#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PYROXD2	84795	hgsc.bcm.edu	37	10	100144773	100144773	+	Missense_Mutation	SNP	C	C	T	rs141962703		TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr10:100144773C>T	ENST00000370575.4	-	15	1654	c.1606G>A	c.(1606-1608)Gtg>Atg	p.V536M	PYROXD2_ENST00000483923.1_5'UTR	NM_032709.2	NP_116098.2	Q8N2H3	PYRD2_HUMAN	pyridine nucleotide-disulphide oxidoreductase domain 2	536							oxidoreductase activity (GO:0016491)	p.V536M(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	12						TGCAGGGGCACGGGGCGGGCG	0.607																																					p.V536M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1606A	10						.	C	MET/VAL	0,4406		0,0,2203	75.0	73.0	74.0		1606	-4.3	0.0	10	dbSNP_134	74	1,8599	1.2+/-3.3	0,1,4299	no	missense	PYROXD2	NM_032709.2	21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	536/582	100144773	1,13005	2203	4300	6503	100134763	SO:0001583	missense	84795	exon15			AK074429	CCDS7474.1	10q24.2	2009-04-22	2009-04-22	2009-04-22	ENSG00000119943	ENSG00000119943			23517	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 33"""	C10orf33			Standard	NM_032709		Approved	FLJ23849	uc001kpc.3	Q8N2H3	OTTHUMG00000018877	ENST00000370575.4:c.1606G>A	10.37:g.100144773C>T	ENSP00000359607:p.Val536Met	Somatic		Capture	SOLID	Phase_I	100134763	NM_032709	D3DR61|Q5TAA9|Q9BRQ1	Missense_Mutation	SNP	ENST00000370575.4	37	CCDS7474.1	.	.	.	.	.	.	.	.	.	.	C	12.78	2.040632	0.35989	0.0	1.16E-4	ENSG00000119943	ENST00000370575	T	0.46451	0.87	5.16	-4.3	0.03710	.	0.739377	0.13556	N	0.379121	T	0.31979	0.0814	M	0.67397	2.05	0.18873	N	0.999987	B	0.26547	0.152	B	0.23574	0.047	T	0.27673	-1.0067	10	0.49607	T	0.09	-1.2767	4.2959	0.10901	0.0917:0.4268:0.2933:0.1882	.	536	Q8N2H3	PYRD2_HUMAN	M	536	ENSP00000359607:V536M	ENSP00000359607:V536M	V	-	1	0	PYROXD2	100134763	0.103000	0.21917	0.016000	0.15963	0.948000	0.59901	0.637000	0.24659	-0.631000	0.05560	0.557000	0.71058	GTG		PYROXD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049782.2	NM_032709	
BTRC	8945	hgsc.bcm.edu	37	10	103294568	103294568	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr10:103294568T>G	ENST00000370187.3	+	10	1366	c.1248T>G	c.(1246-1248)atT>atG	p.I416M	BTRC_ENST00000408038.2_Missense_Mutation_p.I380M|BTRC_ENST00000393441.4_Missense_Mutation_p.I375M	NM_033637.3	NP_378663.1	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing E3 ubiquitin protein ligase	416					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to organic cyclic compound (GO:0071407)|G2/M transition of mitotic cell cycle (GO:0000086)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.I416M(1)		endometrium(4)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	27		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		CAACTGACATTACCCTCCGGA	0.483																																					p.I380M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1140G	10						.						254.0	218.0	230.0					10																	103294568		2203	4300	6503	103284558	SO:0001583	missense	8945	exon9			Y14153	CCDS7511.1, CCDS7512.1, CCDS73183.1	10q24.32	2013-01-10	2012-02-23		ENSG00000166167	ENSG00000166167		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1144	protein-coding gene	gene with protein product		603482	"""beta-transducin repeat containing"""			9660940, 10331953, 18354483	Standard	NM_033637		Approved	bTrCP, betaTrCP, FBXW1A, Fwd1, beta-TrCP1, bTrCP1	uc001kta.4	Q9Y297	OTTHUMG00000018932	ENST00000370187.3:c.1248T>G	10.37:g.103294568T>G	ENSP00000359206:p.Ile416Met	Somatic		Capture	SOLID	Phase_I	103284558	NM_003939	B5MD49|Q5W141|Q5W142|Q9Y213	Missense_Mutation	SNP	ENST00000370187.3	37	CCDS7512.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.089199	0.76756	.	.	ENSG00000166167	ENST00000370187;ENST00000393441;ENST00000408038	T;T;T	0.61510	1.15;1.15;0.1	5.69	-7.31	0.01441	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.64402	D	0.000001	T	0.46678	0.1405	N	0.04880	-0.145	0.58432	D	0.999995	P;P;D	0.69078	0.577;0.699;0.997	P;P;D	0.76071	0.553;0.554;0.987	T	0.63924	-0.6527	10	0.51188	T	0.08	-12.033	11.9141	0.52755	0.0786:0.7796:0.0:0.1418	.	390;380;416	B7Z3H4;Q9Y297-2;Q9Y297	.;.;FBW1A_HUMAN	M	416;375;380	ENSP00000359206:I416M;ENSP00000377088:I375M;ENSP00000385339:I380M	ENSP00000359206:I416M	I	+	3	3	BTRC	103284558	0.003000	0.15002	0.758000	0.31321	0.991000	0.79684	-1.137000	0.03219	-1.481000	0.01863	-0.250000	0.11733	ATT		BTRC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049936.1	NM_033637	
ADD3	120	hgsc.bcm.edu	37	10	111876094	111876094	+	Missense_Mutation	SNP	C	C	T	rs559836081		TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr10:111876094C>T	ENST00000356080.4	+	4	779	c.412C>T	c.(412-414)Cgc>Tgc	p.R138C	ADD3_ENST00000277900.8_Missense_Mutation_p.R138C|ADD3_ENST00000497125.1_3'UTR|ADD3_ENST00000360162.3_Missense_Mutation_p.R138C	NM_016824.3	NP_058432.1	Q9UEY8	ADDG_HUMAN	adducin 3 (gamma)	138						cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.R138C(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	29		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;4.15e-05)|all cancers(201;0.000587)|BRCA - Breast invasive adenocarcinoma(275;0.0742)		AAAACTTACTCGCTGTAAACT	0.433																																					p.R138C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C412T	10						.						170.0	148.0	155.0					10																	111876094		2203	4300	6503	111866084	SO:0001583	missense	120	exon4			U37122	CCDS7561.1, CCDS7562.1	10q25.2	2005-11-08			ENSG00000148700	ENSG00000148700			245	protein-coding gene	gene with protein product		601568		ADDL		8893809	Standard	XM_005269529		Approved		uc001kyv.3	Q9UEY8	OTTHUMG00000019032	ENST00000356080.4:c.412C>T	10.37:g.111876094C>T	ENSP00000348381:p.Arg138Cys	Somatic		Capture	SOLID	Phase_I	111866084	NM_019903	D3DRA8|O43243|Q5VU09|Q92773|Q9UEY7	Missense_Mutation	SNP	ENST00000356080.4	37	CCDS7561.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.182171	0.78677	.	.	ENSG00000148700	ENST00000360162;ENST00000356080;ENST00000277900	T;T;T	0.28454	1.61;1.61;1.61	5.6	4.7	0.59300	Class II aldolase/adducin, N-terminal (2);	0.048695	0.85682	D	0.000000	T	0.62233	0.2411	M	0.89715	3.055	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.71178	-0.4669	10	0.87932	D	0	-5.3828	13.6678	0.62407	0.2811:0.7189:0.0:0.0	.	138;138	Q9UEY8;Q9UEY8-2	ADDG_HUMAN;.	C	138	ENSP00000353286:R138C;ENSP00000348381:R138C;ENSP00000277900:R138C	ENSP00000277900:R138C	R	+	1	0	ADD3	111866084	1.000000	0.71417	0.999000	0.59377	0.957000	0.61999	5.930000	0.70104	1.362000	0.46000	-0.169000	0.13324	CGC		ADD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050289.1	NM_019903	
EBF3	253738	hgsc.bcm.edu	37	10	131646712	131646712	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr10:131646712G>A	ENST00000355311.5	-	11	1144	c.1072C>T	c.(1072-1074)Cag>Tag	p.Q358*	EBF3_ENST00000368648.3_Nonsense_Mutation_p.Q349*			Q9H4W6	COE3_HUMAN	early B-cell factor 3	358					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q349*(3)|p.Q358*(3)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		TGCAACCTCTGAAAGCCGTAA	0.468																																					p.Q349X												.	.	6	Substitution - Nonsense(6)	lung(4)|large_intestine(2)	c.C1045T	10						.						166.0	154.0	158.0					10																	131646712		2203	4300	6503	131536702	SO:0001587	stop_gained	253738	exon11				CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.1072C>T	10.37:g.131646712G>A	ENSP00000347463:p.Gln358*	Somatic		Capture	SOLID	Phase_I	131536702	NM_001005463	A0AUY1|Q5T6H9|Q9H4W5	Nonsense_Mutation	SNP	ENST00000355311.5	37		.	.	.	.	.	.	.	.	.	.	G	37	6.270420	0.97431	.	.	ENSG00000108001	ENST00000355311;ENST00000368648	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-14.9271	20.0887	0.97806	0.0:0.0:1.0:0.0	.	.	.	.	X	358;349	.	ENSP00000347463:Q358X	Q	-	1	0	EBF3	131536702	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.809000	0.99208	2.825000	0.97269	0.655000	0.94253	CAG		EBF3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051015.2	NM_001005463	
RAG1	5896	hgsc.bcm.edu	37	11	36596949	36596949	+	Missense_Mutation	SNP	C	C	T	rs199474676		TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr11:36596949C>T	ENST00000299440.5	+	2	2207	c.2095C>T	c.(2095-2097)Cgg>Tgg	p.R699W		NM_000448.2	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	699			R -> W (in OS; also in a patient with multiple autoimmune disorders; dbSNP:rs199474676). {ECO:0000269|PubMed:21771083}.		adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|DNA recombination (GO:0006310)|histone monoubiquitination (GO:0010390)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|pre-B cell allelic exclusion (GO:0002331)|protein autoubiquitination (GO:0051865)|regulation of T cell differentiation (GO:0045580)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R699W(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	65	all_lung(20;0.226)	all_hematologic(20;0.107)				AGGCATTCTCCGGACTTTCAA	0.522									Familial Hemophagocytic Lymphohistiocytosis																												p.R699W	Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2095T	11						.						57.0	56.0	57.0					11																	36596949		2202	4298	6500	36553525	SO:0001583	missense	5896	exon2	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	M29474	CCDS7902.1	11p13	2014-09-17				ENSG00000166349		"""RING-type (C3HC4) zinc fingers"""	9831	protein-coding gene	gene with protein product	"""recombination activating protein 1"", ""RING finger protein 74"", ""V(D)J recombination-activating protein 1"""	179615				1612612, 1283330	Standard	NM_000448		Approved	RNF74, MGC43321	uc001mwu.4	P15918		ENST00000299440.5:c.2095C>T	11.37:g.36596949C>T	ENSP00000299440:p.Arg699Trp	Somatic		Capture	SOLID	Phase_I	36553525	NM_000448	E9PPC4|Q8IY72|Q8NER2	Missense_Mutation	SNP	ENST00000299440.5	37	CCDS7902.1	.	.	.	.	.	.	.	.	.	.	C	12.47	1.948423	0.34377	.	.	ENSG00000166349	ENST00000534663;ENST00000299440	D;D	0.91740	-2.9;-2.9	6.13	1.42	0.22433	.	0.000000	0.85682	D	0.000000	D	0.97179	0.9078	H	0.96460	3.825	0.54753	D	0.999987	D	0.89917	1.0	D	0.87578	0.998	D	0.97710	1.0190	10	0.87932	D	0	.	16.2267	0.82300	0.3939:0.6061:0.0:0.0	.	699	P15918	RAG1_HUMAN	W	699	ENSP00000434610:R699W;ENSP00000299440:R699W	ENSP00000299440:R699W	R	+	1	2	RAG1	36553525	0.999000	0.42202	0.567000	0.28434	0.476000	0.33039	4.226000	0.58606	0.025000	0.15241	-1.075000	0.02238	CGG		RAG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389535.1	NM_000448	
OR5W2	390148	hgsc.bcm.edu	37	11	55681566	55681566	+	Missense_Mutation	SNP	G	G	A	rs61749302	byFrequency	TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr11:55681566G>A	ENST00000344514.1	-	1	492	c.493C>T	c.(493-495)Cgc>Tgc	p.R165C		NM_001001960.1	NP_001001960.1	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W, member 2	165						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R165C(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(28)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						AAGCATAGGCGGAAGGCCAGT	0.428													G|||	469	0.0936502	0.1392	0.0403	5008	,	,		21011	0.0903		0.0944	False		,,,				2504	0.0726				p.R165C	Melanoma(48;171 1190 15239 43886 49348)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C493T	11						.	G	CYS/ARG	556,3846	246.5+/-255.1	41,474,1686	87.0	77.0	80.0		493	1.5	0.0	11	dbSNP_129	80	722,7870	174.6+/-224.8	31,660,3605	yes	missense	OR5W2	NM_001001960.1	180	72,1134,5291	AA,AG,GG		8.4032,12.6306,9.8353	benign	165/311	55681566	1278,11716	2201	4296	6497	55438142	SO:0001583	missense	390148	exon1			BK004398	CCDS31513.1	11q11	2012-08-09		2004-03-10	ENSG00000187612	ENSG00000187612		"""GPCR / Class A : Olfactory receptors"""	15299	protein-coding gene	gene with protein product				OR5W2P, OR5W3P			Standard	NM_001001960		Approved		uc010rir.2	Q8NH69	OTTHUMG00000166818	ENST00000344514.1:c.493C>T	11.37:g.55681566G>A	ENSP00000342448:p.Arg165Cys	Somatic		Capture	SOLID	Phase_I	55438142	NM_001001960		Missense_Mutation	SNP	ENST00000344514.1	37	CCDS31513.1	210	0.09615384615384616	81	0.16463414634146342	18	0.049723756906077346	44	0.07692307692307693	67	0.08839050131926121	G	4.463	0.085831	0.08583	0.126306	0.084032	ENSG00000187612	ENST00000344514	T	0.00188	8.59	4.77	1.45	0.22620	GPCR, rhodopsin-like superfamily (1);	0.602095	0.13398	N	0.390838	T	0.00012	0.0000	L	0.58510	1.815	0.80722	P	0.0	B	0.19583	0.037	B	0.24848	0.056	T	0.15492	-1.0435	9	0.59425	D	0.04	.	5.7223	0.17995	0.1028:0.0:0.3813:0.5159	.	165	Q8NH69	OR5W2_HUMAN	C	165	ENSP00000342448:R165C	ENSP00000342448:R165C	R	-	1	0	OR5W2	55438142	0.000000	0.05858	0.033000	0.17914	0.046000	0.14306	-1.143000	0.03200	0.425000	0.26087	0.549000	0.68633	CGC		OR5W2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391523.1	NM_001001960	
HYOU1	10525	hgsc.bcm.edu	37	11	118920536	118920536	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr11:118920536A>G	ENST00000404233.3	-	15	1803	c.1679T>C	c.(1678-1680)tTt>tCt	p.F560S	HYOU1_ENST00000525859.1_Missense_Mutation_p.F560S|HYOU1_ENST00000529972.1_Missense_Mutation_p.F560S|HYOU1_ENST00000543287.1_Missense_Mutation_p.F473S	NM_001130991.1|NM_006389.3	NP_001124463.1|NP_006380.1	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1	560					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|response to ischemia (GO:0002931)|response to stress (GO:0006950)	endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)	p.F560S(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(10)|prostate(1)|skin(2)	33	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		CAGTGTCTCAAATACAGACTC	0.428																																					p.F560S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1679C	11						.						264.0	242.0	250.0					11																	118920536		2200	4295	6495	118425746	SO:0001583	missense	10525	exon15			U65785	CCDS8408.1	11q23.1-q23.3	2011-09-02			ENSG00000149428	ENSG00000149428		"""Heat shock proteins / HSP70"""	16931	protein-coding gene	gene with protein product	"""glucose-regulated protein 170"""	601746				9020069, 10037731	Standard	XM_005271390		Approved	ORP150, HSP12A, Grp170	uc001pux.3	Q9Y4L1	OTTHUMG00000166354	ENST00000404233.3:c.1679T>C	11.37:g.118920536A>G	ENSP00000384144:p.Phe560Ser	Somatic		Capture	SOLID	Phase_I	118425746	NM_006389	A8C1Z0|B7Z909|Q2I204|Q53H25	Missense_Mutation	SNP	ENST00000404233.3	37	CCDS8408.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.025777	0.75390	.	.	ENSG00000149428	ENST00000404233;ENST00000353883;ENST00000529972;ENST00000536103;ENST00000535579;ENST00000525859;ENST00000544701;ENST00000543287;ENST00000530473	T;T;T;T;T	0.02258	5.6;5.6;5.6;4.37;5.6	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.08358	0.0208	L	0.52573	1.65	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.91635	0.999;0.972;0.997;0.997	T	0.49862	-0.8894	10	0.20046	T	0.44	-11.3965	14.4125	0.67124	1.0:0.0:0.0:0.0	.	551;604;560;560	B3KXH0;B7Z2N4;Q9Y4L1;A8C1Z0	.;.;HYOU1_HUMAN;.	S	560;551;560;560;409;560;603;473;560	ENSP00000384144:F560S;ENSP00000437313:F560S;ENSP00000433397:F560S;ENSP00000442727:F473S;ENSP00000431874:F560S	ENSP00000278752:F551S	F	-	2	0	HYOU1	118425746	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	7.780000	0.85658	2.175000	0.68902	0.533000	0.62120	TTT		HYOU1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389353.1	NM_006389	
