#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KLHDC1	122773	broad.mit.edu	37	14	50159994	50159995	+	Frame_Shift_Ins	INS	-	-	G	rs151334470		TCGA-AG-A036-01	TCGA-AG-A036-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr14:50159994_50159995insG	ENST00000359332.2	+	1	172_173	c.82_83insG	c.(82-84)tggfs	p.W28fs		NM_172193.2	NP_751943.1	Q8N7A1	KLDC1_HUMAN	kelch domain containing 1	28						cytoplasm (GO:0005737)		p.Y31fs*5(1)		kidney(1)|large_intestine(1)|liver(2)|lung(5)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	12	all_epithelial(31;0.00244)|Breast(41;0.00964)					CCTCTACGTGTGGGGGGGCTAC	0.708																																					p.W28fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.82_83insG	14						.			18,4224		0,18,2103						3.6	1.0			23	16,8216		0,16,4100	no	frameshift	KLHDC1	NM_172193.2		0,34,6203	A1A1,A1R,RR		0.1944,0.4243,0.2726				34,12440				49229745	SO:0001589	frameshift_variant	122773	exon1			AF111806	CCDS9692.1	14q21.3	2007-08-01			ENSG00000197776	ENSG00000197776			19836	protein-coding gene	gene with protein product		611281					Standard	NM_172193		Approved	MST025	uc001www.3	Q8N7A1	OTTHUMG00000140295	ENST00000359332.2:c.89dupG	14.37:g.50160001_50160001dupG	ENSP00000352282:p.Trp28fs	Somatic		Unspecified	Illumina	Phase_I	49229744	NM_172193	B3KXD9|Q8WYI1	Frame_Shift_Ins	INS	ENST00000359332.2	37	CCDS9692.1																																																																																				KLHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276882.2	NM_172193	
CCDC88C	440193	broad.mit.edu	37	14	91739502	91739503	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AG-A036-01	TCGA-AG-A036-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr14:91739502_91739503insG	ENST00000389857.6	-	30	5639_5640	c.5553_5554insC	c.(5551-5556)cccagcfs	p.S1852fs	CCDC88C_ENST00000331194.7_Frame_Shift_Ins_p.S376fs	NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	1852					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				CTATGGGAGCTGGGGGGTGCGG	0.698																																					p.S1852fs												.	.	0			c.5554_5555insC	14						.																																			90809256	SO:0001589	frameshift_variant	440193	exon30				CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.5554dupC	14.37:g.91739508_91739508dupG	ENSP00000374507:p.Ser1852fs	Somatic		Unspecified	Illumina	Phase_I	90809255	NM_001080414	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Frame_Shift_Ins	INS	ENST00000389857.6	37	CCDS45151.1																																																																																				CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353	
PIP5K1C	23396	broad.mit.edu	37	19	3644114	3644115	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AG-A036-01	TCGA-AG-A036-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr19:3644114_3644115insC	ENST00000335312.3	-	12	1568_1569	c.1480_1481insG	c.(1480-1482)gccfs	p.A494fs	PIP5K1C_ENST00000537021.1_Frame_Shift_Ins_p.A494fs|PIP5K1C_ENST00000589578.1_Frame_Shift_Ins_p.A494fs|PIP5K1C_ENST00000539785.1_Frame_Shift_Ins_p.A494fs	NM_001195733.1|NM_012398.2	NP_001182662.1|NP_036530.1	O60331	PI51C_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, gamma	494					actin cytoskeleton organization (GO:0030036)|adherens junction assembly (GO:0034333)|axon guidance (GO:0007411)|clathrin-mediated endocytosis (GO:0072583)|cytoskeletal anchoring at plasma membrane (GO:0007016)|neutrophil chemotaxis (GO:0030593)|phagocytosis (GO:0006909)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet aggregation (GO:0070527)|single organismal cell-cell adhesion (GO:0016337)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle exocytosis (GO:0016079)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|uropod (GO:0001931)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)			large_intestine(3)|ovary(1)|skin(3)|stomach(2)	9		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.95e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0026)|STAD - Stomach adenocarcinoma(1328;0.183)		GTAGCTGCGGGCCCCCCGCAGG	0.708																																					p.A494fs	Esophageal Squamous(135;99 1744 12852 27186 39851)											.	.	0			c.1481_1482insG	19						.																																			3595115	SO:0001589	frameshift_variant	23396	exon12			AB011161	CCDS32872.1, CCDS56074.1, CCDS74257.1	19p13.3	2012-10-02			ENSG00000186111	ENSG00000186111			8996	protein-coding gene	gene with protein product		606102				9535851	Standard	NM_001195733		Approved	PIP5Kgamma, KIAA0589, LCCS3	uc002lyj.2	O60331	OTTHUMG00000180870	ENST00000335312.3:c.1481dupG	19.37:g.3644120_3644120dupC	ENSP00000335333:p.Ala494fs	Somatic		Unspecified	Illumina	Phase_I	3595114	NM_012398	B7Z9E7|C6GIJ7|C6GIJ8|Q7LE07	Frame_Shift_Ins	INS	ENST00000335312.3	37	CCDS32872.1																																																																																				PIP5K1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453432.2	NM_012398	
ZC3HC1	51530	broad.mit.edu	37	7	129663442	129663442	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr7:129663442C>G	ENST00000358303.4	-	8	1226	c.1142G>C	c.(1141-1143)aGc>aCc	p.S381T	ZC3HC1_ENST00000311873.5_Missense_Mutation_p.S360T|RP11-306G20.1_ENST00000587038.1_RNA|ZC3HC1_ENST00000481503.1_Missense_Mutation_p.S338T|ZC3HC1_ENST00000360708.5_Intron|RP11-306G20.1_ENST00000480018.1_RNA	NM_016478.3	NP_057562.3	Q86WB0	NIPA_HUMAN	zinc finger, C3HC-type containing 1	381					mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|protein ubiquitination (GO:0016567)	nuclear membrane (GO:0031965)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)	p.S381T(1)		endometrium(2)|kidney(6)|large_intestine(10)|lung(2)|prostate(1)|urinary_tract(1)	22	Melanoma(18;0.0435)					TGTTCCCATGCTTCGGGTCAC	0.612																																					p.S381T	Melanoma(115;540 1606 16325 28853 48167)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1142C	7						.						128.0	107.0	114.0					7																	129663442		2203	4300	6503	129450678	SO:0001583	missense	51530	exon8			AF151050	CCDS34753.1, CCDS64767.1, CCDS75659.1	7q32.2	2013-01-17			ENSG00000091732	ENSG00000091732		"""Zinc fingers, C3HC-type"""	29913	protein-coding gene	gene with protein product	"""nuclear interaction partner of ALK"""					11042152	Standard	XM_005250403		Approved	NIPA	uc003vpi.3	Q86WB0	OTTHUMG00000157648	ENST00000358303.4:c.1142G>C	7.37:g.129663442C>G	ENSP00000351052:p.Ser381Thr	Somatic		Unspecified	Illumina	Phase_I	129450678	NM_016478	A6NH66|Q75MF3|Q75MF4|Q8N330|Q96F75|Q9HA34|Q9NVX4|Q9P0R0	Missense_Mutation	SNP	ENST00000358303.4	37	CCDS34753.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.246124	0.80024	.	.	ENSG00000091732	ENST00000358303;ENST00000311873;ENST00000481503	T;T;T	0.52295	1.13;1.17;0.67	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.64249	0.2581	M	0.64997	1.995	0.54753	D	0.999985	D;D	0.69078	0.997;0.997	D;D	0.65684	0.937;0.931	T	0.57021	-0.7882	10	0.21540	T	0.41	-14.2958	18.2248	0.89914	0.0:1.0:0.0:0.0	.	381;338	Q86WB0;C9J0I9	NIPA_HUMAN;.	T	381;360;338	ENSP00000351052:S381T;ENSP00000309301:S360T;ENSP00000418533:S338T	ENSP00000309301:S360T	S	-	2	0	ZC3HC1	129450678	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	5.412000	0.66392	2.659000	0.90383	0.655000	0.94253	AGC		ZC3HC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349316.1	NM_016478	
GALNTL5	168391	broad.mit.edu	37	7	151699964	151699964	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr7:151699964C>A	ENST00000392800.2	+	6	1078	c.824C>A	c.(823-825)aCt>aAt	p.T275N	GALNTL5_ENST00000483959.1_3'UTR|GALNTL5_ENST00000431418.2_Missense_Mutation_p.T275N	NM_145292.3	NP_660335.2	Q7Z4T8	GLTL5_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 5	275					spermatid development (GO:0007286)	endosome (GO:0005768)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)	p.T275N(1)		NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(11)|ovary(2)|prostate(2)|skin(3)	32	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		GTAAGGGGAACTTTTGATTGG	0.433																																					p.T275N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C824A	7						.						126.0	131.0	129.0					7																	151699964		2203	4300	6503	151330897	SO:0001583	missense	168391	exon6			AF440400	CCDS5929.1	7q36.2	2014-03-13	2014-03-13	2004-07-28	ENSG00000106648	ENSG00000106648		"""Glycosyltransferase family 2 domain containing"""	21725	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 5"""	615133	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5"""	GALNT15			Standard	NM_145292		Approved	GalNAc-T5L	uc003wkp.3	Q7Z4T8	OTTHUMG00000157306	ENST00000392800.2:c.824C>A	7.37:g.151699964C>A	ENSP00000376548:p.Thr275Asn	Somatic		Unspecified	Illumina	Phase_I	151330897	NM_145292	Q75KN2|Q75MD3|Q8NCV4|Q8WW05|Q9UDR9	Missense_Mutation	SNP	ENST00000392800.2	37	CCDS5929.1	.	.	.	.	.	.	.	.	.	.	C	11.66	1.705446	0.30232	.	.	ENSG00000106648	ENST00000431418;ENST00000392800	T;T	0.59083	0.29;0.29	4.83	-1.58	0.08479	Glycosyl transferase, family 2 (1);	0.470425	0.18166	N	0.149631	T	0.27900	0.0687	N	0.03930	-0.32	0.09310	N	1	B;B	0.24576	0.021;0.106	B;B	0.26094	0.032;0.066	T	0.20306	-1.0279	10	0.87932	D	0	.	5.3972	0.16276	0.0:0.3087:0.3462:0.3451	.	26;275	A8MZD3;Q7Z4T8	.;GLTL5_HUMAN	N	275	ENSP00000392582:T275N;ENSP00000376548:T275N	ENSP00000376548:T275N	T	+	2	0	GALNTL5	151330897	1.000000	0.71417	0.000000	0.03702	0.034000	0.12701	3.184000	0.50926	-0.116000	0.11893	-0.142000	0.14014	ACT		GALNTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348395.1	NM_145292	
GLI3	2737	broad.mit.edu	37	7	42004360	42004360	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr7:42004360C>A	ENST00000395925.3	-	15	4395	c.4311G>T	c.(4309-4311)caG>caT	p.Q1437H	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	1437					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q1437H(1)		NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						CAGAGTAATTCTGCAGATTAG	0.512									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																												p.Q1437H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4311T	7						.						65.0	67.0	67.0					7																	42004360		2203	4300	6503	41970885	SO:0001583	missense	2737	exon15	Familial Cancer Database	;		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.4311G>T	7.37:g.42004360C>A	ENSP00000379258:p.Gln1437His	Somatic		Unspecified	Illumina	Phase_I	41970885	NM_000168	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	37	CCDS5465.1	.	.	.	.	.	.	.	.	.	.	C	14.38	2.519604	0.44866	.	.	ENSG00000106571	ENST00000395925	T	0.15372	2.43	5.62	2.71	0.32032	.	0.130576	0.52532	D	0.000079	T	0.20333	0.0489	L	0.49778	1.585	0.80722	D	1	P	0.44478	0.836	P	0.49192	0.602	T	0.01262	-1.1402	10	0.44086	T	0.13	.	6.9724	0.24656	0.0:0.6622:0.1291:0.2086	.	1437	P10071	GLI3_HUMAN	H	1437	ENSP00000379258:Q1437H	ENSP00000379258:Q1437H	Q	-	3	2	GLI3	41970885	1.000000	0.71417	0.994000	0.49952	0.863000	0.49368	1.809000	0.38922	1.360000	0.45960	0.655000	0.94253	CAG		GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168	
ABCB4	5244	broad.mit.edu	37	7	87056200	87056200	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr7:87056200G>C	ENST00000265723.4	-	16	2041	c.1930C>G	c.(1930-1932)Cta>Gta	p.L644V	ABCB4_ENST00000545634.1_Missense_Mutation_p.L644V|ABCB4_ENST00000453593.1_Missense_Mutation_p.L644V|ABCB4_ENST00000358400.3_Missense_Mutation_p.L644V|ABCB4_ENST00000359206.3_Missense_Mutation_p.L644V	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	644	Interaction with HAX1. {ECO:0000250}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)	p.L644V(1)		breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	TCATCATTTAGTTCAAATTCT	0.408																																					p.L644V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1930G	7						.						97.0	94.0	95.0					7																	87056200		2203	4300	6503	86894136	SO:0001583	missense	5244	exon16			M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.1930C>G	7.37:g.87056200G>C	ENSP00000265723:p.Leu644Val	Somatic		Unspecified	Illumina	Phase_I	86894136	NM_018849	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	ENST00000265723.4	37	CCDS5606.1	.	.	.	.	.	.	.	.	.	.	G	0.018	-1.478700	0.01035	.	.	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634	D;D;D;D;D	0.86956	-2.13;-2.19;-2.18;-2.19;-2.13	4.92	1.93	0.25924	.	418.330000	0.00550	U	0.000260	T	0.75693	0.3884	N	0.04508	-0.205	0.09310	N	1	B;B;B	0.14438	0.002;0.007;0.01	B;B;B	0.15484	0.005;0.013;0.004	T	0.63703	-0.6577	10	0.30078	T	0.28	-0.5506	9.585	0.39510	0.2559:0.0:0.7441:0.0	.	644;644;644	A4D1D5;P21439-2;P21439	.;.;MDR3_HUMAN	V	644	ENSP00000352135:L644V;ENSP00000351172:L644V;ENSP00000265723:L644V;ENSP00000392983:L644V;ENSP00000437465:L644V	ENSP00000265723:L644V	L	-	1	2	ABCB4	86894136	0.340000	0.24792	0.024000	0.17045	0.110000	0.19582	0.217000	0.17603	0.674000	0.31244	0.655000	0.94253	CTA		ABCB4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000336083.1	NM_000443	
KMT2C	58508	broad.mit.edu	37	7	151859627	151859627	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr7:151859627C>T	ENST00000262189.6	-	43	11253	c.11035G>A	c.(11035-11037)Gaa>Aaa	p.E3679K	KMT2C_ENST00000355193.2_Missense_Mutation_p.E3679K	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	3679					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.E3679K(2)									TTCTCTAATTCTGTACATAGC	0.493																																					p.E3679K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G11035A	7						.						156.0	159.0	158.0					7																	151859627		2203	4300	6503	151490560	SO:0001583	missense	58508	exon43			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.11035G>A	7.37:g.151859627C>T	ENSP00000262189:p.Glu3679Lys	Somatic		Unspecified	Illumina	Phase_I	151490560	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.34|18.34	3.602253|3.602253	0.66445|0.66445	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000424877|ENST00000360104	D;D;D|.	0.89746|.	-2.16;-1.86;-2.56|.	5.51|5.51	4.62|4.62	0.57501|0.57501	.|.	0.322393|.	0.21103|.	U|.	0.080126|.	T|T	0.72326|0.72326	0.3446|0.3446	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	P;P;P|.	0.39665|.	0.682;0.649;0.649|.	B;B;B|.	0.41510|.	0.197;0.254;0.359|.	T|T	0.72144|0.72144	-0.4379|-0.4379	10|5	0.66056|.	D|.	0.02|.	.|.	16.2171|16.2171	0.82237|0.82237	0.0:0.8669:0.1331:0.0|0.0:0.8669:0.1331:0.0	.|.	3679;2740;3679|.	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3|.	MLL3_HUMAN;.;.|.	K|K	3679;3679;265|1184	ENSP00000262189:E3679K;ENSP00000347325:E3679K;ENSP00000410411:E265K|.	ENSP00000262189:E3679K|.	E|R	-|-	1|2	0|0	MLL3|MLL3	151490560|151490560	1.000000|1.000000	0.71417|0.71417	0.004000|0.004000	0.12327|0.12327	0.007000|0.007000	0.05969|0.05969	5.597000|5.597000	0.67577|0.67577	1.289000|1.289000	0.44618|0.44618	0.650000|0.650000	0.86243|0.86243	GAA|AGA		KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
PIGU	128869	broad.mit.edu	37	20	33173278	33173278	+	Missense_Mutation	SNP	C	C	T	rs577900938		TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr20:33173278C>T	ENST00000374820.2	-	8	849	c.829G>A	c.(829-831)Gtc>Atc	p.V277I	PIGU_ENST00000480175.1_Intron|PIGU_ENST00000452740.2_Missense_Mutation_p.V297I			Q9H490	PIGU_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class U	297	May be involved in recognition of long- chain fatty acids in GPI.				attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|regulation of JAK-STAT cascade (GO:0046425)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.V297I(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	9						TAGAAGAAGACGTTGATCTGA	0.468													C|||	1	0.000199681	0.0	0.0014	5008	,	,		20586	0.0		0.0	False		,,,				2504	0.0				p.V297I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G889A	20						.						161.0	150.0	154.0					20																	33173278		2203	4300	6503	32636939	SO:0001583	missense	128869	exon9			AL118520	CCDS13239.1	20q11.22	2013-02-26	2006-11-07	2006-11-07	ENSG00000101464	ENSG00000101464		"""Phosphatidylinositol glycan anchor biosynthesis"""	15791	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	608528	"""CDC91 (cell division cycle 91, S. cerevisiae, homolog)-like 1"", ""CDC91 cell division cycle 91-like 1 (S. cerevisiae)"""	CDC91L1		12802054, 15034568	Standard	NM_080476		Approved	bA346K17.2, GAB1	uc002xas.3	Q9H490	OTTHUMG00000032304	ENST00000374820.2:c.829G>A	20.37:g.33173278C>T	ENSP00000363953:p.Val277Ile	Somatic		Unspecified	Illumina	Phase_I	32636939	NM_080476	Q7Z489|Q8N2F2	Missense_Mutation	SNP	ENST00000374820.2	37		.	.	.	.	.	.	.	.	.	.	C	18.99	3.740470	0.69304	.	.	ENSG00000101464	ENST00000217446;ENST00000374820;ENST00000452740;ENST00000438215	.	.	.	5.37	1.3	0.21679	.	0.059218	0.64402	N	0.000003	T	0.48095	0.1481	N	0.21545	0.675	0.53688	D	0.999972	B;B;D	0.71674	0.009;0.043;0.998	B;B;P	0.62014	0.011;0.008;0.897	T	0.30679	-0.9970	9	0.13108	T	0.6	.	9.8215	0.40885	0.0:0.7224:0.0:0.2776	.	297;277;297	E7EVL4;Q9H490-2;Q9H490	.;.;PIGU_HUMAN	I	297;277;297;43	.	ENSP00000217446:V297I	V	-	1	0	PIGU	32636939	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	4.562000	0.60816	0.021000	0.15133	-0.136000	0.14681	GTC		PIGU-201	KNOWN	basic	protein_coding	protein_coding		NM_080476	
SRMS	6725	broad.mit.edu	37	20	62173557	62173557	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr20:62173557G>A	ENST00000217188.1	-	5	945	c.905C>T	c.(904-906)aCg>aTg	p.T302M		NM_080823.2	NP_543013.1	Q9H3Y6	SRMS_HUMAN	src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites	302	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				peptidyl-tyrosine autophosphorylation (GO:0038083)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.T302M(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|prostate(2)|stomach(1)	19	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			CATGAGTTCCGTGACGATGTA	0.682																																					p.T302M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C905T	20						.						97.0	76.0	83.0					20																	62173557		2199	4300	6499	61644001	SO:0001583	missense	6725	exon5				CCDS13525.1	20q13.33	2013-02-14	2003-08-22		ENSG00000125508	ENSG00000125508		"""SH2 domain containing"""	11298	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 148"""	C20orf148		7935409	Standard	NM_080823		Approved	SRM, dJ697K14.1	uc002yfi.1	Q9H3Y6	OTTHUMG00000032977	ENST00000217188.1:c.905C>T	20.37:g.62173557G>A	ENSP00000217188:p.Thr302Met	Somatic		Unspecified	Illumina	Phase_I	61644001	NM_080823		Missense_Mutation	SNP	ENST00000217188.1	37	CCDS13525.1	.	.	.	.	.	.	.	.	.	.	G	17.21	3.332161	0.60853	.	.	ENSG00000125508	ENST00000217188	T	0.09723	2.95	4.62	3.66	0.41972	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000019	T	0.17789	0.0427	N	0.16708	0.43	0.49687	D	0.999814	D	0.89917	1.0	D	0.97110	1.0	T	0.03524	-1.1028	10	0.87932	D	0	.	12.6783	0.56908	0.0829:0.0:0.9171:0.0	.	302	Q9H3Y6	SRMS_HUMAN	M	302	ENSP00000217188:T302M	ENSP00000217188:T302M	T	-	2	0	SRMS	61644001	1.000000	0.71417	0.945000	0.38365	0.232000	0.25224	7.570000	0.82390	0.928000	0.37168	0.561000	0.74099	ACG		SRMS-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080148.1	NM_080823	
OR4K1	79544	broad.mit.edu	37	14	20404494	20404494	+	Silent	SNP	C	C	T	rs141997601		TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr14:20404494C>T	ENST00000285600.4	+	1	728	c.669C>T	c.(667-669)atC>atT	p.I223I		NM_001004063.2	NP_001004063.2	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K, member 1	223						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I223I(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(24)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		TCATTTTGATCGGTGTCCGAT	0.423													C|||	1	0.000199681	0.0	0.0	5008	,	,		29108	0.001		0.0	False		,,,				2504	0.0				p.I223I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C669T	14						.						124.0	119.0	121.0					14																	20404494		2203	4300	6503	19474334	SO:0001819	synonymous_variant	79544	exon1				CCDS32025.1	14q11.2	2013-09-23			ENSG00000155249	ENSG00000155249		"""GPCR / Class A : Olfactory receptors"""	14726	protein-coding gene	gene with protein product							Standard	NM_001004063		Approved		uc001vwj.2	Q8NGD4	OTTHUMG00000170633	ENST00000285600.4:c.669C>T	14.37:g.20404494C>T		Somatic		Unspecified	Illumina	Phase_I	19474334	NM_001004063	B9EKV9|Q8NGD6|Q96R73	Silent	SNP	ENST00000285600.4	37	CCDS32025.1																																																																																				OR4K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409881.1		
DHRS4	10901	broad.mit.edu	37	14	24423018	24423018	+	Silent	SNP	A	A	T			TCGA-AG-A036-01	TCGA-AG-A036-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr14:24423018A>T	ENST00000313250.5	+	1	224	c.21A>T	c.(19-21)ctA>ctT	p.L7L	DHRS4_ENST00000382761.3_De_novo_Start_OutOfFrame|DHRS4_ENST00000397074.3_Silent_p.L7L|DHRS4_ENST00000308178.8_De_novo_Start_OutOfFrame|DHRS4_ENST00000558581.1_Silent_p.L7L|DHRS4-AS1_ENST00000556379.1_RNA|DHRS4_ENST00000543741.2_Silent_p.L7L|DHRS4_ENST00000559632.1_Silent_p.L7L|DHRS4_ENST00000397073.2_De_novo_Start_OutOfFrame|DHRS4_ENST00000421831.1_De_novo_Start_OutOfFrame|DHRS4_ENST00000397075.3_Silent_p.L7L|DHRS4_ENST00000558263.1_Silent_p.L7L	NM_021004.2	NP_066284.2	Q9BTZ2	DHRS4_HUMAN	dehydrogenase/reductase (SDR family) member 4	7					alcohol metabolic process (GO:0006066)|cellular ketone metabolic process (GO:0042180)|oxidation-reduction process (GO:0055114)|protein tetramerization (GO:0051262)|steroid metabolic process (GO:0008202)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	3-keto sterol reductase activity (GO:0000253)|alcohol dehydrogenase [NAD(P)+] activity (GO:0018455)|carbonyl reductase (NADPH) activity (GO:0004090)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|receptor binding (GO:0005102)	p.L7L(1)		central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14				GBM - Glioblastoma multiforme(265;0.00962)	Vitamin A(DB00162)	CGGGGCTGCTAGGCCTCTGTG	0.662																																					p.L7L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A21T	14						.						49.0	53.0	52.0					14																	24423018		2203	4300	6503	23492858	SO:0001819	synonymous_variant	10901	exon1			AF044127	CCDS9605.1, CCDS61408.1, CCDS61409.1, CCDS61410.1, CCDS61411.1, CCDS61412.1	14q11.2	2013-06-14			ENSG00000157326	ENSG00000157326	1.1.1.184	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	16985	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 25C, member 2"""	611596				10333503, 19027726	Standard	NM_021004		Approved	SCAD-SRL, SDR-SRL, humNRDR, FLJ11008, SDR25C2	uc001wla.3	Q9BTZ2	OTTHUMG00000028777	ENST00000313250.5:c.21A>T	14.37:g.24423018A>T		Somatic		Unspecified	Illumina	Phase_I	23492858	NM_021004	B2RB10|B7WNS9|D3YTB8|E2QRL8|O95162|Q20CR0|Q2LC19|Q2LE81|Q58IU4|Q6E0Y1|Q6UWU3|Q71UQ6|Q8TD03|Q9H3N5|Q9NV08	Silent	SNP	ENST00000313250.5	37	CCDS9605.1																																																																																				DHRS4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071857.3		
PRKD1	5587	broad.mit.edu	37	14	30396523	30396525	+	In_Frame_Del	DEL	GCA	GCA	-			TCGA-AG-A036-01	TCGA-AG-A036-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr14:30396523_30396525delGCA	ENST00000331968.5	-	1	423_425	c.194_196delTGC	c.(193-198)ctgcag>cag	p.L65del	PRKD1_ENST00000415220.2_In_Frame_Del_p.L65del	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	65					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.L65delL(2)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		GACGAGTCCTGCAGCAGCAGCAC	0.709																																					p.65_66del												.	.	2	Deletion - In frame(2)	large_intestine(2)	c.194_196del	14						.																																			29466276	SO:0001651	inframe_deletion	5587	exon1				CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.194_196delTGC	14.37:g.30396532_30396534delGCA	ENSP00000333568:p.Leu65del	Somatic		Unspecified	Illumina	Phase_I	29466274	NM_002742	A6NL64|B2RAF6	In_Frame_Del	DEL	ENST00000331968.5	37	CCDS9637.1																																																																																				PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276611.2	NM_002742	
EIF2B2	8892	broad.mit.edu	37	14	75470009	75470010	+	Missense_Mutation	DNP	CA	CA	GT			TCGA-AG-A036-01	TCGA-AG-A036-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr14:75470009_75470010CA>GT	ENST00000266126.5	+	2	275_276	c.195_196CA>GT	c.(193-198)ggCAgg>ggGTgg	p.R66W	RP11-950C14.3_ENST00000554430.1_RNA	NM_014239.3	NP_055054.1	P49770	EI2BB_HUMAN	eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa	66					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|central nervous system development (GO:0007417)|gene expression (GO:0010467)|myelination (GO:0042552)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|regulation of translational initiation (GO:0006446)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|translation initiation factor activity (GO:0003743)	p.G65>?(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(234;0.00661)		GCAGAGAGGGCAGGAGGATGAC	0.594																																					.												.	.	1	Complex(1)	large_intestine(1)	c.195_196GT	14						.																																			74539763	SO:0001583	missense	8892	exon2				CCDS9836.1	14q24.3	2008-08-11	2002-08-29			ENSG00000119718			3258	protein-coding gene	gene with protein product		606454	"""eukaryotic translation initiation factor 2B, subunit 2 (beta, 39kD)"""			8887689	Standard	NM_014239		Approved	EIF2B, EIF-2Bbeta	uc001xrc.2	P49770		Exception_encountered	14.37:g.75470009_75470010delinsGT	ENSP00000266126:p.Arg66Trp	Somatic		Unspecified	Illumina	Phase_I	74539762	NM_014239	O43201	Missense_Mutation	DNP	ENST00000266126.5	37	CCDS9836.1																																																																																				EIF2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414993.1	NM_014239	
GCAT	23464	broad.mit.edu	37	22	38212307	38212307	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr22:38212307G>A	ENST00000248924.6	+	8	1143	c.1087G>A	c.(1087-1089)Gcg>Acg	p.A363T	GCAT_ENST00000323205.6_Missense_Mutation_p.A389T	NM_014291.3	NP_055106.1	O75600	KBL_HUMAN	glycine C-acetyltransferase	363					biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)|L-threonine catabolic process to glycine (GO:0019518)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	glycine C-acetyltransferase activity (GO:0008890)|pyridoxal phosphate binding (GO:0030170)	p.A363T(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|skin(1)	12	Melanoma(58;0.045)				Glycine(DB00145)	CTCTCGCATGGCGGATGACAT	0.582																																					p.A363T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1087A	22						.						53.0	47.0	49.0					22																	38212307		2203	4300	6503	36542253	SO:0001583	missense	23464	exon8			AF077740	CCDS13957.1, CCDS54527.1	22q13.1	2010-01-19	2010-01-19		ENSG00000100116	ENSG00000100116	2.3.1.29		4188	protein-coding gene	gene with protein product	"""2-amino-3-ketobutyrate coenzyme A ligase"""	607422	"""glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase)"""				Standard	NM_014291		Approved	KBL	uc003aua.2	O75600	OTTHUMG00000150664	ENST00000248924.6:c.1087G>A	22.37:g.38212307G>A	ENSP00000248924:p.Ala363Thr	Somatic		Unspecified	Illumina	Phase_I	36542253	NM_014291	E2QC23|Q6ZWF1|Q96CA9	Missense_Mutation	SNP	ENST00000248924.6	37	CCDS13957.1	.	.	.	.	.	.	.	.	.	.	G	35	5.413965	0.96072	.	.	ENSG00000100116	ENST00000323205;ENST00000248924	D;D	0.91124	-2.79;-2.79	4.92	4.92	0.64577	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.95655	0.8587	M	0.83603	2.65	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.996;0.997	D	0.96127	0.9089	10	0.87932	D	0	-13.888	18.2955	0.90145	0.0:0.0:1.0:0.0	.	389;363	E2QC23;O75600	.;KBL_HUMAN	T	389;363	ENSP00000371110:A389T;ENSP00000248924:A363T	ENSP00000248924:A363T	A	+	1	0	GCAT	36542253	1.000000	0.71417	0.985000	0.45067	0.970000	0.65996	8.955000	0.93058	2.576000	0.86940	0.561000	0.74099	GCG		GCAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319506.1	NM_014291.2	
URI1	8725	broad.mit.edu	37	19	30502021	30502021	+	Silent	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr19:30502021G>A	ENST00000542441.2	+	9	1353	c.1056G>A	c.(1054-1056)aaG>aaA	p.K352K	URI1_ENST00000360605.4_Silent_p.K334K|URI1_ENST00000312051.6_Silent_p.K312K|URI1_ENST00000392271.1_Silent_p.K276K			O94763	RMP_HUMAN	URI1, prefoldin-like chaperone	352					cellular response to growth factor stimulus (GO:0071363)|cellular response to steroid hormone stimulus (GO:0071383)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of phosphatase activity (GO:0010923)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to virus (GO:0009615)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	chromatin binding (GO:0003682)|protein phosphatase inhibitor activity (GO:0004864)|RNA polymerase II transcription corepressor activity (GO:0001106)	p.K352K(1)									ATACTGGAAAGAATACCACTT	0.363																																					p.K352K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1056A	19						.						55.0	60.0	59.0					19																	30502021		2203	4300	6503	35193861	SO:0001819	synonymous_variant	8725	exon9			AF091095	CCDS12420.1, CCDS58658.1	19q12	2012-04-17	2011-11-21	2011-11-21	ENSG00000105176	ENSG00000105176		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	13236	protein-coding gene	gene with protein product	"""unconventional prefoldin RPB5 interactor"", ""RPB5-mediating protein"", ""protein phosphatase 1, regulatory subunit 19"""	603494	"""chromosome 19 open reading frame 2"""	C19orf2		9878255, 9819440	Standard	NM_003796		Approved	RMP, NNX3, FLJ10575, URI, PPP1R19	uc002nsr.3	O94763		ENST00000542441.2:c.1056G>A	19.37:g.30502021G>A		Somatic		Unspecified	Illumina	Phase_I	35193861	NM_003796	A8K805|H7BY42|Q8TC23|Q9UNU3	Silent	SNP	ENST00000542441.2	37	CCDS12420.1																																																																																				URI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439756.1	NM_134447	
UPK1A	11045	broad.mit.edu	37	19	36164423	36164423	+	Silent	SNP	C	C	T			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr19:36164423C>T	ENST00000222275.2	+	4	444	c.444C>T	c.(442-444)cgC>cgT	p.R148R	UPK1A_ENST00000379013.2_Silent_p.R148R|UPK1A-AS1_ENST00000443196.1_RNA	NM_007000.2	NP_008931.1	O00322	UPK1A_HUMAN	uroplakin 1A	148					epithelial cell differentiation (GO:0030855)|protein oligomerization (GO:0051259)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	monosaccharide binding (GO:0048029)|protein homodimerization activity (GO:0042803)	p.R148R(1)		breast(1)|large_intestine(4)|lung(2)|stomach(2)	9	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			AGCTGACCCGCCTCTGGGACC	0.647																																					p.R148R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C444T	19						.						26.0	27.0	27.0					19																	36164423		2195	4293	6488	40856263	SO:0001819	synonymous_variant	11045	exon4			AF085807	CCDS12470.1, CCDS62640.1	19q13.1	2013-02-14			ENSG00000105668	ENSG00000105668		"""Tetraspanins"""	12577	protein-coding gene	gene with protein product		611557				9846985, 10404304	Standard	NM_007000		Approved	TSPAN21	uc002oaw.3	O00322	OTTHUMG00000048115	ENST00000222275.2:c.444C>T	19.37:g.36164423C>T		Somatic		Unspecified	Illumina	Phase_I	40856263	NM_007000	Q3KNU5|Q3KNU6	Silent	SNP	ENST00000222275.2	37	CCDS12470.1																																																																																				UPK1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109486.3		
ACTN4	81	broad.mit.edu	37	19	39212269	39212269	+	Silent	SNP	C	C	T			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr19:39212269C>T	ENST00000252699.2	+	12	1459	c.1383C>T	c.(1381-1383)agC>agT	p.S461S	ACTN4_ENST00000424234.2_Intron|ACTN4_ENST00000390009.3_Silent_p.S242S	NM_004924.4	NP_004915.2	O43707	ACTN4_HUMAN	actinin, alpha 4	461					actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cellular component movement (GO:0051272)|positive regulation of pinocytosis (GO:0048549)|positive regulation of sodium:proton antiporter activity (GO:0032417)|protein localization to tight junction (GO:1902396)|protein transport (GO:0015031)|regulation of apoptotic process (GO:0042981)|response to hypoxia (GO:0001666)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|protein complex (GO:0043234)|pseudopodium (GO:0031143)|ribonucleoprotein complex (GO:0030529)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|nucleoside binding (GO:0001882)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.S461S(1)		NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|urinary_tract(3)	30	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CCTTCGAGAGCGACCTGGCTG	0.612																																					p.S461S	Colon(168;199 1940 10254 46213 46384)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1383T	19						.						115.0	88.0	98.0					19																	39212269		2203	4300	6503	43904109	SO:0001819	synonymous_variant	81	exon12			D89980	CCDS12518.1	19q13	2013-01-10			ENSG00000130402	ENSG00000130402		"""EF-hand domain containing"""	166	protein-coding gene	gene with protein product		604638	"""focal segmental glomerulosclerosis 1"""	FSGS1		9461087, 10700177	Standard	NM_004924		Approved		uc002oja.2	O43707	OTTHUMG00000137382	ENST00000252699.2:c.1383C>T	19.37:g.39212269C>T		Somatic		Unspecified	Illumina	Phase_I	43904109	NM_004924	A4K467|D6PXK4|O76048	Silent	SNP	ENST00000252699.2	37	CCDS12518.1																																																																																				ACTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268091.1		
ZNF285	26974	broad.mit.edu	37	19	44891946	44891946	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A036-01	TCGA-AG-A036-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr19:44891946T>C	ENST00000330997.4	-	4	525	c.461A>G	c.(460-462)aAc>aGc	p.N154S	ZNF285_ENST00000591679.1_Missense_Mutation_p.N161S|ZNF285_ENST00000544719.2_Missense_Mutation_p.N154S|CTC-512J12.6_ENST00000588212.1_Intron	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	154					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.N154S(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						GGTCATTATGTTGGCTTTCCT	0.428																																					p.N154S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A461G	19						.						88.0	88.0	88.0					19																	44891946		2201	4297	6498	49583786	SO:0001583	missense	26974	exon4			AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.461A>G	19.37:g.44891946T>C	ENSP00000333595:p.Asn154Ser	Somatic		Unspecified	Illumina	Phase_I	49583786	NM_152354	Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	ENST00000330997.4	37	CCDS12638.1	.	.	.	.	.	.	.	.	.	.	T	1.358	-0.589579	0.03799	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T	0.05382	3.45	2.52	-5.04	0.02964	.	.	.	.	.	T	0.02610	0.0079	N	0.14661	0.345	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.06405	0.002;0.002	T	0.43228	-0.9404	9	0.15066	T	0.55	.	2.4255	0.04458	0.1317:0.4068:0.2656:0.1958	.	178;154	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	S	177;154	ENSP00000333595:N154S	ENSP00000333595:N154S	N	-	2	0	ZNF285	49583786	0.000000	0.05858	0.000000	0.03702	0.113000	0.19764	-4.122000	0.00290	-2.502000	0.00509	0.248000	0.18094	AAC		ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	
