37:g.73610219_73610221delGAG	ENSP00000311665:p.Gly105del	Somatic		Unspecified	Illumina	Phase_I	73287864	NM_025155	A6NDR5|B4DPB0|B7ZAS9|Q4G165|Q53HS9|Q7Z500|Q8TBU6|Q9HAB6	In_Frame_Del	DEL	ENST00000310571.3	37	CCDS8226.1																																																																																				PAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397885.1	NM_025155	
MICAL1	64780	broad.mit.edu	37	6	109767362	109767362	+	Missense_Mutation	SNP	C	C	G	rs201726028		TCGA-AG-A020-01	TCGA-AG-A020-01	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr6:109767362C>G	ENST00000358807.3	-	19	2869	c.2558G>C	c.(2557-2559)gGc>gCc	p.G853A	MICAL1_ENST00000368952.4_Missense_Mutation_p.G872A|MICAL1_ENST00000358577.3_Missense_Mutation_p.G767A	NM_022765.3	NP_073602.3	Q8TDZ2	MICA1_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 1	853					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of protein phosphorylation (GO:0001933)|oxidation-reduction process (GO:0055114)|signal transduction (GO:0007165)|sulfur oxidation (GO:0019417)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		GACTGGCAGGCCCCAGCCCAC	0.647																																					p.G767A												.	.	0			c.G2300C	6						.																																			109874055	SO:0001583	missense	64780	exon18			AB048948	CCDS5076.1, CCDS55047.1	6q21	2013-03-26	2013-03-26	2005-02-16	ENSG00000135596	ENSG00000135596			20619	protein-coding gene	gene with protein product		607129	"""NEDD9 interacting protein with calponin homology and LIM domains"""	NICAL		11827972	Standard	NM_022765		Approved	MICAL, FLJ11937, DKFZp434B1517, FLJ21739	uc003ptk.3	Q8TDZ2	OTTHUMG00000015350	ENST00000358807.3:c.2558G>C	6.37:g.109767362C>G	ENSP00000351664:p.Gly853Ala	None		Unspecified	Illumina	Phase_I	109874055	NM_001159291	B7Z3R5|E1P5F0|Q7Z633|Q8IVS9|Q96G47|Q9H6X6|Q9H7I0|Q9HAA1|Q9UFF7	Missense_Mutation	SNP	ENST00000358807.3	37	CCDS5076.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.377862	0.82682	.	.	ENSG00000135596	ENST00000358807;ENST00000368952;ENST00000358577;ENST00000368957;ENST00000335266	T;T;T	0.50813	0.74;0.73;0.73	5.82	5.82	0.92795	.	0.248224	0.37304	N	0.002157	T	0.58552	0.2130	M	0.61703	1.905	0.45390	D	0.99837	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.87578	0.997;0.998;0.997	T	0.54309	-0.8313	10	0.38643	T	0.18	.	15.6055	0.76668	0.0:1.0:0.0:0.0	.	872;767;853	B7Z3R5;Q8TDZ2-2;Q8TDZ2	.;.;MICA1_HUMAN	A	853;872;767;377;109	ENSP00000351664:G853A;ENSP00000357948:G872A;ENSP00000351385:G767A	ENSP00000335372:G109A	G	-	2	0	MICAL1	109874055	0.922000	0.31269	0.969000	0.41365	0.832000	0.47134	1.682000	0.37628	2.757000	0.94681	0.655000	0.94253	GGC		MICAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041759.2	NM_022765	
ZBTB24	9841	broad.mit.edu	37	6	109796613	109796613	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A020-01	TCGA-AG-A020-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr6:109796613C>T	ENST00000230122.3	-	5	1444	c.1277G>A	c.(1276-1278)cGa>cAa	p.R426Q		NM_001164313.1|NM_014797.2	NP_001157785.1|NP_055612.2	O43167	ZBT24_HUMAN	zinc finger and BTB domain containing 24	426					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R426Q(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	22		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0154)|all cancers(137;0.0216)|OV - Ovarian serous cystadenocarcinoma(136;0.0242)|BRCA - Breast invasive adenocarcinoma(108;0.059)		TGTGTGTGTTCGCAGATGTTT	0.468																																					p.R426Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1277A	6						.						229.0	184.0	199.0					6																	109796613		2203	4300	6503	109903306	SO:0001583	missense	9841	exon5			AB007901	CCDS34509.1	6q21	2014-09-17	2004-04-15	2004-04-16	ENSG00000112365	ENSG00000112365		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	21143	protein-coding gene	gene with protein product	"""POZ (BTB) and AT hook containing zinc finger 2"""	614064	"""zinc finger protein 450"""	ZNF450		9455477	Standard	NM_014797		Approved	KIAA0441, BIF1, PATZ2	uc003ptl.1	O43167	OTTHUMG00000015349	ENST00000230122.3:c.1277G>A	6.37:g.109796613C>T	ENSP00000230122:p.Arg426Gln	Somatic		Unspecified	Illumina	Phase_I	109903306	NM_014797	Q17RC6|Q5TED5|Q8N455	Missense_Mutation	SNP	ENST00000230122.3	37	CCDS34509.1	.	.	.	.	.	.	.	.	.	.	C	33	5.285572	0.95517	.	.	ENSG00000112365	ENST00000230122	T	0.02369	4.32	6.17	5.3	0.74995	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.050655	0.64402	D	0.000001	T	0.08313	0.0207	M	0.71581	2.175	0.42617	D	0.993337	D	0.89917	1.0	D	0.65140	0.932	T	0.02683	-1.1124	10	0.72032	D	0.01	-16.4091	16.944	0.86226	0.129:0.871:0.0:0.0	.	426	O43167	ZBT24_HUMAN	Q	426	ENSP00000230122:R426Q	ENSP00000230122:R426Q	R	-	2	0	ZBTB24	109903306	1.000000	0.71417	0.600000	0.28864	0.992000	0.81027	7.336000	0.79245	1.601000	0.50113	0.655000	0.94253	CGA		ZBTB24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041758.1	NM_014797	
TRAF3IP2	10758	broad.mit.edu	37	6	111880737	111880737	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A020-01	TCGA-AG-A020-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr6:111880737C>A	ENST00000340026.6	-	10	2190	c.1596G>T	c.(1594-1596)tgG>tgT	p.W532C	TRAF3IP2-AS1_ENST00000440395.1_RNA|TRAF3IP2_ENST00000359831.4_Missense_Mutation_p.W522C|TRAF3IP2_ENST00000392556.4_Missense_Mutation_p.W111C|TRAF3IP2-AS1_ENST00000532353.1_RNA|TRAF3IP2_ENST00000368735.1_Missense_Mutation_p.W67C|TRAF3IP2-AS1_ENST00000438298.2_RNA|TRAF3IP2-AS1_ENST00000456352.2_RNA|TRAF3IP2-AS1_ENST00000442928.2_RNA|TRAF3IP2-AS1_ENST00000449449.2_RNA|TRAF3IP2_ENST00000368761.5_Missense_Mutation_p.W523C|TRAF3IP2_ENST00000368731.2_5'UTR			O43734	CIKS_HUMAN	TRAF3 interacting protein 2	532	SEFIR. {ECO:0000255|PROSITE- ProRule:PRU00867}.				B cell apoptotic process (GO:0001783)|humoral immune response (GO:0006959)|immunoglobulin secretion (GO:0048305)|intracellular signal transduction (GO:0035556)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)			p.W532C(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	18		all_cancers(87;7.87e-06)|Acute lymphoblastic leukemia(125;3.61e-09)|all_hematologic(75;2.63e-07)|all_epithelial(87;0.0024)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.033)|all cancers(137;0.0412)|Epithelial(106;0.0732)		TGTTCTGAAGCCAGGTGGGCA	0.522																																					p.W115C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G345T	6						.						110.0	109.0	109.0					6																	111880737		2203	4300	6503	111987430	SO:0001583	missense	10758	exon6			AF136405	CCDS5093.1, CCDS55049.1, CCDS55050.1	6q21	2008-09-05	2002-06-20	2005-04-13	ENSG00000056972	ENSG00000056972			1343	protein-coding gene	gene with protein product		607043	"""chromosome 6 open reading frame 5"", ""chromosome 6 open reading frame 2"""	C6orf4, C6orf5, C6orf6, C6orf2		10962033, 10962024	Standard	NR_028338		Approved	DKFZP586G0522, ACT1, CIKS	uc003pvf.4	O43734	OTTHUMG00000015379	ENST00000340026.6:c.1596G>T	6.37:g.111880737C>A	ENSP00000345984:p.Trp532Cys	Somatic		Unspecified	Illumina	Phase_I	111987430	NM_001164282	B2RAY9|E1P555|Q5R3A3|Q7Z6Q1|Q7Z6Q2|Q7Z6Q3|Q9H5W2|Q9H6Y3|Q9NS14|Q9UG72	Missense_Mutation	SNP	ENST00000340026.6	37		.	.	.	.	.	.	.	.	.	.	C	22.5	4.300108	0.81136	.	.	ENSG00000056972	ENST00000392555;ENST00000368761;ENST00000392556;ENST00000340026;ENST00000359831;ENST00000368735	T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55	6.17	6.17	0.99709	.	0.114870	0.64402	D	0.000005	T	0.52500	0.1738	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.46456	-0.9190	10	0.56958	D	0.05	-22.3458	20.8794	0.99867	0.0:1.0:0.0:0.0	.	522	Q7Z6Q1	.	C	532;523;111;532;522;67	ENSP00000357750:W523C;ENSP00000376339:W111C;ENSP00000345984:W532C;ENSP00000352889:W522C;ENSP00000357724:W67C	ENSP00000345984:W532C	W	-	3	0	TRAF3IP2	111987430	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.676000	0.74498	2.941000	0.99782	0.655000	0.94253	TGG		TRAF3IP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000041841.2		
LPA	4018	broad.mit.edu	37	6	161027610	161027610	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A020-01	TCGA-AG-A020-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr6:161027610C>A	ENST00000316300.5	-	17	2728	c.2684G>T	c.(2683-2685)tGg>tTg	p.W895L	LPA_ENST00000447678.1_Missense_Mutation_p.W895L			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3403	Kringle 8. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)	p.W895L(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	GCAGTACTCCCACCTGACACT	0.512																																					p.W895L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2684T	6						.						120.0	126.0	124.0					6																	161027610		2126	4280	6406	160947600	SO:0001583	missense	4018	exon18			X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.2684G>T	6.37:g.161027610C>A	ENSP00000321334:p.Trp895Leu	Somatic		Unspecified	Illumina	Phase_I	160947600	NM_005577	Q5VTD7|Q9UD88	Missense_Mutation	SNP	ENST00000316300.5	37	CCDS43523.1	.	.	.	.	.	.	.	.	.	.	c	11.86	1.764728	0.31228	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	T;T	0.63096	-0.02;-0.02	2.18	2.18	0.27775	Kringle (4);Kringle-like fold (1);	.	.	.	.	T	0.71888	0.3393	H	0.95539	3.685	0.23468	N	0.99762	P	0.49307	0.922	D	0.68621	0.959	T	0.64415	-0.6413	9	0.15952	T	0.53	.	7.8483	0.29440	0.0:1.0:0.0:0.0	.	3403	P08519	APOA_HUMAN	L	895	ENSP00000321334:W895L;ENSP00000395608:W895L	ENSP00000321334:W895L	W	-	2	0	LPA	160947600	1.000000	0.71417	0.816000	0.32577	0.236000	0.25371	3.370000	0.52372	1.215000	0.43411	0.184000	0.17185	TGG		LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577	
DNAH8	1769	broad.mit.edu	37	6	38980051	38980051	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-A020-01	TCGA-AG-A020-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr6:38980051G>T	ENST00000359357.3	+	88	13035	c.12781G>T	c.(12781-12783)Gaa>Taa	p.E4261*	DNAH8_ENST00000441566.1_Nonsense_Mutation_p.E4225*			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	4261					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.E4261*(2)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TCTTAGACAAGAAATTGACAG	0.353																																					p.E4261X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.G12781T	6						.						112.0	108.0	109.0					6																	38980051		2203	4300	6503	39088029	SO:0001587	stop_gained	1769	exon88			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.12781G>T	6.37:g.38980051G>T	ENSP00000352312:p.Glu4261*	Somatic		Unspecified	Illumina	Phase_I	39088029	NM_001371	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Nonsense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	G	55	24.411429	0.99960	.	.	ENSG00000124721	ENST00000327475;ENST00000359357;ENST00000441566	.	.	.	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	.	.	.	X	4466;4261;4225	.	ENSP00000333363:E4466X	E	+	1	0	DNAH8	39088029	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.830000	0.99415	2.937000	0.99478	0.650000	0.86243	GAA		DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