ANO4	121601	hgsc.bcm.edu	37	12	101520844	101520844	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr12:101520844C>T	ENST00000392977.3	+	27	3074	c.2864C>T	c.(2863-2865)cCg>cTg	p.P955L	ANO4_ENST00000550015.1_Missense_Mutation_p.P475L|ANO4_ENST00000299222.9_Missense_Mutation_p.P475L|ANO4_ENST00000392979.3_Missense_Mutation_p.P920L			Q32M45	ANO4_HUMAN	anoctamin 4	955					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.P920L(1)		NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						AACGAGTGGCCGTGACCATGT	0.483										HNSCC(74;0.22)																											p.P920L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2759T	12						.						97.0	66.0	76.0					12																	101520844		2203	4300	6503	100044975	SO:0001583	missense	121601	exon26			AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.2864C>T	12.37:g.101520844C>T	ENSP00000376703:p.Pro955Leu	Somatic		Capture	SOLID	Phase_I	100044975	NM_178826	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	ENST00000392977.3	37		.	.	.	.	.	.	.	.	.	.	C	27.4	4.824592	0.90955	.	.	ENSG00000151572	ENST00000392979;ENST00000299222;ENST00000392977;ENST00000550015	T;T;T;T	0.72167	-0.57;-0.3;-0.63;-0.3	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.78039	0.4221	L	0.27053	0.805	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.80165	-0.1496	10	0.87932	D	0	.	19.9299	0.97115	0.0:1.0:0.0:0.0	.	475;955;920	Q32M45-3;Q32M45;Q32M45-2	.;ANO4_HUMAN;.	L	920;475;955;475	ENSP00000376705:P920L;ENSP00000299222:P475L;ENSP00000376703:P955L;ENSP00000450192:P475L	ENSP00000299222:P475L	P	+	2	0	ANO4	100044975	1.000000	0.71417	0.972000	0.41901	0.680000	0.39746	7.772000	0.85439	2.769000	0.95229	0.655000	0.94253	CCG		ANO4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409295.1	NM_178826	
UBE3B	89910	hgsc.bcm.edu	37	12	109924290	109924290	+	Silent	SNP	C	C	T			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr12:109924290C>T	ENST00000342494.3	+	6	952	c.357C>T	c.(355-357)tcC>tcT	p.S119S	UBE3B_ENST00000540230.1_Silent_p.S119S|UBE3B_ENST00000536398.1_Silent_p.S119S|UBE3B_ENST00000340074.5_Silent_p.S119S|UBE3B_ENST00000434735.2_Silent_p.S119S|UBE3B_ENST00000280774.5_Silent_p.S119S|UBE3B_ENST00000537063.1_Silent_p.S119S	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	119					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.S119S(1)		NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						GGTATGTGTCCCTGGCTTGTT	0.423																																					p.S119S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C357T	12						.						171.0	148.0	156.0					12																	109924290		2203	4300	6503	108408673	SO:0001819	synonymous_variant	89910	exon6			BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.357C>T	12.37:g.109924290C>T		Somatic		Capture	SOLID	Phase_I	108408673	NM_130466	A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Silent	SNP	ENST00000342494.3	37	CCDS9129.1																																																																																				UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403119.1	NM_183415	
FBXO21	23014	hgsc.bcm.edu	37	12	117595862	117595862	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr12:117595862C>T	ENST00000330622.5	-	10	1353	c.1354G>A	c.(1354-1356)Gac>Aac	p.D452N	FBXO21_ENST00000427718.2_Missense_Mutation_p.D445N			O94952	FBX21_HUMAN	F-box protein 21	452					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	ubiquitin ligase complex (GO:0000151)	DNA binding (GO:0003677)|ubiquitin-protein transferase activity (GO:0004842)	p.D452N(1)		breast(4)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|pancreas(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	29	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0291)		TGGAGGATGTCAAGCACCTTC	0.493																																					p.D445N	GBM(168;452 2038 13535 17701 43680)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1333A	12						.						145.0	147.0	146.0					12																	117595862		2203	4300	6503	116080245	SO:0001583	missense	23014	exon10			AB020682	CCDS9184.1, CCDS44989.1	12q24.23	2004-06-15	2004-06-15					"""F-boxes /  ""other"""""	13592	protein-coding gene	gene with protein product		609095	"""F-box only protein 21"""			10048485, 10531035	Standard	NM_033624		Approved	FBX21, KIAA0875	uc001twk.3	O94952	OTTHUMG00000169495	ENST00000330622.5:c.1354G>A	12.37:g.117595862C>T	ENSP00000328187:p.Asp452Asn	Somatic		Capture	SOLID	Phase_I	116080245	NM_015002	B3KMF0|Q5BJG0|Q9H087	Missense_Mutation	SNP	ENST00000330622.5	37	CCDS9184.1	.	.	.	.	.	.	.	.	.	.	C	33	5.193492	0.94960	.	.	ENSG00000135108	ENST00000427718;ENST00000257563;ENST00000535590;ENST00000330622;ENST00000548840	T;T	0.50813	0.73;0.8	5.02	5.02	0.67125	F-box domain, Skp2-like (1);	0.000000	0.85682	D	0.000000	T	0.55893	0.1949	N	0.24115	0.695	0.80722	D	1	D;P;D;D	0.65815	0.995;0.907;0.993;0.978	P;B;D;P	0.74674	0.858;0.444;0.984;0.736	T	0.54984	-0.8211	10	0.37606	T	0.19	-2.1842	18.5372	0.91014	0.0:1.0:0.0:0.0	.	301;195;452;445	Q8IUQ5;B3KQC8;O94952;O94952-1	.;.;FBX21_HUMAN;.	N	445;361;301;452;104	ENSP00000414468:D445N;ENSP00000328187:D452N	ENSP00000257563:D361N	D	-	1	0	FBXO21	116080245	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.320000	0.79064	2.607000	0.88179	0.655000	0.94253	GAC		FBXO21-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404409.1	NM_033624	
KRAS	3845	hgsc.bcm.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35A	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp	Somatic		Capture	SOLID	Phase_I	25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
CAPRIN2	65981	hgsc.bcm.edu	37	12	30888072	30888072	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr12:30888072C>A	ENST00000395805.2	-	4	1186	c.639G>T	c.(637-639)aaG>aaT	p.K213N	CAPRIN2_ENST00000298892.5_Missense_Mutation_p.K213N|CAPRIN2_ENST00000417045.1_Missense_Mutation_p.K213N|CAPRIN2_ENST00000251071.5_Missense_Mutation_p.K213N|CAPRIN2_ENST00000308433.5_5'UTR|CAPRIN2_ENST00000538387.1_5'UTR	NM_001206856.1	NP_001193785.1			caprin family member 2									p.K213N(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(4)|large_intestine(13)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	48	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TAGTTCGAAGCTTTTTCTTCT	0.408																																					p.K213N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G639T	12						.						180.0	170.0	173.0					12																	30888072		2203	4300	6503	30779339	SO:0001583	missense	65981	exon4			AY074491	CCDS8720.1, CCDS41766.1, CCDS41766.2, CCDS55816.1	12p11	2010-08-03	2007-03-27	2007-03-27	ENSG00000110888	ENSG00000110888			21259	protein-coding gene	gene with protein product		610375	"""C1q domain containing 1"""	C1QDC1		11347906, 14764709	Standard	NM_001002259		Approved	EEG1, FLJ22569, FLJ11391, caprin-2, RNG140	uc001rji.1	Q6IMN6	OTTHUMG00000169185	ENST00000395805.2:c.639G>T	12.37:g.30888072C>A	ENSP00000379150:p.Lys213Asn	Somatic		Capture	SOLID	Phase_I	30779339	NM_001002259		Missense_Mutation	SNP	ENST00000395805.2	37	CCDS55816.1	.	.	.	.	.	.	.	.	.	.	C	16.88	3.245137	0.59103	.	.	ENSG00000110888	ENST00000298892;ENST00000395805;ENST00000251071;ENST00000417045;ENST00000537108;ENST00000541765;ENST00000543380;ENST00000542550	T;T;T;T;T;T;T;T	0.27104	1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69	4.61	-0.684	0.11331	.	0.201608	0.43579	D	0.000557	T	0.39064	0.1064	L	0.59436	1.845	0.80722	D	1	D;D;D;D;D	0.76494	0.995;0.997;0.999;0.996;0.983	P;D;D;D;P	0.64321	0.878;0.924;0.922;0.922;0.782	T	0.14227	-1.0480	10	0.87932	D	0	-16.9831	10.6726	0.45768	0.0:0.4965:0.0:0.5035	.	213;213;213;213;213	Q149P6;Q6IMN6-3;Q6IMN6;Q6IMN6-2;E4NKG2	.;.;CAPR2_HUMAN;.;.	N	213;213;213;213;132;10;10;132	ENSP00000298892:K213N;ENSP00000379150:K213N;ENSP00000251071:K213N;ENSP00000391479:K213N;ENSP00000438010:K132N;ENSP00000444137:K10N;ENSP00000440785:K10N;ENSP00000443353:K132N	ENSP00000251071:K213N	K	-	3	2	CAPRIN2	30779339	0.920000	0.31207	0.988000	0.46212	0.982000	0.71751	-0.116000	0.10724	-0.341000	0.08376	-0.229000	0.12294	AAG		CAPRIN2-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000403322.2	NM_023925	
NUP107	57122	hgsc.bcm.edu	37	12	69135645	69135646	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	TT	TT	TT	-	TT	TT	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr12:69135645_69135646delTT	ENST00000229179.4	+	27	2887_2888	c.2555_2556delTT	c.(2554-2556)cttfs	p.L852fs	NUP107_ENST00000378905.2_Frame_Shift_Del_p.L613fs|NUP107_ENST00000539906.1_Frame_Shift_Del_p.L823fs	NM_020401.2	NP_065134.1	P57740	NU107_HUMAN	nucleoporin 107kDa	852					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|structural constituent of nuclear pore (GO:0017056)	p.C853fs*31(1)	NUP107/LGR5(2)	breast(3)|endometrium(4)|kidney(4)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(2)	39	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)			CTGAGAAAGCTTTGTCTGCCAA	0.386																																					p.852_852del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.2555_2556del	12						.																																			67421913	SO:0001589	frameshift_variant	57122	exon27			AK055629	CCDS8985.1	12q14	2004-03-19			ENSG00000111581	ENSG00000111581			29914	protein-coding gene	gene with protein product		607617				12552102, 12705868	Standard	XM_005269037		Approved	NUP84	uc001suf.3	P57740	OTTHUMG00000169265	ENST00000229179.4:c.2555_2556delTT	12.37:g.69135645_69135646delTT	ENSP00000229179:p.Leu852fs	Somatic		Capture	SOLID	Phase_I	67421912	NM_020401	B4DZ67|Q6PJE1	Frame_Shift_Del	DEL	ENST00000229179.4	37	CCDS8985.1																																																																																				NUP107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403195.1	NM_020401	
DHX37	57647	hgsc.bcm.edu	37	12	125441359	125441359	+	Silent	SNP	T	T	C	rs10773127	byFrequency	TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr12:125441359T>C	ENST00000308736.2	-	18	2429	c.2331A>G	c.(2329-2331)acA>acG	p.T777T	DHX37_ENST00000544745.1_Silent_p.T564T	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	777							ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.T777T(1)		breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		CCACGGGGAATGTGGCCATTG	0.642													C|||	1904	0.380192	0.8533	0.2536	5008	,	,		19284	0.2034		0.2058	False		,,,				2504	0.1922				p.T777T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2331G	12						.	C		3352,1054	382.3+/-324.4	1296,760,147	95.0	93.0	93.0		2331	-3.0	1.0	12	dbSNP_120	93	1821,6779	729.8+/-406.7	189,1443,2668	no	coding-synonymous	DHX37	NM_032656.3		1485,2203,2815	CC,CT,TT		21.1744,23.9219,39.774		777/1158	125441359	5173,7833	2203	4300	6503	124007312	SO:0001819	synonymous_variant	57647	exon18			AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.2331A>G	12.37:g.125441359T>C		Somatic		Capture	SOLID	Phase_I	124007312	NM_032656	Q9BUI7|Q9P211	Silent	SNP	ENST00000308736.2	37	CCDS9261.1																																																																																				DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032656	
SPG20	23111	hgsc.bcm.edu	37	13	36878766	36878766	+	Silent	SNP	G	G	A			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr13:36878766G>A	ENST00000451493.1	-	9	1954	c.1737C>T	c.(1735-1737)taC>taT	p.Y579Y	SPG20_ENST00000355182.4_Silent_p.Y579Y|SPG20_ENST00000494062.2_Silent_p.Y579Y|SPG20_ENST00000438666.2_Silent_p.Y579Y	NM_001142295.1	NP_001135767.1	Q8N0X7	SPG20_HUMAN	spastic paraplegia 20 (Troyer syndrome)	579					abscission (GO:0009838)|adipose tissue development (GO:0060612)|cell death (GO:0008219)|cell division (GO:0051301)|lipid particle organization (GO:0034389)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of collateral sprouting in absence of injury (GO:0048698)|neuromuscular process (GO:0050905)|regulation of mitochondrial membrane potential (GO:0051881)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)|midbody (GO:0030496)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ubiquitin protein ligase binding (GO:0031625)	p.Y579Y(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	27		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;2.42e-08)|Epithelial(112;1.58e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00128)|BRCA - Breast invasive adenocarcinoma(63;0.0125)|GBM - Glioblastoma multiforme(144;0.026)		CATTATATCCGTATCTTTAAA	0.343																																					p.Y579Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1737T	13						.						70.0	62.0	65.0					13																	36878766		2203	4300	6503	35776766	SO:0001819	synonymous_variant	23111	exon9			AB011182	CCDS9356.1	13q13.1	2008-07-04	2007-04-23		ENSG00000133104	ENSG00000133104			18514	protein-coding gene	gene with protein product	"""spartin"""	607111				6022528, 12134148	Standard	NM_001142294		Approved	KIAA0610, TAHCCP1	uc001uvm.3	Q8N0X7	OTTHUMG00000016730	ENST00000451493.1:c.1737C>T	13.37:g.36878766G>A		Somatic		Capture	SOLID	Phase_I	35776766	NM_001142295	O60349|Q86Y67|Q9H1T2|Q9H1T3	Silent	SNP	ENST00000451493.1	37	CCDS9356.1																																																																																				SPG20-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044494.2		