MUC16	94025	broad.mit.edu	37	19	9086657	9086657	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A036-01	TCGA-AG-A036-01	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr19:9086657T>G	ENST00000397910.4	-	1	5361	c.5158A>C	c.(5158-5160)Agc>Cgc	p.S1720R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1720	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S1720R(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGCCTTGGGCTGCTTCCCTTA	0.493																																					p.S1720R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A5158C	19						.						156.0	146.0	149.0					19																	9086657		1977	4179	6156	8947657	SO:0001583	missense	94025	exon1			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.5158A>C	19.37:g.9086657T>G	ENSP00000381008:p.Ser1720Arg	Somatic		Unspecified	Illumina	Phase_I	8947657	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	3.819	-0.038222	0.07497	.	.	ENSG00000181143	ENST00000397910	T	0.02656	4.21	1.33	1.33	0.21861	.	.	.	.	.	T	0.01695	0.0054	N	0.08118	0	.	.	.	B	0.13594	0.008	B	0.06405	0.002	T	0.32877	-0.9890	8	0.87932	D	0	.	4.7934	0.13259	0.0:0.0:0.0:1.0	.	1720	B5ME49	.	R	1720	ENSP00000381008:S1720R	ENSP00000381008:S1720R	S	-	1	0	MUC16	8947657	0.017000	0.18338	0.003000	0.11579	0.119000	0.20118	0.669000	0.25142	0.838000	0.34948	0.260000	0.18958	AGC		MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF583	147949	broad.mit.edu	37	19	56935268	56935268	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr19:56935268G>A	ENST00000333201.9	+	5	1451	c.1241G>A	c.(1240-1242)aGg>aAg	p.R414K	ZNF583_ENST00000291598.7_Missense_Mutation_p.R414K|ZNF583_ENST00000585612.1_Intron	NM_001159861.1|NM_152478.2	NP_001153333.1|NP_689691.2	Q96ND8	ZN583_HUMAN	zinc finger protein 583	414					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R414K(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0564)		AAAGTATGTAGGAAAGCCTTC	0.408																																					p.R414K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1241A	19						.						62.0	65.0	64.0					19																	56935268		2203	4300	6503	61627080	SO:0001583	missense	147949	exon5			AK055592	CCDS12943.1	19q13.43	2013-09-20			ENSG00000198440	ENSG00000198440		"""Zinc fingers, C2H2-type"", ""-"""	26427	protein-coding gene	gene with protein product							Standard	NM_152478		Approved	FLJ31030	uc010ygl.1	Q96ND8	OTTHUMG00000168874	ENST00000333201.9:c.1241G>A	19.37:g.56935268G>A	ENSP00000388502:p.Arg414Lys	Somatic		Unspecified	Illumina	Phase_I	61627080	NM_001159860	O14850|Q2NKK3	Missense_Mutation	SNP	ENST00000333201.9	37	CCDS12943.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.803319	0.90623	.	.	ENSG00000198440	ENST00000291598;ENST00000333201	T;T	0.13307	2.6;2.6	4.57	4.57	0.56435	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.160951	0.30392	N	0.009732	T	0.09862	0.0242	N	0.16098	0.37	0.36646	D	0.877133	B	0.25048	0.117	B	0.28916	0.096	T	0.27971	-1.0058	9	.	.	.	.	16.6374	0.85062	0.0:0.0:1.0:0.0	.	414	Q96ND8	ZN583_HUMAN	K	414	ENSP00000291598:R414K;ENSP00000388502:R414K	.	R	+	2	0	ZNF583	61627080	0.999000	0.42202	0.006000	0.13384	0.998000	0.95712	6.239000	0.72356	2.542000	0.85734	0.563000	0.77884	AGG		ZNF583-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401453.1	NM_152478	
TRPS1	7227	broad.mit.edu	37	8	116632238	116632238	+	Silent	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr8:116632238G>A	ENST00000220888.5	-	2	207	c.48C>T	c.(46-48)ggC>ggT	p.G16G	TRPS1_ENST00000519674.1_Silent_p.G16G|TRPS1_ENST00000520276.1_Silent_p.G20G|TRPS1_ENST00000395715.3_Silent_p.G29G|TRPS1_ENST00000519076.1_Silent_p.G16G			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	16					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.G16G(1)		autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			TCTGGCCCTCGCCTTCACTTG	0.438									Langer-Giedion syndrome																												p.G29G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C87T	8						.						80.0	74.0	76.0					8																	116632238		1840	4095	5935	116701413	SO:0001819	synonymous_variant	7227	exon3	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.48C>T	8.37:g.116632238G>A		Somatic		Unspecified	Illumina	Phase_I	116701413	NM_014112	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Silent	SNP	ENST00000220888.5	37																																																																																					TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	
TNFRSF10B	8795	broad.mit.edu	37	8	22887136	22887136	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A036-01	TCGA-AG-A036-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr8:22887136T>C	ENST00000276431.4	-	4	747	c.463A>G	c.(463-465)Aag>Gag	p.K155E	TNFRSF10B_ENST00000519910.1_5'UTR|TNFRSF10B_ENST00000347739.3_Missense_Mutation_p.K155E|TNFRSF10B_ENST00000542226.1_Missense_Mutation_p.K4E	NM_003842.4|NM_147187.2	NP_003833.4|NP_671716.2	O14763	TR10B_HUMAN	tumor necrosis factor receptor superfamily, member 10b	155					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell surface receptor signaling pathway (GO:0007166)|cellular response to mechanical stimulus (GO:0071260)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of apoptotic process (GO:0042981)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to endoplasmic reticulum stress (GO:0034976)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|TRAIL binding (GO:0045569)	p.K155E(1)		NS(1)|endometrium(2)|large_intestine(7)|liver(1)|lung(3)|skin(1)	15		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0179)|COAD - Colon adenocarcinoma(73;0.0703)		GTGCGGCACTTCCGGCACATC	0.582																																					p.K155E	GBM(94;1064 1342 1839 21060 42553)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A463G	8						.						50.0	42.0	44.0					8																	22887136		2203	4300	6503	22943081	SO:0001583	missense	8795	exon4			AF012628	CCDS6035.1, CCDS6036.1	8p22-p21	2006-02-22			ENSG00000120889	ENSG00000120889		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11905	protein-coding gene	gene with protein product		603612				9285725, 9311998	Standard	NM_003842		Approved	DR5, KILLER, TRICK2A, TRAIL-R2, TRICKB, CD262	uc003xcu.2	O14763	OTTHUMG00000097826	ENST00000276431.4:c.463A>G	8.37:g.22887136T>C	ENSP00000276431:p.Lys155Glu	Somatic		Unspecified	Illumina	Phase_I	22943081	NM_003842	O14720|O15508|O15517|O15531|Q6UXM8|Q7Z360|Q9BVE0	Missense_Mutation	SNP	ENST00000276431.4	37	CCDS6035.1	.	.	.	.	.	.	.	.	.	.	t	13.86	2.363787	0.41902	.	.	ENSG00000120889	ENST00000276431;ENST00000347739;ENST00000542226	T;T;T	0.30182	1.54;1.54;1.54	3.93	-4.63	0.03359	TNFR/CD27/30/40/95 cysteine-rich region (3);	0.566743	0.16675	U	0.204186	T	0.34716	0.0907	M	0.69248	2.105	0.09310	N	1	P;P;D;P	0.61697	0.787;0.597;0.99;0.589	B;B;P;B	0.58970	0.219;0.363;0.849;0.41	T	0.15435	-1.0437	10	0.30854	T	0.27	.	2.8066	0.05429	0.1524:0.0992:0.4675:0.281	.	4;155;155;155	B7Z588;B5BU36;O14763;O14763-2	.;.;TR10B_HUMAN;.	E	155;155;4	ENSP00000276431:K155E;ENSP00000317859:K155E;ENSP00000443386:K4E	ENSP00000276431:K155E	K	-	1	0	TNFRSF10B	22943081	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.186000	0.09670	-0.957000	0.03627	-1.117000	0.02048	AAG		TNFRSF10B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000215099.2	NM_147187	
SULF1	23213	broad.mit.edu	37	8	70541873	70541873	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr8:70541873C>T	ENST00000260128.4	+	19	2960	c.2243C>T	c.(2242-2244)aCg>aTg	p.T748M	SULF1_ENST00000521946.1_3'UTR|SULF1_ENST00000419716.3_Missense_Mutation_p.T748M|SULF1_ENST00000402687.4_Missense_Mutation_p.T748M|SULF1_ENST00000458141.2_Missense_Mutation_p.T748M	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	748					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)	p.T748M(1)		breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			ACTTGCTTCACGCATGACAAC	0.547																																					p.T748M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2243T	8						.						140.0	125.0	130.0					8																	70541873		2203	4300	6503	70704427	SO:0001583	missense	23213	exon19			AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.2243C>T	8.37:g.70541873C>T	ENSP00000260128:p.Thr748Met	Somatic		Unspecified	Illumina	Phase_I	70704427	NM_001128205	Q86YV8|Q8NCA2|Q9UPS5	De_novo_Start_OutOfFrame	SNP	ENST00000260128.4	37	CCDS6204.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.742611	0.89573	.	.	ENSG00000137573	ENST00000458141;ENST00000260128;ENST00000402687;ENST00000419716	T;T;T;T	0.15139	2.45;2.45;2.45;2.45	4.75	4.75	0.60458	Alkaline-phosphatase-like, core domain (1);	0.106709	0.64402	D	0.000005	T	0.41419	0.1158	M	0.80422	2.495	0.80722	D	1	D	0.89917	1.0	P	0.59288	0.855	T	0.42565	-0.9444	10	0.54805	T	0.06	.	17.9404	0.89025	0.0:1.0:0.0:0.0	.	748	Q8IWU6	SULF1_HUMAN	M	748	ENSP00000403040:T748M;ENSP00000260128:T748M;ENSP00000385704:T748M;ENSP00000390315:T748M	ENSP00000260128:T748M	T	+	2	0	SULF1	70704427	1.000000	0.71417	0.959000	0.39883	0.906000	0.53458	7.622000	0.83099	2.440000	0.82611	0.655000	0.94253	ACG		SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378885.2	NM_015170	
RDH10	157506	broad.mit.edu	37	8	74233228	74233228	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A036-01	TCGA-AG-A036-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr8:74233228A>G	ENST00000240285.5	+	4	1364	c.686A>G	c.(685-687)aAg>aGg	p.K229R	RP11-434I12.2_ENST00000514599.1_RNA|RP11-434I12.2_ENST00000517475.1_RNA|RDH10_ENST00000519380.1_Missense_Mutation_p.K64R	NM_172037.4	NP_742034.1	Q8IZV5	RDH10_HUMAN	retinol dehydrogenase 10 (all-trans)	229					bud elongation involved in lung branching (GO:0060449)|ear development (GO:0043583)|embryonic camera-type eye development (GO:0031076)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|gonad development (GO:0008406)|in utero embryonic development (GO:0001701)|metanephros development (GO:0001656)|neural crest cell development (GO:0014032)|nose development (GO:0043584)|phototransduction, visible light (GO:0007603)|primary lung bud formation (GO:0060431)|retinal metabolic process (GO:0042574)|retinoic acid biosynthetic process (GO:0002138)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)	cell body (GO:0044297)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	NADP-retinol dehydrogenase activity (GO:0052650)|retinol dehydrogenase activity (GO:0004745)	p.K229R(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(5)|skin(1)	11	Breast(64;0.0954)		Epithelial(68;0.0105)|all cancers(69;0.0465)|BRCA - Breast invasive adenocarcinoma(89;0.0608)			CATGAACTAAAGGCTGCTGAA	0.428																																					p.K229R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A686G	8						.						141.0	133.0	136.0					8																	74233228		2203	4300	6503	74395782	SO:0001583	missense	157506	exon4			AF456765	CCDS6213.1	8q21.11	2011-09-20			ENSG00000121039	ENSG00000121039	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	19975	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 16C, member 4"""	607599				12407145, 19027726	Standard	NM_172037		Approved	SDR16C4	uc003xzi.3	Q8IZV5	OTTHUMG00000164492	ENST00000240285.5:c.686A>G	8.37:g.74233228A>G	ENSP00000240285:p.Lys229Arg	Somatic		Unspecified	Illumina	Phase_I	74395782	NM_172037		Missense_Mutation	SNP	ENST00000240285.5	37	CCDS6213.1	.	.	.	.	.	.	.	.	.	.	A	13.64	2.296936	0.40594	.	.	ENSG00000121039	ENST00000240285;ENST00000519380	D;T	0.89415	-2.51;0.74	5.43	5.43	0.79202	NAD(P)-binding domain (1);	0.090755	0.85682	D	0.000000	T	0.75576	0.3868	N	0.04724	-0.175	0.53005	D	0.99996	B	0.17667	0.023	B	0.19391	0.025	T	0.71391	-0.4607	10	0.02654	T	1	.	15.6454	0.77046	1.0:0.0:0.0:0.0	.	229	Q8IZV5	RDH10_HUMAN	R	229;64	ENSP00000240285:K229R;ENSP00000428132:K64R	ENSP00000240285:K229R	K	+	2	0	RDH10	74395782	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.319000	0.59197	2.279000	0.76181	0.533000	0.62120	AAG		RDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378982.1		
HEY1	23462	broad.mit.edu	37	8	80677423	80677423	+	Nonstop_Mutation	SNP	T	T	G			TCGA-AG-A036-01	TCGA-AG-A036-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr8:80677423T>G	ENST00000354724.3	-	5	1114	c.915A>C	c.(913-915)taA>taC	p.*305Y	HEY1_ENST00000435063.2_5'UTR|HEY1_ENST00000523976.1_Nonstop_Mutation_p.*215Y|HEY1_ENST00000337919.5_Nonstop_Mutation_p.*309Y|RP11-27N21.3_ENST00000607172.1_lincRNA	NM_012258.3	NP_036390.3	Q9Y5J3	HEY1_HUMAN	hes-related family bHLH transcription factor with YRPW motif 1	0					angiogenesis (GO:0001525)|anterior/posterior axis specification (GO:0009948)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular valve formation (GO:0003190)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac septum morphogenesis (GO:0060411)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to glucocorticoid stimulus (GO:0071385)|dorsal aorta morphogenesis (GO:0035912)|endocardial cushion morphogenesis (GO:0003203)|endocardial cushion to mesenchymal transition involved in heart valve formation (GO:0003199)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000820)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve morphogenesis (GO:0003184)|regulation of vasculogenesis (GO:2001212)|transcription from RNA polymerase II promoter (GO:0006366)|umbilical cord morphogenesis (GO:0036304)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.*305Y(1)	HEY1/NCOA2(10)	cervix(1)|kidney(2)|large_intestine(5)|lung(14)	22	all_lung(9;5.1e-05)		Epithelial(68;0.076)|all cancers(69;0.179)			CATCAGTTCTTTAAAAAGCTC	0.483			T	NCOA2	mesenchymal chondrosarcoma						OREG0018837	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.X305Y			Dom	yes		8	8q21	23462	hairy/enhancer-of-split related with YRPW motif 1		M	.	.	1	Nonstop extension(1)	large_intestine(1)	c.A915C	8						.						31.0	28.0	29.0					8																	80677423		2066	4072	6138	80839978	SO:0001578	stop_lost	23462	exon5			AF151522	CCDS6225.1, CCDS43749.1, CCDS64915.1	8q21	2013-10-17	2013-10-17					"""Basic helix-loop-helix proteins"""	4880	protein-coding gene	gene with protein product		602953	"""hairy/enhancer-of-split related with YRPW motif 1"""			10415358, 10403790	Standard	NM_001040708		Approved	HESR-1, CHF2, HESR1, HRT-1, CHF-2, HERP2, BHLHb31	uc003ybl.3	Q9Y5J3		ENST00000354724.3:c.915A>C	8.37:g.80677423T>G		Somatic	1200	Unspecified	Illumina	Phase_I	80839978	NM_012258	B2R883|Q5TZS3|Q8NAM2|Q9NYP4	Read-through	SNP	ENST00000354724.3	37	CCDS6225.1	.	.	.	.	.	.	.	.	.	.	T	14.19	2.462140	0.43736	.	.	ENSG00000164683	ENST00000354724;ENST00000542205;ENST00000337919;ENST00000523976	.	.	.	5.79	4.65	0.58169	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.3569	0.38173	0.0:0.1359:0.0:0.8641	.	.	.	.	Y	305;309;309;215	.	.	X	-	3	2	HEY1	80839978	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	4.647000	0.61418	2.209000	0.71365	0.533000	0.62120	TAA		HEY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000379516.1	NM_012258	
RUNX1T1	862	broad.mit.edu	37	8	92998514	92998514	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr8:92998514G>A	ENST00000523629.1	-	9	1571	c.1117C>T	c.(1117-1119)Cga>Tga	p.R373*	RUNX1T1_ENST00000396218.1_Nonsense_Mutation_p.R346*|RUNX1T1_ENST00000518844.1_Nonsense_Mutation_p.R346*|RUNX1T1_ENST00000422361.2_Nonsense_Mutation_p.R336*|RUNX1T1_ENST00000520724.1_Nonsense_Mutation_p.R336*|RUNX1T1_ENST00000265814.3_Nonsense_Mutation_p.R373*|RUNX1T1_ENST00000360348.2_Nonsense_Mutation_p.R336*|RUNX1T1_ENST00000436581.2_Nonsense_Mutation_p.R384*	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	373	Important for oligomerization.				fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R336*(1)|p.R373*(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			GTGAGAGATCGCCTTGTTTTT	0.433																																					p.R373X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C1117T	8						.						129.0	127.0	128.0					8																	92998514		2203	4300	6503	93067690	SO:0001587	stop_gained	862	exon10			D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.1117C>T	8.37:g.92998514G>A	ENSP00000428543:p.Arg373*	Somatic		Unspecified	Illumina	Phase_I	93067690	NM_001198626	B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Nonsense_Mutation	SNP	ENST00000523629.1	37	CCDS6256.1	.	.	.	.	.	.	.	.	.	.	G	35	5.475773	0.96291	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844	.	.	.	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.258	14.5933	0.68386	0.0:0.0:0.8542:0.1458	.	.	.	.	X	373;346;373;336;336;336;384;346	.	ENSP00000265814:R373X	R	-	1	2	RUNX1T1	93067690	1.000000	0.71417	0.763000	0.31416	0.997000	0.91878	7.500000	0.81588	2.677000	0.91161	0.655000	0.94253	CGA		RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377045.3	NM_004349, NM_175635	
ZNF7	7553	broad.mit.edu	37	8	146067308	146067308	+	Silent	SNP	C	C	T			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr8:146067308C>T	ENST00000528372.1	+	5	1056	c.816C>T	c.(814-816)caC>caT	p.H272H	ZNF7_ENST00000544249.1_Silent_p.H176H|ZNF7_ENST00000446747.2_Silent_p.H283H|ZNF7_ENST00000529819.1_3'UTR|ZNF7_ENST00000325241.6_Silent_p.H272H|ZNF7_ENST00000525266.1_Intron|ZNF7_ENST00000325217.5_Intron			P17097	ZNF7_HUMAN	zinc finger protein 7	272					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H272H(1)		endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(5)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.0812)|Ovarian(118;0.0822)|Acute lymphoblastic leukemia(644;0.143)	Epithelial(56;8.75e-39)|OV - Ovarian serous cystadenocarcinoma(54;1.13e-38)|all cancers(56;8.48e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;2.11e-07)		AGAGAATCCACACGGGAGAGA	0.478																																					p.H272H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C816T	8						.						78.0	81.0	80.0					8																	146067308		2203	4300	6503	146038112	SO:0001819	synonymous_variant	7553	exon5			AB209619	CCDS6435.1, CCDS64996.1, CCDS64998.1, CCDS64999.1	8q24	2013-01-08	2006-05-09		ENSG00000147789	ENSG00000147789		"""Zinc fingers, C2H2-type"", ""-"""	13139	protein-coding gene	gene with protein product		194531	"""zinc finger protein 7 (KOX 4, clone HF.16)"""			2106481, 1946370	Standard	NM_003416		Approved	KOX4, HF.16	uc003zeg.4	P17097	OTTHUMG00000165200	ENST00000528372.1:c.816C>T	8.37:g.146067308C>T		Somatic		Unspecified	Illumina	Phase_I	146038112	NM_003416	B4DT08|D3DWN6|P17015|Q8N8Y4	Silent	SNP	ENST00000528372.1	37	CCDS6435.1																																																																																				ZNF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382660.1	NM_003416	
UBE4B	10277	broad.mit.edu	37	1	10132264	10132264	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr1:10132264G>A	ENST00000253251.8	+	2	1042	c.203G>A	c.(202-204)gGt>gAt	p.G68D	UBE4B_ENST00000377157.3_5'UTR|UBE4B_ENST00000377153.1_Missense_Mutation_p.G68D|UBE4B_ENST00000343090.6_Missense_Mutation_p.G68D					ubiquitination factor E4B									p.G68D(1)		NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		TCCCCAATAGGTGCATCAGGT	0.493																																					p.G68D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G203A	1						.						61.0	59.0	59.0					1																	10132264		2203	4300	6503	10054851	SO:0001583	missense	10277	exon2			AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.203G>A	1.37:g.10132264G>A	ENSP00000253251:p.Gly68Asp	Somatic		Unspecified	Illumina	Phase_I	10054851	NM_001105562		Missense_Mutation	SNP	ENST00000253251.8	37	CCDS110.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.961112	0.92791	.	.	ENSG00000130939	ENST00000253251;ENST00000377153;ENST00000343090	T;T	0.55234	0.74;0.53	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.49830	0.1580	L	0.27053	0.805	0.80722	D	1	D;D	0.57257	0.964;0.979	P;P	0.51193	0.638;0.662	T	0.34675	-0.9819	10	0.11794	T	0.64	-17.4749	19.2392	0.93875	0.0:0.0:1.0:0.0	.	68;68	O95155;O95155-2	UBE4B_HUMAN;.	D	68	ENSP00000253251:G68D;ENSP00000343001:G68D	ENSP00000253251:G68D	G	+	2	0	UBE4B	10054851	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.153000	0.94687	2.544000	0.85801	0.563000	0.77884	GGT		UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005017.1	NM_006048	
LRIF1	55791	broad.mit.edu	37	1	111494793	111494793	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-A036-01	TCGA-AG-A036-01	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr1:111494793A>T	ENST00000369763.4	-	2	1103	c.713T>A	c.(712-714)gTg>gAg	p.V238E	LRIF1_ENST00000485275.2_Intron|LRIF1_ENST00000494675.1_Intron|RP11-96K19.2_ENST00000440689.1_RNA	NM_018372.3	NP_060842.3	Q5T3J3	LRIF1_HUMAN	ligand dependent nuclear receptor interacting factor 1	238					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)		p.V238E(1)		endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(1)|urinary_tract(2)	28						TACATTTTTCACTGTATTTAC	0.383																																					p.V238E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T713A	1						.						114.0	111.0	112.0					1																	111494793		2203	4300	6503	111296316	SO:0001583	missense	55791	exon2			AY190122	CCDS30800.1, CCDS41366.1	1p13.3	2011-04-15	2011-04-15	2011-04-15	ENSG00000121931	ENSG00000121931			30299	protein-coding gene	gene with protein product	"""receptor interacting factor 1"""	615354	"""chromosome 1 open reading frame 103"""	C1orf103		17455211	Standard	NM_018372		Approved	RIF1, FLJ11269	uc001eaa.3	Q5T3J3	OTTHUMG00000011913	ENST00000369763.4:c.713T>A	1.37:g.111494793A>T	ENSP00000358778:p.Val238Glu	Somatic		Unspecified	Illumina	Phase_I	111296316	NM_018372	Q86XS4|Q8N3B6|Q96HT4|Q9NUM5|Q9NV32	Missense_Mutation	SNP	ENST00000369763.4	37	CCDS30800.1	.	.	.	.	.	.	.	.	.	.	A	16.56	3.157760	0.57368	.	.	ENSG00000121931	ENST00000369763	T	0.53857	0.6	5.81	4.65	0.58169	.	0.000000	0.64402	D	0.000002	T	0.49626	0.1568	L	0.34521	1.04	0.80722	D	1	D	0.67145	0.996	D	0.69479	0.964	T	0.56505	-0.7968	10	0.87932	D	0	-5.3293	10.6498	0.45642	0.8573:0.0:0.0:0.1427	.	238	Q5T3J3	LRIF1_HUMAN	E	238	ENSP00000358778:V238E	ENSP00000358778:V238E	V	-	2	0	LRIF1	111296316	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.231000	0.78106	2.226000	0.72624	0.482000	0.46254	GTG		LRIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000032932.2	NM_018372	
NGF	4803	broad.mit.edu	37	1	115828849	115828849	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr1:115828849G>C	ENST00000369512.2	-	3	736	c.568C>G	c.(568-570)Cgg>Ggg	p.R190G	RP4-663N10.1_ENST00000425449.1_RNA	NM_002506.2	NP_002497.2	P01138	NGF_HUMAN	nerve growth factor (beta polypeptide)	190					activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|adult locomotory behavior (GO:0008344)|apoptotic signaling pathway (GO:0097190)|circadian rhythm (GO:0007623)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|inflammatory response (GO:0006954)|memory (GO:0007613)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle (GO:0045786)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|nerve growth factor processing (GO:0032455)|neuron apoptotic process (GO:0051402)|neuron projection morphogenesis (GO:0048812)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axon extension (GO:0045773)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neurotrophin TRK receptor signaling pathway (GO:0051388)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|Ras protein signal transduction (GO:0007265)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of neurotransmitter secretion (GO:0046928)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to nicotine (GO:0035094)|response to ozone (GO:0010193)|response to peptide hormone (GO:0043434)|response to radiation (GO:0009314)|sensory perception of pain (GO:0019233)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)	nerve growth factor receptor binding (GO:0005163)|receptor signaling protein activity (GO:0005057)	p.R190G(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	13	Lung SC(450;0.211)	all_cancers(81;1.07e-06)|all_epithelial(167;4.43e-06)|all_lung(203;2.86e-05)|Lung NSC(69;4.99e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)	Clenbuterol(DB01407)	TCAATGCCCCGGCACCCGCTG	0.512																																					p.R190G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C568G	1						.						89.0	87.0	88.0					1																	115828849		2203	4300	6503	115630372	SO:0001583	missense	4803	exon3				CCDS882.1	1p13.1	2014-09-17	2008-02-07	2008-02-07	ENSG00000134259	ENSG00000134259		"""Endogenous ligands"""	7808	protein-coding gene	gene with protein product		162030		NGFB			Standard	XM_006710663		Approved		uc001efu.1	P01138	OTTHUMG00000011880	ENST00000369512.2:c.568C>G	1.37:g.115828849G>C	ENSP00000358525:p.Arg190Gly	Somatic		Unspecified	Illumina	Phase_I	115630372	NM_002506	A1A4E5|Q6FHA0|Q96P60|Q9P2Q8|Q9UKL8	Missense_Mutation	SNP	ENST00000369512.2	37	CCDS882.1	.	.	.	.	.	.	.	.	.	.	G	15.87	2.959893	0.53400	.	.	ENSG00000134259	ENST00000369512	T	0.71222	-0.55	4.9	0.0956	0.14486	Nerve growth factor-related (5);Nerve growth factor conserved site (1);	0.070282	0.56097	D	0.000032	T	0.77651	0.4162	M	0.82132	2.575	0.53005	D	0.999962	D	0.89917	1.0	D	0.74674	0.984	T	0.81362	-0.0967	10	0.62326	D	0.03	-17.5583	14.1173	0.65161	0.0:0.0:0.3503:0.6496	.	190	P01138	NGF_HUMAN	G	190	ENSP00000358525:R190G	ENSP00000358525:R190G	R	-	1	2	NGF	115630372	0.999000	0.42202	0.998000	0.56505	0.942000	0.58702	0.920000	0.28705	0.118000	0.18165	0.455000	0.32223	CGG		NGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032832.1	NM_002506	
FMO3	2328	broad.mit.edu	37	1	171083342	171083342	+	Silent	SNP	T	T	A			TCGA-AG-A036-01	TCGA-AG-A036-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr1:171083342T>A	ENST00000367755.4	+	7	1134	c.1023T>A	c.(1021-1023)tcT>tcA	p.S341S	FMO3_ENST00000392085.2_Silent_p.S341S|FMO3_ENST00000538429.1_Silent_p.S278S|FMO3_ENST00000542847.1_Silent_p.S321S	NM_001002294.2	NP_001002294.1	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	341					drug metabolic process (GO:0017144)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	amino acid binding (GO:0016597)|flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)|trimethylamine monooxygenase activity (GO:0034899)	p.S341S(1)		endometrium(1)|kidney(1)|large_intestine(12)|lung(12)|skin(1)|stomach(2)|urinary_tract(2)	31	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Almotriptan(DB00918)|Cimetidine(DB00501)|Clozapine(DB00363)|Dapsone(DB00250)|Dasatinib(DB01254)|Olanzapine(DB00334)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	TTGATGAGTCTATCATCAAAA	0.418																																					p.S341S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1023A	1						.						126.0	120.0	122.0					1																	171083342		2203	4300	6503	169349966	SO:0001819	synonymous_variant	2328	exon7			BC032016	CCDS1292.1	1q24.3	2013-10-01			ENSG00000007933	ENSG00000007933	2.6.1.16		3771	protein-coding gene	gene with protein product		136132				8486388, 9417913	Standard	NM_001002294		Approved		uc001ghh.3	P31513	OTTHUMG00000035505	ENST00000367755.4:c.1023T>A	1.37:g.171083342T>A		Somatic		Unspecified	Illumina	Phase_I	169349966	NM_001002294	B2R816|Q14854|Q8N5N5	Silent	SNP	ENST00000367755.4	37	CCDS1292.1																																																																																				FMO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086219.1	NM_006894	
TNN	63923	broad.mit.edu	37	1	175067474	175067474	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A036-01	TCGA-AG-A036-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr1:175067474A>G	ENST00000239462.4	+	9	1975	c.1862A>G	c.(1861-1863)gAc>gGc	p.D621G		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	621	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)		p.D621G(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		CCAGATATTGACAGCCCCAAA	0.502																																					p.D621G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1862G	1						.						108.0	119.0	116.0					1																	175067474		2203	4300	6503	173334097	SO:0001583	missense	63923	exon9			AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.1862A>G	1.37:g.175067474A>G	ENSP00000239462:p.Asp621Gly	Somatic		Unspecified	Illumina	Phase_I	173334097	NM_022093	B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.263952	0.80358	.	.	ENSG00000120332	ENST00000239462	T	0.04406	3.63	5.23	5.23	0.72850	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.32133	0.0819	H	0.95850	3.73	0.53005	D	0.999967	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.45131	-0.9282	10	0.49607	T	0.09	.	13.659	0.62354	1.0:0.0:0.0:0.0	.	621;621	B3KXB6;Q9UQP3	.;TENN_HUMAN	G	621	ENSP00000239462:D621G	ENSP00000239462:D621G	D	+	2	0	TNN	173334097	1.000000	0.71417	0.998000	0.56505	0.935000	0.57460	4.396000	0.59684	2.101000	0.63845	0.377000	0.23210	GAC		TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527	
TNR	7143	broad.mit.edu	37	1	175365794	175365794	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr1:175365794C>A	ENST00000367674.2	-	5	1834	c.1126G>T	c.(1126-1128)Gat>Tat	p.D376Y	TNR_ENST00000263525.2_Missense_Mutation_p.D376Y			Q92752	TENR_HUMAN	tenascin R	376	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.D376Y(1)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					CCACTCCAATCTCCAGGCACC	0.597																																					p.D376Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1126T	1						.						89.0	78.0	81.0					1																	175365794		2203	4300	6503	173632417	SO:0001583	missense	7143	exon5			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.1126G>T	1.37:g.175365794C>A	ENSP00000356646:p.Asp376Tyr	Somatic		Unspecified	Illumina	Phase_I	173632417	NM_003285	C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	CCDS1318.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.7|21.7	4.186351|4.186351	0.78789|0.78789	.|.	.|.	ENSG00000116147|ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673|ENST00000422274	T;T|.	0.58506|.	0.33;0.33|.	5.96|5.96	5.96|5.96	0.96718|0.96718	Fibronectin, type III (4);Immunoglobulin-like fold (1);|.	0.053543|.	0.64402|.	D|.	0.000001|.	T|T	0.67795|0.67795	0.2931|0.2931	M|M	0.72894|0.72894	2.215|2.215	0.58432|0.58432	D|D	0.999998|0.999998	D|P	0.76494|0.52842	0.999|0.956	D|P	0.77557|0.44732	0.99|0.459	T|T	0.68693|0.68693	-0.5341|-0.5341	10|7	0.72032|.	D|.	0.01|.	.|.	19.9958|19.9958	0.97383|0.97383	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	376|341	Q92752|B4DIX8	TENR_HUMAN|.	Y|I	376|100	ENSP00000356646:D376Y;ENSP00000263525:D376Y|.	ENSP00000263525:D376Y|.	D|R	-|-	1|2	0|0	TNR|TNR	173632417|173632417	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	4.559000|4.559000	0.60796|0.60796	2.826000|2.826000	0.97356|0.97356	0.655000|0.655000	0.94253|0.94253	GAT|AGA		TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285	
RD3	343035	broad.mit.edu	37	1	211652487	211652487	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr1:211652487G>A	ENST00000367002.4	-	3	1642	c.479C>T	c.(478-480)tCg>tTg	p.S160L	RD3_ENST00000484910.1_5'UTR	NM_001164688.1|NM_183059.2	NP_001158160.1|NP_898882.1	Q7Z3Z2	RD3_HUMAN	retinal degeneration 3	160					response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)			p.S160L(1)		central_nervous_system(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	10				OV - Ovarian serous cystadenocarcinoma(81;0.00284)|all cancers(67;0.0279)|Epithelial(68;0.0689)		GGCGAAGGGCGAGATGCGCGC	0.687																																					p.S160L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C479T	1						.						28.0	26.0	27.0					1																	211652487		2202	4297	6499	209719110	SO:0001583	missense	343035	exon3			AY191519	CCDS1498.1	1q32.3	2008-02-05	2006-11-13	2006-11-13	ENSG00000198570	ENSG00000198570			19689	protein-coding gene	gene with protein product		180040	"""chromosome 1 open reading frame 36"""	C1orf36		12914764	Standard	NM_183059		Approved	LCA12	uc001hin.2	Q7Z3Z2	OTTHUMG00000037002	ENST00000367002.4:c.479C>T	1.37:g.211652487G>A	ENSP00000355969:p.Ser160Leu	Somatic		Unspecified	Illumina	Phase_I	209719110	NM_001164688	A8K595	Missense_Mutation	SNP	ENST00000367002.4	37	CCDS1498.1	.	.	.	.	.	.	.	.	.	.	G	9.292	1.050855	0.19827	.	.	ENSG00000198570	ENST00000367002	T	0.10099	2.91	4.33	1.91	0.25777	.	0.671285	0.15281	N	0.270697	T	0.05273	0.0140	N	0.22421	0.69	0.09310	N	0.999999	B	0.31680	0.335	B	0.24974	0.057	T	0.39187	-0.9626	10	0.13470	T	0.59	-4.7972	5.7171	0.17966	0.1238:0.0:0.5648:0.3113	.	160	Q7Z3Z2	RD3_HUMAN	L	160	ENSP00000355969:S160L	ENSP00000355969:S160L	S	-	2	0	RD3	209719110	0.998000	0.40836	0.191000	0.23289	0.630000	0.37929	3.193000	0.50997	0.927000	0.37143	0.555000	0.69702	TCG		RD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089837.1	NM_183059	
EPHA8	2046	broad.mit.edu	37	1	22915454	22915454	+	Missense_Mutation	SNP	G	G	T	rs373378884		TCGA-AG-A036-01	TCGA-AG-A036-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr1:22915454G>T	ENST00000166244.3	+	5	1142	c.1070G>T	c.(1069-1071)cGc>cTc	p.R357L	EPHA8_ENST00000538803.1_Missense_Mutation_p.R357L|EPHA8_ENST00000374644.4_Missense_Mutation_p.R357L	NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	357	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.R357L(2)		breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CCAGGTGGCCGCAGTGACATC	0.662																																					p.R357L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1070T	1						.						39.0	34.0	36.0					1																	22915454		2203	4300	6503	22788041	SO:0001583	missense	2046	exon5			BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.1070G>T	1.37:g.22915454G>T	ENSP00000166244:p.Arg357Leu	Somatic		Unspecified	Illumina	Phase_I	22788041	NM_020526	Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Missense_Mutation	SNP	ENST00000166244.3	37	CCDS225.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.699404	0.88830	.	.	ENSG00000070886	ENST00000166244;ENST00000374644;ENST00000538803	T;T;T	0.58210	0.35;0.35;0.35	4.17	4.17	0.49024	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.76133	0.3945	M	0.89840	3.065	0.80722	D	1	P;D	0.71674	0.698;0.998	P;D	0.68353	0.477;0.957	T	0.82663	-0.0346	10	0.87932	D	0	.	15.5494	0.76137	0.0:0.0:1.0:0.0	.	357;357	P29322;P29322-2	EPHA8_HUMAN;.	L	357	ENSP00000166244:R357L;ENSP00000363775:R357L;ENSP00000440274:R357L	ENSP00000166244:R357L	R	+	2	0	EPHA8	22788041	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.511000	0.98006	2.307000	0.77673	0.491000	0.48974	CGC		EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	NM_020526	
TAF5L	27097	broad.mit.edu	37	1	229730579	229730579	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr1:229730579G>C	ENST00000366676.1	-	4	1234	c.1235C>G	c.(1234-1236)tCa>tGa	p.S412*	TAF5L_ENST00000258281.2_Nonsense_Mutation_p.S412*			O75529	TAF5L_HUMAN	TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	412					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|transcription from RNA polymerase II promoter (GO:0006366)	STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.S412*(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)	11	Breast(184;0.193)|Ovarian(103;0.249)	Prostate(94;0.167)				CCGATCAAATGACCACAGCCT	0.542																																					p.S412X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1235G	1						.						99.0	97.0	98.0					1																	229730579		2203	4300	6503	227797202	SO:0001587	stop_gained	27097	exon5			AF069736	CCDS1581.1, CCDS31051.1	1q42.11-q42.3	2013-01-10	2002-08-29		ENSG00000135801	ENSG00000135801		"""WD repeat domain containing"""	17304	protein-coding gene	gene with protein product	"""PCAF associated factor 65 beta"""		"""TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65 kD"""			9674425, 11124703	Standard	XM_005273100		Approved	PAF65B	uc001htq.3	O75529	OTTHUMG00000039463	ENST00000366676.1:c.1235C>G	1.37:g.229730579G>C	ENSP00000355636:p.Ser412*	Somatic		Unspecified	Illumina	Phase_I	227797202	NM_014409	Q5TDI5|Q5TDI6|Q8IW31	Nonsense_Mutation	SNP	ENST00000366676.1	37	CCDS1581.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.014828	0.93404	.	.	ENSG00000135801	ENST00000366676;ENST00000258281	.	.	.	5.79	4.88	0.63580	.	0.314599	0.34484	N	0.003930	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-5.0454	10.3713	0.44055	0.0703:0.1343:0.7954:0.0	.	.	.	.	X	412	.	ENSP00000258281:S412X	S	-	2	0	TAF5L	227797202	1.000000	0.71417	0.982000	0.44146	0.569000	0.35902	5.584000	0.67490	1.451000	0.47736	-0.136000	0.14681	TCA		TAF5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095229.1	NM_014409	