SMOC2	64094	broad.mit.edu	37	6	168999590	168999590	+	Missense_Mutation	SNP	G	G	A	rs561879643		TCGA-AG-A020-01	TCGA-AG-A020-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr6:168999590G>A	ENST00000356284.2	+	8	950	c.730G>A	c.(730-732)Ggc>Agc	p.G244S	SMOC2_ENST00000354536.5_Missense_Mutation_p.G255S	NM_001166412.1	NP_001159884.1	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2	244	Thyroglobulin type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00500}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.G255S(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	32		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		TGCGCACGGCGGCCTCTACAA	0.627																																					p.G244S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G730A	6						.						94.0	69.0	77.0					6																	168999590		2203	4299	6502	168741515	SO:0001583	missense	64094	exon8			AB014730	CCDS5307.1, CCDS55076.1	6q27	2013-01-10			ENSG00000112562	ENSG00000112562		"""EF-hand domain containing"""	20323	protein-coding gene	gene with protein product		607223				12031507	Standard	NM_022138		Approved	SMAP2	uc003qwr.2	Q9H3U7	OTTHUMG00000016050	ENST00000356284.2:c.730G>A	6.37:g.168999590G>A	ENSP00000348630:p.Gly244Ser	Somatic		Unspecified	Illumina	Phase_I	168741515	NM_001166412	B3KPS7|Q4G169|Q5TAT7|Q5TAT8|Q86VV9|Q96SF3|Q9H1L3|Q9H1L4|Q9H3U0|Q9H4F7|Q9HCV2	Missense_Mutation	SNP	ENST00000356284.2	37	CCDS55076.1	.	.	.	.	.	.	.	.	.	.	G	34	5.335070	0.95758	.	.	ENSG00000112562	ENST00000356284;ENST00000354536;ENST00000366793	D;D	0.94723	-3.5;-3.5	4.89	4.89	0.63831	Thyroglobulin type-1 (5);EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.98305	0.9438	H	0.97732	4.065	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.99761	1.1021	10	0.72032	D	0.01	-21.8918	17.1175	0.86694	0.0:0.0:1.0:0.0	.	244;255	Q9H3U7;Q9H3U7-2	SMOC2_HUMAN;.	S	244;255;244	ENSP00000348630:G244S;ENSP00000346537:G255S	ENSP00000346537:G255S	G	+	1	0	SMOC2	168741515	1.000000	0.71417	0.862000	0.33874	0.926000	0.56050	8.993000	0.93524	2.268000	0.75426	0.386000	0.25728	GGC		SMOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043201.1		
TP53	7157	broad.mit.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-AG-A020-01	TCGA-AG-A020-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000420246.2_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R175H	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,lung,NS,Substitution - Missense,0	.	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	c.G524A	17	GRCh37	CM062017|CM951224	TP53	M	rs28934578	.						50.0	50.0	50.0					17																	7578406		2203	4300	6503	7519131	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His	Somatic		Unspecified	Illumina	Phase_I	7519131	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TBX21	30009	broad.mit.edu	37	17	45822627	45822627	+	Silent	SNP	C	C	T			TCGA-AG-A020-01	TCGA-AG-A020-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr17:45822627C>T	ENST00000177694.1	+	6	1714	c.1503C>T	c.(1501-1503)cgC>cgT	p.R501R		NM_013351.1	NP_037483.1	Q9UL17	TBX21_HUMAN	T-box 21	501					cellular response to organic substance (GO:0071310)|lymphocyte migration (GO:0072676)|multicellular organismal development (GO:0007275)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	neuronal cell body (GO:0043025)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.R501R(1)		NS(1)|endometrium(1)|large_intestine(3)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	22						AGAGGAGGCGCGTGTCCCCCT	0.567																																					p.R501R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1503T	17						.						45.0	47.0	46.0					17																	45822627		2203	4300	6503	43177626	SO:0001819	synonymous_variant	30009	exon6			AF093098	CCDS11514.1	17q21.2	2008-06-23				ENSG00000073861		"""T-boxes"""	11599	protein-coding gene	gene with protein product		604895					Standard	NM_013351		Approved	TBLYM, T-bet	uc002ilv.1	Q9UL17		ENST00000177694.1:c.1503C>T	17.37:g.45822627C>T		Somatic		Unspecified	Illumina	Phase_I	43177626	NM_013351		Silent	SNP	ENST00000177694.1	37	CCDS11514.1																																																																																				TBX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441365.1	NM_013351	
GTF3C1	2975	broad.mit.edu	37	16	27549526	27549526	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-A020-01	TCGA-AG-A020-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr16:27549526G>A	ENST00000356183.4	-	3	598	c.583C>T	c.(583-585)Cga>Tga	p.R195*	GTF3C1_ENST00000561623.1_Nonsense_Mutation_p.R195*	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	195					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)	p.R195*(1)		breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						TGAAGGTCTCGCTGGAGCTCC	0.557																																					p.R195X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C583T	16						.						78.0	79.0	79.0					16																	27549526		2197	4300	6497	27457027	SO:0001587	stop_gained	2975	exon3			U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.583C>T	16.37:g.27549526G>A	ENSP00000348510:p.Arg195*	Somatic		Unspecified	Illumina	Phase_I	27457027	NM_001520	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Nonsense_Mutation	SNP	ENST00000356183.4	37	CCDS32414.1	.	.	.	.	.	.	.	.	.	.	G	37	6.569659	0.97671	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	.	.	.	5.73	4.67	0.58626	.	0.126553	0.52532	D	0.000061	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.3041	11.5781	0.50875	0.0:0.0:0.6448:0.3552	.	.	.	.	X	195;193	.	ENSP00000348510:R195X	R	-	1	2	GTF3C1	27457027	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.556000	0.53734	2.861000	0.98227	0.655000	0.94253	CGA		GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520	
ITGAX	3687	broad.mit.edu	37	16	31383104	31383104	+	Splice_Site	SNP	C	C	T	rs200637041	byFrequency	TCGA-AG-A020-01	TCGA-AG-A020-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr16:31383104C>T	ENST00000268296.4	+	17	2280	c.2159C>T	c.(2158-2160)cCg>cTg	p.P720L	ITGAX_ENST00000562522.1_Splice_Site_p.P720L	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	720					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)	p.P720L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						CTGCTGCTCCCGGTGCGTCTG	0.642													C|||	2	0.000399361	0.0	0.0014	5008	,	,		16934	0.001		0.0	False		,,,				2504	0.0				p.P720L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2159T	16						.						49.0	43.0	45.0					16																	31383104		2197	4300	6497	31290605	SO:0001630	splice_region_variant	3687	exon17			BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.2160+1C>T	16.37:g.31383104C>T		Somatic		Unspecified	Illumina	Phase_I	31290605	NM_000887	Q8IVA6	Missense_Mutation	SNP	ENST00000268296.4	37	CCDS10711.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	15.03	2.711262	0.48517	.	.	ENSG00000140678	ENST00000268296	T	0.44881	0.91	5.4	-1.14	0.09741	Integrin alpha-2 (1);	.	.	.	.	T	0.21550	0.0519	L	0.39566	1.225	0.44492	D	0.997432	P	0.35174	0.488	B	0.25884	0.064	T	0.11203	-1.0597	9	0.31617	T	0.26	.	0.9333	0.01340	0.154:0.3642:0.1512:0.3306	.	720	P20702	ITAX_HUMAN	L	720	ENSP00000268296:P720L	ENSP00000268296:P720L	P	+	2	0	ITGAX	31290605	0.032000	0.19561	0.412000	0.26496	0.080000	0.17528	-0.167000	0.09940	-0.381000	0.07882	0.655000	0.94253	CCG		ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887	Missense_Mutation
SPN	6693	broad.mit.edu	37	16	29676016	29676016	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AG-A020-01	TCGA-AG-A020-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr16:29676016delG	ENST00000360121.3	+	2	1059	c.967delG	c.(967-969)gggfs	p.G324fs	SPN_ENST00000395389.2_Frame_Shift_Del_p.G324fs	NM_001030288.2|NM_003123.4	NP_001025459.1|NP_003114.1	O75398	DEAF1_HUMAN	sialophorin	0					anatomical structure morphogenesis (GO:0009653)|embryonic skeletal system development (GO:0048706)|germ cell development (GO:0007281)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G324fs*38(1)		central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)|stomach(1)	15						GGGAGGGTCCGGGGGCGACAA	0.697																																					p.G323fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.967delG	16						.						6.0	7.0	7.0					16																	29676016		2125	4210	6335	29583517	SO:0001589	frameshift_variant	6693	exon2			J04536	CCDS10650.1	16p11.2	2008-07-31	2008-07-31		ENSG00000197471	ENSG00000197471		"""CD molecules"""	11249	protein-coding gene	gene with protein product	"""leukosialin"""	182160	"""sialophorin (gpL115, leukosialin, CD43)"""			2784859, 2521952	Standard	NM_001030288		Approved	LSN, CD43, GPL115	uc002dtm.4	P16150	OTTHUMG00000097765	ENST00000360121.3:c.967delG	16.37:g.29676016delG	ENSP00000353238:p.Gly324fs	Somatic		Unspecified	Illumina	Phase_I	29583517	NM_001030288	A8K1F8|A8K5R8|C7T5V5|O15152|O75399|O75510|O75511|O75512|O75513|Q9UET1	Frame_Shift_Del	DEL	ENST00000360121.3	37	CCDS10650.1																																																																																				SPN-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215001.2		
PLCG2	5336	broad.mit.edu	37	16	81927346	81927346	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A020-01	TCGA-AG-A020-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr16:81927346C>T	ENST00000359376.3	+	12	1233	c.1019C>T	c.(1018-1020)tCg>tTg	p.S340L		NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	340	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.S340L(2)		NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						CGGAGCGAGTCGTCCCCAGAA	0.617																																					p.S340L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1019T	16						.						63.0	66.0	65.0					16																	81927346		2171	4287	6458	80484847	SO:0001583	missense	5336	exon12				CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.1019C>T	16.37:g.81927346C>T	ENSP00000352336:p.Ser340Leu	Somatic		Unspecified	Illumina	Phase_I	80484847	NM_002661	D3DUL3|Q3ZTS2|Q59H45|Q969T5	Missense_Mutation	SNP	ENST00000359376.3	37	CCDS42204.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.251486	0.80135	.	.	ENSG00000197943	ENST00000359376	T	0.70045	-0.45	3.71	3.71	0.42584	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.123749	0.56097	D	0.000027	D	0.88676	0.6501	H	0.98295	4.195	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.966	D	0.93600	0.6929	10	0.87932	D	0	.	16.357	0.83239	0.0:1.0:0.0:0.0	.	207;340	B4E3H3;P16885	.;PLCG2_HUMAN	L	340	ENSP00000352336:S340L	ENSP00000352336:S340L	S	+	2	0	PLCG2	80484847	1.000000	0.71417	0.944000	0.38274	0.500000	0.33767	7.625000	0.83145	2.034000	0.60081	0.467000	0.42956	TCG		PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432429.1		
SMAD4	4089	broad.mit.edu	37	18	48604788	48604788	+	Missense_Mutation	SNP	A	A	G	rs377767385		TCGA-AG-A020-01	TCGA-AG-A020-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr18:48604788A>G	ENST00000342988.3	+	12	2148	c.1610A>G	c.(1609-1611)gAc>gGc	p.D537G	SMAD4_ENST00000588745.1_Missense_Mutation_p.D441G|SMAD4_ENST00000586253.1_3'UTR|SMAD4_ENST00000398417.2_Missense_Mutation_p.D537G	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	537	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(2)|p.D537G(1)|p.L536fs*11(1)|p.L536fs*14(1)|p.D537V(1)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		CAGCTCCTAGACGAAGTACTT	0.483																																					p.D537G												SMAD4,large_intestine,NS,Substitution - Missense,+1	.	42	Whole gene deletion(36)|Substitution - Missense(2)|Deletion - Frameshift(2)|Unknown(2)	pancreas(26)|large_intestine(6)|lung(3)|breast(3)|stomach(2)|upper_aerodigestive_tract(1)|oesophagus(1)	c.A1610G	18						.						79.0	81.0	81.0					18																	48604788		2203	4300	6503	46858786	SO:0001583	missense	4089	exon12			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1610A>G	18.37:g.48604788A>G	ENSP00000341551:p.Asp537Gly	Somatic		Unspecified	Illumina	Phase_I	46858786	NM_005359	A8K405	Missense_Mutation	SNP	ENST00000342988.3	37	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	A	19.46	3.831347	0.71258	.	.	ENSG00000141646	ENST00000342988;ENST00000398417	D;D	0.98012	-4.66;-4.66	6.07	6.07	0.98685	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (1);	0.000000	0.85682	D	0.000000	D	0.98912	0.9631	M	0.89904	3.07	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99716	1.1008	10	0.87932	D	0	.	15.6232	0.76824	1.0:0.0:0.0:0.0	.	537	Q13485	SMAD4_HUMAN	G	537	ENSP00000341551:D537G;ENSP00000381452:D537G	ENSP00000341551:D537G	D	+	2	0	SMAD4	46858786	1.000000	0.71417	0.989000	0.46669	0.955000	0.61496	9.118000	0.94355	2.326000	0.78906	0.533000	0.62120	GAC		SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359	