PCNX	22990	hgsc.bcm.edu	37	14	71445269	71445269	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr14:71445269C>T	ENST00000304743.2	+	6	2661	c.2215C>T	c.(2215-2217)Cgg>Tgg	p.R739W	PCNX_ENST00000439984.3_Missense_Mutation_p.R739W|PCNX_ENST00000238570.5_Missense_Mutation_p.R739W	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	739						integral component of membrane (GO:0016021)		p.R739W(1)		NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		TTTATTAGGACGGGCTTCCCA	0.463																																					p.R739W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2215T	14						.						78.0	76.0	77.0					14																	71445269		2203	4300	6503	70515022	SO:0001583	missense	22990	exon6			AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.2215C>T	14.37:g.71445269C>T	ENSP00000304192:p.Arg739Trp	Somatic		Capture	SOLID	Phase_I	70515022	NM_014982	B2RTR6|O94897|Q96AI7|Q9Y2J9	Missense_Mutation	SNP	ENST00000304743.2	37	CCDS9806.1	.	.	.	.	.	.	.	.	.	.	C	10.70	1.424458	0.25639	.	.	ENSG00000100731	ENST00000304743;ENST00000238570;ENST00000439984	T;T;T	0.12361	5.27;5.27;2.69	5.56	3.48	0.39840	.	0.000000	0.85682	D	0.000000	T	0.31888	0.0811	L	0.54323	1.7	0.50039	D	0.999842	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.993;0.993;0.997	T	0.07654	-1.0761	10	0.66056	D	0.02	.	14.5084	0.67767	0.2578:0.7422:0.0:0.0	.	739;739;739	B2RTR6;Q96RV3;Q96RV3-2	.;PCX1_HUMAN;.	W	739	ENSP00000304192:R739W;ENSP00000238570:R739W;ENSP00000396617:R739W	ENSP00000238570:R739W	R	+	1	2	PCNX	70515022	0.998000	0.40836	0.998000	0.56505	0.961000	0.63080	1.761000	0.38440	1.269000	0.44280	0.655000	0.94253	CGG		PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1	NM_014982	
VPS13C	54832	hgsc.bcm.edu	37	15	62327204	62327204	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr15:62327204C>T	ENST00000261517.5	-	4	308	c.235G>A	c.(235-237)Gtt>Att	p.V79I	VPS13C_ENST00000395898.3_Missense_Mutation_p.V79I|VPS13C_ENST00000395896.4_Missense_Mutation_p.V79I|VPS13C_ENST00000249837.3_Missense_Mutation_p.V79I	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)									p.V79I(1)		NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						GTCGCAACAACTGCTTCTCCA	0.328																																					p.V79I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G235A	15						.						92.0	92.0	92.0					15																	62327204		2203	4300	6503	60114496	SO:0001583	missense	54832	exon4			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.235G>A	15.37:g.62327204C>T	ENSP00000261517:p.Val79Ile	Somatic		Capture	SOLID	Phase_I	60114496	NM_017684		Missense_Mutation	SNP	ENST00000261517.5	37	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	C	32	5.120493	0.94385	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	D;D;D;D	0.85702	-2.02;-2.02;-2.02;-2.02	5.58	5.58	0.84498	.	0.000000	0.64402	D	0.000001	D	0.91865	0.7425	M	0.68952	2.095	0.58432	D	0.999999	D;D;P;D	0.89917	0.983;1.0;0.898;1.0	P;D;P;D	0.91635	0.866;0.999;0.779;0.999	D	0.92150	0.5727	10	0.87932	D	0	.	18.7178	0.91682	0.0:1.0:0.0:0.0	.	79;79;79;79	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	I	79	ENSP00000249837:V79I;ENSP00000261517:V79I;ENSP00000379233:V79I;ENSP00000379235:V79I	ENSP00000249837:V79I	V	-	1	0	VPS13C	60114496	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.776000	0.75023	2.774000	0.95407	0.655000	0.94253	GTT		VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684	
MYO9A	4649	hgsc.bcm.edu	37	15	72190711	72190711	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr15:72190711T>C	ENST00000356056.5	-	25	4605	c.4133A>G	c.(4132-4134)aAt>aGt	p.N1378S	MYO9A_ENST00000444904.1_Missense_Mutation_p.N1359S|MYO9A_ENST00000563542.1_5'UTR|MYO9A_ENST00000424560.1_Missense_Mutation_p.N1378S|MYO9A_ENST00000564571.1_Missense_Mutation_p.N1378S|MYO9A_ENST00000566885.1_Missense_Mutation_p.N998S	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	1378	Tail.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)	p.N1378S(1)		NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						GCTAGTCTCATTTGAGGCACT	0.448																																					p.N1378S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4133G	15						.						102.0	100.0	100.0					15																	72190711		2199	4297	6496	69977765	SO:0001583	missense	4649	exon25			AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.4133A>G	15.37:g.72190711T>C	ENSP00000348349:p.Asn1378Ser	Somatic		Capture	SOLID	Phase_I	69977765	NM_006901	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	ENST00000356056.5	37	CCDS10239.1	.	.	.	.	.	.	.	.	.	.	T	0	-2.830407	0.00070	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904	D;D;D	0.83419	-1.72;-1.72;-1.72	5.51	-1.77	0.07982	.	.	.	.	.	T	0.44138	0.1279	N	0.00347	-1.61	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.49818	-0.8899	9	0.08179	T	0.78	.	4.5861	0.12282	0.0:0.2474:0.2649:0.4878	.	1359;1378;1378	B2RTY4-2;B2RTY4-4;B2RTY4	.;.;MYO9A_HUMAN	S	1378;1378;1359	ENSP00000348349:N1378S;ENSP00000399162:N1378S;ENSP00000398250:N1359S	ENSP00000348349:N1378S	N	-	2	0	MYO9A	69977765	0.774000	0.28592	0.191000	0.23289	0.014000	0.08584	1.121000	0.31283	-0.087000	0.12528	-1.724000	0.00704	AAT		MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901	
ITGAL	3683	hgsc.bcm.edu	37	16	30507468	30507468	+	Silent	SNP	C	C	T	rs185420636		TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr16:30507468C>T	ENST00000356798.6	+	14	1734	c.1554C>T	c.(1552-1554)ctC>ctT	p.L518L	ITGAL_ENST00000568012.1_3'UTR|RP11-297C4.1_ENST00000563751.1_RNA|ITGAL_ENST00000358164.5_Silent_p.L435L|ITGAL_ENST00000433423.2_Intron	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	518					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)	p.L518L(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	GCTACCCACTCGGGCGGTTTG	0.602													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15173	0.0		0.0	False		,,,				2504	0.0				p.L435L	NSCLC(110;1462 1641 3311 33990 49495)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1305T	16						.						75.0	82.0	79.0					16																	30507468		2197	4300	6497	30414969	SO:0001819	synonymous_variant	3683	exon12				CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.1554C>T	16.37:g.30507468C>T		Somatic		Capture	SOLID	Phase_I	30414969	NM_001114380	O43746|Q45H73|Q96HB1|Q9UBC8	Silent	SNP	ENST00000356798.6	37	CCDS32433.1																																																																																				ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434508.2		
SMPD3	55512	hgsc.bcm.edu	37	16	68404972	68404972	+	Silent	SNP	G	G	A			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr16:68404972G>A	ENST00000219334.5	-	3	1716	c.1113C>T	c.(1111-1113)gcC>gcT	p.A371A	SMPD3_ENST00000563226.1_Silent_p.A371A|SMPD3_ENST00000568373.1_Silent_p.A371A|SMPD3_ENST00000566009.1_5'Flank	NM_018667.3	NP_061137.1	Q9NY59	NSMA2_HUMAN	sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II)	371					cell cycle (GO:0007049)|glycosphingolipid metabolic process (GO:0006687)|hematopoietic progenitor cell differentiation (GO:0002244)|peptide hormone secretion (GO:0030072)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	Golgi cis cisterna (GO:0000137)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)	p.A371A(1)		breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	Phosphatidylserine(DB00144)	TCAATTTGGTGGCTGCTCGCT	0.602																																					p.A371A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1113T	16						.						73.0	60.0	64.0					16																	68404972		2198	4300	6498	66962473	SO:0001819	synonymous_variant	55512	exon3			AJ250460	CCDS10867.1	16q22.1	2008-02-05			ENSG00000103056	ENSG00000103056			14240	protein-coding gene	gene with protein product		605777				10823942	Standard	NM_018667		Approved	NSMASE2	uc002ewa.3	Q9NY59	OTTHUMG00000137559	ENST00000219334.5:c.1113C>T	16.37:g.68404972G>A		Somatic		Capture	SOLID	Phase_I	66962473	NM_018667	B7ZL82|Q2M1S8	Silent	SNP	ENST00000219334.5	37	CCDS10867.1																																																																																				SMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268895.3	NM_018667	
USP6	9098	hgsc.bcm.edu	37	17	5058851	5058851	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr17:5058851G>A	ENST00000574788.1	+	31	5008	c.2778G>A	c.(2776-2778)tgG>tgA	p.W926*	USP6_ENST00000332776.4_3'UTR|USP6_ENST00000250066.6_Nonsense_Mutation_p.W926*|USP6_ENST00000304328.5_Nonsense_Mutation_p.W609*			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	926	USP.				cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)	p.W926*(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						AAGTATCCTGGTTAGCAAGAC	0.473			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																p.W926X			Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G2778A	17						.						154.0	132.0	140.0					17																	5058851		2203	4300	6503	4999575	SO:0001587	stop_gained	9098	exon23			X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.2778G>A	17.37:g.5058851G>A	ENSP00000460380:p.Trp926*	Somatic		Capture	SOLID	Phase_I	4999575	NM_004505	Q15634|Q86WP6|Q8IWT4	Nonsense_Mutation	SNP	ENST00000574788.1	37	CCDS11069.2	.	.	.	.	.	.	.	.	.	.	G	50	16.419912	0.99863	.	.	ENSG00000129204	ENST00000250066;ENST00000304328	.	.	.	2.91	0.376	0.16193	.	0.060911	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	6.1526	0.20320	0.5114:0.0:0.4886:0.0	.	.	.	.	X	926;609	.	ENSP00000250066:W926X	W	+	3	0	USP6	4999575	0.988000	0.35896	0.982000	0.44146	0.050000	0.14768	0.249000	0.18216	-0.090000	0.12462	0.398000	0.26397	TGG		USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438990.1	NM_004505	
GAST	2520	hgsc.bcm.edu	37	17	39872102	39872102	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr17:39872102G>A	ENST00000329402.3	+	3	351	c.284G>A	c.(283-285)cGc>cAc	p.R95H	JUP_ENST00000540235.1_Intron|RNA5SP442_ENST00000365050.1_RNA	NM_000805.4	NP_000796.1	P01350	GAST_HUMAN	gastrin	95		Cleavage.			G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.R95H(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7		Breast(137;0.000307)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			TTCGGCCGCCGCAGTGCTGAG	0.552																																					p.R95H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G284A	17						.						63.0	64.0	64.0					17																	39872102		2203	4300	6503	37125628	SO:0001583	missense	2520	exon3				CCDS11404.1	17q21.2	2013-02-26	2005-06-14	2005-06-14	ENSG00000184502	ENSG00000184502		"""Endogenous ligands"""	4164	protein-coding gene	gene with protein product	"""preprogastrin"""	137250		GAS			Standard	NM_000805		Approved		uc002hxl.3	P01350	OTTHUMG00000133496	ENST00000329402.3:c.284G>A	17.37:g.39872102G>A	ENSP00000331358:p.Arg95His	Somatic		Capture	SOLID	Phase_I	37125628	NM_000805	P78463|P78464	Missense_Mutation	SNP	ENST00000329402.3	37	CCDS11404.1	.	.	.	.	.	.	.	.	.	.	G	13.59	2.281138	0.40394	.	.	ENSG00000184502	ENST00000329402	T	0.68624	-0.34	4.74	3.78	0.43462	Gastrin/cholecystokinin peptide hormone (2);	0.000000	0.51477	D	0.000084	T	0.62466	0.2430	M	0.75447	2.3	0.49582	D	0.999801	P	0.43701	0.815	B	0.37943	0.261	T	0.66945	-0.5795	10	0.87932	D	0	-18.3216	8.7031	0.34338	0.1021:0.0:0.8979:0.0	.	95	P01350	GAST_HUMAN	H	95	ENSP00000331358:R95H	ENSP00000331358:R95H	R	+	2	0	GAST	37125628	1.000000	0.71417	0.995000	0.50966	0.002000	0.02628	4.178000	0.58284	1.224000	0.43551	-0.136000	0.14681	CGC		GAST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257409.1		
OR7C1	26664	hgsc.bcm.edu	37	19	14910361	14910361	+	Silent	SNP	G	G	A			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr19:14910361G>A	ENST00000248073.2	-	1	662	c.588C>T	c.(586-588)aaC>aaT	p.N196N	OR7A5_ENST00000601611.1_Intron	NM_198944.1	NP_945182.1	O76099	OR7C1_HUMAN	olfactory receptor, family 7, subfamily C, member 1	196					spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N196N(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(2)|ovary(2)|prostate(1)	18						ATATCACCACGTTATTAATGA	0.393																																					p.N196N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C588T	19						.						84.0	84.0	84.0					19																	14910361		2203	4300	6503	14771361	SO:0001819	synonymous_variant	26664	exon1			X89676	CCDS12317.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8373	protein-coding gene	gene with protein product				OR7C4			Standard	NM_198944		Approved	OR19-5	uc010xnz.2	O76099		ENST00000248073.2:c.588C>T	19.37:g.14910361G>A		Somatic		Capture	SOLID	Phase_I	14771361	NM_198944	Q15621|Q6IFP2|Q96R94	Silent	SNP	ENST00000248073.2	37	CCDS12317.1																																																																																				OR7C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466519.1		
ZNF347	84671	hgsc.bcm.edu	37	19	53651985	53651985	+	Missense_Mutation	SNP	G	G	T	rs543465832		TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr19:53651985G>T	ENST00000334197.7	-	4	288	c.220C>A	c.(220-222)Caa>Aaa	p.Q74K	ZNF347_ENST00000601469.2_Missense_Mutation_p.Q75K|ZNF347_ENST00000601804.1_Missense_Mutation_p.Q16K|ZNF347_ENST00000452676.2_Missense_Mutation_p.Q75K	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	74	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q74K(1)		endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		CCTGCTATTTGTACTTGGCTC	0.403																																					p.Q75K	Melanoma(64;205 1597 17324 45721)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C223A	19						.						291.0	265.0	274.0					19																	53651985		2203	4300	6503	58343797	SO:0001583	missense	84671	exon4			AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.220C>A	19.37:g.53651985G>T	ENSP00000334146:p.Gln74Lys	Somatic		Capture	SOLID	Phase_I	58343797	NM_001172675	B3KU77|B9EG59|G5E9N4|Q8TCN1	Missense_Mutation	SNP	ENST00000334197.7	37	CCDS33097.1	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.477228	0.00165	.	.	ENSG00000197937	ENST00000334197;ENST00000452676	T;T	0.06068	3.35;3.35	1.82	-3.63	0.04529	Krueppel-associated box (1);	.	.	.	.	T	0.01320	0.0043	N	0.00633	-1.31	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.01281	0.0;0.0	T	0.37842	-0.9688	9	0.02654	T	1	.	5.5139	0.16896	0.1769:0.0:0.5878:0.2353	.	75;74	G5E9N4;Q96SE7	.;ZN347_HUMAN	K	74;75	ENSP00000334146:Q74K;ENSP00000405218:Q75K	ENSP00000334146:Q74K	Q	-	1	0	ZNF347	58343797	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.514000	0.02254	-1.526000	0.01760	-0.485000	0.04761	CAA		ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464170.1	NM_032584	