RYR2	6262	broad.mit.edu	37	1	237802317	237802317	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr1:237802317G>A	ENST00000366574.2	+	46	7248	c.6931G>A	c.(6931-6933)Gag>Aag	p.E2311K	RYR2_ENST00000542537.1_Missense_Mutation_p.E2295K|RYR2_ENST00000360064.6_Missense_Mutation_p.E2309K	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2311	4 X approximate repeats.		E -> D (in CPVT1). {ECO:0000269|PubMed:12093772}.		BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.E2309K(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TACTTTAGGGGAGAGTGTGGA	0.388																																					p.E2311K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6931A	1						.						120.0	117.0	118.0					1																	237802317		1877	4114	5991	235868940	SO:0001583	missense	6262	exon46			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.6931G>A	1.37:g.237802317G>A	ENSP00000355533:p.Glu2311Lys	Somatic		Unspecified	Illumina	Phase_I	235868940	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.010279	0.93346	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.95885	-3.84;-3.84;-3.84	5.05	5.05	0.67936	Intracellular calcium-release channel (1);	0.000000	0.64402	D	0.000005	D	0.97666	0.9235	M	0.77820	2.39	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98408	1.0571	10	0.87932	D	0	-17.0922	18.7649	0.91868	0.0:0.0:1.0:0.0	.	2311	Q92736	RYR2_HUMAN	K	2311;2309;2295	ENSP00000355533:E2311K;ENSP00000353174:E2309K;ENSP00000443798:E2295K	ENSP00000353174:E2309K	E	+	1	0	RYR2	235868940	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	9.675000	0.98638	2.498000	0.84270	0.561000	0.74099	GAG		RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
LRRC47	57470	broad.mit.edu	37	1	3703695	3703695	+	Silent	SNP	G	G	A	rs376974812		TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr1:3703695G>A	ENST00000378251.1	-	2	822	c.795C>T	c.(793-795)ggC>ggT	p.G265G	RP1-286D6.5_ENST00000607459.1_RNA	NM_020710.2	NP_065761.1	Q8N1G4	LRC47_HUMAN	leucine rich repeat containing 47	265							phenylalanine-tRNA ligase activity (GO:0004826)|poly(A) RNA binding (GO:0044822)	p.G265G(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	17	all_cancers(77;0.0375)|Ovarian(185;0.0634)|all_lung(157;0.208)|Lung NSC(156;0.21)	all_epithelial(116;1.34e-16)|all_lung(118;2.53e-06)|Lung NSC(185;0.00028)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.0743)|Ovarian(437;0.127)		Epithelial(90;5.49e-39)|OV - Ovarian serous cystadenocarcinoma(86;1.43e-22)|GBM - Glioblastoma multiforme(42;3.69e-16)|Colorectal(212;1.21e-05)|COAD - Colon adenocarcinoma(227;5.87e-05)|Kidney(185;0.000367)|BRCA - Breast invasive adenocarcinoma(365;0.000704)|KIRC - Kidney renal clear cell carcinoma(229;0.00567)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)		TGCCCTTCCCGCCACCACGGC	0.657																																					p.G265G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C795T	1						.	G		0,4406		0,0,2203	81.0	62.0	68.0		795	-2.4	0.0	1		68	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	LRRC47	NM_020710.2		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		265/584	3703695	2,13004	2203	4300	6503	3693555	SO:0001819	synonymous_variant	57470	exon2			AB033011	CCDS51.1	1p36.32	2008-02-05			ENSG00000130764	ENSG00000130764			29207	protein-coding gene	gene with protein product						10574461	Standard	NM_020710		Approved	KIAA1185, RP1-286D6.3	uc001akx.1	Q8N1G4	OTTHUMG00000003506	ENST00000378251.1:c.795C>T	1.37:g.3703695G>A		Somatic		Unspecified	Illumina	Phase_I	3693555	NM_020710	Q9ULN5	Silent	SNP	ENST00000378251.1	37	CCDS51.1																																																																																				LRRC47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009744.1	NM_020710	
H6PD	9563	broad.mit.edu	37	1	9305568	9305568	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr1:9305568C>G	ENST00000377403.2	+	2	877	c.575C>G	c.(574-576)aCc>aGc	p.T192S	H6PD_ENST00000602477.1_Missense_Mutation_p.T203S	NM_001282587.1|NM_004285.3	NP_001269516.1|NP_004276.2	O95479	G6PE_HUMAN	hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)	192	Glucose 1-dehydrogenase.				pentose-phosphate shunt (GO:0006098)|response to alcohol (GO:0097305)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	6-phosphogluconolactonase activity (GO:0017057)|carbohydrate binding (GO:0030246)|glucose 1-dehydrogenase [NAD(P)] activity (GO:0047936)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)	p.T192S(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	all_lung(157;0.23)	all_epithelial(116;1.28e-19)|all_lung(118;5.22e-06)|Lung NSC(185;1.98e-05)|Renal(390;0.000147)|Breast(348;0.00109)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.88e-07)|COAD - Colon adenocarcinoma(227;7.47e-05)|Kidney(185;0.000244)|KIRC - Kidney renal clear cell carcinoma(229;0.000905)|STAD - Stomach adenocarcinoma(132;0.00176)|BRCA - Breast invasive adenocarcinoma(304;0.00183)|READ - Rectum adenocarcinoma(331;0.0419)		GAACTCGGGACCTTTTTCCAG	0.627																																					p.T192S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C575G	1						.						40.0	42.0	41.0					1																	9305568		2203	4300	6503	9228155	SO:0001583	missense	9563	exon2			AJ012590	CCDS101.1, CCDS72697.1	1p36	2008-02-05	2003-10-10		ENSG00000049239	ENSG00000049239	1.1.1.47		4795	protein-coding gene	gene with protein product		138090	"""glucose dehyrogenase"""	GDH		10349511	Standard	NM_001282587		Approved		uc001apt.3	O95479	OTTHUMG00000001768	ENST00000377403.2:c.575C>G	1.37:g.9305568C>G	ENSP00000366620:p.Thr192Ser	Somatic		Unspecified	Illumina	Phase_I	9228155	NM_004285	Q4TT33|Q66I35|Q68DT3	Missense_Mutation	SNP	ENST00000377403.2	37	CCDS101.1	.	.	.	.	.	.	.	.	.	.	C	0.783	-0.761505	0.02996	.	.	ENSG00000049239	ENST00000377403	D	0.98044	-4.68	5.31	2.11	0.27256	NAD(P)-binding domain (1);Glucose-6-phosphate dehydrogenase, NAD-binding (1);	0.341251	0.37669	N	0.001981	D	0.85230	0.5649	N	0.00633	-1.31	0.09310	N	0.999999	B	0.10296	0.003	B	0.10450	0.005	T	0.79699	-0.1694	10	0.02654	T	1	-25.0442	5.7694	0.18245	0.0776:0.3055:0.4983:0.1185	.	192	O95479	G6PE_HUMAN	S	192	ENSP00000366620:T192S	ENSP00000366620:T192S	T	+	2	0	H6PD	9228155	0.562000	0.26586	0.999000	0.59377	0.951000	0.60555	1.241000	0.32743	0.741000	0.32674	-0.203000	0.12734	ACC		H6PD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004928.2	NM_004285	
CCDC28B	79140	broad.mit.edu	37	1	32669954	32669954	+	Missense_Mutation	SNP	C	C	T	rs200265063		TCGA-AG-A036-01	TCGA-AG-A036-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr1:32669954C>T	ENST00000373602.5	+	4	846	c.499C>T	c.(499-501)Cgt>Tgt	p.R167C	CCDC28B_ENST00000421922.2_Missense_Mutation_p.R167C|RP4-622L5.7_ENST00000373604.4_RNA|IQCC_ENST00000537469.1_5'Flank|RP4-622L5.7_ENST00000421616.1_RNA|CCDC28B_ENST00000483009.1_Intron|IQCC_ENST00000291358.6_5'Flank	NM_024296.3	NP_077272.2	Q9BUN5	CC28B_HUMAN	coiled-coil domain containing 28B	167					cilium assembly (GO:0042384)	centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.R167C(1)		large_intestine(4)|lung(3)|ovary(1)|upper_aerodigestive_tract(2)	10		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				AATGGCTGACCGTAACCTGGA	0.562																																					p.R167C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C499T	1						.						127.0	120.0	123.0					1																	32669954		2203	4300	6503	32442541	SO:0001583	missense	79140	exon4			BC022848	CCDS354.2, CCDS72749.1	1p36.11-p34.2	2008-02-05			ENSG00000160050	ENSG00000160050			28163	protein-coding gene	gene with protein product		610162				16327777	Standard	XM_006710892		Approved	MGC1203, RP4-622L5.5	uc001bul.1	Q9BUN5	OTTHUMG00000005738	ENST00000373602.5:c.499C>T	1.37:g.32669954C>T	ENSP00000362704:p.Arg167Cys	Somatic		Unspecified	Illumina	Phase_I	32442541	NM_024296	A8K789|Q8TBV8	Missense_Mutation	SNP	ENST00000373602.5	37	CCDS354.2	.	.	.	.	.	.	.	.	.	.	C	16.08	3.021045	0.54576	.	.	ENSG00000160050	ENST00000373602;ENST00000421922	T;T	0.47869	0.86;0.83	4.74	2.82	0.32997	.	0.117065	0.64402	D	0.000015	T	0.47691	0.1459	L	0.47716	1.5	0.50467	D	0.999878	D	0.64830	0.994	P	0.51918	0.684	T	0.45026	-0.9289	10	0.62326	D	0.03	-15.6326	8.6313	0.33922	0.2818:0.6432:0.0:0.075	.	167	Q9BUN5	CC28B_HUMAN	C	167	ENSP00000362704:R167C;ENSP00000413017:R167C	ENSP00000362704:R167C	R	+	1	0	CCDC28B	32442541	0.999000	0.42202	0.797000	0.32132	0.544000	0.35116	1.437000	0.34991	0.707000	0.31934	0.556000	0.70494	CGT		CCDC28B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015723.4	NM_024296	
CYP4B1	1580	broad.mit.edu	37	1	47282756	47282756	+	Silent	SNP	C	C	T			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr1:47282756C>T	ENST00000271153.4	+	9	1143	c.1107C>T	c.(1105-1107)tgC>tgT	p.C369C	CYP4B1_ENST00000371919.4_Silent_p.C355C|CYP4B1_ENST00000371923.4_Silent_p.C370C|CYP4B1_ENST00000452782.2_Silent_p.C207C			P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B, polypeptide 1	369					biphenyl metabolic process (GO:0018879)|exogenous drug catabolic process (GO:0042738)|fluorene metabolic process (GO:0018917)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|drug binding (GO:0008144)|fluorene oxygenase activity (GO:0018585)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)	p.C369C(1)		NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	36	Acute lymphoblastic leukemia(166;0.155)				Midazolam(DB00683)|Phenobarbital(DB01174)|Thiamine(DB00152)	TGACCATGTGCATCAAGGAGA	0.542																																					p.C370C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1110T	1						.						174.0	160.0	165.0					1																	47282756		2203	4300	6503	47055343	SO:0001819	synonymous_variant	1580	exon9			BC017758	CCDS542.1, CCDS41328.1	1p33	2013-11-11	2003-01-14		ENSG00000142973	ENSG00000142973		"""Cytochrome P450s"""	2644	protein-coding gene	gene with protein product		124075	"""cytochrome P450, subfamily IVB, polypeptide 1"""				Standard	NM_000779		Approved		uc001cqn.4	P13584	OTTHUMG00000007984	ENST00000271153.4:c.1107C>T	1.37:g.47282756C>T		Somatic		Unspecified	Illumina	Phase_I	47055343	NM_001099772	Q1HBI2|Q8TD85|Q8WWF2|Q8WWU9|Q8WWV0	Silent	SNP	ENST00000271153.4	37	CCDS542.1																																																																																				CYP4B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021911.1	NM_000779	
FH	2271	broad.mit.edu	37	1	241665824	241665824	+	Silent	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr1:241665824G>A	ENST00000366560.3	-	8	1193	c.1155C>T	c.(1153-1155)gcC>gcT	p.A385A		NM_000143.3	NP_000134.2	P07954	FUMH_HUMAN	fumarate hydratase	385					cellular metabolic process (GO:0044237)|fumarate metabolic process (GO:0006106)|homeostasis of number of cells within a tissue (GO:0048873)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|tricarboxylic acid cycle enzyme complex (GO:0045239)	fumarate hydratase activity (GO:0004333)	p.A385A(1)		biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|skin(2)	26	Ovarian(103;0.103)	all_cancers(173;2.37e-314)|all_epithelial(177;5.17e-286)|Breast(1374;1.06e-10)|Acute lymphoblastic leukemia(190;4.93e-10)|all_neural(198;0.00118)	OV - Ovarian serous cystadenocarcinoma(106;0.0214)	Colorectal(1306;2.33e-53)|COAD - Colon adenocarcinoma(196;1.05e-44)|KIRC - Kidney renal clear cell carcinoma(1967;0.000109)		CCATGACTTGGGCTGCAACCA	0.418			"""Mis, N, F"""			"""lieomyomatosis, renal"""			Hereditary Leiomyomatosis and Renal Cell Cancer																												p.A385A	Melanoma(148;1573 2486 7381 46575)	yes	Rec		hereditary leiomyomatosis and renal cell cancer	1	1q42.1	2271	fumarate hydratase		"""E, M"""	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1155T	1						.						104.0	87.0	93.0					1																	241665824		2203	4300	6503	239732447	SO:0001819	synonymous_variant	2271	exon8	Familial Cancer Database	HLRCC, Reed syndrome, Hereditary Multiple Leiomyomata of Skin and Uterus	BC003108	CCDS1617.1	1q42.1	2014-09-17			ENSG00000091483	ENSG00000091483	4.2.1.2		3700	protein-coding gene	gene with protein product		136850					Standard	NM_000143		Approved	fumarase	uc001hyx.3	P07954	OTTHUMG00000039597	ENST00000366560.3:c.1155C>T	1.37:g.241665824G>A		Somatic		Unspecified	Illumina	Phase_I	239732447	NM_000143	B1ANK7	Silent	SNP	ENST00000366560.3	37	CCDS1617.1																																																																																				FH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095490.1	NM_000143	
GRIA4	2893	broad.mit.edu	37	11	105845161	105845161	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-A036-01	TCGA-AG-A036-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr11:105845161A>C	ENST00000530497.1	+	15	2534	c.2534A>C	c.(2533-2535)aAg>aCg	p.K845T	GRIA4_ENST00000393127.2_Missense_Mutation_p.K845T|RNU6-277P_ENST00000516272.1_RNA|GRIA4_ENST00000282499.5_Missense_Mutation_p.K845T|GRIA4_ENST00000533094.1_3'UTR|GRIA4_ENST00000525187.1_Missense_Mutation_p.K845T			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	845					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.K845T(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		GCAGAAGCGAAGAGAATGAAG	0.468																																					p.K845T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A2534C	11						.						154.0	140.0	145.0					11																	105845161		2201	4299	6500	105350371	SO:0001583	missense	2893	exon16			U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.2534A>C	11.37:g.105845161A>C	ENSP00000435775:p.Lys845Thr	Somatic		Unspecified	Illumina	Phase_I	105350371	NM_001077243	Q86XE8	Missense_Mutation	SNP	ENST00000530497.1	37	CCDS8333.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.134177	0.77662	.	.	ENSG00000152578	ENST00000282499;ENST00000393127;ENST00000530497;ENST00000525187	T;T;T;T	0.14391	2.65;2.51;2.65;2.51	5.83	5.83	0.93111	.	0.000000	0.64402	D	0.000001	T	0.37404	0.1002	M	0.67569	2.06	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.91635	0.933;0.999	T	0.08371	-1.0725	10	0.66056	D	0.02	.	16.1968	0.82036	1.0:0.0:0.0:0.0	.	845;845	P48058;G3V164	GRIA4_HUMAN;.	T	845	ENSP00000282499:K845T;ENSP00000376835:K845T;ENSP00000435775:K845T;ENSP00000432180:K845T	ENSP00000282499:K845T	K	+	2	0	GRIA4	105350371	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.307000	0.96226	2.225000	0.72522	0.533000	0.62120	AAG		GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1		
MSANTD4	84437	broad.mit.edu	37	11	105880291	105880291	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr11:105880291G>A	ENST00000301919.4	-	3	2424	c.1009C>T	c.(1009-1011)Cga>Tga	p.R337*	MSANTD4_ENST00000529805.1_Intron	NM_032424.1	NP_115800.1	Q8NCY6	MSD4_HUMAN	Myb/SANT-like DNA-binding domain containing 4 with coiled-coils	337						nucleus (GO:0005634)		p.R337*(1)									TTCTGAATTCGAAGTCTGTCT	0.383																																					p.R337X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1009T	11						.						105.0	99.0	101.0					11																	105880291		2201	4298	6499	105385501	SO:0001587	stop_gained	84437	exon3			AB058729	CCDS31663.1	11q22	2012-03-13	2012-03-13	2012-03-13	ENSG00000170903	ENSG00000170903			29383	protein-coding gene	gene with protein product			"""KIAA1826"""	KIAA1826			Standard	XM_005271697		Approved		uc001piz.3	Q8NCY6	OTTHUMG00000166240	ENST00000301919.4:c.1009C>T	11.37:g.105880291G>A	ENSP00000304713:p.Arg337*	Somatic		Unspecified	Illumina	Phase_I	105385501	NM_032424	Q96JK1|Q96JZ3|Q9H2N4	Nonsense_Mutation	SNP	ENST00000301919.4	37	CCDS31663.1	.	.	.	.	.	.	.	.	.	.	G	49	15.045949	0.99820	.	.	ENSG00000170903	ENST00000301919	.	.	.	5.66	2.67	0.31697	.	0.140928	0.47852	D	0.000209	.	.	.	.	.	.	0.54753	D	0.999985	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.4888	14.802	0.69924	0.0:0.0:0.6075:0.3925	.	.	.	.	X	337	.	ENSP00000304713:R337X	R	-	1	2	KIAA1826	105385501	1.000000	0.71417	0.141000	0.22245	0.948000	0.59901	2.642000	0.46596	0.279000	0.22186	0.491000	0.48974	CGA		MSANTD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388619.1	NM_032424	
C11orf87	399947	broad.mit.edu	37	11	109294862	109294862	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr11:109294862C>T	ENST00000327419.6	+	2	906	c.503C>T	c.(502-504)cCg>cTg	p.P168L	RP11-708B6.2_ENST00000532992.1_RNA|RP11-708B6.2_ENST00000532929.1_RNA	NM_207645.3	NP_997528.2	Q6NUJ2	CK087_HUMAN	chromosome 11 open reading frame 87	168						integral component of membrane (GO:0016021)		p.P168L(1)		breast(2)|endometrium(1)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	17						CCGCCTCCACCGCCAGCCTCC	0.652																																					p.P168L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C503T	11						.						40.0	42.0	41.0					11																	109294862		2201	4298	6499	108800072	SO:0001583	missense	399947	exon2			AB096240, BC035798	CCDS31672.1	11q22.3	2013-12-13	2013-12-13	2013-12-13	ENSG00000185742	ENSG00000185742			33788	protein-coding gene	gene with protein product	"""neuronal integral membrane protein 1"""					12477932	Standard	NM_207645		Approved	LOH11CR1A, LOC399947, NEURIM1	uc010rwb.2	Q6NUJ2		ENST00000327419.6:c.503C>T	11.37:g.109294862C>T	ENSP00000331581:p.Pro168Leu	Somatic		Unspecified	Illumina	Phase_I	108800072	NM_207645	B4E169	Missense_Mutation	SNP	ENST00000327419.6	37	CCDS31672.1	.	.	.	.	.	.	.	.	.	.	C	8.125	0.781771	0.16120	.	.	ENSG00000185742	ENST00000327419	.	.	.	3.42	0.388	0.16264	.	.	.	.	.	T	0.18130	0.0435	N	0.08118	0	0.32620	N	0.523484	B	0.15719	0.014	B	0.08055	0.003	T	0.16424	-1.0403	8	0.33141	T	0.24	-5.3732	3.1802	0.06582	0.186:0.4978:0.0:0.3162	.	168	Q6NUJ2	CK087_HUMAN	L	168	.	ENSP00000331581:P168L	P	+	2	0	C11orf87	108800072	0.000000	0.05858	0.934000	0.37439	0.983000	0.72400	0.007000	0.13174	0.095000	0.17434	-0.123000	0.14984	CCG		C11orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390403.1	NM_207645	
MUC5B	727897	broad.mit.edu	37	11	1272288	1272288	+	Silent	SNP	C	C	A			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr11:1272288C>A	ENST00000529681.1	+	31	14236	c.14178C>A	c.(14176-14178)tcC>tcA	p.S4726S	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Silent_p.S4729S	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4726	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.S4681S(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ccacttcctcctccaGTCCAA	0.602																																					p.S4726S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C14178A	11						.						146.0	171.0	163.0					11																	1272288		2155	4244	6399	1228864	SO:0001819	synonymous_variant	727897	exon31			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.14178C>A	11.37:g.1272288C>A		Somatic		Unspecified	Illumina	Phase_I	1228864	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																				MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
SCN2B	6327	broad.mit.edu	37	11	118037755	118037755	+	Silent	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr11:118037755G>A	ENST00000278947.5	-	4	736	c.495C>T	c.(493-495)tcC>tcT	p.S165S		NM_004588.4	NP_004579.1	O60939	SCN2B_HUMAN	sodium channel, voltage-gated, type II, beta subunit	165					cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|nervous system development (GO:0007399)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|response to pyrethroid (GO:0046684)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	voltage-gated sodium channel complex (GO:0001518)	sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)	p.S165S(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)	7	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.19e-05)|Epithelial(105;0.00117)	Valproic Acid(DB00313)|Zonisamide(DB00909)	AGCCCCCGACGGAGGCACCCA	0.607																																					p.S165S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C495T	11						.						92.0	88.0	90.0					11																	118037755		2200	4296	6496	117542965	SO:0001819	synonymous_variant	6327	exon4			AY358945	CCDS8390.1	11q23.3	2013-09-19	2012-02-28		ENSG00000149575	ENSG00000149575		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	10589	protein-coding gene	gene with protein product		601327	"""sodium channel, voltage-gated, type II, beta polypeptide"", ""sodium channel, voltage-gated, type II, beta"""			10198179	Standard	NM_004588		Approved		uc001psf.2	O60939	OTTHUMG00000048248	ENST00000278947.5:c.495C>T	11.37:g.118037755G>A		Somatic		Unspecified	Illumina	Phase_I	117542965	NM_004588	O75302|Q9UNN3	Silent	SNP	ENST00000278947.5	37	CCDS8390.1																																																																																				SCN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109748.2	NM_004588	
OR51G2	81282	broad.mit.edu	37	11	4935953	4935953	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A036-01	TCGA-AG-A036-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr11:4935953T>C	ENST00000322013.3	-	1	969	c.941A>G	c.(940-942)tAc>tGc	p.Y314C	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005238.1	NP_001005238.1	Q8NGK0	O51G2_HUMAN	olfactory receptor, family 51, subfamily G, member 2	314						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y314C(1)		autonomic_ganglia(1)|endometrium(1)|large_intestine(9)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		ACACAGTTAGTAACAAAAGGC	0.413																																					p.Y314C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A941G	11						.						89.0	71.0	77.0					11																	4935953		2201	4298	6499	4892529	SO:0001583	missense	81282	exon1			AB065794	CCDS31365.1	11p15.4	2012-08-09			ENSG00000176893	ENSG00000176893		"""GPCR / Class A : Olfactory receptors"""	15198	protein-coding gene	gene with protein product							Standard	NM_001005238		Approved		uc001lzr.1	Q8NGK0	OTTHUMG00000066501	ENST00000322013.3:c.941A>G	11.37:g.4935953T>C	ENSP00000322593:p.Tyr314Cys	Somatic		Unspecified	Illumina	Phase_I	4892529	NM_001005238	Q6IFH7	Missense_Mutation	SNP	ENST00000322013.3	37	CCDS31365.1	.	.	.	.	.	.	.	.	.	.	T	13.17	2.155740	0.38021	.	.	ENSG00000176893	ENST00000322013	T	0.00614	6.21	4.46	-8.93	0.00771	.	0.780759	0.10873	N	0.624718	T	0.00328	0.0010	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.49661	-0.8916	10	0.87932	D	0	.	1.7036	0.02877	0.288:0.3902:0.1927:0.1291	.	314	Q8NGK0	O51G2_HUMAN	C	314	ENSP00000322593:Y314C	ENSP00000322593:Y314C	Y	-	2	0	OR51G2	4892529	0.002000	0.14202	0.000000	0.03702	0.668000	0.39293	0.052000	0.14163	-2.539000	0.00486	0.491000	0.48974	TAC		OR51G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142174.1	NM_001005238	
RRP8	23378	broad.mit.edu	37	11	6622578	6622578	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr11:6622578C>T	ENST00000254605.6	-	3	835	c.718G>A	c.(718-720)Gcc>Acc	p.A240T	ILK_ENST00000299421.4_5'Flank|ILK_ENST00000528995.1_5'Flank|ILK_ENST00000396751.2_5'Flank|RRP8_ENST00000534343.1_Intron|RP11-732A19.8_ENST00000527191.1_RNA|ILK_ENST00000537806.1_5'Flank|ILK_ENST00000420936.2_5'Flank	NM_015324.3	NP_056139.1	O43159	RRP8_HUMAN	ribosomal RNA processing 8, methyltransferase, homolog (yeast)	240					cellular response to glucose starvation (GO:0042149)|chromatin modification (GO:0016568)|chromatin silencing at rDNA (GO:0000183)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription by glucose (GO:0046015)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|rDNA heterochromatin (GO:0033553)	methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)	p.A240T(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)	13						GCCATGCGGGCTCGCAAAGCC	0.627																																					p.A240T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G718A	11						.						30.0	30.0	30.0					11																	6622578		2201	4296	6497	6579154	SO:0001583	missense	23378	exon3			AB007869	CCDS31411.1	11p15.4	2009-02-23	2009-02-23	2009-02-23	ENSG00000132275	ENSG00000132275			29030	protein-coding gene	gene with protein product	RRP8 methyltransferase homolog (S. cerevisiae)	615818	"""KIAA0409"""	KIAA0409		9455477	Standard	NM_015324		Approved		uc001med.3	O43159		ENST00000254605.6:c.718G>A	11.37:g.6622578C>T	ENSP00000254605:p.Ala240Thr	Somatic		Unspecified	Illumina	Phase_I	6579154	NM_015324	Q7KZ78|Q9BVM6	Missense_Mutation	SNP	ENST00000254605.6	37	CCDS31411.1	.	.	.	.	.	.	.	.	.	.	C	17.05	3.288768	0.59976	.	.	ENSG00000132275	ENST00000254605;ENST00000533907	T;T	0.46819	0.86;0.86	5.85	4.9	0.64082	.	0.182212	0.48767	N	0.000166	T	0.38453	0.1041	L	0.43152	1.355	0.80722	D	1	P	0.36577	0.558	B	0.39217	0.294	T	0.15492	-1.0435	10	0.22706	T	0.39	-27.2435	7.8881	0.29661	0.1557:0.7582:0.0:0.0861	.	240	O43159	RRP8_HUMAN	T	240	ENSP00000254605:A240T;ENSP00000436246:A240T	ENSP00000254605:A240T	A	-	1	0	RRP8	6579154	1.000000	0.71417	1.000000	0.80357	0.743000	0.42351	2.724000	0.47285	1.390000	0.46547	-0.355000	0.07637	GCC		RRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384505.1	NM_015324	
SPTY2D1	144108	broad.mit.edu	37	11	18636366	18636366	+	Silent	SNP	C	C	T	rs558612480		TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr11:18636366C>T	ENST00000336349.5	-	3	1690	c.1455G>A	c.(1453-1455)ccG>ccA	p.P485P	SPTY2D1_ENST00000543776.1_5'Flank	NM_194285.2	NP_919261.2	Q68D10	SPT2_HUMAN	SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)	485	Ser-rich.							p.P485P(1)		breast(4)|cervix(3)|endometrium(2)|kidney(3)|large_intestine(7)|lung(9)|skin(1)|stomach(1)	30						CAGACCGCCCCGGGGGGCCCA	0.602													C|||	1	0.000199681	0.0	0.0	5008	,	,		17391	0.0		0.0	False		,,,				2504	0.001				p.P485P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1455A	11						.						27.0	30.0	29.0					11																	18636366		2199	4293	6492	18592942	SO:0001819	synonymous_variant	144108	exon3			BX647798	CCDS31441.1	11p15.1	2005-10-28			ENSG00000179119	ENSG00000179119			26818	protein-coding gene	gene with protein product							Standard	NM_194285		Approved	FLJ39441, DKFZp686I068	uc001moy.3	Q68D10	OTTHUMG00000167733	ENST00000336349.5:c.1455G>A	11.37:g.18636366C>T		Somatic		Unspecified	Illumina	Phase_I	18592942	NM_194285	Q6AWA5|Q6MZI5|Q7Z390|Q7Z470|Q86VG8|Q8N3E7|Q8N417|Q8N8I3	Silent	SNP	ENST00000336349.5	37	CCDS31441.1																																																																																				SPTY2D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395941.1	NM_194285	
PRRG4	79056	broad.mit.edu	37	11	32874973	32874973	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr11:32874973C>T	ENST00000257836.3	+	6	834	c.581C>T	c.(580-582)gCg>gTg	p.A194V		NM_024081.5	NP_076986.1	Q9BZD6	TMG4_HUMAN	proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane)	194						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.A194V(1)		large_intestine(2)|lung(2)|prostate(2)|urinary_tract(1)	7	Breast(20;0.206)					CAGGCAGTGGCGCTGACCAGA	0.478																																					p.A194V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C581T	11						.						128.0	121.0	123.0					11																	32874973		2202	4299	6501	32831549	SO:0001583	missense	79056	exon6			AF326351	CCDS7881.1	11p13	2008-02-05			ENSG00000135378	ENSG00000135378			30799	protein-coding gene	gene with protein product		611690				11171957	Standard	NM_024081		Approved	TMG4	uc001mtx.3	Q9BZD6	OTTHUMG00000166219	ENST00000257836.3:c.581C>T	11.37:g.32874973C>T	ENSP00000257836:p.Ala194Val	Somatic		Unspecified	Illumina	Phase_I	32831549	NM_024081		Missense_Mutation	SNP	ENST00000257836.3	37	CCDS7881.1	.	.	.	.	.	.	.	.	.	.	C	14.33	2.504563	0.44558	.	.	ENSG00000135378	ENST00000257836	D	0.98044	-4.68	5.55	4.62	0.57501	.	0.208186	0.50627	D	0.000109	D	0.97586	0.9209	M	0.69358	2.11	0.46521	D	0.999083	D	0.69078	0.997	P	0.55615	0.78	D	0.96765	0.9564	10	0.39692	T	0.17	-13.7402	12.8143	0.57657	0.1641:0.8358:0.0:0.0	.	194	Q9BZD6	TMG4_HUMAN	V	194	ENSP00000257836:A194V	ENSP00000257836:A194V	A	+	2	0	PRRG4	32831549	0.999000	0.42202	1.000000	0.80357	0.201000	0.24016	3.116000	0.50399	1.308000	0.44962	0.544000	0.68410	GCG		PRRG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388446.1	NM_024081	
OR4X2	119764	broad.mit.edu	37	11	48267470	48267470	+	Missense_Mutation	SNP	C	C	T	rs180995599	byFrequency	TCGA-AG-A036-01	TCGA-AG-A036-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr11:48267470C>T	ENST00000302329.3	+	1	863	c.815C>T	c.(814-816)gCg>gTg	p.A272V		NM_001004727.1	NP_001004727.1	Q8NGF9	OR4X2_HUMAN	olfactory receptor, family 4, subfamily X, member 2	272						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A272V(1)		breast(1)|large_intestine(4)|lung(12)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)	20						GTGATAACCGCGATCCTGAAC	0.473													C|||	3	0.000599042	0.0015	0.0	5008	,	,		21327	0.0		0.001	False		,,,				2504	0.0				p.A272V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C815T	11						.	C	VAL/ALA	0,4402		0,0,2201	96.0	88.0	91.0		815	4.6	0.0	11		91	1,8595	1.2+/-3.3	0,1,4297	yes	missense	OR4X2	NM_001004727.1	64	0,1,6498	TT,TC,CC		0.0116,0.0,0.0077	benign	272/304	48267470	1,12997	2201	4298	6499	48224046	SO:0001583	missense	119764	exon1			AB065847	CCDS31486.1	11p11.2	2012-08-09			ENSG00000172208	ENSG00000172208		"""GPCR / Class A : Olfactory receptors"""	15184	protein-coding gene	gene with protein product							Standard	NM_001004727		Approved		uc001ngs.1	Q8NGF9	OTTHUMG00000165302	ENST00000302329.3:c.815C>T	11.37:g.48267470C>T	ENSP00000307751:p.Ala272Val	Somatic		Unspecified	Illumina	Phase_I	48224046	NM_001004727	B2RNK3|Q6IF73|Q96R63	Missense_Mutation	SNP	ENST00000302329.3	37	CCDS31486.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	11.66	1.704494	0.30232	0.0	1.16E-4	ENSG00000172208	ENST00000302329	T	0.38560	1.13	5.47	4.56	0.56223	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000054	T	0.25382	0.0617	N	0.08118	0	0.20975	N	0.999814	P	0.35745	0.518	B	0.36378	0.223	T	0.19679	-1.0298	10	0.87932	D	0	.	12.08	0.53665	0.0:0.9164:0.0:0.0836	.	272	Q8NGF9	OR4X2_HUMAN	V	272	ENSP00000307751:A272V	ENSP00000307751:A272V	A	+	2	0	OR4X2	48224046	0.767000	0.28508	0.024000	0.17045	0.003000	0.03518	4.550000	0.60733	1.301000	0.44836	-0.145000	0.13849	GCG		OR4X2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383376.2	NM_001004727	
TYR	7299	broad.mit.edu	37	11	88961018	88961018	+	Missense_Mutation	SNP	C	C	T	rs151206295	byFrequency	TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr11:88961018C>T	ENST00000263321.5	+	3	1566	c.1064C>T	c.(1063-1065)gCg>gTg	p.A355V		NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	355			A -> E (in OCA1A).|A -> P (in OCA1A). {ECO:0000269|PubMed:10987646, ECO:0000269|PubMed:11295837, ECO:0000269|PubMed:15146472}.		cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.A355V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	ACTGGGATAGCGGATGCCTCT	0.383																																					p.A355V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1064T	11	GRCh37	CM942071	TYR	M	rs151206295	.	C	VAL/ALA	0,4402		0,0,2201	124.0	104.0	111.0		1064	5.1	1.0	11	dbSNP_134	111	2,8594	2.2+/-6.3	0,2,4296	yes	missense	TYR	NM_000372.4	64	0,2,6497	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging	355/530	88961018	2,12996	2201	4298	6499	88600666	SO:0001583	missense	7299	exon3			M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.1064C>T	11.37:g.88961018C>T	ENSP00000263321:p.Ala355Val	Somatic		Unspecified	Illumina	Phase_I	88600666	NM_000372	Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Missense_Mutation	SNP	ENST00000263321.5	37	CCDS8284.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.493946	0.84962	0.0	2.33E-4	ENSG00000077498	ENST00000263321	D	0.98889	-5.21	5.12	5.12	0.69794	Tyrosinase (1);Uncharacterised domain, di-copper centre (2);	0.175294	0.48767	D	0.000163	D	0.98741	0.9577	M	0.75447	2.3	0.58432	D	0.999994	D	0.61080	0.989	P	0.56751	0.805	D	0.99157	1.0860	9	.	.	.	.	18.5246	0.90967	0.0:1.0:0.0:0.0	.	355	P14679	TYRO_HUMAN	V	355	ENSP00000263321:A355V	.	A	+	2	0	TYR	88600666	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.425000	0.66470	2.546000	0.85860	0.650000	0.86243	GCG		TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394045.2	NM_000372	
FAT3	120114	broad.mit.edu	37	11	92534751	92534751	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr11:92534751C>T	ENST00000298047.6	+	9	8589	c.8572C>T	c.(8572-8574)Cag>Tag	p.Q2858*	FAT3_ENST00000525166.1_Nonsense_Mutation_p.Q2708*|FAT3_ENST00000409404.2_Nonsense_Mutation_p.Q2858*			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2858	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Q2858*(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CTCGGATTCCCAGCCCGAAAA	0.502										TCGA Ovarian(4;0.039)																											p.Q2858X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C8572T	11						.						60.0	61.0	60.0					11																	92534751		1972	4153	6125	92174399	SO:0001587	stop_gained	120114	exon9			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.8572C>T	11.37:g.92534751C>T	ENSP00000298047:p.Gln2858*	Somatic		Unspecified	Illumina	Phase_I	92174399	NM_001008781	B5MDB0|Q96AU6	Nonsense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	C	49	15.424441	0.99833	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	.	.	.	6.04	4.06	0.47325	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	9.1728	0.37093	0.1289:0.5316:0.3395:0.0	.	.	.	.	X	2858;2858;2708	.	ENSP00000298047:Q2858X	Q	+	1	0	FAT3	92174399	0.826000	0.29277	1.000000	0.80357	0.907000	0.53573	2.124000	0.42006	2.873000	0.98535	0.563000	0.77884	CAG		FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
CDON	50937	broad.mit.edu	37	11	125889553	125889553	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr11:125889553G>A	ENST00000392693.3	-	4	584	c.457C>T	c.(457-459)Cgc>Tgc	p.R153C	CDON_ENST00000263577.7_Missense_Mutation_p.R153C	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated	153	Ig-like C2-type 2.				anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R153C(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		ATTTTATAGCGCACCTCAGCT	0.448																																					p.R153C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C457T	11						.						132.0	136.0	135.0					11																	125889553		2201	4299	6500	125394763	SO:0001583	missense	50937	exon4			AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.457C>T	11.37:g.125889553G>A	ENSP00000376458:p.Arg153Cys	Somatic		Unspecified	Illumina	Phase_I	125394763	NM_016952	O14631	Missense_Mutation	SNP	ENST00000392693.3	37	CCDS58192.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.4|22.4	4.284979|4.284979	0.80803|0.80803	.|.	.|.	ENSG00000064309|ENSG00000064309	ENST00000534661|ENST00000392693;ENST00000263577;ENST00000531586	.|T;T;T	.|0.61510	.|2.65;2.65;0.1	5.33|5.33	4.42|4.42	0.53409|0.53409	.|Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.|0.000000	.|0.53938	.|D	.|0.000041	T|T	0.79046|0.79046	0.4380|0.4380	M|M	0.89287|0.89287	3.02|3.02	0.53688|0.53688	D|D	0.999971|0.999971	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|0.998;1.0;0.999	T|T	0.82831|0.82831	-0.0263|-0.0263	5|10	.|0.54805	.|T	.|0.06	-18.783|-18.783	14.5518|14.5518	0.68073|0.68073	0.0706:0.0:0.9294:0.0|0.0706:0.0:0.9294:0.0	.|.	.|153;153;153	.|E9PRD8;Q4KMG0;Q4KMG0-2	.|.;CDON_HUMAN;.	V|C	128|153	.|ENSP00000376458:R153C;ENSP00000263577:R153C;ENSP00000434212:R153C	.|ENSP00000263577:R153C	A|R	-|-	2|1	0|0	CDON|CDON	125394763|125394763	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.884000|0.884000	0.51177|0.51177	6.387000|6.387000	0.73191|0.73191	1.384000|1.384000	0.46424|0.46424	-0.215000|-0.215000	0.12644|0.12644	GCG|CGC		CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386749.2	NM_016952	
KIAA0408	9729	broad.mit.edu	37	6	127768831	127768831	+	Silent	SNP	A	A	G			TCGA-AG-A036-01	TCGA-AG-A036-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr6:127768831A>G	ENST00000483725.3	-	5	969	c.633T>C	c.(631-633)caT>caC	p.H211H	SOGA3_ENST00000481848.2_3'UTR|SOGA3_ENST00000556132.1_3'UTR	NM_014702.4	NP_055517.3	Q6ZU52	K0408_HUMAN	KIAA0408	211								p.H211H(1)		endometrium(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|skin(1)	28				GBM - Glioblastoma multiforme(226;0.0217)|all cancers(137;0.13)		TGGGGTCCCCATGAGGTATAT	0.358																																					p.H211H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T633C	6						.						42.0	44.0	43.0					6																	127768831		2192	4285	6477	127810524	SO:0001819	synonymous_variant	9729	exon5			AB007868	CCDS34531.1	6q22.33	2012-11-29			ENSG00000189367	ENSG00000189367			21636	protein-coding gene	gene with protein product							Standard	NM_014702		Approved		uc011ebs.2	Q6ZU52	OTTHUMG00000166439	ENST00000483725.3:c.633T>C	6.37:g.127768831A>G		Somatic		Unspecified	Illumina	Phase_I	127810524	NM_014702	B3KRE5|E1P573|O43158|Q5TF20|Q7L2M2	Silent	SNP	ENST00000483725.3	37	CCDS34531.1																																																																																				KIAA0408-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042145.3	NM_014702	
