#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
DKK1	22943	hgsc.bcm.edu	37	10	54076332	54076332	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr10:54076332G>C	ENST00000373970.3	+	4	705	c.566G>C	c.(565-567)tGt>tCt	p.C189S	PRKG1-AS1_ENST00000420193.1_RNA	NM_012242.2	NP_036374.1	O94907	DKK1_HUMAN	dickkopf WNT signaling pathway inhibitor 1	189	DKK-type Cys-2.				cell morphogenesis involved in differentiation (GO:0000904)|embryonic limb morphogenesis (GO:0030326)|endoderm formation (GO:0001706)|extracellular negative regulation of signal transduction (GO:1900116)|face morphogenesis (GO:0060325)|forebrain development (GO:0030900)|hair follicle development (GO:0001942)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:1901296)|negative regulation of cardiac muscle cell differentiation (GO:2000726)|negative regulation of mesodermal cell fate specification (GO:0042662)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of heart induction by negative regulation of canonical Wnt signaling pathway (GO:0090082)|regulation of endodermal cell fate specification (GO:0042663)|regulation of receptor internalization (GO:0002090)|response to retinoic acid (GO:0032526)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)	growth factor activity (GO:0008083)|low-density lipoprotein particle receptor binding (GO:0050750)|receptor antagonist activity (GO:0048019)|signal transducer activity (GO:0004871)	p.C189S(1)		kidney(2)|large_intestine(4)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	16						GGTTCTGTTTGTCTCCGGTCA	0.418																																					p.C189S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G566C	10						.						129.0	119.0	122.0					10																	54076332		2203	4300	6503	53746338	SO:0001583	missense	22943	exon4				CCDS7246.1	10q11.2	2013-05-15	2013-05-15		ENSG00000107984	ENSG00000107984			2891	protein-coding gene	gene with protein product		605189	"""dickkopf (Xenopus laevis) homolog 1"", ""dickkopf 1 homolog (Xenopus laevis)"""				Standard	NM_012242		Approved	SK, DKK-1	uc001jjr.3	O94907	OTTHUMG00000018247	ENST00000373970.3:c.566G>C	10.37:g.54076332G>C	ENSP00000363081:p.Cys189Ser	Somatic		Capture	SOLID	Phase_I	53746338	NM_012242	B2RC19	Missense_Mutation	SNP	ENST00000373970.3	37	CCDS7246.1	.	.	.	.	.	.	.	.	.	.	G	17.58	3.424716	0.62733	.	.	ENSG00000107984	ENST00000373970	T	0.80824	-1.42	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.90594	0.7051	M	0.80183	2.485	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.91013	0.4851	10	0.87932	D	0	-1.9238	19.688	0.95987	0.0:0.0:1.0:0.0	.	189	O94907	DKK1_HUMAN	S	189	ENSP00000363081:C189S	ENSP00000363081:C189S	C	+	2	0	DKK1	53746338	1.000000	0.71417	1.000000	0.80357	0.288000	0.27193	9.476000	0.97823	2.756000	0.94617	0.561000	0.74099	TGT		DKK1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048100.1		
UNC5B	219699	hgsc.bcm.edu	37	10	73057801	73057801	+	Missense_Mutation	SNP	C	C	T	rs533188246		TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr10:73057801C>T	ENST00000335350.6	+	16	3042	c.2626C>T	c.(2626-2628)Cgg>Tgg	p.R876W	UNC5B_ENST00000373192.4_Missense_Mutation_p.R865W	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	876	Death.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)		p.R876W(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						CCCCAACTCACGGGGCAATGA	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		23320	0.0		0.0	False		,,,				2504	0.001				p.R876W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2626T	10						.						117.0	87.0	97.0					10																	73057801		2203	4300	6503	72727807	SO:0001583	missense	219699	exon16			AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.2626C>T	10.37:g.73057801C>T	ENSP00000334329:p.Arg876Trp	Somatic		Capture	SOLID	Phase_I	72727807	NM_170744	Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Missense_Mutation	SNP	ENST00000335350.6	37	CCDS7309.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.301950	0.81136	.	.	ENSG00000107731	ENST00000335350;ENST00000373192	D;D	0.85629	-2.01;-2.01	5.73	4.82	0.62117	Death (2);DEATH-like (2);	0.000000	0.85682	D	0.000000	D	0.91693	0.7374	M	0.78637	2.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.92455	0.5973	10	0.87932	D	0	-40.9533	12.9927	0.58630	0.4432:0.5568:0.0:0.0	.	865;876	Q8IZJ1-2;Q8IZJ1	.;UNC5B_HUMAN	W	876;865	ENSP00000334329:R876W;ENSP00000362288:R865W	ENSP00000334329:R876W	R	+	1	2	UNC5B	72727807	0.994000	0.37717	0.893000	0.35052	0.994000	0.84299	3.226000	0.51254	1.402000	0.46780	0.655000	0.94253	CGG		UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048541.1	NM_170744	
SORCS1	114815	hgsc.bcm.edu	37	10	108459130	108459130	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr10:108459130C>A	ENST00000263054.6	-	9	1262	c.1255G>T	c.(1255-1257)Gat>Tat	p.D419Y	SORCS1_ENST00000344440.6_Missense_Mutation_p.D419Y|SORCS1_ENST00000369698.1_5'Flank	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	419					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)	p.D419Y(1)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		TGATTCTCATCGGTGCTGATA	0.468																																					p.D419Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1255T	10						.						183.0	146.0	158.0					10																	108459130		2203	4300	6503	108449120	SO:0001583	missense	114815	exon9			AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.1255G>T	10.37:g.108459130C>A	ENSP00000263054:p.Asp419Tyr	Somatic		Capture	SOLID	Phase_I	108449120	NM_052918	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	37	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.559410	0.86335	.	.	ENSG00000108018	ENST00000263054;ENST00000344440	T;T	0.25579	1.79;1.79	6.06	6.06	0.98353	VPS10 (1);	0.000000	0.85682	D	0.000000	T	0.56775	0.2008	M	0.80847	2.515	0.58432	D	0.999999	D;D;D;D;D	0.89917	0.998;1.0;1.0;0.998;1.0	D;D;D;D;D	0.79784	0.971;0.993;0.993;0.971;0.993	T	0.53272	-0.8462	9	.	.	.	-21.8491	20.6397	0.99537	0.0:1.0:0.0:0.0	.	419;419;419;419;419	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	Y	419	ENSP00000263054:D419Y;ENSP00000345964:D419Y	.	D	-	1	0	SORCS1	108449120	1.000000	0.71417	0.998000	0.56505	0.817000	0.46193	7.433000	0.80362	2.880000	0.98712	0.650000	0.86243	GAT		SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918	
PPP1R32	220004	hgsc.bcm.edu	37	11	61252816	61252816	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr11:61252816C>T	ENST00000338608.2	+	6	642	c.517C>T	c.(517-519)Cgc>Tgc	p.R173C	PPP1R32_ENST00000432063.2_Missense_Mutation_p.R173C|RP11-286N22.8_ENST00000544880.1_3'UTR	NM_145017.2	NP_659454.2	Q7Z5V6	PPR32_HUMAN	protein phosphatase 1, regulatory subunit 32	173							phosphatase binding (GO:0019902)	p.R173C(1)									CCAGGGCCCACGCTTCATGAC	0.612																																					p.R173C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C517T	11						.						101.0	89.0	93.0					11																	61252816		2202	4299	6501	61009392	SO:0001583	missense	220004	exon6			AK057333	CCDS8008.1, CCDS53641.1	11q12.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000162148	ENSG00000162148		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28869	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 66"""	C11orf66		12477932	Standard	NM_145017		Approved	IIIG9, FLJ32771	uc001nru.2	Q7Z5V6	OTTHUMG00000168176	ENST00000338608.2:c.517C>T	11.37:g.61252816C>T	ENSP00000344140:p.Arg173Cys	Somatic		Capture	SOLID	Phase_I	61009392	NM_145017	Q4G0P4|Q96M77	Missense_Mutation	SNP	ENST00000338608.2	37	CCDS8008.1	.	.	.	.	.	.	.	.	.	.	C	16.72	3.202113	0.58234	.	.	ENSG00000162148	ENST00000432063;ENST00000338608	T;T	0.48522	0.81;1.39	4.92	3.97	0.46021	.	0.334264	0.26262	N	0.025382	T	0.63686	0.2532	M	0.68317	2.08	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72982	0.969;0.979	T	0.65809	-0.6078	10	0.56958	D	0.05	-29.3353	11.8968	0.52661	0.1734:0.8266:0.0:0.0	.	173;173	Q7Z5V6-2;Q7Z5V6	.;PPR32_HUMAN	C	173	ENSP00000391560:R173C;ENSP00000344140:R173C	ENSP00000344140:R173C	R	+	1	0	C11orf66	61009392	0.126000	0.22350	0.995000	0.50966	0.637000	0.38172	0.764000	0.26532	2.268000	0.75426	0.462000	0.41574	CGC		PPP1R32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398621.1	NM_145017	
FXYD6	53826	hgsc.bcm.edu	37	11	117711884	117711884	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr11:117711884C>T	ENST00000526014.1	-	5	783	c.188G>A	c.(187-189)tGc>tAc	p.C63Y	FXYD6_ENST00000260282.4_Missense_Mutation_p.C63Y|FXYD6-FXYD2_ENST00000532984.1_Intron|FXYD6_ENST00000540359.1_Missense_Mutation_p.C63Y|FXYD6_ENST00000527429.1_Missense_Mutation_p.C63Y|FXYD6_ENST00000584394.1_Missense_Mutation_p.C63Y|FXYD6_ENST00000583233.1_5'UTR|FXYD6_ENST00000539526.1_Missense_Mutation_p.C63Y|FXYD6_ENST00000530956.1_Missense_Mutation_p.C63Y|FXYD6_ENST00000584230.1_Missense_Mutation_p.C63Y|RP11-728F11.4_ENST00000581173.2_RNA|FXYD6_ENST00000529335.2_Missense_Mutation_p.C62Y|FXYD6_ENST00000527717.1_Missense_Mutation_p.C63Y|FXYD6_ENST00000524656.1_Missense_Mutation_p.C63Y	NM_022003.3	NP_071286.1	Q9H0Q3	FXYD6_HUMAN	FXYD domain containing ion transport regulator 6	63					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ion channel activity (GO:0005216)	p.C63Y(1)		central_nervous_system(1)|large_intestine(5)|lung(1)|skin(1)	8	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|Breast(348;0.111)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.89e-05)|Epithelial(105;0.00122)		ATTGAAACTGCACTTGCACCT	0.577																																					p.C63Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G188A	11						.						97.0	82.0	87.0					11																	117711884		2201	4296	6497	117217094	SO:0001583	missense	53826	exon6			BC093040	CCDS8387.1	11q23.3	2010-04-14	2002-01-14		ENSG00000137726	ENSG00000137726			4030	protein-coding gene	gene with protein product	"""phosphohippolin"""	606683	"""FXYD domain-containing ion transport regulator 6"""			10950925	Standard	NM_022003		Approved			Q9H0Q3		ENST00000526014.1:c.188G>A	11.37:g.117711884C>T	ENSP00000433312:p.Cys63Tyr	Somatic		Capture	SOLID	Phase_I	117217094	NM_001164837	A8K0R4|J3QLD2|Q6FIG9|Q6UW52	Missense_Mutation	SNP	ENST00000526014.1	37	CCDS8387.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.041325	0.75732	.	.	ENSG00000137726	ENST00000540359;ENST00000539526;ENST00000260282;ENST00000527717;ENST00000526014;ENST00000524656;ENST00000529335	T;T;T;T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22;-1.22;-1.22;-1.22	5.56	5.56	0.83823	.	.	.	.	.	D	0.87680	0.6238	.	.	.	0.58432	D	0.999991	D;D	0.89917	1.0;0.997	D;D	0.77004	0.989;0.964	D	0.88473	0.3063	8	0.62326	D	0.03	.	15.0344	0.71734	0.0:1.0:0.0:0.0	.	63;63	E9PJ02;Q9H0Q3	.;FXYD6_HUMAN	Y	63;63;63;63;63;63;62	ENSP00000444243:C63Y;ENSP00000442756:C63Y;ENSP00000260282:C63Y;ENSP00000431446:C63Y;ENSP00000433312:C63Y;ENSP00000431427:C63Y;ENSP00000436629:C62Y	ENSP00000260282:C63Y	C	-	2	0	FXYD6	117217094	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.008000	0.63991	2.601000	0.87937	0.655000	0.94253	TGC		FXYD6-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392307.1	NM_022003	