BCL9	607	hgsc.bcm.edu	37	1	147091810	147091810	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr1:147091810C>T	ENST00000234739.3	+	8	2589	c.1849C>T	c.(1849-1851)Cga>Tga	p.R617*		NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	617	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)		p.R617*(1)		breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					CGGTCCTGGCCGAGGGGAACG	0.552			T	"""IGH@, IGL@"""	B-ALL																																p.R617X			Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1849T	1						.						65.0	72.0	69.0					1																	147091810		2203	4300	6503	145558434	SO:0001587	stop_gained	607	exon8			Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.1849C>T	1.37:g.147091810C>T	ENSP00000234739:p.Arg617*	Somatic		Capture	SOLID	Phase_I	145558434	NM_004326	Q5T489	Nonsense_Mutation	SNP	ENST00000234739.3	37	CCDS30833.1	.	.	.	.	.	.	.	.	.	.	C	44	10.830589	0.99474	.	.	ENSG00000116128	ENST00000234739	.	.	.	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-7.5026	18.7977	0.92001	0.0:1.0:0.0:0.0	.	.	.	.	X	617	.	ENSP00000234739:R617X	R	+	1	2	BCL9	145558434	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.125000	0.57931	2.666000	0.90696	0.561000	0.74099	CGA		BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039468.1	NM_004326	
CHTOP	26097	hgsc.bcm.edu	37	1	153617611	153617611	+	Missense_Mutation	SNP	G	G	A	rs535145459		TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr1:153617611G>A	ENST00000368694.3	+	6	925	c.613G>A	c.(613-615)Gcc>Acc	p.A205T	CHTOP_ENST00000368690.3_Missense_Mutation_p.A159T|CHTOP_ENST00000368687.1_Missense_Mutation_p.A180T|CHTOP_ENST00000403433.1_Missense_Mutation_p.A159T|CHTOP_ENST00000495554.1_3'UTR	NM_001206612.1|NM_015607.3	NP_001193541.1|NP_056422.2	Q9Y3Y2	CHTOP_HUMAN	chromatin target of PRMT1	205	Arg/Gly-rich.|Interaction with PRMT1. {ECO:0000250}.				mRNA export from nucleus (GO:0006406)|positive regulation of ATPase activity (GO:0032781)|positive regulation of helicase activity (GO:0051096)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)|transcription export complex (GO:0000346)	poly(A) RNA binding (GO:0044822)	p.A205T(1)		endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(6)	13						AGGGAGAGGTGCCCTTGCTCG	0.537																																					p.A205T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G613A	1						.						106.0	106.0	106.0					1																	153617611		2203	4300	6503	151884235	SO:0001583	missense	26097	exon6				CCDS1048.1, CCDS72917.1, CCDS72918.1	1q21.3	2011-03-24	2011-03-24	2011-03-24	ENSG00000160679	ENSG00000160679			24511	protein-coding gene	gene with protein product	"""small protein rich in arginine and glycine"", ""Friend of Prmt1"""	614206	"""chromosome 1 open reading frame 77"""	C1orf77		19254951	Standard	NM_015607		Approved	DKFZP547E1010, SRAG, FOP	uc001fcn.2	Q9Y3Y2	OTTHUMG00000037052	ENST00000368694.3:c.613G>A	1.37:g.153617611G>A	ENSP00000357683:p.Ala205Thr	Somatic		Capture	SOLID	Phase_I	151884235	NM_015607	D3DV55|Q0VAQ8|Q2VPI9|Q5T7Y8|Q5T7Y9|Q5T7Z0|Q6NSM4|Q6PB28|Q8WYT9|Q9BUC5|Q9H034|Q9H2L0	Missense_Mutation	SNP	ENST00000368694.3	37	CCDS1048.1	.	.	.	.	.	.	.	.	.	.	G	16.27	3.074826	0.55646	.	.	ENSG00000160679	ENST00000368694;ENST00000403433;ENST00000368690;ENST00000368687	.	.	.	5.85	4.84	0.62591	.	0.209002	0.41001	D	0.000967	T	0.53981	0.1830	L	0.27053	0.805	0.40901	D	0.984157	D;D	0.62365	0.988;0.991	P;D	0.66602	0.908;0.945	T	0.56577	-0.7956	9	0.56958	D	0.05	-28.2603	13.46	0.61221	0.0:0.0:0.8114:0.1886	.	206;205	Q9Y3Y2-3;Q9Y3Y2	.;CHTOP_HUMAN	T	205;159;159;180	.	ENSP00000357676:A180T	A	+	1	0	CHTOP	151884235	0.997000	0.39634	1.000000	0.80357	0.968000	0.65278	1.585000	0.36600	2.932000	0.99384	0.643000	0.83706	GCC		CHTOP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000089967.1	NM_015607	
TNN	63923	hgsc.bcm.edu	37	1	175116180	175116180	+	Silent	SNP	G	G	A			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr1:175116180G>A	ENST00000239462.4	+	19	3986	c.3873G>A	c.(3871-3873)acG>acA	p.T1291T		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	1291					axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)		p.T1291T(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		AGAAGCGGACGCTGAGAGGAA	0.587											OREG0013992	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T1291T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3873A	1						.						58.0	55.0	56.0					1																	175116180		2203	4300	6503	173382803	SO:0001819	synonymous_variant	63923	exon19			AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.3873G>A	1.37:g.175116180G>A		Somatic	1921	Capture	SOLID	Phase_I	173382803	NM_022093	B9EGP3|Q5R360	Silent	SNP	ENST00000239462.4	37	CCDS30943.1																																																																																				TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527	
C8A	731	hgsc.bcm.edu	37	1	57347272	57347272	+	Missense_Mutation	SNP	C	C	T	rs142382705		TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr1:57347272C>T	ENST00000361249.3	+	5	715	c.619C>T	c.(619-621)Cgg>Tgg	p.R207W		NM_000562.2	NP_000553.1	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	207	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)		p.R207W(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	43						GAAATACTTTCGGAAACCCTA	0.498																																					p.R207W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C619T	1						.	C	TRP/ARG	0,4406		0,0,2203	112.0	114.0	113.0		619	5.4	1.0	1	dbSNP_134	113	1,8599	1.2+/-3.3	0,1,4299	no	missense	C8A	NM_000562.2	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	207/585	57347272	1,13005	2203	4300	6503	57119860	SO:0001583	missense	731	exon5			M16974	CCDS606.1	1p32.2	2014-09-17			ENSG00000157131	ENSG00000157131		"""Complement system"""	1352	protein-coding gene	gene with protein product		120950					Standard	NM_000562		Approved		uc001cyo.2	P07357	OTTHUMG00000008306	ENST00000361249.3:c.619C>T	1.37:g.57347272C>T	ENSP00000354458:p.Arg207Trp	Somatic		Capture	SOLID	Phase_I	57119860	NM_000562	A2RUI4|A2RUI5|Q13668|Q9H130	Missense_Mutation	SNP	ENST00000361249.3	37	CCDS606.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.506679	0.85282	0.0	1.16E-4	ENSG00000157131	ENST00000361249	D	0.84298	-1.83	5.45	5.45	0.79879	Membrane attack complex component/perforin (MACPF) domain (1);	0.048911	0.85682	D	0.000000	D	0.94082	0.8103	M	0.89715	3.055	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.94904	0.8059	10	0.87932	D	0	-25.4107	19.2776	0.94038	0.0:1.0:0.0:0.0	.	207	P07357	CO8A_HUMAN	W	207	ENSP00000354458:R207W	ENSP00000354458:R207W	R	+	1	2	C8A	57119860	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	3.560000	0.53763	2.556000	0.86216	0.655000	0.94253	CGG		C8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022890.1	NM_000562	
HMCN1	83872	hgsc.bcm.edu	37	1	186056372	186056372	+	Missense_Mutation	SNP	C	C	T	rs138982761		TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr1:186056372C>T	ENST00000271588.4	+	59	9299	c.9070C>T	c.(9070-9072)Cgg>Tgg	p.R3024W	HMCN1_ENST00000367492.2_Missense_Mutation_p.R3024W	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3024	Ig-like C2-type 28.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.R3024W(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ACAGATTATTCGGGCCAAGGT	0.373																																					p.R3024W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C9070T	1						.	C	TRP/ARG	0,4406		0,0,2203	136.0	130.0	132.0		9070	4.7	1.0	1	dbSNP_134	132	1,8599	1.2+/-3.3	0,1,4299	no	missense	HMCN1	NM_031935.2	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	3024/5636	186056372	1,13005	2203	4300	6503	184322995	SO:0001583	missense	83872	exon59			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.9070C>T	1.37:g.186056372C>T	ENSP00000271588:p.Arg3024Trp	Somatic		Capture	SOLID	Phase_I	184322995	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	C	17.71	3.457369	0.63401	0.0	1.16E-4	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.31769	1.48;1.48	5.63	4.7	0.59300	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.161654	0.56097	D	0.000035	T	0.61286	0.2335	M	0.89353	3.025	0.36029	D	0.839268	D	0.89917	1.0	D	0.91635	0.999	T	0.75402	-0.3330	10	0.59425	D	0.04	.	14.0744	0.64880	0.2742:0.7258:0.0:0.0	.	3024	Q96RW7	HMCN1_HUMAN	W	3024	ENSP00000271588:R3024W;ENSP00000356462:R3024W	ENSP00000271588:R3024W	R	+	1	2	HMCN1	184322995	0.938000	0.31826	0.952000	0.39060	0.826000	0.46750	3.244000	0.51399	1.320000	0.45209	0.655000	0.94253	CGG		HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
DNMT3B	1789	hgsc.bcm.edu	37	20	31372633	31372633	+	Missense_Mutation	SNP	C	C	T	rs149520896	byFrequency	TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr20:31372633C>T	ENST00000328111.2	+	4	595	c.274C>T	c.(274-276)Cgg>Tgg	p.R92W	DNMT3B_ENST00000443239.3_Missense_Mutation_p.R92W|DNMT3B_ENST00000201963.3_Missense_Mutation_p.R104W|DNMT3B_ENST00000375623.4_Missense_Mutation_p.R92W|DNMT3B_ENST00000456297.2_Intron|DNMT3B_ENST00000353855.2_Missense_Mutation_p.R92W|DNMT3B_ENST00000348286.2_Missense_Mutation_p.R92W|DNMT3B_ENST00000344505.4_Missense_Mutation_p.R92W	NM_006892.3	NP_008823.1	Q9UBC3	DNM3B_HUMAN	DNA (cytosine-5-)-methyltransferase 3 beta	92	Interaction with DNMT1 and DNMT3A.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation on cytosine within a CG sequence (GO:0010424)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of neuron differentiation (GO:0045666)|protein complex localization (GO:0031503)|regulation of gene expression by genetic imprinting (GO:0006349)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA-methyltransferase activity (GO:0009008)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)|unmethylated CpG binding (GO:0045322)	p.R92W(2)|p.R104W(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(16)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AAAGCTCTTCCGGGAAACCAG	0.507													C|||	2	0.000399361	0.0008	0.0	5008	,	,		17093	0.0		0.001	False		,,,				2504	0.0				p.R92W												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C274T	20						.	C	TRP/ARG,,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	80.0	67.0	72.0		274,,274,274,274,310	5.0	1.0	20	dbSNP_134	72	0,8600		0,0,4300	no	missense,intron,missense,missense,missense,missense	DNMT3B	NM_001207055.1,NM_001207056.1,NM_006892.3,NM_175848.1,NM_175849.1,NM_175850.2	101,,101,101,101,101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,,probably-damaging,probably-damaging,probably-damaging,probably-damaging	92/729,,92/854,92/834,92/771,104/846	31372633	1,13005	2203	4300	6503	30836294	SO:0001583	missense	1789	exon4				CCDS13204.1, CCDS13205.1, CCDS13206.1, CCDS13207.1, CCDS56183.1, CCDS56184.1	20q11.2	2014-09-17			ENSG00000088305	ENSG00000088305			2979	protein-coding gene	gene with protein product		602900				9662389, 10433969	Standard	NM_006892		Approved		uc002wyc.3	Q9UBC3	OTTHUMG00000032226	ENST00000328111.2:c.274C>T	20.37:g.31372633C>T	ENSP00000328547:p.Arg92Trp	Somatic		Capture	SOLID	Phase_I	30836294	NM_175848	A2A2E2|B4DSM8|B4DSU1|E1P5M6|E1P5M7|E7EN63|E9PBF2|Q9UBD4|Q9UJQ5|Q9UKA6|Q9UNE5|Q9Y5R9|Q9Y5S0	Missense_Mutation	SNP	ENST00000328111.2	37	CCDS13205.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409996	0.83340	2.27E-4	0.0	ENSG00000088305	ENST00000328111;ENST00000537219;ENST00000353855;ENST00000348286;ENST00000443239;ENST00000344505;ENST00000375623;ENST00000201963	D;D;D;D;D;T;D	0.97772	-4.39;-4.52;-4.45;-4.48;-4.36;-0.38;-4.53	4.98	4.98	0.66077	.	0.415723	0.25222	N	0.032240	D	0.97142	0.9066	L	0.27053	0.805	0.43000	D	0.994512	P;D;D;D;D	0.89917	0.765;1.0;1.0;1.0;1.0	B;D;D;D;D	0.67231	0.09;0.95;0.939;0.95;0.947	D	0.97331	0.9950	10	0.72032	D	0.01	-14.4438	13.9551	0.64142	0.0:1.0:0.0:0.0	.	92;104;92;92;92	E7EN63;Q9UBC3-6;Q9UBC3-3;Q9UBC3-2;Q9UBC3	.;.;.;.;DNM3B_HUMAN	W	92;178;92;92;92;92;92;104	ENSP00000328547:R92W;ENSP00000313397:R92W;ENSP00000337764:R92W;ENSP00000403169:R92W;ENSP00000345105:R92W;ENSP00000364774:R92W;ENSP00000201963:R104W	ENSP00000201963:R104W	R	+	1	2	DNMT3B	30836294	0.370000	0.25047	1.000000	0.80357	0.989000	0.77384	1.823000	0.39062	2.742000	0.94016	0.655000	0.94253	CGG		DNMT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078643.2	NM_006892	
DOK5	55816	hgsc.bcm.edu	37	20	53260081	53260081	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr20:53260081C>T	ENST00000262593.5	+	7	1170	c.820C>T	c.(820-822)Cgg>Tgg	p.R274W	DOK5_ENST00000395939.1_Missense_Mutation_p.R166W	NM_018431.3	NP_060901.2	Q9P104	DOK5_HUMAN	docking protein 5	274					MAPK cascade (GO:0000165)|nervous system development (GO:0007399)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)		receptor signaling protein activity (GO:0005057)	p.R274W(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|skin(1)	19			Colorectal(105;0.202)			GCACATCACACGGCAGCACAG	0.652																																					p.R274W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C820T	20						.						54.0	48.0	50.0					20																	53260081		2203	4300	6503	52693488	SO:0001583	missense	55816	exon7			AF132732	CCDS13446.1, CCDS13447.1	20q13.2	2013-01-10	2002-11-28	2002-11-29	ENSG00000101134	ENSG00000101134		"""Pleckstrin homology (PH) domain containing"""	16173	protein-coding gene	gene with protein product		608334	"""chromosome 20 open reading frame 180"""	C20orf180		11470823	Standard	XM_005260451		Approved	dJ805C22.1	uc002xwy.3	Q9P104	OTTHUMG00000032778	ENST00000262593.5:c.820C>T	20.37:g.53260081C>T	ENSP00000262593:p.Arg274Trp	Somatic		Capture	SOLID	Phase_I	52693488	NM_018431	Q5T7Y0|Q5TE53|Q8TEW7|Q96H13|Q9BZ24|Q9NQF4|Q9Y411	Missense_Mutation	SNP	ENST00000262593.5	37	CCDS13446.1	.	.	.	.	.	.	.	.	.	.	C	17.75	3.465314	0.63513	.	.	ENSG00000101134	ENST00000262593;ENST00000395939	D;D	0.93659	-2.27;-3.26	5.42	-1.32	0.09201	.	0.000000	0.85682	D	0.000000	D	0.93200	0.7834	L	0.27053	0.805	0.32349	N	0.558736	D;D	0.89917	1.0;0.999	D;D	0.79784	0.993;0.973	D	0.92644	0.6127	10	0.66056	D	0.02	-7.4003	16.721	0.85410	0.7627:0.2373:0.0:0.0	.	166;274	Q9P104-2;Q9P104	.;DOK5_HUMAN	W	274;166	ENSP00000262593:R274W;ENSP00000379270:R166W	ENSP00000262593:R274W	R	+	1	2	DOK5	52693488	0.123000	0.22298	0.098000	0.21074	0.980000	0.70556	0.291000	0.18994	-0.142000	0.11354	-0.122000	0.15005	CGG		DOK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079777.2		