SHPRH	257218	broad.mit.edu	37	6	146262922	146262922	+	Missense_Mutation	SNP	C	C	T	rs574465156		TCGA-AG-A036-01	TCGA-AG-A036-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr6:146262922C>T	ENST00000367505.2	-	10	2591	c.2327G>A	c.(2326-2328)cGt>cAt	p.R776H	SHPRH_ENST00000438092.2_Missense_Mutation_p.R776H|SHPRH_ENST00000367503.3_Missense_Mutation_p.R776H|SHPRH_ENST00000275233.7_Missense_Mutation_p.R776H			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	776	Helicase ATP-binding; second part. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R776H(2)		breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		TAATTCTGAACGCAGTACATC	0.418																																					p.R776H												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G2327A	6						.						67.0	69.0	68.0					6																	146262922		1954	4149	6103	146304615	SO:0001583	missense	257218	exon10			AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.2327G>A	6.37:g.146262922C>T	ENSP00000356475:p.Arg776His	Somatic		Unspecified	Illumina	Phase_I	146304615	NM_173082	Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Missense_Mutation	SNP	ENST00000367505.2	37	CCDS43513.2	.	.	.	.	.	.	.	.	.	.	C	35	5.541068	0.96474	.	.	ENSG00000146414	ENST00000367505;ENST00000367503;ENST00000438092;ENST00000275233	D;D;D;D	0.93763	-3.28;-3.28;-3.28;-3.28	5.91	5.91	0.95273	DEAD-like helicase (1);SNF2-related (1);	0.000000	0.64402	D	0.000001	D	0.96809	0.8958	M	0.80616	2.505	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.96408	0.9302	10	0.66056	D	0.02	-17.2053	20.298	0.98569	0.0:1.0:0.0:0.0	.	665;776;776	Q149N8-2;Q149N8;Q149N8-4	.;SHPRH_HUMAN;.	H	776	ENSP00000356475:R776H;ENSP00000356473:R776H;ENSP00000412797:R776H;ENSP00000275233:R776H	ENSP00000275233:R776H	R	-	2	0	SHPRH	146304615	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	7.430000	0.80321	2.801000	0.96364	0.650000	0.86243	CGT		SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042571.2	NM_173082	
SASH1	23328	broad.mit.edu	37	6	148865916	148865916	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr6:148865916G>A	ENST00000367467.3	+	18	3785	c.3310G>A	c.(3310-3312)Gaa>Aaa	p.E1104K		NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	1104					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)	p.E1104K(1)		breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		GCTGCACGCTGAAGGCATCGA	0.567																																					p.E1104K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3310A	6						.						33.0	33.0	33.0					6																	148865916		2203	4300	6503	148907609	SO:0001583	missense	23328	exon18			AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.3310G>A	6.37:g.148865916G>A	ENSP00000356437:p.Glu1104Lys	Somatic		Unspecified	Illumina	Phase_I	148907609	NM_015278	Q5TGN5|Q8TAI0|Q9H7R7	Missense_Mutation	SNP	ENST00000367467.3	37	CCDS5212.1	.	.	.	.	.	.	.	.	.	.	G	18.86	3.713735	0.68730	.	.	ENSG00000111961	ENST00000367467;ENST00000537769	T	0.52754	0.65	5.11	4.23	0.50019	.	0.046857	0.85682	D	0.000000	T	0.38772	0.1053	L	0.32530	0.975	0.51482	D	0.999924	D;D	0.58620	0.983;0.983	P;P	0.53313	0.723;0.723	T	0.43572	-0.9383	10	0.87932	D	0	-20.056	15.509	0.75766	0.0:0.1389:0.8611:0.0	.	1085;1104	Q6P4R9;O94885	.;SASH1_HUMAN	K	1104;514	ENSP00000356437:E1104K	ENSP00000356437:E1104K	E	+	1	0	SASH1	148907609	1.000000	0.71417	0.523000	0.27875	0.233000	0.25261	6.094000	0.71431	1.132000	0.42129	0.655000	0.94253	GAA		SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042619.1	NM_015278	
SYNE1	23345	broad.mit.edu	37	6	152642927	152642927	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-A036-01	TCGA-AG-A036-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr6:152642927A>T	ENST00000367255.5	-	83	16613	c.16012T>A	c.(16012-16014)Tgg>Agg	p.W5338R	SYNE1_ENST00000423061.1_Missense_Mutation_p.W5267R|SYNE1_ENST00000341594.5_Missense_Mutation_p.W5011R|SYNE1_ENST00000265368.4_Missense_Mutation_p.W5338R|SYNE1_ENST00000448038.1_Missense_Mutation_p.W5267R	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5338					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.W5338R(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCCTGAACCCAACATTTCACA	0.398										HNSCC(10;0.0054)																											p.W5267R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T15799A	6						.						170.0	160.0	163.0					6																	152642927		2203	4300	6503	152684620	SO:0001583	missense	23345	exon82			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.16012T>A	6.37:g.152642927A>T	ENSP00000356224:p.Trp5338Arg	Somatic		Unspecified	Illumina	Phase_I	152684620	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	A	17.61	3.431572	0.62844	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.56941	0.56;0.57;0.47;0.57;0.43	5.53	5.53	0.82687	.	0.000000	0.56097	D	0.000030	T	0.65729	0.2719	M	0.70275	2.135	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;0.999;0.999	T	0.69851	-0.5033	10	0.59425	D	0.04	.	15.6915	0.77457	1.0:0.0:0.0:0.0	.	5338;5338;5338;5267	Q8NF91-7;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	R	5338;5267;5338;5267;5011	ENSP00000356224:W5338R;ENSP00000396024:W5267R;ENSP00000265368:W5338R;ENSP00000390975:W5267R;ENSP00000341887:W5011R	ENSP00000265368:W5338R	W	-	1	0	SYNE1	152684620	1.000000	0.71417	0.928000	0.36995	0.939000	0.58152	8.491000	0.90468	2.107000	0.64212	0.533000	0.62120	TGG		SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
CNKSR3	154043	broad.mit.edu	37	6	154749310	154749310	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr6:154749310G>C	ENST00000607772.1	-	7	1225	c.681C>G	c.(679-681)atC>atG	p.I227M	CNKSR3_ENST00000433165.2_Missense_Mutation_p.I52M|CNKSR3_ENST00000479339.1_Missense_Mutation_p.I147M	NM_173515.2	NP_775786.2	Q6P9H4	CNKR3_HUMAN	CNKSR family member 3	227	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.I227M(1)		breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	15		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;5.03e-11)|BRCA - Breast invasive adenocarcinoma(81;0.00627)		AGGTTGATTTGATGTACATGC	0.343																																					p.I227M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C681G	6						.						136.0	120.0	126.0					6																	154749310		2203	4300	6503	154791002	SO:0001583	missense	154043	exon7			AK055911	CCDS5246.1	6q25.2	2013-01-10	2005-04-11	2005-04-11	ENSG00000153721	ENSG00000153721		"""Sterile alpha motif (SAM) domain containing"""	23034	protein-coding gene	gene with protein product			"""membrane associated guanylate kinase interacting protein-like 1"""	MAGI1			Standard	NM_173515		Approved	FLJ31349		Q6P9H4	OTTHUMG00000015873	ENST00000607772.1:c.681C>G	6.37:g.154749310G>C	ENSP00000475915:p.Ile227Met	Somatic		Unspecified	Illumina	Phase_I	154791002	NM_173515	Q5SGD5|Q96N65	Missense_Mutation	SNP	ENST00000607772.1	37	CCDS5246.1	.	.	.	.	.	.	.	.	.	.	G	17.57	3.423308	0.62733	.	.	ENSG00000153721	ENST00000367209;ENST00000367213;ENST00000433165;ENST00000479339;ENST00000424998;ENST00000454664	T;T;T;T	0.53206	0.63;0.63;0.63;0.63	5.75	4.86	0.63082	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.59473	0.2196	M	0.70903	2.155	0.44395	D	0.9973	D	0.89917	1.0	D	0.91635	0.999	T	0.66709	-0.5855	10	0.87932	D	0	.	14.1848	0.65598	0.0:0.0:0.7088:0.2912	.	227	Q6P9H4	CNKR3_HUMAN	M	25;227;52;147;12;52	ENSP00000356182:I227M;ENSP00000414185:I52M;ENSP00000418975:I147M;ENSP00000406740:I52M	ENSP00000356178:I25M	I	-	3	3	CNKSR3	154791002	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.643000	0.54374	1.364000	0.46038	0.655000	0.94253	ATC		CNKSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042792.2	NM_173515	
FNDC1	84624	broad.mit.edu	37	6	159688885	159688885	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr6:159688885C>G	ENST00000297267.9	+	22	5696	c.5496C>G	c.(5494-5496)tgC>tgG	p.C1832W	FNDC1_ENST00000340366.6_Missense_Mutation_p.C1769W	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	1832					cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.C1832W(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		AAGACCATTGCCAATTTGTGG	0.428																																					p.C1832W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5496G	6						.						111.0	108.0	109.0					6																	159688885		1951	4154	6105	159608875	SO:0001583	missense	84624	exon22			AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.5496C>G	6.37:g.159688885C>G	ENSP00000297267:p.Cys1832Trp	Somatic		Unspecified	Illumina	Phase_I	159608875	NM_032532	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	ENST00000297267.9	37	CCDS47512.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.46|18.46	3.629461|3.629461	0.67015|0.67015	.|.	.|.	ENSG00000164694|ENSG00000164694	ENST00000297267;ENST00000340366|ENST00000329629	T;T|.	0.57752|.	0.38;0.38|.	5.58|5.58	3.75|3.75	0.43078|0.43078	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.50154|0.50154	0.1599|0.1599	M|M	0.69358|0.69358	2.11|2.11	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.83275|.	0.996|.	T|T	0.50482|0.50482	-0.8823|-0.8823	9|5	.|.	.|.	.|.	-29.7065|-29.7065	8.9188|8.9188	0.35599|0.35599	0.0:0.7511:0.0:0.2489|0.0:0.7511:0.0:0.2489	.|.	1832|.	Q4ZHG4|.	FNDC1_HUMAN|.	W|A	1832;1769|1728	ENSP00000297267:C1832W;ENSP00000342460:C1769W|.	.|.	C|P	+|+	3|1	2|0	FNDC1|FNDC1	159608875|159608875	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	1.293000|1.293000	0.33353|0.33353	0.660000|0.660000	0.30964|0.30964	0.491000|0.491000	0.48974|0.48974	TGC|CCA		FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042897.3	NM_032532	
E2F3	1871	broad.mit.edu	37	6	20481593	20481593	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A036-01	TCGA-AG-A036-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr6:20481593T>C	ENST00000346618.3	+	3	728	c.662T>C	c.(661-663)aTc>aCc	p.I221T	E2F3_ENST00000535432.1_Missense_Mutation_p.I90T	NM_001949.4	NP_001940.1	O00716	E2F3_HUMAN	E2F transcription factor 3	221	Leucine-zipper.				mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I221T(1)		central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(3)	7	all_cancers(95;0.154)|all_epithelial(95;0.0585)|Breast(50;0.146)|Ovarian(93;0.148)		OV - Ovarian serous cystadenocarcinoma(7;0.0068)|all cancers(50;0.0148)|Epithelial(50;0.0562)			ATTTATGATATCACCAACGTT	0.473																																					p.I221T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T662C	6						.						172.0	173.0	173.0					6																	20481593		2203	4300	6503	20589572	SO:0001583	missense	1871	exon3			Y10479	CCDS4545.1, CCDS58999.1	6p22	2008-08-29			ENSG00000112242	ENSG00000112242			3115	protein-coding gene	gene with protein product		600427				8246996	Standard	NM_001949		Approved		uc003nda.2	O00716	OTTHUMG00000016389	ENST00000346618.3:c.662T>C	6.37:g.20481593T>C	ENSP00000262904:p.Ile221Thr	Somatic		Unspecified	Illumina	Phase_I	20589572	NM_001949	Q15000|Q68DT0|Q9BZ44	Missense_Mutation	SNP	ENST00000346618.3	37	CCDS4545.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.610678	0.87258	.	.	ENSG00000112242	ENST00000378646;ENST00000346618;ENST00000535432	T;T	0.37584	1.19;1.57	5.68	5.68	0.88126	Transcription factor E2F/dimerisation partner (TDP) (1);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.71693	0.3370	H	0.98559	4.265	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.84020	0.0353	10	0.87932	D	0	.	16.2164	0.82224	0.0:0.0:0.0:1.0	.	221;90	O00716;Q68DT0	E2F3_HUMAN;.	T	100;221;90	ENSP00000262904:I221T;ENSP00000443418:I90T	ENSP00000262904:I221T	I	+	2	0	E2F3	20589572	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.289000	0.77006	0.533000	0.62120	ATC		E2F3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043828.1		
COL21A1	81578	broad.mit.edu	37	6	56029248	56029248	+	Silent	SNP	C	C	T	rs140409980		TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr6:56029248C>T	ENST00000244728.5	-	9	1741	c.1344G>A	c.(1342-1344)ccG>ccA	p.P448P	COL21A1_ENST00000370819.1_Silent_p.P445P|COL21A1_ENST00000535941.1_Silent_p.P448P	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	448	Collagen-like 1.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.P448P(2)		breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			CTGGTTTTCCCGGAGGACAAA	0.423																																					p.P448P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1344A	6						.																																			56137207	SO:0001819	synonymous_variant	81578	exon9			AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.1344G>A	6.37:g.56029248C>T		Somatic		Unspecified	Illumina	Phase_I	56137207	NM_030820	A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Silent	SNP	ENST00000244728.5	37	CCDS55025.1	.	.	.	.	.	.	.	.	.	.	C	8.441	0.850895	0.17034	.	.	ENSG00000124749	ENST00000456983	.	.	.	5.26	-10.5	0.00291	.	.	.	.	.	T	0.15869	0.0382	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40251	-0.9573	4	.	.	.	.	2.0542	0.03578	0.2862:0.3548:0.098:0.261	.	.	.	.	Q	33	.	.	R	-	2	0	COL21A1	56137207	0.078000	0.21339	0.469000	0.27204	0.869000	0.49853	-0.941000	0.03925	-2.325000	0.00638	-2.240000	0.00288	CGG		COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041004.2		
FHL5	9457	broad.mit.edu	37	6	97052725	97052725	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr6:97052725C>T	ENST00000326771.2	+	4	639	c.259C>T	c.(259-261)Cgc>Tgc	p.R87C	FHL5_ENST00000541107.1_Missense_Mutation_p.R87C	NM_020482.4	NP_065228.4	Q5TD97	FHL5_HUMAN	four and a half LIM domains 5	87	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.R87C(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|urinary_tract(1)	27		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)		BRCA - Breast invasive adenocarcinoma(108;0.0948)		CAAGGATGAGCGCCTGCTGTG	0.527																																					p.R87C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C259T	6						.						123.0	113.0	116.0					6																	97052725		2203	4300	6503	97159446	SO:0001583	missense	9457	exon3			AF278541	CCDS5035.1	6q16.1-q16.3	2008-02-05			ENSG00000112214	ENSG00000112214			17371	protein-coding gene	gene with protein product		605126					Standard	NM_020482		Approved	FLJ33049, ACT, dJ393D12.2	uc003pot.2	Q5TD97	OTTHUMG00000015239	ENST00000326771.2:c.259C>T	6.37:g.97052725C>T	ENSP00000326022:p.Arg87Cys	Somatic		Unspecified	Illumina	Phase_I	97159446	NM_001170807	B2RBD1|E1P526|Q5TD98|Q8WW21|Q9NQU2	Missense_Mutation	SNP	ENST00000326771.2	37	CCDS5035.1	.	.	.	.	.	.	.	.	.	.	C	18.37	3.609870	0.66558	.	.	ENSG00000112214	ENST00000541107;ENST00000326771;ENST00000450218	D;D;D	0.88354	-2.37;-2.37;-2.37	5.36	3.47	0.39725	Zinc finger, LIM-type (4);	0.000000	0.46145	D	0.000316	D	0.90872	0.7132	M	0.82323	2.585	0.39064	D	0.960578	D	0.89917	1.0	P	0.61658	0.892	D	0.91419	0.5157	10	0.87932	D	0	.	8.0258	0.30436	0.1189:0.6983:0.1154:0.0674	.	87	Q5TD97	FHL5_HUMAN	C	87	ENSP00000442357:R87C;ENSP00000326022:R87C;ENSP00000396390:R87C	ENSP00000326022:R87C	R	+	1	0	FHL5	97159446	0.000000	0.05858	1.000000	0.80357	0.995000	0.86356	0.371000	0.20450	1.392000	0.46585	0.655000	0.94253	CGC		FHL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041559.1	NM_020482	
THBS2	7058	broad.mit.edu	37	6	169626379	169626379	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr6:169626379G>A	ENST00000366787.3	-	17	2683	c.2434C>T	c.(2434-2436)Cga>Tga	p.R812*	THBS2_ENST00000488355.1_5'Flank|XXyac-YX65C7_A.2_ENST00000444188.1_RNA	NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	812					cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.R812*(1)		NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		CAATTGTCTCGTTCATTGAAG	0.463																																					p.R812X	Esophageal Squamous(91;219 1934 18562 44706)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2434T	6						.						94.0	88.0	90.0					6																	169626379		2203	4300	6503	169368304	SO:0001587	stop_gained	7058	exon17				CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.2434C>T	6.37:g.169626379G>A	ENSP00000355751:p.Arg812*	Somatic		Unspecified	Illumina	Phase_I	169368304	NM_003247	A6H8N1|A7E232|Q5RI52	Nonsense_Mutation	SNP	ENST00000366787.3	37	CCDS34574.1	.	.	.	.	.	.	.	.	.	.	G	39	7.389846	0.98255	.	.	ENSG00000186340	ENST00000366787;ENST00000392099	.	.	.	4.75	-1.93	0.07594	.	0.000000	0.34291	U	0.004094	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.1537	16.1098	0.81255	0.0:0.0:0.3623:0.6377	.	.	.	.	X	812;70	.	ENSP00000355751:R812X	R	-	1	2	THBS2	169368304	0.002000	0.14202	0.854000	0.33618	0.191000	0.23601	0.069000	0.14552	-0.267000	0.09325	-0.313000	0.08912	CGA		THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247	
DNAH9	1770	broad.mit.edu	37	17	11645560	11645560	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A036-01	TCGA-AG-A036-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr17:11645560T>C	ENST00000262442.4	+	30	6109	c.6041T>C	c.(6040-6042)aTt>aCt	p.I2014T	AC005701.1_ENST00000584990.1_RNA|DNAH9_ENST00000454412.2_Missense_Mutation_p.I2014T	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	2014	AAA 1. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.I2014T(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GAAGGATTCATTGAAGCCCAG	0.458																																					p.I2014T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T6041C	17						.						196.0	172.0	180.0					17																	11645560		2203	4300	6503	11586285	SO:0001583	missense	1770	exon30			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.6041T>C	17.37:g.11645560T>C	ENSP00000262442:p.Ile2014Thr	Somatic		Unspecified	Illumina	Phase_I	11586285	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	T	15.80	2.940399	0.52972	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.11604	2.76;2.76	5.61	5.61	0.85477	.	0.070705	0.64402	D	0.000015	T	0.08268	0.0206	N	0.11201	0.11	0.80722	D	1	B	0.16603	0.018	B	0.29077	0.098	T	0.39210	-0.9625	10	0.26408	T	0.33	.	16.1462	0.81575	0.0:0.0:0.0:1.0	.	2014	Q9NYC9	DYH9_HUMAN	T	2014;2014;596	ENSP00000262442:I2014T;ENSP00000414874:I2014T	ENSP00000262442:I2014T	I	+	2	0	DNAH9	11586285	1.000000	0.71417	0.949000	0.38748	0.988000	0.76386	6.260000	0.72502	2.276000	0.75962	0.524000	0.50904	ATT		DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
UNC45B	146862	broad.mit.edu	37	17	33491148	33491148	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr17:33491148C>T	ENST00000268876.5	+	9	1211	c.1114C>T	c.(1114-1116)Cgc>Tgc	p.R372C	UNC45B_ENST00000378449.1_Missense_Mutation_p.R372C|UNC45B_ENST00000394570.2_Missense_Mutation_p.R372C|UNC45B_ENST00000591048.1_Missense_Mutation_p.R372C|UNC45B_ENST00000433649.1_Missense_Mutation_p.R372C|RP11-799D4.3_ENST00000585646.1_RNA	NM_173167.2	NP_775259.1	Q8IWX7	UN45B_HUMAN	unc-45 homolog B (C. elegans)	372					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.R372C(1)		breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(10)|lung(24)|ovary(3)|prostate(2)|skin(1)|stomach(1)|urinary_tract(3)	59		Ovarian(249;0.17)				TGACCCGGAGCGCGATCACTT	0.532																																					p.R372C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1114T	17						.						181.0	171.0	175.0					17																	33491148		2203	4300	6503	30515261	SO:0001583	missense	146862	exon9			AW755253	CCDS11292.1, CCDS45648.1	17q12	2008-02-05	2005-11-17	2005-11-17	ENSG00000141161	ENSG00000141161			14304	protein-coding gene	gene with protein product		611220	"""cardiomyopathy associated 4"""	CMYA4		12356907	Standard	NM_001267052		Approved	UNC45	uc002hja.3	Q8IWX7	OTTHUMG00000132931	ENST00000268876.5:c.1114C>T	17.37:g.33491148C>T	ENSP00000268876:p.Arg372Cys	Somatic		Unspecified	Illumina	Phase_I	30515261	NM_173167	Q495Q8|Q495Q9	Missense_Mutation	SNP	ENST00000268876.5	37	CCDS11292.1	.	.	.	.	.	.	.	.	.	.	C	18.85	3.711746	0.68730	.	.	ENSG00000141161	ENST00000394570;ENST00000268876;ENST00000433649;ENST00000378449	T;T;T;T	0.50001	0.76;0.76;0.76;0.76	4.41	3.36	0.38483	.	0.000000	0.85682	D	0.000000	T	0.64713	0.2623	M	0.69823	2.125	0.51767	D	0.999931	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.991;0.999;0.998	T	0.68254	-0.5457	10	0.87932	D	0	-18.5649	11.6617	0.51349	0.2764:0.7236:0.0:0.0	.	372;372;372	Q8IWX7-2;Q8IWX7-3;Q8IWX7	.;.;UN45B_HUMAN	C	372	ENSP00000378071:R372C;ENSP00000268876:R372C;ENSP00000412840:R372C;ENSP00000367710:R372C	ENSP00000268876:R372C	R	+	1	0	UNC45B	30515261	1.000000	0.71417	0.933000	0.37362	0.958000	0.62258	3.989000	0.56958	2.461000	0.83175	0.462000	0.41574	CGC		UNC45B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256458.2	NM_173167	
KRT32	3882	broad.mit.edu	37	17	39623441	39623441	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr17:39623441C>A	ENST00000225899.3	-	1	240	c.137G>T	c.(136-138)tGc>tTc	p.C46F	RNU2-32P_ENST00000411193.1_RNA	NM_002278.3	NP_002269.3	Q14532	K1H2_HUMAN	keratin 32	46	Head.				epidermis development (GO:0008544)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.C46F(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(137;0.000812)				CGAAGGCAGGCATGCCATGGG	0.657																																					p.C46F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G137T	17						.						36.0	39.0	38.0					17																	39623441		2203	4300	6503	36876967	SO:0001583	missense	3882	exon1			X90761	CCDS11393.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000108759	ENSG00000108759		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6449	protein-coding gene	gene with protein product	"""hard keratin type I"""	602760	"""keratin, hair, acidic, 2"""	KRTHA2		7556444, 8823373, 16831889	Standard	NM_002278		Approved	Ha-2	uc002hwr.3	Q14532	OTTHUMG00000133430	ENST00000225899.3:c.137G>T	17.37:g.39623441C>A	ENSP00000225899:p.Cys46Phe	Somatic		Unspecified	Illumina	Phase_I	36876967	NM_002278		Missense_Mutation	SNP	ENST00000225899.3	37	CCDS11393.1	.	.	.	.	.	.	.	.	.	.	C	5.969	0.362767	0.11296	.	.	ENSG00000108759	ENST00000225899	D	0.97232	-4.3	3.92	0.77	0.18497	.	0.545228	0.15505	N	0.258843	D	0.90745	0.7095	L	0.35593	1.075	0.09310	N	1	B	0.23058	0.079	B	0.20577	0.03	T	0.79130	-0.1930	10	0.06236	T	0.91	.	4.2717	0.10789	0.0:0.5979:0.1888:0.2132	.	46	Q14532	K1H2_HUMAN	F	46	ENSP00000225899:C46F	ENSP00000225899:C46F	C	-	2	0	KRT32	36876967	0.000000	0.05858	0.003000	0.11579	0.747000	0.42532	-0.094000	0.11094	0.228000	0.21019	0.563000	0.77884	TGC		KRT32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257293.1	NM_002278	
OR4D1	26689	broad.mit.edu	37	17	56232547	56232547	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr17:56232547G>A	ENST00000268912.5	+	1	54	c.33G>A	c.(31-33)atG>atA	p.M11I		NM_012374.1	NP_036506.1	Q15615	OR4D1_HUMAN	olfactory receptor, family 4, subfamily D, member 1	11					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M11I(1)		kidney(2)|large_intestine(4)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	13						AGGTATCAATGTTTGTCCTCT	0.408																																					p.M11I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G33A	17						.						119.0	116.0	117.0					17																	56232547		1916	4123	6039	53587546	SO:0001583	missense	26689	exon1			X89670	CCDS42365.1	17q22	2012-08-09			ENSG00000141194	ENSG00000141194		"""GPCR / Class A : Olfactory receptors"""	8293	protein-coding gene	gene with protein product				OR4D3		9119360	Standard	NM_012374		Approved	TPCR16	uc010wno.2	Q15615		ENST00000268912.5:c.33G>A	17.37:g.56232547G>A	ENSP00000365451:p.Met11Ile	Somatic		Unspecified	Illumina	Phase_I	53587546	NM_012374	B2RN14|Q8NGB1|Q96R76	Missense_Mutation	SNP	ENST00000268912.5	37	CCDS42365.1	.	.	.	.	.	.	.	.	.	.	g	8.083	0.772709	0.16051	.	.	ENSG00000141194	ENST00000268912	T	0.01068	5.38	5.63	-3.01	0.05463	.	0.816727	0.10097	U	0.716396	T	0.00695	0.0023	N	0.11131	0.1	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.47459	-0.9116	10	0.87932	D	0	-1.6373	2.2751	0.04100	0.431:0.1198:0.3265:0.1227	.	11	Q15615	OR4D1_HUMAN	I	11	ENSP00000365451:M11I	ENSP00000365451:M11I	M	+	3	0	OR4D1	53587546	0.000000	0.05858	0.032000	0.17829	0.042000	0.13812	-0.821000	0.04452	-0.396000	0.07703	-0.266000	0.10368	ATG		OR4D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443364.1		
MTMR4	9110	broad.mit.edu	37	17	56569102	56569102	+	Silent	SNP	G	G	A	rs143878413		TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr17:56569102G>A	ENST00000323456.5	-	19	3634	c.3510C>T	c.(3508-3510)taC>taT	p.Y1170Y	MTMR4_ENST00000579925.1_Silent_p.Y1113Y	NM_004687.4	NP_004678.3	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	1170					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)	p.Y1170Y(1)		breast(10)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|skin(5)	36	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GAATGTGTTCGTAACATGAGT	0.488																																					p.Y1170Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3510T	17						.	G		1,4405	2.1+/-5.4	0,1,2202	115.0	99.0	105.0		3510	1.9	1.0	17	dbSNP_134	105	0,8600		0,0,4300	no	coding-synonymous	MTMR4	NM_004687.4		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		1170/1196	56569102	1,13005	2203	4300	6503	53924101	SO:0001819	synonymous_variant	9110	exon19			AB014547	CCDS11608.1	17q22-q23	2011-06-09				ENSG00000108389		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7452	protein-coding gene	gene with protein product		603559				9736772	Standard	NM_004687		Approved	KIAA0647, ZFYVE11	uc002iwj.2	Q9NYA4		ENST00000323456.5:c.3510C>T	17.37:g.56569102G>A		Somatic		Unspecified	Illumina	Phase_I	53924101	NM_004687	D3DTZ6|Q8IV27|Q9Y4D5	Silent	SNP	ENST00000323456.5	37	CCDS11608.1																																																																																				MTMR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444721.1	NM_004687	
TP53	7157	broad.mit.edu	37	17	7578509	7578509	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A036-01	TCGA-AG-A036-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr17:7578509A>G	ENST00000269305.4	-	5	610	c.421T>C	c.(421-423)Tgc>Cgc	p.C141R	TP53_ENST00000359597.4_Missense_Mutation_p.C141R|TP53_ENST00000420246.2_Missense_Mutation_p.C141R|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.C141R|TP53_ENST00000455263.2_Missense_Mutation_p.C141R|TP53_ENST00000445888.2_Missense_Mutation_p.C141R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	141	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> A (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C141R(13)|p.0?(8)|p.A138_P142delAKTCP(4)|p.N131fs*27(2)|p.C141S(2)|p.C141fs*8(2)|p.L137_W146del10(1)|p.K139fs*4(1)|p.A45_P49delAKTCP(1)|p.C141fs*34(1)|p.C141fs*30(1)|p.C9R(1)|p.A6_P10delAKTCP(1)|p.A138_V143delAKTCPV(1)|p.C48R(1)|p.C141fs*29(1)|p.C141A(1)|p.C141G(1)|p.K139_C141>N(1)|p.K139fs*29(1)|p.T140fs*28(1)|p.C141fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGCACAGGGCAGGTCTTGGCC	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.C141R	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	.	47	Substitution - Missense(19)|Deletion - In frame(8)|Whole gene deletion(8)|Deletion - Frameshift(6)|Insertion - Frameshift(4)|Complex - frameshift(1)|Complex - deletion inframe(1)	ovary(11)|large_intestine(7)|breast(7)|central_nervous_system(5)|bone(4)|upper_aerodigestive_tract(2)|stomach(2)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(2)|prostate(2)|biliary_tract(1)|lung(1)|oesophagus(1)	c.T421C	17						.						56.0	55.0	56.0					17																	7578509		2203	4300	6503	7519234	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.421T>C	17.37:g.7578509A>G	ENSP00000269305:p.Cys141Arg	Somatic		Unspecified	Illumina	Phase_I	7519234	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	13.32	2.203306	0.38905	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99820	-6.93;-6.93;-6.93;-6.93;-6.93;-6.93;-6.93;-6.93;-6.93	5.48	4.41	0.53225	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.046412	0.85682	D	0.000000	D	0.99806	0.9916	M	0.90309	3.105	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.998;0.994;1.0;0.999;1.0;1.0	D	0.97577	1.0108	10	0.87932	D	0	-26.1094	9.8103	0.40820	0.918:0.0:0.082:0.0	.	102;141;141;48;141;141;141	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	141;141;141;141;141;141;130;48;9;48;9;141	ENSP00000410739:C141R;ENSP00000352610:C141R;ENSP00000269305:C141R;ENSP00000398846:C141R;ENSP00000391127:C141R;ENSP00000391478:C141R;ENSP00000425104:C9R;ENSP00000423862:C48R;ENSP00000424104:C141R	ENSP00000269305:C141R	C	-	1	0	TP53	7519234	1.000000	0.71417	0.996000	0.52242	0.026000	0.11368	5.164000	0.64954	1.020000	0.39573	-0.256000	0.11100	TGC		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
KCNH6	81033	broad.mit.edu	37	17	61607569	61607569	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr17:61607569G>A	ENST00000583023.1	+	3	436	c.425G>A	c.(424-426)cGc>cAc	p.R142H	KCNH6_ENST00000456941.2_Missense_Mutation_p.R142H|KCNH6_ENST00000580652.1_Missense_Mutation_p.R142H|KCNH6_ENST00000314672.5_Missense_Mutation_p.R142H|KCNH6_ENST00000581784.1_Missense_Mutation_p.R142H	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	142	PAC.				potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)	p.R142H(1)		breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	TGCAGCAGCCGCAGCTTGTCC	0.637																																					p.R142H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G425A	17						.						59.0	56.0	57.0					17																	61607569		2203	4300	6503	58961301	SO:0001583	missense	81033	exon3			AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.425G>A	17.37:g.61607569G>A	ENSP00000463533:p.Arg142His	Somatic		Unspecified	Illumina	Phase_I	58961301	NM_030779	Q9BRD7	Missense_Mutation	SNP	ENST00000583023.1	37	CCDS11638.1	.	.	.	.	.	.	.	.	.	.	G	12.22	1.873785	0.33069	.	.	ENSG00000173826	ENST00000314672;ENST00000456941	D;D	0.99264	-5.12;-5.65	4.58	2.48	0.30137	.	0.464165	0.17953	N	0.156446	D	0.95623	0.8577	N	0.08118	0	0.29661	N	0.843257	B;B;B;B;B	0.14438	0.01;0.006;0.007;0.006;0.001	B;B;B;B;B	0.10450	0.002;0.002;0.005;0.003;0.001	D	0.93724	0.7035	10	0.35671	T	0.21	.	9.2217	0.37382	0.2479:0.0:0.7521:0.0	.	19;142;142;142;142	B4DPJ3;B4DKC0;Q9H252-2;Q9H252;Q9H252-3	.;.;.;KCNH6_HUMAN;.	H	142	ENSP00000318212:R142H;ENSP00000396900:R142H	ENSP00000318212:R142H	R	+	2	0	KCNH6	58961301	0.299000	0.24426	1.000000	0.80357	0.957000	0.61999	2.051000	0.41307	1.107000	0.41642	0.561000	0.74099	CGC		KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443853.1	NM_030779	
USP25	29761	broad.mit.edu	37	21	17138320	17138320	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr21:17138320G>T	ENST00000285679.6	+	3	497	c.128G>T	c.(127-129)aGt>aTt	p.S43I	USP25_ENST00000351097.5_Missense_Mutation_p.S43I|USP25_ENST00000400183.2_Missense_Mutation_p.S43I|USP25_ENST00000285681.2_Missense_Mutation_p.S43I	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	43	UBA-like.				cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)	p.S43I(1)		breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		TTGAAGGATAGTAATGGAAAC	0.363																																					p.S43I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G128T	21						.						86.0	81.0	83.0					21																	17138320		2203	4300	6503	16060191	SO:0001583	missense	29761	exon3			AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.128G>T	21.37:g.17138320G>T	ENSP00000285679:p.Ser43Ile	Somatic		Unspecified	Illumina	Phase_I	16060191	NM_013396	C0LSZ0|Q6DHZ9|Q9H9W1	Missense_Mutation	SNP	ENST00000285679.6	37	CCDS33515.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.706912	0.89018	.	.	ENSG00000155313	ENST00000285681;ENST00000285679;ENST00000351097;ENST00000400183	T;T;T;T	0.44083	1.32;1.36;0.93;1.36	5.42	5.42	0.78866	UBA-like (1);	0.000000	0.85682	D	0.000000	T	0.61451	0.2348	L	0.50333	1.59	0.80722	D	1	D;D;D;D	0.89917	0.998;0.995;1.0;0.998	D;D;D;D	0.78314	0.979;0.986;0.986;0.991	T	0.63305	-0.6667	10	0.87932	D	0	.	19.2158	0.93778	0.0:0.0:1.0:0.0	.	43;43;43;43	Q9UHP3-3;Q96B65;Q9UHP3-1;Q9UHP3	.;.;.;UBP25_HUMAN	I	43	ENSP00000285681:S43I;ENSP00000285679:S43I;ENSP00000299574:S43I;ENSP00000383044:S43I	ENSP00000285679:S43I	S	+	2	0	USP25	16060191	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.552000	0.86080	0.561000	0.74099	AGT		USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157964.1		
CHAF1B	8208	broad.mit.edu	37	21	37766863	37766863	+	Silent	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr21:37766863G>A	ENST00000314103.5	+	5	547	c.396G>A	c.(394-396)gtG>gtA	p.V132V	CHAF1B_ENST00000480486.1_3'UTR	NM_005441.2	NP_005432.1	Q13112	CAF1B_HUMAN	chromatin assembly factor 1, subunit B (p60)	132					cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|unfolded protein binding (GO:0051082)	p.V132V(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(6)|ovary(2)|skin(2)	20						TAGAAGATGTGTATGATATTT	0.423																																					p.V132V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G396A	21						.						185.0	180.0	182.0					21																	37766863		2203	4300	6503	36688733	SO:0001819	synonymous_variant	8208	exon5			U20980	CCDS13644.1	21q22.2	2013-01-10			ENSG00000159259	ENSG00000159259		"""WD repeat domain containing"""	1911	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 7"", ""Chromatin assembly factor I, p60 subunit"", ""human chromatin assembly factor-I p60 subunit"""	601245				7600578, 8792829	Standard	NM_005441		Approved	CAF1P60, CAF-1, CAF1, CAF1A, MPP7, MPHOSPH7	uc002yvj.3	Q13112	OTTHUMG00000086606	ENST00000314103.5:c.396G>A	21.37:g.37766863G>A		Somatic		Unspecified	Illumina	Phase_I	36688733	NM_005441	Q99548	Silent	SNP	ENST00000314103.5	37	CCDS13644.1																																																																																				CHAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194616.2	NM_005441	
KCNJ6	3763	broad.mit.edu	37	21	39086698	39086698	+	Silent	SNP	C	C	T	rs373930118		TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr21:39086698C>T	ENST00000609713.1	-	3	1351	c.762G>A	c.(760-762)ccG>ccA	p.P254P	KCNJ6-IT1_ENST00000435001.1_RNA|KCNJ6_ENST00000288309.6_Silent_p.P254P	NM_002240.3	NP_002231.1	P48051	KCNJ6_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 6	254					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)|inward rectifier potassium channel activity (GO:0005242)	p.P254P(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22					Halothane(DB01159)	TCTGGTTCAACGGGATGAACT	0.502																																					p.P254P	Pancreas(48;379 1118 2936 19024 28214)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G762A	21						.	C		1,3817		0,1,1908	110.0	111.0	111.0		762	-4.6	0.4	21		111	0,8286		0,0,4143	no	coding-synonymous	KCNJ6	NM_002240.2		0,1,6051	TT,TC,CC		0.0,0.0262,0.0083		254/424	39086698	1,12103	1909	4143	6052	38008568	SO:0001819	synonymous_variant	3763	exon3			U24660	CCDS42927.1	21q22.1	2011-07-05			ENSG00000157542	ENSG00000157542		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6267	protein-coding gene	gene with protein product		600877		KCNJ7		7796919, 16382105	Standard	NM_002240		Approved	Kir3.2, GIRK2, KATP2, BIR1, hiGIRK2	uc002ywo.3	P48051	OTTHUMG00000086667	ENST00000609713.1:c.762G>A	21.37:g.39086698C>T		Somatic		Unspecified	Illumina	Phase_I	38008568	NM_002240	Q3MJ74|Q53WW6	Silent	SNP	ENST00000609713.1	37	CCDS42927.1																																																																																				KCNJ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194828.2	NM_002240	