FBLN2	2199	broad.mit.edu	37	3	13678033	13678033	+	Silent	SNP	C	C	T	rs17854691		TCGA-AG-A020-01	TCGA-AG-A020-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr3:13678033C>T	ENST00000295760.7	+	16	3231	c.3162C>T	c.(3160-3162)ttC>ttT	p.F1054F	FBLN2_ENST00000535798.1_Silent_p.F1080F|FBLN2_ENST00000404922.3_Silent_p.F1101F|FBLN2_ENST00000492059.1_Silent_p.F1101F	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	1054	EGF-like 10; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)	p.F520F(1)|p.F1101F(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			GCCTGCGCTTCGAGTGTCCTC	0.592																																					p.R1055X												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C3163T	3						.	C	,,	1,4363		0,1,2181	63.0	72.0	69.0		3303,3303,3162	-3.7	0.6	3	dbSNP_123	69	3,8567		0,3,4282	no	coding-synonymous,coding-synonymous,coding-synonymous	FBLN2	NM_001004019.1,NM_001165035.1,NM_001998.2	,,	0,4,6463	TT,TC,CC		0.035,0.0229,0.0309	,,	1101/1232,1101/1232,1054/1185	13678033	4,12930	2182	4285	6467	13653034	SO:0001819	synonymous_variant	2199	exon16			X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.3162C>T	3.37:g.13678033C>T		Somatic		Unspecified	Illumina	Phase_I	13653034	NM_001998	B7Z9C5|Q8IUI0|Q8IUI1	Silent	SNP	ENST00000295760.7	37	CCDS46762.1	.	.	.	.	.	.	.	.	.	.	C	6.708	0.499313	0.12762	2.29E-4	3.5E-4	ENSG00000163520	ENST00000295761;ENST00000421373	.	.	.	4.91	-3.65	0.04502	.	.	.	.	.	T	0.50871	0.1641	.	.	.	0.51482	D	0.99992	.	.	.	.	.	.	T	0.47182	-0.9137	4	.	.	.	.	7.9235	0.29861	0.0:0.2474:0.1181:0.6345	.	.	.	.	L	73;30	.	.	S	+	2	0	FBLN2	13653034	0.000000	0.05858	0.558000	0.28319	0.621000	0.37620	-1.542000	0.02196	-0.832000	0.04251	-1.080000	0.02220	TCG		FBLN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340083.3	NM_001004019	
CTNNB1	1499	broad.mit.edu	37	3	41274897	41274897	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A020-01	TCGA-AG-A020-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr3:41274897T>G	ENST00000349496.5	+	8	1427	c.1147T>G	c.(1147-1149)Tgg>Ggg	p.W383G	CTNNB1_ENST00000396185.3_Missense_Mutation_p.W383G|CTNNB1_ENST00000405570.1_Missense_Mutation_p.W383G|CTNNB1_ENST00000453024.1_Missense_Mutation_p.W376G|CTNNB1_ENST00000396183.3_Missense_Mutation_p.W383G	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	383					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.W383G(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		GAACTGTCTTTGGACTCTCAG	0.408		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.W383G	Colon(6;3 56 14213 18255)		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1147G	3						.						105.0	96.0	99.0					3																	41274897		2203	4300	6503	41249901	SO:0001583	missense	1499	exon8	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.1147T>G	3.37:g.41274897T>G	ENSP00000344456:p.Trp383Gly	Somatic		Unspecified	Illumina	Phase_I	41249901	NM_001098210	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.405136	0.83230	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	T;T;T;T;T	0.73047	-0.71;-0.71;-0.71;-0.71;-0.71	5.72	5.72	0.89469	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85509	0.5713	M	0.87269	2.87	0.80722	D	1	P;D	0.89917	0.858;1.0	B;D	0.79784	0.386;0.993	D	0.85685	0.1303	10	0.34782	T	0.22	-7.7281	15.9983	0.80268	0.0:0.0:0.0:1.0	.	311;383	B4DSW9;P35222	.;CTNB1_HUMAN	G	383;383;383;376;383	ENSP00000385604:W383G;ENSP00000379486:W383G;ENSP00000344456:W383G;ENSP00000411226:W376G;ENSP00000379488:W383G	ENSP00000344456:W383G	W	+	1	0	CTNNB1	41249901	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.171000	0.68590	0.533000	0.62120	TGG		CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CACNA2D3	55799	broad.mit.edu	37	3	54603874	54603874	+	Silent	SNP	C	C	T			TCGA-AG-A020-01	TCGA-AG-A020-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr3:54603874C>T	ENST00000474759.1	+	7	777	c.729C>T	c.(727-729)aaC>aaT	p.N243N	CACNA2D3_ENST00000490478.1_Silent_p.N149N|CACNA2D3_ENST00000415676.2_Silent_p.N243N|CACNA2D3_ENST00000288197.5_Silent_p.N243N	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	243						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.N243N(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	ACTGCAGGAACCGAAAATGGT	0.378																																					p.N243N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C729T	3						.						71.0	68.0	69.0					3																	54603874		1860	4106	5966	54578914	SO:0001819	synonymous_variant	55799	exon7			AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.729C>T	3.37:g.54603874C>T		Somatic		Unspecified	Illumina	Phase_I	54578914	NM_018398	B2RPL6|Q9NY16|Q9NY18	Silent	SNP	ENST00000474759.1	37	CCDS54598.1																																																																																				CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351402.1		
CACNA2D3	55799	broad.mit.edu	37	3	55038848	55038848	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A020-01	TCGA-AG-A020-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr3:55038848G>A	ENST00000474759.1	+	32	2797	c.2749G>A	c.(2749-2751)Gcc>Acc	p.A917T	CACNA2D3_ENST00000490478.1_Missense_Mutation_p.A823T|CACNA2D3_ENST00000478261.1_3'UTR|CACNA2D3_ENST00000415676.2_Missense_Mutation_p.A917T|CACNA2D3_ENST00000288197.5_Missense_Mutation_p.A917T	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	917						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.A917T(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	CAGCGATGGCGCCCATGGCCT	0.448																																					p.A917T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2749A	3						.						113.0	109.0	110.0					3																	55038848		1956	4148	6104	55013888	SO:0001583	missense	55799	exon32			AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.2749G>A	3.37:g.55038848G>A	ENSP00000419101:p.Ala917Thr	Somatic		Unspecified	Illumina	Phase_I	55013888	NM_018398	B2RPL6|Q9NY16|Q9NY18	Missense_Mutation	SNP	ENST00000474759.1	37	CCDS54598.1	.	.	.	.	.	.	.	.	.	.	G	32	5.109610	0.94292	.	.	ENSG00000157445	ENST00000415676;ENST00000474759;ENST00000288197;ENST00000490478;ENST00000398624	T;T;T;T	0.73363	-0.74;-0.74;-0.74;-0.74	6.17	6.17	0.99709	.	0.244180	0.41938	D	0.000793	T	0.72526	0.3471	M	0.68952	2.095	0.48762	D	0.999701	P	0.35908	0.527	B	0.26770	0.073	T	0.74861	-0.3520	10	0.72032	D	0.01	.	19.0599	0.93085	0.0:0.0:1.0:0.0	.	917	Q8IZS8	CA2D3_HUMAN	T	917;917;917;823;823	ENSP00000389506:A917T;ENSP00000419101:A917T;ENSP00000288197:A917T;ENSP00000417279:A823T	ENSP00000288197:A917T	A	+	1	0	CACNA2D3	55013888	1.000000	0.71417	0.916000	0.36221	0.991000	0.79684	5.543000	0.67225	2.941000	0.99782	0.655000	0.94253	GCC		CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351402.1		
PIK3CA	5290	broad.mit.edu	37	3	178919287	178919287	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A020-01	TCGA-AG-A020-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr3:178919287G>A	ENST00000263967.3	+	4	929	c.772G>A	c.(772-774)Gat>Aat	p.D258N		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	258	PI3K-RBD. {ECO:0000255|PROSITE- ProRule:PRU00879}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.D258N(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	GTGTGGATGTGATGAATACTT	0.299		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.D258N	Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G772A	3						.						50.0	49.0	49.0					3																	178919287		1807	4077	5884	180401981	SO:0001583	missense	5290	exon4				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.772G>A	3.37:g.178919287G>A	ENSP00000263967:p.Asp258Asn	Somatic		Unspecified	Illumina	Phase_I	180401981	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	17.17	3.320599	0.60634	.	.	ENSG00000121879	ENST00000263967	T	0.46451	0.87	5.56	5.56	0.83823	Phosphoinositide 3-kinase, ras-binding (2);	0.000000	0.85682	D	0.000000	T	0.38665	0.1049	L	0.37630	1.12	0.80722	D	1	B	0.22851	0.076	B	0.27170	0.077	T	0.10337	-1.0634	10	0.23302	T	0.38	-10.7335	19.9052	0.97004	0.0:0.0:1.0:0.0	.	258	P42336	PK3CA_HUMAN	N	258	ENSP00000263967:D258N	ENSP00000263967:D258N	D	+	1	0	PIK3CA	180401981	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.358000	0.97109	2.776000	0.95493	0.655000	0.94253	GAT		PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-AG-A020-01	TCGA-AG-A020-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12V	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35T	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val	Somatic		Unspecified	Illumina	Phase_I	25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
KCNC2	3747	broad.mit.edu	37	12	75444461	75444461	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A020-01	TCGA-AG-A020-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr12:75444461C>A	ENST00000549446.1	-	3	2004	c.1324G>T	c.(1324-1326)Gat>Tat	p.D442Y	KCNC2_ENST00000393288.2_Missense_Mutation_p.D442Y|KCNC2_ENST00000540018.1_Missense_Mutation_p.D442Y|KCNC2_ENST00000341669.3_Missense_Mutation_p.D442Y|KCNC2_ENST00000548513.1_Missense_Mutation_p.D442Y|KCNC2_ENST00000298972.1_Missense_Mutation_p.D442Y|KCNC2_ENST00000548243.1_5'UTR|KCNC2_ENST00000350228.2_Missense_Mutation_p.D442Y|KCNC2_ENST00000550433.1_Missense_Mutation_p.D442Y	NM_001260497.1|NM_139137.3	NP_001247426.1|NP_631875.1	Q96PR1	KCNC2_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 2	442	Selectivity filter. {ECO:0000250}.				action potential (GO:0001508)|energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.D442Y(2)		breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(28)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	54					Dalfampridine(DB06637)	GGGTACATATCCCCATAACCC	0.517																																					p.D442Y												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1324T	12						.						71.0	61.0	64.0					12																	75444461		2203	4300	6503	73730728	SO:0001583	missense	3747	exon3			AF268896	CCDS9005.1, CCDS9006.1, CCDS9007.1, CCDS58255.1, CCDS58256.1, CCDS58257.1	12q14.1	2012-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6234	protein-coding gene	gene with protein product		176256				8111118, 16382104	Standard	NM_139136		Approved	Kv3.2	uc001sxg.2	Q96PR1	OTTHUMG00000169717	ENST00000549446.1:c.1324G>T	12.37:g.75444461C>A	ENSP00000449253:p.Asp442Tyr	Somatic		Unspecified	Illumina	Phase_I	73730728	NM_139137	B7Z231|F5H030|J3KPP5|Q4LE77|Q86W09|Q8N1V9|Q96PR0	Missense_Mutation	SNP	ENST00000549446.1	37	CCDS9007.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.020774	0.75275	.	.	ENSG00000166006	ENST00000550433;ENST00000548513;ENST00000549446;ENST00000341669;ENST00000298972;ENST00000350228;ENST00000540018;ENST00000393288	D;D;D;D;D;D;D;D	0.99023	-5.34;-5.34;-5.34;-5.34;-5.34;-5.34;-5.34;-5.34	6.06	6.06	0.98353	Ion transport (1);	0.000000	0.64402	D	0.000001	D	0.99715	0.9890	H	0.99425	4.56	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.97208	0.9869	10	0.87932	D	0	.	20.6397	0.99537	0.0:1.0:0.0:0.0	.	442;442;442;442;442	F5H030;Q96PR1-2;Q96PR1;Q96PR1-4;Q96PR1-3	.;.;KCNC2_HUMAN;.;.	Y	442	ENSP00000448301:D442Y;ENSP00000449941:D442Y;ENSP00000449253:D442Y;ENSP00000340121:D442Y;ENSP00000298972:D442Y;ENSP00000319877:D442Y;ENSP00000438423:D442Y;ENSP00000376966:D442Y	ENSP00000298972:D442Y	D	-	1	0	KCNC2	73730728	1.000000	0.71417	0.998000	0.56505	0.852000	0.48524	7.792000	0.85828	2.880000	0.98712	0.650000	0.86243	GAT		KCNC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405581.2	NM_153748	