CCDC138	165055	hgsc.bcm.edu	37	2	109463198	109463198	+	Missense_Mutation	SNP	C	C	T	rs367747465		TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr2:109463198C>T	ENST00000295124.4	+	12	1388	c.1328C>T	c.(1327-1329)tCg>tTg	p.S443L	CCDC138_ENST00000412964.2_Missense_Mutation_p.S443L	NM_144978.1	NP_659415.1	Q96M89	CC138_HUMAN	coiled-coil domain containing 138	443								p.S443L(1)		endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	14						TAACAGCACTCGACTATGACA	0.348																																					p.S443L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1328T	2						.						79.0	82.0	81.0					2																	109463198		2203	4300	6503	108829630	SO:0001583	missense	165055	exon12			AK057307	CCDS2080.1	2q13	2008-02-05			ENSG00000163006	ENSG00000163006			26531	protein-coding gene	gene with protein product						12477932	Standard	NM_144978		Approved	FLJ32745	uc002ten.1	Q96M89	OTTHUMG00000130980	ENST00000295124.4:c.1328C>T	2.37:g.109463198C>T	ENSP00000295124:p.Ser443Leu	Somatic		Capture	SOLID	Phase_I	108829630	NM_144978	Q05DF1|Q4ZG07|Q53TE1|Q6ZUY5|Q86VL7	Missense_Mutation	SNP	ENST00000295124.4	37	CCDS2080.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.35|15.35	2.808471|2.808471	0.50421|0.50421	.|.	.|.	ENSG00000163006|ENSG00000163006	ENST00000456512|ENST00000412964;ENST00000295124	.|T;T	.|0.34072	.|1.38;1.39	6.02|6.02	6.02|6.02	0.97574|0.97574	.|.	.|0.434355	.|0.23549	.|N	.|0.046989	.|T	.|0.38295	.|0.1035	L|L	0.48362|0.48362	1.52|1.52	0.43287|0.43287	D|D	0.995261|0.995261	.|P;B	.|0.45240	.|0.854;0.007	.|B;B	.|0.41466	.|0.358;0.004	.|T	.|0.05053	.|-1.0909	.|10	.|0.33141	.|T	.|0.24	-2.6465|-2.6465	20.1575|20.1575	0.98120|0.98120	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|443;443	.|Q96M89-2;Q96M89	.|.;CC138_HUMAN	X|L	340|443	.|ENSP00000411800:S443L;ENSP00000295124:S443L	.|ENSP00000295124:S443L	R|S	+|+	1|2	2|0	CCDC138|CCDC138	108829630|108829630	0.777000|0.777000	0.28628|0.28628	0.997000|0.997000	0.53966|0.53966	0.989000|0.989000	0.77384|0.77384	3.852000|3.852000	0.55934|0.55934	2.850000|2.850000	0.98022|0.98022	0.650000|0.650000	0.86243|0.86243	CGA|TCG		CCDC138-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253593.1	NM_144978	
GCKR	2646	hgsc.bcm.edu	37	2	27730606	27730606	+	Missense_Mutation	SNP	C	C	T	rs544395651		TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr2:27730606C>T	ENST00000264717.2	+	14	1265	c.1202C>T	c.(1201-1203)aCg>aTg	p.T401M	GCKR_ENST00000424318.2_Missense_Mutation_p.T211M	NM_001486.3	NP_001477.2	Q14397	GCKR_HUMAN	glucokinase (hexokinase 4) regulator	401	SIS 2. {ECO:0000255|PROSITE- ProRule:PRU00797}.				carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|negative regulation of glucokinase activity (GO:0033132)|positive regulation of glucokinase activity (GO:0033133)|protein import into nucleus, translocation (GO:0000060)|regulation of glucose transport (GO:0010827)|response to fructose (GO:0009750)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|triglyceride homeostasis (GO:0070328)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	carbohydrate binding (GO:0030246)|enzyme inhibitor activity (GO:0004857)|fructose-6-phosphate binding (GO:0070095)	p.T401M(1)		breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(2)	29	Acute lymphoblastic leukemia(172;0.155)					CCCTCTCTCACGGAAATCGAT	0.552																																					p.T401M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1202T	2						.						97.0	90.0	92.0					2																	27730606		2203	4300	6503	27584110	SO:0001583	missense	2646	exon14			Z48475	CCDS1757.1	2p23	2008-05-21	2004-05-20		ENSG00000084734	ENSG00000084734			4196	protein-coding gene	gene with protein product		600842	"""glucokinase (hexokinase 4) regulatory protein"""			9570959, 8662230	Standard	NM_001486		Approved		uc002rky.3	Q14397	OTTHUMG00000128426	ENST00000264717.2:c.1202C>T	2.37:g.27730606C>T	ENSP00000264717:p.Thr401Met	Somatic		Capture	SOLID	Phase_I	27584110	NM_001486	A1L4C2|B4DPQ2|Q53RY6|Q99522	Missense_Mutation	SNP	ENST00000264717.2	37	CCDS1757.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	2.446|2.446	-0.327535|-0.327535	0.05314|0.05314	.|.	.|.	ENSG00000084734|ENSG00000084734	ENST00000411584|ENST00000264717;ENST00000424318	.|D;D	.|0.83250	.|-1.7;-1.7	4.52|4.52	-1.74|-1.74	0.08056|0.08056	.|Sugar isomerase (SIS) (1);	.|0.445818	.|0.22925	.|N	.|0.053975	T|T	0.74168|0.74168	0.3681|0.3681	L|L	0.55481|0.55481	1.735|1.735	0.09310|0.09310	N|N	1|1	.|D;P;P	.|0.54397	.|0.966;0.579;0.579	.|P;B;B	.|0.44561	.|0.453;0.07;0.103	T|T	0.67684|0.67684	-0.5607|-0.5607	5|10	.|0.59425	.|D	.|0.04	0.1301|0.1301	3.1313|3.1313	0.06424|0.06424	0.302:0.341:0.0:0.357|0.302:0.341:0.0:0.357	.|.	.|211;399;401	.|F5H1P6;A8K731;Q14397	.|.;.;GCKR_HUMAN	W|M	102|401;211	.|ENSP00000264717:T401M;ENSP00000409109:T211M	.|ENSP00000264717:T401M	R|T	+|+	1|2	2|0	GCKR|GCKR	27584110|27584110	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.003000|0.003000	0.03518|0.03518	-0.674000|-0.674000	0.05233|0.05233	-0.676000|-0.676000	0.05238|0.05238	-0.735000|-0.735000	0.03563|0.03563	CGG|ACG		GCKR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250214.1	NM_001486	
MAP4K3	8491	hgsc.bcm.edu	37	2	39570593	39570593	+	Splice_Site	SNP	C	C	T			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr2:39570593C>T	ENST00000263881.3	-	4	570	c.246G>A	c.(244-246)agG>agA	p.R82R	MAP4K3_ENST00000437545.1_Splice_Site_p.R19R|MAP4K3_ENST00000341681.5_Splice_Site_p.R82R	NM_003618.3	NP_003609.2	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase kinase 3	82	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|protein phosphorylation (GO:0006468)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)		ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.R82R(1)		NS(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_hematologic(82;0.211)				GCTTATCTCGCCTATAAAGAG	0.343																																					p.R82R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G246A	2						.						78.0	80.0	80.0					2																	39570593		2203	4297	6500	39424097	SO:0001630	splice_region_variant	8491	exon4			AF000145	CCDS1803.1, CCDS58707.1	2p22.3	2011-06-09			ENSG00000011566	ENSG00000011566		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6865	protein-coding gene	gene with protein product		604921		RAB8IPL1		9275185	Standard	NM_003618		Approved	GLK, MAPKKKK3	uc002rro.4	Q8IVH8	OTTHUMG00000102127	ENST00000263881.3:c.246-1G>A	2.37:g.39570593C>T		Somatic		Capture	SOLID	Phase_I	39424097	NM_003618	Q6IQ39|Q8IVH7|Q9UDM5|Q9Y6R5	Silent	SNP	ENST00000263881.3	37	CCDS1803.1																																																																																				MAP4K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219966.2	NM_003618	Silent
EPAS1	2034	hgsc.bcm.edu	37	2	46603773	46603773	+	Missense_Mutation	SNP	G	G	A	rs144038192	byFrequency	TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr2:46603773G>A	ENST00000263734.3	+	9	1640	c.1130G>A	c.(1129-1131)aGt>aAt	p.S377N		NM_001430.4	NP_001421.2	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	377					angiogenesis (GO:0001525)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|erythrocyte differentiation (GO:0030218)|lung development (GO:0030324)|mitochondrion organization (GO:0007005)|myoblast fate commitment (GO:0048625)|norepinephrine metabolic process (GO:0042415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart rate (GO:0002027)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|surfactant homeostasis (GO:0043129)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)	p.S377N(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			TTTGATAGCAGTGGCAAGGGG	0.542													G|||	6	0.00119808	0.0045	0.0	5008	,	,		18194	0.0		0.0	False		,,,				2504	0.0				p.S377N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1130A	2						.	G	ASN/SER	1,4405	2.1+/-5.4	0,1,2202	129.0	127.0	128.0		1130	2.4	0.0	2	dbSNP_134	128	0,8600		0,0,4300	yes	missense	EPAS1	NM_001430.4	46	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	377/871	46603773	1,13005	2203	4300	6503	46457277	SO:0001583	missense	2034	exon9			U81984	CCDS1825.1	2p21-p16	2013-05-21			ENSG00000116016	ENSG00000116016		"""Basic helix-loop-helix proteins"""	3374	protein-coding gene	gene with protein product	"""HIF-1 alpha-like factor"""	603349				9000051, 9079689, 18378852	Standard	NM_001430		Approved	MOP2, PASD2, HIF2A, HLF, bHLHe73	uc002ruv.3	Q99814	OTTHUMG00000128818	ENST00000263734.3:c.1130G>A	2.37:g.46603773G>A	ENSP00000263734:p.Ser377Asn	Somatic		Capture	SOLID	Phase_I	46457277	NM_001430	Q86VA2|Q99630	Missense_Mutation	SNP	ENST00000263734.3	37	CCDS1825.1	5	0.0022893772893772895	5	0.01016260162601626	0	0.0	0	0.0	0	0.0	G	7.133	0.580194	0.13686	2.27E-4	0.0	ENSG00000116016	ENST00000263734	T	0.47528	0.84	4.27	2.4	0.29515	.	1.058270	0.07275	N	0.869793	T	0.24005	0.0581	N	0.19112	0.55	0.09310	N	1	B	0.16396	0.017	B	0.17098	0.017	T	0.21827	-1.0234	10	0.18276	T	0.48	.	7.8779	0.29605	0.0839:0.0:0.7566:0.1595	.	377	Q99814	EPAS1_HUMAN	N	377	ENSP00000263734:S377N	ENSP00000263734:S377N	S	+	2	0	EPAS1	46457277	0.008000	0.16893	0.001000	0.08648	0.746000	0.42486	1.722000	0.38042	0.698000	0.31739	0.462000	0.41574	AGT		EPAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250752.2	NM_001430	
ARHGAP25	9938	hgsc.bcm.edu	37	2	69049780	69049780	+	Silent	SNP	C	C	T			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr2:69049780C>T	ENST00000295381.3	+	10	1925	c.1506C>T	c.(1504-1506)taC>taT	p.Y502Y	ARHGAP25_ENST00000479844.1_Silent_p.Y196Y|ARHGAP25_ENST00000467265.1_Silent_p.Y463Y|ARHGAP25_ENST00000409202.3_Silent_p.Y503Y|ARHGAP25_ENST00000409030.3_Silent_p.Y495Y|ARHGAP25_ENST00000409220.1_Silent_p.Y496Y	NM_001007231.2	NP_001007232.2	P42331	RHG25_HUMAN	Rho GTPase activating protein 25	502					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.Y496Y(1)		breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(20)|ovary(3)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	52						CTTCCACCTACGATAACGTCC	0.572																																					p.Y496Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1488T	2						.						109.0	105.0	107.0					2																	69049780		2203	4300	6503	68903284	SO:0001819	synonymous_variant	9938	exon9			D29642	CCDS33214.1, CCDS46312.1, CCDS33214.2, CCDS54363.1, CCDS54364.1	2p13.3	2013-01-10			ENSG00000163219	ENSG00000163219		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	28951	protein-coding gene	gene with protein product		610587				7584044	Standard	NM_001007231		Approved	KIAA0053	uc010fdg.3	P42331	OTTHUMG00000152621	ENST00000295381.3:c.1506C>T	2.37:g.69049780C>T		Somatic		Capture	SOLID	Phase_I	68903284	NM_001166276	A8K2Y1|B7Z498|E9PFQ7|G5E9G2|Q8IXQ2	Silent	SNP	ENST00000295381.3	37		.	.	.	.	.	.	.	.	.	.	C	0.731	-0.780021	0.02929	.	.	ENSG00000163219	ENST00000497259	.	.	.	5.16	-10.3	0.00346	.	.	.	.	.	T	0.64000	0.2559	.	.	.	0.46823	D	0.999215	.	.	.	.	.	.	T	0.79829	-0.1638	4	.	.	.	.	18.5551	0.91081	0.0727:0.7054:0.0:0.2218	.	.	.	.	M	362	.	.	T	+	2	0	ARHGAP25	68903284	0.000000	0.05858	0.039000	0.18376	0.349000	0.29174	-5.130000	0.00148	-3.738000	0.00113	-1.028000	0.02416	ACG		ARHGAP25-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_014882	
ATP6V1B1	525	hgsc.bcm.edu	37	2	71185268	71185268	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr2:71185268T>G	ENST00000234396.4	+	3	340	c.267T>G	c.(265-267)atT>atG	p.I89M	AC007040.11_ENST00000606025.1_Intron|ATP6V1B1_ENST00000412314.1_Missense_Mutation_p.I89M	NM_001692.3	NP_001683.2	P15313	VATB1_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1	89					ATP hydrolysis coupled proton transport (GO:0015991)|ATP metabolic process (GO:0046034)|calcium ion homeostasis (GO:0055074)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|pH reduction (GO:0045851)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATP binding (GO:0005524)|hydrogen ion transmembrane transporter activity (GO:0015078)|hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances (GO:0016820)	p.I89M(1)		endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|prostate(1)|skin(1)	19						CCAAGGCGATTGTTCAGGTGA	0.517																																					p.I89M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T267G	2						.						77.0	78.0	77.0					2																	71185268		2203	4300	6503	71038776	SO:0001583	missense	525	exon3			AF107466	CCDS1912.1	2p13	2010-04-21	2008-07-31	2002-05-10	ENSG00000116039	ENSG00000116039	3.6.3.14	"""ATPases / V-type"""	853	protein-coding gene	gene with protein product	"""Renal tubular acidosis with deafness"""	192132	"""vacuolar proton pump 3"""	VPP3, ATP6B1		9916796, 2527371	Standard	XM_005264368		Approved	VATB, RTA1B, Vma2	uc002shj.3	P15313	OTTHUMG00000129711	ENST00000234396.4:c.267T>G	2.37:g.71185268T>G	ENSP00000234396:p.Ile89Met	Somatic		Capture	SOLID	Phase_I	71038776	NM_001692	Q53FY0|Q6P4H6	Missense_Mutation	SNP	ENST00000234396.4	37	CCDS1912.1	.	.	.	.	.	.	.	.	.	.	T	12.76	2.034535	0.35893	.	.	ENSG00000116039	ENST00000234396;ENST00000483246;ENST00000412314;ENST00000454446	D;D;D	0.86164	-2.08;-2.08;-2.08	4.79	2.32	0.28847	ATPase, F1/V1/A1 complex, alpha/beta subunit, N-terminal (1);	0.170119	0.40728	N	0.001030	D	0.88855	0.6550	M	0.69248	2.105	0.38684	D	0.952607	P;P;P	0.46064	0.872;0.766;0.766	P;P;P	0.58454	0.595;0.774;0.839	D	0.85189	0.1008	10	0.36615	T	0.2	-5.5439	5.478	0.16706	0.1533:0.0869:0.0:0.7598	.	64;89;89	B4DWH7;C9JL73;P15313	.;.;VATB1_HUMAN	M	89;64;89;106	ENSP00000234396:I89M;ENSP00000388353:I89M;ENSP00000408361:I106M	ENSP00000234396:I89M	I	+	3	3	ATP6V1B1	71038776	0.060000	0.20803	1.000000	0.80357	0.961000	0.63080	-0.827000	0.04424	0.307000	0.22880	0.533000	0.62120	ATT		ATP6V1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251920.2	NM_001692	