CHD4	1108	hgsc.bcm.edu	37	12	6697516	6697516	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr12:6697516G>A	ENST00000357008.2	-	23	3576	c.3413C>T	c.(3412-3414)gCt>gTt	p.A1138V	CHD4_ENST00000540960.1_5'Flank|CHD4_ENST00000544040.1_Missense_Mutation_p.A1131V|CHD4_ENST00000544484.1_Missense_Mutation_p.A1135V|CHD4_ENST00000309577.6_Missense_Mutation_p.A1138V	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1138	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)	p.A1138V(1)		central_nervous_system(2)	2						AACTGTGTCAGCAGTGGCCAG	0.468																																					p.A1138V	Colon(32;586 792 4568 16848 45314)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3413T	12						.						85.0	83.0	84.0					12																	6697516		2203	4300	6503	6567777	SO:0001583	missense	1108	exon23			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.3413C>T	12.37:g.6697516G>A	ENSP00000349508:p.Ala1138Val	Somatic		Capture	SOLID	Phase_I	6567777	NM_001273	Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	37	CCDS8552.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.595032	0.86953	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07	5.77	5.77	0.91146	Helicase, C-terminal (3);	0.127057	0.52532	D	0.000068	D	0.92805	0.7712	H	0.97758	4.07	0.80722	D	1	P;B;D	0.67145	0.51;0.29;0.996	B;B;D	0.73380	0.407;0.353;0.98	D	0.94771	0.7945	10	0.87932	D	0	.	19.598	0.95548	0.0:0.0:1.0:0.0	.	1138;1138;1131	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	V	1135;1131;1138;1138;1112	ENSP00000440392:A1135V;ENSP00000440542:A1131V;ENSP00000312419:A1138V;ENSP00000349508:A1138V	ENSP00000312419:A1138V	A	-	2	0	CHD4	6567777	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.817000	0.99352	2.734000	0.93682	0.436000	0.28706	GCT		CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273	
KRAS	3845	hgsc.bcm.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35A	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp	Somatic		Capture	SOLID	Phase_I	25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
CNTN1	1272	hgsc.bcm.edu	37	12	41327650	41327650	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr12:41327650G>T	ENST00000551295.2	+	9	1072	c.955G>T	c.(955-957)Gat>Tat	p.D319Y	CNTN1_ENST00000547702.1_Missense_Mutation_p.D319Y|CNTN1_ENST00000547849.1_Missense_Mutation_p.D319Y|CNTN1_ENST00000347616.1_Missense_Mutation_p.D319Y|CNTN1_ENST00000360099.3_Missense_Mutation_p.D319Y|CNTN1_ENST00000348761.2_Missense_Mutation_p.D308Y	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	319	Ig-like C2-type 3.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.D319Y(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				TAGAGGAAAGGATAAACATCA	0.333																																					p.D308Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G922T	12						.						81.0	82.0	82.0					12																	41327650		2203	4299	6502	39613917	SO:0001583	missense	1272	exon8			Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.955G>T	12.37:g.41327650G>T	ENSP00000447006:p.Asp319Tyr	Somatic		Capture	SOLID	Phase_I	39613917	NM_175038	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	ENST00000551295.2	37	CCDS8737.1	.	.	.	.	.	.	.	.	.	.	G	18.84	3.709798	0.68730	.	.	ENSG00000018236	ENST00000547702;ENST00000551295;ENST00000547849;ENST00000347616;ENST00000360099;ENST00000348761	T;T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33;-0.33	5.11	4.21	0.49690	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.158424	0.53938	D	0.000047	T	0.81049	0.4742	M	0.75447	2.3	0.58432	D	0.999995	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.83588	0.0121	10	0.66056	D	0.02	.	15.219	0.73296	0.0:0.0:0.8581:0.1419	.	319;308;319	Q12860-3;Q12860-2;Q12860	.;.;CNTN1_HUMAN	Y	319;319;319;319;319;308	ENSP00000448004:D319Y;ENSP00000447006:D319Y;ENSP00000448653:D319Y;ENSP00000325660:D319Y;ENSP00000353213:D319Y;ENSP00000261160:D308Y	ENSP00000325660:D319Y	D	+	1	0	CNTN1	39613917	1.000000	0.71417	0.990000	0.47175	0.992000	0.81027	9.230000	0.95299	1.280000	0.44463	0.561000	0.74099	GAT		CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843	
EP400	57634	hgsc.bcm.edu	37	12	132530375	132530375	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr12:132530375G>A	ENST00000333577.4	+	40	7347	c.7238G>A	c.(7237-7239)cGa>cAa	p.R2413Q	EP400_ENST00000330386.6_Missense_Mutation_p.R2296Q|EP400_ENST00000389561.2_Missense_Mutation_p.R2377Q|EP400_ENST00000332482.4_Missense_Mutation_p.R2340Q|EP400_ENST00000389562.2_Missense_Mutation_p.R2376Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2413	Myb-like. {ECO:0000255|PROSITE- ProRule:PRU00133}.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.R2376Q(1)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		TCCTGTAGCCGAATCTACCGC	0.502																																					p.R2376Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G7127A	12						.						140.0	104.0	116.0					12																	132530375		2203	4300	6503	131096328	SO:0001583	missense	57634	exon39			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.7238G>A	12.37:g.132530375G>A	ENSP00000333602:p.Arg2413Gln	Somatic		Capture	SOLID	Phase_I	131096328	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	ENST00000333577.4	37		.	.	.	.	.	.	.	.	.	.	G	17.81	3.480416	0.63849	.	.	ENSG00000183495	ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000541296	D;D;D;D;D	0.92348	-3.01;-3.0;-3.02;-3.02;-3.0	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.95962	0.8685	M	0.75447	2.3	0.44345	D	0.997238	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.997;0.997	D	0.96288	0.9211	10	0.72032	D	0.01	.	18.7731	0.91900	0.0:0.0:1.0:0.0	.	2377;2296;2376	Q96L91-2;Q96L91-4;Q96L91-5	.;.;.	Q	2413;2377;2376;2340;2296;2377	ENSP00000333602:R2413Q;ENSP00000374212:R2377Q;ENSP00000374213:R2376Q;ENSP00000331737:R2340Q;ENSP00000330620:R2296Q	ENSP00000330620:R2296Q	R	+	2	0	EP400	131096328	1.000000	0.71417	0.956000	0.39512	0.816000	0.46133	9.476000	0.97823	2.439000	0.82584	0.655000	0.94253	CGA		EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
DCLK1	9201	hgsc.bcm.edu	37	13	36445396	36445396	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr13:36445396G>A	ENST00000360631.3	-	5	1116	c.905C>T	c.(904-906)tCc>tTc	p.S302F	DCLK1_ENST00000255448.4_Missense_Mutation_p.S302F|DCLK1_ENST00000379892.4_Missense_Mutation_p.S302F			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	302	Pro/Ser-rich.				axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)	p.S302F(2)		breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		GCTACGCCTGGACGGTCCTGG	0.517																																					p.S302F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C905T	13						.						216.0	205.0	209.0					13																	36445396		2203	4300	6503	35343396	SO:0001583	missense	9201	exon5			AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.905C>T	13.37:g.36445396G>A	ENSP00000353846:p.Ser302Phe	Somatic		Capture	SOLID	Phase_I	35343396	NM_004734	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Missense_Mutation	SNP	ENST00000360631.3	37		.	.	.	.	.	.	.	.	.	.	G	21.5	4.158220	0.78114	.	.	ENSG00000133083	ENST00000255448;ENST00000360631;ENST00000539451;ENST00000379892	T;T;T	0.69685	-0.42;-0.41;1.73	5.28	5.28	0.74379	.	0.068772	0.64402	D	0.000011	T	0.69133	0.3077	L	0.61218	1.895	0.58432	D	0.999999	P	0.43607	0.812	B	0.42245	0.381	T	0.74009	-0.3802	10	0.66056	D	0.02	.	19.2736	0.94021	0.0:0.0:1.0:0.0	.	302	O15075-2	.	F	302	ENSP00000255448:S302F;ENSP00000353846:S302F;ENSP00000369222:S302F	ENSP00000255448:S302F	S	-	2	0	DCLK1	35343396	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.879000	0.75572	2.617000	0.88574	0.655000	0.94253	TCC		DCLK1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000044487.1	NM_004734	
RNF219	79596	hgsc.bcm.edu	37	13	79213164	79213164	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr13:79213164T>A	ENST00000282003.6	-	4	401	c.343A>T	c.(343-345)Agt>Tgt	p.S115C		NM_024546.3	NP_078822.3	Q5W0B1	RN219_HUMAN	ring finger protein 219	115							zinc ion binding (GO:0008270)	p.S115C(1)		breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|liver(1)|lung(11)|prostate(1)|skin(1)	32		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.0414)		AGATTTTTACTCTTAAGCTCT	0.373																																					p.S115C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A343T	13						.						99.0	97.0	98.0					13																	79213164		2202	4300	6502	78111165	SO:0001583	missense	79596	exon4			BC028586	CCDS31997.1	13q31.1	2011-05-23	2008-03-26	2008-03-26	ENSG00000152193	ENSG00000152193		"""RING-type (C3HC4) zinc fingers"""	20308	protein-coding gene	gene with protein product		615906	"""chromosome 13 open reading frame 7"""	C13orf7			Standard	XM_006719865		Approved	FLJ13449	uc001vkw.1	Q5W0B1	OTTHUMG00000017122	ENST00000282003.6:c.343A>T	13.37:g.79213164T>A	ENSP00000282003:p.Ser115Cys	Somatic		Capture	SOLID	Phase_I	78111165	NM_024546	B2RN99|Q8TBY2|Q9H0T2|Q9H8M0	Missense_Mutation	SNP	ENST00000282003.6	37	CCDS31997.1	.	.	.	.	.	.	.	.	.	.	T	16.19	3.053641	0.55218	.	.	ENSG00000152193	ENST00000282003	.	.	.	5.38	4.25	0.50352	.	0.694043	0.14953	N	0.288782	T	0.19967	0.0480	N	0.19112	0.55	0.31478	N	0.667574	P	0.47106	0.89	B	0.39971	0.315	T	0.23762	-1.0179	9	0.66056	D	0.02	-0.7802	2.3594	0.04303	0.0:0.1954:0.3168:0.4878	.	115	Q5W0B1	RN219_HUMAN	C	115	.	ENSP00000282003:S115C	S	-	1	0	RNF219	78111165	0.918000	0.31147	1.000000	0.80357	0.998000	0.95712	1.082000	0.30803	2.036000	0.60181	0.533000	0.62120	AGT		RNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045363.1	NM_024546	
GPC6	10082	hgsc.bcm.edu	37	13	94482727	94482727	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr13:94482727G>A	ENST00000377047.4	+	3	1255	c.640G>A	c.(640-642)Gcc>Acc	p.A214T	GPC6-AS2_ENST00000445540.1_RNA	NM_005708.3	NP_005699.1	Q9Y625	GPC6_HUMAN	glypican 6	214					carbohydrate metabolic process (GO:0005975)|cell migration (GO:0016477)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.A214T(2)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	38	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				GGTTACCCGCGCCTTCATTGC	0.493																																					p.A214T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G640A	13						.						56.0	54.0	55.0					13																	94482727		2203	4300	6503	93280728	SO:0001583	missense	10082	exon3			AF111178	CCDS9469.1	13q32	2008-02-05			ENSG00000183098	ENSG00000183098		"""Proteoglycans / Cell Surface : Glypicans"""	4454	protein-coding gene	gene with protein product	"""glypican proteoglycan 6"""	604404				10329016	Standard	NM_005708		Approved		uc001vlt.3	Q9Y625	OTTHUMG00000017205	ENST00000377047.4:c.640G>A	13.37:g.94482727G>A	ENSP00000366246:p.Ala214Thr	Somatic		Capture	SOLID	Phase_I	93280728	NM_005708	A8K279|Q96SG5|Q96SG8|Q9H1P4	Missense_Mutation	SNP	ENST00000377047.4	37	CCDS9469.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.566736	0.86439	.	.	ENSG00000183098	ENST00000377047	T	0.59083	0.29	5.49	4.64	0.57946	.	0.000000	0.85682	D	0.000000	T	0.72526	0.3471	M	0.79258	2.445	0.46298	D	0.998978	D;P	0.60575	0.988;0.943	P;P	0.58130	0.833;0.694	T	0.76187	-0.3051	10	0.49607	T	0.09	.	16.1766	0.81857	0.0:0.0:0.8657:0.1343	.	214;214	B4E2M1;Q9Y625	.;GPC6_HUMAN	T	214	ENSP00000366246:A214T	ENSP00000366246:A214T	A	+	1	0	GPC6	93280728	1.000000	0.71417	0.976000	0.42696	0.867000	0.49689	7.583000	0.82559	1.477000	0.48234	-0.164000	0.13417	GCC		GPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045460.4	NM_005708	
