#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
APBB1IP	54518	hgsc.bcm.edu	37	10	26789858	26789858	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr10:26789858C>A	ENST00000376236.4	+	5	726	c.271C>A	c.(271-273)Cag>Aag	p.Q91K	APBB1IP_ENST00000356785.4_Missense_Mutation_p.Q91K	NM_019043.3	NP_061916.3	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein	91					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)		p.Q91K(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(27)|skin(7)|upper_aerodigestive_tract(1)	45						AGAGTCCTTGCAGAATCAACA	0.458																																					p.Q91K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C271A	10						.						164.0	143.0	150.0					10																	26789858		2203	4300	6503	26829864	SO:0001583	missense	54518	exon5			AB085852	CCDS31167.1	10p12.1	2013-01-10			ENSG00000077420	ENSG00000077420		"""Pleckstrin homology (PH) domain containing"""	17379	protein-coding gene	gene with protein product	"""Rap1-GTP-interacting adaptor molecule"""	609036				9407065	Standard	NM_019043		Approved	INAG1, RIAM	uc001iss.3	Q7Z5R6	OTTHUMG00000017841	ENST00000376236.4:c.271C>A	10.37:g.26789858C>A	ENSP00000365411:p.Gln91Lys	Somatic		Capture	SOLID	Phase_I	26829864	NM_019043	Q8IWS8|Q8IYL7|Q8IZZ7	Missense_Mutation	SNP	ENST00000376236.4	37	CCDS31167.1	.	.	.	.	.	.	.	.	.	.	C	10.04	1.241766	0.22711	.	.	ENSG00000077420	ENST00000445780;ENST00000376236;ENST00000356785	T	0.28666	1.6	5.84	5.84	0.93424	.	0.570980	0.19712	N	0.107783	T	0.37972	0.1023	M	0.63843	1.955	0.09310	N	1	P;P;D	0.56035	0.924;0.915;0.974	P;B;P	0.53861	0.603;0.169;0.736	T	0.41431	-0.9509	10	0.23302	T	0.38	.	5.4204	0.16398	0.1469:0.6359:0.1413:0.0759	.	91;91;91	B4E100;Q7Z5R6;Q8IYL7	.;AB1IP_HUMAN;.	K	91	ENSP00000365411:Q91K	ENSP00000349237:Q91K	Q	+	1	0	APBB1IP	26829864	0.012000	0.17670	0.138000	0.22173	0.094000	0.18550	0.661000	0.25023	2.759000	0.94783	0.563000	0.77884	CAG		APBB1IP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047270.1	NM_019043	
FAS	355	hgsc.bcm.edu	37	10	90770540	90770540	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr10:90770540T>A	ENST00000355279.2	+	6	536	c.536T>A	c.(535-537)cTt>cAt	p.L179H	FAS_ENST00000313771.5_3'UTR|FAS_ENST00000352159.4_Missense_Mutation_p.L179H|FAS_ENST00000357339.2_Intron|FAS_ENST00000355740.2_Missense_Mutation_p.L179H			P49327	FAS_HUMAN	Fas cell surface death receptor	0	Beta-ketoacyl synthase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.L179H(1)		breast(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.0161)		Colorectal(12;0.000136)|COAD - Colon adenocarcinoma(12;0.000193)	Cerulenin(DB01034)|Orlistat(DB01083)	TGGCTTTGTCTTCTTCTTTTG	0.353																																					p.L179H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T536A	10						.						299.0	270.0	280.0					10																	90770540		2203	4300	6503	90760520	SO:0001583	missense	355	exon6			M67454	CCDS7393.1, CCDS7394.1, CCDS7395.1	10q24.1	2014-09-17	2013-05-22	2005-01-07	ENSG00000026103	ENSG00000026103		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11920	protein-coding gene	gene with protein product	"""TNF receptor superfamily member 6"""	134637	"""tumor necrosis factor receptor superfamily, member 6"", ""Fas (TNF receptor superfamily, member 6)"""	FAS1, APT1, TNFRSF6		1385299, 1385309	Standard	NM_000043		Approved	CD95, APO-1	uc001kfr.3	P25445	OTTHUMG00000018701	ENST00000355279.2:c.536T>A	10.37:g.90770540T>A	ENSP00000347426:p.Leu179His	Somatic		Capture	SOLID	Phase_I	90760520	NM_000043	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000355279.2	37	CCDS7395.1	.	.	.	.	.	.	.	.	.	.	T	7.138	0.581307	0.13686	.	.	ENSG00000026103	ENST00000540197;ENST00000355740;ENST00000352159;ENST00000355279;ENST00000371875	D;T;T	0.94232	-3.38;-0.94;-0.84	0.591	0.591	0.17465	.	2.604410	0.01260	N	0.009148	D	0.94945	0.8365	L	0.59436	1.845	0.09310	N	1	D;D	0.76494	0.999;0.995	D;P	0.65443	0.935;0.706	D	0.83784	0.0227	9	0.19147	T	0.46	11.9558	.	.	.	.	179;179	Q5T9P3;P25445	.;TNR6_HUMAN	H	206;179;179;179;179	ENSP00000347979:L179H;ENSP00000345601:L179H;ENSP00000347426:L179H	ENSP00000345601:L179H	L	+	2	0	FAS	90760520	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.268000	0.08607	0.492000	0.27815	0.352000	0.21897	CTT		FAS-011	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000049280.2		
APBB1	322	hgsc.bcm.edu	37	11	6413381	6413381	+	IGR	SNP	C	C	T			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr11:6413381C>T	ENST00000609360.1	-	0	2642				APBB1_ENST00000526240.1_5'Flank|SMPD1_ENST00000527275.1_Silent_p.T361T|SMPD1_ENST00000342245.4_Silent_p.T362T|SMPD1_ENST00000356761.2_Silent_p.T362T|SMPD1_ENST00000299397.3_Silent_p.T362T	NM_001164.3	NP_001155.1	O00213	APBB1_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)						apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|histone H4 acetylation (GO:0043967)|negative regulation of cell growth (GO:0030308)|negative regulation of thymidylate synthase biosynthetic process (GO:0050760)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|proline-rich region binding (GO:0070064)|transcription factor binding (GO:0008134)	p.T362T(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|prostate(2)|skin(1)|urinary_tract(1)	24		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;6.49e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		CCCTGCGCACCCTCAGGTACT	0.577																																					p.T361T	GBM(147;1810 2556 5672 39622)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1083T	11						.						47.0	45.0	46.0					11																	6413381		2201	4296	6497	6369957	SO:0001628	intergenic_variant	6609	exon2			L77864	CCDS31410.1, CCDS58114.1, CCDS66015.1, CCDS66016.1, CCDS66017.1, CCDS66018.1	11p15	2008-02-01				ENSG00000166313			581	protein-coding gene	gene with protein product		602709		RIR		8955346, 8894693	Standard	NM_001164		Approved	Fe65	uc001mcy.1	O00213			11.37:g.6413381C>T		Somatic		Capture	SOLID	Phase_I	6369957	NM_001007593	A1E379|A6NH82|A6NL69|B7Z1J5|B7Z1J6|B7Z2Y0|D3DQT2|Q7Z324|Q96A93|V9GYK0|V9GYT4	Silent	SNP	ENST00000609360.1	37		.	.	.	.	.	.	.	.	.	.	C	8.776	0.927139	0.18056	.	.	ENSG00000166311	ENST00000526280	.	.	.	4.87	0.572	0.17357	.	.	.	.	.	T	0.42268	0.1195	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.21449	-1.0245	4	.	.	.	-43.7837	1.925	0.03315	0.1399:0.4915:0.1363:0.2323	.	.	.	.	L	92	.	.	P	+	2	0	SMPD1	6369957	0.487000	0.25988	0.986000	0.45419	0.963000	0.63663	-0.347000	0.07750	0.100000	0.17581	0.561000	0.74099	CCC		APBB1-023	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000471831.1	NM_001164	
NUDT22	84304	hgsc.bcm.edu	37	11	63995078	63995078	+	Silent	SNP	C	C	G	rs151057740	byFrequency	TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr11:63995078C>G	ENST00000279206.3	+	3	675	c.519C>G	c.(517-519)ctC>ctG	p.L173L	TRPT1_ENST00000546089.1_5'Flank|TRPT1_ENST00000394547.3_5'Flank|TRPT1_ENST00000394546.2_5'Flank|DNAJC4_ENST00000321685.3_5'Flank|TRPT1_ENST00000317459.6_5'Flank|TRPT1_ENST00000540472.1_5'Flank|TRPT1_ENST00000541278.1_5'Flank|NUDT22_ENST00000441250.2_Intron|DNAJC4_ENST00000355040.4_5'Flank|TRPT1_ENST00000546133.1_5'Flank|RP11-783K16.14_ENST00000534988.1_RNA	NM_001128612.2|NM_032344.2	NP_001122084.1|NP_115720	Q9BRQ3	NUD22_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 22	173	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.						hydrolase activity (GO:0016787)	p.L173L(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(4)	8						ACCAGGACCTCGCTGGGCAGC	0.612																																					p.L173L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C519G	11						.	C	,,	0,4402		0,0,2201	87.0	82.0	83.0		519,,519	-1.8	0.9	11	dbSNP_134	83	3,8591	3.0+/-9.4	0,3,4294	no	coding-synonymous,intron,coding-synonymous	NUDT22	NM_001128612.1,NM_001128613.1,NM_032344.2	,,	0,3,6495	GG,GC,CC		0.0349,0.0,0.0231	,,	173/304,,173/304	63995078	3,12993	2201	4297	6498	63751654	SO:0001819	synonymous_variant	84304	exon3			BC006129	CCDS8061.1, CCDS44640.1	11q13.1	2008-02-05			ENSG00000149761	ENSG00000149761		"""Nudix motif containing"""	28189	protein-coding gene	gene with protein product						12477932	Standard	NM_032344		Approved	MGC13045	uc009ype.4	Q9BRQ3	OTTHUMG00000167791	ENST00000279206.3:c.519C>G	11.37:g.63995078C>G		Somatic		Capture	SOLID	Phase_I	63751654	NM_001128612	C9JY06|Q71RD5	Silent	SNP	ENST00000279206.3	37	CCDS8061.1																																																																																				NUDT22-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396304.2	NM_032344	
RNF41	10193	hgsc.bcm.edu	37	12	56604131	56604131	+	Silent	SNP	G	G	A			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr12:56604131G>A	ENST00000345093.4	-	4	681	c.312C>T	c.(310-312)agC>agT	p.S104S	RNF41_ENST00000552244.1_Silent_p.S104S|RNF41_ENST00000552656.1_Silent_p.S104S|RNF41_ENST00000394013.2_Silent_p.S33S	NM_005785.3|NM_194359.2	NP_005776.1|NP_919340.1	Q9H4P4	RNF41_HUMAN	ring finger protein 41, E3 ubiquitin protein ligase	104					extrinsic apoptotic signaling pathway (GO:0097191)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|proteasomal protein catabolic process (GO:0010498)|protein autoubiquitination (GO:0051865)|protein polyubiquitination (GO:0000209)|regulation of establishment of cell polarity (GO:2000114)|regulation of lymphocyte differentiation (GO:0045619)|regulation of MAPK cascade (GO:0043408)|regulation of myeloid cell differentiation (GO:0045637)|regulation of protein kinase B signaling (GO:0051896)|regulation of reactive oxygen species metabolic process (GO:2000377)	cytosol (GO:0005829)	acid-amino acid ligase activity (GO:0016881)|protein tag (GO:0031386)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S104S(1)		breast(1)|endometrium(4)|large_intestine(2)|lung(1)|skin(2)|urinary_tract(1)	11						GCTCACAGTCGCTGAGGTGAG	0.537																																					p.S104S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C312T	12						.						113.0	92.0	99.0					12																	56604131		2203	4300	6503	54890398	SO:0001819	synonymous_variant	10193	exon4			AF077599	CCDS8909.1, CCDS8910.1	12q13.13	2014-03-24	2014-03-24		ENSG00000181852	ENSG00000181852		"""RING-type (C3HC4) zinc fingers"""	18401	protein-coding gene	gene with protein product			"""ring finger protein 41"""				Standard	NM_005785		Approved	SBBI03, NRDP1	uc001skg.2	Q9H4P4	OTTHUMG00000170328	ENST00000345093.4:c.312C>T	12.37:g.56604131G>A		Somatic		Capture	SOLID	Phase_I	54890398	NM_005785	A6NFW0|B2RBT8|O75598	Silent	SNP	ENST00000345093.4	37	CCDS8909.1																																																																																				RNF41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408525.1	NM_005785	
FNDC3A	22862	hgsc.bcm.edu	37	13	49742763	49742763	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr13:49742763A>T	ENST00000492622.2	+	10	1357	c.1052A>T	c.(1051-1053)tAt>tTt	p.Y351F	FNDC3A_ENST00000541916.1_Missense_Mutation_p.Y351F|FNDC3A_ENST00000398316.3_Missense_Mutation_p.Y295F	NM_001079673.1	NP_001073141.1	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	351	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				fertilization (GO:0009566)|Sertoli cell development (GO:0060009)|single organismal cell-cell adhesion (GO:0016337)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	poly(A) RNA binding (GO:0044822)	p.Y351F(1)		endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|prostate(5)|skin(2)|urinary_tract(1)	41		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		CAGGCAGAATATAATTCTATA	0.373																																					p.Y351F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1052T	13						.						100.0	104.0	103.0					13																	49742763		2203	4300	6503	48640764	SO:0001583	missense	22862	exon10			AB023187	CCDS9413.2, CCDS41886.1	13q14.12	2013-02-11	2005-01-20	2005-01-22	ENSG00000102531	ENSG00000102531		"""Fibronectin type III domain containing"""	20296	protein-coding gene	gene with protein product		615794	"""fibronectin type III domain containing 3"""	FNDC3			Standard	NM_001079673		Approved	bA203I16.5, KIAA0970	uc001vcm.3	Q9Y2H6	OTTHUMG00000016911	ENST00000492622.2:c.1052A>T	13.37:g.49742763A>T	ENSP00000417257:p.Tyr351Phe	Somatic		Capture	SOLID	Phase_I	48640764	NM_001079673	B4DYG1|Q5HYC9|Q5JVF8|Q5JVF9|Q6EVH3|Q6EVH4|Q6N020|Q6P9D5|Q6ZME4|Q9H1W1	Missense_Mutation	SNP	ENST00000492622.2	37	CCDS41886.1	.	.	.	.	.	.	.	.	.	.	A	14.14	2.446293	0.43429	.	.	ENSG00000102531	ENST00000492622;ENST00000337156;ENST00000541916;ENST00000398316	T;T;T	0.57273	0.41;0.41;0.41	5.54	0.0851	0.14440	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.567589	0.16800	N	0.199006	T	0.45256	0.1333	L	0.55213	1.73	0.29735	N	0.837576	B;B;B	0.15930	0.012;0.001;0.015	B;B;B	0.33690	0.164;0.027;0.168	T	0.43909	-0.9362	10	0.20046	T	0.44	-5.8623	6.837	0.23941	0.2104:0.5612:0.2284:0.0	.	295;351;351	Q9Y2H6-2;G5E9X3;Q9Y2H6	.;.;FND3A_HUMAN	F	351;287;351;295	ENSP00000417257:Y351F;ENSP00000441831:Y351F;ENSP00000381362:Y295F	ENSP00000338579:Y287F	Y	+	2	0	FNDC3A	48640764	0.997000	0.39634	0.991000	0.47740	0.984000	0.73092	1.316000	0.33620	0.144000	0.18951	-0.332000	0.08345	TAT		FNDC3A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354845.2	NM_014923	
KLF5	688	hgsc.bcm.edu	37	13	73636462	73636462	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr13:73636462C>G	ENST00000377687.4	+	2	1261	c.725C>G	c.(724-726)tCt>tGt	p.S242C	KLF5_ENST00000477333.1_3'UTR|KLF5_ENST00000539231.1_Missense_Mutation_p.S151C	NM_001730.3	NP_001721.2	Q13887	KLF5_HUMAN	Kruppel-like factor 5 (intestinal)	242					angiogenesis (GO:0001525)|cellular response to organic cyclic compound (GO:0071407)|cellular response to peptide (GO:1901653)|intestinal epithelial cell development (GO:0060576)|microvillus assembly (GO:0030033)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of microvillus assembly (GO:0032534)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.S242C(1)|p.S242Y(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(6;0.00187)|Breast(118;0.0735)		GBM - Glioblastoma multiforme(99;0.0011)		ATGCCCAGTTCTACAAATCAG	0.488																																					p.S242C												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C725G	13						.						107.0	105.0	106.0					13																	73636462		2203	4300	6503	72534463	SO:0001583	missense	688	exon2			D14520	CCDS9448.1, CCDS66562.1	13q21.3	2013-01-08			ENSG00000102554	ENSG00000102554		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6349	protein-coding gene	gene with protein product		602903		BTEB2		8479902, 9973612	Standard	NM_001730		Approved	IKLF, CKLF	uc001vje.3	Q13887	OTTHUMG00000017074	ENST00000377687.4:c.725C>G	13.37:g.73636462C>G	ENSP00000366915:p.Ser242Cys	Somatic		Capture	SOLID	Phase_I	72534463	NM_001730	L0R3U5|L0R4T9|Q9UHP8	Missense_Mutation	SNP	ENST00000377687.4	37	CCDS9448.1	.	.	.	.	.	.	.	.	.	.	C	19.14	3.770709	0.69992	.	.	ENSG00000102554	ENST00000539231;ENST00000377687;ENST00000545883	T;T	0.08807	3.25;3.05	5.94	5.94	0.96194	.	0.398451	0.31415	N	0.007692	T	0.15825	0.0381	M	0.61703	1.905	0.53005	D	0.999967	D	0.55172	0.97	B	0.43916	0.436	T	0.00317	-1.1822	10	0.49607	T	0.09	.	20.3591	0.98849	0.0:1.0:0.0:0.0	.	242	Q13887	KLF5_HUMAN	C	151;242;222	ENSP00000440407:S151C;ENSP00000366915:S242C	ENSP00000366915:S242C	S	+	2	0	KLF5	72534463	0.677000	0.27577	1.000000	0.80357	0.998000	0.95712	3.652000	0.54439	2.816000	0.96949	0.561000	0.74099	TCT		KLF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045263.1		
CLDN10	9071	hgsc.bcm.edu	37	13	96086260	96086260	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr13:96086260C>A	ENST00000376873.3	+	1	403	c.173C>A	c.(172-174)tCt>tAt	p.S58Y		NM_001160100.1|NM_182848.3	NP_001153572.1|NP_878268.1	P78369	CLD10_HUMAN	claudin 10	60					calcium-independent cell-cell adhesion (GO:0016338)|cell adhesion (GO:0007155)|ion transport (GO:0006811)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.S58Y(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	15	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.18)			GCGTTGGGTTCTTTCCATTGC	0.493																																					p.S58Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C173A	13						.						126.0	120.0	122.0					13																	96086260		2203	4300	6503	94884261	SO:0001583	missense	9071	exon1			U89916	CCDS9475.1, CCDS9476.1	13q31-q34	2008-07-18			ENSG00000134873	ENSG00000134873		"""Claudins"""	2033	protein-coding gene	gene with protein product						18025272	Standard	NM_182848		Approved	OSP-L, CPETRL3	uc001vmh.2	P78369	OTTHUMG00000017217	ENST00000376873.3:c.173C>A	13.37:g.96086260C>A	ENSP00000366069:p.Ser58Tyr	Somatic		Capture	SOLID	Phase_I	94884261	NM_182848	Q6IBF9|Q96N78	Missense_Mutation	SNP	ENST00000376873.3	37	CCDS9475.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.538808	0.85917	.	.	ENSG00000134873	ENST00000376873	D	0.89343	-2.5	5.24	5.24	0.73138	.	.	.	.	.	D	0.91392	0.7284	.	.	.	0.80722	D	1	P	0.42203	0.773	P	0.49451	0.611	D	0.91549	0.5255	8	0.52906	T	0.07	.	17.3607	0.87349	0.0:1.0:0.0:0.0	.	58	Q96N78	.	Y	58	ENSP00000366069:S58Y	ENSP00000366069:S58Y	S	+	2	0	CLDN10	94884261	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.361000	0.79497	2.602000	0.87976	0.563000	0.77884	TCT		CLDN10-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045483.3	NM_006984	
CTSG	1511	hgsc.bcm.edu	37	14	25044607	25044607	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr14:25044607C>T	ENST00000216336.2	-	2	103	c.67G>A	c.(67-69)Gga>Aga	p.G23R		NM_001911.2	NP_001902.1	P08311	CATG_HUMAN	cathepsin G	23	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|defense response to fungus (GO:0050832)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|negative regulation of growth of symbiont in host (GO:0044130)|neutrophil mediated killing of gram-positive bacterium (GO:0070946)|positive regulation of immune response (GO:0050778)|proteolysis (GO:0006508)|response to lipopolysaccharide (GO:0032496)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	heparin binding (GO:0008201)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)	p.G23R(1)		autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)|urinary_tract(1)	25				GBM - Glioblastoma multiforme(265;0.0269)		TCCCGGCCTCCGATGATCTCC	0.572																																					p.G23R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G67A	14						.						97.0	101.0	100.0					14																	25044607		2203	4300	6503	24114447	SO:0001583	missense	1511	exon2			M16117	CCDS9631.1	14q12	2013-02-25			ENSG00000100448	ENSG00000100448		"""Cathepsins"", ""Endogenous ligands"""	2532	protein-coding gene	gene with protein product		116830				2569462	Standard	NM_001911		Approved	CG	uc001wpq.3	P08311	OTTHUMG00000140182	ENST00000216336.2:c.67G>A	14.37:g.25044607C>T	ENSP00000216336:p.Gly23Arg	Somatic		Capture	SOLID	Phase_I	24114447	NM_001911	Q6IBJ6|Q9UCA5|Q9UCU6	Missense_Mutation	SNP	ENST00000216336.2	37	CCDS9631.1	.	.	.	.	.	.	.	.	.	.	C	17.31	3.356037	0.61293	.	.	ENSG00000100448	ENST00000216336	D	0.95554	-3.74	5.38	4.5	0.54988	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.37095	N	0.002246	D	0.98108	0.9376	H	0.95260	3.645	0.42745	D	0.993751	D	0.89917	1.0	D	0.73708	0.981	D	0.98643	1.0676	10	0.87932	D	0	.	10.4166	0.44325	0.0:0.9099:0.0:0.0901	.	23	P08311	CATG_HUMAN	R	23	ENSP00000216336:G23R	ENSP00000216336:G23R	G	-	1	0	CTSG	24114447	1.000000	0.71417	1.000000	0.80357	0.446000	0.32137	2.315000	0.43752	1.420000	0.47138	0.655000	0.94253	GGA		CTSG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276536.2	NM_001911	