ULK1	8408	broad.mit.edu	37	12	132405904	132405904	+	Nonstop_Mutation	SNP	T	T	G			TCGA-AG-A020-01	TCGA-AG-A020-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr12:132405904T>G	ENST00000321867.4	+	28	3502	c.3151T>G	c.(3151-3153)Tga>Gga	p.*1051G	ULK1_ENST00000540647.1_Nonstop_Mutation_p.*296G	NM_003565.2	NP_003556	O75385	ULK1_HUMAN	unc-51 like autophagy activating kinase 1	0					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|cellular response to nutrient levels (GO:0031669)|cerebellar granule cell differentiation (GO:0021707)|negative regulation of collateral sprouting (GO:0048671)|neuron projection development (GO:0031175)|neuron projection regeneration (GO:0031102)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|protein autophosphorylation (GO:0046777)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|radial glia guided migration of cerebellar granule cell (GO:0021933)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of autophagy (GO:0010506)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|response to starvation (GO:0042594)	ATG1/UKL1 signaling complex (GO:0034273)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extrinsic component of autophagic vacuole membrane (GO:0097635)|extrinsic component of omegasome membrane (GO:0097629)|extrinsic component of pre-autophagosomal structure membrane (GO:0097632)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)	ATP binding (GO:0005524)|protein complex binding (GO:0032403)|protein serine/threonine kinase activity (GO:0004674)|Rab GTPase binding (GO:0017137)	p.*1051G(1)		breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	29	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		CATCTGTGCCTGACCTTTCTG	0.667																																					p.X1051G												.	.	1	Nonstop extension(1)	large_intestine(1)	c.T3151G	12						.						113.0	111.0	112.0					12																	132405904		2203	4300	6503	130971857	SO:0001578	stop_lost	8408	exon28			AF045458	CCDS9274.1	12q24.3	2014-02-12	2013-07-02		ENSG00000177169	ENSG00000177169			12558	protein-coding gene	gene with protein product	"""ATG1 autophagy related 1 homolog (S. cerevisiae)"""	603168	"""unc-51 (C. elegans)-like kinase 1"", ""unc-51-like kinase 1 (C. elegans)"""			9693035	Standard	NM_003565		Approved	ATG1, ATG1A	uc001uje.3	O75385	OTTHUMG00000168052	ENST00000321867.4:c.3151T>G	12.37:g.132405904T>G	ENSP00000324560:p.*1051Glyext*36	Somatic		Unspecified	Illumina	Phase_I	130971857	NM_003565	Q9UQ28	Read-through	SNP	ENST00000321867.4	37	CCDS9274.1	.	.	.	.	.	.	.	.	.	.	T	15.79	2.937694	0.52972	.	.	ENSG00000177169	ENST00000321867;ENST00000540647	.	.	.	4.56	4.56	0.56223	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.205	0.65728	0.0:0.0:0.0:1.0	.	.	.	.	G	1051;296	.	.	X	+	1	0	ULK1	130971857	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	2.586000	0.46119	1.822000	0.53115	0.459000	0.35465	TGA		ULK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397769.3		
GRXCR1	389207	broad.mit.edu	37	4	43032468	43032468	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-A020-01	TCGA-AG-A020-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr4:43032468C>T	ENST00000399770.2	+	4	784	c.784C>T	c.(784-786)Cga>Tga	p.R262*		NM_001080476.2	NP_001073945.1	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	262					auditory receptor cell differentiation (GO:0042491)|cell redox homeostasis (GO:0045454)|inner ear receptor cell development (GO:0060119)|inner ear receptor stereocilium organization (GO:0060122)|negative regulation of phosphatase activity (GO:0010923)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of sound (GO:0007605)|vestibular receptor cell development (GO:0060118)	kinocilium (GO:0060091)|stereocilium (GO:0032420)	electron carrier activity (GO:0009055)|protein disulfide oxidoreductase activity (GO:0015035)	p.R262*(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(22)|ovary(1)|prostate(2)|skin(1)	32						GTCCATGTTTCGAAACTGCTT	0.473																																					p.R262X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C784T	4						.						174.0	164.0	167.0					4																	43032468		1945	4152	6097	42727225	SO:0001587	stop_gained	389207	exon4				CCDS43225.1	4p14	2014-06-12			ENSG00000215203	ENSG00000215203			31673	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 88"""	613283	"""deafness, autosomal recessive 25"""	DFNB25		20137778	Standard	NM_001080476		Approved	PPP1R88	uc003gwt.3	A8MXD5	OTTHUMG00000160434	ENST00000399770.2:c.784C>T	4.37:g.43032468C>T	ENSP00000382670:p.Arg262*	Somatic		Unspecified	Illumina	Phase_I	42727225	NM_001080476		Nonsense_Mutation	SNP	ENST00000399770.2	37	CCDS43225.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.728299	0.89390	.	.	ENSG00000215203	ENST00000399770	.	.	.	5.64	5.64	0.86602	.	0.282108	0.28983	U	0.013518	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.3762	18.6692	0.91504	0.0:1.0:0.0:0.0	.	.	.	.	X	262	.	ENSP00000382670:R262X	R	+	1	2	GRXCR1	42727225	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	5.588000	0.67517	2.649000	0.89929	0.579000	0.79373	CGA		GRXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360576.1	NM_001080476	
FRYL	285527	broad.mit.edu	37	4	48569287	48569287	+	Silent	SNP	C	C	T			TCGA-AG-A020-01	TCGA-AG-A020-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr4:48569287C>T	ENST00000503238.1	-	25	3146	c.3147G>A	c.(3145-3147)gcG>gcA	p.A1049A	FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000537810.1_Silent_p.A1049A|FRYL_ENST00000507711.1_Silent_p.A1049A|FRYL_ENST00000358350.4_Silent_p.A1049A			O94915	FRYL_HUMAN	FRY-like	1049					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)			p.A1049A(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						GAATAATATTCGCCACTAAGG	0.328																																					p.A1049A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3147A	4						.						108.0	97.0	100.0					4																	48569287		1847	4109	5956	48264044	SO:0001819	synonymous_variant	285527	exon28			AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.3147G>A	4.37:g.48569287C>T		Somatic		Unspecified	Illumina	Phase_I	48264044	NM_015030	O95640|Q8WTZ5|Q9NT40	Silent	SNP	ENST00000503238.1	37	CCDS43227.1																																																																																				FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		
MUM1L1	139221	broad.mit.edu	37	X	105451154	105451154	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-A020-01	TCGA-AG-A020-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chrX:105451154A>C	ENST00000357175.2	+	4	2378	c.1729A>C	c.(1729-1731)Aca>Cca	p.T577P	MUM1L1_ENST00000337685.2_Missense_Mutation_p.T577P|MUM1L1_ENST00000372552.1_Missense_Mutation_p.T577P	NM_001171020.1	NP_001164491.1	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	577						extracellular vesicular exosome (GO:0070062)		p.T577P(2)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						TGTAAATGGCACAAAAGGATC	0.448																																					p.T577P												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1729C	X						.						46.0	41.0	42.0					X																	105451154		1871	4090	5961	105337810	SO:0001583	missense	139221	exon5			AK090835	CCDS55469.1	Xq22.3	2008-02-05			ENSG00000157502	ENSG00000157502			26583	protein-coding gene	gene with protein product							Standard	NM_152423		Approved	FLJ33516	uc004emf.2	Q5H9M0	OTTHUMG00000022146	ENST00000357175.2:c.1729A>C	X.37:g.105451154A>C	ENSP00000349699:p.Thr577Pro	Somatic		Unspecified	Illumina	Phase_I	105337810	NM_152423	D3DUX2|Q49AS5|Q8N2C0|Q96MT6	Missense_Mutation	SNP	ENST00000357175.2	37	CCDS55469.1	.	.	.	.	.	.	.	.	.	.	A	13.53	2.265524	0.40095	.	.	ENSG00000157502	ENST00000357175;ENST00000337685;ENST00000372552	T;T;T	0.44482	0.92;0.92;0.92	5.08	5.08	0.68730	.	0.367796	0.23243	N	0.050337	T	0.44222	0.1283	L	0.44542	1.39	0.27597	N	0.94909	P	0.52061	0.95	P	0.50708	0.648	T	0.42413	-0.9453	10	0.66056	D	0.02	-27.3014	10.1122	0.42570	1.0:0.0:0.0:0.0	.	577	Q5H9M0	MUML1_HUMAN	P	577	ENSP00000349699:T577P;ENSP00000338641:T577P;ENSP00000361632:T577P	ENSP00000338641:T577P	T	+	1	0	MUM1L1	105337810	0.918000	0.31147	0.625000	0.29200	0.471000	0.32888	2.214000	0.42853	1.992000	0.58205	0.486000	0.48141	ACA		MUM1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057795.1	NM_152423	
GUCY2F	2986	broad.mit.edu	37	X	108619326	108619326	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A020-01	TCGA-AG-A020-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chrX:108619326G>T	ENST00000218006.2	-	18	3512	c.3221C>A	c.(3220-3222)cCa>cAa	p.P1074Q		NM_001522.2	NP_001513.2	P51841	GUC2F_HUMAN	guanylate cyclase 2F, retinal	1074					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)	p.P1074Q(1)		breast(3)|central_nervous_system(2)|endometrium(5)|kidney(6)|large_intestine(14)|lung(33)|prostate(3)|skin(1)	67						GTCCACTGGTGGGGGCACAGG	0.438																																					p.P1074Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3221A	X						.						183.0	172.0	176.0					X																	108619326		2203	4300	6503	108505982	SO:0001583	missense	2986	exon18			L37378	CCDS14545.1	Xq22	2008-08-01			ENSG00000101890	ENSG00000101890			4691	protein-coding gene	gene with protein product	"""guanylate cyclase 2D-like, membrane (retina-specific)"""	300041				8838319, 7777544	Standard	NM_001522		Approved	GUC2DL, GC-F, RetGC-2, ROS-GC2, CYGF	uc004eod.4	P51841	OTTHUMG00000022184	ENST00000218006.2:c.3221C>A	X.37:g.108619326G>T	ENSP00000218006:p.Pro1074Gln	Somatic		Unspecified	Illumina	Phase_I	108505982	NM_001522	Q9UJF1	Missense_Mutation	SNP	ENST00000218006.2	37	CCDS14545.1	.	.	.	.	.	.	.	.	.	.	G	16.23	3.063699	0.55432	.	.	ENSG00000101890	ENST00000218006	T	0.79845	-1.31	4.31	2.53	0.30540	.	0.193466	0.45361	D	0.000377	D	0.85035	0.5605	L	0.60455	1.87	0.58432	D	0.999994	D	0.89917	1.0	D	0.97110	1.0	T	0.83233	-0.0062	10	0.62326	D	0.03	.	7.925	0.29870	0.212:0.0:0.7879:0.0	.	1074	P51841	GUC2F_HUMAN	Q	1074	ENSP00000218006:P1074Q	ENSP00000218006:P1074Q	P	-	2	0	GUCY2F	108505982	1.000000	0.71417	0.921000	0.36526	0.921000	0.55340	3.485000	0.53208	0.571000	0.29365	0.600000	0.82982	CCA		GUCY2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057884.1	NM_001522	