DNER	92737	hgsc.bcm.edu	37	2	230456366	230456366	+	Missense_Mutation	SNP	G	G	A	rs143332732	byFrequency	TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr2:230456366G>A	ENST00000341772.4	-	2	649	c.515C>T	c.(514-516)aCg>aTg	p.T172M		NM_139072.3	NP_620711.3	Q8NFT8	DNER_HUMAN	delta/notch-like EGF repeat containing	172					central nervous system development (GO:0007417)|endocytosis (GO:0006897)|glial cell differentiation (GO:0010001)|neuron migration (GO:0001764)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|skeletal muscle fiber development (GO:0048741)|synapse assembly (GO:0007416)	dendrite (GO:0030425)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|clathrin binding (GO:0030276)|transmembrane signaling receptor activity (GO:0004888)	p.T172M(1)		NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	63		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)		CAGTGTCACCGTTGCCTGAGA	0.527																																					p.T172M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C515T	2						.	G	MET/THR	0,4406		0,0,2203	88.0	79.0	82.0		515	5.8	0.1	2	dbSNP_134	82	2,8598	2.2+/-6.3	0,2,4298	no	missense	DNER	NM_139072.3	81	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	172/738	230456366	2,13004	2203	4300	6503	230164610	SO:0001583	missense	92737	exon2			AY358891	CCDS33390.1	2q36.3	2006-10-26			ENSG00000187957	ENSG00000187957			24456	protein-coding gene	gene with protein product		607299				11950833, 11997712	Standard	NM_139072		Approved	UNQ26, bet	uc002vpv.3	Q8NFT8	OTTHUMG00000153637	ENST00000341772.4:c.515C>T	2.37:g.230456366G>A	ENSP00000345229:p.Thr172Met	Somatic		Capture	SOLID	Phase_I	230164610	NM_139072	A6NP39|Q53R88|Q53TP7|Q53TQ5|Q8IYT0|Q8TB42|Q9NTF1|Q9UDM2	Missense_Mutation	SNP	ENST00000341772.4	37	CCDS33390.1	.	.	.	.	.	.	.	.	.	.	G	15.83	2.947916	0.53186	0.0	2.33E-4	ENSG00000187957	ENST00000341772	D	0.85258	-1.96	5.75	5.75	0.90469	.	0.266104	0.43110	D	0.000607	D	0.82944	0.5147	N	0.19112	0.55	0.46749	D	0.999183	D	0.67145	0.996	P	0.50791	0.65	T	0.83019	-0.0168	10	0.39692	T	0.17	.	19.9405	0.97159	0.0:0.0:1.0:0.0	.	172	Q8NFT8	DNER_HUMAN	M	172	ENSP00000345229:T172M	ENSP00000345229:T172M	T	-	2	0	DNER	230164610	1.000000	0.71417	0.112000	0.21494	0.037000	0.13140	4.399000	0.59703	2.708000	0.92522	0.655000	0.94253	ACG		DNER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331902.1	NM_139072	
AGA	175	hgsc.bcm.edu	37	4	178352946	178352947	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	TT	TT	TT	-	TT	TT	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr4:178352946_178352947delTT	ENST00000264595.2	-	9	1083_1084	c.956_957delAA	c.(955-957)aaafs	p.K319fs	AGA_ENST00000506853.1_5'Flank	NM_000027.3|NM_001171988.1	NP_000018.2|NP_001165459.1	P20933	ASPG_HUMAN	aspartylglucosaminidase	319					protein deglycosylation (GO:0006517)|protein maturation (GO:0051604)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	N4-(beta-N-acetylglucosaminyl)-L-asparaginase activity (GO:0003948)|peptidase activity (GO:0008233)	p.K319fs*8(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(5)|skin(2)	16		all_lung(41;1.27e-09)|Lung NSC(41;1.1e-08)|Breast(14;6.27e-05)|Melanoma(52;0.00102)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Hepatocellular(41;0.148)|all_neural(102;0.164)|Colorectal(36;0.245)		all cancers(43;1.37e-22)|Epithelial(43;3.86e-20)|OV - Ovarian serous cystadenocarcinoma(60;3.8e-11)|Colorectal(24;6.98e-05)|GBM - Glioblastoma multiforme(59;0.000362)|COAD - Colon adenocarcinoma(29;0.000462)|STAD - Stomach adenocarcinoma(60;0.0029)|LUSC - Lung squamous cell carcinoma(193;0.0328)|READ - Rectum adenocarcinoma(43;0.163)		ATGTTGAAAGTTTATTGCAAGC	0.351																																					p.309_309del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.926_927del	4						.																																			178589941	SO:0001589	frameshift_variant	175	exon9			X55330	CCDS3829.1	4q34.3	2014-06-23			ENSG00000038002	ENSG00000038002	3.5.1.26		318	protein-coding gene	gene with protein product	"""glycosylasparaginase"", ""N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase"""	613228					Standard	NM_000027		Approved	ASRG	uc003iuu.2	P20933	OTTHUMG00000160723	ENST00000264595.2:c.956_957delAA	4.37:g.178352946_178352947delTT	ENSP00000264595:p.Lys319fs	Somatic		Capture	SOLID	Phase_I	178589940	NM_001171988	B2R7H2|D3DP47|Q4W5Q2|Q6FHN6|Q9UCK6|Q9UCK7|Q9UCK8	Frame_Shift_Del	DEL	ENST00000264595.2	37	CCDS3829.1																																																																																				AGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361916.1	NM_000027	
APC	324	hgsc.bcm.edu	37	5	112174862	112174862	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr5:112174862C>T	ENST00000457016.1	+	16	3951	c.3571C>T	c.(3571-3573)Cag>Tag	p.Q1191*	APC_ENST00000508376.2_Nonsense_Mutation_p.Q1191*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.Q1191*			P25054	APC_HUMAN	adenomatous polyposis coli	1191	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q1191*(3)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCCTTCATCACAGAAACAGTC	0.348		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q1173X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,breast,NS,Substitution - Nonsense,0 	.	4	Substitution - Nonsense(3)|Unknown(1)	large_intestine(2)|breast(1)|skin(1)	c.C3517T	5						.						83.0	88.0	86.0					5																	112174862		2200	4299	6499	112202761	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3571C>T	5.37:g.112174862C>T	ENSP00000413133:p.Gln1191*	Somatic		Capture	SOLID	Phase_I	112202761	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	36	5.712523	0.96830	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.76	5.76	0.90799	.	0.114673	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-7.8565	16.9524	0.86249	0.0:0.8727:0.1273:0.0	.	.	.	.	X	1191	.	.	Q	+	1	0	APC	112202761	1.000000	0.71417	0.998000	0.56505	0.604000	0.37047	4.187000	0.58344	2.732000	0.93576	0.655000	0.94253	CAG		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
OSMR	9180	hgsc.bcm.edu	37	5	38904527	38904527	+	Nonsense_Mutation	SNP	C	C	T	rs147586955		TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr5:38904527C>T	ENST00000274276.3	+	9	1609	c.1207C>T	c.(1207-1209)Cga>Tga	p.R403*		NM_003999.2	NP_003990.1	Q99650	OSMR_HUMAN	oncostatin M receptor	403	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	oncostatin-M receptor complex (GO:0005900)	growth factor binding (GO:0019838)|oncostatin-M receptor activity (GO:0004924)	p.R403*(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	46	all_lung(31;0.000365)					GTACATGGCGCGAGTACGGTG	0.468													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17816	0.0		0.0	False		,,,				2504	0.0				p.R403X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1207T	5						.						109.0	97.0	101.0					5																	38904527		2203	4300	6503	38940284	SO:0001587	stop_gained	9180	exon9			U60805	CCDS3928.1, CCDS54847.1	5p13.2	2013-02-11			ENSG00000145623	ENSG00000145623		"""Fibronectin type III domain containing"""	8507	protein-coding gene	gene with protein product		601743				8999038	Standard	NM_001168355		Approved	OSMRB	uc003jln.2	Q99650	OTTHUMG00000090811	ENST00000274276.3:c.1207C>T	5.37:g.38904527C>T	ENSP00000274276:p.Arg403*	Somatic		Capture	SOLID	Phase_I	38940284	NM_003999	Q6P4E8|Q96QJ6	Nonsense_Mutation	SNP	ENST00000274276.3	37	CCDS3928.1	2	9.157509157509158E-4	1	0.0020325203252032522	1	0.0027624309392265192	0	0.0	0	0.0	C	41	8.829233	0.98970	.	.	ENSG00000145623	ENST00000274276;ENST00000513831	.	.	.	5.7	4.61	0.57282	.	0.976288	0.08391	N	0.952939	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.2671	0.31821	0.0:0.8574:0.0:0.1426	.	.	.	.	X	403;10	.	ENSP00000274276:R403X	R	+	1	2	OSMR	38940284	0.000000	0.05858	0.005000	0.12908	0.021000	0.10359	0.394000	0.20834	1.081000	0.41110	0.650000	0.86243	CGA		OSMR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000207609.2	NM_003999	
APC	324	hgsc.bcm.edu	37	5	112136975	112136975	+	Splice_Site	SNP	G	G	A	rs387906228		TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr5:112136975G>A	ENST00000457016.1	+	8	1109		c.e8-1		APC_ENST00000508376.2_Splice_Site|APC_ENST00000257430.4_Splice_Site			P25054	APC_HUMAN	adenomatous polyposis coli						anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CATCTTAACAGAGGTCATCTC	0.418		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											.	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	1	Unknown(1)	large_intestine(1)	.	5	GRCh37	CS941417	APC	S		.						78.0	72.0	74.0					5																	112136975		2202	4300	6502	112164874	SO:0001630	splice_region_variant	324	.	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.730-1G>A	5.37:g.112136975G>A		Somatic		Capture	SOLID	Phase_I	112164874	.	D3DT03|Q15162|Q15163|Q93042	Splice_Site	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.142368	0.77888	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.38	5.38	0.77491	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1327	0.93414	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	APC	112164874	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.060000	0.76692	2.516000	0.84829	0.585000	0.79938	.		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	Intron
PCDHA13	56136	hgsc.bcm.edu	37	5	140262952	140262952	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr5:140262952G>A	ENST00000289272.2	+	1	1099	c.1099G>A	c.(1099-1101)Gcc>Acc	p.A367T	PCDHA11_ENST00000398640.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA13_ENST00000409494.1_Missense_Mutation_p.A367T|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA4_ENST00000530339.1_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	367	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A367T(1)		NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCAGCCTAGCGCCATTATTGC	0.507																																					p.A367T	Melanoma(147;1739 1852 5500 27947 37288)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1099A	5						.						119.0	119.0	119.0					5																	140262952		2203	4300	6503	140243136	SO:0001583	missense	56136	exon1			AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.1099G>A	5.37:g.140262952G>A	ENSP00000289272:p.Ala367Thr	Somatic		Capture	SOLID	Phase_I	140243136	NM_031865	O75277	Missense_Mutation	SNP	ENST00000289272.2	37	CCDS4240.1	.	.	.	.	.	.	.	.	.	.	G	0	-2.646199	0.00111	.	.	ENSG00000239389	ENST00000409494;ENST00000289272	T;T	0.41065	1.01;1.01	5.33	-2.13	0.07144	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.08223	0.0205	N	0.00197	-1.87	0.09310	N	1	B;B;B	0.10296	0.001;0.003;0.003	B;B;B	0.04013	0.0;0.001;0.0	T	0.34950	-0.9808	9	0.02654	T	1	.	7.8728	0.29576	0.7682:0.0:0.1285:0.1033	.	367;367;367	Q9Y5I0;C9JA99;Q9Y5I0-2	PCDAD_HUMAN;.;.	T	367	ENSP00000386821:A367T;ENSP00000289272:A367T	ENSP00000289272:A367T	A	+	1	0	PCDHA13	140243136	0.802000	0.28943	0.000000	0.03702	0.005000	0.04900	2.460000	0.45031	-0.673000	0.05259	-2.118000	0.00350	GCC		PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335000.1	NM_018904	
IRF4	3662	hgsc.bcm.edu	37	6	401501	401501	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr6:401501C>T	ENST00000380956.4	+	7	949	c.823C>T	c.(823-825)Cgg>Tgg	p.R275W		NM_001195286.1|NM_002460.3	NP_001182215.1|NP_002451.2	Q15306	IRF4_HUMAN	interferon regulatory factor 4	275					cytokine-mediated signaling pathway (GO:0019221)|defense response to protozoan (GO:0042832)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of DNA binding (GO:0043388)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of interleukin-13 biosynthetic process (GO:0045368)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of T-helper cell differentiation (GO:0045622)|T cell activation (GO:0042110)|T-helper 17 cell lineage commitment (GO:0072540)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear nucleosome (GO:0000788)|nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.R275W(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		CGAGGGCTGCCGGATCTCCCA	0.582			T	IGH@	MM																																p.R274W			Dom	yes		6	6p25-p23	3662	interferon regulatory factor 4		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C820T	6						.						66.0	52.0	57.0					6																	401501		2203	4300	6503	346501	SO:0001583	missense	3662	exon7			U52682	CCDS4469.1	6p25-p23	2008-08-29			ENSG00000137265	ENSG00000137265			6119	protein-coding gene	gene with protein product		601900		MUM1		8921401, 18417578	Standard	NM_002460		Approved	LSIRF	uc003msz.4	Q15306	OTTHUMG00000016294	ENST00000380956.4:c.823C>T	6.37:g.401501C>T	ENSP00000370343:p.Arg275Trp	Somatic		Capture	SOLID	Phase_I	346501	NM_001195286	Q5VUI7|Q99660	Missense_Mutation	SNP	ENST00000380956.4	37	CCDS4469.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.955369	0.73902	.	.	ENSG00000137265	ENST00000380956;ENST00000412334	D	0.97114	-4.25	5.76	1.35	0.21983	SMAD domain-like (1);SMAD/FHA domain (1);Interferon regulatory factor-3 (1);	0.097281	0.64402	D	0.000003	D	0.98012	0.9345	M	0.84683	2.71	0.50313	D	0.999869	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.80764	0.973;0.993;0.982;0.994	D	0.98446	1.0589	10	0.72032	D	0.01	-32.1881	15.7271	0.77770	0.7875:0.2125:0.0:0.0	.	275;305;274;275	F2Z3D5;Q99419;Q15306-2;Q15306	.;.;.;IRF4_HUMAN	W	275;304	ENSP00000370343:R275W	ENSP00000370343:R275W	R	+	1	2	IRF4	346501	1.000000	0.71417	0.998000	0.56505	0.961000	0.63080	2.128000	0.42045	0.290000	0.22444	-0.182000	0.12963	CGG		IRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043638.1		
CUL7	9820	hgsc.bcm.edu	37	6	43010598	43010598	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr6:43010598G>A	ENST00000265348.3	-	19	3672	c.3587C>T	c.(3586-3588)gCg>gTg	p.A1196V	CUL7_ENST00000535468.1_Missense_Mutation_p.A1280V|CUL7_ENST00000478630.1_5'Flank			Q14999	CUL7_HUMAN	cullin 7	1196					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)		p.A1196V(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			ATTTTGCAGCGCCAGCAAGAA	0.542																																					p.A1196V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3587T	6						.						43.0	40.0	41.0					6																	43010598		2203	4300	6503	43118576	SO:0001583	missense	9820	exon19			BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.3587C>T	6.37:g.43010598G>A	ENSP00000265348:p.Ala1196Val	Somatic		Capture	SOLID	Phase_I	43118576	NM_014780	B4DYZ0|F5H0L1|Q5T654	Missense_Mutation	SNP	ENST00000265348.3	37	CCDS4881.1	.	.	.	.	.	.	.	.	.	.	G	35	5.541788	0.96474	.	.	ENSG00000044090	ENST00000265348;ENST00000535468	T;T	0.76060	-0.99;-0.99	5.59	5.59	0.84812	Cullin, N-terminal (1);	0.221347	0.46758	D	0.000280	D	0.83760	0.5324	M	0.68593	2.085	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.985;0.994;0.998;0.998	D	0.84407	0.0563	10	0.66056	D	0.02	-9.0074	19.5991	0.95552	0.0:0.0:1.0:0.0	.	1280;1196;1280;1196	F5H0L1;A8K9U1;B4DYZ0;Q14999	.;.;.;CUL7_HUMAN	V	1196;1280	ENSP00000265348:A1196V;ENSP00000438788:A1280V	ENSP00000265348:A1196V	A	-	2	0	CUL7	43118576	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.277000	0.95755	2.632000	0.89209	0.579000	0.79373	GCG		CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040575.1	NM_014780	