G2E3	55632	hgsc.bcm.edu	37	14	31081500	31081500	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr14:31081500A>C	ENST00000206595.6	+	13	1742	c.1588A>C	c.(1588-1590)Ata>Cta	p.I530L	G2E3_ENST00000438909.2_Missense_Mutation_p.I484L|G2E3_ENST00000553504.1_Missense_Mutation_p.I560L	NM_017769.3	NP_060239.2	Q7L622	G2E3_HUMAN	G2/M-phase specific E3 ubiquitin protein ligase	530	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				apoptotic process (GO:0006915)|blastocyst development (GO:0001824)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.I530L(1)		endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						TCTCAGACTTATAACGACATT	0.323																																					p.I530L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1588C	14						.						102.0	106.0	105.0					14																	31081500		2203	4294	6497	30151251	SO:0001583	missense	55632	exon13			AK000340	CCDS9638.1	14q12	2013-01-28	2010-09-17	2009-02-03	ENSG00000092140	ENSG00000092140		"""Zinc fingers, PHD-type"""	20338	protein-coding gene	gene with protein product	"""PHD finger protein 7B"""	611299	"""KIAA1333"""	KIAA1333		18511420, 17239372	Standard	NM_017769		Approved	FLJ20333, PHF7B	uc001wqk.2	Q7L622	OTTHUMG00000140204	ENST00000206595.6:c.1588A>C	14.37:g.31081500A>C	ENSP00000206595:p.Ile530Leu	Somatic		Capture	SOLID	Phase_I	30151251	NM_017769	Q9BVR2|Q9H9E9|Q9NXC0|Q9P2L3	Missense_Mutation	SNP	ENST00000206595.6	37	CCDS9638.1	.	.	.	.	.	.	.	.	.	.	A	15.01	2.704822	0.48412	.	.	ENSG00000092140	ENST00000206595;ENST00000438909;ENST00000553504	T;T;T	0.56611	0.45;0.45;0.45	5.47	-0.099	0.13626	HECT (3);	0.681685	0.15924	N	0.237995	T	0.45196	0.1330	L	0.53249	1.67	0.27300	N	0.957599	B;B	0.10296	0.003;0.0	B;B	0.09377	0.004;0.002	T	0.47355	-0.9124	10	0.66056	D	0.02	-0.0254	10.7542	0.46225	0.5411:0.0:0.4589:0.0	.	42;530	Q49AD9;Q7L622	.;G2E3_HUMAN	L	530;484;560	ENSP00000206595:I530L;ENSP00000391068:I484L;ENSP00000451653:I560L	ENSP00000206595:I530L	I	+	1	0	G2E3	30151251	0.774000	0.28592	0.879000	0.34478	0.849000	0.48306	-0.002000	0.12924	0.100000	0.17581	0.454000	0.30748	ATA		G2E3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276613.2	NM_017769	
GRIN2A	2903	hgsc.bcm.edu	37	16	9858336	9858336	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr16:9858336C>T	ENST00000396573.2	-	14	3374	c.3065G>A	c.(3064-3066)cGc>cAc	p.R1022H	GRIN2A_ENST00000562109.1_Missense_Mutation_p.R1022H|GRIN2A_ENST00000404927.2_Missense_Mutation_p.R1022H|GRIN2A_ENST00000330684.3_Missense_Mutation_p.R1022H|GRIN2A_ENST00000396575.2_Missense_Mutation_p.R1022H|GRIN2A_ENST00000535259.1_Missense_Mutation_p.R865H	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	1022					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.R1022H(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TGAATCCTGGCGTATGGAATC	0.532																																					p.R1022H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3065A	16						.						107.0	114.0	111.0					16																	9858336		2197	4300	6497	9765837	SO:0001583	missense	2903	exon13				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.3065G>A	16.37:g.9858336C>T	ENSP00000379818:p.Arg1022His	Somatic		Capture	SOLID	Phase_I	9765837	NM_001134408	O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	C	19.79	3.893778	0.72639	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.12879	2.64;2.64;2.65;2.64;2.64	5.33	5.33	0.75918	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.050105	0.85682	D	0.000000	T	0.37404	0.1002	M	0.67953	2.075	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.85130	0.994;0.964;0.997	T	0.03139	-1.1068	9	.	.	.	.	18.0263	0.89270	0.0:1.0:0.0:0.0	.	865;1022;1022	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	H	1022;1022;865;1022;1022	ENSP00000379818:R1022H;ENSP00000385872:R1022H;ENSP00000441572:R865H;ENSP00000332549:R1022H;ENSP00000379820:R1022H	.	R	-	2	0	GRIN2A	9765837	1.000000	0.71417	0.991000	0.47740	0.817000	0.46193	7.376000	0.79658	2.491000	0.84063	0.655000	0.94253	CGC		GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
SEZ6L2	26470	hgsc.bcm.edu	37	16	29891206	29891206	+	Missense_Mutation	SNP	C	C	T	rs113753753	byFrequency	TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr16:29891206C>T	ENST00000308713.5	-	9	2079	c.1552G>A	c.(1552-1554)Gac>Aac	p.D518N	SEZ6L2_ENST00000350527.3_Missense_Mutation_p.D448N|SEZ6L2_ENST00000537485.1_Missense_Mutation_p.D474N|SEZ6L2_ENST00000346932.5_Missense_Mutation_p.D404N	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	518	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.D518N(1)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GGCTCTGTGTCGTTCCAGTGG	0.617													C|||	34	0.00678914	0.0023	0.0115	5008	,	,		18456	0.0		0.0219	False		,,,				2504	0.001				p.D404N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1210A	16						.	C	ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP	34,4360	39.2+/-71.8	0,34,2163	178.0	167.0	171.0		1342,1210,1342,1552	5.8	1.0	16	dbSNP_132	171	227,8373	94.0+/-155.9	5,217,4078	yes	missense,missense,missense,missense	SEZ6L2	NM_001114099.2,NM_001114100.2,NM_012410.3,NM_201575.3	23,23,23,23	5,251,6241	TT,TC,CC		2.6395,0.7738,2.0086	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	448/841,404/810,448/854,518/911	29891206	261,12733	2197	4300	6497	29798707	SO:0001583	missense	26470	exon7			AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.1552G>A	16.37:g.29891206C>T	ENSP00000312550:p.Asp518Asn	Somatic		Capture	SOLID	Phase_I	29798707	NM_001114100	B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Missense_Mutation	SNP	ENST00000308713.5	37	CCDS10659.1	16	0.007326007326007326	0	0.0	6	0.016574585635359115	0	0.0	10	0.013192612137203167	C	34	5.379373	0.95945	0.007738	0.026395	ENSG00000174938	ENST00000350527;ENST00000308713;ENST00000346932;ENST00000537485	T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01	5.79	5.79	0.91817	Complement control module (2);Sushi/SCR/CCP (3);	0.098599	0.44285	D	0.000467	T	0.48352	0.1495	L	0.43923	1.385	0.50467	D	0.999873	D;D;D;D;D;D	0.71674	0.994;0.998;0.998;0.998;0.998;0.998	P;P;P;P;P;P	0.60682	0.766;0.878;0.878;0.807;0.878;0.807	T	0.59461	-0.7450	10	0.35671	T	0.21	.	18.7978	0.92003	0.0:1.0:0.0:0.0	.	474;518;404;448;518;448	F5H293;B7Z5L4;Q9BW82;Q6UXD5-2;Q6UXD5;Q6UXD5-3	.;.;.;.;SE6L2_HUMAN;.	N	448;518;404;474	ENSP00000310206:D448N;ENSP00000312550:D518N;ENSP00000319215:D404N;ENSP00000439412:D474N	ENSP00000312550:D518N	D	-	1	0	SEZ6L2	29798707	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.761000	0.68801	2.735000	0.93741	0.655000	0.94253	GAC		SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255154.2	NM_012410	
TP53	7157	hgsc.bcm.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R175H	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,lung,NS,Substitution - Missense,0 	.	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	c.G524A	17	GRCh37	CM062017|CM951224	TP53	M	rs28934578	.						50.0	50.0	50.0					17																	7578406		2203	4300	6503	7519131	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His	Somatic		Capture	SOLID	Phase_I	7519131	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
MYH1	4619	hgsc.bcm.edu	37	17	10409146	10409146	+	Silent	SNP	A	A	G			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr17:10409146A>G	ENST00000226207.5	-	19	2251	c.2157T>C	c.(2155-2157)taT>taC	p.Y719Y	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	719	Myosin motor.				muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.Y719Y(2)		NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						TGAAGTCTGCATAAAGGATTC	0.408																																					p.Y719Y												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T2157C	17						.						53.0	50.0	51.0					17																	10409146		2203	4300	6503	10349871	SO:0001819	synonymous_variant	4619	exon19				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.2157T>C	17.37:g.10409146A>G		Somatic		Capture	SOLID	Phase_I	10349871	NM_005963	Q14CA4|Q9Y622	Silent	SNP	ENST00000226207.5	37	CCDS11155.1																																																																																				MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963	
ZNF532	55205	hgsc.bcm.edu	37	18	56585939	56585939	+	Silent	SNP	C	C	T			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr18:56585939C>T	ENST00000336078.4	+	4	1196	c.420C>T	c.(418-420)gaC>gaT	p.D140D	ZNF532_ENST00000591083.1_Silent_p.D140D|ZNF532_ENST00000589288.1_Silent_p.D140D|ZNF532_ENST00000591230.1_Silent_p.D140D|ZNF532_ENST00000591808.1_Silent_p.D140D	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	140					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D140D(1)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						AGTTTGATGACGACGAGAAGA	0.537																																					p.D140D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C420T	18						.						121.0	108.0	112.0					18																	56585939		2203	4300	6503	54736919	SO:0001819	synonymous_variant	55205	exon4			AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.420C>T	18.37:g.56585939C>T		Somatic		Capture	SOLID	Phase_I	54736919	NM_018181	Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Silent	SNP	ENST00000336078.4	37	CCDS11969.1																																																																																				ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256130.1	NM_018181	
HNRNPL	3191	hgsc.bcm.edu	37	19	39329199	39329199	+	Silent	SNP	G	G	A			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr19:39329199G>A	ENST00000221419.5	-	10	1761	c.1395C>T	c.(1393-1395)taC>taT	p.Y465Y	HNRNPL_ENST00000600873.1_Silent_p.Y332Y|AC104534.3_ENST00000594769.1_Missense_Mutation_p.T82M	NM_001533.2	NP_001524.2	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L	465	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription regulatory region DNA binding (GO:0044212)	p.Y332Y(1)|p.Y465Y(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			CTTCCAACCCGTATGACTGAC	0.547																																					p.Y332Y												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C996T	19						.						68.0	56.0	60.0					19																	39329199		2203	4300	6503	44021039	SO:0001819	synonymous_variant	3191	exon10			X16135	CCDS33015.1, CCDS33016.1	19q13.2	2013-06-12		2007-08-16	ENSG00000104824	ENSG00000104824		"""RNA binding motif (RRM) containing"""	5045	protein-coding gene	gene with protein product		603083		HNRPL		2687284	Standard	NM_001533		Approved		uc021uuh.1	P14866	OTTHUMG00000182612	ENST00000221419.5:c.1395C>T	19.37:g.39329199G>A		Somatic		Capture	SOLID	Phase_I	44021039	NM_001005335	A6ND69|A6NIT8|Q9H3P3	Silent	SNP	ENST00000221419.5	37	CCDS33015.1																																																																																				HNRNPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462670.1		
TSPAN2	10100	hgsc.bcm.edu	37	1	115596024	115596024	+	Silent	SNP	G	G	A			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr1:115596024G>A	ENST00000369516.2	-	7	607	c.576C>T	c.(574-576)gtC>gtT	p.V192V	TSPAN2_ENST00000369514.2_Intron|TSPAN2_ENST00000369515.2_Silent_p.V167V|TSPAN2_ENST00000491992.1_5'UTR	NM_005725.4	NP_005716.2	O60636	TSN2_HUMAN	tetraspanin 2	192					astrocyte development (GO:0014002)|axon development (GO:0061564)|brain development (GO:0007420)|inflammatory response (GO:0006954)|microglia development (GO:0014005)|myelination (GO:0042552)|oligodendrocyte differentiation (GO:0048709)	integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|plasma membrane (GO:0005886)		p.V192V(1)		central_nervous_system(1)|large_intestine(4)|lung(3)|pancreas(1)|prostate(1)	10	Lung SC(450;0.211)	all_cancers(81;2.9e-07)|all_epithelial(167;1.42e-06)|all_lung(203;6.72e-06)|Lung NSC(69;1.13e-05)|Acute lymphoblastic leukemia(138;0.191)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)		TTCCAATACCGACAATTCCAA	0.373																																					p.V192V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C576T	1						.						114.0	109.0	111.0					1																	115596024		2203	4300	6503	115397547	SO:0001819	synonymous_variant	10100	exon7			AF054839	CCDS881.1	1p13.1	2013-02-14			ENSG00000134198	ENSG00000134198		"""Tetraspanins"""	20659	protein-coding gene	gene with protein product		613133				9714763, 11739647	Standard	NM_005725		Approved	TSPAN-2, TSN2, FLJ12082	uc001eft.3	O60636	OTTHUMG00000011878	ENST00000369516.2:c.576C>T	1.37:g.115596024G>A		Somatic		Capture	SOLID	Phase_I	115397547	NM_005725	D6PTH4|Q5TET2|Q8WU05	Silent	SNP	ENST00000369516.2	37	CCDS881.1																																																																																				TSPAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032828.1	NM_005725	
KLHL20	27252	hgsc.bcm.edu	37	1	173743565	173743565	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr1:173743565C>G	ENST00000209884.4	+	9	1553	c.1417C>G	c.(1417-1419)Cct>Gct	p.P473A	KLHL20_ENST00000546011.1_Missense_Mutation_p.P284A	NM_014458.3	NP_055273.2	Q9Y2M5	KLH20_HUMAN	kelch-like family member 20	473					cytoskeleton organization (GO:0007010)|Golgi to endosome transport (GO:0006895)|negative regulation of apoptotic process (GO:0043066)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K33-linked ubiquitination (GO:1990390)|protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|response to interferon-alpha (GO:0035455)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|PML body (GO:0016605)|trans-Golgi network (GO:0005802)	interferon-gamma binding (GO:0019964)|ubiquitin-protein transferase activity (GO:0004842)	p.P473A(1)		breast(3)|endometrium(6)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|upper_aerodigestive_tract(1)	34						CGGGACATCTCCTCTCAACAC	0.502																																					p.P473A	GBM(159;862 2695 6559 23041)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1417G	1						.						205.0	182.0	190.0					1																	173743565		2203	4300	6503	172010188	SO:0001583	missense	27252	exon9			AB026190	CCDS1310.1	1q25.1	2013-01-30	2013-01-30		ENSG00000076321	ENSG00000076321		"""Kelch-like"", ""BTB/POZ domain containing"""	25056	protein-coding gene	gene with protein product			"""kelch-like 20 (Drosophila)"""			14668487, 20389280	Standard	NM_014458		Approved	KLEIP, KHLHX	uc001gjc.3	Q9Y2M5	OTTHUMG00000040548	ENST00000209884.4:c.1417C>G	1.37:g.173743565C>G	ENSP00000209884:p.Pro473Ala	Somatic		Capture	SOLID	Phase_I	172010188	NM_014458	B3KMA0|B4DUR0|Q5TZF2|Q5ZF45|Q9H457	Missense_Mutation	SNP	ENST00000209884.4	37	CCDS1310.1	.	.	.	.	.	.	.	.	.	.	C	16.61	3.170770	0.57584	.	.	ENSG00000076321	ENST00000546011;ENST00000209884	T;T	0.77098	-1.07;-1.07	5.27	5.27	0.74061	Galactose oxidase, beta-propeller (1);	0.202935	0.53938	D	0.000059	T	0.72930	0.3522	N	0.24115	0.695	0.80722	D	1	P;D	0.61080	0.891;0.989	P;D	0.67231	0.852;0.95	T	0.69953	-0.5005	10	0.17832	T	0.49	.	17.6701	0.88214	0.0:1.0:0.0:0.0	.	284;473	B4DUR0;Q9Y2M5	.;KLH20_HUMAN	A	284;473	ENSP00000443121:P284A;ENSP00000209884:P473A	ENSP00000209884:P473A	P	+	1	0	KLHL20	172010188	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.592000	0.82676	2.456000	0.83038	0.655000	0.94253	CCT		KLHL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097582.1	NM_014458	
UBR4	23352	hgsc.bcm.edu	37	1	19510612	19510612	+	Missense_Mutation	SNP	G	G	A	rs545822812		TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr1:19510612G>A	ENST00000375254.3	-	16	2023	c.1996C>T	c.(1996-1998)Cgg>Tgg	p.R666W	UBR4_ENST00000375217.2_Missense_Mutation_p.R666W|UBR4_ENST00000375226.2_Missense_Mutation_p.R666W|UBR4_ENST00000375267.2_Missense_Mutation_p.R666W	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	666					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R666W(1)		breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		AAATTGTTCCGAGAGTTCAGC	0.423													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19312	0.0		0.0	False		,,,				2504	0.0				p.R666W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1996T	1						.						108.0	105.0	106.0					1																	19510612		2203	4300	6503	19383199	SO:0001583	missense	23352	exon16			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.1996C>T	1.37:g.19510612G>A	ENSP00000364403:p.Arg666Trp	Somatic		Capture	SOLID	Phase_I	19383199	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	37	CCDS189.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.030841	0.75504	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226	T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29	5.85	4.93	0.64822	.	0.058027	0.64402	D	0.000002	T	0.72977	0.3528	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.76184	-0.3052	10	0.87932	D	0	.	13.7133	0.62680	0.0:0.0:0.7217:0.2783	.	666	Q5T4S7	UBR4_HUMAN	W	666	ENSP00000364403:R666W;ENSP00000364416:R666W;ENSP00000364365:R666W;ENSP00000364374:R666W	ENSP00000364365:R666W	R	-	1	2	UBR4	19383199	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	3.496000	0.53288	1.451000	0.47736	0.655000	0.94253	CGG		UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
PRG4	10216	hgsc.bcm.edu	37	1	186275555	186275555	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr1:186275555C>T	ENST00000445192.2	+	7	749	c.704C>T	c.(703-705)aCt>aTt	p.T235I	PRG4_ENST00000367485.4_Missense_Mutation_p.T142I|PRG4_ENST00000367483.4_Missense_Mutation_p.T194I|PRG4_ENST00000367486.3_Missense_Mutation_p.T192I|PRG4_ENST00000367484.3_Missense_Mutation_p.T194I	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	235					cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.T235I(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						AAGGTCACAACTCCTGACACG	0.438																																					p.T142I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C425T	1						.						245.0	229.0	234.0					1																	186275555		2203	4300	6503	184542178	SO:0001583	missense	10216	exon5			U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.704C>T	1.37:g.186275555C>T	ENSP00000399679:p.Thr235Ile	Somatic		Capture	SOLID	Phase_I	184542178	NM_001127709	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Missense_Mutation	SNP	ENST00000445192.2	37	CCDS1369.1	.	.	.	.	.	.	.	.	.	.	C	5.997	0.367779	0.11352	.	.	ENSG00000116690	ENST00000367486;ENST00000367484;ENST00000533951;ENST00000367482;ENST00000367483;ENST00000367485;ENST00000445192	T;T;T;T;T;T	0.48522	3.12;3.45;0.81;3.44;3.49;3.39	3.97	3.03	0.35002	.	0.957255	0.08565	U	0.926928	T	0.31918	0.0812	N	0.22421	0.69	0.23056	N	0.998361	P;P;B;B	0.42518	0.782;0.557;0.267;0.386	B;B;B;B	0.36766	0.232;0.232;0.116;0.232	T	0.09400	-1.0676	10	0.41790	T	0.15	-1.3861	8.8966	0.35467	0.0:0.8863:0.0:0.1137	.	101;142;235;194	Q92954-4;Q92954-3;Q92954;Q92954-2	.;.;PRG4_HUMAN;.	I	192;194;144;101;194;142;235	ENSP00000356456:T192I;ENSP00000356454:T194I;ENSP00000431330:T144I;ENSP00000356453:T194I;ENSP00000356455:T142I;ENSP00000399679:T235I	ENSP00000356452:T101I	T	+	2	0	PRG4	184542178	0.480000	0.25933	0.890000	0.34922	0.066000	0.16364	0.786000	0.26844	1.931000	0.55961	0.467000	0.42956	ACT		PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807	