CTSG	1511	hgsc.bcm.edu	37	14	25043995	25043995	+	Silent	SNP	G	G	A	rs143803246		TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr14:25043995G>A	ENST00000216336.2	-	3	261	c.225C>T	c.(223-225)ggC>ggT	p.G75G		NM_001911.2	NP_001902.1	P08311	CATG_HUMAN	cathepsin G	75	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|defense response to fungus (GO:0050832)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|negative regulation of growth of symbiont in host (GO:0044130)|neutrophil mediated killing of gram-positive bacterium (GO:0070946)|positive regulation of immune response (GO:0050778)|proteolysis (GO:0006508)|response to lipopolysaccharide (GO:0032496)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	heparin binding (GO:0008201)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)	p.G75G(1)		autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)|urinary_tract(1)	25				GBM - Glioblastoma multiforme(265;0.0269)		TATTGTGGGCGCCCAGGGTGA	0.557																																					p.G75G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C225T	14						.						139.0	122.0	128.0					14																	25043995		2203	4300	6503	24113835	SO:0001819	synonymous_variant	1511	exon3			M16117	CCDS9631.1	14q12	2013-02-25			ENSG00000100448	ENSG00000100448		"""Cathepsins"", ""Endogenous ligands"""	2532	protein-coding gene	gene with protein product		116830				2569462	Standard	NM_001911		Approved	CG	uc001wpq.3	P08311	OTTHUMG00000140182	ENST00000216336.2:c.225C>T	14.37:g.25043995G>A		Somatic		Capture	SOLID	Phase_I	24113835	NM_001911	Q6IBJ6|Q9UCA5|Q9UCU6	Silent	SNP	ENST00000216336.2	37	CCDS9631.1																																																																																				CTSG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276536.2	NM_001911	
KTN1	3895	hgsc.bcm.edu	37	14	56096735	56096735	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr14:56096735G>A	ENST00000395314.3	+	7	1209	c.1141G>A	c.(1141-1143)Gga>Aga	p.G381R	KTN1_ENST00000395309.3_Missense_Mutation_p.G381R|KTN1_ENST00000438792.2_Missense_Mutation_p.G381R|KTN1_ENST00000395308.1_Missense_Mutation_p.G381R|KTN1_ENST00000413890.2_Missense_Mutation_p.G381R|KTN1_ENST00000395311.1_Missense_Mutation_p.G381R|KTN1_ENST00000416613.1_Missense_Mutation_p.G381R	NM_001079521.1	NP_001072989.1	Q86UP2	KTN1_HUMAN	kinectin 1 (kinesin receptor)	381					microtubule-based movement (GO:0007018)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.G381R(2)		breast(4)|central_nervous_system(1)|large_intestine(8)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	19						AGATCGAATTGGAACATTAGA	0.294			T	RET	papillary thryoid																																p.G381R			Dom	yes		14	14q22.1	3895	kinectin 1 (kinesin receptor)		E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1141A	14						.						123.0	123.0	123.0					14																	56096735		2203	4300	6503	55166488	SO:0001583	missense	3895	exon7				CCDS41957.1, CCDS41958.1, CCDS41959.1	14q22.1	2008-05-02			ENSG00000126777	ENSG00000126777			6467	protein-coding gene	gene with protein product		600381				9605849	Standard	NM_001079521		Approved	KIAA0004, CG1	uc001xcc.3	Q86UP2	OTTHUMG00000140312	ENST00000395314.3:c.1141G>A	14.37:g.56096735G>A	ENSP00000378725:p.Gly381Arg	Somatic		Capture	SOLID	Phase_I	55166488	NM_004986	B4DZ88|Q13999|Q14707|Q15387|Q17RZ5|Q5GGW3|Q86W57	Missense_Mutation	SNP	ENST00000395314.3	37	CCDS41957.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.952734	0.73787	.	.	ENSG00000126777	ENST00000413890;ENST00000395309;ENST00000438792;ENST00000395314;ENST00000395308;ENST00000395311;ENST00000416613	T;T;T;T;T;T;T	0.37752	1.18;1.18;1.18;1.18;1.18;1.18;1.18	5.97	5.97	0.96955	.	0.276236	0.26828	N	0.022289	T	0.46425	0.1392	L	0.36672	1.1	0.30540	N	0.766517	D;D;P;D	0.76494	0.974;0.999;0.906;0.985	P;D;P;D	0.71414	0.889;0.973;0.802;0.923	T	0.37888	-0.9686	10	0.21540	T	0.41	-16.9036	12.8183	0.57677	0.0768:0.0:0.9232:0.0	.	381;381;381;381	B4DZ88;Q86UP2-2;Q17RZ5;Q86UP2	.;.;.;KTN1_HUMAN	R	381	ENSP00000394992:G381R;ENSP00000378720:G381R;ENSP00000391964:G381R;ENSP00000378725:G381R;ENSP00000378719:G381R;ENSP00000378722:G381R;ENSP00000388807:G381R	ENSP00000378719:G381R	G	+	1	0	KTN1	55166488	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.552000	0.60747	2.835000	0.97688	0.591000	0.81541	GGA		KTN1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276912.2		
SPTB	6710	hgsc.bcm.edu	37	14	65240071	65240071	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr14:65240071C>T	ENST00000389721.5	-	24	5077	c.5045G>A	c.(5044-5046)cGc>cAc	p.R1682H	SPTB_ENST00000542895.1_Missense_Mutation_p.R1682H|SPTB_ENST00000556626.1_Missense_Mutation_p.R1682H|SPTB_ENST00000389720.3_Missense_Mutation_p.R1682H|SPTB_ENST00000389722.3_Missense_Mutation_p.R1682H	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1682					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)	p.R1682H(1)		breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		CTTGCGCTTGCGCTCTTCCGC	0.552																																					p.R1682H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5045A	14						.						131.0	113.0	119.0					14																	65240071		2203	4300	6503	64309824	SO:0001583	missense	6710	exon24				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.5045G>A	14.37:g.65240071C>T	ENSP00000374371:p.Arg1682His	Somatic		Capture	SOLID	Phase_I	64309824	NM_001024858	Q15510|Q15519	Missense_Mutation	SNP	ENST00000389721.5	37	CCDS32100.1	.	.	.	.	.	.	.	.	.	.	C	19.90	3.912487	0.72983	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000335612;ENST00000553938;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T;T	0.61392	0.11;0.11;0.11;0.11;0.11;0.11	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.80999	0.4732	M	0.89968	3.075	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.85189	0.1008	10	0.87932	D	0	.	17.6535	0.88171	0.0:1.0:0.0:0.0	.	466;1682;1686	E7EV95;P11277;Q59FP5	.;SPTB1_HUMAN;.	H	1686;1682;466;347;1682;1682;1682;1682	ENSP00000374372:R1682H;ENSP00000451324:R347H;ENSP00000451752:R1682H;ENSP00000374371:R1682H;ENSP00000443882:R1682H;ENSP00000374370:R1682H	ENSP00000334218:R466H	R	-	2	0	SPTB	64309824	1.000000	0.71417	0.353000	0.25747	0.147000	0.21601	7.792000	0.85828	2.537000	0.85549	0.561000	0.74099	CGC		SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1		
NRXN3	9369	hgsc.bcm.edu	37	14	79175869	79175869	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr14:79175869G>C	ENST00000554719.1	+	4	903	c.412G>C	c.(412-414)Gaa>Caa	p.E138Q	NRXN3_ENST00000335750.5_Missense_Mutation_p.E138Q|RP11-232C2.2_ENST00000555680.1_RNA	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	142	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)	p.E138Q(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CTTTGCCGTGGAACTCCTCGA	0.507																																					p.E138Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G412C	14						.						141.0	143.0	142.0					14																	79175869		2203	4300	6503	78245622	SO:0001583	missense	9369	exon4			AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.412G>C	14.37:g.79175869G>C	ENSP00000451648:p.Glu138Gln	Somatic		Capture	SOLID	Phase_I	78245622	NM_004796	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	ENST00000554719.1	37	CCDS9870.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.508784	0.85282	.	.	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000554719;ENST00000335750;ENST00000557081	T;T;T	0.80123	-1.34;-1.34;-1.34	5.38	5.38	0.77491	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.90570	0.7044	M	0.82823	2.61	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.76071	0.981;0.987	D	0.90781	0.4679	9	.	.	.	.	19.1251	0.93380	0.0:0.0:1.0:0.0	.	511;138	Q9Y4C0;Q9Y4C0-3	NRX3A_HUMAN;.	Q	511;509;138;138;82	ENSP00000451648:E138Q;ENSP00000338349:E138Q;ENSP00000450462:E82Q	.	E	+	1	0	NRXN3	78245622	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	9.869000	0.99810	2.518000	0.84900	0.563000	0.77884	GAA		NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413787.1	NM_001105250	
KCNK13	56659	hgsc.bcm.edu	37	14	90651117	90651117	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr14:90651117G>A	ENST00000282146.4	+	2	1438	c.997G>A	c.(997-999)Gca>Aca	p.A333T		NM_022054.2	NP_071337.2	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13	333					synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.A333T(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(12)|prostate(1)|skin(4)	25		all_cancers(154;0.186)				AGACGGGGTGGCAGAGAGTGA	0.612																																					p.A333T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G997A	14						.						61.0	62.0	62.0					14																	90651117		2203	4300	6503	89720870	SO:0001583	missense	56659	exon2			AF287303	CCDS9889.1	14q32.11	2012-03-07				ENSG00000152315		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6275	protein-coding gene	gene with protein product		607367				11060316, 16382106	Standard	NM_022054		Approved	K2p13.1, THIK-1, THIK1	uc001xye.1	Q9HB14		ENST00000282146.4:c.997G>A	14.37:g.90651117G>A	ENSP00000282146:p.Ala333Thr	Somatic		Capture	SOLID	Phase_I	89720870	NM_022054	B5TJL8|Q96E79	Missense_Mutation	SNP	ENST00000282146.4	37	CCDS9889.1	.	.	.	.	.	.	.	.	.	.	G	7.001	0.554858	0.13436	.	.	ENSG00000152315	ENST00000282146	T	0.11604	2.76	5.3	1.2	0.21068	.	1.551420	0.04012	N	0.298327	T	0.05686	0.0149	N	0.14661	0.345	0.22156	N	0.999325	B	0.06786	0.001	B	0.04013	0.001	T	0.36114	-0.9761	10	0.10636	T	0.68	.	1.8219	0.03112	0.4407:0.3101:0.0989:0.1503	.	333	Q9HB14	KCNKD_HUMAN	T	333	ENSP00000282146:A333T	ENSP00000282146:A333T	A	+	1	0	KCNK13	89720870	1.000000	0.71417	0.899000	0.35326	0.015000	0.08874	2.254000	0.43214	-0.035000	0.13691	0.655000	0.94253	GCA		KCNK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411251.1	NM_022054	
DICER1	23405	hgsc.bcm.edu	37	14	95566250	95566250	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr14:95566250C>T	ENST00000526495.1	-	24	4364	c.4073G>A	c.(4072-4074)cGc>cAc	p.R1358H	DICER1_ENST00000393063.1_Missense_Mutation_p.R1358H|DICER1_ENST00000527414.1_Missense_Mutation_p.R1358H|DICER1_ENST00000556045.1_Missense_Mutation_p.R256H|DICER1_ENST00000541352.1_Missense_Mutation_p.R1358H|DICER1_ENST00000343455.3_Missense_Mutation_p.R1358H			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	1358	RNase III 1. {ECO:0000255|PROSITE- ProRule:PRU00177}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)	p.R1358H(1)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		TTTTCCAAGGCGATACAGATT	0.398			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																												p.R1358H		yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4073A	14						.						115.0	109.0	111.0					14																	95566250		2203	4300	6503	94636003	SO:0001583	missense	23405	exon21	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.4073G>A	14.37:g.95566250C>T	ENSP00000437256:p.Arg1358His	Somatic		Capture	SOLID	Phase_I	94636003	NM_001195573	A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Missense_Mutation	SNP	ENST00000526495.1	37	CCDS9931.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.666351	0.88251	.	.	ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000556045;ENST00000541352	T;T;T;T;T;T	0.78816	-1.21;-1.21;-1.21;-1.21;-1.21;-1.21	5.91	5.91	0.95273	Ribonuclease III (5);	0.000000	0.85682	D	0.000000	D	0.86830	0.6027	M	0.67953	2.075	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.998	D;D;D	0.87578	0.998;0.992;0.975	T	0.81479	-0.0914	10	0.16896	T	0.51	-19.1274	20.2985	0.98592	0.0:1.0:0.0:0.0	.	256;1358;1358	B3KRG4;E0AD28;Q9UPY3	.;.;DICER_HUMAN	H	1358;1358;1358;1358;256;1358	ENSP00000343745:R1358H;ENSP00000437256:R1358H;ENSP00000376783:R1358H;ENSP00000435681:R1358H;ENSP00000451041:R256H;ENSP00000444719:R1358H	ENSP00000343745:R1358H	R	-	2	0	DICER1	94636003	1.000000	0.71417	1.000000	0.80357	0.429000	0.31625	7.456000	0.80751	2.793000	0.96121	0.655000	0.94253	CGC		DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387997.1		