GRIA3	2892	broad.mit.edu	37	X	122387324	122387324	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A020-01	TCGA-AG-A020-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chrX:122387324G>T	ENST00000371251.1	+	3	491	c.439G>T	c.(439-441)Ggc>Tgc	p.G147C	GRIA3_ENST00000541091.1_Missense_Mutation_p.G131C|GRIA3_ENST00000264357.5_Missense_Mutation_p.G147C|GRIA3_ENST00000371256.5_Missense_Mutation_p.G147C|GRIA3_ENST00000479118.1_3'UTR|GRIA3_ENST00000542149.1_Missense_Mutation_p.G147C			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3	147					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)	p.G147C(2)		breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	AGCCTTGAAGGGCGCTATTCT	0.522																																					p.G147C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G439T	X						.						106.0	90.0	96.0					X																	122387324		2203	4300	6503	122215005	SO:0001583	missense	2892	exon3			U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.439G>T	X.37:g.122387324G>T	ENSP00000360297:p.Gly147Cys	Somatic		Unspecified	Illumina	Phase_I	122215005	NM_007325	D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Missense_Mutation	SNP	ENST00000371251.1	37	CCDS14604.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.344946	0.82022	.	.	ENSG00000125675	ENST00000264357;ENST00000542149;ENST00000371256;ENST00000371251;ENST00000541091	D;D;D;D;D	0.82893	-1.66;-1.66;-1.66;-1.66;-1.66	5.63	5.63	0.86233	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.89497	0.6732	L	0.54323	1.7	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.987;1.0;0.999	D	0.90125	0.4202	10	0.72032	D	0.01	.	17.7593	0.88460	0.0:0.0:1.0:0.0	.	131;147;147	B7Z4C0;P42263;P42263-2	.;GRIA3_HUMAN;.	C	147;147;147;147;131	ENSP00000264357:G147C;ENSP00000446146:G147C;ENSP00000360302:G147C;ENSP00000360297:G147C;ENSP00000446440:G131C	ENSP00000264357:G147C	G	+	1	0	GRIA3	122215005	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.009000	0.88606	2.499000	0.84300	0.513000	0.50165	GGC		GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058854.1	NM_000828	
TENM1	10178	broad.mit.edu	37	X	123554302	123554302	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A020-01	TCGA-AG-A020-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chrX:123554302A>G	ENST00000371130.3	-	24	4883	c.4820T>C	c.(4819-4821)gTa>gCa	p.V1607A	STAG2_ENST00000469481.1_Intron|TENM1_ENST00000422452.2_Missense_Mutation_p.V1614A	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1607					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.V1609A(1)									CAGCCAGTATACTTGTCCGCC	0.527																																					p.V1607A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T4820C	X						.						75.0	56.0	63.0					X																	123554302		2203	4300	6503	123381983	SO:0001583	missense	10178	exon24			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.4820T>C	X.37:g.123554302A>G	ENSP00000360171:p.Val1607Ala	Somatic		Unspecified	Illumina	Phase_I	123381983	NM_014253	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	a	11.53	1.667096	0.29604	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.86097	-2.07;-2.05	5.49	4.34	0.51931	Six-bladed beta-propeller, TolB-like (1);	0.065091	0.64402	D	0.000009	T	0.81302	0.4794	M	0.65975	2.015	0.42896	D	0.994213	B;B;B	0.28512	0.018;0.004;0.214	B;B;B	0.25759	0.008;0.005;0.063	T	0.78109	-0.2332	10	0.30854	T	0.27	.	9.9838	0.41830	0.9201:0.0:0.0798:0.0	.	1613;1614;1607	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	A	1607;1614	ENSP00000360171:V1607A;ENSP00000403954:V1614A	ENSP00000360171:V1607A	V	-	2	0	ODZ1	123381983	1.000000	0.71417	0.992000	0.48379	0.557000	0.35523	5.131000	0.64751	1.840000	0.53500	0.483000	0.47432	GTA		TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
SLITRK2	84631	broad.mit.edu	37	X	144903997	144903997	+	Silent	SNP	G	G	A			TCGA-AG-A020-01	TCGA-AG-A020-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chrX:144903997G>A	ENST00000370490.1	+	1	4309	c.54G>A	c.(52-54)caG>caA	p.Q18Q	SLITRK2_ENST00000447897.2_Silent_p.Q18Q|SLITRK2_ENST00000434188.2_Silent_p.Q18Q|SLITRK2_ENST00000413937.2_Silent_p.Q18Q|SLITRK2_ENST00000428560.2_Silent_p.Q18Q			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	18					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.Q18Q(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					GGATCTTACAGACAGAGAGTC	0.468																																					p.Q18Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G54A	X						.						69.0	63.0	65.0					X																	144903997		2203	4300	6503	144711689	SO:0001819	synonymous_variant	84631	exon3			Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.54G>A	X.37:g.144903997G>A		Somatic		Unspecified	Illumina	Phase_I	144711689	NM_001144006	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Silent	SNP	ENST00000370490.1	37	CCDS14680.1																																																																																				SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539	
MAMLD1	10046	broad.mit.edu	37	X	149638895	149638895	+	Silent	SNP	G	G	A			TCGA-AG-A020-01	TCGA-AG-A020-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chrX:149638895G>A	ENST00000370401.2	+	4	1360	c.1050G>A	c.(1048-1050)ccG>ccA	p.P350P	MAMLD1_ENST00000432680.2_Silent_p.P325P|MAMLD1_ENST00000455522.2_5'Flank|MAMLD1_ENST00000262858.5_Silent_p.P350P|MAMLD1_ENST00000426613.2_Silent_p.P325P			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	350	Poly-Pro.				male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.P277P(1)|p.P350P(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					acccaccaccgctgccactgc	0.627																																					p.P325P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G975A	X						.						80.0	56.0	64.0					X																	149638895		2202	4300	6502	149389553	SO:0001819	synonymous_variant	10046	exon2			U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.1050G>A	X.37:g.149638895G>A		Somatic		Unspecified	Illumina	Phase_I	149389553	NM_001177466	B2RCQ4|B4DG93|B9EGA5	Silent	SNP	ENST00000370401.2	37	CCDS14693.2																																																																																				MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060844.2	NM_005491	
OPN1LW	5956	broad.mit.edu	37	X	153420184	153420184	+	Silent	SNP	C	C	T			TCGA-AG-A020-01	TCGA-AG-A020-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chrX:153420184C>T	ENST00000369951.4	+	4	774	c.714C>T	c.(712-714)tgC>tgT	p.C238C	OPN1LW_ENST00000463296.1_Intron	NM_020061.4	NP_064445.2	P04000	OPSR_HUMAN	opsin 1 (cone pigments), long-wave-sensitive	238					phototransduction, visible light (GO:0007603)|positive regulation of cytokinesis (GO:0032467)|protein-chromophore linkage (GO:0018298)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)	p.C238C(2)		endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	15	all_cancers(53;1.83e-16)|all_epithelial(53;2.73e-10)|all_lung(58;6.39e-07)|Lung NSC(58;8.37e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TCATGCTCTGCTACCTCCAAG	0.602																																					p.C238C												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C714T	X						.						281.0	206.0	231.0					X																	153420184		2189	4251	6440	153073378	SO:0001819	synonymous_variant	5956	exon4			Z68193	CCDS14742.1	Xq28	2013-01-08	2008-04-16		ENSG00000102076	ENSG00000102076		"""GPCR / Class A : Opsin receptors"""	9936	protein-coding gene	gene with protein product	"""cone dystrophy 5 (X-linked)"""	300822	"""color blindness, protan"", ""red cone photoreceptor pigment"""	CBBM, RCP, CBP			Standard	NM_020061		Approved	COD5	uc004fjz.4	P04000	OTTHUMG00000034295	ENST00000369951.4:c.714C>T	X.37:g.153420184C>T		Somatic		Unspecified	Illumina	Phase_I	153073378	NM_020061		Silent	SNP	ENST00000369951.4	37	CCDS14742.1																																																																																				OPN1LW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082839.2	NM_020061	
FAM47C	442444	broad.mit.edu	37	X	37028940	37028940	+	Silent	SNP	C	C	T			TCGA-AG-A020-01	TCGA-AG-A020-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chrX:37028940C>T	ENST00000358047.3	+	1	2509	c.2457C>T	c.(2455-2457)acC>acT	p.T819T		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	819								p.T819T(1)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						CTACCAAGACCGGAGCGTCCC	0.547																																					p.T819T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2457T	X						.						58.0	58.0	58.0					X																	37028940		2202	4300	6502	36938861	SO:0001819	synonymous_variant	442444	exon1			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.2457C>T	X.37:g.37028940C>T		Somatic		Unspecified	Illumina	Phase_I	36938861	NM_001013736	Q6ZU46	Silent	SNP	ENST00000358047.3	37	CCDS35227.1																																																																																				FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736	
SRPX	8406	broad.mit.edu	37	X	38019445	38019445	+	Silent	SNP	T	T	C			TCGA-AG-A020-01	TCGA-AG-A020-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chrX:38019445T>C	ENST00000378533.3	-	7	886	c.780A>G	c.(778-780)aaA>aaG	p.K260K	TM4SF2_ENST00000465127.1_Intron|SRPX_ENST00000343800.6_Silent_p.K247K|SRPX_ENST00000479015.1_5'Flank|SRPX_ENST00000432886.2_Silent_p.K201K|SRPX_ENST00000538295.1_Silent_p.K260K|SRPX_ENST00000544439.1_Silent_p.K240K	NM_006307.4	NP_006298.1	P78539	SRPX_HUMAN	sushi-repeat containing protein, X-linked	260	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				autophagy (GO:0006914)|cell adhesion (GO:0007155)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|phagolysosome assembly (GO:0001845)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|response to endoplasmic reticulum stress (GO:0034976)	autophagic vacuole (GO:0005776)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)		p.K260K(1)		autonomic_ganglia(1)|breast(2)|endometrium(5)|large_intestine(5)|lung(10)|prostate(2)	25						TGCCACAGCGTTTGACTGTAG	0.527																																					p.K260K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A780G	X						.						77.0	61.0	66.0					X																	38019445		2202	4300	6502	37904389	SO:0001819	synonymous_variant	8406	exon7			U78093	CCDS14245.1, CCDS55400.1, CCDS55401.1, CCDS55402.1	Xp21.1	2011-01-25	2011-01-25		ENSG00000101955	ENSG00000101955			11309	protein-coding gene	gene with protein product		300187	"""sushi-repeat-containing protein, X chromosome"", ""sushi-repeat-containing protein, X-linked"""			8634708, 8634709	Standard	NM_006307		Approved	ETX1	uc004ddy.2	P78539	OTTHUMG00000021362	ENST00000378533.3:c.780A>G	X.37:g.38019445T>C		Somatic		Unspecified	Illumina	Phase_I	37904389	NM_006307	A8K065|B3KWP8|B4DDB8|B4DQH5|F5H4D7|G3V1L0|Q4VX66|Q99652|Q99913	Silent	SNP	ENST00000378533.3	37	CCDS14245.1																																																																																				SRPX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056243.1	NM_006307	
RPGR	6103	broad.mit.edu	37	X	38145583	38145585	+	Intron	DEL	TCC	TCC	-	rs199663434		TCGA-AG-A020-01	TCGA-AG-A020-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chrX:38145583_38145585delTCC	ENST00000339363.3	-	14	2688				TM4SF2_ENST00000465127.1_Intron|RPGR_ENST00000309513.3_Intron|RPGR_ENST00000342811.3_Intron|RPGR_ENST00000378505.2_In_Frame_Del_p.889_890EE>E|RPGR_ENST00000318842.7_Intron|RPGR_ENST00000338898.3_Intron			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator						cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)	p.E890delE(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						cccttctccttcctcttctccct	0.591																																					p.889_890del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.2667_2669del	X						.		,	260,2646		30,169,31,1108,261					,		0.1			6	751,4006		117,346,171,1370,920	no	coding,intron	RPGR	NM_001034853.1,NM_000328.2	,	147,515,202,2478,1181	A1A1,A1R,A1,RR,R		15.7873,8.947,13.1933	,	,		1011,6652				38030529	SO:0001627	intron_variant	6103	exon15			U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.2520+761GGA>-	X.37:g.38145583_38145585delTCC		Somatic		Unspecified	Illumina	Phase_I	38030527	NM_001034853	B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	In_Frame_Del	DEL	ENST00000339363.3	37																																																																																					RPGR-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_000328	