C4BPA	722	hgsc.bcm.edu	37	1	207305032	207305032	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr1:207305032C>T	ENST00000367070.3	+	8	1225	c.1031C>T	c.(1030-1032)aCg>aTg	p.T344M		NM_000715.3	NP_000706.1	P04003	C4BPA_HUMAN	complement component 4 binding protein, alpha	344	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|negative regulation of complement activation, classical pathway (GO:0045959)|positive regulation of protein catabolic process (GO:0045732)|regulation of complement activation (GO:0030449)|regulation of opsonization (GO:1903027)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|other organism cell (GO:0044216)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)	p.T344M(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)|skin(1)|urinary_tract(2)	28						GATGAGCCTACGACTGTGATT	0.403																																					p.T344M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1031T	1						.						155.0	121.0	132.0					1																	207305032		2203	4300	6503	205371655	SO:0001583	missense	722	exon8			M31452	CCDS1477.1	1q32	2010-09-24	2001-11-28		ENSG00000123838	ENSG00000123838			1325	protein-coding gene	gene with protein product		120830	"""complement component 4-binding protein, alpha"""	C4BP			Standard	XM_005273251		Approved		uc001hfo.3	P04003	OTTHUMG00000036173	ENST00000367070.3:c.1031C>T	1.37:g.207305032C>T	ENSP00000356037:p.Thr344Met	Somatic		Capture	SOLID	Phase_I	205371655	NM_000715	Q5VVQ8	Missense_Mutation	SNP	ENST00000367070.3	37	CCDS1477.1	.	.	.	.	.	.	.	.	.	.	c	5.931	0.355889	0.11239	.	.	ENSG00000123838	ENST00000367070	T	0.64438	-0.1	4.66	-9.31	0.00646	Complement control module (2);Sushi/SCR/CCP (3);	1.519990	0.03884	N	0.277602	T	0.46229	0.1382	L	0.31578	0.945	0.09310	N	1	B	0.17852	0.024	B	0.18263	0.021	T	0.40175	-0.9577	10	0.42905	T	0.14	.	10.4152	0.44318	0.1829:0.1261:0.0:0.691	.	344	P04003	C4BPA_HUMAN	M	344	ENSP00000356037:T344M	ENSP00000356037:T344M	T	+	2	0	C4BPA	205371655	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.198000	0.00142	-2.705000	0.00396	-1.674000	0.00743	ACG		C4BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088089.3		
RCOR3	55758	hgsc.bcm.edu	37	1	211452612	211452612	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr1:211452612A>G	ENST00000367005.4	+	6	641	c.500A>G	c.(499-501)gAt>gGt	p.D167G	RCOR3_ENST00000452621.2_Missense_Mutation_p.D225G|RCOR3_ENST00000419091.2_Missense_Mutation_p.D225G|RCOR3_ENST00000367006.4_Missense_Mutation_p.D225G	NM_018254.3	NP_060724.1	Q9P2K3	RCOR3_HUMAN	REST corepressor 3	167					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.D167G(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.00961)|all cancers(67;0.0999)|Epithelial(68;0.171)		CATCCAATGGATGGGAATGAT	0.323																																					p.D225G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A674G	1						.						127.0	115.0	119.0					1																	211452612		2203	4300	6503	209519235	SO:0001583	missense	55758	exon7			AK001738	CCDS31016.1, CCDS44312.1, CCDS44313.1, CCDS44314.1	1q32.3	2008-02-05			ENSG00000117625	ENSG00000117625			25594	protein-coding gene	gene with protein product						10718198	Standard	NM_018254		Approved	FLJ10876	uc010psw.2	Q9P2K3	OTTHUMG00000036996	ENST00000367005.4:c.500A>G	1.37:g.211452612A>G	ENSP00000355972:p.Asp167Gly	Somatic		Capture	SOLID	Phase_I	209519235	NM_001136223	B3KYA2|B4DYY7|Q5VT47|Q7L9I5|Q8N5U3|Q9NV83	Missense_Mutation	SNP	ENST00000367005.4	37	CCDS31016.1	.	.	.	.	.	.	.	.	.	.	A	13.53	2.264727	0.40095	.	.	ENSG00000117625	ENST00000367006;ENST00000452621;ENST00000419091;ENST00000367005	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	5.69	4.54	0.55810	.	0.044536	0.85682	D	0.000000	T	0.35364	0.0929	L	0.43152	1.355	0.54753	D	0.999983	P;B;P;B	0.39216	0.664;0.037;0.613;0.356	B;B;B;B	0.39258	0.295;0.039;0.249;0.185	T	0.05037	-1.0910	10	0.23891	T	0.37	-19.1116	12.1109	0.53838	0.8712:0.0:0.0:0.1288	.	225;167;225;225	Q9P2K3-3;Q9P2K3;Q9P2K3-2;Q9P2K3-4	.;RCOR3_HUMAN;.;.	G	225;225;225;167	ENSP00000355973:D225G;ENSP00000398558:D225G;ENSP00000413929:D225G;ENSP00000355972:D167G	ENSP00000355972:D167G	D	+	2	0	RCOR3	209519235	1.000000	0.71417	1.000000	0.80357	0.002000	0.02628	9.061000	0.93913	0.959000	0.37980	-0.509000	0.04479	GAT		RCOR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089821.1	NM_018254	
TP53BP2	7159	hgsc.bcm.edu	37	1	223976784	223976784	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr1:223976784C>A	ENST00000343537.7	-	16	3380	c.3089G>T	c.(3088-3090)aGt>aTt	p.S1030I	TP53BP2_ENST00000498843.1_5'UTR|TP53BP2_ENST00000391879.2_Missense_Mutation_p.S263I|TP53BP2_ENST00000391878.2_Missense_Mutation_p.S901I	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	1024	Mediates interaction with APC2.				cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)	p.S901I(1)		NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		CTGCATGTCACTGTAGGTCAT	0.458																																					p.S1030I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3089T	1						.						205.0	176.0	186.0					1																	223976784		2203	4300	6503	222043407	SO:0001583	missense	7159	exon16			U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.3089G>T	1.37:g.223976784C>A	ENSP00000341957:p.Ser1030Ile	Somatic		Capture	SOLID	Phase_I	222043407	NM_001031685	B4DG66|Q12892|Q86X75|Q96KQ3	Missense_Mutation	SNP	ENST00000343537.7	37	CCDS44319.1	.	.	.	.	.	.	.	.	.	.	C	34	5.350377	0.95830	.	.	ENSG00000143514	ENST00000391878;ENST00000343537;ENST00000391879	T;T;T	0.56103	0.53;0.69;0.48	5.74	5.74	0.90152	Src homology-3 domain (1);Ankyrin repeat-containing domain (2);	0.073769	0.85682	D	0.000000	T	0.74650	0.3744	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.76291	-0.3013	10	0.87932	D	0	.	19.9151	0.97057	0.0:1.0:0.0:0.0	.	1030;1024	B4DG66;Q13625	.;ASPP2_HUMAN	I	901;1030;263	ENSP00000375750:S901I;ENSP00000341957:S1030I;ENSP00000375751:S263I	ENSP00000341957:S1030I	S	-	2	0	TP53BP2	222043407	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	7.792000	0.85828	2.716000	0.92895	0.591000	0.81541	AGT		TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090985.3	NM_001031685, NM_005426	
SLC2A1	6513	hgsc.bcm.edu	37	1	43396494	43396494	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr1:43396494C>T	ENST00000426263.3	-	4	497	c.319G>A	c.(319-321)Gcc>Acc	p.A107T	SLC2A1_ENST00000372500.3_Missense_Mutation_p.A107T|SLC2A1_ENST00000415851.2_Missense_Mutation_p.A107T|SLC2A1_ENST00000475162.1_5'UTR	NM_006516.2	NP_006507.2	P11166	GTR1_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 1	107					carbohydrate metabolic process (GO:0005975)|cellular response to glucose starvation (GO:0042149)|energy reserve metabolic process (GO:0006112)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|L-ascorbic acid metabolic process (GO:0019852)|protein complex assembly (GO:0006461)|regulation of insulin secretion (GO:0050796)|response to osmotic stress (GO:0006970)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|caveola (GO:0005901)|cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|female pronucleus (GO:0001939)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|midbody (GO:0030496)|plasma membrane (GO:0005886)	D-glucose transmembrane transporter activity (GO:0055056)|dehydroascorbic acid transporter activity (GO:0033300)|glucose transmembrane transporter activity (GO:0005355)|identical protein binding (GO:0042802)|protein self-association (GO:0043621)|xenobiotic transporter activity (GO:0042910)	p.A107T(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|pancreas(2)	13	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0122)			Etomidate(DB00292)	ATGAGCACGGCGGACACGAAG	0.602																																					p.A107T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G319A	1						.						73.0	65.0	68.0					1																	43396494		2203	4300	6503	43169081	SO:0001583	missense	6513	exon4			K03195	CCDS477.1	1p34.2	2013-05-22			ENSG00000117394	ENSG00000117394		"""Solute carriers"""	11005	protein-coding gene	gene with protein product		138140	"""human T-cell leukemia virus (I and II) receptor"""	GLUT1, GLUT, HTLVR		8839927, 14622599, 18451999	Standard	NM_006516		Approved	DYT18	uc001cik.2	P11166	OTTHUMG00000007657	ENST00000426263.3:c.319G>A	1.37:g.43396494C>T	ENSP00000416293:p.Ala107Thr	Somatic		Capture	SOLID	Phase_I	43169081	NM_006516	A8K9S6|B2R620|D3DPX0|O75535|Q147X2	Missense_Mutation	SNP	ENST00000426263.3	37	CCDS477.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.261683	0.80358	.	.	ENSG00000117394	ENST00000426263;ENST00000372501;ENST00000439722;ENST00000415851;ENST00000372500	T;T;T	0.79940	-1.32;-1.32;-1.32	5.51	2.38	0.29361	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.198170	0.52532	D	0.000062	T	0.80199	0.4579	M	0.78285	2.405	0.80722	D	1	B	0.30326	0.276	B	0.32090	0.14	T	0.79759	-0.1668	10	0.72032	D	0.01	.	12.7798	0.57471	0.448:0.552:0.0:0.0	.	107	P11166	GTR1_HUMAN	T	107;107;12;107;107	ENSP00000416293:A107T;ENSP00000395521:A12T;ENSP00000361578:A107T	ENSP00000361578:A107T	A	-	1	0	SLC2A1	43169081	0.947000	0.32204	0.091000	0.20842	0.954000	0.61252	2.536000	0.45693	0.621000	0.30232	0.555000	0.69702	GCC		SLC2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020358.2	NM_006516	
BEND5	79656	hgsc.bcm.edu	37	1	49201937	49201937	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr1:49201937G>A	ENST00000371833.3	-	5	1168	c.1082C>T	c.(1081-1083)tCg>tTg	p.S361L	AGBL4_ENST00000371838.1_Intron|BEND5_ENST00000476096.1_Intron|AGBL4_ENST00000371839.1_Intron	NM_024603.2	NP_078879.2	Q7L4P6	BEND5_HUMAN	BEN domain containing 5	361	BEN. {ECO:0000255|PROSITE- ProRule:PRU00784}.					Golgi apparatus (GO:0005794)		p.S192L(1)		large_intestine(5)|lung(2)|skin(1)	8						TTTGTGAGGCGAGAGGGGTGG	0.453																																					p.S361L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1082T	1						.						153.0	136.0	142.0					1																	49201937		2203	4300	6503	48974524	SO:0001583	missense	79656	exon5			BC007932	CCDS552.2	1p33	2012-11-22	2008-10-03	2008-10-03	ENSG00000162373	ENSG00000162373		"""BEN domain containing"""	25668	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 165"""	C1orf165		12477932	Standard	NM_024603		Approved	FLJ11588	uc001crx.4	Q7L4P6	OTTHUMG00000008153	ENST00000371833.3:c.1082C>T	1.37:g.49201937G>A	ENSP00000360899:p.Ser361Leu	Somatic		Capture	SOLID	Phase_I	48974524	NM_024603	D3DQ27|Q96A62|Q9HAI3	Missense_Mutation	SNP	ENST00000371833.3	37	CCDS552.2	.	.	.	.	.	.	.	.	.	.	G	22.0	4.229041	0.79688	.	.	ENSG00000162373	ENST00000371833;ENST00000294347	T	0.47177	0.85	5.35	5.35	0.76521	BEN domain (2);	0.000000	0.85682	D	0.000000	T	0.54464	0.1860	N	0.19112	0.55	0.80722	D	1	D	0.71674	0.998	D	0.76575	0.988	T	0.52253	-0.8600	9	.	.	.	-22.0799	18.0379	0.89309	0.0:0.0:1.0:0.0	.	361	Q7L4P6	BEND5_HUMAN	L	361;73	ENSP00000360899:S361L	.	S	-	2	0	BEND5	48974524	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.414000	0.97362	2.516000	0.84829	0.555000	0.69702	TCG		BEND5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022323.1	NM_024603	
KIAA1804	84451	hgsc.bcm.edu	37	1	233489656	233489656	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr1:233489656C>G	ENST00000366624.3	+	3	1351	c.1090C>G	c.(1090-1092)Ccc>Gcc	p.P364A	MLK4_ENST00000366623.3_Missense_Mutation_p.P364A	NM_032435.2	NP_115811.2												p.P364A(1)									ACTCACTTTGCCCATTCCATC	0.517																																					p.P364A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1090G	1						.						143.0	124.0	130.0					1																	233489656		2203	4300	6503	231556279	SO:0001583	missense	84451	exon3																														ENST00000366624.3:c.1090C>G	1.37:g.233489656C>G	ENSP00000355583:p.Pro364Ala	Somatic		Capture	SOLID	Phase_I	231556279	NM_032435		Missense_Mutation	SNP	ENST00000366624.3	37	CCDS1598.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.708354	0.89018	.	.	ENSG00000143674	ENST00000366623;ENST00000366624	D;D	0.82344	-1.6;-1.6	4.91	4.91	0.64330	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.88768	0.6526	L	0.45470	1.425	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.987	D	0.89845	0.4005	10	0.87932	D	0	.	18.301	0.90163	0.0:1.0:0.0:0.0	.	364;364	Q5TCX8;Q5TCX8-2	M3KL4_HUMAN;.	A	364	ENSP00000355582:P364A;ENSP00000355583:P364A	ENSP00000355582:P364A	P	+	1	0	RP5-862P8.2	231556279	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.645000	0.83430	2.538000	0.85594	0.563000	0.77884	CCC		MLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092495.1		
CASS4	57091	hgsc.bcm.edu	37	20	55012440	55012440	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr20:55012440G>T	ENST00000360314.3	+	3	482	c.257G>T	c.(256-258)gGc>gTc	p.G86V	CASS4_ENST00000434344.1_Missense_Mutation_p.G86V|CASS4_ENST00000371336.3_Missense_Mutation_p.G86V	NM_001164116.1	NP_001157588.1	Q9NQ75	CASS4_HUMAN	Cas scaffolding protein family member 4	86					cell adhesion (GO:0007155)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)	p.G86V(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(4)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	54						TTCCTGAGAGGCCTGGAAGAA	0.627																																					p.G86V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G257T	20						.						30.0	33.0	32.0					20																	55012440		2203	4300	6503	54445847	SO:0001583	missense	57091	exon2			AJ276678	CCDS33492.1, CCDS54475.1	20q13.31	2011-04-13	2008-04-14	2008-04-15	ENSG00000087589	ENSG00000087589		"""Cas scaffolding proteins"""	15878	protein-coding gene	gene with protein product	"""HEF-like protein"", ""HEF1-Efs-p130Cas-like"""		"""chromosome 20 open reading frame 32"""	C20orf32			Standard	NM_020356		Approved	HEFL, HEPL	uc002xxr.2	Q9NQ75	OTTHUMG00000032788	ENST00000360314.3:c.257G>T	20.37:g.55012440G>T	ENSP00000353462:p.Gly86Val	Somatic		Capture	SOLID	Phase_I	54445847	NM_020356	E1P5Z8|Q5QPD6|Q96K09|Q9BYL5	Missense_Mutation	SNP	ENST00000360314.3	37	CCDS33492.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.999998	0.74818	.	.	ENSG00000087589	ENST00000360314;ENST00000371336;ENST00000434344	T;T;T	0.24151	2.36;2.36;1.87	5.57	1.13	0.20643	.	0.666605	0.15562	N	0.255879	T	0.21631	0.0521	M	0.65975	2.015	0.21020	N	0.999803	D;B;B;B	0.53462	0.96;0.091;0.186;0.117	B;B;B;B	0.42422	0.387;0.026;0.063;0.028	T	0.19257	-1.0311	10	0.44086	T	0.13	-16.946	1.0146	0.01505	0.2423:0.3115:0.2869:0.1592	.	86;86;86;86	B4DII4;Q9NQ75-3;Q9NQ75-2;Q9NQ75	.;.;.;CASS4_HUMAN	V	86	ENSP00000353462:G86V;ENSP00000360387:G86V;ENSP00000410027:G86V	ENSP00000353462:G86V	G	+	2	0	CASS4	54445847	0.000000	0.05858	0.057000	0.19452	0.690000	0.40134	0.188000	0.17018	0.274000	0.22072	0.655000	0.94253	GGC		CASS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079789.2	NM_020356	
TUBA8	51807	hgsc.bcm.edu	37	22	18609377	18609377	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr22:18609377A>C	ENST00000330423.3	+	4	705	c.632A>C	c.(631-633)gAc>gCc	p.D211A	TUBA8_ENST00000316027.6_Missense_Mutation_p.D145A	NM_018943.2	NP_061816.1	Q9NY65	TBA8_HUMAN	tubulin, alpha 8	211					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.D211A(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	14						GCCATCTATGACATCTGCCGC	0.512																																					p.D145A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A434C	22						.						178.0	154.0	162.0					22																	18609377		2203	4300	6503	16989377	SO:0001583	missense	51807	exon4			AJ245922	CCDS13751.1, CCDS54495.1	22q11	2005-06-11			ENSG00000183785	ENSG00000183785		"""Tubulins"""	12410	protein-coding gene	gene with protein product		605742		TUBAL2		10772959, 10591208	Standard	NM_001193414		Approved		uc002znv.2	Q9NY65	OTTHUMG00000150097	ENST00000330423.3:c.632A>C	22.37:g.18609377A>C	ENSP00000333326:p.Asp211Ala	Somatic		Capture	SOLID	Phase_I	16989377	NM_001193414	B2RCX2|B3KPW9|B4DWG3|Q2M3N4	Missense_Mutation	SNP	ENST00000330423.3	37	CCDS13751.1	.	.	.	.	.	.	.	.	.	.	.	17.11	3.306233	0.60305	.	.	ENSG00000183785	ENST00000316027;ENST00000330423;ENST00000416740	T;T;T	0.70749	-0.51;-0.51;-0.51	5.67	5.67	0.87782	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.85682	D	0.000000	D	0.89570	0.6753	H	0.97465	4.01	0.80722	D	1	D;D;D	0.76494	0.997;0.999;0.987	D;D;D	0.74023	0.971;0.982;0.942	D	0.93081	0.6491	10	0.87932	D	0	.	15.3851	0.74691	1.0:0.0:0.0:0.0	.	145;235;211	B3KPW9;C9J2C0;Q9NY65	.;.;TBA8_HUMAN	A	145;211;235	ENSP00000318575:D145A;ENSP00000333326:D211A;ENSP00000412646:D235A	ENSP00000318575:D145A	D	+	2	0	TUBA8	16989377	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.288000	0.76882	0.533000	0.62120	GAC		TUBA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316232.3	NM_018943	
PNPLA5	150379	hgsc.bcm.edu	37	22	44285724	44285724	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr22:44285724G>T	ENST00000597664.1	-	3	576	c.447C>A	c.(445-447)taC>taA	p.Y149*	PNPLA5_ENST00000381198.2_Intron|PNPLA5_ENST00000216177.4_Nonsense_Mutation_p.Y149*|PNPLA5_ENST00000593866.1_Intron			Q7Z6Z6	PLPL5_HUMAN	patatin-like phospholipase domain containing 5	149	Patatin.				lipid catabolic process (GO:0016042)		hydrolase activity (GO:0016787)	p.Y149*(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	16		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)				AGAAAGGAAAGTATAAGGTGC	0.557																																					p.Y149X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C447A	22						.						63.0	62.0	62.0					22																	44285724		2203	4300	6503	42617057	SO:0001587	stop_gained	150379	exon3			Z97055	CCDS14053.1, CCDS54537.1	22q13.31	2009-01-12			ENSG00000100341	ENSG00000100341		"""Patatin-like phospholipase domain containing"""	24888	protein-coding gene	gene with protein product		611589				16799181, 19029121	Standard	NM_138814		Approved	dJ388M5.4, GS2L	uc003beg.3	Q7Z6Z6	OTTHUMG00000030779	ENST00000597664.1:c.447C>A	22.37:g.44285724G>T	ENSP00000471069:p.Tyr149*	Somatic		Capture	SOLID	Phase_I	42617057	NM_138814	B1AHL8|B3KPR1|Q6ZST0	Nonsense_Mutation	SNP	ENST00000597664.1	37		.	.	.	.	.	.	.	.	.	.	G	18.54	3.645968	0.67358	.	.	ENSG00000100341	ENST00000216177	.	.	.	4.36	0.827	0.18835	.	0.096386	0.43747	D	0.000537	.	.	.	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-12.1507	6.1496	0.20304	0.621:0.0:0.379:0.0	.	.	.	.	X	149	.	ENSP00000216177:Y149X	Y	-	3	2	PNPLA5	42617057	0.002000	0.14202	0.001000	0.08648	0.002000	0.02628	0.082000	0.14847	0.127000	0.18452	-0.339000	0.08088	TAC		PNPLA5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000075667.4	NM_138814	