SCARF1	8578	hgsc.bcm.edu	37	17	1551177	1551177	+	5'Flank	SNP	T	T	C			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr17:1551177T>C	ENST00000263071.4	-	0	0				SCARF1_ENST00000571272.1_5'Flank|RILP_ENST00000301336.6_Missense_Mutation_p.K299R|SCARF1_ENST00000348987.3_5'Flank	NM_003693.2|NM_145350.1	NP_003684.2|NP_663325.1	Q14162	SREC_HUMAN	scavenger receptor class F, member 1						cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|dendrite development (GO:0016358)|neuron remodeling (GO:0016322)|positive regulation of axon regeneration (GO:0048680)|positive regulation of neuron projection development (GO:0010976)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)|transmembrane signaling receptor activity (GO:0004888)	p.K299R(1)		cervix(1)|endometrium(3)|kidney(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CTTGATCTTCTTCCGCTGCTT	0.612																																					p.K299R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A896G	17						.						198.0	136.0	157.0					17																	1551177		2203	4300	6503	1497927	SO:0001631	upstream_gene_variant	83547	exon6			D63483	CCDS11007.1, CCDS45564.1	17p13.3	2008-07-18			ENSG00000074660	ENSG00000074660			16820	protein-coding gene	gene with protein product	"""scavenger receptor expressed by endothelial cells"", ""acetyl LDL receptor"""	607873				9395444, 8590280	Standard	NM_003693		Approved	SREC, KIAA0149	uc002fsz.2	Q14162	OTTHUMG00000090555		17.37:g.1551177T>C	Exception_encountered	Somatic		Capture	SOLID	Phase_I	1497927	NM_031430	A8MQ05|O43701|Q8NHD2|Q8NHD3|Q8NHD4|Q8NHD5	Missense_Mutation	SNP	ENST00000263071.4	37	CCDS11007.1	.	.	.	.	.	.	.	.	.	.	T	11.62	1.693626	0.30052	.	.	ENSG00000167705	ENST00000301336	T	0.43294	0.95	5.6	2.02	0.26589	.	0.216972	0.37219	N	0.002196	T	0.14056	0.0340	N	0.01352	-0.895	0.29109	N	0.881013	B	0.25048	0.117	B	0.25884	0.064	T	0.20207	-1.0282	10	0.22109	T	0.4	-9.8949	7.9966	0.30271	0.0:0.3233:0.0:0.6767	.	299	Q96NA2	RILP_HUMAN	R	299	ENSP00000301336:K299R	ENSP00000301336:K299R	K	-	2	0	RILP	1497927	0.106000	0.21978	0.998000	0.56505	0.477000	0.33069	-0.029000	0.12329	0.422000	0.26005	0.533000	0.62120	AAG		SCARF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207081.4	NM_003693	
ERBB2	2064	hgsc.bcm.edu	37	17	37881332	37881332	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr17:37881332G>A	ENST00000269571.5	+	21	2683	c.2524G>A	c.(2524-2526)Gta>Ata	p.V842I	ERBB2_ENST00000540147.1_Missense_Mutation_p.V812I|ERBB2_ENST00000584601.1_Missense_Mutation_p.V812I|ERBB2_ENST00000406381.2_Missense_Mutation_p.V812I|ERBB2_ENST00000445658.2_Missense_Mutation_p.V566I|ERBB2_ENST00000584450.1_Missense_Mutation_p.V842I|ERBB2_ENST00000541774.1_Missense_Mutation_p.V827I|MIR4728_ENST00000580969.1_RNA			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	842	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)	p.V842I(6)		NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	TGTGCGGCTCGTACACAGGGA	0.597		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																											p.V812I			Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	ERBB2,stomach,NS,Substitution - Missense,0 	.	6	Substitution - Missense(6)	large_intestine(5)|stomach(1)	c.G2434A	17						.						70.0	61.0	64.0					17																	37881332		2203	4300	6503	35134858	SO:0001583	missense	2064	exon24			X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.2524G>A	17.37:g.37881332G>A	ENSP00000269571:p.Val842Ile	Somatic		Capture	SOLID	Phase_I	35134858	NM_001005862	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	SNP	ENST00000269571.5	37	CCDS32642.1	.	.	.	.	.	.	.	.	.	.	G	16.87	3.241303	0.58995	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000445658;ENST00000269571;ENST00000540147	D;D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.69;-1.69	5.09	5.09	0.68999	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.85106	0.5621	N	0.21142	0.635	0.80722	D	1	D;D;D	0.76494	0.997;0.979;0.999	D;P;D	0.64506	0.92;0.559;0.926	D	0.87344	0.2333	9	0.87932	D	0	.	18.2846	0.90110	0.0:0.0:1.0:0.0	.	566;827;842	B4DTR1;P04626-4;P04626	.;.;ERBB2_HUMAN	I	812;827;566;842;812	ENSP00000385185:V812I;ENSP00000446466:V827I;ENSP00000404047:V566I;ENSP00000269571:V842I;ENSP00000443562:V812I	ENSP00000269571:V842I	V	+	1	0	ERBB2	35134858	1.000000	0.71417	0.919000	0.36401	0.900000	0.52787	9.657000	0.98554	2.651000	0.90000	0.563000	0.77884	GTA		ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2		
CA10	56934	hgsc.bcm.edu	37	17	49710917	49710917	+	Missense_Mutation	SNP	C	C	T	rs201368392		TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr17:49710917C>T	ENST00000285273.4	-	9	1995	c.884G>A	c.(883-885)cGc>cAc	p.R295H	CA10_ENST00000451037.2_Missense_Mutation_p.R295H|CA10_ENST00000340813.6_Missense_Mutation_p.R301H|CA10_ENST00000571918.1_5'Flank|CA10_ENST00000442502.2_Missense_Mutation_p.R295H|CA10_ENST00000570565.1_Missense_Mutation_p.R220H	NM_001082533.1	NP_001076002.1	Q9NS85	CAH10_HUMAN	carbonic anhydrase X	295					brain development (GO:0007420)			p.R295H(1)		cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|skin(3)|stomach(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		Zonisamide(DB00909)	GCGGATGCAGCGGTTGTTGAG	0.527													C|||	1	0.000199681	0.0	0.0	5008	,	,		20658	0.0		0.001	False		,,,				2504	0.0				p.R295H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G884A	17						.						128.0	111.0	117.0					17																	49710917		2203	4300	6503	47065916	SO:0001583	missense	56934	exon8			AF288385	CCDS32684.1	17q21	2012-08-21			ENSG00000154975	ENSG00000154975		"""Carbonic anhydrases"""	1369	protein-coding gene	gene with protein product		604642				8673298, 9921901	Standard	NM_020178		Approved	CARPX, CA-RPX, HUCEP-15	uc002itx.4	Q9NS85	OTTHUMG00000177544	ENST00000285273.4:c.884G>A	17.37:g.49710917C>T	ENSP00000285273:p.Arg295His	Somatic		Capture	SOLID	Phase_I	47065916	NM_020178	B2R7J0|B4DGL6	Missense_Mutation	SNP	ENST00000285273.4	37	CCDS32684.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	35	5.491476	0.96339	.	.	ENSG00000154975	ENST00000442502;ENST00000285273;ENST00000451037;ENST00000340813	T;T;T;T	0.79845	-1.31;-1.31;-1.31;-1.31	5.44	5.44	0.79542	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.051150	0.85682	D	0.000000	D	0.93517	0.7931	H	0.96996	3.92	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.95447	0.8531	10	0.87932	D	0	.	18.2623	0.90039	0.0:1.0:0.0:0.0	.	295;301;220	Q9NS85;Q68D28;B4DGL6	CAH10_HUMAN;.;.	H	295;295;295;301	ENSP00000390666:R295H;ENSP00000285273:R295H;ENSP00000405388:R295H;ENSP00000340363:R301H	ENSP00000285273:R295H	R	-	2	0	CA10	47065916	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.666000	0.83877	2.558000	0.86282	0.655000	0.94253	CGC		CA10-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000437480.1	NM_020178	
CPLX4	339302	hgsc.bcm.edu	37	18	56963955	56963955	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr18:56963955G>A	ENST00000299721.3	-	3	644	c.458C>T	c.(457-459)gCg>gTg	p.A153V	CPLX4_ENST00000587244.1_Intron	NM_181654.3	NP_857637.1	Q7Z7G2	CPLX4_HUMAN	complexin 4	153					exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter secretion (GO:0046928)	cell junction (GO:0030054)|membrane (GO:0016020)|synapse (GO:0045202)		p.A153V(1)		autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	16		Colorectal(73;0.175)				CTTCTGCTCCGCTGTCTGCTT	0.498																																					p.A153V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C458T	18						.						91.0	84.0	87.0					18																	56963955		2203	4300	6503	55114935	SO:0001583	missense	339302	exon3			AY286502	CCDS11973.1	18q21.32	2005-08-02			ENSG00000166569	ENSG00000166569			24330	protein-coding gene	gene with protein product		609586				15911881	Standard	NM_181654		Approved	CPX-IV	uc002lhy.3	Q7Z7G2	OTTHUMG00000132756	ENST00000299721.3:c.458C>T	18.37:g.56963955G>A	ENSP00000299721:p.Ala153Val	Somatic		Capture	SOLID	Phase_I	55114935	NM_181654	F1T0L6	Missense_Mutation	SNP	ENST00000299721.3	37	CCDS11973.1	.	.	.	.	.	.	.	.	.	.	G	34	5.349439	0.95830	.	.	ENSG00000166569	ENST00000299721	.	.	.	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.80019	0.4547	M	0.73962	2.25	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	T	0.81331	-0.0981	9	0.72032	D	0.01	-9.7614	19.3422	0.94347	0.0:0.0:1.0:0.0	.	153	Q7Z7G2	CPLX4_HUMAN	V	153	.	ENSP00000299721:A153V	A	-	2	0	CPLX4	55114935	1.000000	0.71417	0.205000	0.23548	0.994000	0.84299	9.393000	0.97256	2.653000	0.90120	0.561000	0.74099	GCG		CPLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256127.1	NM_181654	
NETO1	81832	hgsc.bcm.edu	37	18	70532111	70532111	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr18:70532111C>A	ENST00000327305.6	-	3	809	c.152G>T	c.(151-153)gGt>gTt	p.G51V	NETO1_ENST00000397929.1_Missense_Mutation_p.G50V|NETO1_ENST00000580049.1_5'UTR|NETO1_ENST00000299430.2_Missense_Mutation_p.G50V|NETO1_ENST00000583169.1_Missense_Mutation_p.G51V	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	51	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)		p.G51V(1)		NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		GGTAAAGATACCTCCCTCTGC	0.423																																					p.G50V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G149T	18						.						122.0	111.0	115.0					18																	70532111		2203	4300	6503	68683091	SO:0001583	missense	81832	exon3			AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.152G>T	18.37:g.70532111C>A	ENSP00000313088:p.Gly51Val	Somatic		Capture	SOLID	Phase_I	68683091	NM_138999	Q86W85|Q8ND78|Q8TDF4	Missense_Mutation	SNP	ENST00000327305.6	37	CCDS12000.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.834090	0.91036	.	.	ENSG00000166342	ENST00000327305;ENST00000299430;ENST00000397929	T;T;T	0.58060	0.36;0.36;0.7	5.7	5.7	0.88788	CUB (5);	0.000000	0.64402	D	0.000009	D	0.82715	0.5097	H	0.96080	3.765	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.87335	0.2327	10	0.87932	D	0	-14.9843	20.202	0.98263	0.0:1.0:0.0:0.0	.	50;50;51	Q8TDF5-1;Q8TDF5-2;Q8TDF5	.;.;NETO1_HUMAN	V	51;50;50	ENSP00000313088:G51V;ENSP00000299430:G50V;ENSP00000381024:G50V	ENSP00000299430:G50V	G	-	2	0	NETO1	68683091	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.776000	0.85560	2.855000	0.98099	0.650000	0.86243	GGT		NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256301.2	NM_138999	