PRDM15	63977	broad.mit.edu	37	21	43230561	43230561	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr21:43230561C>G	ENST00000269844.3	-	28	3809	c.3699G>C	c.(3697-3699)aaG>aaC	p.K1233N	PRDM15_ENST00000470586.1_5'UTR|PRDM15_ENST00000398548.1_Missense_Mutation_p.K904N|PRDM15_ENST00000447207.2_Missense_Mutation_p.K867N|PRDM15_ENST00000538201.1_Missense_Mutation_p.K887N|PRDM15_ENST00000422911.1_Missense_Mutation_p.K924N	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	1233					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.K1233N(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						TGGTGGACACCTTGGTCCCGC	0.662																																					p.K1233N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3699C	21						.						81.0	56.0	65.0					21																	43230561		2203	4299	6502	42103630	SO:0001583	missense	63977	exon28			AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.3699G>C	21.37:g.43230561C>G	ENSP00000269844:p.Lys1233Asn	Somatic		Unspecified	Illumina	Phase_I	42103630	NM_022115	E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Missense_Mutation	SNP	ENST00000269844.3	37	CCDS13676.1	.	.	.	.	.	.	.	.	.	.	c	15.26	2.780975	0.49891	.	.	ENSG00000141956	ENST00000422911;ENST00000398548;ENST00000538201;ENST00000447207;ENST00000269844	T;T;T;T;T	0.09538	4.72;4.72;4.72;4.72;2.97	4.11	0.455	0.16649	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	.	.	.	.	T	0.14442	0.0349	N	0.24115	0.695	0.42674	D	0.993523	B;D;D	0.89917	0.014;1.0;1.0	B;D;D	0.91635	0.012;0.998;0.999	T	0.18555	-1.0333	9	0.40728	T	0.16	-26.2487	5.3073	0.15811	0.1554:0.55:0.0:0.2945	.	1233;924;904	P57071;E9PDJ6;E9PF37	PRD15_HUMAN;.;.	N	924;904;887;867;1233	ENSP00000408592:K924N;ENSP00000381556:K904N;ENSP00000444044:K887N;ENSP00000390245:K867N;ENSP00000269844:K1233N	ENSP00000269844:K1233N	K	-	3	2	PRDM15	42103630	0.989000	0.36119	1.000000	0.80357	0.789000	0.44602	0.307000	0.19296	0.192000	0.20272	-0.851000	0.03033	AAG		PRDM15-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022115	
STX4	6810	broad.mit.edu	37	16	31051088	31051088	+	Silent	SNP	C	C	T			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr16:31051088C>T	ENST00000313843.3	+	10	1173	c.858C>T	c.(856-858)ctC>ctT	p.L286L	STX4_ENST00000394998.1_Silent_p.L284L|STX4_ENST00000493902.1_3'UTR	NM_004604.3	NP_004595.2	Q12846	STX4_HUMAN	syntaxin 4	286	Interaction with CENPF. {ECO:0000250}.				blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|neurotransmitter transport (GO:0006836)|platelet activation (GO:0030168)|post-Golgi vesicle-mediated transport (GO:0006892)|SNARE complex assembly (GO:0035493)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|membrane (GO:0016020)|myelin sheath adaxonal region (GO:0035749)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|specific granule (GO:0042581)|trans-Golgi network (GO:0005802)|vacuole (GO:0005773)		p.L286L(1)		NS(2)|breast(1)|large_intestine(3)|lung(3)	9						CCGTCGTCCTCCTAGCAGTCA	0.602																																					p.L286L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C858T	16						.						329.0	247.0	275.0					16																	31051088		2197	4300	6497	30958589	SO:0001819	synonymous_variant	6810	exon10			AF026007	CCDS10700.1, CCDS61916.1	16p11.2	2008-02-05	2006-04-25	2006-04-25	ENSG00000103496	ENSG00000103496			11439	protein-coding gene	gene with protein product		186591	"""syntaxin 4A (placental)"""	STX4A		8206394, 16339081	Standard	NM_001272095		Approved	p35-2	uc002eak.4	Q12846	OTTHUMG00000132404	ENST00000313843.3:c.858C>T	16.37:g.31051088C>T		Somatic		Unspecified	Illumina	Phase_I	30958589	NM_004604	A8MXY0|Q15525|Q6FHE8	Silent	SNP	ENST00000313843.3	37	CCDS10700.1																																																																																				STX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255538.3	NM_004604	
MYLK3	91807	broad.mit.edu	37	16	46766140	46766140	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A036-01	TCGA-AG-A036-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr16:46766140T>C	ENST00000394809.4	-	4	1557	c.1442A>G	c.(1441-1443)gAg>gGg	p.E481G	MYLK3_ENST00000536476.1_Missense_Mutation_p.E140G	NM_182493.2	NP_872299.2	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	481					cardiac myofibril assembly (GO:0055003)|cellular response to interleukin-1 (GO:0071347)|positive regulation of sarcomere organization (GO:0060298)|protein phosphorylation (GO:0006468)|regulation of vascular permeability involved in acute inflammatory response (GO:0002528)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)	p.E481G(1)|p.E560G(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(5)|stomach(3)	37		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				GCTGCCAGCCTCGGCGCCTGG	0.652																																					p.E481G												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1442G	16						.						22.0	24.0	23.0					16																	46766140		2203	4299	6502	45323641	SO:0001583	missense	91807	exon4			AJ247087	CCDS10723.2	16q11.2	2008-10-23			ENSG00000140795	ENSG00000140795			29826	protein-coding gene	gene with protein product	"""MLC kinase"""	612147				17885681	Standard	NM_182493		Approved	caMLCK, MLCK	uc002eei.4	Q32MK0	OTTHUMG00000132543	ENST00000394809.4:c.1442A>G	16.37:g.46766140T>C	ENSP00000378288:p.Glu481Gly	Somatic		Unspecified	Illumina	Phase_I	45323641	NM_182493	B5BUL9|B7Z5U8|Q32MK1|Q96DV1	Missense_Mutation	SNP	ENST00000394809.4	37	CCDS10723.2	.	.	.	.	.	.	.	.	.	.	t	11.71	1.720987	0.30503	.	.	ENSG00000140795	ENST00000394809;ENST00000536476	T;T	0.69306	-0.39;-0.37	5.27	4.11	0.48088	.	0.709521	0.11565	N	0.551335	T	0.56906	0.2017	L	0.60455	1.87	0.34466	D	0.702259	B;P	0.44627	0.255;0.839	B;B	0.36134	0.078;0.218	T	0.64373	-0.6423	10	0.30854	T	0.27	.	7.7395	0.28833	0.1865:0.0:0.0:0.8135	.	481;481	B5BUL9;Q32MK0	.;MYLK3_HUMAN	G	481;140	ENSP00000378288:E481G;ENSP00000439297:E140G	ENSP00000378288:E481G	E	-	2	0	MYLK3	45323641	0.284000	0.24287	0.846000	0.33378	0.023000	0.10783	1.294000	0.33365	1.981000	0.57761	0.454000	0.30748	GAG		MYLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255743.2	NM_182493	
SLC12A3	6559	broad.mit.edu	37	16	56906353	56906353	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A036-01	TCGA-AG-A036-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr16:56906353A>G	ENST00000563236.1	+	7	968	c.943A>G	c.(943-945)Aaa>Gaa	p.K315E	SLC12A3_ENST00000262502.5_Missense_Mutation_p.K314E|SLC12A3_ENST00000438926.2_Missense_Mutation_p.K315E|SLC12A3_ENST00000566786.1_Missense_Mutation_p.K314E			P55017	S12A3_HUMAN	solute carrier family 12 (sodium/chloride transporter), member 3	315					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:chloride symporter activity (GO:0015378)|transporter activity (GO:0005215)	p.K315E(1)		breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(28)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	CAAGGCCTCCAAAGGCTTCTT	0.572																																					p.K315E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A943G	16						.						82.0	74.0	77.0					16																	56906353		2198	4300	6498	55463854	SO:0001583	missense	6559	exon7				CCDS10770.1, CCDS45491.1, CCDS58464.1	16q13	2013-07-18	2013-07-18		ENSG00000070915	ENSG00000070915		"""Solute carriers"""	10912	protein-coding gene	gene with protein product		600968				8812482	Standard	NM_000339		Approved	NCCT	uc002ekd.4	P55017	OTTHUMG00000133284	ENST00000563236.1:c.943A>G	16.37:g.56906353A>G	ENSP00000456149:p.Lys315Glu	Somatic		Unspecified	Illumina	Phase_I	55463854	NM_000339	A8MSJ2|C9JNN9	Missense_Mutation	SNP	ENST00000563236.1	37	CCDS58464.1	.	.	.	.	.	.	.	.	.	.	A	17.30	3.354659	0.61293	.	.	ENSG00000070915	ENST00000438926;ENST00000262502	.	.	.	5.72	5.72	0.89469	Amino acid permease domain (1);	0.087786	0.85682	D	0.000000	T	0.67211	0.2869	M	0.66378	2.025	0.52501	D	0.999954	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.15052	0.007;0.012;0.007	T	0.65569	-0.6136	9	0.72032	D	0.01	.	15.9825	0.80121	1.0:0.0:0.0:0.0	.	314;315;315	P55017-3;P55017;P55017-2	.;S12A3_HUMAN;.	E	314;315	.	ENSP00000262502:K315E	K	+	1	0	SLC12A3	55463854	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.995000	0.63908	2.182000	0.69389	0.459000	0.35465	AAA		SLC12A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432337.1		
GSE1	23199	broad.mit.edu	37	16	85690941	85690941	+	Silent	SNP	G	G	A	rs371123194		TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr16:85690941G>A	ENST00000253458.7	+	8	1547	c.1371G>A	c.(1369-1371)ccG>ccA	p.P457P	GSE1_ENST00000393243.1_Silent_p.P384P|GSE1_ENST00000405402.2_Silent_p.P353P|RN7SL381P_ENST00000577658.1_RNA	NM_014615.2	NP_055430.1	Q14687	GSE1_HUMAN	Gse1 coiled-coil protein	457								p.P457P(1)									CCTTGCATCCGGTGCCCACCC	0.637																																					p.P353P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1059A	16						.	G	,	2,4392	4.2+/-10.8	0,2,2195	68.0	60.0	62.0		1059,1371	-5.1	0.2	16		62	0,8596		0,0,4298	no	coding-synonymous,coding-synonymous	KIAA0182	NM_001134473.1,NM_014615.2	,	0,2,6493	AA,AG,GG		0.0,0.0455,0.0154	,	353/1114,457/1218	85690941	2,12988	2197	4298	6495	84248442	SO:0001819	synonymous_variant	23199	exon7			D80004	CCDS10952.1, CCDS45539.1, CCDS62007.1	16q24.1	2012-12-07	2012-12-07	2012-10-02	ENSG00000131149	ENSG00000131149			28979	protein-coding gene	gene with protein product	"""genetic suppressor element 1"""		"""KIAA0182"", ""Gse1 coiled-coil protein homolog (mouse)"""	KIAA0182		8724849, 8786132	Standard	NM_014615		Approved		uc002fix.4	Q14687	OTTHUMG00000137650	ENST00000253458.7:c.1371G>A	16.37:g.85690941G>A		Somatic		Unspecified	Illumina	Phase_I	84248442	NM_001134473	D3DUM4|Q8IY61|Q96GA4|Q9BW09	Silent	SNP	ENST00000253458.7	37	CCDS10952.1	.	.	.	.	.	.	.	.	.	.	G	4.505	0.093638	0.08632	4.55E-4	0.0	ENSG00000131149	ENST00000412692	.	.	.	5.07	-5.06	0.02946	.	.	.	.	.	T	0.17492	0.0420	.	.	.	0.29076	N	0.883013	.	.	.	.	.	.	T	0.33497	-0.9866	4	.	.	.	-32.0284	1.3781	0.02225	0.2518:0.1771:0.3756:0.1955	.	.	.	.	Q	264	.	.	R	+	2	0	KIAA0182	84248442	0.000000	0.05858	0.213000	0.23690	0.571000	0.35966	-0.565000	0.05929	-0.387000	0.07809	-0.314000	0.08810	CGG		GSE1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325527.1	NM_014615	
EPG5	57724	broad.mit.edu	37	18	43495483	43495483	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr18:43495483G>T	ENST00000282041.5	-	20	3720	c.3686C>A	c.(3685-3687)cCc>cAc	p.P1229H	EPG5_ENST00000585906.1_5'UTR	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	1229					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)			p.P1229H(1)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						TACCTGAGTGGGCGTGGCCAA	0.448																																					p.P1229H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3686A	18						.						88.0	92.0	90.0					18																	43495483		2099	4220	6319	41749481	SO:0001583	missense	57724	exon20			AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.3686C>A	18.37:g.43495483G>T	ENSP00000282041:p.Pro1229His	Somatic		Unspecified	Illumina	Phase_I	41749481	NM_020964	A2BDF3|Q9H8C8	Missense_Mutation	SNP	ENST00000282041.5	37	CCDS11926.2	.	.	.	.	.	.	.	.	.	.	G	13.35	2.210180	0.39003	.	.	ENSG00000152223	ENST00000282041;ENST00000308403	T	0.11063	2.81	5.51	5.51	0.81932	.	0.202176	0.31989	N	0.006748	T	0.19248	0.0462	L	0.34521	1.04	0.09310	N	0.999999	D;D	0.53885	0.963;0.963	P;P	0.53593	0.73;0.73	T	0.01889	-1.1253	10	0.62326	D	0.03	-4.0504	19.4214	0.94723	0.0:0.0:1.0:0.0	.	1229;1229	Q9HCE0-2;Q9HCE0	.;EPG5_HUMAN	H	1229;104	ENSP00000282041:P1229H	ENSP00000282041:P1229H	P	-	2	0	EPG5	41749481	1.000000	0.71417	0.404000	0.26397	0.057000	0.15508	5.787000	0.69013	2.598000	0.87819	0.650000	0.86243	CCC		EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
PHLPP1	23239	broad.mit.edu	37	18	60562287	60562287	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr18:60562287G>C	ENST00000262719.5	+	5	2344	c.2110G>C	c.(2110-2112)Ggg>Cgg	p.G704R	PHLPP1_ENST00000400316.4_Missense_Mutation_p.G192R			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	704					apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)	p.G191R(1)		endometrium(2)|kidney(2)|lung(13)	17						TAATCATTTAGGGGACTTCCC	0.448																																					p.G704R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2110C	18						.						58.0	56.0	56.0					18																	60562287		1876	4110	5986	58713267	SO:0001583	missense	23239	exon5			AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.2110G>C	18.37:g.60562287G>C	ENSP00000262719:p.Gly704Arg	Somatic		Unspecified	Illumina	Phase_I	58713267	NM_194449	A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Missense_Mutation	SNP	ENST00000262719.5	37	CCDS45881.2	.	.	.	.	.	.	.	.	.	.	G	20.2	3.943508	0.73672	.	.	ENSG00000081913	ENST00000400316;ENST00000262719	T;T	0.24151	1.87;1.87	5.81	5.81	0.92471	.	.	.	.	.	T	0.42245	0.1194	L	0.37697	1.125	0.51012	D	0.9999	D	0.64830	0.994	D	0.66497	0.944	T	0.03025	-1.1081	9	0.34782	T	0.22	-19.5691	20.0831	0.97789	0.0:0.0:1.0:0.0	.	704	O60346	PHLP1_HUMAN	R	192;704	ENSP00000383170:G192R;ENSP00000262719:G704R	ENSP00000262719:G704R	G	+	1	0	PHLPP1	58713267	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.064000	0.64338	2.765000	0.95021	0.655000	0.94253	GGG		PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319249.2	NM_194449	
PTPRM	5797	broad.mit.edu	37	18	8394505	8394505	+	Missense_Mutation	SNP	G	G	A	rs142178302	byFrequency	TCGA-AG-A036-01	TCGA-AG-A036-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr18:8394505G>A	ENST00000332175.8	+	30	5238	c.4201G>A	c.(4201-4203)Gcc>Acc	p.A1401T	PTPRM_ENST00000400053.4_Missense_Mutation_p.A1339T|PTPRM_ENST00000444013.1_Missense_Mutation_p.A1188T|PTPRM_ENST00000400060.4_Missense_Mutation_p.A1415T|PTPRM_ENST00000580170.1_Missense_Mutation_p.A1414T	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	1401	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.A1401T(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				GACGTTCTGCGCCATCAGCAT	0.537													G|||	2	0.000399361	0.0	0.0	5008	,	,		19482	0.001		0.001	False		,,,				2504	0.0				p.A1401T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4201A	18						.	G	THR/ALA,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	78.0	58.0	65.0		4240,4201	5.8	1.0	18	dbSNP_134	65	0,8600		0,0,4300	yes	missense,missense	PTPRM	NM_001105244.1,NM_002845.3	58,58	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	1414/1466,1401/1453	8394505	1,13005	2203	4300	6503	8384505	SO:0001583	missense	5797	exon30			X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.4201G>A	18.37:g.8394505G>A	ENSP00000331418:p.Ala1401Thr	Somatic		Unspecified	Illumina	Phase_I	8384505	NM_002845	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	37	CCDS11840.1	2	9.157509157509158E-4	0	0.0	0	0.0	1	0.0017482517482517483	1	0.0013192612137203166	G	32	5.151972	0.94645	2.27E-4	0.0	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	T;T;T;T	0.18502	2.21;2.21;2.21;2.21	5.75	5.75	0.90469	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.121135	0.56097	D	0.000035	T	0.31575	0.0801	L	0.37697	1.125	0.80722	D	1	D;D;D	0.76494	0.999;0.979;0.998	D;P;P	0.69824	0.966;0.624;0.766	T	0.01661	-1.1301	10	0.13108	T	0.6	.	19.9923	0.97371	0.0:0.0:1.0:0.0	.	1188;1414;1401	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	T	1401;1415;1339;1188	ENSP00000331418:A1401T;ENSP00000382933:A1415T;ENSP00000382927:A1339T;ENSP00000387608:A1188T	ENSP00000331418:A1401T	A	+	1	0	PTPRM	8384505	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	8.010000	0.88615	2.727000	0.93392	0.650000	0.86243	GCC		PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
CDH19	28513	broad.mit.edu	37	18	64235761	64235761	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr18:64235761C>A	ENST00000540086.1	-	3	628	c.382G>T	c.(382-384)Gtg>Ttg	p.V128L	CDH19_ENST00000262150.2_Missense_Mutation_p.V128L	NM_001271028.1	NP_001257957.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	233	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V128L(1)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				TCAGGTTCCACAGCCCTTCCA	0.433																																					p.V128L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G382T	18						.						141.0	136.0	137.0					18																	64235761		2203	4299	6502	62386741	SO:0001583	missense	28513	exon3			AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000540086.1:c.382G>T	18.37:g.64235761C>A	ENSP00000439593:p.Val128Leu	Somatic		Unspecified	Illumina	Phase_I	62386741	NM_021153	O15098	Missense_Mutation	SNP	ENST00000540086.1	37	CCDS59325.1	.	.	.	.	.	.	.	.	.	.	C	13.09	2.132796	0.37630	.	.	ENSG00000071991	ENST00000262150;ENST00000540086;ENST00000454642	T;T	0.45276	0.9;0.9	5.87	5.0	0.66597	Cadherin (4);Cadherin-like (1);	0.135540	0.49916	D	0.000134	T	0.15349	0.0370	N	0.05592	-0.015	0.37848	D	0.929295	B;P	0.36874	0.379;0.572	B;B	0.28305	0.041;0.088	T	0.24657	-1.0154	10	0.02654	T	1	.	8.0061	0.30325	0.0:0.7249:0.1318:0.1433	.	128;128	F5H1K0;Q9H159	.;CAD19_HUMAN	L	128;128;73	ENSP00000262150:V128L;ENSP00000439593:V128L	ENSP00000262150:V128L	V	-	1	0	CDH19	62386741	0.740000	0.28207	1.000000	0.80357	0.998000	0.95712	1.108000	0.31123	1.497000	0.48584	0.591000	0.81541	GTG		CDH19-005	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000442285.1	NM_021153	
NFKBIZ	64332	broad.mit.edu	37	3	101578204	101578204	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr3:101578204C>T	ENST00000326172.5	+	12	2261	c.2146C>T	c.(2146-2148)Cca>Tca	p.P716S	NFKBIZ_ENST00000326151.5_Missense_Mutation_p.P594S|NFKBIZ_ENST00000394054.2_Missense_Mutation_p.P616S	NM_031419.3	NP_113607.1	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta	716	Interaction with NFKB1/p50. {ECO:0000250}.				inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.P716S(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24						GCAGAGAGCTCCACCGTATTA	0.433																																					p.P616S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1846T	3						.						95.0	91.0	93.0					3																	101578204		2203	4300	6503	103060894	SO:0001583	missense	64332	exon13			AF548362	CCDS2946.1, CCDS43123.1	3p12-q12	2013-01-10			ENSG00000144802	ENSG00000144802		"""Ankyrin repeat domain containing"""	29805	protein-coding gene	gene with protein product	"""IL-1 inducible nuclear ankyrin-repeat protein"""	608004				12565889, 16513645	Standard	NM_031419		Approved	MAIL, FLJ34463, INAP	uc003dvp.3	Q9BYH8	OTTHUMG00000159194	ENST00000326172.5:c.2146C>T	3.37:g.101578204C>T	ENSP00000325663:p.Pro716Ser	Somatic		Unspecified	Illumina	Phase_I	103060894	NM_001005474	B3KNR2|D3DN54|Q8IUL4|Q8NAZ8	Missense_Mutation	SNP	ENST00000326172.5	37	CCDS2946.1	.	.	.	.	.	.	.	.	.	.	C	11.72	1.723621	0.30593	.	.	ENSG00000144802	ENST00000394054;ENST00000326151;ENST00000326172	T;T;T	0.53423	0.62;0.66;0.66	5.53	3.66	0.41972	.	0.194828	0.45126	D	0.000385	T	0.17619	0.0423	N	0.02539	-0.55	0.30429	N	0.777334	B;B	0.25667	0.131;0.045	B;B	0.27715	0.082;0.012	T	0.28554	-1.0040	10	0.06625	T	0.88	-3.5266	6.6104	0.22749	0.0:0.5467:0.3433:0.11	.	594;716	Q9BYH8-3;Q9BYH8	.;IKBZ_HUMAN	S	616;594;716	ENSP00000377618:P616S;ENSP00000325593:P594S;ENSP00000325663:P716S	ENSP00000325593:P594S	P	+	1	0	NFKBIZ	103060894	0.998000	0.40836	0.992000	0.48379	0.979000	0.70002	2.318000	0.43779	0.747000	0.32809	0.655000	0.94253	CCA		NFKBIZ-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353793.1	NM_031419	
PIK3R4	30849	broad.mit.edu	37	3	130409453	130409453	+	Silent	SNP	G	G	C			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr3:130409453G>C	ENST00000356763.3	-	14	3701	c.3144C>G	c.(3142-3144)ctC>ctG	p.L1048L	PIK3R4_ENST00000512677.1_5'UTR	NM_014602.2	NP_055417.1	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	1048					innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.L1048L(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(6)|large_intestine(16)|lung(28)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	77						GGCAGAATGTGAGCGTCTTGA	0.403																																					p.L1048L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3144G	3						.						113.0	108.0	110.0					3																	130409453		2203	4300	6503	131892143	SO:0001819	synonymous_variant	30849	exon14			Y08991	CCDS3067.1	3q22.1	2013-01-10	2008-02-04		ENSG00000196455	ENSG00000196455		"""WD repeat domain containing"""	8982	protein-coding gene	gene with protein product		602610				8999962	Standard	NM_014602		Approved	VPS15, p150	uc003enj.3	Q99570	OTTHUMG00000159645	ENST00000356763.3:c.3144C>G	3.37:g.130409453G>C		Somatic		Unspecified	Illumina	Phase_I	131892143	NM_014602	Q2TBF4	Silent	SNP	ENST00000356763.3	37	CCDS3067.1																																																																																				PIK3R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356668.1	NM_014602	
SCN10A	6336	broad.mit.edu	37	3	38833624	38833624	+	Silent	SNP	G	G	T			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr3:38833624G>T	ENST00000449082.2	-	2	305	c.306C>A	c.(304-306)tcC>tcA	p.S102S		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	102					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.S102S(1)		NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	CACTAAACCGGGAAATGGTCC	0.443																																					p.S102S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C306A	3						.						187.0	183.0	184.0					3																	38833624		2203	4300	6503	38808628	SO:0001819	synonymous_variant	6336	exon2			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.306C>A	3.37:g.38833624G>T		Somatic		Unspecified	Illumina	Phase_I	38808628	NM_006514	A6NDQ1	Silent	SNP	ENST00000449082.2	37	CCDS33736.1																																																																																				SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514	
NBEAL2	23218	broad.mit.edu	37	3	47039977	47039977	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A036-01	TCGA-AG-A036-01	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr3:47039977T>A	ENST00000450053.3	+	22	3322	c.3143T>A	c.(3142-3144)aTa>aAa	p.I1048K	NBEAL2_ENST00000383740.2_5'UTR|NBEAL2_ENST00000292309.5_Missense_Mutation_p.I1048K	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	1048					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)		p.I609K(1)|p.I1048K(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		ATGTCCAGCATAGTTCGGGAG	0.592											OREG0015546	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I1048K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T3143A	3						.						51.0	53.0	52.0					3																	47039977		2066	4219	6285	47014981	SO:0001583	missense	23218	exon22			AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.3143T>A	3.37:g.47039977T>A	ENSP00000415034:p.Ile1048Lys	Somatic	943	Unspecified	Illumina	Phase_I	47014981	NM_015175	O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	ENST00000450053.3	37	CCDS46817.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.01|14.01	2.406652|2.406652	0.42715|0.42715	.|.	.|.	ENSG00000160796|ENSG00000160796	ENST00000292309;ENST00000450053|ENST00000416683	T;T|.	0.59083|.	0.52;0.29|.	5.31|5.31	4.12|4.12	0.48240|0.48240	Armadillo-like helical (1);|.	0.352161|.	0.29876|.	N|.	0.010979|.	T|.	0.59169|.	0.2174|.	L|L	0.53249|0.53249	1.67|1.67	0.80722|0.80722	D|D	1|1	B|.	0.32245|.	0.361|.	B|.	0.26416|.	0.069|.	T|.	0.56697|.	-0.7936|.	10|.	0.66056|.	D|.	0.02|.	.|.	8.6987|8.6987	0.34312|0.34312	0.0:0.14:0.0:0.86|0.0:0.14:0.0:0.86	.|.	1048|.	Q6ZNJ1|.	NBEL2_HUMAN|.	K|K	1048|520	ENSP00000292309:I1048K;ENSP00000415034:I1048K|.	ENSP00000292309:I1048K|.	I|X	+|+	2|1	0|0	NBEAL2|NBEAL2	47014981|47014981	1.000000|1.000000	0.71417|0.71417	0.780000|0.780000	0.31762|0.31762	0.487000|0.487000	0.33371|0.33371	4.567000|4.567000	0.60850|0.60850	2.234000|2.234000	0.73211|0.73211	0.459000|0.459000	0.35465|0.35465	ATA|TAG		NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3	XM_291064	
RAD54L2	23132	broad.mit.edu	37	3	51697105	51697105	+	Missense_Mutation	SNP	C	C	T	rs139648304		TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr3:51697105C>T	ENST00000409535.2	+	22	4198	c.4073C>T	c.(4072-4074)aCg>aTg	p.T1358M	RAD54L2_ENST00000296477.3_Missense_Mutation_p.T1052M	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	1358						nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)	p.T1358M(1)		NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		TCCTCTTCCACGGCTACCTCA	0.572																																					p.T1358M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4073T	3						.	C	MET/THR	1,4405	2.1+/-5.4	0,1,2202	114.0	109.0	110.0		4073	5.6	1.0	3	dbSNP_134	110	0,8600		0,0,4300	no	missense	RAD54L2	NM_015106.2	81	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	1358/1468	51697105	1,13005	2203	4300	6503	51672145	SO:0001583	missense	23132	exon22			AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.4073C>T	3.37:g.51697105C>T	ENSP00000386520:p.Thr1358Met	Somatic		Unspecified	Illumina	Phase_I	51672145	NM_015106	Q8TB57|Q9BV54	Missense_Mutation	SNP	ENST00000409535.2	37	CCDS33765.2	.	.	.	.	.	.	.	.	.	.	C	15.63	2.891351	0.52014	2.27E-4	0.0	ENSG00000164080	ENST00000409535;ENST00000296477	D;D	0.94046	-3.23;-3.34	5.56	5.56	0.83823	.	0.128261	0.50627	D	0.000112	D	0.86347	0.5911	N	0.08118	0	0.80722	D	1	P;D	0.57257	0.955;0.979	B;B	0.41299	0.289;0.353	D	0.87628	0.2514	10	0.37606	T	0.19	-8.4982	18.5281	0.90980	0.0:1.0:0.0:0.0	.	1358;947	Q9Y4B4;B3KV54	ARIP4_HUMAN;.	M	1358;1052	ENSP00000386520:T1358M;ENSP00000296477:T1052M	ENSP00000296477:T1052M	T	+	2	0	RAD54L2	51672145	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.593000	0.46180	2.609000	0.88269	0.655000	0.94253	ACG		RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328700.2	NM_015106	
FGF12	2257	broad.mit.edu	37	3	191888261	191888261	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr3:191888261G>A	ENST00000454309.2	-	4	1424	c.599C>T	c.(598-600)cCg>cTg	p.P200L	FGF12_ENST00000450716.1_Missense_Mutation_p.P138L|FGF12_ENST00000430714.1_Missense_Mutation_p.P101L|FGF12_ENST00000445105.2_Missense_Mutation_p.P138L|FGF12_ENST00000264730.3_Missense_Mutation_p.P138L	NM_021032.4	NP_066360.1	P61328	FGF12_HUMAN	fibroblast growth factor 12	200					adult locomotory behavior (GO:0008344)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell-cell signaling (GO:0007267)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|JNK cascade (GO:0007254)|negative regulation of cation channel activity (GO:2001258)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|positive regulation of sodium ion transport (GO:0010765)|regulation of membrane depolarization (GO:0003254)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular space (GO:0005615)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)|ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)	p.P72L(1)|p.P200L(1)		endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	30	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)		AATAGGTTTCGGTACAAAATG	0.428																																					p.P138L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C413T	3						.						154.0	155.0	155.0					3																	191888261		2203	4300	6503	193370955	SO:0001583	missense	2257	exon5			U66197	CCDS3301.1, CCDS46983.1	3q28	2008-07-18			ENSG00000114279	ENSG00000114279			3668	protein-coding gene	gene with protein product	"""fibroblast growth factor 12B"", ""fibroblast growth factor homologous factor 1"", ""myocyte-activating factor"", ""fibroblast growth factor FGF-12b"""	601513		FGF12B		8790420, 9345906	Standard	NM_021032		Approved	FHF1	uc003fsx.3	P61328	OTTHUMG00000156132	ENST00000454309.2:c.599C>T	3.37:g.191888261G>A	ENSP00000413496:p.Pro200Leu	Somatic		Unspecified	Illumina	Phase_I	193370955	NM_004113	B2R6B7|B2R976|O35339|P70376|Q8TBG5|Q92912|Q93001	Missense_Mutation	SNP	ENST00000454309.2	37	CCDS3301.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.868522	0.91587	.	.	ENSG00000114279	ENST00000264730;ENST00000392454;ENST00000445105;ENST00000454309;ENST00000440901;ENST00000450716;ENST00000430714;ENST00000448795	T;T;T;T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.82870	0.5131	M	0.74647	2.275	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.83287	-0.0035	10	0.87932	D	0	.	19.6475	0.95784	0.0:0.0:1.0:0.0	.	138;200	P61328-2;P61328	.;FGF12_HUMAN	L	138;138;138;200;95;138;101;114	ENSP00000264730:P138L;ENSP00000393686:P138L;ENSP00000413496:P200L;ENSP00000400948:P95L;ENSP00000397635:P138L;ENSP00000410125:P101L;ENSP00000412904:P114L	ENSP00000264730:P138L	P	-	2	0	FGF12	193370955	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.476000	0.97823	2.885000	0.99019	0.655000	0.94253	CCG		FGF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343160.1	NM_021032	
PTPN11	5781	broad.mit.edu	37	12	112926270	112926270	+	Missense_Mutation	SNP	C	C	T	rs121918457		TCGA-AG-A036-01	TCGA-AG-A036-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr12:112926270C>T	ENST00000351677.2	+	12	1601	c.1403C>T	c.(1402-1404)aCg>aTg	p.T468M		NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	472	Substrate binding. {ECO:0000250}.|Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.		G -> A (in LEOPARD1). {ECO:0000269|PubMed:15121796, ECO:0000269|PubMed:15389709}.		abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)	p.T468M(1)		NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						CGGACAGGGACGTTCATTGTG	0.443			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																												p.T468M			Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1403T	12	GRCh37	CM021672	PTPN11	M	rs121918457	.						126.0	116.0	120.0					12																	112926270		2203	4300	6503	111410653	SO:0001583	missense	5781	exon12	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.1403C>T	12.37:g.112926270C>T	ENSP00000340944:p.Thr468Met	Somatic		Unspecified	Illumina	Phase_I	111410653	NM_002834	A8K1D9|Q96HD7	Missense_Mutation	SNP	ENST00000351677.2	37	CCDS9163.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.764120	0.89932	.	.	ENSG00000179295	ENST00000351677	D	0.99537	-6.11	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	D	0.99718	0.9891	M	0.92738	3.34	0.80722	A	1	D	0.89917	1.0	D	0.80764	0.994	D	0.97478	1.0045	9	0.72032	D	0.01	.	18.7696	0.91885	0.0:1.0:0.0:0.0	.	468	Q06124-2	.	M	468	ENSP00000340944:T468M	ENSP00000340944:T468M	T	+	2	0	PTPN11	111410653	1.000000	0.71417	0.951000	0.38953	0.819000	0.46315	7.397000	0.79903	2.508000	0.84585	0.650000	0.86243	ACG		PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259496.2		
SBNO1	55206	broad.mit.edu	37	12	123815038	123815038	+	Silent	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr12:123815038G>A	ENST00000602398.1	-	9	1189	c.1062C>T	c.(1060-1062)gaC>gaT	p.D354D	SBNO1_ENST00000420886.2_Silent_p.D354D|SBNO1_ENST00000602750.1_Silent_p.D353D|SBNO1_ENST00000267176.4_Silent_p.D353D			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	354					regulation of transcription, DNA-templated (GO:0006355)			p.D353D(1)		NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		CATACTTTAAGTCATTTGAAA	0.274																																					p.D353D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1059T	12						.						72.0	72.0	72.0					12																	123815038		2202	4297	6499	122380991	SO:0001819	synonymous_variant	55206	exon8			AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.1062C>T	12.37:g.123815038G>A		Somatic		Unspecified	Illumina	Phase_I	122380991	NM_018183	Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Silent	SNP	ENST00000602398.1	37	CCDS53844.1																																																																																				SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467684.1	NM_018183	
RIMBP2	23504	broad.mit.edu	37	12	130919422	130919422	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr12:130919422C>A	ENST00000261655.4	-	11	2222	c.2059G>T	c.(2059-2061)Gag>Tag	p.E687*	RIMBP2_ENST00000535703.1_Nonsense_Mutation_p.E595*|RIMBP2_ENST00000536002.1_Nonsense_Mutation_p.E595*	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	687					negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.E687*(1)		NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CTCCTTTTCTCTAACTTGGAA	0.592																																					p.E687X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G2059T	12						.						42.0	48.0	46.0					12																	130919422		2203	4300	6503	129485375	SO:0001587	stop_gained	23504	exon11			AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.2059G>T	12.37:g.130919422C>A	ENSP00000261655:p.Glu687*	Somatic		Unspecified	Illumina	Phase_I	129485375	NM_015347	Q96ID2	Nonsense_Mutation	SNP	ENST00000261655.4	37	CCDS31925.1	.	.	.	.	.	.	.	.	.	.	C	50	16.814226	0.99872	.	.	ENSG00000060709	ENST00000261655;ENST00000392375;ENST00000535703;ENST00000536002	.	.	.	5.0	5.0	0.66597	.	0.127979	0.51477	D	0.000091	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	-18.018	18.3226	0.90243	0.0:1.0:0.0:0.0	.	.	.	.	X	687;595;595;595	.	ENSP00000261655:E687X	E	-	1	0	RIMBP2	129485375	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.548000	0.82154	2.309000	0.77851	0.561000	0.74099	GAG		RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347	
KDM5A	5927	broad.mit.edu	37	12	419112	419112	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr12:419112C>T	ENST00000399788.2	-	22	3597	c.3235G>A	c.(3235-3237)Gac>Aac	p.D1079N	KDM5A_ENST00000382815.4_Missense_Mutation_p.D1079N	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	1079					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.D1079N(2)		NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						ACACCAATGTCGGTCCGGGGG	0.353			T	NUP98	AML																																p.D1079N			Dom	yes		12	12p11	5927	"""lysine (K)-specific demethylase 5A, JARID1A"""		L	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3235A	12						.						60.0	57.0	58.0					12																	419112		1794	4067	5861	289373	SO:0001583	missense	5927	exon22				CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.3235G>A	12.37:g.419112C>T	ENSP00000382688:p.Asp1079Asn	Somatic		Unspecified	Illumina	Phase_I	289373	NM_001042603	A8MV76|Q4LE72|Q86XZ1	Missense_Mutation	SNP	ENST00000399788.2	37	CCDS41736.1	.	.	.	.	.	.	.	.	.	.	C	33	5.285384	0.95517	.	.	ENSG00000073614	ENST00000261253;ENST00000399787;ENST00000399788;ENST00000382815;ENST00000544760	D;D;D	0.86562	-2.14;-1.96;-1.75	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	D	0.88047	0.6332	L	0.56280	1.765	0.80722	D	1	P;P;D	0.55172	0.939;0.791;0.97	P;B;P	0.46253	0.509;0.115;0.509	D	0.88160	0.2857	10	0.54805	T	0.06	-20.4149	20.3081	0.98638	0.0:1.0:0.0:0.0	.	1079;1079;1079	F5H1F7;P29375;P29375-2	.;KDM5A_HUMAN;.	N	698;1038;1079;1079;698	ENSP00000382688:D1079N;ENSP00000372265:D1079N;ENSP00000440622:D698N	ENSP00000261253:D698N	D	-	1	0	KDM5A	289373	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.447000	0.80620	2.795000	0.96236	0.655000	0.94253	GAC		KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397812.1	NM_005056	
CDCA3	83461	broad.mit.edu	37	12	6958266	6958266	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A036-01	TCGA-AG-A036-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr12:6958266A>G	ENST00000538862.2	-	6	1649	c.748T>C	c.(748-750)Tgg>Cgg	p.W250R	CDCA3_ENST00000229265.6_Missense_Mutation_p.W225R|CDCA3_ENST00000604599.1_5'Flank|CDCA3_ENST00000422785.3_Intron|CDCA3_ENST00000540683.1_3'UTR|CDCA3_ENST00000535406.1_Missense_Mutation_p.W250R			Q99618	CDCA3_HUMAN	cell division cycle associated 3	250					mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)		p.W250R(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(1)|stomach(1)	8						CCTTGCTCCCATGCTCGTCCT	0.537																																					p.W250R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T748C	12						.						119.0	98.0	105.0					12																	6958266		2203	4300	6503	6828527	SO:0001583	missense	83461	exon6			BG354576	CCDS8565.1, CCDS73428.1	12p13.31	2010-07-20				ENSG00000111665			14624	protein-coding gene	gene with protein product	"""trigger of mitotic entry 1"""	607749				9074930, 12188893	Standard	XR_242988		Approved	TOME-1, GRCC8	uc001qrg.2	Q99618		ENST00000538862.2:c.748T>C	12.37:g.6958266A>G	ENSP00000442068:p.Trp250Arg	Somatic		Unspecified	Illumina	Phase_I	6828527	NM_031299	A8K5V6|D3DUS6	Missense_Mutation	SNP	ENST00000538862.2	37	CCDS8565.1	.	.	.	.	.	.	.	.	.	.	A	5.975	0.363798	0.11296	.	.	ENSG00000111665	ENST00000229265;ENST00000538862;ENST00000535406	.	.	.	5.53	1.87	0.25490	.	0.501816	0.20111	N	0.099007	T	0.45216	0.1331	L	0.40543	1.245	0.58432	D	0.999997	B	0.18166	0.026	B	0.22601	0.04	T	0.23368	-1.0190	9	0.39692	T	0.17	-9.2387	8.4256	0.32727	0.7842:0.0:0.2158:0.0	.	250	Q99618	CDCA3_HUMAN	R	225;250;250	.	ENSP00000229265:W225R	W	-	1	0	CDCA3	6828527	0.831000	0.29352	0.257000	0.24404	0.038000	0.13279	1.461000	0.35255	0.167000	0.19631	0.533000	0.62120	TGG		CDCA3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401940.2	NM_031299	