TTL	150465	hgsc.bcm.edu	37	2	113286271	113286271	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr2:113286271G>T	ENST00000233336.6	+	7	1224	c.1033G>T	c.(1033-1035)Gaa>Taa	p.E345*	TTL_ENST00000460450.1_3'UTR	NM_153712.4	NP_714923.1	Q8NG68	TTL_HUMAN	tubulin tyrosine ligase	345	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)|microtubule cytoskeleton organization (GO:0000226)|regulation of axon extension (GO:0030516)		ATP binding (GO:0005524)|tubulin-tyrosine ligase activity (GO:0004835)	p.E345*(1)		breast(1)|large_intestine(2)|ovary(1)	4		Ovarian(717;0.024)		BRCA - Breast invasive adenocarcinoma(221;6.17e-07)|STAD - Stomach adenocarcinoma(1183;0.00644)		GCTCTATGCAGAACTGTGCCA	0.433			T	ETV6	ALL																																p.E345X			Dom	yes		2	2q13	150465	tubulin tyrosine ligase		L	.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1033T	2						.						96.0	90.0	92.0					2																	113286271		2203	4300	6503	113002742	SO:0001587	stop_gained	150465	exon7				CCDS2096.1	2q13	2010-04-21			ENSG00000114999	ENSG00000114999	6.3.2.25		21586	protein-coding gene	gene with protein product		608291				11431336	Standard	NM_153712		Approved	MGC46235	uc002thu.3	Q8NG68	OTTHUMG00000131316	ENST00000233336.6:c.1033G>T	2.37:g.113286271G>T	ENSP00000233336:p.Glu345*	Somatic		Capture	SOLID	Phase_I	113002742	NM_153712	Q585T3|Q7Z302|Q8N426	Nonsense_Mutation	SNP	ENST00000233336.6	37	CCDS2096.1	.	.	.	.	.	.	.	.	.	.	G	38	7.120203	0.98077	.	.	ENSG00000114999	ENST00000233336	.	.	.	4.68	4.68	0.58851	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	16.5285	0.84344	0.0:0.0:1.0:0.0	.	.	.	.	X	345	.	ENSP00000233336:E345X	E	+	1	0	TTL	113002742	1.000000	0.71417	0.981000	0.43875	0.999000	0.98932	8.536000	0.90627	2.409000	0.81822	0.650000	0.86243	GAA		TTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254085.2	NM_153712	
SLC20A1	6574	hgsc.bcm.edu	37	2	113416569	113416569	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr2:113416569A>G	ENST00000272542.3	+	7	1485	c.946A>G	c.(946-948)Aca>Gca	p.T316A	SLC20A1_ENST00000480984.1_3'UTR	NM_005415.4	NP_005406.3	Q8WUM9	S20A1_HUMAN	solute carrier family 20 (phosphate transporter), member 1	316					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	high-affinity inorganic phosphate:sodium symporter activity (GO:0005316)|inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|sodium:phosphate symporter activity (GO:0005436)	p.T316A(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|skin(1)|urinary_tract(3)	28						GGAGGAGAGAACAGTCTCATT	0.493																																					p.T316A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A946G	2						.						98.0	96.0	97.0					2																	113416569		2203	4300	6503	113133040	SO:0001583	missense	6574	exon7				CCDS2099.1	2q13	2013-05-22			ENSG00000144136	ENSG00000144136		"""Solute carriers"""	10946	protein-coding gene	gene with protein product	"""gibbon ape leukemia virus receptor 1"""	137570		GLVR1		8041748	Standard	NM_005415		Approved	PiT-1, Glvr-1	uc002tib.3	Q8WUM9	OTTHUMG00000131317	ENST00000272542.3:c.946A>G	2.37:g.113416569A>G	ENSP00000272542:p.Thr316Ala	Somatic		Capture	SOLID	Phase_I	113133040	NM_005415	Q08344|Q6DHX8|Q9UQ82	Missense_Mutation	SNP	ENST00000272542.3	37	CCDS2099.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.070|9.070	0.996711|0.996711	0.19043|0.19043	.|.	.|.	ENSG00000144136|ENSG00000144136	ENST00000433924|ENST00000272542;ENST00000409095	.|D	.|0.90069	.|-2.61	5.9|5.9	4.76|4.76	0.60689|0.60689	.|.	.|0.177605	.|0.64402	.|N	.|0.000015	T|T	0.78027|0.78027	0.4219|0.4219	N|N	0.17872|0.17872	0.535|0.535	0.20873|0.20873	N|N	0.999837|0.999837	.|B;B	.|0.16166	.|0.016;0.016	.|B;B	.|0.15484	.|0.013;0.013	T|T	0.58978|0.58978	-0.7540|-0.7540	6|10	0.07325|0.09843	T|T	0.83|0.71	-23.0946|-23.0946	9.9561|9.9561	0.41668|0.41668	0.9204:0.0:0.0796:0.0|0.9204:0.0:0.0796:0.0	.|.	.|316;316	.|A7LNJ1;Q8WUM9	.|.;S20A1_HUMAN	S|A	99|316;128	.|ENSP00000272542:T316A	ENSP00000413393:N86S|ENSP00000272542:T316A	N|T	+|+	2|1	0|0	SLC20A1|SLC20A1	113133040|113133040	0.883000|0.883000	0.30277|0.30277	0.387000|0.387000	0.26183|0.26183	0.990000|0.990000	0.78478|0.78478	2.347000|2.347000	0.44036|0.44036	1.073000|1.073000	0.40885|0.40885	0.533000|0.533000	0.62120|0.62120	AAC|ACA		SLC20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254086.2	NM_005415	
GPR39	2863	hgsc.bcm.edu	37	2	133174726	133174726	+	Silent	SNP	C	C	T			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr2:133174726C>T	ENST00000329321.3	+	1	580	c.111C>T	c.(109-111)taC>taT	p.Y37Y		NM_001508.2	NP_001499.1	O43194	GPR39_HUMAN	G protein-coupled receptor 39	37					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)	p.Y37Y(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TTCTGGTGTACCTGATCATCT	0.547																																					p.Y37Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C111T	2						.						115.0	109.0	111.0					2																	133174726		2203	4300	6503	132891196	SO:0001819	synonymous_variant	2863	exon1			AF034633	CCDS2170.1	2q21-q22	2012-08-21			ENSG00000183840	ENSG00000183840		"""GPCR / Class A : Orphans"""	4496	protein-coding gene	gene with protein product		602886				9441746	Standard	NM_001508		Approved		uc002ttl.3	O43194	OTTHUMG00000131679	ENST00000329321.3:c.111C>T	2.37:g.133174726C>T		Somatic		Capture	SOLID	Phase_I	132891196	NM_001508	B2RC12|B6V9G4|Q08AS2|Q53R01	Silent	SNP	ENST00000329321.3	37	CCDS2170.1																																																																																				GPR39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254582.1		
NDUFS1	4719	hgsc.bcm.edu	37	2	207009666	207009666	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr2:207009666C>A	ENST00000233190.6	-	9	1088	c.822G>T	c.(820-822)ttG>ttT	p.L274F	NDUFS1_ENST00000455934.2_Missense_Mutation_p.L288F|NDUFS1_ENST00000432169.1_Missense_Mutation_p.L163F|NDUFS1_ENST00000423725.1_Missense_Mutation_p.L217F|NDUFS1_ENST00000457011.1_Missense_Mutation_p.L158F|NDUFS1_ENST00000440274.1_Missense_Mutation_p.L238F|NDUFS1_ENST00000449699.1_Missense_Mutation_p.L274F	NM_005006.6	NP_004997.4	P28331	NDUS1_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)	274	4Fe-4S Mo/W bis-MGD-type. {ECO:0000255|PROSITE-ProRule:PRU01004}.				apoptotic mitochondrial changes (GO:0008637)|ATP metabolic process (GO:0046034)|cellular metabolic process (GO:0044237)|cellular respiration (GO:0045333)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|regulation of mitochondrial membrane potential (GO:0051881)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial respiratory chain complex I (GO:0005747)	2 iron, 2 sulfur cluster binding (GO:0051537)|4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.L274F(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(15)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GCATACGTGGCAAAATCCTCA	0.363																																					p.L274F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G822T	2						.						189.0	156.0	167.0					2																	207009666		2203	4300	6503	206717911	SO:0001583	missense	4719	exon9				CCDS2366.1, CCDS56162.1, CCDS56163.1, CCDS56164.1, CCDS56165.1	2q33-q34	2011-07-04	2002-08-29		ENSG00000023228	ENSG00000023228	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7707	protein-coding gene	gene with protein product	"""complex I 75kDa subunit"", ""NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial"""	157655	"""NADH dehydrogenase (ubiquinone) Fe-S protein 1 (75kD) (NADH-coenzyme Q reductase)"""			1935949	Standard	NM_005006		Approved	CI-75k	uc010ziq.2	P28331	OTTHUMG00000132892	ENST00000233190.6:c.822G>T	2.37:g.207009666C>A	ENSP00000233190:p.Leu274Phe	Somatic		Capture	SOLID	Phase_I	206717911	NM_005006	B4DIN9|B4DJA0|B4DPG1|B4DUC1|E7ENF3|Q53TR8|Q8N1C4|Q8TCC9	Missense_Mutation	SNP	ENST00000233190.6	37	CCDS2366.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.457320	0.84317	.	.	ENSG00000023228	ENST00000233190;ENST00000423725;ENST00000457011;ENST00000440274;ENST00000455934;ENST00000449699;ENST00000432169	D;D;D;D;D;D;D	0.85258	-1.96;-1.96;-1.96;-1.96;-1.96;-1.96;-1.96	5.47	5.47	0.80525	.	0.067775	0.64402	D	0.000010	D	0.94545	0.8243	H	0.94698	3.57	0.80722	D	1	D;D;D;D	0.76494	0.999;0.991;0.975;0.975	D;P;P;P	0.65684	0.937;0.846;0.835;0.707	D	0.95722	0.8767	10	0.87932	D	0	-31.7273	19.3299	0.94281	0.0:1.0:0.0:0.0	.	163;238;288;274	B4DPG1;E7ENF3;B4DJA0;P28331	.;.;.;NDUS1_HUMAN	F	274;217;158;238;288;274;163	ENSP00000233190:L274F;ENSP00000397760:L217F;ENSP00000400976:L158F;ENSP00000409766:L238F;ENSP00000392709:L288F;ENSP00000399912:L274F;ENSP00000409689:L163F	ENSP00000233190:L274F	L	-	3	2	NDUFS1	206717911	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.209000	0.32357	2.563000	0.86464	0.655000	0.94253	TTG		NDUFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256391.4	NM_005006	
SLC8A1	6546	hgsc.bcm.edu	37	2	40366774	40366774	+	Missense_Mutation	SNP	G	G	C	rs373510583		TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr2:40366774G>C	ENST00000403092.1	-	10	2345	c.2312C>G	c.(2311-2313)cCc>cGc	p.P771R	SLC8A1-AS1_ENST00000593848.1_RNA|SLC8A1-AS1_ENST00000601679.1_RNA|SLC8A1_ENST00000402441.1_Missense_Mutation_p.P735R|SLC8A1_ENST00000542024.1_Missense_Mutation_p.P735R|SLC8A1-AS1_ENST00000598247.1_RNA|SLC8A1-AS1_ENST00000596532.1_RNA|SLC8A1-AS1_ENST00000435515.1_RNA|SLC8A1_ENST00000405269.1_Missense_Mutation_p.P735R|SLC8A1_ENST00000406785.2_Missense_Mutation_p.P735R|SLC8A1-AS1_ENST00000599956.1_RNA|SLC8A1_ENST00000408028.2_Missense_Mutation_p.P763R|SLC8A1-AS1_ENST00000597385.1_RNA|SLC8A1_ENST00000405901.3_Missense_Mutation_p.P766R|SLC8A1-AS1_ENST00000597170.1_RNA|SLC8A1_ENST00000332839.4_Missense_Mutation_p.P771R|SLC8A1_ENST00000406391.2_Missense_Mutation_p.P735R|SLC8A1-AS1_ENST00000444629.1_RNA|SLC8A1-AS1_ENST00000599268.1_RNA|SLC8A1_ENST00000542756.1_Missense_Mutation_p.P766R|SLC8A1-AS1_ENST00000599740.1_RNA|SLC8A1-AS1_ENST00000593878.1_RNA			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	771					blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.P771R(1)		NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	GAAACAGGAGGGCAGCTTCTC	0.507																																					p.P766R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2297G	2						.						195.0	169.0	178.0					2																	40366774		2203	4300	6503	40220278	SO:0001583	missense	6546	exon8				CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.2312C>G	2.37:g.40366774G>C	ENSP00000384763:p.Pro771Arg	Somatic		Capture	SOLID	Phase_I	40220278	NM_001112800	A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	37	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.368914	0.82463	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.34275	1.4;1.41;1.42;1.41;1.4;1.4;1.42;1.37;1.4;1.41	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.64091	0.2567	M	0.83953	2.67	0.80722	D	1	D;D;D;D	0.89917	0.994;1.0;1.0;1.0	D;D;D;D	0.97110	0.98;1.0;1.0;1.0	T	0.70004	-0.4991	10	0.87932	D	0	.	16.17	0.81801	0.0:0.0:1.0:0.0	.	735;758;766;771	P32418-2;P32418-3;F6VPY9;P32418	.;.;.;NAC1_HUMAN	R	735;771;766;771;766;735;735;771;763;758;735;735	ENSP00000383886:P735R;ENSP00000440727:P766R;ENSP00000384763:P771R;ENSP00000385678:P766R;ENSP00000385188:P735R;ENSP00000385535:P735R;ENSP00000332931:P771R;ENSP00000384908:P763R;ENSP00000385811:P735R;ENSP00000443515:P735R	ENSP00000332931:P771R	P	-	2	0	SLC8A1	40220278	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.731000	0.98807	2.391000	0.81399	0.563000	0.77884	CCC		SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097	
EGR4	1961	hgsc.bcm.edu	37	2	73518870	73518870	+	Silent	SNP	C	C	T			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr2:73518870C>T	ENST00000545030.1	-	2	1559	c.1485G>A	c.(1483-1485)gcG>gcA	p.A495A	EGR4_ENST00000436467.2_Silent_p.A392A	NM_001965.3	NP_001956.3	Q05215	EGR4_HUMAN	early growth response 4	495					cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A392A(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						CGTCGGAGCGCGCAAAGCTCC	0.682																																					p.A495A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1485A	2						.						42.0	38.0	39.0					2																	73518870		2203	4300	6503	73372378	SO:0001819	synonymous_variant	1961	exon2				CCDS1925.2	2p13	2013-01-08			ENSG00000135625	ENSG00000135625		"""Zinc fingers, C2H2-type"""	3241	protein-coding gene	gene with protein product		128992				1584812	Standard	NM_001965		Approved	NGFI-C, PAT133	uc010yrj.2	Q05215	OTTHUMG00000129774	ENST00000545030.1:c.1485G>A	2.37:g.73518870C>T		Somatic		Capture	SOLID	Phase_I	73372378	NM_001965	B2RAE3|G3V1T5|Q2Z1P5	Silent	SNP	ENST00000545030.1	37	CCDS1925.2																																																																																				EGR4-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_001965	
CNGA3	1261	hgsc.bcm.edu	37	2	98996644	98996644	+	Silent	SNP	G	G	A			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr2:98996644G>A	ENST00000272602.2	+	3	261	c.222G>A	c.(220-222)tcG>tcA	p.S74S	CNGA3_ENST00000409937.1_Silent_p.S78S|CNGA3_ENST00000436404.2_Silent_p.S74S|CNGA3_ENST00000393504.1_Silent_p.S74S			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	74					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)	p.S74S(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						CCAGGCTGTCGCGCCTCATCT	0.602																																					p.S74S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G222A	2						.						51.0	51.0	51.0					2																	98996644		2203	4300	6503	98363076	SO:0001819	synonymous_variant	1261	exon4			S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.222G>A	2.37:g.98996644G>A		Somatic		Capture	SOLID	Phase_I	98363076	NM_001298	E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Silent	SNP	ENST00000272602.2	37	CCDS2034.1																																																																																				CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	NM_001298	
SPAG16	79582	hgsc.bcm.edu	37	2	215274985	215274985	+	Silent	SNP	C	C	T			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr2:215274985C>T	ENST00000331683.5	+	16	1937	c.1842C>T	c.(1840-1842)gaC>gaT	p.D614D	AC107218.3_ENST00000412896.1_RNA|AC107218.3_ENST00000437883.1_RNA|SPAG16_ENST00000374309.3_Silent_p.D520D|VWC2L_ENST00000312504.5_5'Flank|VWC2L_ENST00000427124.1_5'Flank	NM_024532.4	NP_078808.3	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16	614					cilium assembly (GO:0042384)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)		p.D614D(2)		endometrium(4)|kidney(1)|large_intestine(15)|lung(27)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	56		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		TTTCTCACGACGGGGAGATTC	0.502																																					p.D614D												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C1842T	2						.						132.0	126.0	128.0					2																	215274985		2203	4300	6503	214983230	SO:0001819	synonymous_variant	79582	exon16			AF310672	CCDS2396.1, CCDS46508.1	2q34	2013-05-21			ENSG00000144451	ENSG00000144451		"""WD repeat domain containing"""	23225	protein-coding gene	gene with protein product		612173				12391165, 11867345	Standard	NM_024532		Approved	PF20, FLJ22724, DKFZp666P1710, WDR29	uc002veq.4	Q8N0X2	OTTHUMG00000133015	ENST00000331683.5:c.1842C>T	2.37:g.215274985C>T		Somatic		Capture	SOLID	Phase_I	214983230	NM_024532	Q498B7|Q658W1|Q68DB3|Q6I9Z6|Q8N9C7|Q9H601	Silent	SNP	ENST00000331683.5	37	CCDS2396.1																																																																																				SPAG16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256601.2	NM_024532	
GAL3ST2	64090	hgsc.bcm.edu	37	2	242741273	242741273	+	Missense_Mutation	SNP	C	C	T	rs372108744		TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr2:242741273C>T	ENST00000192314.6	+	3	328	c.197C>T	c.(196-198)aCg>aTg	p.T66M	AC114730.5_ENST00000437438.1_RNA	NM_022134.2	NP_071417.2	Q9H3Q3	G3ST2_HUMAN	galactose-3-O-sulfotransferase 2	66					biosynthetic process (GO:0009058)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	galactosylceramide sulfotransferase activity (GO:0001733)|sulfotransferase activity (GO:0008146)	p.T66M(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|prostate(1)|skin(1)	14		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		GCCAGCAGCACGGTGCTCAAC	0.667																																					p.T66M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C197T	2						.		MET/THR	0,4406		0,0,2203	63.0	55.0	57.0		197	3.8	0.9	2		57	1,8597	1.2+/-3.3	0,1,4298	no	missense	GAL3ST2	NM_022134.2	81	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	66/399	242741273	1,13003	2203	4299	6502	242389946	SO:0001583	missense	64090	exon3			AB040610	CCDS33427.1	2q37.2	2014-05-19			ENSG00000154252	ENSG00000154252		"""Sulfotransferases, membrane-bound"""	24869	protein-coding gene	gene with protein product		608237				11029462	Standard	NM_022134		Approved	GP3ST	uc002wcj.1	Q9H3Q3	OTTHUMG00000151473	ENST00000192314.6:c.197C>T	2.37:g.242741273C>T	ENSP00000192314:p.Thr66Met	Somatic		Capture	SOLID	Phase_I	242389946	NM_022134	Q17RK0|Q57Z52	Missense_Mutation	SNP	ENST00000192314.6	37	CCDS33427.1	.	.	.	.	.	.	.	.	.	.	C	15.23	2.771599	0.49680	0.0	1.16E-4	ENSG00000154252	ENST00000192314	T	0.23348	1.91	3.8	3.8	0.43715	.	0.181747	0.38663	N	0.001614	T	0.59542	0.2201	H	0.95187	3.635	0.39602	D	0.96974	D	0.89917	1.0	D	0.97110	1.0	T	0.70662	-0.4810	10	0.72032	D	0.01	-19.5362	9.9902	0.41865	0.0:0.9045:0.0:0.0954	.	66	Q9H3Q3	G3ST2_HUMAN	M	66	ENSP00000192314:T66M	ENSP00000192314:T66M	T	+	2	0	GAL3ST2	242389946	1.000000	0.71417	0.909000	0.35828	0.142000	0.21351	4.993000	0.63895	2.118000	0.64928	0.306000	0.20318	ACG		GAL3ST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322792.1	NM_022134	
TSEN2	80746	hgsc.bcm.edu	37	3	12531461	12531461	+	Silent	SNP	G	G	A	rs78685815	byFrequency	TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr3:12531461G>A	ENST00000284995.6	+	2	549	c.162G>A	c.(160-162)gcG>gcA	p.A54A	TSEN2_ENST00000402228.3_Silent_p.A54A|TSEN2_ENST00000314571.7_Silent_p.A54A|TSEN2_ENST00000454502.2_Silent_p.A54A|TSEN2_ENST00000383797.5_Silent_p.A54A|TSEN2_ENST00000415684.1_Silent_p.A54A|TSEN2_ENST00000444864.1_Silent_p.A54A	NM_025265.3	NP_079541.1	Q8NCE0	SEN2_HUMAN	TSEN2 tRNA splicing endonuclease subunit	54					mRNA processing (GO:0006397)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-intron endonuclease complex (GO:0000214)	lyase activity (GO:0016829)|nucleic acid binding (GO:0003676)|tRNA-intron endonuclease activity (GO:0000213)	p.A54A(1)		central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(7)	19						TGAGGAATGCGGAGGACATTG	0.463													A|||	468	0.0934505	0.2103	0.0865	5008	,	,		20603	0.0298		0.0239	False		,,,				2504	0.0777				p.A54A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G162A	3						.	A	,,,,	698,3708		41,616,1546	129.0	122.0	124.0		162,162,162,162,162	-4.3	0.0	3	dbSNP_131	124	120,8480		3,114,4183	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	TSEN2	NM_001145392.1,NM_001145393.1,NM_001145394.1,NM_001145395.1,NM_025265.3	,,,,	44,730,5729	AA,AG,GG		1.3953,15.842,6.2894	,,,,	54/466,54/440,54/407,54/403,54/466	12531461	818,12188	2203	4300	6503	12506461	SO:0001819	synonymous_variant	80746	exon2			BC019582	CCDS2611.1, CCDS46757.1, CCDS46758.1, CCDS46759.1	3p25.2	2013-08-06	2013-08-06		ENSG00000154743	ENSG00000154743		"""tRNA splicing endonuclease subunits"""	28422	protein-coding gene	gene with protein product		608753	"""tRNA splicing endonuclease 2 homolog (SEN2, S. cerevisiae)"", ""tRNA splicing endonuclease 2 homolog (S. cerevisiae)"""			15109492	Standard	NM_025265		Approved	SEN2, SEN2L, MGC2776	uc003bxb.3	Q8NCE0	OTTHUMG00000129765	ENST00000284995.6:c.162G>A	3.37:g.12531461G>A		Somatic		Capture	SOLID	Phase_I	12506461	NM_025265	B7Z6K1|C9IZI7|G5E9Q3|Q8WTW7|Q9BPU7	Silent	SNP	ENST00000284995.6	37	CCDS2611.1																																																																																				TSEN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251981.1	NM_025265	