ZNF540	163255	hgsc.bcm.edu	37	19	38103868	38103868	+	Missense_Mutation	SNP	C	C	T	rs201168289	byFrequency	TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr19:38103868C>T	ENST00000592533.1	+	5	2019	c.1687C>T	c.(1687-1689)Cgt>Tgt	p.R563C	ZNF540_ENST00000343599.5_Missense_Mutation_p.R563C|ZNF540_ENST00000316433.4_Missense_Mutation_p.R563C|ZNF540_ENST00000589117.1_Missense_Mutation_p.R531C	NM_152606.4	NP_689819.1	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540	563					negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|translation repressor activity, nucleic acid binding (GO:0000900)	p.R563C(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(13)|lung(8)|skin(1)	28			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CTTTAGTCGGCGTGGGCAGTT	0.388													C|||	2	0.000399361	0.0	0.0014	5008	,	,		19439	0.0		0.0	False		,,,				2504	0.001				p.R563C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1687T	19						.	C	CYS/ARG,CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	93.0	102.0	99.0		1687,1591,1687	-4.1	0.0	19		99	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	ZNF540	NM_152606.3,NM_001172226.1,NM_001172225.1	180,180,180	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	benign,benign,benign	563/661,531/629,563/661	38103868	2,13004	2203	4300	6503	42795708	SO:0001583	missense	163255	exon5			AL832315	CCDS12506.1, CCDS54258.1	19q13.13	2013-01-08				ENSG00000171817		"""Zinc fingers, C2H2-type"", ""-"""	25331	protein-coding gene	gene with protein product		613903					Standard	NM_152606		Approved	DKFZp547B0714	uc002ogq.4	Q8NDQ6		ENST00000592533.1:c.1687C>T	19.37:g.38103868C>T	ENSP00000466274:p.Arg563Cys	Somatic		Capture	SOLID	Phase_I	42795708	NM_152606	A0AVS5|A8K371|Q05D58|Q3LIC5|Q6ZN36|Q7Z3C8|Q86T31	Missense_Mutation	SNP	ENST00000592533.1	37	CCDS12506.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	13.88	2.368408	0.42003	2.27E-4	1.16E-4	ENSG00000171817	ENST00000316433;ENST00000343599	T	0.08634	3.07	2.05	-4.09	0.03951	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04003	0.0112	N	0.21373	0.66	0.09310	N	1	B;B	0.14438	0.01;0.006	B;B	0.06405	0.002;0.001	T	0.43988	-0.9357	9	0.33940	T	0.23	.	0.7183	0.00936	0.2719:0.2271:0.3249:0.1762	.	531;563	Q8NDQ6-2;Q8NDQ6	.;ZN540_HUMAN	C	563;531	ENSP00000324598:R563C	ENSP00000324598:R563C	R	+	1	0	ZNF540	42795708	0.000000	0.05858	0.000000	0.03702	0.960000	0.62799	-2.507000	0.00961	-0.345000	0.08325	0.305000	0.20034	CGT		ZNF540-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459481.1	NM_152606	
MAP3K10	4294	hgsc.bcm.edu	37	19	40711125	40711125	+	Silent	SNP	G	G	A			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr19:40711125G>A	ENST00000253055.3	+	4	1398	c.1110G>A	c.(1108-1110)ctG>ctA	p.L370L	AC118344.1_ENST00000408124.1_RNA	NM_002446.3	NP_002437.2	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase 10	370					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|JNK cascade (GO:0007254)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|bHLH transcription factor binding (GO:0043425)|JUN kinase kinase kinase activity (GO:0004706)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription corepressor activity (GO:0003714)	p.L370L(1)		NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						AGATGCCACTGGAGTCCTTCC	0.572																																					p.L370L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1110A	19						.						80.0	77.0	78.0					19																	40711125		2203	4300	6503	45402965	SO:0001819	synonymous_variant	4294	exon4			X90846	CCDS12549.1	19q13.2	2014-08-12			ENSG00000130758		2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6849	protein-coding gene	gene with protein product	"""MKN28 kinase"", ""mixed lineage kinase 2"", ""MKN28 derived nonreceptor_type serine/threonine kinase"""	600137		MLK2		8536694, 7731697	Standard	NM_002446		Approved	MST, MEKK10	uc002ona.3	Q02779	OTTHUMG00000182591	ENST00000253055.3:c.1110G>A	19.37:g.40711125G>A		Somatic		Capture	SOLID	Phase_I	45402965	NM_002446	Q12761|Q14871	Silent	SNP	ENST00000253055.3	37	CCDS12549.1																																																																																				MAP3K10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462552.1	NM_002446	
FUT1	2523	hgsc.bcm.edu	37	19	49253517	49253517	+	Missense_Mutation	SNP	G	G	A	rs146216905		TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr19:49253517G>A	ENST00000310160.3	-	4	1996	c.1022C>T	c.(1021-1023)cCg>cTg	p.P341L	FUT1_ENST00000601931.1_5'Flank	NM_000148.3	NP_000139.1	P19526	FUT1_HUMAN	fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group)	341					carbohydrate metabolic process (GO:0005975)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	fucosyltransferase activity (GO:0008417)|galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)	p.P341L(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(3)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	17		all_lung(116;1.7e-06)|all_epithelial(76;3.52e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000135)|all cancers(93;0.000354)|Epithelial(262;0.0191)|GBM - Glioblastoma multiforme(486;0.0222)		GGCCGCCTCCGGCTTAAAGAT	0.572													G|||	1	0.000199681	0.0	0.0	5008	,	,		19326	0.0		0.001	False		,,,				2504	0.0				p.P341L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1022T	19						.	G	LEU/PRO	0,4406		0,0,2203	44.0	41.0	42.0		1022	4.7	0.6	19	dbSNP_134	42	4,8596	3.7+/-12.6	0,4,4296	yes	missense	FUT1	NM_000148.3	98	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	probably-damaging	341/366	49253517	4,13002	2203	4300	6503	53945329	SO:0001583	missense	2523	exon4				CCDS12733.1	19q13.33	2014-07-19	2006-01-19		ENSG00000174951	ENSG00000174951	2.4.1.69	"""Blood group antigens"", ""Fucosyltransferases"""	4012	protein-coding gene	gene with protein product		211100	"""fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, Bombay phenotype included)"", ""fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase)"""	H, HSC			Standard	NM_000148		Approved		uc002pkk.3	P19526		ENST00000310160.3:c.1022C>T	19.37:g.49253517G>A	ENSP00000312021:p.Pro341Leu	Somatic		Capture	SOLID	Phase_I	53945329	NM_000148	O14505|O14506|O14507	Missense_Mutation	SNP	ENST00000310160.3	37	CCDS12733.1	.	.	.	.	.	.	.	.	.	.	G	12.69	2.014220	0.35511	0.0	4.65E-4	ENSG00000174951	ENST00000310160;ENST00000539428	D	0.94793	-3.52	4.69	4.69	0.59074	.	0.103160	0.43747	D	0.000526	D	0.96920	0.8994	M	0.85373	2.75	0.23754	N	0.996939	D	0.89917	1.0	D	0.97110	1.0	D	0.91483	0.5206	10	0.66056	D	0.02	-2.8763	10.5302	0.44973	0.0:0.0:0.8069:0.193	.	341	P19526	FUT1_HUMAN	L	341;331	ENSP00000312021:P341L	ENSP00000312021:P341L	P	-	2	0	FUT1	53945329	0.998000	0.40836	0.557000	0.28306	0.070000	0.16714	3.552000	0.53705	2.619000	0.88677	0.561000	0.74099	CCG		FUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466194.1	NM_000148	
ELF3	1999	hgsc.bcm.edu	37	1	201983015	201983016	+	Frame_Shift_Ins	INS	-	-	AACG	rs569552742		TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	-	-	-	AACG	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr1:201983015_201983016insAACG	ENST00000359651.3	+	7	4056_4057	c.864_865insAACG	c.(865-867)aacfs	p.-290fs	ELF3_ENST00000367283.3_Frame_Shift_Ins_p.-290fs|RP11-510N19.5_ENST00000504773.1_RNA|ELF3_ENST00000367284.5_Frame_Shift_Ins_p.-290fs					E74-like factor 3 (ets domain transcription factor, epithelial-specific )									p.G291fs*11(1)		breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	20						ACCCGGAGCTCAACGAGGGCCT	0.594																																					p.L288fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.864_865insAACG	1						.																																			200249639	SO:0001589	frameshift_variant	1999	exon8			AF016295	CCDS1419.1	1q32.2	2008-02-05			ENSG00000163435	ENSG00000163435			3318	protein-coding gene	gene with protein product		602191		ESX		9395241, 9129154	Standard	NM_001114309		Approved	EPR-1, ESE-1, ERT	uc001gxh.4	P78545	OTTHUMG00000035867	ENST00000359651.3:c.865_868dupAACG	1.37:g.201983016_201983019dupAACG	ENSP00000352673:p.Glu290fs	Somatic		Capture	SOLID	Phase_I	200249638	NM_001114309		Frame_Shift_Ins	INS	ENST00000359651.3	37	CCDS1419.1																																																																																				ELF3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087360.1	NM_004433	
PLOD1	5351	hgsc.bcm.edu	37	1	12017947	12017947	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr1:12017947G>A	ENST00000196061.4	+	8	817	c.790G>A	c.(790-792)Gaa>Aaa	p.E264K	PLOD1_ENST00000376369.3_Missense_Mutation_p.E311K|PLOD1_ENST00000485046.1_3'UTR	NM_000302.3	NP_000293.2	Q02809	PLOD1_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1	264					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|extracellular matrix organization (GO:0030198)|hydroxylysine biosynthetic process (GO:0046947)|oxidation-reduction process (GO:0055114)|response to hypoxia (GO:0001666)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)|protein homodimerization activity (GO:0042803)	p.E264K(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000809)|KIRC - Kidney renal clear cell carcinoma(229;0.00267)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	Succinic acid(DB00139)|Vitamin C(DB00126)	CTGGACCTTCGAAACAGGCTG	0.637																																					p.E264K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G790A	1						.						113.0	105.0	108.0					1																	12017947		2203	4300	6503	11940534	SO:0001583	missense	5351	exon8			BC016657	CCDS142.1	1p36.22	2011-08-25	2011-08-24	2004-12-14	ENSG00000083444	ENSG00000083444	1.14.11.4		9081	protein-coding gene	gene with protein product	"""lysyl hydroxlase 1"""	153454	"""procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase, Ehlers-Danlos syndrome type VI)"""	LLH, PLOD		1577494	Standard	NM_000302		Approved	LH1	uc001atm.3	Q02809	OTTHUMG00000002393	ENST00000196061.4:c.790G>A	1.37:g.12017947G>A	ENSP00000196061:p.Glu264Lys	Somatic		Capture	SOLID	Phase_I	11940534	NM_000302	B4DR87|Q96AV9|Q9H132	Missense_Mutation	SNP	ENST00000196061.4	37	CCDS142.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.803924	0.90623	.	.	ENSG00000083444	ENST00000376369;ENST00000429000;ENST00000196061	T;T;T	0.65732	-0.17;1.61;-0.17	4.69	3.75	0.43078	.	0.053206	0.64402	D	0.000001	T	0.67458	0.2895	M	0.84948	2.725	0.58432	D	0.999999	D;P	0.61080	0.989;0.939	B;B	0.43867	0.434;0.284	T	0.75614	-0.3257	10	0.66056	D	0.02	.	13.7833	0.63094	0.0:0.1548:0.8452:0.0	.	311;264	B4DR87;Q02809	.;PLOD1_HUMAN	K	311;266;264	ENSP00000365548:E311K;ENSP00000405372:E266K;ENSP00000196061:E264K	ENSP00000196061:E264K	E	+	1	0	PLOD1	11940534	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.579000	0.82511	1.156000	0.42514	0.561000	0.74099	GAA		PLOD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000006865.1	NM_000302	
COL11A1	1301	hgsc.bcm.edu	37	1	103467497	103467497	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr1:103467497C>A	ENST00000370096.3	-	24	2438	c.2126G>T	c.(2125-2127)gGt>gTt	p.G709V	COL11A1_ENST00000512756.1_Missense_Mutation_p.G593V|COL11A1_ENST00000358392.2_Missense_Mutation_p.G721V|COL11A1_ENST00000353414.4_Missense_Mutation_p.G670V|COL11A1_ENST00000461720.1_5'UTR	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	709	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.G721V(1)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		ACCAGGAGGACCAATTGGACC	0.353																																					p.G709V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2126T	1						.						101.0	101.0	101.0					1																	103467497		2203	4299	6502	103240085	SO:0001583	missense	1301	exon24			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.2126G>T	1.37:g.103467497C>A	ENSP00000359114:p.Gly709Val	Somatic		Capture	SOLID	Phase_I	103240085	NM_001854	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.734046	0.89482	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756	D;D;D;D	0.99637	-6.29;-6.29;-6.29;-6.29	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.99802	0.9915	H	0.94698	3.57	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;1.0;1.0;0.999	D	0.97332	0.9951	10	0.87932	D	0	.	19.949	0.97192	0.0:1.0:0.0:0.0	.	593;670;721;709	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	V	709;721;670;593	ENSP00000359114:G709V;ENSP00000351163:G721V;ENSP00000302551:G670V;ENSP00000426533:G593V	ENSP00000302551:G670V	G	-	2	0	COL11A1	103240085	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.990000	0.76225	2.706000	0.92434	0.655000	0.94253	GGT		COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