HUWE1	10075	broad.mit.edu	37	X	53565406	53565406	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A020-01	TCGA-AG-A020-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chrX:53565406C>T	ENST00000342160.3	-	76	12345	c.11888G>A	c.(11887-11889)cGc>cAc	p.R3963H	HUWE1_ENST00000262854.6_Missense_Mutation_p.R3963H			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	3963					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.R3853H(1)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TAACACAGTGCGGTGAGTCTC	0.522																																					p.R3963H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G11888A	X						.						144.0	91.0	109.0					X																	53565406		2203	4300	6503	53582131	SO:0001583	missense	10075	exon77			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.11888G>A	X.37:g.53565406C>T	ENSP00000340648:p.Arg3963His	Somatic		Unspecified	Illumina	Phase_I	53582131	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	C	17.00	3.275866	0.59649	.	.	ENSG00000086758	ENST00000342160;ENST00000262854	T;T	0.49720	0.77;0.77	5.42	5.42	0.78866	.	0.412831	0.24332	N	0.039453	T	0.69324	0.3098	M	0.76328	2.33	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.999	D;D;D	0.74674	0.977;0.964;0.984	T	0.73304	-0.4025	10	0.87932	D	0	.	16.9563	0.86260	0.0:1.0:0.0:0.0	.	785;3963;3947	Q5H935;Q7Z6Z7;Q7Z6Z7-2	.;HUWE1_HUMAN;.	H	3963	ENSP00000340648:R3963H;ENSP00000262854:R3963H	ENSP00000262854:R3963H	R	-	2	0	HUWE1	53582131	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.899000	0.75682	2.267000	0.75376	0.529000	0.55759	CGC		HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
PCDH19	57526	broad.mit.edu	37	X	99663337	99663337	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A020-01	TCGA-AG-A020-01	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chrX:99663337T>A	ENST00000373034.4	-	1	1934	c.259A>T	c.(259-261)Att>Ttt	p.I87F	PCDH19_ENST00000255531.7_Missense_Mutation_p.I87F|PCDH19_ENST00000420881.2_Missense_Mutation_p.I87F	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	87	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I87F(1)		breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						TCACGGTCAATCTTCTGCTTG	0.572																																					p.I87F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A259T	X						.						73.0	68.0	70.0					X																	99663337		2088	4208	6296	99549993	SO:0001583	missense	57526	exon1			AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.259A>T	X.37:g.99663337T>A	ENSP00000362125:p.Ile87Phe	Somatic		Unspecified	Illumina	Phase_I	99549993	NM_001105243	B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	ENST00000373034.4	37	CCDS55462.1	.	.	.	.	.	.	.	.	.	.	T	19.52	3.842273	0.71488	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.35048	1.33;1.33;1.33	5.7	5.7	0.88788	Cadherin, N-terminal (1);Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.71247	0.3317	H	0.95187	3.635	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.83275	0.996;0.988;0.993	T	0.80892	-0.1179	10	0.87932	D	0	.	14.5681	0.68194	0.0:0.0:0.0:1.0	.	87;87;87	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	F	87	ENSP00000400327:I87F;ENSP00000362125:I87F;ENSP00000255531:I87F	ENSP00000255531:I87F	I	-	1	0	PCDH19	99549993	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	6.186000	0.72026	1.906000	0.55180	0.441000	0.28932	ATT		PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057479.2	NM_020766	
FLNA	2316	broad.mit.edu	37	X	153590615	153590615	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A020-01	TCGA-AG-A020-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chrX:153590615C>T	ENST00000369850.3	-	18	2887	c.2651G>A	c.(2650-2652)cGc>cAc	p.R884H	FLNA_ENST00000360319.4_Missense_Mutation_p.R884H|FLNA_ENST00000422373.1_Missense_Mutation_p.R884H|FLNA_ENST00000344736.4_Missense_Mutation_p.R884H	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	884					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)	p.R884H(1)		breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTCACCAGTGCGACTGAGGCC	0.652																																					p.R884H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2651A	X						.						68.0	72.0	71.0					X																	153590615		2074	4178	6252	153243809	SO:0001583	missense	2316	exon18			X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.2651G>A	X.37:g.153590615C>T	ENSP00000358866:p.Arg884His	Somatic		Unspecified	Illumina	Phase_I	153243809	NM_001456	E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	ENST00000369850.3	37	CCDS48194.1	.	.	.	.	.	.	.	.	.	.	C	16.92	3.254805	0.59212	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.84800	-1.9;-1.9;-1.9;-1.9	4.91	4.91	0.64330	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000003	D	0.88138	0.6356	L	0.42245	1.32	0.80722	D	1	D;D	0.76494	0.99;0.999	D;D	0.70487	0.923;0.969	D	0.88555	0.3119	10	0.62326	D	0.03	.	11.4197	0.49974	0.0:0.9016:0.0:0.0984	.	884;884	P21333-2;P21333	.;FLNA_HUMAN	H	884;857;884;884;884	ENSP00000353467:R884H;ENSP00000416926:R884H;ENSP00000358866:R884H;ENSP00000358863:R884H	ENSP00000358863:R884H	R	-	2	0	FLNA	153243809	0.065000	0.20965	0.948000	0.38648	0.709000	0.40893	1.181000	0.32017	2.156000	0.67533	0.529000	0.55759	CGC		FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3		
DPP10	57628	broad.mit.edu	37	2	116497365	116497365	+	Silent	SNP	A	A	C			TCGA-AG-A020-01	TCGA-AG-A020-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr2:116497365A>C	ENST00000410059.1	+	9	1228	c.748A>C	c.(748-750)Aga>Cga	p.R250R	DPP10_ENST00000393147.2_Silent_p.R254R|DPP10_ENST00000310323.8_Silent_p.R243R|DPP10_ENST00000409163.1_Silent_p.R200R	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	250						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)	p.R243R(1)|p.R250R(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						AGATGGAGAAAGACTTGCCTT	0.468																																					p.R200R												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A598C	2						.						203.0	174.0	184.0					2																	116497365		2203	4299	6502	116213835	SO:0001819	synonymous_variant	57628	exon10			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.748A>C	2.37:g.116497365A>C		Somatic		Unspecified	Illumina	Phase_I	116213835	NM_001178036	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Silent	SNP	ENST00000410059.1	37	CCDS46400.1																																																																																				DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868	
KYNU	8942	broad.mit.edu	37	2	143743579	143743579	+	Silent	SNP	G	G	A	rs140758594		TCGA-AG-A020-01	TCGA-AG-A020-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr2:143743579G>A	ENST00000264170.4	+	10	1149	c.891G>A	c.(889-891)acG>acA	p.T297T	KYNU_ENST00000375773.2_Silent_p.T297T|KYNU_ENST00000409512.1_Silent_p.T297T	NM_003937.2	NP_003928.1			kynureninase									p.T297T(2)		large_intestine(10)|liver(1)|lung(18)|prostate(3)|skin(4)	36				BRCA - Breast invasive adenocarcinoma(221;0.072)		ATGCCCATACGATTAAACCTG	0.328																																					p.T297T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G891A	2						.	G	,,	1,4405	4.2+/-10.8	0,1,2202	75.0	75.0	75.0		891,891,891	-7.6	0.0	2	dbSNP_134	75	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	KYNU	NM_001032998.1,NM_001199241.1,NM_003937.2	,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,	297/308,297/466,297/466	143743579	1,13005	2203	4300	6503	143460049	SO:0001819	synonymous_variant	8942	exon10			U57721	CCDS2183.1, CCDS33299.1	2q22.2	2010-11-23	2010-11-23		ENSG00000115919	ENSG00000115919	3.7.1.3		6469	protein-coding gene	gene with protein product	"""L-kynurenine hydrolase"""	605197	"""kynureninase (L-kynurenine hydrolase)"""			8706755, 9180257	Standard	NM_001199241		Approved		uc002tvl.3	Q16719	OTTHUMG00000131829	ENST00000264170.4:c.891G>A	2.37:g.143743579G>A		Somatic		Unspecified	Illumina	Phase_I	143460049	NM_001032998		Silent	SNP	ENST00000264170.4	37	CCDS2183.1																																																																																				KYNU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254772.1	NM_001032998	
TTN	7273	broad.mit.edu	37	2	179604188	179604188	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A020-01	TCGA-AG-A020-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr2:179604188A>G	ENST00000591111.1	-	46	13045	c.12821T>C	c.(12820-12822)gTa>gCa	p.V4274A	TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V4353A|TTN_ENST00000589042.1_Missense_Mutation_p.V4591A|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.V4228A|TTN_ENST00000342175.6_Missense_Mutation_p.V4420A|TTN_ENST00000342992.6_Intron			Q8WZ42	TITIN_HUMAN	titin	32487					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.V4228A(1)|p.V4420A(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGTATCTTTACTGTAGCAAC	0.443																																					p.V4228A												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T12683C	2						.						126.0	118.0	121.0					2																	179604188		1930	4139	6069	179312433	SO:0001583	missense	7273	exon45			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.12821T>C	2.37:g.179604188A>G	ENSP00000465570:p.Val4274Ala	Somatic		Unspecified	Illumina	Phase_I	179312433	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	A	1.815	-0.473732	0.04414	.	.	ENSG00000155657	ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T	0.61742	0.13;0.09;0.08	5.29	-10.6	0.00265	.	.	.	.	.	T	0.33059	0.0850	L	0.29908	0.895	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.34551	-0.9824	9	0.87932	D	0	.	1.4454	0.02363	0.1771:0.1576:0.2806:0.3847	.	4228;4353;4420	D3DPF9;E7EQE6;E7ET18	.;.;.	A	4228;4420;4353;4228	ENSP00000434586:V4228A;ENSP00000340554:V4420A;ENSP00000352154:V4353A	ENSP00000340554:V4420A	V	-	2	0	TTN	179312433	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.563000	0.05943	-2.822000	0.00343	-0.327000	0.08410	GTA		TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ZNF638	27332	broad.mit.edu	37	2	71607379	71607379	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-A020-01	TCGA-AG-A020-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr2:71607379G>T	ENST00000409544.1	+	9	2923	c.2293G>T	c.(2293-2295)Gag>Tag	p.E765*	ZNF638_ENST00000410075.1_3'UTR|RNU6-105P_ENST00000363909.1_RNA|ZNF638_ENST00000377802.2_Nonsense_Mutation_p.E765*|ZNF638_ENST00000264447.4_Nonsense_Mutation_p.E765*|ZNF638_ENST00000355812.3_Nonsense_Mutation_p.E765*	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	765					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.E765*(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						AAAGACTTTAGAGTCAAAGAA	0.249																																					p.E765X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G2293T	2						.						33.0	33.0	33.0					2																	71607379		2189	4244	6433	71460887	SO:0001587	stop_gained	27332	exon9			D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.2293G>T	2.37:g.71607379G>T	ENSP00000386433:p.Glu765*	Somatic		Unspecified	Illumina	Phase_I	71460887	NM_014497	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Nonsense_Mutation	SNP	ENST00000409544.1	37	CCDS1917.1	.	.	.	.	.	.	.	.	.	.	G	39	7.420577	0.98272	.	.	ENSG00000075292	ENST00000410075;ENST00000544512;ENST00000394137;ENST00000355812;ENST00000377802;ENST00000264447;ENST00000409544	.	.	.	4.58	4.58	0.56647	.	0.310564	0.28431	N	0.015365	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-9.6736	13.1824	0.59662	0.0:0.0:1.0:0.0	.	.	.	.	X	765;871;344;765;765;765;765	.	ENSP00000264447:E765X	E	+	1	0	ZNF638	71460887	0.991000	0.36638	0.973000	0.42090	0.150000	0.21749	2.648000	0.46647	2.835000	0.97688	0.591000	0.81541	GAG		ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497	