RUVBL1	8607	hgsc.bcm.edu	37	3	127819445	127819445	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr3:127819445C>T	ENST00000322623.5	-	6	845	c.746G>A	c.(745-747)cGg>cAg	p.R249Q	RUVBL1_ENST00000417360.1_Missense_Mutation_p.R249Q|RUVBL1_ENST00000464873.1_Missense_Mutation_p.R189Q	NM_003707.2	NP_003698.1	Q9Y265	RUVB1_HUMAN	RuvB-like AAA ATPase 1	249					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Ino80 complex (GO:0031011)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)	p.R249Q(1)		endometrium(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26				GBM - Glioblastoma multiforme(114;0.181)		TACCTGGGGCCGCGCATTAGC	0.493																																					p.R249Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G746A	3						.						135.0	96.0	109.0					3																	127819445		2203	4300	6503	129302135	SO:0001583	missense	8607	exon6			AF070735	CCDS3047.1	3q21	2013-09-12	2013-09-12		ENSG00000175792	ENSG00000175792		"""INO80 complex subunits"", ""ATPases / AAA-type"""	10474	protein-coding gene	gene with protein product	"""pontin"", ""INO80 complex subunit H"""	603449	"""RuvB (E coli homolog)-like 1"", ""RuvB-like 1 (E. coli)"", ""RuvB-like AAA ATPase"""			9774387, 9588198	Standard	NM_003707		Approved	TIP49, NMP238, RVB1, TIP49a, Pontin52, ECP54, TIH1, Rvb1, INO80H	uc003ekh.3	Q9Y265	OTTHUMG00000159658	ENST00000322623.5:c.746G>A	3.37:g.127819445C>T	ENSP00000318297:p.Arg249Gln	Somatic		Capture	SOLID	Phase_I	129302135	NM_003707	B2R5S0|P82276|Q1KMR0|Q53HK5|Q53HL7|Q53Y27|Q9BSX9	Missense_Mutation	SNP	ENST00000322623.5	37	CCDS3047.1	.	.	.	.	.	.	.	.	.	.	C	19.73	3.881742	0.72294	.	.	ENSG00000175792	ENST00000464873;ENST00000322623;ENST00000417360;ENST00000478892	T;T;T	0.69175	-0.38;-0.38;0.07	5.65	5.65	0.86999	TIP49, C-terminal (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.67002	0.2847	M	0.64260	1.97	0.80722	D	1	B;B;B	0.27679	0.079;0.185;0.04	B;B;B	0.21546	0.009;0.035;0.024	T	0.65809	-0.6078	10	0.59425	D	0.04	-10.7574	19.7222	0.96147	0.0:1.0:0.0:0.0	.	249;249;189	Q9Y265-2;Q9Y265;E7ETR0	.;RUVB1_HUMAN;.	Q	189;249;249;48	ENSP00000420738:R189Q;ENSP00000318297:R249Q;ENSP00000393755:R249Q	ENSP00000318297:R249Q	R	-	2	0	RUVBL1	129302135	0.964000	0.33143	0.979000	0.43373	0.942000	0.58702	5.849000	0.69465	2.648000	0.89879	0.591000	0.81541	CGG		RUVBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356728.2		
ATP2C1	27032	hgsc.bcm.edu	37	3	130715625	130715625	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr3:130715625G>A	ENST00000510168.1	+	24	2778	c.2228G>A	c.(2227-2229)gGa>gAa	p.G743E	ATP2C1_ENST00000422190.2_Missense_Mutation_p.G743E|ATP2C1_ENST00000513801.1_Missense_Mutation_p.G727E|ATP2C1_ENST00000393221.4_Missense_Mutation_p.G777E|ATP2C1_ENST00000428331.2_Missense_Mutation_p.G743E|ATP2C1_ENST00000505330.1_Missense_Mutation_p.G727E|ATP2C1_ENST00000504381.1_Missense_Mutation_p.G688E|ATP2C1_ENST00000533801.2_Missense_Mutation_p.G738E|ATP2C1_ENST00000359644.3_Missense_Mutation_p.G743E|ATP2C1_ENST00000504948.1_Missense_Mutation_p.G727E|ATP2C1_ENST00000328560.8_Missense_Mutation_p.G743E|ATP2C1_ENST00000507488.2_Missense_Mutation_p.G727E|ATP2C1_ENST00000508532.1_Missense_Mutation_p.G743E			P98194	AT2C1_HUMAN	ATPase, Ca++ transporting, type 2C, member 1	743					actin cytoskeleton reorganization (GO:0031532)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cellular calcium ion homeostasis (GO:0006874)|cellular manganese ion homeostasis (GO:0030026)|epidermis development (GO:0008544)|Golgi calcium ion homeostasis (GO:0032468)|Golgi calcium ion transport (GO:0032472)|ion transmembrane transport (GO:0034220)|manganese ion transmembrane transport (GO:0071421)|manganese ion transport (GO:0006828)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|manganese ion binding (GO:0030145)|manganese-transporting ATPase activity (GO:0015410)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.G743E(1)		breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|prostate(2)|skin(2)|urinary_tract(1)	39					Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	ATTATGGATGGACCCCCAGCT	0.358									Hailey-Hailey disease																												p.G727E	Esophageal Squamous(99;456 1443 27647 34099 42636)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2180A	3	GRCh37	CD003708	ATP2C1	D		.						130.0	128.0	129.0					3																	130715625		2203	4300	6503	132198315	SO:0001583	missense	27032	exon23	Familial Cancer Database	HHD, Familial Benign Chronic Pemphigus, Benign Familial Pemphigus	AF181120	CCDS33856.1, CCDS46912.1, CCDS46913.1, CCDS46914.1, CCDS56278.1, CCDS56279.1, CCDS56280.1, CCDS56281.1, CCDS75006.1	3q21.3	2012-10-22			ENSG00000017260	ENSG00000017260	3.6.3.8	"""ATPases / P-type"""	13211	protein-coding gene	gene with protein product	"""secretory pathway Ca2+/Mn2+ ATPase 1"", ""calcium-transporting ATPase type 2C member 1"""	604384	"""benign chronic pemphigus (Hailey-Hailey disease)"""	BCPM		10615129, 10767338	Standard	NM_001001485		Approved	KIAA1347, ATP2C1A, PMR1, SPCA1	uc011bli.2	P98194	OTTHUMG00000136802	ENST00000510168.1:c.2228G>A	3.37:g.130715625G>A	ENSP00000427461:p.Gly743Glu	Somatic		Capture	SOLID	Phase_I	132198315	NM_001199183	B2RAT7|B4DSW3|B7Z3X9|G3XAH8|G8JLN9|O76005|Q86V72|Q86V73|Q8N6V1|Q8NCJ7	Missense_Mutation	SNP	ENST00000510168.1	37	CCDS46914.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	30|30	5.056841|5.056841	0.93793|0.93793	.|.	.|.	ENSG00000017260|ENSG00000017260	ENST00000504612;ENST00000508660|ENST00000505330;ENST00000504381;ENST00000507488;ENST00000393221;ENST00000533801;ENST00000510168;ENST00000508532;ENST00000504948;ENST00000513801;ENST00000328560;ENST00000428331;ENST00000359644;ENST00000422190;ENST00000347421	.|D;D;D;D;D;D;D;D;D;D;D;D;D	.|0.99113	.|-5.44;-5.44;-5.44;-5.44;-5.44;-5.44;-5.44;-5.44;-5.44;-5.44;-5.44;-5.44;-5.44	5.73|5.73	5.73|5.73	0.89815|0.89815	.|ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.99560|0.99560	0.9842|0.9842	H|H	0.95187|0.95187	3.635|3.635	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D;D	.|0.97110	.|1.0;1.0;1.0;1.0;1.0;1.0;1.0	D|D	0.98162|0.98162	1.0447|1.0447	5|10	.|0.87932	.|D	.|0	.|.	19.8961|19.8961	0.96958|0.96958	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|777;738;777;743;777;743;743	.|G3XAH8;B4DSW3;B4E2Q0;P98194-5;B7Z3X9;P98194-2;P98194	.|.;.;.;.;.;.;AT2C1_HUMAN	N|E	697;261|727;688;727;777;738;743;743;727;727;743;743;743;743;742	.|ENSP00000423774:G727E;ENSP00000425320:G688E;ENSP00000421326:G727E;ENSP00000376914:G777E;ENSP00000432956:G738E;ENSP00000427461:G743E;ENSP00000424783:G743E;ENSP00000423330:G727E;ENSP00000422872:G727E;ENSP00000329664:G743E;ENSP00000395809:G743E;ENSP00000352665:G743E;ENSP00000402677:G743E	.|ENSP00000329664:G743E	D|G	+|+	1|2	0|0	ATP2C1|ATP2C1	132198315|132198315	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.966000|0.966000	0.64601|0.64601	9.869000|9.869000	0.99810|0.99810	2.699000|2.699000	0.92147|0.92147	0.655000|0.655000	0.94253|0.94253	GAC|GGA		ATP2C1-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356648.2	NM_001001486	
TMEM108	66000	hgsc.bcm.edu	37	3	133098901	133098901	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr3:133098901G>T	ENST00000321871.6	+	4	556	c.346G>T	c.(346-348)Ggg>Tgg	p.G116W	TMEM108_ENST00000515826.1_Missense_Mutation_p.G116W|TMEM108_ENST00000508711.1_Intron|TMEM108_ENST00000393130.3_Missense_Mutation_p.G116W	NM_001136469.1|NM_023943.2	NP_001129941.1|NP_076432.1	Q6UXF1	TM108_HUMAN	transmembrane protein 108	116	Pro-rich.					integral component of membrane (GO:0016021)		p.G116W(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						CCTGTCCACAGGGCCCGCTCC	0.667																																					p.G116W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G346T	3						.						48.0	42.0	44.0					3																	133098901		2201	4298	6499	134581591	SO:0001583	missense	66000	exon4			AL136578	CCDS33858.1, CCDS75012.1	3q22.1	2014-04-07			ENSG00000144868	ENSG00000144868			28451	protein-coding gene	gene with protein product	"""cancer/testis antigen 124"""					11214970	Standard	XM_005247726		Approved	MGC3040, CT124	uc003epi.3	Q6UXF1	OTTHUMG00000159685	ENST00000321871.6:c.346G>T	3.37:g.133098901G>T	ENSP00000324651:p.Gly116Trp	Somatic		Capture	SOLID	Phase_I	134581591	NM_001136469	D3DNC9|Q9BQH1|Q9BW81|Q9C0H3	Missense_Mutation	SNP	ENST00000321871.6	37	CCDS33858.1	.	.	.	.	.	.	.	.	.	.	G	0.119	-1.127996	0.01770	.	.	ENSG00000144868	ENST00000321871;ENST00000393130;ENST00000514894;ENST00000512662;ENST00000512137;ENST00000515826;ENST00000510183	T;T;T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8;0.8;0.8	3.81	-0.254	0.12992	.	0.985693	0.08228	N	0.978048	T	0.35508	0.0934	L	0.44542	1.39	0.09310	N	1	B;B	0.14805	0.0;0.011	B;B	0.12156	0.004;0.007	T	0.38373	-0.9664	10	0.87932	D	0	0.1332	2.5347	0.04711	0.1921:0.1447:0.5156:0.1476	.	116;116	E9PB58;Q6UXF1	.;TM108_HUMAN	W	116;116;67;67;116;116;116	ENSP00000324651:G116W;ENSP00000376838:G116W;ENSP00000422072:G67W;ENSP00000427447:G67W;ENSP00000426301:G116W;ENSP00000423338:G116W;ENSP00000421486:G116W	ENSP00000324651:G116W	G	+	1	0	TMEM108	134581591	0.013000	0.17824	0.000000	0.03702	0.002000	0.02628	0.458000	0.21892	-0.171000	0.10797	-1.134000	0.01955	GGG		TMEM108-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356907.2	NM_023943	
P2RY14	9934	hgsc.bcm.edu	37	3	150931440	150931440	+	Missense_Mutation	SNP	C	C	T	rs150238875		TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr3:150931440C>T	ENST00000309170.3	-	3	977	c.665G>A	c.(664-666)cGg>cAg	p.R222Q	P2RY14_ENST00000424796.2_Missense_Mutation_p.R222Q|MED12L_ENST00000474524.1_Intron|MED12L_ENST00000273432.4_Intron	NM_001081455.1|NM_014879.3	NP_001074924.1|NP_055694.3	Q15391	P2Y14_HUMAN	purinergic receptor P2Y, G-protein coupled, 14	222					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|UDP-activated nucleotide receptor activity (GO:0045029)	p.R222L(1)|p.R222Q(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(1)	20			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AGTGGAATTCCGACTTGACTT	0.383																																					p.R222Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G665A	3						.	C	GLN/ARG,GLN/ARG,	2,4404	4.2+/-10.8	0,2,2201	97.0	97.0	97.0		665,665,	-6.9	0.0	3	dbSNP_134	97	0,8600		0,0,4300	no	missense,missense,intron	P2RY14,MED12L	NM_001081455.1,NM_014879.3,NM_053002.4	43,43,	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign,benign,	222/339,222/339,	150931440	2,13004	2203	4300	6503	152414130	SO:0001583	missense	9934	exon3			D13626	CCDS3156.1	3q21-q25	2012-08-08	2004-07-12	2004-07-14	ENSG00000174944	ENSG00000174944		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	16442	protein-coding gene	gene with protein product		610116	"""G protein-coupled receptor 105"""	GPR105			Standard	NM_014879		Approved	KIAA0001	uc003eys.1	Q15391	OTTHUMG00000159859	ENST00000309170.3:c.665G>A	3.37:g.150931440C>T	ENSP00000308361:p.Arg222Gln	Somatic		Capture	SOLID	Phase_I	152414130	NM_014879	Q8IYT7	Missense_Mutation	SNP	ENST00000309170.3	37	CCDS3156.1	.	.	.	.	.	.	.	.	.	.	C	3.226	-0.158543	0.06544	4.54E-4	0.0	ENSG00000174944	ENST00000309170;ENST00000424796	T;T	0.37235	1.21;1.21	5.9	-6.89	0.01660	GPCR, rhodopsin-like superfamily (1);	0.590962	0.17921	N	0.157489	T	0.11580	0.0282	N	0.03050	-0.425	0.09310	N	1	B	0.26708	0.157	B	0.24848	0.056	T	0.19321	-1.0309	10	0.19590	T	0.45	-3.1123	11.2014	0.48743	0.0:0.2983:0.0867:0.615	.	222	Q15391	P2Y14_HUMAN	Q	222	ENSP00000308361:R222Q;ENSP00000408733:R222Q	ENSP00000308361:R222Q	R	-	2	0	P2RY14	152414130	0.000000	0.05858	0.002000	0.10522	0.074000	0.17049	0.121000	0.15667	-1.897000	0.01101	-0.781000	0.03364	CGG		P2RY14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357789.1	NM_014879	
ZMAT3	64393	hgsc.bcm.edu	37	3	178742841	178742841	+	Silent	SNP	C	C	T			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr3:178742841C>T	ENST00000311417.2	-	6	1575	c.834G>A	c.(832-834)cgG>cgA	p.R278R	ZMAT3_ENST00000432729.1_Silent_p.R277R	NM_022470.3	NP_071915.1			zinc finger, matrin-type 3									p.R278R(1)		breast(1)|endometrium(1)|large_intestine(6)|lung(2)|ovary(2)|prostate(1)|skin(1)	14	all_cancers(143;3.31e-18)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;6.74e-27)|GBM - Glioblastoma multiforme(14;0.00448)|BRCA - Breast invasive adenocarcinoma(182;0.0527)			CATTCCTGTACCGCTGTTCAG	0.428																																					p.R277R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G831A	3						.						241.0	215.0	224.0					3																	178742841		2203	4300	6503	180225535	SO:0001819	synonymous_variant	64393	exon7			AK122768	CCDS3224.1, CCDS46962.1	3q26.32	2012-10-05	2010-09-15		ENSG00000172667	ENSG00000172667		"""Zinc fingers, matrin-type"""	29983	protein-coding gene	gene with protein product		606452				9400996, 11689294	Standard	NM_022470		Approved	WIG1, MGC10613, FLJ12296, WIG-1, PAG608	uc003fjg.3	Q9HA38	OTTHUMG00000157290	ENST00000311417.2:c.834G>A	3.37:g.178742841C>T		Somatic		Capture	SOLID	Phase_I	180225535	NM_152240		Silent	SNP	ENST00000311417.2	37	CCDS3224.1																																																																																				ZMAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348336.2	NM_152240	
C3orf67	200844	hgsc.bcm.edu	37	3	58853603	58853603	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr3:58853603T>C	ENST00000482387.1	-	6	796	c.700A>G	c.(700-702)Aat>Gat	p.N234D	RP11-147N17.1_ENST00000463703.1_RNA|RP11-147N17.1_ENST00000493123.1_RNA|RP11-147N17.1_ENST00000492031.1_RNA|C3orf67_ENST00000472469.1_Missense_Mutation_p.N141D|RP11-147N17.1_ENST00000482372.1_RNA|C3orf67_ENST00000295966.7_Missense_Mutation_p.N234D			Q6ZVT6	CC067_HUMAN	chromosome 3 open reading frame 67	234								p.N234D(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(3)|prostate(2)|skin(1)	19		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)		CTTCTGTTATTATTCTTATCT	0.383																																					p.N234D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A700G	3						.						207.0	201.0	203.0					3																	58853603		2203	4300	6503	58828643	SO:0001583	missense	200844	exon10			AK124920	CCDS33776.1	3p14.2	2011-01-25			ENSG00000163689	ENSG00000163689			24763	protein-coding gene	gene with protein product							Standard	NM_198463		Approved	FLJ42117, FLJ42930	uc003dkt.1	Q6ZVT6	OTTHUMG00000159151	ENST00000482387.1:c.700A>G	3.37:g.58853603T>C	ENSP00000417122:p.Asn234Asp	Somatic		Capture	SOLID	Phase_I	58828643	NM_198463	B9EKV6|Q6ZV69	Missense_Mutation	SNP	ENST00000482387.1	37		.	.	.	.	.	.	.	.	.	.	T	17.89	3.500296	0.64298	.	.	ENSG00000163689	ENST00000295966;ENST00000482387;ENST00000472469	T;T;T	0.48836	0.8;0.8;0.8	5.57	4.34	0.51931	.	0.315119	0.33180	N	0.005190	T	0.50171	0.1600	L	0.56769	1.78	0.80722	D	1	P;P;P	0.52316	0.952;0.728;0.787	P;B;B	0.50860	0.652;0.297;0.23	T	0.44345	-0.9334	10	0.28530	T	0.3	-18.592	10.2757	0.43507	0.147:0.0:0.0:0.853	.	141;234;234	C9J3M8;Q6ZVT6-2;Q6ZVT6	.;.;CC067_HUMAN	D	234;234;141	ENSP00000295966:N234D;ENSP00000417122:N234D;ENSP00000417271:N141D	ENSP00000295966:N234D	N	-	1	0	C3orf67	58828643	0.953000	0.32496	1.000000	0.80357	0.998000	0.95712	1.864000	0.39469	2.111000	0.64477	0.533000	0.62120	AAT		C3orf67-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000353803.1	NM_198463	
ADAMTS9	56999	hgsc.bcm.edu	37	3	64589754	64589754	+	Silent	SNP	A	A	T			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr3:64589754A>T	ENST00000498707.1	-	25	3933	c.3591T>A	c.(3589-3591)acT>acA	p.T1197T	ADAMTS9_ENST00000295903.4_Silent_p.T1169T	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	1197	TSP type-1 7. {ECO:0000255|PROSITE- ProRule:PRU00210}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.T1197T(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		CTTTCCCACAAGTGGCTGAGC	0.512																																					p.T1197T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T3591A	3						.						101.0	94.0	96.0					3																	64589754		2203	4300	6503	64564794	SO:0001819	synonymous_variant	56999	exon25			AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.3591T>A	3.37:g.64589754A>T		Somatic		Capture	SOLID	Phase_I	64564794	NM_182920	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Silent	SNP	ENST00000498707.1	37	CCDS2903.1	.	.	.	.	.	.	.	.	.	.	A	7.903	0.734732	0.15574	.	.	ENSG00000163638	ENST00000481060	.	.	.	5.22	-6.47	0.01902	.	.	.	.	.	T	0.34250	0.0891	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43360	-0.9396	4	.	.	.	.	0.54	0.00644	0.2907:0.1685:0.2891:0.2518	.	.	.	.	H	253	.	.	L	-	2	0	ADAMTS9	64564794	0.289000	0.24334	0.968000	0.41197	0.639000	0.38242	-0.357000	0.07651	-0.801000	0.04427	-1.237000	0.01550	CTT		ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1		
CPOX	1371	hgsc.bcm.edu	37	3	98307680	98307680	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr3:98307680A>T	ENST00000264193.2	-	4	1048	c.830T>A	c.(829-831)tTt>tAt	p.F277Y		NM_000097.5	NP_000088.3	P36551	HEM6_HUMAN	coproporphyrinogen oxidase	277					heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to arsenic-containing substance (GO:0046685)|response to insecticide (GO:0017085)|response to iron ion (GO:0010039)|response to lead ion (GO:0010288)|response to methylmercury (GO:0051597)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	coproporphyrinogen oxidase activity (GO:0004109)|protein homodimerization activity (GO:0042803)|structural constituent of eye lens (GO:0005212)	p.F277Y(1)		endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(1)	16						TCCACCACCAAACCACCACTG	0.438																																					p.F277Y	Esophageal Squamous(75;7 1223 22300 43648 48951)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T830A	3						.						94.0	82.0	86.0					3																	98307680		2203	4300	6503	99790370	SO:0001583	missense	1371	exon4			BC017210	CCDS2932.1	3q12	2012-10-02		2004-01-30		ENSG00000080819	1.3.3.3		2321	protein-coding gene	gene with protein product	"""coproporphyria"""	612732	"""coproporphyrinogen oxidase (coproporphyria, harderoporphyria)"""	CPO		7757079, 8407975	Standard	NM_000097		Approved	CPX, HCP	uc003dsx.3	P36551		ENST00000264193.2:c.830T>A	3.37:g.98307680A>T	ENSP00000264193:p.Phe277Tyr	Somatic		Capture	SOLID	Phase_I	99790370	NM_000097	A8K275|B4DSD5|Q14060|Q53F08|Q8IZ45|Q96AF3	Missense_Mutation	SNP	ENST00000264193.2	37	CCDS2932.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.598533	0.87055	.	.	ENSG00000080819	ENST00000264193	D	0.96104	-3.91	5.93	4.76	0.60689	.	0.047462	0.85682	D	0.000000	D	0.97876	0.9302	H	0.94771	3.58	0.80722	D	1	D	0.54207	0.965	P	0.60886	0.88	D	0.97670	1.0166	10	0.54805	T	0.06	-14.4467	11.6141	0.51078	0.8509:0.1491:0.0:0.0	.	277	P36551	HEM6_HUMAN	Y	277	ENSP00000264193:F277Y	ENSP00000264193:F277Y	F	-	2	0	CPOX	99790370	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.932000	0.92897	1.048000	0.40298	0.460000	0.39030	TTT		CPOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358900.1	NM_000097	