ADAM30	11085	hgsc.bcm.edu	37	1	120437809	120437809	+	Missense_Mutation	SNP	G	G	A	rs141186333		TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr1:120437809G>A	ENST00000369400.1	-	1	1309	c.1151C>T	c.(1150-1152)tCg>tTg	p.S384L		NM_021794.3	NP_068566.2	Q9UKF2	ADA30_HUMAN	ADAM metallopeptidase domain 30	384	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.S384L(1)		NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(16)|ovary(2)|skin(2)	38	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;1.55e-06)|Lung NSC(69;1.04e-05)|all_epithelial(167;0.00138)		Lung(183;0.0204)|LUSC - Lung squamous cell carcinoma(189;0.117)		TGTTGCTCCCGAAGAGATATG	0.413													G|||	1	0.000199681	0.0	0.0014	5008	,	,		22065	0.0		0.0	False		,,,				2504	0.0				p.S384L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1151T	1						.	G	LEU/SER	0,4406		0,0,2203	116.0	121.0	119.0		1151	-9.1	0.0	1	dbSNP_134	119	8,8592	5.7+/-21.5	0,8,4292	yes	missense	ADAM30	NM_021794.3	145	0,8,6495	AA,AG,GG		0.093,0.0,0.0615	benign	384/791	120437809	8,12998	2203	4300	6503	120239332	SO:0001583	missense	11085	exon1			AF171932	CCDS907.1	1p12	2012-05-16	2005-08-18		ENSG00000134249	ENSG00000134249		"""ADAM metallopeptidase domain containing"""	208	protein-coding gene	gene with protein product		604779	"""a disintegrin and metalloproteinase domain 30"""				Standard	NM_021794		Approved	svph4	uc001eij.3	Q9UKF2	OTTHUMG00000012176	ENST00000369400.1:c.1151C>T	1.37:g.120437809G>A	ENSP00000358407:p.Ser384Leu	Somatic		Capture	SOLID	Phase_I	120239332	NM_021794	A8K8W8|Q5T3X6|Q9UKF1	Missense_Mutation	SNP	ENST00000369400.1	37	CCDS907.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	11.03	1.519198	0.27211	0.0	9.3E-4	ENSG00000134249	ENST00000369400;ENST00000543066	T	0.64438	-0.1	4.88	-9.07	0.00724	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	3.053280	0.01374	N	0.012689	T	0.23014	0.0556	L	0.51422	1.61	0.09310	N	1	B	0.19817	0.039	B	0.22152	0.038	T	0.16276	-1.0408	10	0.23891	T	0.37	.	1.4456	0.02364	0.3134:0.096:0.1515:0.4391	.	384	Q9UKF2	ADA30_HUMAN	L	384	ENSP00000358407:S384L	ENSP00000358407:S384L	S	-	2	0	ADAM30	120239332	0.000000	0.05858	0.000000	0.03702	0.077000	0.17291	-2.033000	0.01425	-1.650000	0.01506	0.563000	0.77884	TCG		ADAM30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033678.1	NM_021794	
KIAA0907	22889	hgsc.bcm.edu	37	1	155883954	155883954	+	Silent	SNP	T	T	C			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr1:155883954T>C	ENST00000368321.3	-	14	1826	c.1803A>G	c.(1801-1803)caA>caG	p.Q601Q	RIT1_ENST00000539040.1_5'Flank|RIT1_ENST00000368323.3_5'Flank|KIAA0907_ENST00000368320.3_3'UTR	NM_014949.2	NP_055764.2	Q7Z7F0	K0907_HUMAN	KIAA0907	601							RNA binding (GO:0003723)	p.Q601Q(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|urinary_tract(1)	21	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			TAGCTCGTGGTTGTGATGAAG	0.443																																					p.Q601Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1803G	1						.						162.0	142.0	149.0					1																	155883954		2203	4300	6503	154150578	SO:0001819	synonymous_variant	22889	exon14			BC062637	CCDS30885.1	1q22	2012-11-30			ENSG00000132680	ENSG00000132680			29145	protein-coding gene	gene with protein product						10048485	Standard	NM_014949		Approved	BLOM7	uc001fmi.1	Q7Z7F0	OTTHUMG00000014103	ENST00000368321.3:c.1803A>G	1.37:g.155883954T>C		Somatic		Capture	SOLID	Phase_I	154150578	NM_014949	O94981|Q7L7Q2|Q7Z7E9|Q8TBQ0	Silent	SNP	ENST00000368321.3	37	CCDS30885.1																																																																																				KIAA0907-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039583.1	NM_014949	
OR10X1	128367	hgsc.bcm.edu	37	1	158549277	158549277	+	Missense_Mutation	SNP	C	C	T	rs41273507	byFrequency	TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr1:158549277C>T	ENST00000368150.1	-	1	412	c.413G>A	c.(412-414)cGc>cAc	p.R138H		NM_001004477.1	NP_001004477.1	Q8NGY0	O10X1_HUMAN	olfactory receptor, family 10, subfamily X, member 1 (gene/pseudogene)	138						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R138H(1)		breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(22)|ovary(2)|skin(2)|urinary_tract(1)	37	all_hematologic(112;0.0378)					GGCCAGGAAGCGGTCATATCC	0.458													C|||	5	0.000998403	0.0	0.0	5008	,	,		22562	0.0		0.004	False		,,,				2504	0.001				p.R138H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G413A	1						.	C	HIS/ARG	3,4403	8.1+/-20.4	0,3,2200	82.0	83.0	83.0		413	5.0	0.6	1	dbSNP_127	83	18,8582	12.6+/-44.7	0,18,4282	yes	missense	OR10X1	NM_001004477.1	29	0,21,6482	TT,TC,CC		0.2093,0.0681,0.1615	probably-damaging	138/327	158549277	21,12985	2203	4300	6503	156815901	SO:0001583	missense	128367	exon1			BK004194	CCDS30900.1	1q23.1	2013-10-10	2013-10-10	2004-03-10	ENSG00000186400	ENSG00000186400		"""GPCR / Class A : Olfactory receptors"""	14995	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily X, member 1"""	OR10X1P			Standard	NM_001004477		Approved		uc010pin.2	Q8NGY0	OTTHUMG00000019635	ENST00000368150.1:c.413G>A	1.37:g.158549277C>T	ENSP00000357132:p.Arg138His	Somatic		Capture	SOLID	Phase_I	156815901	NM_001004477	Q6IFR8	Missense_Mutation	SNP	ENST00000368150.1	37	CCDS30900.1	3	0.0013736263736263737	0	0.0	0	0.0	0	0.0	3	0.00395778364116095	C	17.83	3.484824	0.63962	6.81E-4	0.002093	ENSG00000186400	ENST00000368150	T	0.77489	-1.1	5.0	5.0	0.66597	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48767	D	0.000172	D	0.87489	0.6190	M	0.85373	2.75	0.43564	D	0.995882	D	0.89917	1.0	D	0.71414	0.973	D	0.89221	0.3571	10	0.87932	D	0	.	17.2345	0.86995	0.0:1.0:0.0:0.0	rs41273507	138	Q8NGY0	O10X1_HUMAN	H	138	ENSP00000357132:R138H	ENSP00000357132:R138H	R	-	2	0	OR10X1	156815901	1.000000	0.71417	0.618000	0.29105	0.173000	0.22820	5.560000	0.67332	2.579000	0.87056	0.557000	0.71058	CGC		OR10X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051850.2	NM_001004477	
OR6K3	391114	hgsc.bcm.edu	37	1	158687151	158687151	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr1:158687151C>A	ENST00000368146.1	-	1	802	c.803G>T	c.(802-804)gGc>gTc	p.G268V	OR6K3_ENST00000368145.1_Missense_Mutation_p.G252V			Q8NGY3	OR6K3_HUMAN	olfactory receptor, family 6, subfamily K, member 3	268						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G268V(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)	41	all_hematologic(112;0.0378)					TGATACACTGCCAAAGAATAT	0.448																																					p.G252V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G755T	1						.						136.0	117.0	124.0					1																	158687151		2203	4300	6503	156953775	SO:0001583	missense	391114	exon1			AB065633	CCDS30903.1, CCDS30903.2	1q23.1	2012-08-09			ENSG00000203757	ENSG00000203757		"""GPCR / Class A : Olfactory receptors"""	15030	protein-coding gene	gene with protein product							Standard	NM_001005327		Approved		uc021pbn.1	Q8NGY3	OTTHUMG00000022770	ENST00000368146.1:c.803G>T	1.37:g.158687151C>A	ENSP00000357128:p.Gly268Val	Somatic		Capture	SOLID	Phase_I	156953775	NM_001005327	Q5VUV0|Q6IFR5	Missense_Mutation	SNP	ENST00000368146.1	37		.	.	.	.	.	.	.	.	.	.	C	14.50	2.552492	0.45487	.	.	ENSG00000203757	ENST00000368145;ENST00000368146	T;T	0.35605	1.3;1.3	3.77	2.86	0.33363	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.40171	0.1106	M	0.72479	2.2	0.41461	D	0.988045	D	0.64830	0.994	P	0.59012	0.85	T	0.40905	-0.9538	9	0.66056	D	0.02	.	10.3267	0.43798	0.0:0.8989:0.0:0.1011	.	268	Q8NGY3	OR6K3_HUMAN	V	252;268	ENSP00000357127:G252V;ENSP00000357128:G268V	ENSP00000357127:G252V	G	-	2	0	OR6K3	156953775	0.000000	0.05858	0.183000	0.23137	0.118000	0.20060	-0.281000	0.08456	0.907000	0.36646	0.467000	0.42956	GGC		OR6K3-201	KNOWN	basic	protein_coding	protein_coding			
LUZP1	7798	hgsc.bcm.edu	37	1	23417961	23417961	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr1:23417961A>G	ENST00000302291.4	-	4	3595	c.2794T>C	c.(2794-2796)Tct>Cct	p.S932P	LUZP1_ENST00000374623.3_Missense_Mutation_p.S932P|LUZP1_ENST00000314174.5_Missense_Mutation_p.S932P|LUZP1_ENST00000418342.1_Missense_Mutation_p.S932P			Q86V48	LUZP1_HUMAN	leucine zipper protein 1	932					artery development (GO:0060840)|neural fold bending (GO:0021503)|ventricular septum development (GO:0003281)	membrane (GO:0016020)|nucleus (GO:0005634)		p.S932P(1)		NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(2)	31		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Ovarian(437;0.00373)|Breast(348;0.00815)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;4.88e-27)|Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;4.31e-06)|GBM - Glioblastoma multiforme(114;8.64e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00176)|STAD - Stomach adenocarcinoma(196;0.0146)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0967)|LUSC - Lung squamous cell carcinoma(448;0.199)		TCTTCTAAAGATTTCAAGTCT	0.478																																					p.S932P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2794C	1						.						108.0	110.0	109.0					1																	23417961		2203	4300	6503	23290548	SO:0001583	missense	7798	exon4			BC051733	CCDS30628.1	1p36	2008-02-05			ENSG00000169641	ENSG00000169641			14985	protein-coding gene	gene with protein product		601422				8812416	Standard	NM_033631		Approved	LUZP	uc010odv.1	Q86V48	OTTHUMG00000003227	ENST00000302291.4:c.2794T>C	1.37:g.23417961A>G	ENSP00000303758:p.Ser932Pro	Somatic		Capture	SOLID	Phase_I	23290548	NM_033631	Q5TH93|Q8N4X3|Q8TEH1	Missense_Mutation	SNP	ENST00000302291.4	37	CCDS30628.1	.	.	.	.	.	.	.	.	.	.	A	16.96	3.266598	0.59540	.	.	ENSG00000169641	ENST00000418342;ENST00000374623;ENST00000302291;ENST00000314174	T;T;T;T	0.20881	2.24;2.24;2.24;2.04	5.08	5.08	0.68730	.	0.141869	0.32987	N	0.005402	T	0.33030	0.0849	L	0.44542	1.39	0.26583	N	0.973338	D;D	0.64830	0.994;0.994	P;P	0.61800	0.894;0.894	T	0.09552	-1.0669	10	0.33940	T	0.23	.	12.6249	0.56623	1.0:0.0:0.0:0.0	.	932;932	Q86V48-2;Q86V48	.;LUZP1_HUMAN	P	932	ENSP00000393460:S932P;ENSP00000363752:S932P;ENSP00000303758:S932P;ENSP00000313705:S932P	ENSP00000303758:S932P	S	-	1	0	LUZP1	23290548	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	3.891000	0.56227	1.933000	0.56026	0.397000	0.26171	TCT		LUZP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008900.3	NM_033631	
ZMYM4	9202	hgsc.bcm.edu	37	1	35855606	35855606	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr1:35855606C>T	ENST00000314607.6	+	15	2574	c.2494C>T	c.(2494-2496)Cga>Tga	p.R832*	ZMYM4_ENST00000373297.2_Nonsense_Mutation_p.R743*	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	832					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.R832*(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CTTGAAATGGCGAGGGGAAAT	0.388																																					p.R832X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2494T	1						.						148.0	139.0	142.0					1																	35855606		2203	4300	6503	35628193	SO:0001587	stop_gained	9202	exon15			AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.2494C>T	1.37:g.35855606C>T	ENSP00000322915:p.Arg832*	Somatic		Capture	SOLID	Phase_I	35628193	NM_005095	A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Nonsense_Mutation	SNP	ENST00000314607.6	37	CCDS389.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.153936|6.153936	0.97329|0.97329	.|.	.|.	ENSG00000146463|ENSG00000146463	ENST00000457946|ENST00000314607;ENST00000373297	.|.	.|.	.|.	5.39|5.39	4.46|4.46	0.54185|0.54185	.|.	.|0.372428	.|0.24206	.|N	.|0.040572	T|.	0.33527|.	0.0866|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.34204|.	-0.9838|.	3|.	.|0.02654	.|T	.|1	-6.6399|-6.6399	13.0919|13.0919	0.59171|0.59171	0.2923:0.7077:0.0:0.0|0.2923:0.7077:0.0:0.0	.|.	.|.	.|.	.|.	V|X	491|832;743	.|.	.|ENSP00000322915:R832X	A|R	+|+	2|1	0|2	ZMYM4|ZMYM4	35628193|35628193	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	0.759000|0.759000	0.26461|0.26461	1.237000|1.237000	0.43756|0.43756	0.591000|0.591000	0.81541|0.81541	GCG|CGA		ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012207.3	NM_005095	