PYROXD1	79912	broad.mit.edu	37	12	21590727	21590727	+	Silent	SNP	G	G	C			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr12:21590727G>C	ENST00000240651.9	+	1	117	c.63G>C	c.(61-63)gcG>gcC	p.A21A	PYROXD1_ENST00000545178.1_Silent_p.A21A|PYROXD1_ENST00000538582.1_5'Flank	NM_024854.3	NP_079130.2	Q8WU10	PYRD1_HUMAN	pyridine nucleotide-disulphide oxidoreductase domain 1	21							oxidoreductase activity (GO:0016491)	p.A21A(1)		endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|soft_tissue(1)	18						GCGGCATCGCGGGCGTCACTT	0.682																																					p.A21A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G63C	12						.						18.0	22.0	21.0					12																	21590727		2201	4298	6499	21481994	SO:0001819	synonymous_variant	79912	exon1			AL832441	CCDS31755.1	12p12.1	2014-02-12			ENSG00000121350	ENSG00000121350			26162	protein-coding gene	gene with protein product						12477932	Standard	NM_024854		Approved	DKFZp762G094, FLJ22028	uc001rew.3	Q8WU10	OTTHUMG00000169129	ENST00000240651.9:c.63G>C	12.37:g.21590727G>C		Somatic		Unspecified	Illumina	Phase_I	21481994	NM_024854	A6NKI6|B3KWN8|Q9H6P1	Silent	SNP	ENST00000240651.9	37	CCDS31755.1																																																																																				PYROXD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402363.1	NM_024854	
LMNTD1	160492	broad.mit.edu	37	12	25699468	25699468	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr12:25699468G>A	ENST00000282881.6	-	3	417	c.268C>T	c.(268-270)Ccg>Tcg	p.P90S	IFLTD1_ENST00000458174.2_Missense_Mutation_p.P111S|IFLTD1_ENST00000445693.1_Missense_Mutation_p.P27S|IFLTD1_ENST00000539744.1_5'UTR|IFLTD1_ENST00000413632.2_Missense_Mutation_p.P111S	NM_152590.3	NP_689803.2	Q8N9Z9	LMTD1_HUMAN		90					cell proliferation (GO:0008283)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|nuclear envelope (GO:0005635)	structural molecule activity (GO:0005198)	p.P90S(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	22	all_lung(3;2.75e-22)|Lung NSC(3;1.77e-21)|all_hematologic(7;0.00656)|Colorectal(261;0.0847)					TGTTTCTTCGGAACTGAGAAG	0.378																																					p.P27S												IFLTD1,central_nervous_system,brain,Substitution - Missense,+1	.	1	Substitution - Missense(1)	large_intestine(1)	c.C79T	12						.						44.0	42.0	43.0					12																	25699468		2203	4298	6501	25590735	SO:0001583	missense	160492	exon2																														ENST00000282881.6:c.268C>T	12.37:g.25699468G>A	ENSP00000282881:p.Pro90Ser	Somatic		Unspecified	Illumina	Phase_I	25590735	NM_001145727	B4DL27|B4DY70|Q8IY38	Missense_Mutation	SNP	ENST00000282881.6	37	CCDS8704.1	.	.	.	.	.	.	.	.	.	.	G	9.300	1.052796	0.19907	.	.	ENSG00000152936	ENST00000282881;ENST00000458174;ENST00000445693;ENST00000413632;ENST00000538178;ENST00000540106;ENST00000542224	T;T;T;T	0.18960	2.72;2.7;2.18;2.49	4.94	-0.369	0.12534	.	.	.	.	.	T	0.11281	0.0275	N	0.24115	0.695	0.09310	N	1	B;B;B;B	0.27932	0.047;0.194;0.094;0.123	B;B;B;B	0.23275	0.02;0.045;0.027;0.02	T	0.26815	-1.0092	9	0.72032	D	0.01	.	3.066	0.06214	0.2825:0.0:0.3985:0.3189	.	27;111;111;90	Q8N9Z9-3;Q8N9Z9-5;Q8N9Z9-4;Q8N9Z9	.;.;.;ILFT1_HUMAN	S	90;111;27;111;65;65;65	ENSP00000282881:P90S;ENSP00000407353:P111S;ENSP00000407043:P27S;ENSP00000393150:P111S	ENSP00000282881:P90S	P	-	1	0	IFLTD1	25590735	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-0.262000	0.08682	-0.163000	0.10946	-0.897000	0.02905	CCG		IFLTD1-008	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000402279.1		
KRT82	3888	broad.mit.edu	37	12	52797552	52797552	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr12:52797552C>T	ENST00000257974.2	-	2	630	c.553G>A	c.(553-555)Ggg>Agg	p.G185R	RP3-416H24.4_ENST00000547174.1_RNA	NM_033033.3	NP_149022.3	Q9NSB4	KRT82_HUMAN	keratin 82	185	Coil 1B.|Rod.					keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)	p.G185R(1)|p.S184fs*1(1)		endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	29				BRCA - Breast invasive adenocarcinoma(357;0.193)		ACGCGGTCCCCGGACACACAG	0.592																																					p.G185R												.	.	2	Substitution - Missense(1)|Deletion - Frameshift(1)	ovary(1)|large_intestine(1)	c.G553A	12						.						66.0	71.0	69.0					12																	52797552		2203	4300	6503	51083819	SO:0001583	missense	3888	exon2			Y19207	CCDS8826.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000161850		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6459	protein-coding gene	gene with protein product	"""hard keratin type II 2"""	601078	"""keratin, hair, basic, 2"""	KRTHB2		2431943, 16831889	Standard	NM_033033		Approved	Hb-2	uc001sai.1	Q9NSB4	OTTHUMG00000169636	ENST00000257974.2:c.553G>A	12.37:g.52797552C>T	ENSP00000257974:p.Gly185Arg	Somatic		Unspecified	Illumina	Phase_I	51083819	NM_033033		Missense_Mutation	SNP	ENST00000257974.2	37	CCDS8826.1	.	.	.	.	.	.	.	.	.	.	C	9.070	0.996662	0.19043	.	.	ENSG00000161850	ENST00000257974	T	0.75589	-0.95	5.21	4.32	0.51571	Filament (1);	0.126723	0.35179	N	0.003381	T	0.64011	0.2560	L	0.39633	1.23	0.27431	N	0.953991	B	0.25169	0.119	B	0.26094	0.066	T	0.61187	-0.7113	10	0.87932	D	0	.	7.4794	0.27395	0.0:0.7143:0.1373:0.1484	.	185	Q9NSB4	KRT82_HUMAN	R	185	ENSP00000257974:G185R	ENSP00000257974:G185R	G	-	1	0	KRT82	51083819	0.000000	0.05858	0.856000	0.33681	0.177000	0.22998	-0.268000	0.08607	1.336000	0.45506	0.462000	0.41574	GGG		KRT82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405189.1	NM_033033	
ZNF385A	25946	broad.mit.edu	37	12	54765484	54765484	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr12:54765484C>G	ENST00000338010.5	-	5	490	c.437G>C	c.(436-438)gGa>gCa	p.G146A	RP11-753H16.5_ENST00000552785.1_RNA|ZNF385A_ENST00000552382.1_5'UTR|ZNF385A_ENST00000551771.1_Intron|ZNF385A_ENST00000551109.1_Missense_Mutation_p.G126A|ZNF385A_ENST00000546970.1_Missense_Mutation_p.G126A|RP11-753H16.3_ENST00000550474.1_RNA|ZNF385A_ENST00000352268.6_Intron|ZNF385A_ENST00000394313.2_Missense_Mutation_p.G126A	NM_001130967.1	NP_001124439.1	Q96PM9	Z385A_HUMAN	zinc finger protein 385A	146	Necessary for binding to ITPR1, CEBPA and p53/TP53 mRNAs. {ECO:0000250}.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|hemostasis (GO:0007599)|learning or memory (GO:0007611)|locomotory behavior (GO:0007626)|megakaryocyte development (GO:0035855)|mRNA localization resulting in posttranscriptional regulation of gene expression (GO:0010609)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)|positive regulation of DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:1902164)|positive regulation of fat cell differentiation (GO:0045600)|regulation of cytoplasmic translation (GO:2000765)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA 3'-UTR binding (GO:0003730)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.G126A(2)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|urinary_tract(1)	15						TGGCCCCAGTCCATTCTCCAT	0.582																																					p.G126A												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G377C	12						.						45.0	50.0	48.0					12																	54765484		2203	4300	6503	53051751	SO:0001583	missense	25946	exon4			AF304052	CCDS8879.1, CCDS44910.1, CCDS44911.1	12q13.13	2012-10-05	2007-12-06	2007-12-06		ENSG00000161642			17521	protein-coding gene	gene with protein product		609124	"""zinc finger protein 385"""	ZNF385			Standard	XM_005268785		Approved	DKFZp586G1122, Hzf, ZFP385	uc001sfy.3	Q96PM9	OTTHUMG00000169840	ENST00000338010.5:c.437G>C	12.37:g.54765484C>G	ENSP00000338927:p.Gly146Ala	Somatic		Unspecified	Illumina	Phase_I	53051751	NM_015481	B2RDN5|B4DKH2|F1T0F1|J3KNS3|Q5VH53|Q9H7R6|Q9UFU3	Missense_Mutation	SNP	ENST00000338010.5	37	CCDS44911.1	.	.	.	.	.	.	.	.	.	.	C	1.319	-0.599919	0.03744	.	.	ENSG00000161642	ENST00000551109;ENST00000394313;ENST00000338010;ENST00000546970;ENST00000546919;ENST00000549937;ENST00000549962;ENST00000547210;ENST00000550774;ENST00000550120	T;T;T;T;T;T;T;T;T	0.45668	1.52;1.52;1.51;1.52;1.52;1.59;0.89;0.89;0.96	3.43	3.43	0.39272	.	0.355152	0.21932	N	0.067020	T	0.14356	0.0347	N	0.03608	-0.345	0.80722	D	1	P;B;B	0.37500	0.597;0.143;0.056	B;B;B	0.29077	0.098;0.028;0.01	T	0.15150	-1.0447	10	0.07175	T	0.84	-0.308	10.5707	0.45198	0.0:1.0:0.0:0.0	.	126;126;126	F8VRY0;Q96PM9;F1T0F1	.;Z385A_HUMAN;.	A	126;126;146;126;126;154;109;126;126;89	ENSP00000449161:G126A;ENSP00000377849:G126A;ENSP00000338927:G146A;ENSP00000446913:G126A;ENSP00000448466:G126A;ENSP00000448567:G154A;ENSP00000450149:G109A;ENSP00000448264:G126A;ENSP00000449462:G126A	ENSP00000338927:G146A	G	-	2	0	ZNF385A	53051751	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.855000	0.48333	1.942000	0.56320	0.561000	0.74099	GGA		ZNF385A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406162.1	NM_015481	
NCKAP1L	3071	broad.mit.edu	37	12	54901673	54901673	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A036-01	TCGA-AG-A036-01	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr12:54901673T>A	ENST00000293373.6	+	4	422	c.343T>A	c.(343-345)Tgc>Agc	p.C115S	NCKAP1L_ENST00000545638.2_Missense_Mutation_p.C65S	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	115					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)	p.C115S(1)		NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						CATTGATGCCTGCCAGTGCCA	0.418																																					p.C65S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T193A	12						.						241.0	228.0	233.0					12																	54901673		2203	4300	6503	53187940	SO:0001583	missense	3071	exon4			AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.343T>A	12.37:g.54901673T>A	ENSP00000293373:p.Cys115Ser	Somatic		Unspecified	Illumina	Phase_I	53187940	NM_001184976	B4DUT5|Q52LW0	Missense_Mutation	SNP	ENST00000293373.6	37	CCDS31813.1	.	.	.	.	.	.	.	.	.	.	T	14.41	2.527560	0.44969	.	.	ENSG00000123338	ENST00000293373;ENST00000545638	T;T	0.28895	1.59;1.59	5.53	5.53	0.82687	.	0.049689	0.85682	D	0.000000	T	0.34542	0.0901	L	0.46741	1.465	0.58432	D	0.999997	P	0.48089	0.905	P	0.49597	0.616	T	0.05435	-1.0885	10	0.13853	T	0.58	-12.873	13.603	0.62031	0.0:0.0:0.0:1.0	.	115	P55160	NCKPL_HUMAN	S	115;65	ENSP00000293373:C115S;ENSP00000445596:C65S	ENSP00000293373:C115S	C	+	1	0	NCKAP1L	53187940	1.000000	0.71417	1.000000	0.80357	0.812000	0.45895	3.178000	0.50879	2.100000	0.63781	0.374000	0.22700	TGC		NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406195.1	NM_005337	
GLIPR1	11010	broad.mit.edu	37	12	75874745	75874745	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr12:75874745G>A	ENST00000266659.3	+	1	286	c.85G>A	c.(85-87)Gaa>Aaa	p.E29K		NM_006851.2	NP_006842.2	P48060	GLIP1_HUMAN	GLI pathogenesis-related 1	29					cellular lipid metabolic process (GO:0044255)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.E29K(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	14						GCCAGATATCGAAAATGAAGA	0.403																																					p.E29K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G85A	12						.						92.0	87.0	89.0					12																	75874745		2203	4300	6503	74161012	SO:0001583	missense	11010	exon1			U16307	CCDS9011.1	12q14.1	2008-08-15	2008-08-15			ENSG00000139278			17001	protein-coding gene	gene with protein product		602692	"""GLI pathogenesis-related 1 (glioma)"""			7607567, 8973356	Standard	NM_006851		Approved	RTVP1, GliPR	uc001sxs.3	P48060	OTTHUMG00000169757	ENST00000266659.3:c.85G>A	12.37:g.75874745G>A	ENSP00000266659:p.Glu29Lys	Somatic		Unspecified	Illumina	Phase_I	74161012	NM_006851	A7YET6|F8VUC2|Q15409|Q969K2	Missense_Mutation	SNP	ENST00000266659.3	37	CCDS9011.1	.	.	.	.	.	.	.	.	.	.	G	5.239	0.229495	0.09916	.	.	ENSG00000139278	ENST00000266659;ENST00000456650	T;T	0.41400	1.0;1.0	6.03	-2.8	0.05823	CAP domain (2);	0.834705	0.11253	N	0.583421	T	0.18425	0.0442	N	0.14661	0.345	0.09310	N	1	B;B	0.12630	0.006;0.001	B;B	0.08055	0.003;0.001	T	0.31779	-0.9931	10	0.08837	T	0.75	.	6.7535	0.23499	0.4329:0.2017:0.3653:0.0	.	29;29	F6VVE8;P48060	.;GLIP1_HUMAN	K	29	ENSP00000266659:E29K;ENSP00000391144:E29K	ENSP00000266659:E29K	E	+	1	0	GLIPR1	74161012	0.000000	0.05858	0.000000	0.03702	0.559000	0.35586	-0.048000	0.11944	-0.588000	0.05882	-0.137000	0.14449	GAA		GLIPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405722.1	NM_006851	
EPYC	1833	broad.mit.edu	37	12	91363838	91363838	+	Missense_Mutation	SNP	G	G	C	rs374036301		TCGA-AG-A036-01	TCGA-AG-A036-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr12:91363838G>C	ENST00000261172.3	-	6	873	c.781C>G	c.(781-783)Cga>Gga	p.R261G		NM_004950.4	NP_004941.2	Q99645	EPYC_HUMAN	epiphycan	261					female pregnancy (GO:0007565)	proteinaceous extracellular matrix (GO:0005578)	glycosaminoglycan binding (GO:0005539)	p.R261G(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(8)|skin(2)	18						TGAAGGGCTCGTAGATTTTCT	0.478																																					p.R261G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C781G	12						.						210.0	212.0	211.0					12																	91363838		2203	4300	6503	89887969	SO:0001583	missense	1833	exon6			AF031658	CCDS31870.1	12q21	2010-03-19	2006-11-21	2006-11-21	ENSG00000083782	ENSG00000083782		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	3053	protein-coding gene	gene with protein product	"""epiphycan proteoglycan"""	601657	"""dermatan sulphate proteoglycan 3"", ""dermatan sulfate proteoglycan 3"""	DSPG3		8975717	Standard	NM_004950		Approved	Pg-Lb, SLRR3B	uc001tbk.3	Q99645	OTTHUMG00000170072	ENST00000261172.3:c.781C>G	12.37:g.91363838G>C	ENSP00000261172:p.Arg261Gly	Somatic		Unspecified	Illumina	Phase_I	89887969	NM_004950	A8K3M7|Q8NEJ5	Missense_Mutation	SNP	ENST00000261172.3	37	CCDS31870.1	.	.	.	.	.	.	.	.	.	.	G	12.50	1.955270	0.34471	.	.	ENSG00000083782	ENST00000261172	T	0.02682	4.2	5.33	3.44	0.39384	.	0.279542	0.37053	N	0.002274	T	0.09024	0.0223	M	0.75615	2.305	0.09310	N	1	P	0.51449	0.945	P	0.50136	0.632	T	0.03443	-1.1036	10	0.87932	D	0	.	14.3393	0.66614	0.0:0.0:0.7301:0.2699	.	261	Q99645	EPYC_HUMAN	G	261	ENSP00000261172:R261G	ENSP00000261172:R261G	R	-	1	2	EPYC	89887969	0.690000	0.27699	0.007000	0.13788	0.271000	0.26615	3.984000	0.56923	0.582000	0.29556	0.467000	0.42956	CGA		EPYC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407146.2	NM_004950	
CRADD	8738	broad.mit.edu	37	12	94243920	94243920	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr12:94243920C>T	ENST00000542893.2	+	3	791	c.473C>T	c.(472-474)tCg>tTg	p.S158L	CRADD_ENST00000332896.3_Missense_Mutation_p.S158L|CRADD_ENST00000548330.1_3'UTR|CRADD_ENST00000548483.1_Intron|CRADD_ENST00000541813.1_Intron			P78560	CRADD_HUMAN	CASP2 and RIPK1 domain containing adaptor with death domain	158	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to mechanical stimulus (GO:0071260)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|positive regulation of apoptotic signaling pathway (GO:2001235)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	death domain binding (GO:0070513)|protease binding (GO:0002020)|protein binding, bridging (GO:0030674)	p.S158L(1)		endometrium(1)|large_intestine(5)|lung(1)|ovary(1)	8						AACGTGCAGTCGCAGGTGGTG	0.657																																					p.S158L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C473T	12						.						54.0	49.0	50.0					12																	94243920		2203	4300	6503	92768051	SO:0001583	missense	8738	exon3			U84388	CCDS9048.1	12q21.33-q23.1	2008-08-04				ENSG00000169372			2340	protein-coding gene	gene with protein product	"""RIP-associated ICH1/CED3-homologous protein with death domain"""	603454				8985253, 9044836	Standard	NM_003805		Approved	RAIDD	uc001tda.3	P78560		ENST00000542893.2:c.473C>T	12.37:g.94243920C>T	ENSP00000439068:p.Ser158Leu	Somatic		Unspecified	Illumina	Phase_I	92768051	NM_003805	B7Z2Q5	Missense_Mutation	SNP	ENST00000542893.2	37	CCDS9048.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.766118	0.90020	.	.	ENSG00000169372	ENST00000332896;ENST00000542893	D;D	0.93604	-3.25;-3.25	5.76	5.76	0.90799	Death (3);DEATH-like (2);	0.353759	0.30374	N	0.009775	D	0.95268	0.8465	M	0.68952	2.095	0.80722	D	1	D	0.67145	0.996	P	0.55112	0.769	D	0.94244	0.7487	10	0.41790	T	0.15	-4.6403	19.9772	0.97314	0.0:1.0:0.0:0.0	.	158	P78560	CRADD_HUMAN	L	158	ENSP00000327647:S158L;ENSP00000439068:S158L	ENSP00000327647:S158L	S	+	2	0	CRADD	92768051	0.999000	0.42202	0.948000	0.38648	0.971000	0.66376	3.926000	0.56491	2.724000	0.93272	0.563000	0.77884	TCG		CRADD-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408515.1	NM_003805	
RAN	5901	broad.mit.edu	37	12	131357439	131357439	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr12:131357439C>T	ENST00000543796.1	+	3	353	c.95C>T	c.(94-96)aCt>aTt	p.T32I	RAN_ENST00000392369.2_Missense_Mutation_p.T32I|RAN_ENST00000254675.3_5'UTR|RAN_ENST00000392367.3_Missense_Mutation_p.T32I|RAN_ENST00000541630.1_5'UTR			P62826	RAN_HUMAN	RAN, member RAS oncogene family	32					actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|cellular protein complex localization (GO:0034629)|DNA metabolic process (GO:0006259)|gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription, DNA-templated (GO:0045893)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)	p.T32I(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(2)	9	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	Lung NSC(355;7.46e-07)|all_epithelial(31;7.36e-06)		OV - Ovarian serous cystadenocarcinoma(86;9.18e-49)|Epithelial(86;1.42e-45)|all cancers(50;6.28e-40)		CGTCATTTGACTGGTGAATTT	0.398																																					p.T32I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C95T	12						.						337.0	321.0	327.0					12																	131357439		2203	4300	6503	129923392	SO:0001583	missense	5901	exon3			M31469	CCDS9271.1, CCDS73546.1	12q24.33	2014-05-09			ENSG00000132341	ENSG00000132341			9846	protein-coding gene	gene with protein product		601179				8421051	Standard	XM_005253592		Approved	ARA24, TC4, Gsp1	uc001uir.3	P62826	OTTHUMG00000134328	ENST00000543796.1:c.95C>T	12.37:g.131357439C>T	ENSP00000446215:p.Thr32Ile	Somatic		Unspecified	Illumina	Phase_I	129923392	NM_006325	A8K3Z8|P17080|P28746|P28747|Q6IPB2|Q86V08|Q8NI90|Q9CSP3|Q9CWI7|Q9CZA2|Q9UDJ5|Q9UEU9	Missense_Mutation	SNP	ENST00000543796.1	37	CCDS9271.1	.	.	.	.	.	.	.	.	.	.	C	17.32	3.360201	0.61403	.	.	ENSG00000132341	ENST00000543796;ENST00000448750;ENST00000392369;ENST00000535090;ENST00000392367	T;T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12;-1.12	3.72	2.81	0.32909	Small GTP-binding protein domain (1);	0.057033	0.64402	D	0.000001	T	0.78000	0.4215	M	0.79011	2.435	0.80722	D	1	B;B	0.25390	0.125;0.125	B;B	0.32980	0.156;0.156	T	0.75952	-0.3136	10	0.66056	D	0.02	-7.5365	9.9664	0.41727	0.0:0.8979:0.0:0.1021	.	32;32	A8K3Z8;P62826	.;RAN_HUMAN	I	32;50;32;28;32	ENSP00000446215:T32I;ENSP00000396127:T50I;ENSP00000376176:T32I;ENSP00000444042:T28I;ENSP00000376174:T32I	ENSP00000376174:T32I	T	+	2	0	RAN	129923392	1.000000	0.71417	0.724000	0.30704	0.495000	0.33615	6.785000	0.75089	0.675000	0.31264	0.511000	0.50034	ACT		RAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259441.2	NM_006325	
UNC13C	440279	broad.mit.edu	37	15	54786896	54786896	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A036-01	TCGA-AG-A036-01	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr15:54786896T>G	ENST00000260323.11	+	19	5024	c.5024T>G	c.(5023-5025)cTt>cGt	p.L1675R	UNC13C_ENST00000545554.1_Missense_Mutation_p.L1675R|UNC13C_ENST00000537900.1_Missense_Mutation_p.L1673R	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1675	MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)	p.L1675R(1)		breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GTGCGTGAACTTCCTGCCTTC	0.353																																					p.L1675R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T5024G	15						.						167.0	162.0	164.0					15																	54786896		1856	4096	5952	52574188	SO:0001583	missense	440279	exon18			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.5024T>G	15.37:g.54786896T>G	ENSP00000260323:p.Leu1675Arg	Somatic		Unspecified	Illumina	Phase_I	52574188	NM_001080534	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.382471	0.82792	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;D;T	0.81499	-1.49;-1.5;-1.49	5.87	5.87	0.94306	Munc13 homology 1 (1);	0.000000	0.85682	D	0.000000	D	0.90497	0.7023	M	0.85373	2.75	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.91240	0.5021	10	0.54805	T	0.06	.	15.7569	0.78037	0.0:0.0:0.0:1.0	.	1675	Q8NB66	UN13C_HUMAN	R	1675;1675;1673	ENSP00000260323:L1675R;ENSP00000438156:L1675R;ENSP00000442569:L1673R	ENSP00000260323:L1675R	L	+	2	0	UNC13C	52574188	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.997000	0.88414	2.371000	0.80710	0.533000	0.62120	CTT		UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
ALDH1A2	8854	broad.mit.edu	37	15	58257942	58257942	+	Silent	SNP	A	A	G			TCGA-AG-A036-01	TCGA-AG-A036-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr15:58257942A>G	ENST00000249750.4	-	8	1649	c.882T>C	c.(880-882)atT>atC	p.I294I	ALDH1A2_ENST00000537372.1_Silent_p.I273I|ALDH1A2_ENST00000559517.1_Silent_p.I198I|ALDH1A2_ENST00000347587.3_Silent_p.I256I|ALDH1A2_ENST00000558231.1_Silent_p.I265I	NM_003888.3	NP_003879.2	O94788	AL1A2_HUMAN	aldehyde dehydrogenase 1 family, member A2	294					9-cis-retinoic acid biosynthetic process (GO:0042904)|anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|cardiac muscle tissue development (GO:0048738)|cellular response to retinoic acid (GO:0071300)|determination of bilateral symmetry (GO:0009855)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract development (GO:0048566)|embryonic forelimb morphogenesis (GO:0035115)|face development (GO:0060324)|heart morphogenesis (GO:0003007)|hindbrain development (GO:0030902)|kidney development (GO:0001822)|liver development (GO:0001889)|lung development (GO:0030324)|midgut development (GO:0007494)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of cell proliferation (GO:0008285)|neural crest cell development (GO:0014032)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|proximal/distal pattern formation (GO:0009954)|regulation of endothelial cell proliferation (GO:0001936)|response to cytokine (GO:0034097)|response to estradiol (GO:0032355)|response to vitamin A (GO:0033189)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)|retinoic acid receptor signaling pathway (GO:0048384)|retinol metabolic process (GO:0042572)|ureter maturation (GO:0035799)|vitamin A metabolic process (GO:0006776)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)	3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|retinal binding (GO:0016918)|retinal dehydrogenase activity (GO:0001758)	p.I294I(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	Tretinoin(DB00755)|Vitamin A(DB00162)	CAGCAAAAATAATATTAGGAC	0.413																																					p.I198I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T594C	15						.						117.0	118.0	118.0					15																	58257942		2192	4292	6484	56045234	SO:0001819	synonymous_variant	8854	exon6			AB015228	CCDS10163.1, CCDS10164.1, CCDS45266.1, CCDS55968.1	15q21.2	2011-02-18			ENSG00000128918	ENSG00000128918		"""Aldehyde dehydrogenases"""	15472	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 2"""	603687				9819382	Standard	NM_003888		Approved	RALDH2	uc002aex.3	O94788	OTTHUMG00000132624	ENST00000249750.4:c.882T>C	15.37:g.58257942A>G		Somatic		Unspecified	Illumina	Phase_I	56045234	NM_170697	B3KY52|B4DZR2|F5H2Y9|H0YM00|Q2PJS6|Q8NHQ4|Q9UBR8|Q9UFY0	Silent	SNP	ENST00000249750.4	37	CCDS10163.1																																																																																				ALDH1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255869.1		
SMAD3	4088	broad.mit.edu	37	15	67479829	67479829	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr15:67479829G>C	ENST00000327367.4	+	8	1446	c.1136G>C	c.(1135-1137)gGc>gCc	p.G379A	SMAD3_ENST00000439724.3_Missense_Mutation_p.G335A|SMAD3_ENST00000540846.2_Missense_Mutation_p.G274A|SMAD3_ENST00000537194.2_Missense_Mutation_p.G184A	NM_005902.3	NP_005893.1	P84022	SMAD3_HUMAN	SMAD family member 3	379	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell-cell junction organization (GO:0045216)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|embryonic pattern specification (GO:0009880)|endoderm development (GO:0007492)|evasion or tolerance of host defenses by virus (GO:0019049)|extrinsic apoptotic signaling pathway (GO:0097191)|gene expression (GO:0010467)|heart looping (GO:0001947)|immune response (GO:0006955)|immune system development (GO:0002520)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|lens fiber cell differentiation (GO:0070306)|liver development (GO:0001889)|mesoderm formation (GO:0001707)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)|nodal signaling pathway (GO:0038092)|osteoblast development (GO:0002076)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta3 production (GO:0032916)|primary miRNA processing (GO:0031053)|protein stabilization (GO:0050821)|regulation of binding (GO:0051098)|regulation of epithelial cell proliferation (GO:0050678)|regulation of immune response (GO:0050776)|regulation of striated muscle tissue development (GO:0016202)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|somitogenesis (GO:0001756)|T cell activation (GO:0042110)|thyroid gland development (GO:0030878)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transdifferentiation (GO:0060290)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transport (GO:0006810)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nuclear inner membrane (GO:0005637)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|bHLH transcription factor binding (GO:0043425)|chromatin DNA binding (GO:0031490)|co-SMAD binding (GO:0070410)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G379A(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(11)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(7;0.125)		TTCGTCAAAGGCTGGGGAGCG	0.597																																					p.G335A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1004C	15						.						112.0	107.0	109.0					15																	67479829		2201	4299	6500	65266883	SO:0001583	missense	4088	exon8			BC050743	CCDS10222.1, CCDS45288.1, CCDS53950.1, CCDS53951.1	15q21-q22	2006-11-06	2006-11-06	2004-05-26	ENSG00000166949	ENSG00000166949		"""SMADs"""	6769	protein-coding gene	gene with protein product		603109	"""MAD, mothers against decapentaplegic homolog 3 (Drosophila)"", ""SMAD, mothers against DPP homolog 3 (Drosophila)"""	MADH3		8774881, 8673135	Standard	NM_001145102		Approved	JV15-2, HsT17436	uc002aqj.3	P84022	OTTHUMG00000133230	ENST00000327367.4:c.1136G>C	15.37:g.67479829G>C	ENSP00000332973:p.Gly379Ala	Somatic		Unspecified	Illumina	Phase_I	65266883	NM_001145103	A8K4B6|B7Z4Z5|B7Z6M9|B7Z9Q2|F5H383|O09064|O09144|O14510|O35273|Q92940|Q93002|Q9GKR4	Missense_Mutation	SNP	ENST00000327367.4	37	CCDS10222.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.046774	0.93740	.	.	ENSG00000166949	ENST00000327367;ENST00000535241;ENST00000540846;ENST00000439724;ENST00000537194	D;D;D;D	0.99483	-5.99;-5.99;-5.99;-5.99	5.71	5.71	0.89125	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.103998	0.64402	D	0.000003	D	0.99684	0.9881	M	0.93808	3.46	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.97802	1.0245	10	0.87932	D	0	.	19.8575	0.96767	0.0:0.0:1.0:0.0	.	335;379	B7Z4Z5;P84022	.;SMAD3_HUMAN	A	379;379;274;335;184	ENSP00000332973:G379A;ENSP00000437757:G274A;ENSP00000401133:G335A;ENSP00000445348:G184A	ENSP00000332973:G379A	G	+	2	0	SMAD3	65266883	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	9.633000	0.98432	2.698000	0.92095	0.561000	0.74099	GGC		SMAD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256967.2	NM_005902	
RASGRF1	5923	broad.mit.edu	37	15	79339164	79339164	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr15:79339164G>A	ENST00000419573.3	-	5	1076	c.802C>T	c.(802-804)Cgc>Tgc	p.R268C	RASGRF1_ENST00000560334.1_5'UTR|RASGRF1_ENST00000558480.2_Missense_Mutation_p.R268C	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	268	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R268C(1)		breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						CGCAGCGGGCGCAGGAAATTG	0.587																																					p.R268C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C802T	15						.						133.0	107.0	116.0					15																	79339164		2196	4293	6489	77126219	SO:0001583	missense	5923	exon5			M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.802C>T	15.37:g.79339164G>A	ENSP00000405963:p.Arg268Cys	Somatic		Unspecified	Illumina	Phase_I	77126219	NM_002891	F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	ENST00000419573.3	37	CCDS10309.1	.	.	.	.	.	.	.	.	.	.	G	18.51	3.639842	0.67244	.	.	ENSG00000058335	ENST00000419573;ENST00000394741	T	0.65178	-0.14	4.03	4.03	0.46877	Dbl homology (DH) domain (5);	0.072935	0.53938	D	0.000041	T	0.72374	0.3452	L	0.46157	1.445	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;0.997	T	0.75758	-0.3205	10	0.87932	D	0	.	13.7003	0.62604	0.0:0.0:1.0:0.0	.	268;268;268;268	A8K270;Q8IUU5;Q13972;F8VPA5	.;.;RGRF1_HUMAN;.	C	268	ENSP00000405963:R268C	ENSP00000378224:R268C	R	-	1	0	RASGRF1	77126219	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	2.169000	0.42434	2.072000	0.62099	0.655000	0.94253	CGC		RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891	
NCAPG	64151	broad.mit.edu	37	4	17829924	17829924	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-A036-01	TCGA-AG-A036-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr4:17829924A>T	ENST00000251496.2	+	12	1853	c.1677A>T	c.(1675-1677)aaA>aaT	p.K559N		NM_022346.4	NP_071741.2	Q9BPX3	CND3_HUMAN	non-SMC condensin I complex, subunit G	559					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)		p.K559N(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	27				STAD - Stomach adenocarcinoma(129;0.18)		CATTGCAGAAATGTCTTATTT	0.358																																					p.K559N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1677T	4						.						137.0	135.0	136.0					4																	17829924		2203	4300	6503	17439022	SO:0001583	missense	64151	exon12			AF331796	CCDS3424.1	4p15.32	2014-01-15			ENSG00000109805	ENSG00000109805			24304	protein-coding gene	gene with protein product	"""chromosome condensation protein G"""	606280				10910072, 11136719	Standard	NM_022346		Approved	FLJ12450, hCAP-G, CAP-G, YCG1	uc003gpp.4	Q9BPX3	OTTHUMG00000128539	ENST00000251496.2:c.1677A>T	4.37:g.17829924A>T	ENSP00000251496:p.Lys559Asn	Somatic		Unspecified	Illumina	Phase_I	17439022	NM_022346	Q3MJE0|Q96SV9|Q9BUR3|Q9BVY1|Q9H914|Q9H9Z6|Q9HBI9	Missense_Mutation	SNP	ENST00000251496.2	37	CCDS3424.1	.	.	.	.	.	.	.	.	.	.	A	18.47	3.631598	0.67015	.	.	ENSG00000109805	ENST00000251496;ENST00000510063	T;T	0.52983	0.64;0.64	5.01	1.78	0.24846	Armadillo-type fold (1);	0.094038	0.64402	D	0.000001	T	0.62502	0.2433	M	0.76328	2.33	0.53005	D	0.999968	D	0.89917	1.0	D	0.79784	0.993	T	0.61797	-0.6989	10	0.72032	D	0.01	-17.5901	7.5322	0.27689	0.5015:0.0:0.4985:0.0	.	559	Q9BPX3	CND3_HUMAN	N	559;124	ENSP00000251496:K559N;ENSP00000425625:K124N	ENSP00000251496:K559N	K	+	3	2	NCAPG	17439022	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	0.702000	0.25631	0.488000	0.27723	-0.472000	0.04984	AAA		NCAPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250375.1	NM_022346	
SLC34A2	10568	broad.mit.edu	37	4	25664165	25664165	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr4:25664165G>A	ENST00000382051.3	+	2	93	c.43G>A	c.(43-45)Gat>Aat	p.D15N	SLC34A2_ENST00000503434.1_Missense_Mutation_p.D15N|SLC34A2_ENST00000504570.1_Missense_Mutation_p.D15N	NM_001177998.1|NM_006424.2	NP_001171469.1|NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 2	15					aging (GO:0007568)|cellular phosphate ion homeostasis (GO:0030643)|in utero embryonic development (GO:0001701)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|response to fructose (GO:0009750)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	phosphate ion binding (GO:0042301)|sodium ion binding (GO:0031402)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)	p.D15N(1)	SLC34A2/ROS1(14)	breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(4)	41		Breast(46;0.0503)				GCCCAACCCCGATAAGTACCT	0.547			T	ROS1	NSCLC																																p.D15N			Dom	yes		4	4p15.2	10568	"""solute carrier family 34 (sodium phosphate), member 2"""		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G43A	4						.						55.0	55.0	55.0					4																	25664165		2203	4300	6503	25273263	SO:0001583	missense	10568	exon2			AF111856	CCDS3435.1, CCDS54750.1	4p15.2	2013-07-17	2013-07-17		ENSG00000157765	ENSG00000157765		"""Solute carriers"""	11020	protein-coding gene	gene with protein product		604217	"""solute carrier family 34 (sodium phosphate), member 2"""			10329428, 10610722	Standard	NM_006424		Approved	NAPI-3B	uc003grr.3	O95436	OTTHUMG00000097757	ENST00000382051.3:c.43G>A	4.37:g.25664165G>A	ENSP00000371483:p.Asp15Asn	Somatic		Unspecified	Illumina	Phase_I	25273263	NM_001177999	A5PL17|Q8N2K2|Q8WYA9|Q9P0V7	Missense_Mutation	SNP	ENST00000382051.3	37	CCDS3435.1	.	.	.	.	.	.	.	.	.	.	G	2.796	-0.250195	0.05867	.	.	ENSG00000157765	ENST00000513204;ENST00000504570;ENST00000382051;ENST00000503434;ENST00000507530	T;T;T;T;T	0.54279	0.58;1.97;1.97;1.97;0.58	5.52	-4.5	0.03493	.	1.911480	0.02175	N	0.060064	T	0.23611	0.0571	N	0.03115	-0.41	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.41179	-0.9523	10	0.02654	T	1	1.7155	7.8636	0.29524	0.5117:0.0:0.3863:0.102	.	15;15	O95436-2;O95436	.;NPT2B_HUMAN	N	15	ENSP00000423038:D15N;ENSP00000425501:D15N;ENSP00000371483:D15N;ENSP00000423021:D15N;ENSP00000424266:D15N	ENSP00000371483:D15N	D	+	1	0	SLC34A2	25273263	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	0.088000	0.14979	-1.138000	0.02884	-0.238000	0.12139	GAT		SLC34A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214990.1	NM_006424	
GLUD2	2747	broad.mit.edu	37	X	120182603	120182603	+	Silent	SNP	T	T	C			TCGA-AG-A036-01	TCGA-AG-A036-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chrX:120182603T>C	ENST00000328078.1	+	1	1142	c.1065T>C	c.(1063-1065)caT>caC	p.H355H		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	355					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)	p.H355H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						AATTGCAACATGGGTCCATTC	0.473																																					p.H355H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1065C	X						.						209.0	190.0	196.0					X																	120182603		2203	4300	6503	120010284	SO:0001819	synonymous_variant	2747	exon1			U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.1065T>C	X.37:g.120182603T>C		Somatic		Unspecified	Illumina	Phase_I	120010284	NM_012084	B2R8G0|Q9UDQ4	Silent	SNP	ENST00000328078.1	37	CCDS14603.1																																																																																				GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058133.1	NM_012084	
ZNF280C	55609	broad.mit.edu	37	X	129364660	129364660	+	Silent	SNP	A	A	T			TCGA-AG-A036-01	TCGA-AG-A036-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chrX:129364660A>T	ENST00000370978.4	-	9	966	c.813T>A	c.(811-813)atT>atA	p.I271I		NM_017666.4	NP_060136.1	Q8ND82	Z280C_HUMAN	zinc finger protein 280C	271					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I271I(1)		endometrium(3)|kidney(4)|large_intestine(9)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	26						CTGATTTAACAATTACTCCCA	0.348																																					p.I271I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T813A	X						.						120.0	112.0	115.0					X																	129364660		2202	4300	6502	129192341	SO:0001819	synonymous_variant	55609	exon9			AL834333	CCDS14622.1	Xq25	2008-05-02	2007-09-20	2007-09-20	ENSG00000056277	ENSG00000056277			25955	protein-coding gene	gene with protein product			"""suppressor of hairy wing homolog 3 (Drosophila)"""	SUHW3		12477932	Standard	NM_017666		Approved	FLJ20095, ZNF633	uc004evm.3	Q8ND82	OTTHUMG00000022393	ENST00000370978.4:c.813T>A	X.37:g.129364660A>T		Somatic		Unspecified	Illumina	Phase_I	129192341	NM_017666	A8K2V8|Q9NXR3	Silent	SNP	ENST00000370978.4	37	CCDS14622.1																																																																																				ZNF280C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058251.1	NM_017666	