ZMAT3	64393	hgsc.bcm.edu	37	3	178745465	178745465	+	Missense_Mutation	SNP	G	G	A	rs139328684		TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr3:178745465G>A	ENST00000311417.2	-	4	1267	c.526C>T	c.(526-528)Cgg>Tgg	p.R176W	ZMAT3_ENST00000432729.1_Missense_Mutation_p.R176W	NM_022470.3	NP_071915.1			zinc finger, matrin-type 3									p.R176W(1)		breast(1)|endometrium(1)|large_intestine(6)|lung(2)|ovary(2)|prostate(1)|skin(1)	14	all_cancers(143;3.31e-18)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;6.74e-27)|GBM - Glioblastoma multiforme(14;0.00448)|BRCA - Breast invasive adenocarcinoma(182;0.0527)			TCCGCCAGCCGCAGCCTCTTG	0.478																																					p.R176W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C526T	3						.						63.0	66.0	65.0					3																	178745465		2203	4300	6503	180228159	SO:0001583	missense	64393	exon5			AK122768	CCDS3224.1, CCDS46962.1	3q26.32	2012-10-05	2010-09-15		ENSG00000172667	ENSG00000172667		"""Zinc fingers, matrin-type"""	29983	protein-coding gene	gene with protein product		606452				9400996, 11689294	Standard	NM_022470		Approved	WIG1, MGC10613, FLJ12296, WIG-1, PAG608	uc003fjg.3	Q9HA38	OTTHUMG00000157290	ENST00000311417.2:c.526C>T	3.37:g.178745465G>A	ENSP00000311221:p.Arg176Trp	Somatic		Capture	SOLID	Phase_I	180228159	NM_152240		Missense_Mutation	SNP	ENST00000311417.2	37	CCDS3224.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.897582	0.91962	.	.	ENSG00000172667	ENST00000311417;ENST00000432729	T;T	0.49720	0.77;0.77	5.61	4.72	0.59763	Zinc finger, U1-type (1);	0.000000	0.85682	D	0.000000	T	0.59004	0.2162	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.992;0.998	T	0.63292	-0.6670	10	0.72032	D	0.01	-12.2286	15.7294	0.77790	0.0:0.0:0.8623:0.1377	.	176;176	Q9HA38-2;Q9HA38	.;ZMAT3_HUMAN	W	176	ENSP00000311221:R176W;ENSP00000396506:R176W	ENSP00000311221:R176W	R	-	1	2	ZMAT3	180228159	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.631000	0.83237	1.326000	0.45319	0.655000	0.94253	CGG		ZMAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348336.2	NM_152240	
DCHS2	54798	hgsc.bcm.edu	37	4	155156488	155156488	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr4:155156488C>T	ENST00000357232.4	-	25	7950	c.7951G>A	c.(7951-7953)Gaa>Aaa	p.E2651K		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2651					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E2651K(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CTCTGGATTTCCTTATCTTCT	0.478																																					p.E2651K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G7951A	4						.						106.0	100.0	102.0					4																	155156488		2203	4300	6503	155375938	SO:0001583	missense	54798	exon25			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.7951G>A	4.37:g.155156488C>T	ENSP00000349768:p.Glu2651Lys	Somatic		Capture	SOLID	Phase_I	155375938	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.982350	0.93044	.	.	ENSG00000197410	ENST00000357232	T	0.71222	-0.55	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000001	D	0.85703	0.5758	M	0.81942	2.565	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.86949	0.2084	10	0.72032	D	0.01	.	19.4946	0.95067	0.0:1.0:0.0:0.0	.	2651	Q6V1P9	PCD23_HUMAN	K	2651	ENSP00000349768:E2651K	ENSP00000349768:E2651K	E	-	1	0	DCHS2	155375938	1.000000	0.71417	0.974000	0.42286	0.903000	0.53119	7.818000	0.86416	2.599000	0.87857	0.460000	0.39030	GAA		DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
APC	324	hgsc.bcm.edu	37	5	112128143	112128143	+	Splice_Site	SNP	C	C	T	rs62619935		TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr5:112128143C>T	ENST00000457016.1	+	7	1026	c.646C>T	c.(646-648)Cga>Tga	p.R216*	APC_ENST00000257430.4_Splice_Site_p.R216*|APC_ENST00000508376.2_Splice_Site_p.R216*			P25054	APC_HUMAN	adenomatous polyposis coli	216	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R216*(12)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TTTATTTTAGCGAAGAATAGC	0.323		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R216X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	12	Substitution - Nonsense(12)	large_intestine(12)	c.C646T	5	GRCh37	CM992133	APC	M	rs62619935	.						52.0	51.0	51.0					5																	112128143		2202	4300	6502	112156042	SO:0001630	splice_region_variant	324	exon8	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.646-1C>T	5.37:g.112128143C>T		Somatic		Capture	SOLID	Phase_I	112156042	NM_001127510	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	39	7.466758	0.98302	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.19	2.99	0.34606	.	0.630262	0.16042	N	0.232387	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-5.2274	1.7088	0.02888	0.2899:0.3634:0.2259:0.1208	rs62619935	.	.	.	X	216	.	.	R	+	1	2	APC	112156042	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	0.662000	0.25038	1.304000	0.44892	-0.158000	0.13435	CGA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	Nonsense_Mutation
APC	324	hgsc.bcm.edu	37	5	112128191	112128191	+	Nonsense_Mutation	SNP	C	C	T	rs397515734		TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr5:112128191C>T	ENST00000457016.1	+	7	1074	c.694C>T	c.(694-696)Cga>Tga	p.R232*	APC_ENST00000257430.4_Nonsense_Mutation_p.R232*|APC_ENST00000508376.2_Nonsense_Mutation_p.R232*			P25054	APC_HUMAN	adenomatous polyposis coli	232	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R232*(13)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		ACTTCGTATACGACAGCTTTT	0.308		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R232X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Nonsense,0 	.	13	Substitution - Nonsense(13)	large_intestine(13)	c.C694T	5	GRCh37	CM920029	APC	M		.						82.0	79.0	80.0					5																	112128191		2202	4300	6502	112156090	SO:0001587	stop_gained	324	exon8	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.694C>T	5.37:g.112128191C>T	ENSP00000413133:p.Arg232*	Somatic		Capture	SOLID	Phase_I	112156090	NM_001127510	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	40	8.033640	0.98621	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.19	4.32	0.51571	.	0.206644	0.42682	D	0.000664	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.475	13.9715	0.64242	0.2757:0.7243:0.0:0.0	.	.	.	.	X	232	.	ENSP00000257430:R232X	R	+	1	2	APC	112156090	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	1.535000	0.36061	1.304000	0.44892	-0.158000	0.13435	CGA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
DNAH5	1767	hgsc.bcm.edu	37	5	13922251	13922251	+	Missense_Mutation	SNP	C	C	T	rs149833711		TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr5:13922251C>T	ENST00000265104.4	-	5	729	c.625G>A	c.(625-627)Gtc>Atc	p.V209I		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	209	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.V209I(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CCCGACAGGACGTTCACAAAG	0.532									Kartagener syndrome				C|||	1	0.000199681	0.0	0.0014	5008	,	,		18602	0.0		0.0	False		,,,				2504	0.0				p.V209I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G625A	5						.	C	ILE/VAL	1,4405		0,1,2202	85.0	78.0	81.0		625	2.2	0.1	5	dbSNP_134	81	1,8599		0,1,4299	no	missense	DNAH5	NM_001369.2	29	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	benign	209/4625	13922251	2,13004	2203	4300	6503	13975251	SO:0001583	missense	1767	exon5	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.625G>A	5.37:g.13922251C>T	ENSP00000265104:p.Val209Ile	Somatic		Capture	SOLID	Phase_I	13975251	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	.	7.684	0.689640	0.14973	2.27E-4	1.16E-4	ENSG00000039139	ENST00000265104	T	0.22539	1.95	5.44	2.15	0.27550	.	0.207319	0.40385	N	0.001101	T	0.09468	0.0233	N	0.08118	0	0.40213	D	0.977653	B	0.06786	0.001	B	0.04013	0.001	T	0.24261	-1.0165	10	0.21014	T	0.42	.	9.4147	0.38514	0.0:0.7346:0.0:0.2654	.	209	Q8TE73	DYH5_HUMAN	I	209	ENSP00000265104:V209I	ENSP00000265104:V209I	V	-	1	0	DNAH5	13975251	0.205000	0.23458	0.051000	0.19133	0.251000	0.25915	0.807000	0.27140	0.107000	0.17824	0.561000	0.74099	GTC		DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
TCF7	6932	hgsc.bcm.edu	37	5	133478730	133478730	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr5:133478730C>T	ENST00000321584.4	+	8	1161	c.965C>T	c.(964-966)gCc>gTc	p.A322V	TCF7_ENST00000432532.2_Missense_Mutation_p.A207V|TCF7_ENST00000395029.1_Missense_Mutation_p.A322V|TCF7_ENST00000520958.1_Missense_Mutation_p.A207V|TCF7_ENST00000395023.1_Missense_Mutation_p.A207V|TCF7_ENST00000378560.4_Missense_Mutation_p.A207V|TCF7_ENST00000342854.5_Missense_Mutation_p.A322V|TCF7_ENST00000378564.1_Missense_Mutation_p.A322V|TCF7_ENST00000518915.1_Missense_Mutation_p.A207V|TCF7_ENST00000321603.6_Missense_Mutation_p.A322V			P36402	TCF7_HUMAN	transcription factor 7 (T-cell specific, HMG-box)	322					alpha-beta T cell differentiation (GO:0046632)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cellular response to interleukin-4 (GO:0071353)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|generation of neurons (GO:0048699)|immune response (GO:0006955)|neural tube development (GO:0021915)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|T cell receptor V(D)J recombination (GO:0033153)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.A322V(2)		kidney(2)|large_intestine(7)|lung(2)|skin(1)	12		Breast(839;0.058)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TATGAGCTGGCCCGCAAGGAG	0.632																																					p.A322V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C965T	5						.						33.0	31.0	32.0					5																	133478730		2203	4300	6503	133506629	SO:0001583	missense	6932	exon8			Z47362	CCDS4169.1, CCDS4170.1, CCDS43362.1, CCDS47263.1, CCDS47263.2	5q31	2008-02-05			ENSG00000081059	ENSG00000081059			11639	protein-coding gene	gene with protein product		189908					Standard	NM_003202		Approved	TCF-1	uc003kyt.3	P36402	OTTHUMG00000129124	ENST00000321584.4:c.965C>T	5.37:g.133478730C>T	ENSP00000326540:p.Ala322Val	Somatic		Capture	SOLID	Phase_I	133506629	NM_003202	B3KSH3|Q86WR9|Q9UKI4	Missense_Mutation	SNP	ENST00000321584.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.741071|5.741071	0.96873|0.96873	.|.	.|.	ENSG00000081059|ENSG00000081059	ENST00000342854;ENST00000361590;ENST00000321603;ENST00000321584;ENST00000378564;ENST00000395029;ENST00000378560;ENST00000432532;ENST00000520958;ENST00000518915;ENST00000395023;ENST00000517799|ENST00000520699	D;D;D;D;D;D;D;D;D;D;D|.	0.98732|.	-5.1;-5.1;-5.1;-5.1;-5.1;-5.1;-5.1;-5.1;-5.1;-5.1;-5.1|.	5.69|5.69	5.69|5.69	0.88448|0.88448	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.90865|0.90865	0.7130|0.7130	H|H	0.98155|0.98155	4.16|4.16	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	1.0;0.996;1.0;0.997;1.0;0.998|.	D;D;D;D;D;D|.	0.91635|.	0.999;0.99;0.999;0.948;0.998;0.994|.	D|D	0.93759|0.93759	0.7065|0.7065	10|5	0.87932|.	D|.	0|.	.|.	19.8047|19.8047	0.96525|0.96525	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	136;322;322;120;322;322|.	B3KSI6;P36402-9;B7WNT5;B3KQ75;P36402;P36402-5|.	.;.;.;.;TCF7_HUMAN;.|.	V|S	322;322;322;322;322;322;207;207;207;207;207;100|47	ENSP00000340347:A322V;ENSP00000326654:A322V;ENSP00000326540:A322V;ENSP00000367827:A322V;ENSP00000378472:A322V;ENSP00000367822:A207V;ENSP00000397946:A207V;ENSP00000429547:A207V;ENSP00000430179:A207V;ENSP00000378469:A207V;ENSP00000427968:A100V|.	ENSP00000326540:A322V|.	A|P	+|+	2|1	0|0	TCF7|TCF7	133506629|133506629	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	7.818000|7.818000	0.86416|0.86416	2.692000|2.692000	0.91855|0.91855	0.563000|0.563000	0.77884|0.77884	GCC|CCC		TCF7-201	KNOWN	basic	protein_coding	protein_coding		NM_201634	
POU4F3	5459	hgsc.bcm.edu	37	5	145719605	145719605	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr5:145719605G>T	ENST00000230732.4	+	2	704	c.615G>T	c.(613-615)caG>caT	p.Q205H	CTC-359M8.1_ENST00000515598.1_RNA	NM_002700.2	NP_002691.1	Q15319	PO4F3_HUMAN	POU class 4 homeobox 3	205	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				auditory receptor cell differentiation (GO:0042491)|axon extension (GO:0048675)|inner ear morphogenesis (GO:0042472)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q205H(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGGTGACCCAGGCGGACGTGG	0.652																																					p.Q205H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G615T	5						.						39.0	43.0	42.0					5																	145719605		2203	4300	6503	145699798	SO:0001583	missense	5459	exon2			U10060	CCDS4281.1	5q32	2011-06-20	2007-07-13		ENSG00000091010	ENSG00000091010		"""Homeoboxes / POU class"""	9220	protein-coding gene	gene with protein product		602460	"""POU domain class 4, transcription factor 3"""	DFNA15		9506947	Standard	NM_002700		Approved	BRN3C	uc003loa.2	Q15319	OTTHUMG00000129684	ENST00000230732.4:c.615G>T	5.37:g.145719605G>T	ENSP00000230732:p.Gln205His	Somatic		Capture	SOLID	Phase_I	145699798	NM_002700	O60557|Q2M3F8	Missense_Mutation	SNP	ENST00000230732.4	37	CCDS4281.1	.	.	.	.	.	.	.	.	.	.	G	15.61	2.884052	0.51908	.	.	ENSG00000091010	ENST00000230732	D	0.88201	-2.35	4.51	2.58	0.30949	POU-specific (4);Lambda repressor-like, DNA-binding (2);POU (1);	0.000000	0.85682	D	0.000000	D	0.93510	0.7929	M	0.89214	3.015	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91065	0.4888	10	0.87932	D	0	.	4.6223	0.12461	0.2184:0.183:0.5987:0.0	.	205	Q15319	PO4F3_HUMAN	H	205	ENSP00000230732:Q205H	ENSP00000230732:Q205H	Q	+	3	2	POU4F3	145699798	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.524000	0.73791	0.442000	0.26555	0.462000	0.41574	CAG		POU4F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251887.2	NM_002700	
NMUR2	56923	hgsc.bcm.edu	37	5	151784215	151784215	+	Missense_Mutation	SNP	C	C	T	rs377153615		TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr5:151784215C>T	ENST00000255262.3	-	1	625	c.460G>A	c.(460-462)Gcc>Acc	p.A154T	NMUR2_ENST00000518933.1_Intron	NM_020167.4	NP_064552.3	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	154					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|arachidonic acid secretion (GO:0050482)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell-cell signaling (GO:0007267)|central nervous system development (GO:0007417)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|feeding behavior (GO:0007631)|grooming behavior (GO:0007625)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|reduction of food intake in response to dietary excess (GO:0002023)|regulation of smooth muscle contraction (GO:0006940)|response to pain (GO:0048265)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|GTP binding (GO:0005525)|intracellular calcium activated chloride channel activity (GO:0005229)|neuromedin U binding (GO:0042924)|neuromedin U receptor activity (GO:0001607)	p.A154T(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(12)|liver(1)|lung(15)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	44		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			TGCAGTTTGGCGCGGAACGGG	0.637																																					p.A154T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G460A	5						.	C	THR/ALA	0,4406		0,0,2203	46.0	52.0	50.0		460	5.3	0.9	5		50	1,8599	1.2+/-3.3	0,1,4299	no	missense	NMUR2	NM_020167.4	58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	154/416	151784215	1,13005	2203	4300	6503	151764408	SO:0001583	missense	56923	exon1			AF242874	CCDS4321.1	5q33.1	2012-08-08		2004-05-28	ENSG00000132911	ENSG00000132911		"""GPCR / Class A : Neuromedin U receptors"""	16454	protein-coding gene	gene with protein product		605108		NMU2R		8940772, 10894543	Standard	NM_020167		Approved		uc003luv.2	Q9GZQ4	OTTHUMG00000130131	ENST00000255262.3:c.460G>A	5.37:g.151784215C>T	ENSP00000255262:p.Ala154Thr	Somatic		Capture	SOLID	Phase_I	151764408	NM_020167	Q7LC54|Q96AM5|Q9NRA6	Missense_Mutation	SNP	ENST00000255262.3	37	CCDS4321.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.365243	0.82463	0.0	1.16E-4	ENSG00000132911	ENST00000255262	T	0.38077	1.16	5.35	5.35	0.76521	GPCR, rhodopsin-like superfamily (1);	0.074714	0.56097	D	0.000035	T	0.57154	0.2034	L	0.59912	1.85	0.58432	D	0.999999	D	0.89917	1.0	D	0.78314	0.991	T	0.52616	-0.8552	10	0.37606	T	0.19	-27.6655	18.0632	0.89383	0.0:1.0:0.0:0.0	.	154	Q9GZQ4	NMUR2_HUMAN	T	154	ENSP00000255262:A154T	ENSP00000255262:A154T	A	-	1	0	NMUR2	151764408	1.000000	0.71417	0.950000	0.38849	0.287000	0.27160	4.679000	0.61649	2.502000	0.84385	0.591000	0.81541	GCC		NMUR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252439.1	NM_020167	
ERGIC1	57222	hgsc.bcm.edu	37	5	172341769	172341769	+	Silent	SNP	C	C	T	rs368325900		TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr5:172341769C>T	ENST00000393784.3	+	5	442	c.303C>T	c.(301-303)atC>atT	p.I101I	ERGIC1_ENST00000523291.1_Silent_p.I101I|ERGIC1_ENST00000326654.2_Silent_p.I56I	NM_001031711.2	NP_001026881.1	Q969X5	ERGI1_HUMAN	endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1	101					ER to Golgi vesicle-mediated transport (GO:0006888)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.I101I(1)		endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(2)	9	Renal(175;0.000159)|Lung NSC(126;0.00344)|all_lung(126;0.00594)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TGGGCCACATCGACAACTCCA	0.572																																					p.I101I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C303T	5						.	C		0,4406		0,0,2203	66.0	64.0	64.0		303	-3.2	0.9	5		64	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ERGIC1	NM_001031711.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		101/291	172341769	1,13005	2203	4300	6503	172274375	SO:0001819	synonymous_variant	57222	exon5			AF267855	CCDS34292.1	5q35.1	2009-11-06			ENSG00000113719	ENSG00000113719			29205	protein-coding gene	gene with protein product						10574461, 15308636	Standard	NM_001031711		Approved	ERGIC32, ERGIC-32, KIAA1181, NET24	uc003mbw.4	Q969X5	OTTHUMG00000130520	ENST00000393784.3:c.303C>T	5.37:g.172341769C>T		Somatic		Capture	SOLID	Phase_I	172274375	NM_001031711	Q9H0L0|Q9H2J2|Q9ULN9	Silent	SNP	ENST00000393784.3	37	CCDS34292.1	.	.	.	.	.	.	.	.	.	.	C	9.666	1.145508	0.21288	0.0	1.16E-4	ENSG00000113719	ENST00000519567	.	.	.	5.37	-3.15	0.05233	.	.	.	.	.	T	0.62816	0.2459	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60000	-0.7348	4	.	.	.	-27.766	13.3474	0.60582	0.0:0.4133:0.0:0.5867	.	.	.	.	L	90	.	.	S	+	2	0	ERGIC1	172274375	0.001000	0.12720	0.933000	0.37362	0.921000	0.55340	-1.868000	0.01644	-0.844000	0.04184	-1.736000	0.00690	TCG		ERGIC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252938.3	NM_020462	
ADAMTS2	9509	hgsc.bcm.edu	37	5	178579248	178579248	+	Silent	SNP	G	G	A			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr5:178579248G>A	ENST00000251582.7	-	10	1625	c.1524C>T	c.(1522-1524)acC>acT	p.T508T	ADAMTS2_ENST00000274609.5_Silent_p.T508T	NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	508	Disintegrin.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.T508T(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		AGGGGTCAAAGGTCCGGAACT	0.612																																					p.T508T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1524T	5						.						71.0	61.0	64.0					5																	178579248		2203	4300	6503	178511854	SO:0001819	synonymous_variant	9509	exon10			AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.1524C>T	5.37:g.178579248G>A		Somatic		Capture	SOLID	Phase_I	178511854	NM_021599		Silent	SNP	ENST00000251582.7	37	CCDS4444.1																																																																																				ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244	