CNNM3	26505	broad.mit.edu	37	2	97493857	97493857	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A020-01	TCGA-AG-A020-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr2:97493857G>A	ENST00000305510.3	+	5	1739	c.1711G>A	c.(1711-1713)Ggg>Agg	p.G571R	ANKRD23_ENST00000476975.1_Intron|CNNM3_ENST00000377060.3_Missense_Mutation_p.G523R	NM_017623.4	NP_060093.3	Q8NE01	CNNM3_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 3	571					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)	p.G571R(1)		NS(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(2)|skin(1)|urinary_tract(2)	13						AGTGGAGATCGGGAAAGAGGG	0.567																																					p.G571R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1711A	2						.						109.0	115.0	113.0					2																	97493857		2203	4300	6503	96857584	SO:0001583	missense	26505	exon5			AF216965	CCDS2025.1, CCDS2026.1	2q11.2	2014-08-08	2014-08-07		ENSG00000168763	ENSG00000168763			104	protein-coding gene	gene with protein product		607804	"""cyclin M3"""	ACDP3		21393841, 24632616	Standard	XM_005263917		Approved		uc002swy.3	Q8NE01	OTTHUMG00000130531	ENST00000305510.3:c.1711G>A	2.37:g.97493857G>A	ENSP00000305449:p.Gly571Arg	Somatic		Unspecified	Illumina	Phase_I	96857584	NM_017623	B3KX67|Q8TBV4|Q96IW4|Q9NRK4|Q9NXW6	Missense_Mutation	SNP	ENST00000305510.3	37	CCDS2025.1	.	.	.	.	.	.	.	.	.	.	G	32	5.110384	0.94292	.	.	ENSG00000168763	ENST00000377060;ENST00000424641;ENST00000305510	T;T	0.58797	0.31;0.31	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.81361	0.4806	M	0.91612	3.225	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.991	D	0.85680	0.1300	10	0.87932	D	0	-39.4218	17.2957	0.87170	0.0:0.0:1.0:0.0	.	523;571	Q8NE01-2;Q8NE01	.;CNNM3_HUMAN	R	523;523;571	ENSP00000366260:G523R;ENSP00000305449:G571R	ENSP00000305449:G571R	G	+	1	0	CNNM3	96857584	1.000000	0.71417	0.999000	0.59377	0.945000	0.59286	9.601000	0.98297	2.611000	0.88343	0.491000	0.48974	GGG		CNNM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252952.2	NM_017623	
ALS2	57679	broad.mit.edu	37	2	202614457	202614457	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A020-01	TCGA-AG-A020-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr2:202614457G>T	ENST00000264276.6	-	8	2165	c.1793C>A	c.(1792-1794)aCa>aAa	p.T598K		NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	598					behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)	p.T598K(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						AGGAACTGTTGTTGGAAAATC	0.368																																					p.T598K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1793A	2						.						108.0	102.0	104.0					2																	202614457		1858	4089	5947	202322702	SO:0001583	missense	57679	exon8			AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.1793C>A	2.37:g.202614457G>T	ENSP00000264276:p.Thr598Lys	Somatic		Unspecified	Illumina	Phase_I	202322702	NM_020919	Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Missense_Mutation	SNP	ENST00000264276.6	37	CCDS42800.1	.	.	.	.	.	.	.	.	.	.	G	19.22	3.784941	0.70222	.	.	ENSG00000003393	ENST00000264276	T	0.79845	-1.31	5.87	5.87	0.94306	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.047300	0.85682	D	0.000000	T	0.76040	0.3932	N	0.25060	0.705	0.80722	D	1	P;B;P	0.44478	0.836;0.437;0.629	B;B;B	0.44163	0.319;0.443;0.243	T	0.76386	-0.2978	10	0.46703	T	0.11	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	598;598;598	Q96Q42-3;Q6IQ41;Q96Q42	.;.;ALS2_HUMAN	K	598	ENSP00000264276:T598K	ENSP00000264276:T598K	T	-	2	0	ALS2	202322702	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.189000	0.58358	2.941000	0.99782	0.655000	0.94253	ACA		ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335562.3	NM_020919	
KIAA1958	158405	broad.mit.edu	37	9	115422301	115422301	+	Silent	SNP	G	G	A	rs552377099		TCGA-AG-A020-01	TCGA-AG-A020-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr9:115422301G>A	ENST00000337530.6	+	4	2399	c.2103G>A	c.(2101-2103)tcG>tcA	p.S701S	KIAA1958_ENST00000536272.1_Silent_p.S729S	NM_133465.2	NP_597722.1	Q8N8K9	K1958_HUMAN	KIAA1958	701								p.S701S(1)		endometrium(1)|large_intestine(9)|lung(10)|prostate(2)|skin(3)	25						CCTTTGTCTCGTTCACTCAGG	0.612													G|||	1	0.000199681	0.0	0.0	5008	,	,		18847	0.001		0.0	False		,,,				2504	0.0				p.S701S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2103A	9						.						71.0	70.0	70.0					9																	115422301		2203	4300	6503	114462122	SO:0001819	synonymous_variant	158405	exon4			AB075838	CCDS35108.1, CCDS69642.1	9q33.1	2009-09-22			ENSG00000165185	ENSG00000165185			23427	protein-coding gene	gene with protein product							Standard	NM_001287038		Approved	FLJ39294	uc004bgf.1	Q8N8K9	OTTHUMG00000020508	ENST00000337530.6:c.2103G>A	9.37:g.115422301G>A		Somatic		Unspecified	Illumina	Phase_I	114462122	NM_133465	B7ZKW6|Q2M336|Q5T252|Q8TF43|Q96N02	Silent	SNP	ENST00000337530.6	37	CCDS35108.1																																																																																				KIAA1958-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053690.1	NM_133465	
PAPPA	5069	broad.mit.edu	37	9	119028244	119028244	+	Silent	SNP	T	T	C			TCGA-AG-A020-01	TCGA-AG-A020-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr9:119028244T>C	ENST00000328252.3	+	8	3210	c.2841T>C	c.(2839-2841)tgT>tgC	p.C947C	PAPPA_ENST00000534838.1_5'UTR	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	947					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.C947C(1)		NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						GTGGGTACTGTGGCGATGGCA	0.438																																					p.C947C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2841C	9						.						94.0	87.0	89.0					9																	119028244		2203	4300	6503	118068065	SO:0001819	synonymous_variant	5069	exon8				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.2841T>C	9.37:g.119028244T>C		Somatic		Unspecified	Illumina	Phase_I	118068065	NM_002581	B1AMF9|Q08371|Q68G52|Q9UDK7	Silent	SNP	ENST00000328252.3	37	CCDS6813.1																																																																																				PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
PCCA	5095	broad.mit.edu	37	13	100909900	100909900	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A020-01	TCGA-AG-A020-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr13:100909900G>A	ENST00000376285.1	+	9	727	c.689G>A	c.(688-690)cGc>cAc	p.R230H	PCCA_ENST00000376286.4_Missense_Mutation_p.R204H|PCCA_ENST00000376279.3_Missense_Mutation_p.R230H	NM_000282.3	NP_000273.2	P05165	PCCA_HUMAN	propionyl CoA carboxylase, alpha polypeptide	230	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|propionyl-CoA carboxylase activity (GO:0004658)	p.R230H(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|prostate(1)|skin(2)	26	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	AAAGGCATGCGCATTGCTTGG	0.443																																					p.R230H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G689A	13						.						131.0	111.0	117.0					13																	100909900		2203	4300	6503	99707901	SO:0001583	missense	5095	exon9			X14608	CCDS9496.2, CCDS45065.1, CCDS53878.1	13q32	2011-01-14	2010-04-30		ENSG00000175198	ENSG00000175198	6.4.1.3		8653	protein-coding gene	gene with protein product		232000	"""propionyl Coenzyme A carboxylase, alpha polypeptide"""			1427880	Standard	NM_000282		Approved		uc001voo.3	P05165	OTTHUMG00000017284	ENST00000376285.1:c.689G>A	13.37:g.100909900G>A	ENSP00000365462:p.Arg230His	Somatic		Unspecified	Illumina	Phase_I	99707901	NM_001178004	B4DKY8|B4DPF9|C9JPQ8|Q15979|Q8WXQ7	Missense_Mutation	SNP	ENST00000376285.1	37	CCDS9496.2	.	.	.	.	.	.	.	.	.	.	G	27.2	4.810635	0.90707	.	.	ENSG00000175198	ENST00000376286;ENST00000376279;ENST00000376285	D;D;D	0.97665	-4.48;-4.48;-4.48	4.82	4.82	0.62117	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);Biotin carboxylation domain (1);	0.000000	0.85682	D	0.000000	D	0.98899	0.9627	H	0.94658	3.565	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76071	0.987;0.978;0.987	D	0.99737	1.1014	10	0.87932	D	0	.	17.8754	0.88824	0.0:0.0:1.0:0.0	.	230;204;230	C9JPQ8;P05165-2;P05165	.;.;PCCA_HUMAN	H	204;230;230	ENSP00000365463:R204H;ENSP00000365456:R230H;ENSP00000365462:R230H	ENSP00000365456:R230H	R	+	2	0	PCCA	99707901	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.208000	0.95075	2.212000	0.71576	0.563000	0.77884	CGC		PCCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045627.2		
TET1	80312	broad.mit.edu	37	10	70404538	70404538	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-A020-01	TCGA-AG-A020-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr10:70404538A>C	ENST00000373644.4	+	4	2261	c.2052A>C	c.(2050-2052)aaA>aaC	p.K684N		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	684					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)	p.K684N(2)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						AAGAACAAAAATTGGAATTGA	0.393																																					p.K684N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A2052C	10						.						65.0	61.0	62.0					10																	70404538		2203	4300	6503	70074544	SO:0001583	missense	80312	exon4			AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.2052A>C	10.37:g.70404538A>C	ENSP00000362748:p.Lys684Asn	Somatic		Unspecified	Illumina	Phase_I	70074544	NM_030625	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	37	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	A	13.31	2.200391	0.38905	.	.	ENSG00000138336	ENST00000373644	T	0.08546	3.08	5.93	2.29	0.28610	.	0.420483	0.23799	N	0.044445	T	0.03827	0.0108	N	0.14661	0.345	0.24774	N	0.99286	B	0.31125	0.309	B	0.23852	0.049	T	0.36648	-0.9739	10	0.72032	D	0.01	.	2.8236	0.05479	0.5125:0.0:0.29:0.1974	.	684	Q8NFU7	TET1_HUMAN	N	684	ENSP00000362748:K684N	ENSP00000362748:K684N	K	+	3	2	TET1	70074544	1.000000	0.71417	0.995000	0.50966	0.867000	0.49689	1.280000	0.33202	0.497000	0.27926	0.533000	0.62120	AAA		TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
ZSWIM8	23053	broad.mit.edu	37	10	75556556	75556556	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-A020-01	TCGA-AG-A020-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr10:75556556G>T	ENST00000605216.1	+	16	3260	c.3043G>T	c.(3043-3045)Gag>Tag	p.E1015*	ZSWIM8_ENST00000398706.2_Nonsense_Mutation_p.E1020*|ZSWIM8-AS1_ENST00000456638.2_RNA|RP11-574K11.31_ENST00000603027.1_3'UTR|ZSWIM8_ENST00000604524.1_Nonsense_Mutation_p.E1015*|ZSWIM8_ENST00000603114.1_Nonsense_Mutation_p.E982*|ZSWIM8_ENST00000604729.1_Nonsense_Mutation_p.E1020*	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	1015							zinc ion binding (GO:0008270)	p.E1020*(1)									CTTGGACCGAGAGAGCCAGAC	0.527																																					p.E1020X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G3058T	10						.						51.0	55.0	54.0					10																	75556556		2032	4202	6234	75226562	SO:0001587	stop_gained	23053	exon16			BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.3043G>T	10.37:g.75556556G>T	ENSP00000474748:p.Glu1015*	Somatic		Unspecified	Illumina	Phase_I	75226562	NM_015037	B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Nonsense_Mutation	SNP	ENST00000605216.1	37		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	36|36|36	5.874733|5.874733|5.874733	0.97055|0.97055|0.97055	.|.|.	.|.|.	ENSG00000214655|ENSG00000214655|ENSG00000214655	ENST00000412198|ENST00000398706|ENST00000433366	.|.|.	.|.|.	.|.|.	5.3|5.3|5.3	5.3|5.3|5.3	0.74995|0.74995|0.74995	.|.|.	0.156200|0.156200|.	0.40728|0.40728|.	U|U|.	0.001029|0.001029|.	T|.|T	0.81475|.|0.81475	0.4830|.|0.4830	.|.|.	.|.|.	.|.|.	0.80722|0.80722|0.80722	A|A|A	1|1|1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	D|.|D	0.83921|.|0.83921	0.0301|.|0.0301	4|.|4	.|0.56958|0.87932	.|D|D	.|0.05|0	-8.3409|-8.3409|-8.3409	18.9581|18.9581|18.9581	0.92668|0.92668|0.92668	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|.|.	.|.|.	.|.|.	D|X|I	289|1020|730	.|.|.	.|ENSP00000381693:E1020X|ENSP00000387828:R730I	E|E|R	+|+|+	3|1|2	2|0|0	KIAA0913|KIAA0913|KIAA0913	75226562|75226562|75226562	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.997000|0.997000|0.997000	0.91878|0.91878|0.91878	9.649000|9.649000|9.649000	0.98487|0.98487|0.98487	2.482000|2.482000|2.482000	0.83794|0.83794|0.83794	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GAG|GAG|AGA		ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000468545.1	NM_001242487	