LPPR4	9890	hgsc.bcm.edu	37	1	99772387	99772387	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr1:99772387G>A	ENST00000370185.3	+	7	2610	c.2113G>A	c.(2113-2115)Gtc>Atc	p.V705I	LPPR4_ENST00000370184.1_Missense_Mutation_p.V547I|LPPR4_ENST00000457765.1_Missense_Mutation_p.V647I	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		705					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)	p.V705I(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		CACCATCCGCGTCACCCCAGT	0.512																																					p.V705I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2113A	1						.						65.0	57.0	60.0					1																	99772387		2203	4300	6503	99544975	SO:0001583	missense	9890	exon7																														ENST00000370185.3:c.2113G>A	1.37:g.99772387G>A	ENSP00000359204:p.Val705Ile	Somatic		Capture	SOLID	Phase_I	99544975	NM_014839	E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Missense_Mutation	SNP	ENST00000370185.3	37	CCDS757.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.603781	0.87157	.	.	ENSG00000117600	ENST00000370185;ENST00000457765;ENST00000370184	T;T;T	0.27104	2.25;2.2;1.69	6.02	6.02	0.97574	.	0.416961	0.26761	N	0.022631	T	0.38401	0.1039	L	0.47716	1.5	0.80722	D	1	D;D	0.71674	0.998;0.994	D;P	0.73708	0.981;0.543	T	0.01033	-1.1474	9	.	.	.	-36.1055	20.5407	0.99260	0.0:0.0:1.0:0.0	.	647;705	E7EPS1;Q7Z2D5	.;LPPR4_HUMAN	I	705;647;547	ENSP00000359204:V705I;ENSP00000394913:V647I;ENSP00000359203:V547I	.	V	+	1	0	RP4-788L13.1	99544975	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.438000	0.97539	2.865000	0.98341	0.655000	0.94253	GTC		LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029670.2		
HRNR	388697	hgsc.bcm.edu	37	1	152191466	152191466	+	Missense_Mutation	SNP	C	C	T	rs376040395	byFrequency	TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr1:152191466C>T	ENST00000368801.2	-	3	2714	c.2639G>A	c.(2638-2640)cGc>cAc	p.R880H	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	880					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.R880H(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATGTCGGCCGCGGCCCGAAGC	0.627													C|||	2	0.000399361	0.0	0.0	5008	,	,		20954	0.0		0.001	False		,,,				2504	0.001				p.R880H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2639A	1						.	C	HIS/ARG	0,4406		0,0,2203	87.0	95.0	93.0		2639	-4.1	0.0	1		93	1,8599	1.2+/-3.3	0,1,4299	no	missense	HRNR	NM_001009931.1	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	880/2851	152191466	1,13005	2203	4300	6503	150458090	SO:0001583	missense	388697	exon3			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.2639G>A	1.37:g.152191466C>T	ENSP00000357791:p.Arg880His	Somatic		Capture	SOLID	Phase_I	150458090	NM_001009931	Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	C	3.616	-0.078540	0.07184	0.0	1.16E-4	ENSG00000197915	ENST00000368801	T	0.01871	4.59	2.07	-4.14	0.03892	.	.	.	.	.	T	0.00271	0.0008	N	0.19112	0.55	0.09310	N	1	P	0.46578	0.88	B	0.19946	0.027	T	0.49214	-0.8963	9	0.15499	T	0.54	.	4.0907	0.09968	0.0:0.2699:0.3225:0.4077	.	880	Q86YZ3	HORN_HUMAN	H	880	ENSP00000357791:R880H	ENSP00000357791:R880H	R	-	2	0	HRNR	150458090	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.906000	0.00171	-2.279000	0.00676	-0.362000	0.07510	CGC		HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
ADORA1	134	hgsc.bcm.edu	37	1	203098226	203098226	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr1:203098226C>T	ENST00000367236.4	+	2	1178	c.257C>T	c.(256-258)cCg>cTg	p.P86L	ADORA1_ENST00000367235.1_Missense_Mutation_p.P86L|ADORA1_ENST00000337894.4_Missense_Mutation_p.P86L|RP11-335O13.7_ENST00000421055.1_RNA|ADORA1_ENST00000309502.3_Missense_Mutation_p.P86L	NM_001048230.1	NP_001041695.1	P30542	AA1R_HUMAN	adenosine A1 receptor	86					activation of MAPKK activity (GO:0000186)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|cognition (GO:0050890)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood pressure (GO:0045776)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, non-REM sleep (GO:0042323)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of heart contraction (GO:0045822)|negative regulation of hormone secretion (GO:0046888)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of mucus secretion (GO:0070256)|negative regulation of neurotrophin production (GO:0032900)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of vasodilation (GO:0045908)|nervous system development (GO:0007399)|phagocytosis (GO:0006909)|positive regulation of blood pressure (GO:0045777)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of nucleoside transport (GO:0032244)|positive regulation of peptide secretion (GO:0002793)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of protein dephosphorylation (GO:0035307)|protein targeting to membrane (GO:0006612)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of glomerular filtration (GO:0003093)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|relaxation of vascular smooth muscle (GO:0060087)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|temperature homeostasis (GO:0001659)	asymmetric synapse (GO:0032279)|axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled adenosine receptor activity (GO:0001609)|phospholipase C activity (GO:0004629)|purine nucleoside binding (GO:0001883)	p.P86L(2)		central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(9)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	25					Adenosine(DB00640)|Aminophylline(DB01223)|Caffeine(DB00201)|Defibrotide(DB04932)|Dyphylline(DB00651)|Enprofylline(DB00824)|Gabapentin(DB00996)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Theobromine(DB01412)|Theophylline(DB00277)	GTTGCCTGTCCGGTCCTCATC	0.627																																					p.P86L												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.C257T	1						.						194.0	177.0	182.0					1																	203098226		2203	4300	6503	201364849	SO:0001583	missense	134	exon2			BC026340	CCDS1434.1	1q32.1	2012-08-08			ENSG00000163485	ENSG00000163485		"""GPCR / Class A : Adenosine receptors"""	262	protein-coding gene	gene with protein product		102775				1662665, 2541503	Standard	NM_001048230		Approved	RDC7	uc001gzf.1	P30542	OTTHUMG00000042125	ENST00000367236.4:c.257C>T	1.37:g.203098226C>T	ENSP00000356205:p.Pro86Leu	Somatic		Capture	SOLID	Phase_I	201364849	NM_001048230	A6NFY5|A6NGP4|A8K1L3|B3KXQ4|D2CGD0|Q6FHK3|Q8TAM8	Missense_Mutation	SNP	ENST00000367236.4	37	CCDS1434.1	.	.	.	.	.	.	.	.	.	.	C	9.697	1.153357	0.21371	.	.	ENSG00000163485	ENST00000309502;ENST00000367236;ENST00000337894;ENST00000367235	T;T;T;T	0.28666	1.6;1.6;1.6;1.6	5.17	5.17	0.71159	GPCR, rhodopsin-like superfamily (1);	0.157286	0.56097	D	0.000027	T	0.12008	0.0292	N	0.04508	-0.205	0.58432	D	0.999999	P;B	0.35481	0.504;0.004	B;B	0.29440	0.102;0.002	T	0.18967	-1.0320	10	0.09338	T	0.73	-9.5203	12.0785	0.53657	0.0:0.9208:0.0:0.0792	.	119;86	B7Z379;P30542	.;AA1R_HUMAN	L	86	ENSP00000308549:P86L;ENSP00000356205:P86L;ENSP00000338435:P86L;ENSP00000356204:P86L	ENSP00000308549:P86L	P	+	2	0	ADORA1	201364849	0.999000	0.42202	0.997000	0.53966	0.987000	0.75469	4.088000	0.57678	2.389000	0.81357	0.655000	0.94253	CCG		ADORA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100273.1	NM_000674	
SYS1	90196	hgsc.bcm.edu	37	20	43994315	43994315	+	Silent	SNP	C	C	T			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr20:43994315C>T	ENST00000243918.5	+	3	510	c.219C>T	c.(217-219)aaC>aaT	p.N73N	SYS1-DBNDD2_ENST00000475242.1_3'UTR|SYS1_ENST00000414310.1_Silent_p.N52N|SYS1_ENST00000479779.1_3'UTR|SYS1_ENST00000372727.1_Silent_p.N73N|SYS1-DBNDD2_ENST00000452133.1_Silent_p.N73N|SYS1_ENST00000426004.1_Silent_p.N73N	NM_033542.3	NP_291020.1	Q8N2H4	SYS1_HUMAN	Sys1 golgi trafficking protein	73					protein transport (GO:0015031)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)		p.N73N(1)		cervix(1)|endometrium(2)|large_intestine(2)|prostate(1)|skin(1)	7		Myeloproliferative disorder(115;0.0122)				TCATCCTCAACGCCCTCACCT	0.502																																					p.N73N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C219T	20						.						233.0	231.0	232.0					20																	43994315		2203	4300	6503	43427729	SO:0001819	synonymous_variant	90196	exon3			AL021578	CCDS13351.1, CCDS56192.1	20q13.12	2014-05-07	2014-05-07	2006-11-06	ENSG00000204070	ENSG00000204070			16162	protein-coding gene	gene with protein product		612979	"""chromosome 20 open reading frame 169"", ""SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae)"""	C20orf169		15077113	Standard	NM_001197129		Approved	dJ453C12.4	uc002xnv.3	Q8N2H4	OTTHUMG00000032579	ENST00000243918.5:c.219C>T	20.37:g.43994315C>T		Somatic		Capture	SOLID	Phase_I	43427729	NM_001099791	C9JFB3|E1P620|Q5QPU7|Q96SD8|Q9BQZ2|Q9BQZ4|Q9H1F7	Silent	SNP	ENST00000243918.5	37	CCDS13351.1																																																																																				SYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079453.2	NM_033542	
GMEB2	26205	hgsc.bcm.edu	37	20	62224377	62224377	+	Silent	SNP	G	G	A			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr20:62224377G>A	ENST00000266068.1	-	6	1156	c.678C>T	c.(676-678)acC>acT	p.T226T	GMEB2_ENST00000370077.1_Silent_p.T226T|GMEB2_ENST00000370069.1_Silent_p.T175T			Q9UKD1	GMEB2_HUMAN	glucocorticoid modulatory element binding protein 2	226					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)	p.T226T(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	18	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)			CAATGGCCGCGGTCCAGTCGC	0.627																																					p.T226T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C678T	20						.						60.0	52.0	55.0					20																	62224377		2203	4300	6503	61694821	SO:0001819	synonymous_variant	26205	exon7			AF173867	CCDS13528.1	20q13.33	2008-07-02			ENSG00000101216	ENSG00000101216			4371	protein-coding gene	gene with protein product		607451				10523663, 11743720	Standard	NM_012384		Approved	P79PIF, KIAA1269, PIF79	uc002yfq.1	Q9UKD1	OTTHUMG00000032988	ENST00000266068.1:c.678C>T	20.37:g.62224377G>A		Somatic		Capture	SOLID	Phase_I	61694821	NM_012384	E1P5J3|Q5TDS0|Q9H431|Q9H4X7|Q9H4X8|Q9UF78|Q9ULF1	Silent	SNP	ENST00000266068.1	37	CCDS13528.1																																																																																				GMEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080166.1	NM_012384	