IRX1	79192	hgsc.bcm.edu	37	5	3600194	3600194	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr5:3600194G>A	ENST00000302006.3	+	2	1184	c.1132G>A	c.(1132-1134)Gca>Aca	p.A378T	CTD-2012M11.3_ENST00000559410.1_RNA	NM_024337.3	NP_077313.3	P78414	IRX1_HUMAN	iroquois homeobox 1	378					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.A378T(1)		biliary_tract(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|pancreas(1)|prostate(5)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						GACCAACAGCGCATTCCTCGC	0.687																																					p.A378T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1132A	5						.						49.0	41.0	43.0					5																	3600194		2201	4300	6501	3653194	SO:0001583	missense	79192	exon2			U90307	CCDS34132.1	5p15.33	2011-12-16	2007-07-13		ENSG00000170549	ENSG00000170549		"""Homeoboxes / TALE class"""	14358	protein-coding gene	gene with protein product		606197					Standard	NM_024337		Approved	IRX-5	uc003jde.3	P78414	OTTHUMG00000161632	ENST00000302006.3:c.1132G>A	5.37:g.3600194G>A	ENSP00000305244:p.Ala378Thr	Somatic		Capture	SOLID	Phase_I	3653194	NM_024337	Q7Z2F8|Q8N312	Missense_Mutation	SNP	ENST00000302006.3	37	CCDS34132.1	.	.	.	.	.	.	.	.	.	.	G	15.65	2.895790	0.52121	.	.	ENSG00000170549	ENST00000302006	T	0.64438	-0.1	4.3	4.3	0.51218	.	0.055128	0.64402	D	0.000001	T	0.77691	0.4168	M	0.70275	2.135	0.53688	D	0.999973	D	0.89917	1.0	D	0.83275	0.996	T	0.78568	-0.2154	10	0.40728	T	0.16	.	16.7647	0.85521	0.0:0.0:1.0:0.0	.	378	P78414	IRX1_HUMAN	T	378	ENSP00000305244:A378T	ENSP00000305244:A378T	A	+	1	0	IRX1	3653194	1.000000	0.71417	0.995000	0.50966	0.113000	0.19764	6.847000	0.75404	1.900000	0.55004	0.563000	0.77884	GCA		IRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365546.1	NM_024337	
PDZD2	23037	hgsc.bcm.edu	37	5	32074051	32074051	+	Missense_Mutation	SNP	G	G	A	rs384728	byFrequency	TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr5:32074051G>A	ENST00000438447.1	+	18	3227	c.2839G>A	c.(2839-2841)Gga>Aga	p.G947R	PDZD2_ENST00000282493.3_Missense_Mutation_p.G947R			O15018	PDZD2_HUMAN	PDZ domain containing 2	947					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.G947R(1)		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						CAGTCTCCCCGGAAGCCCACA	0.587																																					p.G947R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2839A	5						.						54.0	60.0	58.0					5																	32074051		2203	4300	6503	32109808	SO:0001583	missense	23037	exon17			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.2839G>A	5.37:g.32074051G>A	ENSP00000402033:p.Gly947Arg	Somatic		Capture	SOLID	Phase_I	32109808	NM_178140	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.266746	0.80358	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.09817	2.94;2.94	5.78	5.78	0.91487	.	0.000000	0.50627	D	0.000118	T	0.20373	0.0490	L	0.29908	0.895	0.39286	D	0.964657	D;D	0.89917	1.0;1.0	D;D	0.85130	0.95;0.997	T	0.01140	-1.1439	10	0.54805	T	0.06	.	10.8624	0.46833	0.0847:0.0:0.9153:0.0	.	773;947	B4E3P2;O15018	.;PDZD2_HUMAN	R	947;749;947	ENSP00000402033:G947R;ENSP00000282493:G947R	ENSP00000282493:G947R	G	+	1	0	PDZD2	32109808	1.000000	0.71417	0.994000	0.49952	0.867000	0.49689	3.961000	0.56759	2.724000	0.93272	0.563000	0.77884	GGA		PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
RASGEF1C	255426	hgsc.bcm.edu	37	5	179545655	179545655	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr5:179545655C>T	ENST00000393371.2	-	9	1333	c.1037G>A	c.(1036-1038)cGc>cAc	p.R346H	RASGEF1C_ENST00000361132.4_Missense_Mutation_p.R346H|RASGEF1C_ENST00000519883.1_5'Flank|RASGEF1C_ENST00000522500.1_Missense_Mutation_p.R195H			Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C	346	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.R346H(1)		breast(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	12	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGCCGCCCCGCGCAGGGCTGT	0.677																																					p.R346H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1037A	5						.						58.0	67.0	64.0					5																	179545655		2203	4300	6503	179478261	SO:0001583	missense	255426	exon10			AK093160	CCDS4452.1	5q35.3	2005-08-16			ENSG00000146090	ENSG00000146090			27400	protein-coding gene	gene with protein product						12477932	Standard	XM_006714839		Approved	FLJ35841	uc003mlr.3	Q8N431	OTTHUMG00000130914	ENST00000393371.2:c.1037G>A	5.37:g.179545655C>T	ENSP00000377037:p.Arg346His	Somatic		Capture	SOLID	Phase_I	179478261	NM_175062	D3DWQ7|Q7Z4T0|Q8NA49	Missense_Mutation	SNP	ENST00000393371.2	37	CCDS4452.1	.	.	.	.	.	.	.	.	.	.	C	17.55	3.417212	0.62622	.	.	ENSG00000146090	ENST00000361132;ENST00000393371;ENST00000522500	T;T;T	0.32272	1.46;1.46;1.46	4.18	4.18	0.49190	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.23688	0.0573	N	0.17082	0.46	0.58432	D	0.999997	P	0.47910	0.902	P	0.45406	0.479	T	0.03034	-1.1080	10	0.23302	T	0.38	.	15.9577	0.79898	0.0:1.0:0.0:0.0	.	346	Q8N431	RGF1C_HUMAN	H	346;346;195	ENSP00000354963:R346H;ENSP00000377037:R346H;ENSP00000429114:R195H	ENSP00000354963:R346H	R	-	2	0	RASGEF1C	179478261	1.000000	0.71417	0.889000	0.34880	0.149000	0.21700	6.952000	0.75989	2.268000	0.75426	0.313000	0.20887	CGC		RASGEF1C-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253506.2	NM_175062	
PSMB8	5696	hgsc.bcm.edu	37	6	32811701	32811701	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr6:32811701C>A	ENST00000374882.3	-	1	123	c.73G>T	c.(73-75)Ggg>Tgg	p.G25W	PSMB8_ENST00000374881.2_Intron|TAPSAR1_ENST00000453426.1_lincRNA|PSMB8_ENST00000395339.3_Missense_Mutation_p.G25W|PSMB9_ENST00000395330.1_5'Flank	NM_148919.3	NP_683720.2	P28062	PSB8_HUMAN	proteasome (prosome, macropain) subunit, beta type, 8	25					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|fat cell differentiation (GO:0045444)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|spermatoproteasome complex (GO:1990111)	threonine-type endopeptidase activity (GO:0004298)	p.G25W(1)		NS(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(1)	11					Carfilzomib(DB08889)	GAGCGACGCCCGCTTCCCGCA	0.652																																					p.G25W	NSCLC(48;53 1172 10859 13624 22883)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G73T	6						.						77.0	101.0	92.0					6																	32811701		1509	2709	4218	32919679	SO:0001583	missense	5696	exon1				CCDS4756.1, CCDS4757.1	6p21.3	2013-03-27	2013-03-27		ENSG00000204264	ENSG00000204264		"""Proteasome (prosome, macropain) subunits"""	9545	protein-coding gene	gene with protein product		177046	"""proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional protease 7)"", ""large multifunctional peptidase 7"""	LMP7		1529427, 10329130	Standard	XM_005275000		Approved	RING10, D6S216E, PSMB5i, beta5i	uc003oce.3	P28062	OTTHUMG00000031285	ENST00000374882.3:c.73G>T	6.37:g.32811701C>A	ENSP00000364016:p.Gly25Trp	Somatic		Capture	SOLID	Phase_I	32919679	NM_148919	B0UZC0|Q29824|Q5JNW6|Q5QNR8|Q96J48	Missense_Mutation	SNP	ENST00000374882.3	37	CCDS4757.1	.	.	.	.	.	.	.	.	.	.	C	10.98	1.505307	0.26949	.	.	ENSG00000204264	ENST00000395339;ENST00000374882	T;T	0.38560	1.13;1.81	5.11	-8.9	0.00782	.	2.336620	0.01080	N	0.004965	T	0.23766	0.0575	L	0.29908	0.895	0.18873	N	0.999986	D;B	0.71674	0.998;0.004	P;B	0.61477	0.889;0.01	T	0.45366	-0.9266	10	0.33940	T	0.23	-0.0286	8.3141	0.32088	0.0905:0.5733:0.22:0.1163	.	25;25	B7Z6U7;P28062	.;PSB8_HUMAN	W	25	ENSP00000378748:G25W;ENSP00000364016:G25W	ENSP00000364016:G25W	G	-	1	0	PSMB8	32919679	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.183000	0.03079	-1.740000	0.01345	-1.292000	0.01352	GGG		PSMB8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076617.3	NM_148919	
GLP1R	2740	hgsc.bcm.edu	37	6	39034027	39034027	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr6:39034027G>A	ENST00000373256.4	+	5	500	c.457G>A	c.(457-459)Gca>Aca	p.A153T		NM_002062.3	NP_002053.3	P43220	GLP1R_HUMAN	glucagon-like peptide 1 receptor	153					activation of adenylate cyclase activity (GO:0007190)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|learning or memory (GO:0007611)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of heart contraction (GO:0008016)|regulation of insulin secretion (GO:0050796)|response to stress (GO:0006950)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucagon receptor activity (GO:0004967)|transmembrane signaling receptor activity (GO:0004888)	p.A153T(1)		breast(5)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	31					Exenatide(DB01276)|Glucagon recombinant(DB00040)|Liraglutide(DB06655)	GGTGGGCTACGCACTCTCCTT	0.622																																					p.A153T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G457A	6						.						178.0	131.0	147.0					6																	39034027		2203	4300	6503	39142005	SO:0001583	missense	2740	exon5				CCDS4839.1	6p21	2012-08-10			ENSG00000112164	ENSG00000112164		"""GPCR / Class B : Glucagon receptors"""	4324	protein-coding gene	gene with protein product		138032					Standard	NM_002062		Approved		uc003ooj.4	P43220	OTTHUMG00000014638	ENST00000373256.4:c.457G>A	6.37:g.39034027G>A	ENSP00000362353:p.Ala153Thr	Somatic		Capture	SOLID	Phase_I	39142005	NM_002062	Q2M229|Q99669	Missense_Mutation	SNP	ENST00000373256.4	37	CCDS4839.1	.	.	.	.	.	.	.	.	.	.	G	15.48	2.845353	0.51164	.	.	ENSG00000112164	ENST00000373256	T	0.37235	1.21	4.77	3.87	0.44632	GPCR, family 2-like (1);	0.335596	0.25377	N	0.031101	T	0.13670	0.0331	L	0.37850	1.14	0.35020	D	0.75779	B	0.13145	0.007	B	0.15870	0.014	T	0.03969	-1.0988	10	0.41790	T	0.15	.	10.5213	0.44920	0.0941:0.0:0.9059:0.0	.	153	P43220	GLP1R_HUMAN	T	153	ENSP00000362353:A153T	ENSP00000362353:A153T	A	+	1	0	GLP1R	39142005	0.972000	0.33761	0.817000	0.32601	0.746000	0.42486	2.825000	0.48096	0.944000	0.37579	0.650000	0.86243	GCA		GLP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040443.1		
OGFRL1	79627	hgsc.bcm.edu	37	6	72006484	72006484	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr6:72006484C>T	ENST00000370435.4	+	6	790	c.656C>T	c.(655-657)gCt>gTt	p.A219V	RP3-331H24.5_ENST00000602823.1_lincRNA|RP11-154D6.1_ENST00000586232.1_RNA|RP11-154D6.1_ENST00000586030.1_RNA|RP11-154D6.1_ENST00000423255.1_RNA|RP11-154D6.1_ENST00000591156.1_RNA|RP11-154D6.1_ENST00000587253.1_RNA|RP11-154D6.1_ENST00000432050.1_RNA|RP11-154D6.1_ENST00000588612.1_RNA|RP11-154D6.1_ENST00000412751.1_RNA	NM_024576.3	NP_078852.3	Q5TC84	OGRL1_HUMAN	opioid growth factor receptor-like 1	219						membrane (GO:0016020)	receptor activity (GO:0004872)	p.A219V(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|upper_aerodigestive_tract(1)	13						GTTGCTCGGGCTGTTAACTGG	0.388																																					p.A219V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C656T	6						.						60.0	67.0	64.0					6																	72006484		2201	4296	6497	72063205	SO:0001583	missense	79627	exon6				CCDS34482.1	6q13	2008-02-05			ENSG00000119900	ENSG00000119900			21378	protein-coding gene	gene with protein product							Standard	NM_024576		Approved	dJ331H24.1	uc003pfx.1	Q5TC84	OTTHUMG00000015000	ENST00000370435.4:c.656C>T	6.37:g.72006484C>T	ENSP00000359464:p.Ala219Val	Somatic		Capture	SOLID	Phase_I	72063205	NM_024576	Q2TAC1|Q8NEQ4|Q9H7B5	Missense_Mutation	SNP	ENST00000370435.4	37	CCDS34482.1	.	.	.	.	.	.	.	.	.	.	C	34	5.364874	0.95877	.	.	ENSG00000119900	ENST00000370435	T	0.52983	0.64	5.63	5.63	0.86233	Opioid growth factor receptor (OGFr) conserved domain (1);	0.000000	0.85682	D	0.000000	T	0.65637	0.2710	M	0.75615	2.305	0.80722	D	1	D	0.71674	0.998	D	0.74023	0.982	T	0.65598	-0.6129	10	0.56958	D	0.05	-15.7834	20.0429	0.97598	0.0:1.0:0.0:0.0	.	219	Q5TC84	OGRL1_HUMAN	V	219	ENSP00000359464:A219V	ENSP00000359464:A219V	A	+	2	0	OGFRL1	72063205	1.000000	0.71417	0.990000	0.47175	0.998000	0.95712	5.986000	0.70563	2.812000	0.96745	0.555000	0.69702	GCT		OGFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041153.2	NM_024576	
HTR1B	3351	hgsc.bcm.edu	37	6	78173018	78173018	+	Missense_Mutation	SNP	C	C	T	rs200659363		TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr6:78173018C>T	ENST00000369947.2	-	1	472	c.103G>A	c.(103-105)Gcc>Acc	p.A35T		NM_000863.1	NP_000854.1	P28222	5HT1B_HUMAN	5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled	35					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|bone remodeling (GO:0046849)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to temperature stimulus (GO:0071502)|drinking behavior (GO:0042756)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to mineralocorticoid (GO:0051385)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.A35T(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|prostate(2)|upper_aerodigestive_tract(2)	25		all_cancers(76;0.0867)|Acute lymphoblastic leukemia(125;0.00119)|all_hematologic(105;0.0332)		BRCA - Breast invasive adenocarcinoma(397;0.205)	Almotriptan(DB00918)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Clozapine(DB00363)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Methysergide(DB00247)|Naratriptan(DB00952)|Olanzapine(DB00334)|Ondansetron(DB00904)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Sumatriptan(DB00669)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	TAGTCCTTGGCGCTGCAGTTT	0.597																																					p.A35T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G103A	6						.						152.0	136.0	141.0					6																	78173018		2203	4300	6503	78229737	SO:0001583	missense	3351	exon1			BC069065	CCDS4986.1	6q13	2012-08-08	2012-02-03		ENSG00000135312	ENSG00000135312		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5287	protein-coding gene	gene with protein product		182131	"""5-hydroxytryptamine (serotonin) receptor 1B"""			1348246, 11247661	Standard	NM_000863		Approved	S12, 5-HT1B, HTR1D2, 5-HT1DB	uc003pil.1	P28222	OTTHUMG00000015066	ENST00000369947.2:c.103G>A	6.37:g.78173018C>T	ENSP00000358963:p.Ala35Thr	Somatic		Capture	SOLID	Phase_I	78229737	NM_000863	Q4VAY7	Missense_Mutation	SNP	ENST00000369947.2	37	CCDS4986.1	.	.	.	.	.	.	.	.	.	.	C	0.322	-0.961104	0.02249	.	.	ENSG00000135312	ENST00000369947	T	0.34859	1.34	4.6	-1.32	0.09201	.	1.768550	0.03522	N	0.221110	T	0.06050	0.0157	N	0.12182	0.205	0.09310	N	0.999993	B	0.10296	0.003	B	0.04013	0.001	T	0.18650	-1.0330	9	.	.	.	.	5.1226	0.14867	0.2111:0.5528:0.096:0.1401	.	35	P28222	5HT1B_HUMAN	T	35	ENSP00000358963:A35T	.	A	-	1	0	HTR1B	78229737	0.314000	0.24563	0.079000	0.20413	0.098000	0.18820	0.201000	0.17276	-0.338000	0.08413	-1.134000	0.01955	GCC		HTR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041292.1	NM_000863	
BACH2	60468	hgsc.bcm.edu	37	6	90660822	90660822	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr6:90660822C>T	ENST00000257749.4	-	7	1710	c.1003G>A	c.(1003-1005)Gtg>Atg	p.V335M	RP3-512E2.2_ENST00000445838.1_RNA|BACH2_ENST00000343122.3_Missense_Mutation_p.V335M|BACH2_ENST00000537989.1_Missense_Mutation_p.V335M|RP3-512E2.2_ENST00000413986.1_RNA	NM_021813.2	NP_068585.1	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 2	335						cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)	p.V335M(2)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	45		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		GGCGAGGCCACGCTCCTGGAT	0.637																																					p.V335M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1003A	6						.						38.0	42.0	41.0					6																	90660822		2203	4299	6502	90717543	SO:0001583	missense	60468	exon7			AL121787	CCDS5026.1	6q15	2013-01-10			ENSG00000112182	ENSG00000112182		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	14078	protein-coding gene	gene with protein product		605394				10949928, 12829606	Standard	NM_001170794		Approved	BTBD25	uc003pnw.3	Q9BYV9	OTTHUMG00000015216	ENST00000257749.4:c.1003G>A	6.37:g.90660822C>T	ENSP00000257749:p.Val335Met	Somatic		Capture	SOLID	Phase_I	90717543	NM_021813	E1P518|Q59H70|Q5T793|Q9NTS5	Missense_Mutation	SNP	ENST00000257749.4	37	CCDS5026.1	.	.	.	.	.	.	.	.	.	.	C	1.353	-0.590892	0.03799	.	.	ENSG00000112182	ENST00000257749;ENST00000537989;ENST00000343122	T;T;T	0.37752	1.18;1.18;1.18	5.03	1.14	0.20703	.	1.015500	0.07846	N	0.963896	T	0.06050	0.0157	N	0.14661	0.345	0.09310	N	1	P	0.41265	0.744	B	0.25140	0.058	T	0.18840	-1.0324	10	0.48119	T	0.1	-28.1707	7.0582	0.25111	0.0:0.5915:0.2622:0.1463	.	335	Q9BYV9	BACH2_HUMAN	M	335	ENSP00000257749:V335M;ENSP00000437473:V335M;ENSP00000345642:V335M	ENSP00000257749:V335M	V	-	1	0	BACH2	90717543	0.000000	0.05858	0.167000	0.22817	0.160000	0.22226	-0.424000	0.07025	0.292000	0.22492	-0.878000	0.02970	GTG		BACH2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041522.2	NM_021813	
ZNF703	80139	hgsc.bcm.edu	37	8	37556142	37556142	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr8:37556142G>A	ENST00000331569.4	+	2	1952	c.1723G>A	c.(1723-1725)Gcg>Acg	p.A575T		NM_025069.1	NP_079345.1	Q9H7S9	ZN703_HUMAN	zinc finger protein 703	575					adherens junction assembly (GO:0034333)|cellular response to estradiol stimulus (GO:0071392)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of homotypic cell-cell adhesion (GO:0034111)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|protein complex (GO:0043234)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.A575T(1)	FGFR1/ZNF703(2)	breast(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(1)|pancreas(1)	7			BRCA - Breast invasive adenocarcinoma(5;7.93e-25)|LUSC - Lung squamous cell carcinoma(8;1.05e-09)			TTCGCCATACGCGCTGTATGG	0.637																																					p.A575T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1723A	8						.						36.0	32.0	33.0					8																	37556142		2203	4300	6503	37675300	SO:0001583	missense	80139	exon2			AK024361	CCDS6094.1	8p12	2008-05-02				ENSG00000183779			25883	protein-coding gene	gene with protein product						15897872	Standard	NM_025069		Approved	FLJ14299, ZNF503L	uc003xjy.1	Q9H7S9		ENST00000331569.4:c.1723G>A	8.37:g.37556142G>A	ENSP00000332325:p.Ala575Thr	Somatic		Capture	SOLID	Phase_I	37675300	NM_025069	Q5XG76	Missense_Mutation	SNP	ENST00000331569.4	37	CCDS6094.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.119142	0.77323	.	.	ENSG00000183779	ENST00000331569;ENST00000397235	T	0.61859	0.07	3.22	3.22	0.36961	.	0.000000	0.85682	D	0.000000	T	0.73297	0.3569	M	0.72894	2.215	0.80722	D	1	D	0.76494	0.999	D	0.72625	0.978	T	0.78720	-0.2094	10	0.87932	D	0	-8.9695	15.0086	0.71533	0.0:0.0:1.0:0.0	.	575	Q9H7S9	ZN703_HUMAN	T	575;148	ENSP00000332325:A575T	ENSP00000332325:A575T	A	+	1	0	ZNF703	37675300	1.000000	0.71417	0.993000	0.49108	0.814000	0.46013	9.057000	0.93889	1.801000	0.52704	0.306000	0.20318	GCG		ZNF703-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376683.2	NM_025069	