APC	324	broad.mit.edu	37	5	112175639	112175639	+	Nonsense_Mutation	SNP	C	C	T	rs121913332		TCGA-AG-A020-01	TCGA-AG-A020-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr5:112175639C>T	ENST00000457016.1	+	16	4728	c.4348C>T	c.(4348-4350)Cga>Tga	p.R1450*	APC_ENST00000508376.2_Nonsense_Mutation_p.R1450*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.R1450*			P25054	APC_HUMAN	adenomatous polyposis coli	1450	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R1450*(153)|p.?(1)|p.P1424fs*19(1)|p.K1192fs*3(1)|p.R1450fs*22(1)|p.S1436fs*22(1)|p.R1450fs*5(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCAAACCAAGCGAGAAGTACC	0.478	R1450*(LS123_LARGE_INTESTINE)|R1450*(MKN74_STOMACH)|R1450*(SW1417_LARGE_INTESTINE)|R1450*(SW837_LARGE_INTESTINE)	12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R1432X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,rectum,Substitution - Nonsense,0	.	159	Substitution - Nonsense(153)|Deletion - Frameshift(4)|Unknown(1)|Insertion - Frameshift(1)	large_intestine(136)|stomach(13)|soft_tissue(4)|small_intestine(3)|endometrium(1)|skin(1)|pancreas(1)	c.C4294T	5	GRCh37	CM930030	APC	M	rs121913332	.						102.0	90.0	94.0					5																	112175639		2202	4300	6502	112203538	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4348C>T	5.37:g.112175639C>T	ENSP00000413133:p.Arg1450*	Somatic		Unspecified	Illumina	Phase_I	112203538	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	41	8.651223	0.98901	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	4.2	0.49525	.	0.600559	0.18052	N	0.153248	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.0649	14.037	0.64651	0.426:0.574:0.0:0.0	.	.	.	.	X	1450	.	.	R	+	1	2	APC	112203538	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.171000	0.50824	1.564000	0.49628	0.655000	0.94253	CGA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
HAND1	9421	broad.mit.edu	37	5	153857052	153857052	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A020-01	TCGA-AG-A020-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr5:153857052G>A	ENST00000231121.2	-	1	772	c.517C>T	c.(517-519)Cgt>Tgt	p.R173C		NM_004821.2	NP_004812.1	O96004	HAND1_HUMAN	heart and neural crest derivatives expressed 1	173					angiogenesis (GO:0001525)|blastocyst development (GO:0001824)|cardiac left ventricle formation (GO:0003218)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cartilage morphogenesis (GO:0060536)|embryonic heart tube development (GO:0035050)|embryonic heart tube formation (GO:0003144)|heart development (GO:0007507)|heart looping (GO:0001947)|mesenchyme development (GO:0060485)|mesoderm formation (GO:0001707)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)|trophectodermal cell differentiation (GO:0001829)|trophoblast giant cell differentiation (GO:0060707)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.R173C(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	6	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			TTGCTCTCACGGCCGCCATCC	0.622																																					p.R173C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C517T	5						.						94.0	91.0	92.0					5																	153857052		2203	4300	6503	153837245	SO:0001583	missense	9421	exon1			AF061756	CCDS4327.1	5q33	2013-05-21			ENSG00000113196	ENSG00000113196		"""Basic helix-loop-helix proteins"""	4807	protein-coding gene	gene with protein product		602406				9337404, 9931445	Standard	NM_004821		Approved	eHand, Thing1, Hxt, bHLHa27	uc003lvn.3	O96004	OTTHUMG00000130193	ENST00000231121.2:c.517C>T	5.37:g.153857052G>A	ENSP00000231121:p.Arg173Cys	Somatic		Unspecified	Illumina	Phase_I	153837245	NM_004821		Missense_Mutation	SNP	ENST00000231121.2	37	CCDS4327.1	.	.	.	.	.	.	.	.	.	.	G	19.04	3.750396	0.69533	.	.	ENSG00000113196	ENST00000231121	D	0.95949	-3.86	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	D	0.95567	0.8559	L	0.38175	1.15	0.54753	D	0.999983	D	0.89917	1.0	P	0.62184	0.899	D	0.95684	0.8734	10	0.59425	D	0.04	-22.2536	14.3607	0.66768	0.0:0.0:1.0:0.0	.	173	O96004	HAND1_HUMAN	C	173	ENSP00000231121:R173C	ENSP00000231121:R173C	R	-	1	0	HAND1	153837245	0.859000	0.29813	0.998000	0.56505	0.920000	0.55202	0.477000	0.22196	2.448000	0.82819	0.462000	0.41574	CGT		HAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252511.1	NM_004821	
TENM2	57451	broad.mit.edu	37	5	167674074	167674074	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A020-01	TCGA-AG-A020-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr5:167674074G>A	ENST00000518659.1	+	27	6169	c.6130G>A	c.(6130-6132)Gag>Aag	p.E2044K	TENM2_ENST00000403607.2_Missense_Mutation_p.E1868K|TENM2_ENST00000545108.1_Missense_Mutation_p.E2043K|TENM2_ENST00000520394.1_Missense_Mutation_p.E1805K|TENM2_ENST00000519204.1_Missense_Mutation_p.E1923K	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	2044					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.E1877K(1)									CGGGTATGACGAGACCACTGG	0.532																																					p.E2035K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6103A	5						.						80.0	79.0	80.0					5																	167674074		1934	4143	6077	167606652	SO:0001583	missense	57451	exon27			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.6130G>A	5.37:g.167674074G>A	ENSP00000429430:p.Glu2044Lys	Somatic		Unspecified	Illumina	Phase_I	167606652	NM_001122679	Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	37		.	.	.	.	.	.	.	.	.	.	G	23.2	4.390428	0.82902	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.90620	-2.23;-2.22;-2.33;-2.65;-2.7	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.95959	0.8684	M	0.84433	2.695	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.91635	0.999;0.998;0.98	D	0.96218	0.9158	10	0.72032	D	0.01	.	19.2461	0.93902	0.0:0.0:1.0:0.0	.	2043;2044;1805	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	K	2044;2043;1923;1805;1868	ENSP00000429430:E2044K;ENSP00000438635:E2043K;ENSP00000428964:E1923K;ENSP00000427874:E1805K;ENSP00000384905:E1868K	ENSP00000384905:E1868K	E	+	1	0	ODZ2	167606652	1.000000	0.71417	0.987000	0.45799	0.790000	0.44656	9.869000	0.99810	2.560000	0.86352	0.561000	0.74099	GAG		TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
DOCK2	1794	broad.mit.edu	37	5	169461428	169461428	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A020-01	TCGA-AG-A020-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr5:169461428C>A	ENST00000256935.8	+	35	3573	c.3493C>A	c.(3493-3495)Cca>Aca	p.P1165T	DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_Missense_Mutation_p.P226T|DOCK2_ENST00000520908.1_Missense_Mutation_p.P657T	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1165	Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.P1165T(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGCAGAGCACCCAACCATTGC	0.582																																					p.P1165T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3493A	5						.						95.0	90.0	92.0					5																	169461428		2203	4300	6503	169394006	SO:0001583	missense	1794	exon35			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3493C>A	5.37:g.169461428C>A	ENSP00000256935:p.Pro1165Thr	Somatic		Unspecified	Illumina	Phase_I	169394006	NM_004946	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	C	7.423	0.637176	0.14386	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.39997	1.05;1.05;1.05	5.63	5.63	0.86233	.	0.243081	0.41605	D	0.000857	T	0.34135	0.0887	L	0.39397	1.21	0.28165	N	0.928823	B;B	0.15473	0.0;0.013	B;B	0.06405	0.001;0.002	T	0.13415	-1.0510	10	0.31617	T	0.26	.	12.6264	0.56632	0.0:0.9237:0.0:0.0763	.	657;1165	E7ERW7;Q92608	.;DOCK2_HUMAN	T	1165;657;226	ENSP00000256935:P1165T;ENSP00000429283:P657T;ENSP00000438827:P226T	ENSP00000256935:P1165T	P	+	1	0	DOCK2	169394006	0.002000	0.14202	0.985000	0.45067	0.127000	0.20565	0.486000	0.22340	2.656000	0.90262	0.655000	0.94253	CCA		DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
GRM6	2916	broad.mit.edu	37	5	178413312	178413312	+	Missense_Mutation	SNP	G	G	A	rs61733863	byFrequency	TCGA-AG-A020-01	TCGA-AG-A020-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A020-01	TCGA-AG-A020-01	g.chr5:178413312G>A	ENST00000517717.1	-	9	1981	c.1943C>T	c.(1942-1944)gCg>gTg	p.A648V	RP11-281O15.4_ENST00000519491.1_RNA|GRM6_ENST00000231188.5_Missense_Mutation_p.A648V			O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6	648					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|detection of light stimulus involved in visual perception (GO:0050908)|detection of visible light (GO:0009584)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|locomotory behavior (GO:0007626)|positive regulation of calcium ion import (GO:0090280)|regulation of synaptic transmission, glutamatergic (GO:0051966)|retina development in camera-type eye (GO:0060041)|synaptic transmission (GO:0007268)	cell projection (GO:0042995)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|new growing cell tip (GO:0035841)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|protein homodimerization activity (GO:0042803)	p.A648V(1)		NS(2)|breast(4)|endometrium(9)|large_intestine(12)|lung(21)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	55	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		GGCACAGACCGCGGCCCCAGG	0.642													g|||	3	0.000599042	0.0015	0.0	5008	,	,		17344	0.001		0.0	False		,,,				2504	0.0				p.A648V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1943T	5						.	C	VAL/ALA	4,4402	8.1+/-20.4	0,4,2199	38.0	38.0	38.0		1943	2.3	0.0	5	dbSNP_129	38	3,8595	3.0+/-9.4	0,3,4296	yes	missense	GRM6	NM_000843.3	64	0,7,6495	AA,AG,GG		0.0349,0.0908,0.0538	benign	648/878	178413312	7,12997	2203	4299	6502	178345918	SO:0001583	missense	2916	exon8			U82083	CCDS4442.1	5q35	2014-01-28						"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4598	protein-coding gene	gene with protein product		604096				9215706	Standard	NM_000843		Approved	GPRC1F, mGlu6, MGLUR6, CSNB1B	uc003mjr.3	O15303	OTTHUMG00000130889	ENST00000517717.1:c.1943C>T	5.37:g.178413312G>A	ENSP00000430767:p.Ala648Val	Somatic		Unspecified	Illumina	Phase_I	178345918	NM_000843		Missense_Mutation	SNP	ENST00000517717.1	37	CCDS4442.1	2	9.157509157509158E-4	1	0.0020325203252032522	0	0.0	1	0.0017482517482517483	0	0.0	g	0.005	-2.201130	0.00296	9.08E-4	3.49E-4	ENSG00000113262	ENST00000319065;ENST00000231188;ENST00000517717	D;D	0.88277	-2.36;-2.36	5.02	2.26	0.28386	GPCR, family 3, C-terminal (2);	.	.	.	.	T	0.78541	0.4299	N	0.13299	0.325	0.09310	N	1	P;B	0.42123	0.771;0.026	B;B	0.42555	0.391;0.025	T	0.65356	-0.6188	9	0.10377	T	0.69	.	9.5679	0.39409	0.1488:0.1203:0.7309:0.0	.	804;648	E7EX65;O15303	.;GRM6_HUMAN	V	804;648;648	ENSP00000231188:A648V;ENSP00000430767:A648V	ENSP00000231188:A648V	A	-	2	0	GRM6	178345918	0.083000	0.21467	0.000000	0.03702	0.004000	0.04260	1.437000	0.34991	0.016000	0.14998	-2.900000	0.00093	GCG		GRM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253474.2		