CD2AP	23607	hgsc.bcm.edu	37	6	47522495	47522495	+	Silent	SNP	C	C	T			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr6:47522495C>T	ENST00000359314.5	+	5	990	c.534C>T	c.(532-534)gaC>gaT	p.D178D		NM_012120.2	NP_036252.1	Q9Y5K6	CD2AP_HUMAN	CD2-associated protein	178					mitotic nuclear division (GO:0007067)|negative regulation of transforming growth factor beta1 production (GO:0032911)|positive regulation of protein localization to nucleus (GO:1900182)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of receptor-mediated endocytosis (GO:0048259)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|substrate-dependent cell migration, cell extension (GO:0006930)|vesicle organization (GO:0016050)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)	p.D178D(1)		kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	20			Lung(136;0.105)|LUSC - Lung squamous cell carcinoma(51;0.138)			AAGCCCAGGACGATTCAGGTA	0.318																																					p.D178D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C534T	6						.						65.0	60.0	62.0					6																	47522495		2203	4300	6503	47630454	SO:0001819	synonymous_variant	23607	exon5			AF146277	CCDS34472.1	6p12	2008-02-05			ENSG00000198087	ENSG00000198087			14258	protein-coding gene	gene with protein product		604241				10339567	Standard	NM_012120		Approved	CMS	uc003oyw.3	Q9Y5K6	OTTHUMG00000014799	ENST00000359314.5:c.534C>T	6.37:g.47522495C>T		Somatic		Capture	SOLID	Phase_I	47630454	NM_012120	A6NL34|Q5VYA3|Q9UG97	Silent	SNP	ENST00000359314.5	37	CCDS34472.1																																																																																				CD2AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040817.2		
THEMIS	387357	hgsc.bcm.edu	37	6	128134475	128134475	+	Silent	SNP	C	C	A			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr6:128134475C>A	ENST00000368248.2	-	4	1459	c.1311G>T	c.(1309-1311)gtG>gtT	p.V437V	THEMIS_ENST00000537166.1_Silent_p.V402V|THEMIS_ENST00000543064.1_Silent_p.V437V|THEMIS_ENST00000368250.1_Silent_p.V358V	NM_001010923.2	NP_001010923.1	Q8N1K5	THMS1_HUMAN	thymocyte selection associated	437	CABIT 2.				negative T cell selection (GO:0043383)|positive T cell selection (GO:0043368)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.V437V(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(3)	60						TATCATGAATCACCTCTACAA	0.433																																					p.V437V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1311T	6						.						92.0	98.0	96.0					6																	128134475		2203	4300	6503	128176168	SO:0001819	synonymous_variant	387357	exon4			AK094863	CCDS34534.1, CCDS55055.1	6q22.33	2012-02-08	2009-06-25	2009-06-25	ENSG00000172673	ENSG00000172673			21569	protein-coding gene	gene with protein product	"""thymocyte expressed molecule involved in selection"""	613607	"""chromosome 6 open reading frame 207"", ""chromosome 6 open reading frame 190"", ""thymocyte selection pathway associated"""	C6orf207, C6orf190, TSEPA		19597499, 19597498, 19597497	Standard	NM_001010923		Approved	bA325O24.4, FLJ40584, bA325O24.3	uc011ebt.2	Q8N1K5	OTTHUMG00000015534	ENST00000368248.2:c.1311G>T	6.37:g.128134475C>A		Somatic		Capture	SOLID	Phase_I	128176168	NM_001010923	A1L4F0|A8K7N1|B3KT31|B3KW32|B3KY07|F5H1J9|Q5T3C4|Q5T3C5|Q6MZT7	Silent	SNP	ENST00000368248.2	37	CCDS34534.1																																																																																				THEMIS-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_001010923	
EXOC4	60412	hgsc.bcm.edu	37	7	133164872	133164872	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr7:133164872G>C	ENST00000253861.4	+	9	1426	c.1397G>C	c.(1396-1398)aGt>aCt	p.S466T	EXOC4_ENST00000393161.2_Missense_Mutation_p.S466T|EXOC4_ENST00000539845.1_Missense_Mutation_p.S365T	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	466					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)	p.S466T(1)		NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				GAGCTCTATAGTCGGAGTGGA	0.458																																					p.S466T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1397C	7						.						118.0	114.0	115.0					7																	133164872		2203	4300	6503	132815412	SO:0001583	missense	60412	exon9			AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.1397G>C	7.37:g.133164872G>C	ENSP00000253861:p.Ser466Thr	Somatic		Capture	SOLID	Phase_I	132815412	NM_001037126	E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Missense_Mutation	SNP	ENST00000253861.4	37	CCDS5829.1	.	.	.	.	.	.	.	.	.	.	G	15.83	2.950355	0.53186	.	.	ENSG00000131558	ENST00000253861;ENST00000393161;ENST00000546185;ENST00000539845	.	.	.	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.54481	0.1861	L	0.42245	1.32	0.80722	D	1	P;P	0.48764	0.915;0.779	B;B	0.44224	0.444;0.351	T	0.46762	-0.9168	9	0.15066	T	0.55	.	19.8933	0.96939	0.0:0.0:1.0:0.0	.	466;466	Q96A65;Q8TAR2	EXOC4_HUMAN;.	T	466;466;85;365	.	ENSP00000253861:S466T	S	+	2	0	EXOC4	132815412	1.000000	0.71417	1.000000	0.80357	0.697000	0.40408	7.419000	0.80179	2.802000	0.96397	0.655000	0.94253	AGT		EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339182.1	NM_021807	
DDX56	54606	hgsc.bcm.edu	37	7	44611173	44611173	+	Missense_Mutation	SNP	G	G	A	rs200686546		TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr7:44611173G>A	ENST00000258772.5	-	6	914	c.808C>T	c.(808-810)Cgg>Tgg	p.R270W	DDX56_ENST00000431640.1_Missense_Mutation_p.R270W|DDX56_ENST00000485367.1_5'UTR	NM_001257189.1|NM_019082.3	NP_001244118.1|NP_061955.1	Q9NY93	DDX56_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 56	270	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)	p.R270W(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(5)|upper_aerodigestive_tract(1)	16						CGGTAACTCCGTTCTAGAGTG	0.532													G|||	1	0.000199681	0.0	0.0	5008	,	,		19857	0.0		0.001	False		,,,				2504	0.0				p.R270W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C808T	7						.						91.0	82.0	85.0					7																	44611173		2203	4300	6503	44577698	SO:0001583	missense	54606	exon6			AJ131712	CCDS5492.1, CCDS59053.1	7p13	2012-02-23	2012-02-23		ENSG00000136271	ENSG00000136271		"""DEAD-boxes"""	18193	protein-coding gene	gene with protein product	"""nucleolar helicase of 61 kDa"""	608023	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 56"""			10749921	Standard	NM_019082		Approved	NOH61	uc003tlg.4	Q9NY93	OTTHUMG00000129211	ENST00000258772.5:c.808C>T	7.37:g.44611173G>A	ENSP00000258772:p.Arg270Trp	Somatic		Capture	SOLID	Phase_I	44577698	NM_019082	A4D2K9|C9JV95|Q6IAE2|Q9H9I8	Missense_Mutation	SNP	ENST00000258772.5	37	CCDS5492.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	.	18.44	3.625340	0.66901	.	.	ENSG00000136271	ENST00000258772;ENST00000431640	T;T	0.04156	3.69;3.75	5.82	0.162	0.14981	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.21674	0.0522	M	0.82056	2.57	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.995	T	0.01829	-1.1265	10	0.87932	D	0	-26.1822	16.9155	0.86150	0.0:0.0:0.2375:0.7625	.	270;270	C9JV95;Q9NY93	.;DDX56_HUMAN	W	270	ENSP00000258772:R270W;ENSP00000393488:R270W	ENSP00000258772:R270W	R	-	1	2	DDX56	44577698	0.997000	0.39634	0.988000	0.46212	0.767000	0.43475	1.053000	0.30442	-0.288000	0.09051	-0.261000	0.10672	CGG		DDX56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251291.1	NM_019082	
HTR5A	3361	hgsc.bcm.edu	37	7	154863063	154863063	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr7:154863063C>T	ENST00000287907.2	+	1	1030	c.454C>T	c.(454-456)Cgc>Tgc	p.R152C	HTR5A-AS1_ENST00000395731.2_5'UTR|HTR5A-AS1_ENST00000543018.1_5'UTR|HTR5A-AS1_ENST00000493904.1_5'UTR	NM_024012.3	NP_076917.1	P47898	5HT5A_HUMAN	5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled	152					cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hippocampus development (GO:0021766)|response to estradiol (GO:0032355)|serotonin receptor signaling pathway (GO:0007210)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	serotonin receptor activity (GO:0004993)	p.R152C(2)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(3)|stomach(1)	48	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	Asenapine(DB06216)|Loxapine(DB00408)|Olanzapine(DB00334)	ATACACGCTCCGCACCCGCAA	0.627																																					p.R152C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C454T	7						.						97.0	71.0	80.0					7																	154863063		2203	4300	6503	154493996	SO:0001583	missense	3361	exon1				CCDS5936.1	7q36.1	2012-08-08	2012-02-03		ENSG00000157219	ENSG00000157219		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5300	protein-coding gene	gene with protein product		601305	"""5-hydroxytryptamine (serotonin) receptor 5A"""			7988681	Standard	NM_024012		Approved	5-HT5A	uc003wlu.2	P47898	OTTHUMG00000151327	ENST00000287907.2:c.454C>T	7.37:g.154863063C>T	ENSP00000287907:p.Arg152Cys	Somatic		Capture	SOLID	Phase_I	154493996	NM_024012	Q2M2D2	Missense_Mutation	SNP	ENST00000287907.2	37	CCDS5936.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.183618	0.78677	.	.	ENSG00000157219	ENST00000287907	T	0.73469	-0.75	4.75	3.86	0.44501	GPCR, rhodopsin-like superfamily (1);	0.124687	0.56097	D	0.000034	D	0.86969	0.6061	M	0.94142	3.5	0.53688	D	0.99997	D	0.62365	0.991	P	0.60012	0.867	D	0.88615	0.3159	10	0.66056	D	0.02	.	10.0952	0.42471	0.1551:0.6954:0.1494:0.0	.	152	P47898	5HT5A_HUMAN	C	152	ENSP00000287907:R152C	ENSP00000287907:R152C	R	+	1	0	HTR5A	154493996	1.000000	0.71417	0.800000	0.32199	0.948000	0.59901	3.890000	0.56220	1.187000	0.43000	0.655000	0.94253	CGC		HTR5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322240.1	NM_024012	
RB1CC1	9821	hgsc.bcm.edu	37	8	53568975	53568975	+	Silent	SNP	G	G	A			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr8:53568975G>A	ENST00000025008.5	-	15	3937	c.3414C>T	c.(3412-3414)tcC>tcT	p.S1138S	RB1CC1_ENST00000435644.2_Silent_p.S1138S|RB1CC1_ENST00000521611.1_Intron|RB1CC1_ENST00000539297.1_Silent_p.S1138S	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	1138					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)		p.S1138S(1)		NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				TAATTAACTCGGAAATACACT	0.299																																					p.S1138S	GBM(180;1701 2102 13475 42023 52570)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3414T	8						.						45.0	47.0	46.0					8																	53568975		2199	4297	6496	53731528	SO:0001819	synonymous_variant	9821	exon15			AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.3414C>T	8.37:g.53568975G>A		Somatic		Capture	SOLID	Phase_I	53731528	NM_001083617	Q86YR4|Q8WVU9|Q92601	Silent	SNP	ENST00000025008.5	37	CCDS34892.1																																																																																				RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	NM_014781	
ATP6V1H	51606	hgsc.bcm.edu	37	8	54708292	54708292	+	Missense_Mutation	SNP	C	C	T	rs200328593		TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr8:54708292C>T	ENST00000359530.2	-	9	1048	c.785G>A	c.(784-786)cGc>cAc	p.R262H	ATP6V1H_ENST00000520188.1_Missense_Mutation_p.R222H|ATP6V1H_ENST00000396774.2_Missense_Mutation_p.R262H|ATP6V1H_ENST00000355221.3_Missense_Mutation_p.R244H	NM_015941.3	NP_057025.2	Q9UI12	VATH_HUMAN	ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H	262					ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|endocytosis (GO:0006897)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|regulation of catalytic activity (GO:0050790)|regulation of defense response to virus by virus (GO:0050690)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V1 domain (GO:0000221)	enzyme regulator activity (GO:0030234)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)	p.R244H(1)		endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|urinary_tract(1)	18		all_epithelial(80;0.0487)|Lung NSC(129;0.109)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;2.79e-06)|Epithelial(17;0.000629)|all cancers(17;0.00359)			GATATTATAGCGCCGCAGGTG	0.403																																					p.R262H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G785A	8						.	C	HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	103.0	108.0	106.0		785,731,785	5.8	1.0	8		106	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense,missense	ATP6V1H	NM_015941.2,NM_213619.1,NM_213620.1	29,29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	262/484,244/466,262/484	54708292	1,13005	2203	4300	6503	54870845	SO:0001583	missense	51606	exon9			AF132945	CCDS6153.1, CCDS6154.1	8q11.2	2011-05-24	2002-08-29		ENSG00000047249	ENSG00000047249		"""ATPases / V-type"""	18303	protein-coding gene	gene with protein product	"""vacuolar ATP synthase subunit H"""	608861	"""ATPase, H+ transporting, lysosomal 50/57kD, V1 subunit H"""			9620685, 10810093	Standard	NM_015941		Approved	CGI-11, SFD, VMA13, SFDalpha, SFDbeta	uc003xrm.4	Q9UI12	OTTHUMG00000164231	ENST00000359530.2:c.785G>A	8.37:g.54708292C>T	ENSP00000352522:p.Arg262His	Somatic		Capture	SOLID	Phase_I	54870845	NM_015941	B3KMR0|Q6PK44|Q9H3E3|Q9Y300	Missense_Mutation	SNP	ENST00000359530.2	37	CCDS6153.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.168523	0.78339	0.0	1.16E-4	ENSG00000047249	ENST00000355221;ENST00000520188;ENST00000359530;ENST00000396774	.	.	.	5.8	5.8	0.92144	Armadillo-like helical (1);Armadillo-type fold (1);	0.095397	0.85682	D	0.000000	T	0.53818	0.1820	L	0.29908	0.895	0.80722	D	1	B;B	0.19445	0.036;0.018	B;B	0.15870	0.009;0.014	T	0.43278	-0.9401	9	0.31617	T	0.26	-10.9483	20.0693	0.97712	0.0:1.0:0.0:0.0	.	244;262	Q9UI12-2;Q9UI12	.;VATH_HUMAN	H	244;222;262;262	.	ENSP00000347359:R244H	R	-	2	0	ATP6V1H	54870845	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.758000	0.94735	0.563000	0.77884	CGC		ATP6V1H-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377865.1	NM_015941	
DLC1	10395	hgsc.bcm.edu	37	8	12948826	12948826	+	Splice_Site	SNP	C	C	T			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr8:12948826C>T	ENST00000276297.4	-	14	4265		c.e14+1		DLC1_ENST00000510318.1_Splice_Site|DLC1_ENST00000358919.2_Splice_Site|DLC1_ENST00000512044.2_Splice_Site|DLC1_ENST00000520226.1_Splice_Site	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein						actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.?(1)		NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						CAATTCCTTACCTGGAAAAGC	0.423																																					.												.	.	1	Unknown(1)	large_intestine(1)	.	8						.						106.0	105.0	105.0					8																	12948826		2203	4300	6503	12993197	SO:0001630	splice_region_variant	10395	.			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.3855+1G>A	8.37:g.12948826C>T		Somatic		Capture	SOLID	Phase_I	12993197	.	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Splice_Site	SNP	ENST00000276297.4	37	CCDS5989.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.379406	0.82682	.	.	ENSG00000164741	ENST00000276297;ENST00000358919;ENST00000510318;ENST00000512044;ENST00000520226	.	.	.	4.66	4.66	0.58398	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1942	0.89815	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DLC1	12993197	1.000000	0.71417	0.997000	0.53966	0.964000	0.63967	7.648000	0.83479	2.614000	0.88457	0.650000	0.86243	.		DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094	Intron