PLXNA3	55558	broad.mit.edu	37	X	153695105	153695105	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AG-A036-01	TCGA-AG-A036-01			A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chrX:153695105delA	ENST00000369682.3	+	17	3251	c.3076delA	c.(3076-3078)accfs	p.T1026fs		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	1026	IPT/TIG 3.				axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCCCACCGTCACCCGCCTTGA	0.642																																					p.T1026fs												.	.	0			c.3076delA	X						.						39.0	33.0	35.0					X																	153695105		2188	4292	6480	153348299	SO:0001589	frameshift_variant	55558	exon17			X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.3076delA	X.37:g.153695105delA	ENSP00000358696:p.Thr1026fs	None		Unspecified	Illumina	Phase_I	153348299	NM_017514	Q5HY36	Frame_Shift_Del	DEL	ENST00000369682.3	37	CCDS14752.1																																																																																				PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081634.1	NM_017514	
CLIC2	1193	broad.mit.edu	37	X	154528113	154528113	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chrX:154528113G>C	ENST00000369449.2	-	3	496	c.278C>G	c.(277-279)aCc>aGc	p.T93S	CLIC2_ENST00000465553.1_5'UTR	NM_001289.4	NP_001280.3	O15247	CLIC2_HUMAN	chloride intracellular channel 2	93	N-terminal.|Required for insertion into the membrane. {ECO:0000250}.				chloride transmembrane transport (GO:1902476)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|oxidation-reduction process (GO:0055114)|positive regulation of binding (GO:0051099)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|signal transduction (GO:0007165)|transport (GO:0006810)	chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	chloride channel activity (GO:0005254)|glutathione peroxidase activity (GO:0004602)|voltage-gated chloride channel activity (GO:0005247)	p.T93S(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)	18	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					AGGAGCCAGGGTTTGTTCTAA	0.368																																					p.T93S	Melanoma(108;581 1592 2289 21669 28822)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C278G	X						.						92.0	90.0	91.0					X																	154528113		2203	4300	6503	154181307	SO:0001583	missense	1193	exon3			AJ000217	CCDS14767.1	Xq28	2012-09-26			ENSG00000155962	ENSG00000155962		"""Ion channels / Chloride channels : Intracellular"""	2063	protein-coding gene	gene with protein product		300138				9339381	Standard	NM_001289		Approved	XAP121	uc004fnf.3	O15247	OTTHUMG00000022660	ENST00000369449.2:c.278C>G	X.37:g.154528113G>C	ENSP00000358460:p.Thr93Ser	Somatic		Unspecified	Illumina	Phase_I	154181307	NM_001289	A8K9S0|O15174|Q5JT80|Q8TCE3	Missense_Mutation	SNP	ENST00000369449.2	37	CCDS14767.1	.	.	.	.	.	.	.	.	.	.	.	11.43	1.635109	0.29068	.	.	ENSG00000155962	ENST00000369449	T	0.25579	1.79	5.06	4.18	0.49190	Glutathione S-transferase/chloride channel, C-terminal (1);Thioredoxin-like fold (2);	0.155750	0.56097	D	0.000031	T	0.27663	0.0680	M	0.71871	2.18	0.32532	N	0.534766	B;B	0.18166	0.026;0.011	B;B	0.28305	0.088;0.045	T	0.25363	-1.0134	10	0.13108	T	0.6	-10.2638	11.0982	0.48157	0.0998:0.0:0.9002:0.0	.	111;93	Q86YM0;O15247	.;CLIC2_HUMAN	S	93	ENSP00000358460:T93S	ENSP00000358460:T93S	T	-	2	0	CLIC2	154181307	0.931000	0.31567	0.998000	0.56505	0.908000	0.53690	1.265000	0.33027	2.262000	0.75019	0.415000	0.27848	ACC		CLIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058793.1	NM_001289	
DPP10	57628	broad.mit.edu	37	2	116572435	116572435	+	Silent	SNP	T	T	A			TCGA-AG-A036-01	TCGA-AG-A036-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr2:116572435T>A	ENST00000410059.1	+	20	2247	c.1767T>A	c.(1765-1767)atT>atA	p.I589I	DPP10_ENST00000409163.1_Silent_p.I539I|DPP10_ENST00000310323.8_Silent_p.I582I|DPP10_ENST00000393147.2_Silent_p.I593I	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	589						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)	p.I589I(1)|p.I582I(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						CCGTACTCATTGACATGGATA	0.423																																					p.I539I												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T1617A	2						.						141.0	136.0	138.0					2																	116572435		2203	4300	6503	116288905	SO:0001819	synonymous_variant	57628	exon21			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.1767T>A	2.37:g.116572435T>A		Somatic		Unspecified	Illumina	Phase_I	116288905	NM_001178036	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Silent	SNP	ENST00000410059.1	37	CCDS46400.1																																																																																				DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868	
TFCP2L1	29842	broad.mit.edu	37	2	121989409	121989409	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr2:121989409C>T	ENST00000263707.5	-	13	1431	c.1334G>A	c.(1333-1335)aGc>aAc	p.S445N		NM_014553.2	NP_055368.1	Q9NZI6	TF2L1_HUMAN	transcription factor CP2-like 1	445					cell morphogenesis (GO:0000902)|cytoplasm organization (GO:0007028)|determination of adult lifespan (GO:0008340)|epithelial cell maturation (GO:0002070)|female pregnancy (GO:0007565)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of growth (GO:0045927)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|salivary gland development (GO:0007431)|steroid biosynthetic process (GO:0006694)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.S445N(1)		cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)|pancreas(2)|skin(1)|stomach(1)	22	Renal(3;0.01)					CACCTCGTTGCTCACCACCAC	0.632																																					p.S445N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1334A	2						.						77.0	66.0	70.0					2																	121989409		2203	4300	6503	121705879	SO:0001583	missense	29842	exon13			AF198488	CCDS2134.1	2q14	2008-02-05			ENSG00000115112	ENSG00000115112			17925	protein-coding gene	gene with protein product		609785				10644752, 11073954	Standard	NM_014553		Approved	LBP-9, CRTR1	uc002tmx.3	Q9NZI6	OTTHUMG00000131443	ENST00000263707.5:c.1334G>A	2.37:g.121989409C>T	ENSP00000263707:p.Ser445Asn	Somatic		Unspecified	Illumina	Phase_I	121705879	NM_014553	Q4ZG43	Missense_Mutation	SNP	ENST00000263707.5	37	CCDS2134.1	.	.	.	.	.	.	.	.	.	.	C	16.83	3.232428	0.58777	.	.	ENSG00000115112	ENST00000263707	T	0.22743	1.94	5.43	4.52	0.55395	.	0.143803	0.64402	N	0.000003	T	0.27663	0.0680	M	0.73962	2.25	0.53005	D	0.999965	B	0.24882	0.113	B	0.27380	0.079	T	0.05886	-1.0858	10	0.56958	D	0.05	.	12.1288	0.53932	0.0:0.9122:0.0:0.0878	.	445	Q9NZI6	TF2L1_HUMAN	N	445	ENSP00000263707:S445N	ENSP00000263707:S445N	S	-	2	0	TFCP2L1	121705879	0.995000	0.38212	0.989000	0.46669	0.872000	0.50106	1.341000	0.33907	1.207000	0.43291	0.491000	0.48974	AGC		TFCP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338539.1	NM_014553	
THSD7B	80731	broad.mit.edu	37	2	137814076	137814076	+	Missense_Mutation	SNP	A	A	C	rs546067581		TCGA-AG-A036-01	TCGA-AG-A036-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr2:137814076A>C	ENST00000409968.1	+	3	404	c.226A>C	c.(226-228)Agt>Cgt	p.S76R	THSD7B_ENST00000413152.2_Missense_Mutation_p.S45R|THSD7B_ENST00000543459.1_5'Flank|THSD7B_ENST00000272643.3_Missense_Mutation_p.S76R			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	76	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)		p.S76R(1)		NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		CGGGTGGACAAGTCACCTGTC	0.532													A|||	1	0.000199681	0.0	0.0	5008	,	,		19145	0.001		0.0	False		,,,				2504	0.0				p.S45R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A133C	2						.						82.0	89.0	87.0					2																	137814076		2026	4199	6225	137530546	SO:0001583	missense	80731	exon2					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.226A>C	2.37:g.137814076A>C	ENSP00000387145:p.Ser76Arg	Somatic		Unspecified	Illumina	Phase_I	137530546	NM_001080427		Missense_Mutation	SNP	ENST00000409968.1	37		.	.	.	.	.	.	.	.	.	.	A	15.94	2.980694	0.53827	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.60548	0.18;0.18;0.18	5.89	3.5	0.40072	.	0.170423	0.64402	D	0.000008	T	0.48995	0.1531	L	0.31476	0.935	0.80722	D	1	P	0.44734	0.842	P	0.51945	0.685	T	0.40079	-0.9582	10	0.11485	T	0.65	.	6.205	0.20598	0.7452:0.0:0.1352:0.1196	.	45	C9JKN6	.	R	76;76;45	ENSP00000387145:S76R;ENSP00000272643:S76R;ENSP00000413841:S45R	ENSP00000272643:S76R	S	+	1	0	THSD7B	137530546	0.999000	0.42202	0.693000	0.30195	0.985000	0.73830	4.439000	0.59968	0.475000	0.27415	0.477000	0.44152	AGT		THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9	
LRP1B	53353	broad.mit.edu	37	2	141458027	141458027	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A036-01	TCGA-AG-A036-01	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr2:141458027T>G	ENST00000389484.3	-	41	7562	c.6591A>C	c.(6589-6591)ttA>ttC	p.L2197F		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2197					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.L2197F(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GTATACTTTTTAATATTGTTC	0.388										TSP Lung(27;0.18)																											p.L2197F	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A6591C	2						.						93.0	98.0	96.0					2																	141458027		2203	4300	6503	141174497	SO:0001583	missense	53353	exon41			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.6591A>C	2.37:g.141458027T>G	ENSP00000374135:p.Leu2197Phe	Somatic		Unspecified	Illumina	Phase_I	141174497	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	T	17.95	3.513899	0.64522	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.92911	-3.13	4.47	3.21	0.36854	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.56097	U	0.000038	D	0.92799	0.7710	L	0.52364	1.645	0.42393	D	0.99253	D	0.71674	0.998	D	0.83275	0.996	D	0.91120	0.4929	10	0.45353	T	0.12	.	5.8495	0.18685	0.0:0.0867:0.1691:0.7442	.	2197	Q9NZR2	LRP1B_HUMAN	F	2197;2135	ENSP00000374135:L2197F	ENSP00000374135:L2197F	L	-	3	2	LRP1B	141174497	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	0.470000	0.22084	1.766000	0.52107	0.477000	0.44152	TTA		LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
RIF1	55183	broad.mit.edu	37	2	152322629	152322629	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-A036-01	TCGA-AG-A036-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr2:152322629A>C	ENST00000243326.5	+	29	7078	c.6595A>C	c.(6595-6597)Aat>Cat	p.N2199H	RIF1_ENST00000453091.2_Missense_Mutation_p.N2199H|RIF1_ENST00000444746.2_Missense_Mutation_p.N2199H|RIF1_ENST00000430328.2_Missense_Mutation_p.N2199H|RIF1_ENST00000428287.2_Missense_Mutation_p.N2199H			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.N2199H(1)		NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		ATCACCTGTTAATAAGGTAAG	0.408																																					p.N2199H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A6595C	2						.						50.0	53.0	52.0					2																	152322629		2201	4298	6499	152030875	SO:0001583	missense	55183	exon30			AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.6595A>C	2.37:g.152322629A>C	ENSP00000243326:p.Asn2199His	Somatic		Unspecified	Illumina	Phase_I	152030875	NM_001177664	A0AVS0|Q9NS16	Missense_Mutation	SNP	ENST00000243326.5	37	CCDS2194.1	.	.	.	.	.	.	.	.	.	.	A	6.304	0.424223	0.11928	.	.	ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000243326;ENST00000430328	T;T;T;T;T	0.11712	2.78;2.75;2.75;2.78;2.75	6.16	3.91	0.45181	.	0.572763	0.20487	N	0.091364	T	0.10551	0.0258	L	0.51422	1.61	0.18873	N	0.999987	B;B	0.11235	0.004;0.004	B;B	0.09377	0.003;0.004	T	0.26916	-1.0089	10	0.28530	T	0.3	-1.4171	8.8834	0.35389	0.7368:0.1521:0.0:0.1111	.	2199;2199	Q5UIP0;Q5UIP0-2	RIF1_HUMAN;.	H	2199	ENSP00000390181:N2199H;ENSP00000414615:N2199H;ENSP00000415691:N2199H;ENSP00000243326:N2199H;ENSP00000416123:N2199H	ENSP00000243326:N2199H	N	+	1	0	RIF1	152030875	0.975000	0.34042	0.931000	0.37212	0.127000	0.20565	2.513000	0.45494	0.628000	0.30357	0.528000	0.53228	AAT		RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254836.3		
PRPF40A	55660	broad.mit.edu	37	2	153514525	153514525	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr2:153514525C>A	ENST00000410080.1	-	25	3119	c.2578G>T	c.(2578-2580)Gaa>Taa	p.E860*		NM_017892.3	NP_060362.3	O75400	PR40A_HUMAN	PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)	887					cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|mRNA processing (GO:0006397)|regulation of cell shape (GO:0008360)|regulation of cytokinesis (GO:0032465)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.E756*(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|prostate(1)|urinary_tract(1)	21						GCATCGGATTCTGGAGAGTCC	0.338																																					p.E860X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G2578T	2						.						103.0	85.0	91.0					2																	153514525		1811	4067	5878	153222771	SO:0001587	stop_gained	55660	exon25			AF049523	CCDS46430.1	2q23.3	2010-01-25	2007-01-12	2006-01-13	ENSG00000196504	ENSG00000196504			16463	protein-coding gene	gene with protein product		612941	"""formin-binding protein 3"", ""formin binding protein 3"", ""PRP40 pre-mRNA processing factor 40 homolog A (yeast)"""	FNBP3		9724750, 12460579	Standard	NM_017892		Approved	FLJ20585, FBP11, HYPA, NY-REN-6, HIP10, FBP-11, FLAF1, Prp40	uc002tyh.4	O75400	OTTHUMG00000154031	ENST00000410080.1:c.2578G>T	2.37:g.153514525C>A	ENSP00000386458:p.Glu860*	Somatic		Unspecified	Illumina	Phase_I	153222771	NM_017892	O43856|O75404|Q8TBQ1|Q9H782|Q9NWU9|Q9P0Q2|Q9Y5A8	Nonsense_Mutation	SNP	ENST00000410080.1	37	CCDS46430.1	.	.	.	.	.	.	.	.	.	.	C	44	11.258635	0.99538	.	.	ENSG00000196504	ENST00000410080;ENST00000356402;ENST00000440252;ENST00000359961	.	.	.	5.41	5.41	0.78517	.	0.093853	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	-18.8005	16.3008	0.82811	0.0:1.0:0.0:0.0	.	.	.	.	X	860;869;756;811	.	ENSP00000348770:E869X	E	-	1	0	PRPF40A	153222771	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	5.440000	0.66563	2.702000	0.92279	0.563000	0.77884	GAA		PRPF40A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333559.2	XM_371575	
XIRP2	129446	broad.mit.edu	37	2	168100237	168100237	+	Silent	SNP	T	T	C			TCGA-AG-A036-01	TCGA-AG-A036-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr2:168100237T>C	ENST00000409195.1	+	9	2424	c.2335T>C	c.(2335-2337)Ttg>Ctg	p.L779L	XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000295237.9_Silent_p.L779L|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409273.1_Silent_p.L557L	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	604					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.L779L(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AACACAGCCGTTGGACACAAT	0.408																																					p.L557L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1669C	2						.						70.0	65.0	67.0					2																	168100237		1860	4097	5957	167808483	SO:0001819	synonymous_variant	129446	exon7			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.2335T>C	2.37:g.168100237T>C		Somatic		Unspecified	Illumina	Phase_I	167808483	NM_001199144	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	ENST00000409195.1	37	CCDS42769.1																																																																																				XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
CHN1	1123	broad.mit.edu	37	2	175711665	175711665	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A036-01	TCGA-AG-A036-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr2:175711665T>A	ENST00000409900.3	-	7	883	c.570A>T	c.(568-570)agA>agT	p.R190S	CHN1_ENST00000409156.3_Intron|CHN1_ENST00000295497.7_Missense_Mutation_p.R65S|CHN1_ENST00000409597.1_5'Flank|CHN1_ENST00000488080.1_5'UTR	NM_001822.5	NP_001813.1	P15882	CHIN_HUMAN	chimerin 1	190					ephrin receptor signaling pathway (GO:0048013)|motor neuron axon guidance (GO:0008045)|positive regulation of signal transduction (GO:0009967)|regulation of axonogenesis (GO:0050770)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)	p.R190S(1)		NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.226)			TCAGAGTTGCTCTTCTAACAA	0.363			T	TAF15	extraskeletal myxoid chondrosarcoma																																p.R190S			Dom	yes		2	2q31-q32.1	1123	chimerin (chimaerin) 1		M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A570T	2						.						50.0	43.0	45.0					2																	175711665		1793	4013	5806	175419911	SO:0001583	missense	1123	exon7				CCDS46454.1, CCDS46455.1, CCDS56147.1	2q31-q32.1	2013-02-14	2012-10-17		ENSG00000128656	ENSG00000128656		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1943	protein-coding gene	gene with protein product	"""Chimerin 1 (GTPase-activating protein, rho, 2)"", ""chimaerin 1"""	118423	"""Duane retraction syndrome 2"", ""chimerin (chimaerin) 1"""	CHN, DURS2		2299665, 15013773, 18653847	Standard	NM_001822		Approved	RhoGAP2, ARHGAP2, n-chimerin	uc002uji.3	P15882	OTTHUMG00000154225	ENST00000409900.3:c.570A>T	2.37:g.175711665T>A	ENSP00000386741:p.Arg190Ser	Somatic		Unspecified	Illumina	Phase_I	175419911	NM_001822	A8K1M6|B3KNU6|B4DV19|Q53SD6|Q53SH5|Q96FB0	Missense_Mutation	SNP	ENST00000409900.3	37	CCDS46455.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.107066	0.77096	.	.	ENSG00000128656	ENST00000409900;ENST00000295497;ENST00000443238;ENST00000444573	T;T;T;D	0.93426	-0.54;-0.48;-1.46;-3.22	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	D	0.94565	0.8249	L	0.38175	1.15	0.80722	D	1	P;D	0.76494	0.895;0.999	P;D	0.70016	0.573;0.967	D	0.94705	0.7887	10	0.49607	T	0.09	.	16.1199	0.81342	0.0:0.0:0.0:1.0	.	190;65	P15882;P15882-2	CHIN_HUMAN;.	S	190;65;16;65	ENSP00000386741:R190S;ENSP00000295497:R65S;ENSP00000409798:R16S;ENSP00000392603:R65S	ENSP00000295497:R65S	R	-	3	2	CHN1	175419911	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.372000	0.52387	2.194000	0.70268	0.533000	0.62120	AGA		CHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334453.1	NM_001822	
TTN	7273	broad.mit.edu	37	2	179424792	179424792	+	Silent	SNP	T	T	C			TCGA-AG-A036-01	TCGA-AG-A036-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr2:179424792T>C	ENST00000591111.1	-	276	81368	c.81144A>G	c.(81142-81144)gaA>gaG	p.E27048E	TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Silent_p.E19816E|TTN_ENST00000589042.1_Silent_p.E28689E|TTN_ENST00000460472.2_Silent_p.E19624E|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000342992.6_Silent_p.E26121E|TTN_ENST00000359218.5_Silent_p.E19749E|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	27048	Fibronectin type-III 97. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.E19624E(1)|p.E19816E(1)|p.E19749E(1)|p.E26119E(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATTTTTTGTATTCTACAGTAT	0.423																																					p.N19624S												.	.	4	Substitution - coding silent(4)	large_intestine(4)	c.A58871G	2						.						70.0	67.0	68.0					2																	179424792		1848	4085	5933	179133038	SO:0001819	synonymous_variant	7273	exon154			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.81144A>G	2.37:g.179424792T>C		Somatic		Unspecified	Illumina	Phase_I	179133038	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																					TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
DNAH7	56171	broad.mit.edu	37	2	196877517	196877517	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-A036-01	TCGA-AG-A036-01	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr2:196877517A>T	ENST00000312428.6	-	10	1083	c.983T>A	c.(982-984)cTt>cAt	p.L328H	DNAH7_ENST00000410072.1_Missense_Mutation_p.L328H	NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	328	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)	p.L328H(1)		NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TTACATTTTAAGTAGAGTCTC	0.323																																					p.L328H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T983A	2						.						80.0	77.0	78.0					2																	196877517		1813	4075	5888	196585762	SO:0001583	missense	56171	exon10			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.983T>A	2.37:g.196877517A>T	ENSP00000311273:p.Leu328His	Somatic		Unspecified	Illumina	Phase_I	196585762	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	37	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	A	13.82	2.352042	0.41700	.	.	ENSG00000118997	ENST00000312428;ENST00000410072;ENST00000312446	T;T	0.23754	1.89;2.77	5.28	5.28	0.74379	.	0.090347	0.45606	D	0.000354	T	0.34774	0.0909	M	0.74881	2.28	0.39441	D	0.967247	P	0.35821	0.523	B	0.40534	0.332	T	0.25293	-1.0136	10	0.44086	T	0.13	.	12.7278	0.57180	1.0:0.0:0.0:0.0	.	328	Q8WXX0	DYH7_HUMAN	H	328	ENSP00000311273:L328H;ENSP00000386260:L328H	ENSP00000311273:L328H	L	-	2	0	DNAH7	196585762	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	4.576000	0.60915	1.999000	0.58509	0.482000	0.46254	CTT		DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
SGOL2	151246	broad.mit.edu	37	2	201438405	201438405	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-A036-01	TCGA-AG-A036-01	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr2:201438405A>T	ENST00000357799.4	+	7	3434	c.3336A>T	c.(3334-3336)caA>caT	p.Q1112H		NM_001160033.1|NM_001160046.1|NM_152524.5	NP_001153505.1|NP_001153518.1|NP_689737.4	Q562F6	SGOL2_HUMAN	shugoshin-like 2 (S. pombe)	1112					meiotic sister chromatid cohesion, centromeric (GO:0051754)|mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)		p.Q1112H(1)		NS(2)|breast(2)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	46						TATCTGAACAAGCTGATAAGG	0.378																																					p.Q1112H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3336T	2						.						109.0	103.0	105.0					2																	201438405		1839	4079	5918	201146650	SO:0001583	missense	151246	exon7			AY094614	CCDS42796.1	2q33.2	2008-02-05			ENSG00000163535	ENSG00000163535			30812	protein-coding gene	gene with protein product		612425					Standard	NM_001160046		Approved	TRIPIN, FLJ25211	uc002uvw.2	Q562F6	OTTHUMG00000154535	ENST00000357799.4:c.3336A>T	2.37:g.201438405A>T	ENSP00000350447:p.Gln1112His	Somatic		Unspecified	Illumina	Phase_I	201146650	NM_001160046	Q53RR9|Q53T20|Q86XY4|Q8IWK2|Q8IZK1|Q8N1Q5|Q96LQ3	Missense_Mutation	SNP	ENST00000357799.4	37	CCDS42796.1	.	.	.	.	.	.	.	.	.	.	A	12.71	2.020974	0.35606	.	.	ENSG00000163535	ENST00000357799	T	0.16597	2.33	5.52	-3.67	0.04476	.	0.347785	0.24415	N	0.038736	T	0.11024	0.0269	L	0.55481	1.735	0.09310	N	0.999999	B;B;B	0.09022	0.002;0.002;0.002	B;B;B	0.12837	0.008;0.008;0.008	T	0.17137	-1.0379	10	0.41790	T	0.15	0.6691	1.5823	0.02637	0.2762:0.3089:0.2868:0.1281	.	1112;1112;1112	B7Z7S9;Q562F6-2;Q562F6	.;.;SGOL2_HUMAN	H	1112	ENSP00000350447:Q1112H	ENSP00000350447:Q1112H	Q	+	3	2	SGOL2	201146650	0.001000	0.12720	0.000000	0.03702	0.014000	0.08584	0.036000	0.13819	-0.791000	0.04486	0.528000	0.53228	CAA		SGOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335834.1	NM_152524	
MARCH4	57574	broad.mit.edu	37	2	217234552	217234552	+	Silent	SNP	G	G	A	rs374936017		TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr2:217234552G>A	ENST00000273067.4	-	1	2198	c.432C>T	c.(430-432)acC>acT	p.T144T		NM_020814.2	NP_065865.1	Q9P2E8	MARH4_HUMAN	membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase	144						Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.T144T(2)		breast(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(1)	20		Renal(323;0.0854)		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)		AGCGATCCTCGGTCTTCTCCT	0.587																																					p.T144T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C432T	2						.						72.0	63.0	66.0					2																	217234552		2203	4300	6503	216942797	SO:0001819	synonymous_variant	57574	exon1			AB037820	CCDS33376.1	2q35	2013-01-09	2012-02-23		ENSG00000144583	ENSG00000144583		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	29269	protein-coding gene	gene with protein product		608208	"""membrane-associated ring finger (C3HC4) 4"""			10718198, 14722266	Standard	NM_020814		Approved	KIAA1399, MARCH-IV, RNF174	uc002vgb.3	Q9P2E8	OTTHUMG00000154824	ENST00000273067.4:c.432C>T	2.37:g.217234552G>A		Somatic		Unspecified	Illumina	Phase_I	216942797	NM_020814	Q4KMN7|Q86WR8	Silent	SNP	ENST00000273067.4	37	CCDS33376.1																																																																																				MARCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337272.2	NM_020814	
FEV	54738	broad.mit.edu	37	2	219848966	219848966	+	Silent	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr2:219848966G>A	ENST00000295727.1	-	2	695	c.114C>T	c.(112-114)ccC>ccT	p.P38P		NM_017521.2	NP_059991.1	Q99581	FEV_HUMAN	FEV (ETS oncogene family)	38					cell differentiation (GO:0030154)|neuron fate specification (GO:0048665)|neuron maturation (GO:0042551)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.P38P(1)	EWSR1/FEV(11)|FUS/FEV(2)	large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	4		Renal(207;0.0474)		Epithelial(149;9.77e-07)|all cancers(144;0.000167)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCTGAACCGCGGGGCTCAGCG	0.657			T	"""EWSR1,  FUS"""	Ewing sarcoma																																p.P38P	NSCLC(198;941 2228 4658 24163 34665)		Dom	yes		2	2q36	54738	FEV protein - (HSRNAFEV)		M	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C114T	2						.						9.0	10.0	10.0					2																	219848966		2191	4288	6479	219557210	SO:0001819	synonymous_variant	54738	exon2				CCDS2428.1	2q36	2008-02-05			ENSG00000163497	ENSG00000163497			18562	protein-coding gene	gene with protein product		607150	"""FEV (fifth Ewing variant)"""			9121764	Standard	NM_017521		Approved	Pet-1	uc002vji.1	Q99581	OTTHUMG00000133080	ENST00000295727.1:c.114C>T	2.37:g.219848966G>A		Somatic		Unspecified	Illumina	Phase_I	219557210	NM_017521		Silent	SNP	ENST00000295727.1	37	CCDS2428.1																																																																																				FEV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256725.1		
TSSC1	7260	broad.mit.edu	37	2	3358400	3358400	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr2:3358400C>T	ENST00000382125.4	-	2	239	c.47G>A	c.(46-48)cGt>cAt	p.R16H	TSSC1_ENST00000398659.4_Missense_Mutation_p.R16H|TSSC1_ENST00000443925.2_Missense_Mutation_p.R16H	NM_003310.2	NP_003301.1	Q53HC9	TSSC1_HUMAN	tumor suppressing subtransferable candidate 1	16								p.R16H(1)		breast(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|skin(1)	18	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)		TGTTAAGGCACGTGCCTGCAG	0.363																																					p.R16H	Colon(140;1261 1762 4183 34270 49743)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G47A	2						.						84.0	81.0	82.0					2																	3358400		2203	4300	6503	3337407	SO:0001583	missense	7260	exon2			AF019952	CCDS1651.1	2p25.3	2013-01-10			ENSG00000032389	ENSG00000032389		"""WD repeat domain containing"""	12383	protein-coding gene	gene with protein product		608998				9403053, 9925925	Standard	NM_003310		Approved		uc002qxj.2	Q53HC9	OTTHUMG00000090329	ENST00000382125.4:c.47G>A	2.37:g.3358400C>T	ENSP00000371559:p.Arg16His	Somatic		Unspecified	Illumina	Phase_I	3337407	NM_003310	D6W4Y1|O43179|Q53S19|Q53SG2	Missense_Mutation	SNP	ENST00000382125.4	37	CCDS1651.1	.	.	.	.	.	.	.	.	.	.	c	22.6	4.306831	0.81247	.	.	ENSG00000032389	ENST00000382125;ENST00000398659;ENST00000443925;ENST00000444776	D;D	0.97378	-3.52;-4.36	4.45	4.45	0.53987	.	0.000000	0.85682	D	0.000000	D	0.98397	0.9467	M	0.84773	2.715	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99075	1.0835	10	0.87932	D	0	-0.4511	15.0171	0.71594	0.0:1.0:0.0:0.0	.	16	Q53HC9	TSSC1_HUMAN	H	16	ENSP00000371559:R16H;ENSP00000381652:R16H	ENSP00000371559:R16H	R	-	2	0	TSSC1	3337407	1.000000	0.71417	0.992000	0.48379	0.991000	0.79684	6.132000	0.71676	2.478000	0.83669	0.558000	0.71614	CGT		TSSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206694.2	NM_003310	
TSGA10	80705	broad.mit.edu	37	2	99767052	99767052	+	Intron	SNP	C	C	G			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr2:99767052C>G	ENST00000393483.3	-	1	225				C2ORF15_ENST00000302513.2_Missense_Mutation_p.Q45E|C2ORF15_ENST00000409684.1_Missense_Mutation_p.Q45E	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10						cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)		p.Q45E(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						ATCTGCTACTCAGGTATCTGC	0.368																																					p.Q45E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C133G	2						.						61.0	62.0	62.0					2																	99767052		2203	4300	6503	99133484	SO:0001627	intron_variant	150590	exon4			AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.619+4103G>C	2.37:g.99767052C>G		Somatic		Unspecified	Illumina	Phase_I	99133484	NM_144706	B7Z925|D3DVH7|Q8NEP0|Q9BWX0	Missense_Mutation	SNP	ENST00000393483.3	37	CCDS2037.1	.	.	.	.	.	.	.	.	.	.	C	11.71	1.718688	0.30503	.	.	ENSG00000241962	ENST00000302513;ENST00000409684	.	.	.	5.03	5.03	0.67393	.	.	.	.	.	T	0.33147	0.0853	N	0.08118	0	0.80722	D	1	P	0.35872	0.525	B	0.33454	0.164	T	0.40175	-0.9577	8	0.87932	D	0	-0.0011	13.7268	0.62763	0.0:1.0:0.0:0.0	.	45	Q8WU43	CB015_HUMAN	E	45	.	ENSP00000302202:Q45E	Q	+	1	0	C2orf15	99133484	0.987000	0.35691	0.958000	0.39756	0.756000	0.42949	3.369000	0.52365	2.605000	0.88082	0.462000	0.41574	CAG		TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253125.1	NM_182911	
AFF3	3899	broad.mit.edu	37	2	100168047	100168047	+	Silent	SNP	G	G	A	rs201311680		TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr2:100168047G>A	ENST00000409236.2	-	23	3682	c.3570C>T	c.(3568-3570)aaC>aaT	p.N1190N	AFF3_ENST00000356421.2_Silent_p.N1215N|AFF3_ENST00000317233.4_Silent_p.N1190N|AFF3_ENST00000409579.1_Silent_p.N1215N			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	1190					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)	p.N1215N(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						GATCCAGGTCGTTGAAGAATT	0.537																																					p.N1215N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3645T	2						.						64.0	61.0	62.0					2																	100168047		2203	4300	6503	99534479	SO:0001819	synonymous_variant	3899	exon24			U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.3570C>T	2.37:g.100168047G>A		Somatic		Unspecified	Illumina	Phase_I	99534479	NM_001025108	B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Silent	SNP	ENST00000409236.2	37	CCDS42723.1																																																																																				AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328982.3	NM_002285	
AFF3	3899	broad.mit.edu	37	2	100199293	100199293	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr2:100199293G>T	ENST00000409236.2	-	15	2872	c.2760C>A	c.(2758-2760)gaC>gaA	p.D920E	AFF3_ENST00000356421.2_Missense_Mutation_p.D945E|AFF3_ENST00000317233.4_Missense_Mutation_p.D920E|AFF3_ENST00000409579.1_Missense_Mutation_p.D945E			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	920					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)	p.D945E(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						GCAGCTGGCTGTCGGCCTTAG	0.488																																					p.D945E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2835A	2						.						132.0	120.0	124.0					2																	100199293		2203	4300	6503	99565725	SO:0001583	missense	3899	exon16			U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.2760C>A	2.37:g.100199293G>T	ENSP00000387207:p.Asp920Glu	Somatic		Unspecified	Illumina	Phase_I	99565725	NM_001025108	B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	ENST00000409236.2	37	CCDS42723.1	.	.	.	.	.	.	.	.	.	.	G	5.340	0.247972	0.10130	.	.	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236	T;T;T;T	0.62788	-0.0;-0.0;-0.0;-0.0	5.93	4.12	0.48240	.	0.201183	0.40908	N	0.000999	T	0.18551	0.0445	N	0.00114	-2.085	0.25476	N	0.987786	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.34700	-0.9818	10	0.02654	T	1	.	10.1629	0.42862	0.0:0.6929:0.2086:0.0984	.	920;945	P51826;P51826-2	AFF3_HUMAN;.	E	920;945;945;920	ENSP00000317421:D920E;ENSP00000348793:D945E;ENSP00000386834:D945E;ENSP00000387207:D920E	ENSP00000317421:D920E	D	-	3	2	AFF3	99565725	1.000000	0.71417	0.916000	0.36221	0.940000	0.58332	2.013000	0.40942	0.837000	0.34925	0.655000	0.94253	GAC		AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328982.3	NM_002285	
SLC4A3	6508	broad.mit.edu	37	2	220494319	220494319	+	Silent	SNP	C	C	T			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr2:220494319C>T	ENST00000358055.3	+	5	1025	c.513C>T	c.(511-513)gaC>gaT	p.D171D	SLC4A3_ENST00000317151.3_Silent_p.D171D|SLC4A3_ENST00000373762.3_Silent_p.D171D|SLC4A3_ENST00000497589.1_Intron|SLC4A3_ENST00000273063.6_Silent_p.D171D|AC009955.8_ENST00000455896.1_RNA|SLC4A3_ENST00000373760.2_Silent_p.D171D			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	171					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)	p.D171D(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTGGAAGTGACGAGGATGACA	0.637																																					p.D171D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C513T	2						.						43.0	43.0	43.0					2																	220494319		2203	4300	6503	220202563	SO:0001819	synonymous_variant	6508	exon5				CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.513C>T	2.37:g.220494319C>T		Somatic		Unspecified	Illumina	Phase_I	220202563	NM_005070	A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	De_novo_Start_InFrame	SNP	ENST00000358055.3	37	CCDS2445.1																																																																																				SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316472.1	NM_005070	
PALM2	114299	broad.mit.edu	37	9	112705199	112705199	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A036-01	TCGA-AG-A036-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr9:112705199A>G	ENST00000374531.2	+	7	708	c.634A>G	c.(634-636)Agc>Ggc	p.S212G	PALM2-AKAP2_ENST00000374530.3_Intron|PALM2_ENST00000448454.2_Missense_Mutation_p.S246G|AKAP2_ENST00000555236.1_Intron|PALM2_ENST00000314527.4_Missense_Mutation_p.S244G|PALM2_ENST00000483909.1_Missense_Mutation_p.S210G|PALM2-AKAP2_ENST00000302798.7_Intron|AKAP2_ENST00000510514.5_Intron	NM_001037293.2	NP_001032370.1	Q8IXS6	PALM2_HUMAN	paralemmin 2	212					regulation of cell shape (GO:0008360)	plasma membrane (GO:0005886)		p.S212G(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(1)	18						TGGACAATCAAGCTTAGGAGG	0.473																																					p.S212G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A634G	9						.						87.0	76.0	80.0					9																	112705199		2203	4300	6503	111745020	SO:0001583	missense	445815	exon7			AJ312216	CCDS35099.1, CCDS48002.1, CCDS48002.2	9q31.3	2009-10-16			ENSG00000243444	ENSG00000243444			15845	protein-coding gene	gene with protein product						11478809	Standard	NM_001037293		Approved			Q8IXS6	OTTHUMG00000020479	ENST00000374531.2:c.634A>G	9.37:g.112705199A>G	ENSP00000363656:p.Ser212Gly	Somatic		Unspecified	Illumina	Phase_I	111745020	NM_001037293	A9Z1X9|Q8N9D5|Q96DU1	Missense_Mutation	SNP	ENST00000374531.2	37	CCDS35099.1	.	.	.	.	.	.	.	.	.	.	A	11.16	1.557756	0.27827	.	.	ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000157654	ENST00000374531;ENST00000448454;ENST00000483909;ENST00000314527;ENST00000413420	T;T;T;T;T	0.18810	2.19;2.19;2.19;2.19;2.19	6.17	5.02	0.67125	.	.	.	.	.	T	0.16342	0.0393	N	0.22421	0.69	0.80722	D	1	B;B	0.15141	0.007;0.012	B;B	0.19666	0.026;0.02	T	0.02821	-1.1106	9	0.87932	D	0	.	11.8857	0.52600	0.8608:0.0:0.0:0.1392	.	212;246	Q8IXS6;D3YTA4	PALM2_HUMAN;.	G	212;246;210;244;244	ENSP00000363656:S212G;ENSP00000400206:S246G;ENSP00000417525:S210G;ENSP00000323805:S244G;ENSP00000397839:S244G	ENSP00000397839:S244G	S	+	1	0	PALM2-AKAP2;PALM2	111745020	1.000000	0.71417	0.986000	0.45419	0.866000	0.49608	6.004000	0.70709	1.117000	0.41842	-0.438000	0.05819	AGC		PALM2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053604.1	NM_001037293	