SFRP1	6422	hgsc.bcm.edu	37	8	41122692	41122692	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr8:41122692A>C	ENST00000220772.3	-	3	1276	c.939T>G	c.(937-939)ttT>ttG	p.F313L	SFRP1_ENST00000379845.3_Missense_Mutation_p.F177L	NM_003012.4	NP_003003.3	Q8N474	SFRP1_HUMAN	secreted frizzled-related protein 1	313					bone trabecula formation (GO:0060346)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to BMP stimulus (GO:0071773)|cellular response to estradiol stimulus (GO:0071392)|cellular response to estrogen stimulus (GO:0071391)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to prostaglandin E stimulus (GO:0071380)|cellular response to starvation (GO:0009267)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vitamin D (GO:0071305)|cellular response to X-ray (GO:0071481)|convergent extension involved in somitogenesis (GO:0090246)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral axis specification (GO:0009950)|female gonad development (GO:0008585)|gonad development (GO:0008406)|hematopoietic progenitor cell differentiation (GO:0002244)|hematopoietic stem cell differentiation (GO:0060218)|male gonad development (GO:0008584)|menstrual cycle phase (GO:0022601)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of bone remodeling (GO:0046851)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of canonical Wnt signaling pathway involved in controlling type B pancreatic cell proliferation (GO:2000080)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of planar cell polarity pathway involved in axis elongation (GO:2000041)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|negative regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000054)|neural crest cell fate commitment (GO:0014034)|neural tube closure (GO:0001843)|osteoblast differentiation (GO:0001649)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|proteolysis (GO:0006508)|regulation of angiogenesis (GO:0045765)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell cycle process (GO:0010564)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|somatic stem cell maintenance (GO:0035019)|stromal-epithelial cell signaling involved in prostate gland development (GO:0044345)|ureteric bud development (GO:0001657)|vasculature development (GO:0001944)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cysteine-type endopeptidase activity (GO:0004197)|drug binding (GO:0008144)|frizzled binding (GO:0005109)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.F313L(1)		breast(1)|central_nervous_system(1)|large_intestine(2)|liver(1)|lung(1)|skin(1)	7	Breast(1;9.19e-13)|Ovarian(28;0.00769)|Colorectal(14;0.0305)|Lung SC(25;0.211)	all_lung(54;0.0034)|Lung NSC(58;0.0134)|Hepatocellular(245;0.023)|Esophageal squamous(32;0.0559)	BRCA - Breast invasive adenocarcinoma(1;1.11e-10)|LUSC - Lung squamous cell carcinoma(45;0.00894)|COAD - Colon adenocarcinoma(11;0.0174)			AGAATCACTTAAACACGGACT	0.577																																					p.F313L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T939G	8						.						29.0	24.0	26.0					8																	41122692		2202	4300	6502	41241849	SO:0001583	missense	6422	exon3			AF017987	CCDS34886.1	8p11.21	2006-12-15			ENSG00000104332	ENSG00000104332		"""Secreted frizzled-related proteins"""	10776	protein-coding gene	gene with protein product		604156				9391078, 9192640	Standard	NM_003012		Approved	SARP2, FRP, FRP-1	uc003xnt.3	Q8N474	OTTHUMG00000164074	ENST00000220772.3:c.939T>G	8.37:g.41122692A>C	ENSP00000220772:p.Phe313Leu	Somatic		Capture	SOLID	Phase_I	41241849	NM_003012	O00546|O14779	Missense_Mutation	SNP	ENST00000220772.3	37	CCDS34886.1	.	.	.	.	.	.	.	.	.	.	A	14.54	2.565993	0.45694	.	.	ENSG00000104332	ENST00000220772;ENST00000379845;ENST00000535263	T	0.68624	-0.34	4.89	-3.21	0.05140	.	0.188416	0.47455	D	0.000238	T	0.53045	0.1772	L	0.39898	1.24	0.48632	D	0.999685	B	0.24920	0.114	B	0.24974	0.057	T	0.40997	-0.9533	10	0.52906	T	0.07	.	13.0845	0.59132	0.3385:0.0:0.6615:0.0	.	313	Q8N474	SFRP1_HUMAN	L	313;177;313	ENSP00000220772:F313L	ENSP00000220772:F313L	F	-	3	2	SFRP1	41241849	1.000000	0.71417	0.975000	0.42487	0.038000	0.13279	1.065000	0.30592	-0.452000	0.07087	-0.371000	0.07208	TTT		SFRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377132.1	NM_003012	
SPAG1	6674	hgsc.bcm.edu	37	8	101252701	101252701	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr8:101252701A>C	ENST00000388798.2	+	18	2542	c.2351A>C	c.(2350-2352)aAg>aCg	p.K784T	SPAG1_ENST00000251809.3_Missense_Mutation_p.K784T	NM_003114.4	NP_003105.2	Q07617	SPAG1_HUMAN	sperm associated antigen 1	784					axonemal dynein complex assembly (GO:0070286)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	GTP binding (GO:0005525)|hydrolase activity (GO:0016787)	p.K784T(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	30	all_cancers(14;2.35e-05)|all_epithelial(15;5.2e-08)|Lung NSC(17;0.000283)|all_lung(17;0.000823)	Breast(495;0.195)	Epithelial(11;1.12e-09)|all cancers(13;1.26e-07)|OV - Ovarian serous cystadenocarcinoma(57;4.37e-05)|STAD - Stomach adenocarcinoma(118;0.0525)	KIRC - Kidney renal clear cell carcinoma(542;0.00178)|READ - Rectum adenocarcinoma(644;0.236)		GCTTCTGAGAAGGGAGGCAAA	0.468																																					p.K784T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2351C	8						.						76.0	83.0	80.0					8																	101252701		2203	4300	6503	101321877	SO:0001583	missense	6674	exon18			AF311312	CCDS34930.1	8q22	2014-01-21			ENSG00000104450	ENSG00000104450		"""Tetratricopeptide (TTC) repeat domain containing"""	11212	protein-coding gene	gene with protein product		603395				16368546	Standard	NM_172218		Approved	SP75, FLJ32920, HSD-3.8, TPIS, CT140	uc003yjh.2	Q07617	OTTHUMG00000164706	ENST00000388798.2:c.2351A>C	8.37:g.101252701A>C	ENSP00000373450:p.Lys784Thr	Somatic		Capture	SOLID	Phase_I	101321877	NM_003114	A6NP70|B3KQ58|G3XAM3|Q7Z5G1	Missense_Mutation	SNP	ENST00000388798.2	37	CCDS34930.1	.	.	.	.	.	.	.	.	.	.	A	14.05	2.421095	0.42918	.	.	ENSG00000104450	ENST00000251809;ENST00000388798	T;T	0.61859	0.07;0.07	5.79	3.34	0.38264	.	2.721960	0.00567	N	0.000284	T	0.57725	0.2073	L	0.56769	1.78	0.09310	N	1	B	0.18863	0.031	B	0.14023	0.01	T	0.38045	-0.9679	10	0.52906	T	0.07	-1.2471	7.8503	0.29451	0.6699:0.2618:0.0683:0.0	.	784	Q07617	SPAG1_HUMAN	T	784	ENSP00000251809:K784T;ENSP00000373450:K784T	ENSP00000251809:K784T	K	+	2	0	SPAG1	101321877	0.001000	0.12720	0.001000	0.08648	0.180000	0.23129	0.749000	0.26320	0.424000	0.26061	0.459000	0.35465	AAG		SPAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379853.2	NM_172218	
TGFBR1	7046	hgsc.bcm.edu	37	9	101891312	101891312	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr9:101891312A>C	ENST00000374994.4	+	2	390	c.273A>C	c.(271-273)aaA>aaC	p.K91N	TGFBR1_ENST00000550253.1_Missense_Mutation_p.K22N|TGFBR1_ENST00000552516.1_Missense_Mutation_p.K91N|TGFBR1_ENST00000374990.2_Missense_Mutation_p.K91N	NM_004612.2	NP_004603.1	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor 1	91					activation of MAPKK activity (GO:0000186)|angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|artery morphogenesis (GO:0048844)|blastocyst development (GO:0001824)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen fibril organization (GO:0030199)|embryonic cranial skeleton morphogenesis (GO:0048701)|endothelial cell migration (GO:0043542)|epithelial to mesenchymal transition (GO:0001837)|extracellular structure organization (GO:0043062)|germ cell migration (GO:0008354)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mesenchymal cell differentiation (GO:0048762)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|parathyroid gland development (GO:0060017)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of protein binding (GO:0043393)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|response to cholesterol (GO:0070723)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	endosome (GO:0005768)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)	p.K91N(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	27		Acute lymphoblastic leukemia(62;0.0559)				CCTCTTCAAAAACTGGGTCTG	0.373																																					p.K91N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A273C	9						.						102.0	87.0	92.0					9																	101891312		2203	4300	6503	100931133	SO:0001583	missense	7046	exon2				CCDS6738.1, CCDS47998.1	9q22	2014-01-30	2008-07-31		ENSG00000106799	ENSG00000106799			11772	protein-coding gene	gene with protein product	"""activin A receptor type II-like kinase, 53kDa"""	190181	"""transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kD)"", ""multiple self-healing squamous epithelioma"""	MSSE, ESS1		1319842, 8530052, 21358634	Standard	NM_001130916		Approved	ALK-5, ACVRLK4	uc004azc.3	P36897	OTTHUMG00000020353	ENST00000374994.4:c.273A>C	9.37:g.101891312A>C	ENSP00000364133:p.Lys91Asn	Somatic		Capture	SOLID	Phase_I	100931133	NM_004612	Q6IR47|Q706C0|Q706C1	Missense_Mutation	SNP	ENST00000374994.4	37	CCDS6738.1	.	.	.	.	.	.	.	.	.	.	A	8.848	0.943914	0.18281	.	.	ENSG00000106799	ENST00000547314;ENST00000552573;ENST00000374994;ENST00000540092;ENST00000374990;ENST00000552516;ENST00000549021;ENST00000548365;ENST00000550253;ENST00000546584	T;T;T;T;T;T;T;T;T	0.71817	-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6	6.08	3.77	0.43336	TGF-beta receptor/activin receptor, type I/II (1);	0.259853	0.43919	D	0.000508	T	0.42787	0.1218	N	0.05078	-0.115	0.33289	D	0.563314	B;B;B	0.18968	0.006;0.032;0.0	B;B;B	0.19391	0.009;0.025;0.009	T	0.40924	-0.9537	10	0.16896	T	0.51	.	4.9788	0.14155	0.7121:0.0:0.15:0.1379	.	22;91;91	F8VRH6;P36897-3;P36897	.;.;TGFR1_HUMAN	N	22;22;91;91;91;91;22;22;22;88	ENSP00000449934:K22N;ENSP00000447182:K22N;ENSP00000364133:K91N;ENSP00000364129:K91N;ENSP00000447297:K91N;ENSP00000449028:K22N;ENSP00000448518:K22N;ENSP00000450052:K22N;ENSP00000447707:K88N	ENSP00000364129:K91N	K	+	3	2	TGFBR1	100931133	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	1.595000	0.36708	1.117000	0.41842	0.482000	0.46254	AAA		TGFBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053390.3		
ZNF462	58499	hgsc.bcm.edu	37	9	109689973	109689973	+	Silent	SNP	G	G	A			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr9:109689973G>A	ENST00000277225.5	+	3	4069	c.3780G>A	c.(3778-3780)acG>acA	p.T1260T	ZNF462_ENST00000441147.2_Silent_p.T105T|ZNF462_ENST00000457913.1_Silent_p.T1260T			Q96JM2	ZN462_HUMAN	zinc finger protein 462	1260					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T1260T(1)		NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						GGGACAAAACGAAACTCCGAG	0.542																																					p.T1260T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3780A	9						.						154.0	162.0	159.0					9																	109689973		2203	4300	6503	108729794	SO:0001819	synonymous_variant	58499	exon3			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.3780G>A	9.37:g.109689973G>A		Somatic		Capture	SOLID	Phase_I	108729794	NM_021224	Q5T0T4|Q8N408	Silent	SNP	ENST00000277225.5	37	CCDS35096.1																																																																																				ZNF462-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053532.2	NM_021224	
TRPM3	80036	hgsc.bcm.edu	37	9	73399089	73399089	+	Silent	SNP	A	A	G			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr9:73399089A>G	ENST00000377111.2	-	7	1323	c.1080T>C	c.(1078-1080)gtT>gtC	p.V360V	TRPM3_ENST00000408909.2_Silent_p.V207V|TRPM3_ENST00000358082.3_Silent_p.V232V|TRPM3_ENST00000396280.5_Silent_p.V207V|TRPM3_ENST00000357533.2_Silent_p.V362V|TRPM3_ENST00000361823.5_Silent_p.V207V|TRPM3_ENST00000396285.1_Silent_p.V207V|TRPM3_ENST00000377110.3_Silent_p.V360V|TRPM3_ENST00000377106.1_Silent_p.V232V|TRPM3_ENST00000423814.3_Silent_p.V387V|TRPM3_ENST00000360823.2_Silent_p.V232V|TRPM3_ENST00000396292.4_Silent_p.V232V|TRPM3_ENST00000377105.1_Silent_p.V207V|TRPM3_ENST00000377101.1_Silent_p.V207V|TRPM3_ENST00000396283.1_Silent_p.V232V	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	385					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)	p.V232V(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						CATCACAGACAACCACTGGCA	0.542																																					p.V360V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1080C	9						.						116.0	99.0	105.0					9																	73399089		2203	4300	6503	72588909	SO:0001819	synonymous_variant	80036	exon7			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.1080T>C	9.37:g.73399089A>G		Somatic		Capture	SOLID	Phase_I	72588909	NM_001007471	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Silent	SNP	ENST00000377111.2	37		.	.	.	.	.	.	.	.	.	.	A	11.34	1.608701	0.28623	.	.	ENSG00000083067	ENST00000396280	.	.	.	6.17	-2.39	0.06602	.	.	.	.	.	T	0.50701	0.1631	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44847	-0.9301	4	.	.	.	-14.888	6.9792	0.24694	0.1931:0.5885:0.1311:0.0872	.	.	.	.	R	207	.	.	C	-	1	0	TRPM3	72588909	0.999000	0.42202	0.963000	0.40424	0.982000	0.71751	0.819000	0.27308	-0.291000	0.09012	0.533000	0.62120	TGT		TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945	
STXBP1	6812	hgsc.bcm.edu	37	9	130446647	130446647	+	Intron	SNP	G	G	T			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chr9:130446647G>T	ENST00000373299.1	+	18	1817				STXBP1_ENST00000373302.3_Splice_Site_p.G568V|STXBP1_ENST00000481942.1_Intron	NM_001032221.3	NP_001027392.1	P61764	STXB1_HUMAN	syntaxin binding protein 1						axon target recognition (GO:0007412)|energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long term synaptic depression (GO:0060292)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|protein stabilization (GO:0050821)|protein transport (GO:0015031)|regulation of insulin secretion (GO:0050796)|regulation of SNARE complex assembly (GO:0035542)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|regulation of synaptic vesicle priming (GO:0010807)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|protein complex (GO:0043234)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|SNARE binding (GO:0000149)|syntaxin binding (GO:0019905)|syntaxin-1 binding (GO:0017075)	p.G568V(1)		breast(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|skin(2)	23						TCTCCCACAGGTTCTACTCAC	0.483																																					p.G568V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1703T	9						.						111.0	97.0	101.0					9																	130446647		2203	4300	6503	129486468	SO:0001627	intron_variant	6812	exon19			AF004563	CCDS6874.1, CCDS35146.1	9q34.1	2008-07-21			ENSG00000136854	ENSG00000136854			11444	protein-coding gene	gene with protein product	"""syntaxin-binding protein 1"""	602926				9545644	Standard	NM_001032221		Approved	hUNC18, MUNC18-1, UNC18, rbSec1	uc004brk.2	P61764	OTTHUMG00000020713	ENST00000373299.1:c.1702+1808G>T	9.37:g.130446647G>T		Somatic		Capture	SOLID	Phase_I	129486468	NM_003165	B1AM97|Q28208|Q62759|Q64320|Q96TG8	Missense_Mutation	SNP	ENST00000373299.1	37	CCDS35146.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.477151	0.84640	.	.	ENSG00000136854	ENST00000535154;ENST00000373302;ENST00000541198	D	0.83506	-1.73	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.92838	0.7722	M	0.91406	3.205	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.94089	0.7351	9	.	.	.	.	16.3897	0.83531	0.0:0.0:1.0:0.0	.	568	P61764-2	.	V	522;568;400	ENSP00000362399:G568V	.	G	+	2	0	STXBP1	129486468	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.439000	0.97543	2.473000	0.83533	0.561000	0.74099	GGT		STXBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054229.1	NM_003165	
PPEF1	5475	hgsc.bcm.edu	37	X	18767935	18767935	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chrX:18767935C>A	ENST00000361511.4	+	7	755	c.261C>A	c.(259-261)agC>agA	p.S87R	PPEF1_ENST00000349874.5_Missense_Mutation_p.S87R|PPEF1_ENST00000471570.1_3'UTR|PPEF1_ENST00000359763.6_Intron|PPEF1_ENST00000543630.1_Missense_Mutation_p.S87R|PPEF1_ENST00000544635.1_Missense_Mutation_p.S22R	NM_006240.2|NM_152224.1	NP_006231.2|NP_689410.1	O14829	PPE1_HUMAN	protein phosphatase, EF-hand calcium binding domain 1	87					detection of stimulus involved in sensory perception (GO:0050906)|phototransduction, visible light (GO:0007603)|protein dephosphorylation (GO:0006470)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)	p.S87R(1)		breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	43	Hepatocellular(33;0.183)					CTCTTGAAAGCGAACAGGACA	0.438																																					p.S87R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C261A	X						.						121.0	101.0	107.0					X																	18767935		2203	4300	6503	18677856	SO:0001583	missense	5475	exon7			BC036026	CCDS14188.1, CCDS43920.1	Xp22	2013-01-10			ENSG00000086717	ENSG00000086717		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9243	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, alpha isozyme"""	300109		PPEF		9215685, 9326663	Standard	NM_152224		Approved	PPP7CA	uc004cyq.3	O14829	OTTHUMG00000021219	ENST00000361511.4:c.261C>A	X.37:g.18767935C>A	ENSP00000354871:p.Ser87Arg	Somatic		Capture	SOLID	Phase_I	18677856	NM_152226	A6NHP4|A8K348|O15253|Q9NU21|Q9UJH0	Missense_Mutation	SNP	ENST00000361511.4	37	CCDS14188.1	.	.	.	.	.	.	.	.	.	.	C	8.429	0.848199	0.17034	.	.	ENSG00000086717	ENST00000361511;ENST00000349874;ENST00000543630;ENST00000544635	T;T;T;T	0.23147	3.24;3.1;1.92;3.26	3.72	0.984	0.19773	.	1.520740	0.03926	N	0.284486	T	0.34542	0.0901	L	0.41824	1.3	0.09310	N	1	D;D;D	0.69078	0.997;0.978;0.966	P;P;P	0.61328	0.887;0.825;0.559	T	0.25710	-1.0124	10	0.18710	T	0.47	0.1075	5.3118	0.15835	0.0:0.5993:0.0:0.4006	.	87;87;87	O14829-5;O14829;O14829-3	.;PPE1_HUMAN;.	R	87;87;87;22	ENSP00000354871:S87R;ENSP00000341892:S87R;ENSP00000437785:S87R;ENSP00000441289:S22R	ENSP00000341892:S87R	S	+	3	2	PPEF1	18677856	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.797000	0.04570	0.079000	0.16929	-0.312000	0.09012	AGC		PPEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055953.3	NM_006240	
CXorf22	170063	hgsc.bcm.edu	37	X	35984744	35984744	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3598-01A-01W-0833-10	TCGA-AG-3598-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	7f987d01-01ba-4ec9-a775-bef2f1aaddfd	726a5de6-6979-4171-88dd-83f4bdf7fc3c	g.chrX:35984744G>C	ENST00000297866.5	+	9	1539	c.1473G>C	c.(1471-1473)gaG>gaC	p.E491D		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	491								p.E491D(2)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						AGATGATAGAGATTATTGGTT	0.338																																					p.E491D												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1473C	X						.						112.0	105.0	108.0					X																	35984744		2202	4300	6502	35894665	SO:0001583	missense	170063	exon9			BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.1473G>C	X.37:g.35984744G>C	ENSP00000297866:p.Glu491Asp	Somatic		Capture	SOLID	Phase_I	35894665	NM_152632	Q5JRM8|Q8N6X8	Missense_Mutation	SNP	ENST00000297866.5	37	CCDS14237.2	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.347324	0.00219	.	.	ENSG00000165164	ENST00000297866	T	0.13196	2.61	5.55	-5.01	0.02991	.	0.159507	0.53938	N	0.000054	T	0.04998	0.0134	L	0.34521	1.04	0.09310	N	1	B	0.09022	0.002	B	0.11329	0.006	T	0.44559	-0.9320	10	0.02654	T	1	-11.994	1.3189	0.02112	0.4105:0.0953:0.1727:0.3215	.	491	Q6ZTR5	CX022_HUMAN	D	491	ENSP00000297866:E491D	ENSP00000297866:E491D	E	+	3	2	CXorf22	35894665	0.517000	0.26226	0.001000	0.08648	0.001000	0.01503	-0.169000	0.09911	-1.054000	0.03214	-0.928000	0.02712	GAG		CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632	