TRIM55	84675	hgsc.bcm.edu	37	8	67066360	67066360	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chr8:67066360C>T	ENST00000315962.4	+	9	1688	c.1315C>T	c.(1315-1317)Ccc>Tcc	p.P439S	TRIM55_ENST00000276573.7_Missense_Mutation_p.P439S|TRIM55_ENST00000353317.5_Intron|TRIM55_ENST00000350034.4_Intron	NM_184085.1	NP_908973.1	Q9BYV6	TRI55_HUMAN	tripartite motif containing 55	439					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)	p.P439S(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	39		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			AACTGCGGATCCCTTGTTTTA	0.547																																					p.P439S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1315T	8						.						66.0	61.0	63.0					8																	67066360		2203	4300	6503	67228914	SO:0001583	missense	84675	exon9			AJ291712	CCDS6184.1, CCDS6185.1, CCDS6186.1, CCDS6187.1	8q13.1	2013-01-09	2011-01-25	2004-11-17	ENSG00000147573	ENSG00000147573		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	14215	protein-coding gene	gene with protein product		606469	"""ring finger protein 29"", ""tripartite motif-containing 55"""	RNF29		11243782	Standard	NM_033058		Approved	MURF-2	uc003xvv.3	Q9BYV6	OTTHUMG00000164473	ENST00000315962.4:c.1315C>T	8.37:g.67066360C>T	ENSP00000323913:p.Pro439Ser	Somatic		Capture	SOLID	Phase_I	67228914	NM_184085	B3KRC0|B3KRJ3|Q53XX3|Q8IUD9|Q8IUE4|Q96DV2|Q96DV3|Q9BYV5	Missense_Mutation	SNP	ENST00000315962.4	37	CCDS6184.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.882914	0.91740	.	.	ENSG00000147573	ENST00000315962;ENST00000276573	T;T	0.57107	0.42;0.43	5.94	5.94	0.96194	.	0.000000	0.64402	D	0.000005	T	0.66934	0.2840	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.66472	-0.5915	10	0.62326	D	0.03	.	20.4237	0.99064	0.0:1.0:0.0:0.0	.	439;439	Q9BYV6;Q9BYV6-3	TRI55_HUMAN;.	S	439	ENSP00000323913:P439S;ENSP00000276573:P439S	ENSP00000276573:P439S	P	+	1	0	TRIM55	67228914	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.348000	0.66004	2.834000	0.97654	0.650000	0.86243	CCC		TRIM55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378921.1	NM_184085	
PTCHD1	139411	hgsc.bcm.edu	37	X	23411333	23411333	+	Silent	SNP	C	C	T			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chrX:23411333C>T	ENST00000379361.4	+	3	2558	c.1698C>T	c.(1696-1698)taC>taT	p.Y566Y		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	566					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)	p.Y461Y(1)		NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						CTATAGAATACTGGAACACTA	0.413																																					p.Y566Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1698T	X						.						96.0	92.0	93.0					X																	23411333		2203	4300	6503	23321254	SO:0001819	synonymous_variant	139411	exon3			AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.1698C>T	X.37:g.23411333C>T		Somatic		Capture	SOLID	Phase_I	23321254	NM_173495	B4DQH0|Q0IJ60|Q6P6B8	Silent	SNP	ENST00000379361.4	37	CCDS35215.2																																																																																				PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056047.2	NM_173495	
FAM47B	170062	hgsc.bcm.edu	37	X	34962542	34962542	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chrX:34962542C>T	ENST00000329357.5	+	1	1630	c.1594C>T	c.(1594-1596)Cgc>Tgc	p.R532C		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	532								p.R532C(2)		breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						GGACAGGAGACGCCGGGCGGC	0.498																																					p.R532C												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C1594T	X						.						94.0	84.0	87.0					X																	34962542		2202	4300	6502	34872463	SO:0001583	missense	170062	exon1			BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.1594C>T	X.37:g.34962542C>T	ENSP00000328307:p.Arg532Cys	Somatic		Capture	SOLID	Phase_I	34872463	NM_152631	Q5JQN5|Q6PIG3	Missense_Mutation	SNP	ENST00000329357.5	37	CCDS14236.1	.	.	.	.	.	.	.	.	.	.	C	5.656	0.305749	0.10733	.	.	ENSG00000189132	ENST00000329357	T	0.41758	0.99	0.602	0.602	0.17535	.	.	.	.	.	T	0.18718	0.0449	N	0.14661	0.345	0.09310	N	1	P	0.36768	0.569	B	0.14023	0.01	T	0.11179	-1.0598	8	0.72032	D	0.01	.	.	.	.	.	532	Q8NA70	FA47B_HUMAN	C	532	ENSP00000328307:R532C	ENSP00000328307:R532C	R	+	1	0	FAM47B	34872463	0.002000	0.14202	0.003000	0.11579	0.002000	0.02628	0.279000	0.18771	0.543000	0.28864	0.292000	0.19580	CGC		FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631	
RBM10	8241	hgsc.bcm.edu	37	X	47032536	47032536	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chrX:47032536C>T	ENST00000377604.3	+	5	1184	c.442C>T	c.(442-444)Cag>Tag	p.Q148*	RBM10_ENST00000329236.7_Nonsense_Mutation_p.Q71*|RBM10_ENST00000345781.6_Nonsense_Mutation_p.Q71*	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	148	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)	p.Q148*(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						GATCCGTGGCCAGCTGCAGTC	0.612																																					p.Q148X	Melanoma(171;120 2705 19495 39241)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C442T	X						.						86.0	70.0	75.0					X																	47032536		2203	4300	6503	46917480	SO:0001587	stop_gained	8241	exon5			U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.442C>T	X.37:g.47032536C>T	ENSP00000366829:p.Gln148*	Somatic		Capture	SOLID	Phase_I	46917480	NM_005676	C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Nonsense_Mutation	SNP	ENST00000377604.3	37	CCDS14274.1	.	.	.	.	.	.	.	.	.	.	C	39	7.378596	0.98248	.	.	ENSG00000182872	ENST00000377604;ENST00000329236;ENST00000345781	.	.	.	3.81	3.81	0.43845	.	0.158984	0.42172	D	0.000750	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	-5.9209	10.7407	0.46152	0.0:1.0:0.0:0.0	.	.	.	.	X	148;71;71	.	ENSP00000328848:Q71X	Q	+	1	0	RBM10	46917480	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	6.328000	0.72915	1.641000	0.50575	0.436000	0.28706	CAG		RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	NM_005676	
SSX5	6758	hgsc.bcm.edu	37	X	48049588	48049588	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chrX:48049588C>G	ENST00000376923.1	-	5	446	c.447G>C	c.(445-447)gaG>gaC	p.E149D	SSX5_ENST00000311798.1_Missense_Mutation_p.E190D|SSX5_ENST00000347757.1_Missense_Mutation_p.E149D			O60225	SSX5_HUMAN	synovial sarcoma, X breakpoint 5	149					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.E190D(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(7)|skin(1)	18						TGTTAACCTTCTCAGAGGTAT	0.488																																					p.E149D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G447C	X						.						129.0	112.0	118.0					X																	48049588		2203	4299	6502	47934532	SO:0001583	missense	6758	exon6			BC016640	CCDS14288.1, CCDS14289.1	Xp11.23	2008-02-05			ENSG00000165583	ENSG00000165583			11339	protein-coding gene	gene with protein product		300327					Standard	NM_021015		Approved		uc004diz.1	O60225	OTTHUMG00000021471	ENST00000376923.1:c.447G>C	X.37:g.48049588C>G	ENSP00000366122:p.Glu149Asp	Somatic		Capture	SOLID	Phase_I	47934532	NM_175723	Q5JQ59|Q5JQ60|Q96AW3	Missense_Mutation	SNP	ENST00000376923.1	37	CCDS14289.1	.	.	.	.	.	.	.	.	.	.	N	8.617	0.890538	0.17613	.	.	ENSG00000165583	ENST00000311798;ENST00000376923;ENST00000347757;ENST00000403001	T;T;T;T	0.35048	3.02;3.05;3.05;1.33	1.66	-3.17	0.05202	.	1.504810	0.04642	N	0.405509	T	0.40119	0.1104	M	0.62723	1.935	0.09310	N	1	B;P	0.34462	0.325;0.454	B;P	0.44946	0.275;0.465	T	0.40961	-0.9535	10	0.36615	T	0.2	.	2.8846	0.05657	0.0:0.3619:0.2425:0.3955	.	149;190	O60225;O60225-2	SSX5_HUMAN;.	D	190;149;149;89	ENSP00000312415:E190D;ENSP00000366122:E149D;ENSP00000290558:E149D;ENSP00000385051:E89D	ENSP00000312415:E190D	E	-	3	2	SSX5	47934532	0.001000	0.12720	0.000000	0.03702	0.021000	0.10359	0.067000	0.14510	-0.931000	0.03746	0.171000	0.16805	GAG		SSX5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056466.1	NM_021015	
APEX2	27301	hgsc.bcm.edu	37	X	55033487	55033487	+	Silent	SNP	C	C	T			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chrX:55033487C>T	ENST00000374987.3	+	6	1242	c.1176C>T	c.(1174-1176)aaC>aaT	p.N392N	ALAS2_ENST00000498636.1_5'Flank	NM_014481.2	NP_055296.2	Q9UBZ4	APEX2_HUMAN	APEX nuclease (apurinic/apyrimidinic endonuclease) 2	392	Required for the colocalization with PCNA in nuclear foci in presence of oxidative- induced DNA damaging agents.		N -> H (identified in a patient with mtDNA maintenance disorders). {ECO:0000269|PubMed:20843780}.		base-excision repair (GO:0006284)|cell cycle (GO:0007049)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)	mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008311)|zinc ion binding (GO:0008270)	p.N392N(1)		breast(1)|endometrium(8)|large_intestine(4)|lung(6)|prostate(1)|urinary_tract(1)	21						GCCAGAAAAACCTGAAGAGCT	0.557								Other BER factors																													p.N392N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1176T	X						.						56.0	54.0	55.0					X																	55033487		2203	4300	6503	55050212	SO:0001819	synonymous_variant	27301	exon6			AB021260	CCDS14365.1	Xp11.23	2014-02-18			ENSG00000169188	ENSG00000169188	4.2.99.18		17889	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 2"""	300773				11376153	Standard	NM_014481		Approved	APEXL2, APE2, XTH2, ZGRF2	uc004dtz.4	Q9UBZ4	OTTHUMG00000021642	ENST00000374987.3:c.1176C>T	X.37:g.55033487C>T		Somatic		Capture	SOLID	Phase_I	55050212	NM_014481	Q9Y5X7	Silent	SNP	ENST00000374987.3	37	CCDS14365.1																																																																																				APEX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056845.1		
FAM133A	286499	hgsc.bcm.edu	37	X	92964843	92964843	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chrX:92964843C>T	ENST00000355813.5	+	4	951	c.425C>T	c.(424-426)tCc>tTc	p.S142F	FAM133A_ENST00000322139.4_Missense_Mutation_p.S142F|FAM133A_ENST00000538690.1_Missense_Mutation_p.S142F|FAM133A_ENST00000332647.4_Missense_Mutation_p.S142F	NM_001171109.1|NM_173698.2	NP_001164580.1|NP_775969.1	Q8N9E0	F133A_HUMAN	family with sequence similarity 133, member A	142	Lys-rich.|Ser-rich.							p.S142F(1)		breast(2)|endometrium(2)|large_intestine(8)|lung(7)|upper_aerodigestive_tract(1)	20						TACAAATCATCCCAAAGCTCT	0.373																																					p.S142F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C425T	X						.						32.0	27.0	28.0					X																	92964843		2201	4295	6496	92851499	SO:0001583	missense	286499	exon5			AK094978	CCDS14466.1	Xq21.32	2010-05-04			ENSG00000179083	ENSG00000179083			26748	protein-coding gene	gene with protein product	"""cancer/testis antigen 115"""						Standard	NM_173698		Approved	RP1-32F7.2, FLJ37659, CT115	uc022bzv.1	Q8N9E0	OTTHUMG00000021975	ENST00000355813.5:c.425C>T	X.37:g.92964843C>T	ENSP00000348067:p.Ser142Phe	Somatic		Capture	SOLID	Phase_I	92851499	NM_001171110		Missense_Mutation	SNP	ENST00000355813.5	37	CCDS14466.1	.	.	.	.	.	.	.	.	.	.	c	11.77	1.737830	0.30774	.	.	ENSG00000179083	ENST00000538690;ENST00000355813;ENST00000322139;ENST00000332647	T;T;T;T	0.51817	0.69;0.69;0.69;0.69	3.0	3.0	0.34707	.	0.074149	0.56097	U	0.000027	T	0.60919	0.2306	M	0.76002	2.32	0.25184	N	0.990181	D	0.69078	0.997	P	0.62184	0.899	T	0.51919	-0.8644	10	0.72032	D	0.01	-2.6891	8.661	0.34093	0.0:1.0:0.0:0.0	.	142	Q8N9E0	F133A_HUMAN	F	142	ENSP00000441389:S142F;ENSP00000348067:S142F;ENSP00000318974:S142F;ENSP00000362169:S142F	ENSP00000318974:S142F	S	+	2	0	FAM133A	92851499	0.998000	0.40836	0.868000	0.34077	0.829000	0.46940	1.658000	0.37376	1.768000	0.52137	0.597000	0.82753	TCC		FAM133A-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057452.1	NM_173698	
FMR1	2332	hgsc.bcm.edu	37	X	147024827	147024827	+	Silent	SNP	C	C	T			TCGA-AG-3583-01A-01W-0831-10	TCGA-AG-3583-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	ce45b9fe-f42b-4933-8d06-31cb8a528f9d	ba86e5b4-dd24-4497-8df7-aab5cb75c5db	g.chrX:147024827C>T	ENST00000370475.4	+	14	1580	c.1452C>T	c.(1450-1452)cgC>cgT	p.R484R	FMR1_ENST00000492846.1_3'UTR|FMR1_ENST00000440235.2_Silent_p.R131R|FMR1_ENST00000218200.8_Silent_p.R463R|FMR1_ENST00000439526.2_Silent_p.R461R|FMR1_ENST00000370471.3_Intron|FMR1_ENST00000370470.1_Silent_p.R484R|FMR1_ENST00000370477.1_Silent_p.R463R	NM_002024.5	NP_002015.1	Q06787	FMR1_HUMAN	fragile X mental retardation 1	484	Interaction with RANBP9.				central nervous system development (GO:0007417)|mRNA transport (GO:0051028)|negative regulation of translational initiation (GO:0045947)	cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|membrane (GO:0016020)|mRNA cap binding complex (GO:0005845)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|synapse (GO:0045202)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R484R(1)		NS(1)|breast(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	35	Acute lymphoblastic leukemia(192;6.56e-05)					ACGGCAGACGCGGTCCTGGAT	0.418									Fragile X syndrome																												p.R463R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1389T	X						.						127.0	118.0	121.0					X																	147024827		2203	4300	6503	146832519	SO:0001819	synonymous_variant	2332	exon13	Familial Cancer Database	Martin-Bell syndrome, FRAXA syndrome	X69962	CCDS14682.1, CCDS55518.1, CCDS55519.1, CCDS76039.1	Xq27.3	2014-09-17			ENSG00000102081	ENSG00000102081			3775	protein-coding gene	gene with protein product		309550	"""premature ovarian failure 1"""	POF1, POF		1572655	Standard	NM_002024		Approved	FMRP, FRAXA, MGC87458	uc010nst.3	Q06787	OTTHUMG00000022606	ENST00000370475.4:c.1452C>T	X.37:g.147024827C>T		Somatic		Capture	SOLID	Phase_I	146832519	NM_001185082	A6NNH4|D3DWT0|D3DWT1|D3DWT2|G8JL90|Q16578|Q5PQZ6|Q99054	Silent	SNP	ENST00000370475.4	37	CCDS14682.1																																																																																				FMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058655.1	NM_002024	