RAB14	51552	broad.mit.edu	37	9	123943812	123943812	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr9:123943812C>G	ENST00000373840.4	-	8	747	c.510G>C	c.(508-510)aaG>aaC	p.K170N		NM_016322.3	NP_057406.2	P61106	RAB14_HUMAN	RAB14, member RAS oncogene family	170					embryo development (GO:0009790)|endocytic recycling (GO:0032456)|fibroblast growth factor receptor signaling pathway (GO:0008543)|Golgi to endosome transport (GO:0006895)|GTP catabolic process (GO:0006184)|intracellular transport (GO:0046907)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of protein localization (GO:0032880)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|nuclear outer membrane-endoplasmic reticulum membrane network (GO:0042175)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|rough endoplasmic reticulum (GO:0005791)|trans-Golgi network transport vesicle (GO:0030140)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)	p.K170N(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	5						GATAGATTTTCTTGGCAGCCT	0.463																																					p.K170N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G510C	9						.						84.0	79.0	81.0					9																	123943812		2203	4300	6503	122983633	SO:0001583	missense	51552	exon8			AF152463	CCDS6827.1	9q32-q34.11	2008-07-21			ENSG00000119396	ENSG00000119396		"""RAB, member RAS oncogene"""	16524	protein-coding gene	gene with protein product	"""F protein-binding protein 1"", ""bA165P4.3 (member RAS oncogene family)"", ""small GTP binding protein RAB14"""	612673				9792283, 15004230	Standard	NM_016322		Approved	FBP, RAB-14	uc004blc.3	P61106	OTTHUMG00000020582	ENST00000373840.4:c.510G>C	9.37:g.123943812C>G	ENSP00000362946:p.Lys170Asn	Somatic		Unspecified	Illumina	Phase_I	122983633	NM_016322	B3KR31|P35287|Q5JVD4|Q6Q7K5|Q969L0|Q9UI11	Missense_Mutation	SNP	ENST00000373840.4	37	CCDS6827.1	.	.	.	.	.	.	.	.	.	.	C	13.29	2.193961	0.38707	.	.	ENSG00000119396	ENST00000373840;ENST00000451303	T;T	0.78126	-1.15;-1.15	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.69015	0.3064	L	0.39085	1.19	0.80722	D	1	B	0.09022	0.002	B	0.19666	0.026	T	0.62101	-0.6925	10	0.30078	T	0.28	.	12.6402	0.56705	0.0:0.9253:0.0:0.0747	.	170	P61106	RAB14_HUMAN	N	170	ENSP00000362946:K170N;ENSP00000400107:K170N	ENSP00000362946:K170N	K	-	3	2	RAB14	122983633	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.009000	0.70745	2.820000	0.97059	0.650000	0.86243	AAG		RAB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053857.1	NM_016322	
OR1L6	392390	broad.mit.edu	37	9	125512580	125512580	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-A036-01	TCGA-AG-A036-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr9:125512580A>T	ENST00000373684.1	+	1	562	c.562A>T	c.(562-564)Atc>Ttc	p.I188F	OR1L6_ENST00000304720.2_Missense_Mutation_p.I152F			Q8NGR2	OR1L6_HUMAN	olfactory receptor, family 1, subfamily L, member 6	188						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I188F(1)		breast(1)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	12						TTCTTGCAGCATCTCCCACCT	0.507																																					p.I152F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A454T	9						.						187.0	144.0	158.0					9																	125512580		2203	4300	6503	124552401	SO:0001583	missense	392390	exon1				CCDS35130.1, CCDS35130.2	9q33.2	2013-09-20			ENSG00000171459	ENSG00000171459		"""GPCR / Class A : Olfactory receptors"""	8218	protein-coding gene	gene with protein product				OR1L7			Standard	NM_001004453		Approved		uc022bna.1	Q8NGR2	OTTHUMG00000020621	ENST00000373684.1:c.562A>T	9.37:g.125512580A>T	ENSP00000362788:p.Ile188Phe	Somatic		Unspecified	Illumina	Phase_I	124552401	NM_001004453	Q6IFM8|Q96R80	Missense_Mutation	SNP	ENST00000373684.1	37		.	.	.	.	.	.	.	.	.	.	.	12.40	1.926878	0.34002	.	.	ENSG00000171459	ENST00000373684;ENST00000304720	T;T	0.37058	1.22;7.54	4.62	2.11	0.27256	GPCR, rhodopsin-like superfamily (1);	0.106321	0.41823	D	0.000804	T	0.35998	0.0951	N	0.25332	0.735	0.21064	N	0.999797	D	0.60575	0.988	P	0.62435	0.902	T	0.05115	-1.0905	10	0.51188	T	0.08	-29.2836	5.0299	0.14404	0.6951:0.0:0.0932:0.2118	.	188	Q8NGR2	OR1L6_HUMAN	F	188;152	ENSP00000362788:I188F;ENSP00000304235:I152F	ENSP00000304235:I152F	I	+	1	0	OR1L6	124552401	0.000000	0.05858	1.000000	0.80357	0.882000	0.50991	-1.670000	0.01956	0.914000	0.36822	0.533000	0.62120	ATC		OR1L6-201	KNOWN	basic	protein_coding	protein_coding			
SCAI	286205	broad.mit.edu	37	9	127764298	127764298	+	Silent	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr9:127764298G>A	ENST00000336505.6	-	12	1148	c.1090C>T	c.(1090-1092)Ctg>Ttg	p.L364L	SCAI_ENST00000373549.4_Silent_p.L387L|SCAI_ENST00000487795.1_5'UTR	NM_001144877.2	NP_001138349.1	Q8N9R8	SCAI_HUMAN	suppressor of cancer cell invasion	364					negative regulation of cell migration (GO:0030336)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)	p.L387L(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|prostate(5)|stomach(1)|urinary_tract(1)	35						AGGTAAATCAGAAGCACGCTA	0.423																																					p.L387L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1159T	9						.						114.0	109.0	111.0					9																	127764298		1899	4126	6025	126804119	SO:0001819	synonymous_variant	286205	exon13			AK093983	CCDS43877.1, CCDS48017.1	9q34.11	2009-11-06	2009-07-09	2009-07-09	ENSG00000173611	ENSG00000173611			26709	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 126"""	C9orf126			Standard	NM_173690		Approved	FLJ36664, NET40	uc004bpd.3	Q8N9R8	OTTHUMG00000020667	ENST00000336505.6:c.1090C>T	9.37:g.127764298G>A		Somatic		Unspecified	Illumina	Phase_I	126804119	NM_173690	Q3SXZ1|Q3SXZ2|Q5T163|Q8N1I4	Silent	SNP	ENST00000336505.6	37	CCDS48017.1																																																																																				SCAI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054055.3	NM_173690	
SARDH	1757	broad.mit.edu	37	9	136529131	136529131	+	Silent	SNP	C	C	T			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr9:136529131C>T	ENST00000371872.4	-	21	2894	c.2637G>A	c.(2635-2637)tcG>tcA	p.S879S	SARDH_ENST00000469828.1_5'UTR|SARDH_ENST00000422262.2_Silent_p.S711S|SARDH_ENST00000371868.1_Silent_p.S329S|SARDH_ENST00000439388.1_Silent_p.S879S	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	879					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)	p.S879S(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		CAAAGTCCAGCGAGACCTAGG	0.582																																					p.S879S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2637A	9						.						85.0	70.0	75.0					9																	136529131		2203	4300	6503	135518952	SO:0001819	synonymous_variant	1757	exon21				CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.2637G>A	9.37:g.136529131C>T		Somatic		Unspecified	Illumina	Phase_I	135518952	NM_007101	B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Silent	SNP	ENST00000371872.4	37	CCDS6978.1																																																																																				SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054931.1		
TEK	7010	broad.mit.edu	37	9	27183556	27183556	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A036-01	TCGA-AG-A036-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr9:27183556T>C	ENST00000380036.4	+	8	1572	c.1130T>C	c.(1129-1131)cTa>cCa	p.L377P	TEK_ENST00000406359.4_Missense_Mutation_p.L334P|TEK_ENST00000519097.1_Missense_Mutation_p.L230P	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	377	Ig-like C2-type 2.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.L377P(1)		breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	GGCTGGCCGCTACCTACTAAT	0.443																																					p.L377P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1130C	9						.						142.0	157.0	152.0					9																	27183556		2203	4300	6503	27173556	SO:0001583	missense	7010	exon8			L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.1130T>C	9.37:g.27183556T>C	ENSP00000369375:p.Leu377Pro	Somatic		Unspecified	Illumina	Phase_I	27173556	NM_000459	A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Missense_Mutation	SNP	ENST00000380036.4	37	CCDS6519.1	.	.	.	.	.	.	.	.	.	.	T	15.68	2.904573	0.52333	.	.	ENSG00000120156	ENST00000519097;ENST00000380036;ENST00000346448;ENST00000406359;ENST00000519080	T;T;T;T	0.26067	1.76;1.76;1.76;1.76	5.52	4.37	0.52481	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.179623	0.26727	N	0.022820	T	0.36303	0.0962	L	0.34521	1.04	0.58432	D	0.999997	P;B;D;D	0.76494	0.917;0.098;0.999;0.996	B;B;D;P	0.91635	0.445;0.084;0.999;0.893	T	0.03773	-1.1005	10	0.31617	T	0.26	.	10.6709	0.45757	0.0:0.0:0.1606:0.8394	.	230;410;334;377	E7EWI2;Q59HG2;B4DHD3;Q02763	.;.;.;TIE2_HUMAN	P	230;377;334;334;187	ENSP00000430686:L230P;ENSP00000369375:L377P;ENSP00000383977:L334P;ENSP00000428337:L187P	ENSP00000343716:L334P	L	+	2	0	TEK	27173556	0.834000	0.29399	0.784000	0.31847	0.969000	0.65631	1.880000	0.39628	1.015000	0.39444	0.533000	0.62120	CTA		TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051965.3		
CAMSAP1	157922	broad.mit.edu	37	9	138706953	138706953	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr9:138706953G>T	ENST00000389532.4	-	16	4560	c.4496C>A	c.(4495-4497)tCc>tAc	p.S1499Y	CAMSAP1_ENST00000409386.3_Missense_Mutation_p.S1510Y|CAMSAP1_ENST00000483991.1_5'UTR|CAMSAP1_ENST00000312405.6_Missense_Mutation_p.S1221Y	NM_015447.3	NP_056262.3	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein 1	1499	CKK. {ECO:0000255|PROSITE- ProRule:PRU00841}.				cytoskeleton organization (GO:0007010)|neuron projection development (GO:0031175)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|spectrin binding (GO:0030507)	p.S1499Y(1)		breast(3)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(11)|lung(16)|ovary(3)|pancreas(1)|skin(1)	47				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		CTCCAATATGGAATTCTTGTG	0.373																																					p.S1499Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4496A	9						.						121.0	102.0	109.0					9																	138706953		2203	4300	6503	137846774	SO:0001583	missense	157922	exon16			AJ519841	CCDS35176.2	9q34.3	2008-02-05			ENSG00000130559	ENSG00000130559			19946	protein-coding gene	gene with protein product		613774				12477932	Standard	NM_015447		Approved	FLJ31228, DKFZp434F195	uc004cgr.4	Q5T5Y3	OTTHUMG00000020918	ENST00000389532.4:c.4496C>A	9.37:g.138706953G>T	ENSP00000374183:p.Ser1499Tyr	Somatic		Unspecified	Illumina	Phase_I	137846774	NM_015447	A1L4L2|B2REB2|B2REB3|Q70W33|Q8NCY0|Q96E80|Q96FM3|Q9UFJ5	Missense_Mutation	SNP	ENST00000389532.4	37	CCDS35176.2	.	.	.	.	.	.	.	.	.	.	G	13.21	2.168676	0.38315	.	.	ENSG00000130559	ENST00000389532;ENST00000312405;ENST00000409386	T;T;T	0.15017	2.47;2.46;2.47	5.49	4.56	0.56223	PRC-barrel-like (1);Microtubule-binding calmodulin-regulated spectrin-associated, C-terminal (2);	0.137765	0.51477	D	0.000095	T	0.28863	0.0716	N	0.22421	0.69	0.41443	D	0.987935	D;D	0.76494	0.999;0.993	D;D	0.74023	0.982;0.964	T	0.12915	-1.0529	10	0.87932	D	0	-3.0362	16.0468	0.80725	0.0:0.1345:0.8655:0.0	.	1499;1510	Q5T5Y3;Q5T5Y3-3	CAMP1_HUMAN;.	Y	1499;1221;1510	ENSP00000374183:S1499Y;ENSP00000312463:S1221Y;ENSP00000386420:S1510Y	ENSP00000312463:S1221Y	S	-	2	0	CAMSAP1	137846774	1.000000	0.71417	0.162000	0.22713	0.243000	0.25628	4.977000	0.63792	1.257000	0.44085	0.655000	0.94253	TCC		CAMSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055024.2	XM_351857	
TMTC4	84899	broad.mit.edu	37	13	101321036	101321036	+	5'UTR	SNP	G	G	C			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr13:101321036G>C	ENST00000376234.3	-	0	148				TMTC4_ENST00000342624.5_Missense_Mutation_p.H6D|TMTC4_ENST00000328767.5_5'UTR	NM_001079669.1	NP_001073137.1	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat containing 4							integral component of membrane (GO:0016021)		p.H6D(1)		breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CCAGCATTATGCTGGTTAGGA	0.463																																					p.H6D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C16G	13						.						59.0	58.0	58.0					13																	101321036		1890	4102	5992	100119037	SO:0001623	5_prime_UTR_variant	84899	exon3				CCDS9497.2, CCDS41904.1, CCDS66575.1	13q32.3	2013-01-10	2006-01-06		ENSG00000125247	ENSG00000125247		"""Tetratricopeptide (TTC) repeat domain containing"""	25904	protein-coding gene	gene with protein product							Standard	XM_005254082		Approved	FLJ14624, FLJ22153	uc001vot.3	Q5T4D3	OTTHUMG00000017289	ENST00000376234.3:c.-42C>G	13.37:g.101321036G>C		Somatic		Unspecified	Illumina	Phase_I	100119037	NM_032813	A6NLI7|B7Z666|Q5T4D4|Q5T4D5|Q5T4D6|Q8WV63|Q96SU8	Missense_Mutation	SNP	ENST00000376234.3	37	CCDS41904.1	.	.	.	.	.	.	.	.	.	.	g	16.21	3.059670	0.55325	.	.	ENSG00000125247	ENST00000342624;ENST00000475272	T	0.59638	0.25	5.54	5.54	0.83059	.	0.347798	0.24666	N	0.036587	T	0.54565	0.1866	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.08055	0.003	T	0.50874	-0.8776	9	0.62326	D	0.03	.	19.5038	0.95106	0.0:0.0:1.0:0.0	.	6	Q5T4D3-3	.	D	6	ENSP00000343871:H6D	ENSP00000343871:H6D	H	-	1	0	TMTC4	100119037	1.000000	0.71417	1.000000	0.80357	0.600000	0.36913	6.775000	0.75018	2.624000	0.88883	0.550000	0.68814	CAT		TMTC4-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045649.2	NM_032813	
NALCN	259232	broad.mit.edu	37	13	102047655	102047655	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr13:102047655G>C	ENST00000251127.6	-	3	251	c.170C>G	c.(169-171)aCg>aGg	p.T57R	NALCN_ENST00000376196.3_Missense_Mutation_p.T57R|NALCN_ENST00000376200.5_Missense_Mutation_p.T57R|NALCN_ENST00000470333.1_5'UTR	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	57					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.T57R(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GGTCATTGGCGTATTCATACA	0.443																																					p.T57R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C170G	13						.						154.0	118.0	130.0					13																	102047655		2203	4300	6503	100845656	SO:0001583	missense	259232	exon3			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.170C>G	13.37:g.102047655G>C	ENSP00000251127:p.Thr57Arg	Somatic		Unspecified	Illumina	Phase_I	100845656	NM_052867	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.411513	0.83340	.	.	ENSG00000102452	ENST00000251127;ENST00000376196;ENST00000376200;ENST00000449582	D;D;D	0.97772	-4.53;-4.53;-4.53	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.98713	0.9568	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99701	1.1004	10	0.72032	D	0.01	.	19.7619	0.96323	0.0:0.0:1.0:0.0	.	57;57	F2Z323;Q8IZF0	.;NALCN_HUMAN	R	57	ENSP00000251127:T57R;ENSP00000365367:T57R;ENSP00000365373:T57R	ENSP00000251127:T57R	T	-	2	0	NALCN	100845656	1.000000	0.71417	0.999000	0.59377	0.693000	0.40251	9.476000	0.97823	2.681000	0.91329	0.561000	0.74099	ACG		NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867	
WAC	51322	broad.mit.edu	37	10	28900738	28900738	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A036-01	TCGA-AG-A036-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr10:28900738T>C	ENST00000354911.4	+	10	1485	c.1324T>C	c.(1324-1326)Tct>Cct	p.S442P	WAC_ENST00000375646.1_Missense_Mutation_p.S290P|WAC_ENST00000347934.4_Missense_Mutation_p.S339P|WAC_ENST00000375664.4_Missense_Mutation_p.S397P	NM_016628.4	NP_057712.2	Q9BTA9	WAC_HUMAN	WW domain containing adaptor with coiled-coil	442					cellular response to DNA damage stimulus (GO:0006974)|G1 DNA damage checkpoint (GO:0044783)|histone H2B conserved C-terminal lysine ubiquitination (GO:0071894)|histone monoubiquitination (GO:0010390)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	chromatin binding (GO:0003682)|RNA polymerase II core binding (GO:0000993)	p.S442P(1)		NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|urinary_tract(1)	32						GTCTTTAACATCTGATGCGTC	0.373																																					p.S339P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1015C	10						.						156.0	138.0	144.0					10																	28900738		2203	4300	6503	28940744	SO:0001583	missense	51322	exon9			AK055852	CCDS7159.1, CCDS7160.1, CCDS7161.1	10p12.1	2007-05-17	2003-03-19		ENSG00000095787	ENSG00000095787			17327	protein-coding gene	gene with protein product		615049	"""WW domain-containing adaptor with coiled coil"""			11827461	Standard	NR_024557		Approved	Wwp4, FLJ31290, PRO1741, BM-016, MGC10753	uc001iuf.3	Q9BTA9	OTTHUMG00000017872	ENST00000354911.4:c.1324T>C	10.37:g.28900738T>C	ENSP00000346986:p.Ser442Pro	Somatic		Unspecified	Illumina	Phase_I	28940744	NM_100486	A8K2A9|C9JBT9|D3DRW5|D3DRW6|D3DRW7|Q53EN9|Q5JU75|Q5JU77|Q5VXK0|Q5VXK2|Q8TCK1|Q96DP3|Q96FW6|Q96JI3	Missense_Mutation	SNP	ENST00000354911.4	37	CCDS7159.1	.	.	.	.	.	.	.	.	.	.	T	18.49	3.635617	0.67130	.	.	ENSG00000095787	ENST00000375664;ENST00000375646;ENST00000347934;ENST00000354911;ENST00000338396	T;T;T;T	0.28895	1.59;1.75;1.62;1.59	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.46073	0.1374	L	0.32530	0.975	0.80722	D	1	D;D;P	0.76494	0.969;0.999;0.948	P;D;B	0.80764	0.649;0.994;0.446	T	0.45308	-0.9270	10	0.87932	D	0	-12.1921	16.1617	0.81721	0.0:0.0:0.0:1.0	.	397;339;442	Q9BTA9-2;Q9BTA9-5;Q9BTA9	.;.;WAC_HUMAN	P	397;290;339;442;5	ENSP00000364816:S397P;ENSP00000364797:S290P;ENSP00000311106:S339P;ENSP00000346986:S442P	ENSP00000341462:S5P	S	+	1	0	WAC	28940744	1.000000	0.71417	0.898000	0.35279	0.088000	0.18126	7.997000	0.88414	2.275000	0.75901	0.528000	0.53228	TCT		WAC-017	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000047371.1	NM_100264	
TBC1D12	23232	broad.mit.edu	37	10	96260074	96260074	+	Silent	SNP	T	T	C			TCGA-AG-A036-01	TCGA-AG-A036-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr10:96260074T>C	ENST00000225235.4	+	6	1619	c.1509T>C	c.(1507-1509)aaT>aaC	p.N503N		NM_015188.1	NP_056003.1	O60347	TBC12_HUMAN	TBC1 domain family, member 12	503	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)	p.N503N(1)		breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	20		Colorectal(252;0.0429)				ATGAACTAAATATCACTCCTG	0.413																																					p.N503N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1509C	10						.						147.0	135.0	139.0					10																	96260074		1877	4110	5987	96250064	SO:0001819	synonymous_variant	23232	exon6			AB011180	CCDS41553.1	10q23.33	2013-09-20			ENSG00000108239	ENSG00000108239			29082	protein-coding gene	gene with protein product						9628581	Standard	NM_015188		Approved	KIAA0608	uc001kjr.2	O60347	OTTHUMG00000018794	ENST00000225235.4:c.1509T>C	10.37:g.96260074T>C		Somatic		Unspecified	Illumina	Phase_I	96250064	NM_015188	Q5VYA6|Q8WX26|Q8WX59|Q9UG83	Silent	SNP	ENST00000225235.4	37	CCDS41553.1																																																																																				TBC1D12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049482.2		
GPR123	84435	broad.mit.edu	37	10	134940770	134940770	+	Silent	SNP	C	C	A			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr10:134940770C>A	ENST00000392607.3	+	6	871	c.435C>A	c.(433-435)atC>atA	p.I145I	GPR123_ENST00000392606.2_Silent_p.I48I|GPR123_ENST00000607359.1_Silent_p.I865I	NM_001083909.1	NP_001077378.1	Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	145					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.I865I(1)|p.I145I(1)		endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(3)	14		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		TCCCCTTTATCATCTGTGGGG	0.642																																					p.I145I												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C435A	10						.						55.0	47.0	50.0					10																	134940770		2203	4299	6502	134790760	SO:0001819	synonymous_variant	84435	exon6			AB058731	CCDS41580.1	10q26	2014-08-08			ENSG00000197177	ENSG00000197177		"""-"", ""GPCR / Class B : Orphans"""	13838	protein-coding gene	gene with protein product		612302				12565841	Standard	XM_005252695		Approved	KIAA1828	uc001llw.3	Q86SQ6	OTTHUMG00000019304	ENST00000392607.3:c.435C>A	10.37:g.134940770C>A		Somatic		Unspecified	Illumina	Phase_I	134790760	NM_001083909	A5HL16|A6NG50|Q5T234|Q86SN7|Q96JJ9	Silent	SNP	ENST00000392607.3	37	CCDS41580.1																																																																																				GPR123-003	NOVEL	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051113.2		
APC	324	broad.mit.edu	37	5	112151261	112151261	+	Nonsense_Mutation	SNP	C	C	T	rs137854568		TCGA-AG-A036-01	TCGA-AG-A036-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr5:112151261C>T	ENST00000457016.1	+	9	1284	c.904C>T	c.(904-906)Cga>Tga	p.R302*	APC_ENST00000508376.2_Nonsense_Mutation_p.R302*|APC_ENST00000257430.4_Nonsense_Mutation_p.R302*			P25054	APC_HUMAN	adenomatous polyposis coli	302	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R302*(13)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CTCTGCACCTCGAAGGCTGAC	0.428		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R284X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,colon,Substitution - Nonsense,0	.	13	Substitution - Nonsense(13)	large_intestine(13)	c.C850T	5	GRCh37	CM910029	APC	M	rs137854568	.						113.0	100.0	104.0					5																	112151261		2202	4300	6502	112179160	SO:0001587	stop_gained	324	exon7	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.904C>T	5.37:g.112151261C>T	ENSP00000413133:p.Arg302*	Somatic		Unspecified	Illumina	Phase_I	112179160	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	41	8.654520	0.98901	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.5148	18.9031	0.92451	0.0:1.0:0.0:0.0	.	.	.	.	X	302;284;302;302;302	.	ENSP00000257430:R302X	R	+	1	2	APC	112179160	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.567000	0.60850	2.520000	0.84964	0.650000	0.86243	CGA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APC	324	broad.mit.edu	37	5	112175507	112175507	+	Nonsense_Mutation	SNP	C	C	T	rs587782518		TCGA-AG-A036-01	TCGA-AG-A036-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr5:112175507C>T	ENST00000457016.1	+	16	4596	c.4216C>T	c.(4216-4218)Cag>Tag	p.Q1406*	APC_ENST00000508376.2_Nonsense_Mutation_p.Q1406*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.Q1406*			P25054	APC_HUMAN	adenomatous polyposis coli	1406	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q1406*(15)|p.Q1406fs*11(1)|p.?(1)|p.K1192fs*3(1)|p.I1401fs*2(1)|p.Y1376fs*41(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CAGCTCCGTTCAGAGTGAACC	0.468		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q1388X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,colon,Substitution - Nonsense,0	.	20	Substitution - Nonsense(15)|Deletion - Frameshift(3)|Unknown(1)|Insertion - Frameshift(1)	large_intestine(18)|soft_tissue(1)|skin(1)	c.C4162T	5	GRCh37	CI084250|CM023011	APC	I|M		.						113.0	105.0	108.0					5																	112175507		2202	4300	6502	112203406	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4216C>T	5.37:g.112175507C>T	ENSP00000413133:p.Gln1406*	Somatic		Unspecified	Illumina	Phase_I	112203406	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	41	8.658788	0.98903	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	5.3	0.74995	.	0.187376	0.50627	D	0.000103	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.0613	15.6825	0.77381	0.0:0.8637:0.1363:0.0	.	.	.	.	X	1406	.	.	Q	+	1	0	APC	112203406	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.175000	0.77632	1.615000	0.50252	0.655000	0.94253	CAG		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PCDHB8	56128	broad.mit.edu	37	5	140558959	140558959	+	Silent	SNP	C	C	T			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr5:140558959C>T	ENST00000239444.2	+	1	1589	c.1344C>T	c.(1342-1344)aaC>aaT	p.N448N	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	448	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.N448N(1)		NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCAATGACAACGCCCCCGCCT	0.592																																					p.N448N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1344T	5						.						163.0	209.0	193.0					5																	140558959		2203	4300	6503	140539143	SO:0001819	synonymous_variant	56128	exon1			AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1344C>T	5.37:g.140558959C>T		Somatic		Unspecified	Illumina	Phase_I	140539143	NM_019120	B9EGV1	Silent	SNP	ENST00000239444.2	37	CCDS4250.1																																																																																				PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2	NM_019120	
PCDHGB2	56103	broad.mit.edu	37	5	140741735	140741735	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr5:140741735G>A	ENST00000522605.1	+	1	2033	c.2033G>A	c.(2032-2034)cGc>cAc	p.R678H	PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA5_ENST00000518069.1_5'Flank|PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	678					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R678H(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCAGCGACCGCCGGGAGCCC	0.597																																					p.R678H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2033A	5						.						57.0	62.0	60.0					5																	140741735		2018	4191	6209	140721919	SO:0001583	missense	56103	exon1			AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.2033G>A	5.37:g.140741735G>A	ENSP00000429018:p.Arg678His	Somatic		Unspecified	Illumina	Phase_I	140721919	NM_018923	Q3MIJ3|Q9UN65	Missense_Mutation	SNP	ENST00000522605.1	37	CCDS54924.1	.	.	.	.	.	.	.	.	.	.	.	4.776	0.144372	0.09134	.	.	ENSG00000253910	ENST00000522605	T	0.51071	0.72	4.95	-4.49	0.03504	.	.	.	.	.	T	0.29355	0.0731	L	0.43757	1.38	0.09310	N	1	B;B	0.15141	0.005;0.012	B;B	0.09377	0.003;0.004	T	0.26849	-1.0091	9	0.15499	T	0.54	.	3.8358	0.08893	0.4849:0.0999:0.3148:0.1004	.	678;678	Q9Y5G2-2;Q9Y5G2	.;PCDGE_HUMAN	H	678	ENSP00000429018:R678H	ENSP00000429018:R678H	R	+	2	0	PCDHGB2	140721919	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.816000	0.00752	-1.278000	0.02408	-1.439000	0.01073	CGC		PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374741.1	NM_018923	
FBXO38	81545	broad.mit.edu	37	5	147796631	147796631	+	Silent	SNP	C	C	A			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr5:147796631C>A	ENST00000340253.5	+	12	1650	c.1482C>A	c.(1480-1482)tcC>tcA	p.S494S	FBXO38_ENST00000513826.1_Silent_p.S494S|FBXO38_ENST00000296701.6_Silent_p.S494S|FBXO38_ENST00000394370.3_Silent_p.S494S			Q6PIJ6	FBX38_HUMAN	F-box protein 38	494					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.S494S(1)	ATG4C/FBXO38(2)	NS(1)|breast(2)|endometrium(7)|kidney(5)|large_intestine(9)|lung(15)|ovary(5)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCAGAACTCCAACAATGACG	0.453																																					p.S494S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1482A	5						.						175.0	146.0	156.0					5																	147796631		2203	4300	6503	147776824	SO:0001819	synonymous_variant	81545	exon12			BC005873	CCDS43384.1, CCDS64285.1	5q33.1	2008-02-05			ENSG00000145868	ENSG00000145868		"""F-boxes /  ""other"""""	28844	protein-coding gene	gene with protein product		608533				12477932	Standard	NM_030793		Approved	MOKA, SP329, FLJ13962, Fbx38	uc003lpg.2	Q6PIJ6	OTTHUMG00000129929	ENST00000340253.5:c.1482C>A	5.37:g.147796631C>A		Somatic		Unspecified	Illumina	Phase_I	147776824	NM_205836	Q6PK72|Q7Z2U0|Q86VN3|Q9BXY6|Q9H837|Q9HC40	Silent	SNP	ENST00000340253.5	37																																																																																					FBXO38-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000252185.2	NM_030793	
LRRC14B	389257	broad.mit.edu	37	5	195313	195313	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr5:195313C>T	ENST00000328278.3	+	2	1418	c.1390C>T	c.(1390-1392)Cgg>Tgg	p.R464W	CTD-2083E4.7_ENST00000563761.1_RNA	NM_001080478.1	NP_001073947.1	A6NHZ5	LR14B_HUMAN	leucine rich repeat containing 14B	464								p.R476W(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|upper_aerodigestive_tract(2)	10						CGTGCTGCTGCGGGCTGACCG	0.567																																					p.R464W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1390T	5						.						110.0	122.0	118.0					5																	195313		2179	4278	6457	248313	SO:0001583	missense	389257	exon2				CCDS47184.1	5p15.33	2010-02-17			ENSG00000185028	ENSG00000185028			37268	protein-coding gene	gene with protein product							Standard	NM_001080478		Approved		uc003jal.1	A6NHZ5	OTTHUMG00000161578	ENST00000328278.3:c.1390C>T	5.37:g.195313C>T	ENSP00000327675:p.Arg464Trp	Somatic		Unspecified	Illumina	Phase_I	248313	NM_001080478		Missense_Mutation	SNP	ENST00000328278.3	37	CCDS47184.1	.	.	.	.	.	.	.	.	.	.	C	11.80	1.747772	0.30955	.	.	ENSG00000185028	ENST00000328278	T	0.01422	4.91	5.41	4.54	0.55810	.	0.419967	0.28317	N	0.015789	T	0.03871	0.0109	L	0.50333	1.59	0.09310	N	1	D	0.76494	0.999	P	0.56916	0.809	T	0.28235	-1.0050	10	0.72032	D	0.01	.	9.2007	0.37256	0.1652:0.6753:0.1594:0.0	.	464	A6NHZ5	LR14B_HUMAN	W	464	ENSP00000327675:R464W	ENSP00000327675:R464W	R	+	1	2	LRRC14B	248313	0.292000	0.24362	0.067000	0.19924	0.056000	0.15407	0.586000	0.23894	1.291000	0.44653	0.561000	0.74099	CGG		LRRC14B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000365393.2	NM_001080478	
ADAMTS16	170690	broad.mit.edu	37	5	5318311	5318311	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr5:5318311C>T	ENST00000274181.7	+	22	3614	c.3476C>T	c.(3475-3477)cCg>cTg	p.P1159L		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	1159	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.P1159L(1)		breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						GGGGGCCGGCCGGCCTCAGGC	0.647																																					p.P1159L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3476T	5						.						32.0	38.0	36.0					5																	5318311		2059	4170	6229	5371311	SO:0001583	missense	170690	exon22			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.3476C>T	5.37:g.5318311C>T	ENSP00000274181:p.Pro1159Leu	Somatic		Unspecified	Illumina	Phase_I	5371311	NM_139056	C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	37	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	C	12.57	1.977854	0.34942	.	.	ENSG00000145536	ENST00000274181	T	0.51071	0.72	4.69	3.77	0.43336	.	0.066204	0.64402	D	0.000011	T	0.42337	0.1198	M	0.79258	2.445	0.80722	D	1	P	0.38504	0.634	B	0.32864	0.154	T	0.30179	-0.9987	10	0.20046	T	0.44	.	9.2438	0.37513	0.0:0.8812:0.0:0.1188	.	1159	Q8TE57	ATS16_HUMAN	L	1159	ENSP00000274181:P1159L	ENSP00000274181:P1159L	P	+	2	0	ADAMTS16	5371311	0.786000	0.28738	0.588000	0.28705	0.031000	0.12232	2.704000	0.47118	1.022000	0.39626	0.563000	0.77884	CCG		ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
MARVELD2	153562	broad.mit.edu	37	5	68728916	68728916	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A036-01	TCGA-AG-A036-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr5:68728916G>A	ENST00000325631.5	+	5	1573	c.1499G>A	c.(1498-1500)cGa>cAa	p.R500Q	MARVELD2_ENST00000413223.2_Missense_Mutation_p.R384Q	NM_001038603.2|NM_001244734.1	NP_001033692.2|NP_001231663.1	Q8N4S9	MALD2_HUMAN	MARVEL domain containing 2	500					cell-cell junction organization (GO:0045216)|establishment of endothelial barrier (GO:0061028)|sensory perception of sound (GO:0007605)|tight junction assembly (GO:0070830)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|paranodal junction (GO:0033010)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)		p.R500Q(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(1)|lung(4)|skin(1)|urinary_tract(1)	15		Lung NSC(167;0.000937)|Prostate(74;0.0187)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;7.31e-57)|Epithelial(20;1.05e-52)|all cancers(19;2.63e-48)|Lung(70;0.0183)		TCGGAAAGCCGACAGGTTAGT	0.423																																					p.R500Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1499A	5						.						105.0	101.0	102.0					5																	68728916		2203	4300	6503	68764672	SO:0001583	missense	153562	exon5			AK055094	CCDS34175.1, CCDS58956.1	5q13.1	2007-05-01	2004-07-12	2004-07-14	ENSG00000152939	ENSG00000152939			26401	protein-coding gene	gene with protein product	"""tricellulin"""	610572	"""MARVEL (membrane-associating) domain containing 2"", ""deafness, autosomal recessive 49"""	MRVLDC2, DFNB49		17186462	Standard	NM_001038603		Approved	FLJ30532, TRIC	uc003jwq.3	Q8N4S9	OTTHUMG00000162512	ENST00000325631.5:c.1499G>A	5.37:g.68728916G>A	ENSP00000323264:p.Arg500Gln	Somatic		Unspecified	Illumina	Phase_I	68764672	NM_001038603	A1BQX0|A1BQX1|A8KA97|Q96NM9	Missense_Mutation	SNP	ENST00000325631.5	37	CCDS34175.1	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.789694	0.00623	.	.	ENSG00000152939	ENST00000325631;ENST00000454295;ENST00000512803;ENST00000436532;ENST00000413223	T;T;T;T;T	0.39229	1.69;1.09;1.71;1.66;1.66	5.74	1.57	0.23409	Occludin/RNA polymerase II elongation factor, ELL domain (1);	0.436751	0.26130	N	0.026180	T	0.12220	0.0297	N	0.01705	-0.755	0.09310	N	1	B;B	0.11235	0.002;0.004	B;B	0.08055	0.002;0.003	T	0.28106	-1.0054	10	0.07482	T	0.82	-16.6217	4.3767	0.11274	0.4114:0.3218:0.2668:0.0	.	488;500	Q8N4S9-3;Q8N4S9	.;MALD2_HUMAN	Q	500;488;500;384;384	ENSP00000323264:R500Q;ENSP00000396244:R488Q;ENSP00000423490:R500Q;ENSP00000414776:R384Q;ENSP00000398922:R384Q	ENSP00000323264:R500Q	R	+	2	0	MARVELD2	68764672	0.001000	0.12720	0.011000	0.14972	0.053000	0.15095	-0.390000	0.07332	-0.008000	0.14320	-0.119000	0.15052	CGA		MARVELD2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369583.1	NM_144724	
HNRNPH1	3187	broad.mit.edu	37	5	179045226	179045226	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A036-01	TCGA-AG-A036-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A036-01	TCGA-AG-A036-01	g.chr5:179045226C>T	ENST00000356731.5	-	5	2170	c.635G>A	c.(634-636)aGa>aAa	p.R212K	HNRNPH1_ENST00000524180.1_5'Flank|HNRNPH1_ENST00000442819.2_Missense_Mutation_p.R212K|HNRNPH1_ENST00000329433.6_Missense_Mutation_p.R212K|HNRNPH1_ENST00000511300.2_5'Flank|HNRNPH1_ENST00000510411.1_Missense_Mutation_p.R212K|HNRNPH1_ENST00000393432.4_Missense_Mutation_p.R212K			P31943	HNRH1_HUMAN	heterogeneous nuclear ribonucleoprotein H1 (H)	212					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA splicing (GO:0043484)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)	p.R212K(2)		breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(4)|skin(1)	14						AGCCCCAGGTCTGTCATAAGG	0.493																																					p.R212K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G635A	5						.						138.0	131.0	133.0					5																	179045226		2203	4300	6503	178977832	SO:0001583	missense	3187	exon6			BC001348	CCDS4446.1	5q35.3	2013-02-12		2008-04-18	ENSG00000169045	ENSG00000169045		"""RNA binding motif (RRM) containing"""	5041	protein-coding gene	gene with protein product		601035		HNRPH1		7499401	Standard	NM_005520		Approved	hnRNPH	uc003mkf.5	P31943	OTTHUMG00000130908	ENST00000356731.5:c.635G>A	5.37:g.179045226C>T	ENSP00000349168:p.Arg212Lys	Somatic		Unspecified	Illumina	Phase_I	178977832	NM_005520	B3KW86|D3DWQ2|Q6IBM4	Missense_Mutation	SNP	ENST00000356731.5	37	CCDS4446.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	24.6|24.6	4.551327|4.551327	0.86127|0.86127	.|.	.|.	ENSG00000169045|ENSG00000169045	ENST00000521173;ENST00000508103;ENST00000506721|ENST00000393432;ENST00000442819;ENST00000356731;ENST00000329433;ENST00000510411;ENST00000523921;ENST00000523137;ENST00000505811	T;T|T;T;T;T;T;T;T;T	0.36340|0.30714	1.26;1.26|2.67;2.67;2.67;2.65;2.69;2.48;1.52;2.0	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.58949|0.58949	0.2158|0.2158	M|M	0.85542|0.85542	2.76|2.76	0.80722|0.80722	D|D	1|1	.|D	.|0.57571	.|0.98	.|P	.|0.58970	.|0.849	T|T	0.64795|0.64795	-0.6323|-0.6323	7|10	0.87932|0.87932	D|D	0|0	-11.3825|-11.3825	19.809|19.809	0.96540|0.96540	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|212	.|P31943	.|HNRH1_HUMAN	N|K	87;166;166|212;212;212;212;212;26;164;212	ENSP00000425732:D166N;ENSP00000420850:D166N|ENSP00000377082:R212K;ENSP00000397797:R212K;ENSP00000349168:R212K;ENSP00000327539:R212K;ENSP00000426275:R212K;ENSP00000429270:R26K;ENSP00000427986:R164K;ENSP00000424087:R212K	ENSP00000420850:D166N|ENSP00000327539:R212K	D|R	-|-	1|2	0|0	HNRNPH1|HNRNPH1	178977832|178977832	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	7.445000|7.445000	0.80570|0.80570	2.753000|2.753000	0.94483|0.94483	0.585000|0.585000	0.79938|0.79938	GAC|AGA		HNRNPH1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253497.3	NM_005520	