ACR	49	hgsc.bcm.edu	37	22	51177898	51177898	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr22:51177898A>G	ENST00000216139.5	+	2	317	c.277A>G	c.(277-279)Aaa>Gaa	p.K93E	ACR_ENST00000529621.1_Missense_Mutation_p.K93E|AC000036.4_ENST00000449652.1_RNA|AC002056.5_ENST00000532913.1_RNA	NM_001097.2	NP_001088.2	P10323	ACRO_HUMAN	acrosin	93	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				acrosome matrix dispersal (GO:0002077)|acrosome reaction (GO:0007340)|activation of adenylate cyclase activity (GO:0007190)|binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|response to steroid hormone (GO:0048545)|single fertilization (GO:0007338)	acrosomal matrix (GO:0043159)|extracellular region (GO:0005576)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|protein complex (GO:0043234)	amidase activity (GO:0004040)|copper ion binding (GO:0005507)|DNA binding (GO:0003677)|drug binding (GO:0008144)|fucose binding (GO:0042806)|mannose binding (GO:0005537)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)	p.K93E(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|skin(1)	7		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;1.1e-06)|LUAD - Lung adenocarcinoma(64;0.247)		CTTCGTCGGCAAAAAGTACGT	0.577																																					p.K93E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A277G	22						.						82.0	60.0	67.0					22																	51177898		2203	4300	6503	49524764	SO:0001583	missense	49	exon2			CR456366	CCDS14101.1	22q13.33	2012-10-23	2012-10-23		ENSG00000100312	ENSG00000100312	3.4.21.10		126	protein-coding gene	gene with protein product	"""preproacrosin"", ""acrosin light and heavy chain prepropeptide"""	102480				2298447, 12398221	Standard	NM_001097		Approved		uc003bnh.4	P10323	OTTHUMG00000150155	ENST00000216139.5:c.277A>G	22.37:g.51177898A>G	ENSP00000216139:p.Lys93Glu	Somatic		Capture	SOLID	Phase_I	49524764	NM_001097	Q6ICK2	Missense_Mutation	SNP	ENST00000216139.5	37	CCDS14101.1	.	.	.	.	.	.	.	.	.	.	A	11.68	1.710645	0.30322	.	.	ENSG00000100312	ENST00000216139;ENST00000529621	T;D	0.92858	0.27;-3.12	4.43	4.43	0.53597	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.665977	0.12425	N	0.470076	D	0.82967	0.5152	N	0.20807	0.61	0.09310	N	1	P;P	0.38440	0.631;0.631	B;B	0.30105	0.111;0.111	T	0.71682	-0.4519	10	0.19147	T	0.46	-6.7718	11.9647	0.53027	1.0:0.0:0.0:0.0	.	93;93	E9PLV5;P10323	.;ACRO_HUMAN	E	93	ENSP00000216139:K93E;ENSP00000435120:K93E	ENSP00000216139:K93E	K	+	1	0	ACR	49524764	0.000000	0.05858	0.270000	0.24601	0.061000	0.15899	-0.471000	0.06631	2.001000	0.58596	0.379000	0.24179	AAA		ACR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000316605.2	NM_001097	
IL1R2	7850	hgsc.bcm.edu	37	2	102641110	102641110	+	Silent	SNP	C	C	T			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr2:102641110C>T	ENST00000332549.3	+	7	1096	c.867C>T	c.(865-867)cgC>cgT	p.R289R	IL1R2_ENST00000441002.1_Silent_p.R289R|IL1R2_ENST00000393414.2_Silent_p.R289R|IL1R2_ENST00000485335.1_3'UTR	NM_004633.3	NP_004624.1	P27930	IL1R2_HUMAN	interleukin 1 receptor, type II	289	Ig-like C2-type 3.				cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)	p.R289R(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)	28						CGGGAGGCCGCGTGACCGAGG	0.577																																					p.R289R	Pancreas(106;189 1628 2302 5133 12295)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C867T	2						.						51.0	48.0	49.0					2																	102641110		2203	4300	6503	102007542	SO:0001819	synonymous_variant	7850	exon7			X59770	CCDS2054.1, CCDS58719.1	2q12	2013-01-11			ENSG00000115590	ENSG00000115590		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5994	protein-coding gene	gene with protein product		147811		IL1RB		10191101, 1833184	Standard	NM_004633		Approved	CD121b	uc002tbm.3	P27930	OTTHUMG00000130695	ENST00000332549.3:c.867C>T	2.37:g.102641110C>T		Somatic		Capture	SOLID	Phase_I	102007542	NM_173343	D3DVJ5|Q6LCE6|Q9UE68	Silent	SNP	ENST00000332549.3	37	CCDS2054.1																																																																																				IL1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253191.1	NM_004633	
NBAS	51594	hgsc.bcm.edu	37	2	15415752	15415752	+	Silent	SNP	A	A	T			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr2:15415752A>T	ENST00000281513.5	-	44	5605	c.5580T>A	c.(5578-5580)ccT>ccA	p.P1860P	NBAS_ENST00000441750.1_Silent_p.P1740P	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	1860					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.P1860P(1)		NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						TAATGAGATGAGGGTCTCCAG	0.483																																					p.P1860P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T5580A	2						.						109.0	107.0	108.0					2																	15415752		2203	4300	6503	15333203	SO:0001819	synonymous_variant	51594	exon44			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.5580T>A	2.37:g.15415752A>T		Somatic		Capture	SOLID	Phase_I	15333203	NM_015909	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Silent	SNP	ENST00000281513.5	37	CCDS1685.1	.	.	.	.	.	.	.	.	.	.	A	10.35	1.327219	0.24080	.	.	ENSG00000151779	ENST00000442506	.	.	.	5.57	1.78	0.24846	.	.	.	.	.	T	0.53867	0.1823	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44050	-0.9353	4	.	.	.	.	6.1768	0.20449	0.574:0.3101:0.1159:0.0	.	.	.	.	H	908	.	.	L	-	2	0	NBAS	15333203	0.802000	0.28943	1.000000	0.80357	0.972000	0.66771	-0.088000	0.11198	0.457000	0.26962	0.482000	0.46254	CTC		NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909	
BUB1	699	hgsc.bcm.edu	37	2	111425403	111425403	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr2:111425403T>C	ENST00000302759.6	-	7	709	c.591A>G	c.(589-591)atA>atG	p.I197M	BUB1_ENST00000409311.1_Missense_Mutation_p.I197M|BUB1_ENST00000535254.1_Missense_Mutation_p.I177M	NM_004336.3	NP_004327.1	O43683	BUB1_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase	197					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of chromosome segregation (GO:0051983)|regulation of sister chromatid cohesion (GO:0007063)|spindle assembly checkpoint (GO:0071173)|viral process (GO:0016032)	condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.I197M(1)		breast(3)|endometrium(8)|kidney(4)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|stomach(1)	45		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)		AAGCTGAAGATATCACTCCAG	0.318																																					p.I197M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A591G	2						.						151.0	163.0	159.0					2																	111425403		2203	4300	6503	111141874	SO:0001583	missense	699	exon7			AF046078	CCDS33273.1, CCDS62984.1, CCDS62985.1	2q13	2013-01-17	2013-01-17		ENSG00000169679	ENSG00000169679			1148	protein-coding gene	gene with protein product		602452	"""budding uninhibited by benzimidazoles 1 (yeast homolog)"", ""budding uninhibited by benzimidazoles 1 homolog (yeast)"""	BUB1L			Standard	NM_004336		Approved	hBUB1, BUB1A	uc002tgc.3	O43683	OTTHUMG00000153638	ENST00000302759.6:c.591A>G	2.37:g.111425403T>C	ENSP00000302530:p.Ile197Met	Somatic		Capture	SOLID	Phase_I	111141874	NM_004336	E9PC26|F5GXI5|O43430|O43643|O60626|Q53QE4	Missense_Mutation	SNP	ENST00000302759.6	37	CCDS33273.1	.	.	.	.	.	.	.	.	.	.	T	12.51	1.961068	0.34565	.	.	ENSG00000169679	ENST00000535254;ENST00000409311;ENST00000302759;ENST00000541432	T;T;T	0.30182	2.27;1.54;2.54	5.73	-9.39	0.00619	.	2.908700	0.00649	N	0.000541	T	0.10680	0.0261	N	0.02011	-0.69	0.09310	N	1	B;B;B	0.11235	0.003;0.004;0.003	B;B;B	0.10450	0.005;0.004;0.004	T	0.21042	-1.0257	10	0.34782	T	0.22	7.9325	7.6836	0.28528	0.3397:0.4916:0.0:0.1687	.	177;197;197	F5GXI5;E9PC26;O43683	.;.;BUB1_HUMAN	M	177;197;197;197	ENSP00000441013:I177M;ENSP00000386701:I197M;ENSP00000302530:I197M	ENSP00000302530:I197M	I	-	3	3	BUB1	111141874	0.000000	0.05858	0.000000	0.03702	0.968000	0.65278	-1.662000	0.01970	-1.702000	0.01411	-0.250000	0.11733	ATA		BUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331925.1	NM_004336	
CSRNP3	80034	hgsc.bcm.edu	37	2	166536038	166536038	+	Silent	SNP	C	C	T	rs144711438		TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr2:166536038C>T	ENST00000342316.4	+	5	1805	c.1533C>T	c.(1531-1533)agC>agT	p.S511S	CSRNP3_ENST00000409420.1_Silent_p.S543S|CSRNP3_ENST00000314499.7_Silent_p.S511S	NM_024969.3	NP_079245.2	Q8WYN3	CSRN3_HUMAN	cysteine-serine-rich nuclear protein 3	511					apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S511S(1)		breast(2)|cervix(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(3)|skin(2)	33						AAAATGATAGCGGTGTGCCCT	0.502																																					p.S511S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1533T	2						.	C	,	0,4406		0,0,2203	93.0	78.0	83.0		1533,1533	-0.1	0.0	2	dbSNP_134	83	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	CSRNP3	NM_001172173.1,NM_024969.3	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	511/586,511/586	166536038	1,13005	2203	4300	6503	166244284	SO:0001819	synonymous_variant	80034	exon7			AB063300	CCDS2225.1	2q24.3	2012-04-17	2009-01-07	2009-01-07	ENSG00000178662	ENSG00000178662		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30729	protein-coding gene	gene with protein product	"""TGF beta induced apotosis protein 2"", ""protein phosphatase 1, regulatory subunit 73"""		"""family with sequence similarity 130, member A2"""	FAM130A2		17726538	Standard	NM_024969		Approved	FLJ32093, TAIP-2, PPP1R73	uc002udg.3	Q8WYN3	OTTHUMG00000132145	ENST00000342316.4:c.1533C>T	2.37:g.166536038C>T		Somatic		Capture	SOLID	Phase_I	166244284	NM_001172173	B3KPR4|Q53SG0|Q6ZTX3|Q9HAF9	Silent	SNP	ENST00000342316.4	37	CCDS2225.1																																																																																				CSRNP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255191.2	NM_024969	
ERBB4	2066	hgsc.bcm.edu	37	2	212295748	212295748	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr2:212295748G>T	ENST00000342788.4	-	21	2875	c.2565C>A	c.(2563-2565)aaC>aaA	p.N855K	ERBB4_ENST00000402597.1_Missense_Mutation_p.N845K|ERBB4_ENST00000436443.1_Missense_Mutation_p.N855K	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	855	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.N855K(1)		NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	TTTTCACATGGTTTGGAGATT	0.418										TSP Lung(8;0.080)																											p.N855K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2565A	2						.						146.0	140.0	142.0					2																	212295748		2203	4300	6503	212003993	SO:0001583	missense	2066	exon21			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.2565C>A	2.37:g.212295748G>T	ENSP00000342235:p.Asn855Lys	Somatic		Capture	SOLID	Phase_I	212003993	NM_005235	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	37	CCDS2394.1	.	.	.	.	.	.	.	.	.	.	G	17.96	3.516741	0.64634	.	.	ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597	T;T;T	0.62105	0.05;0.05;0.05	5.04	3.12	0.35913	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.55273	0.1910	N	0.25094	0.71	0.80722	D	1	D;P;D;D	0.58970	0.965;0.908;0.98;0.984	P;P;P;P	0.53518	0.452;0.523;0.607;0.728	T	0.55692	-0.8101	10	0.72032	D	0.01	.	7.3936	0.26923	0.2925:0.0:0.7075:0.0	.	845;845;855;855	Q15303-4;Q15303-2;Q15303-3;Q15303	.;.;.;ERBB4_HUMAN	K	855;855;845	ENSP00000342235:N855K;ENSP00000403204:N855K;ENSP00000385565:N845K	ENSP00000342235:N855K	N	-	3	2	ERBB4	212003993	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.334000	0.33827	0.514000	0.28300	0.563000	0.77884	AAC		ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
SPRED2	200734	hgsc.bcm.edu	37	2	65541139	65541139	+	Silent	SNP	G	G	A			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr2:65541139G>A	ENST00000356388.4	-	6	942	c.753C>T	c.(751-753)taC>taT	p.Y251Y	SPRED2_ENST00000443619.2_Silent_p.Y248Y|SPRED2_ENST00000474228.1_5'Flank	NM_181784.2	NP_861449.2	Q7Z698	SPRE2_HUMAN	sprouty-related, EVH1 domain containing 2	251	KBD. {ECO:0000255|PROSITE- ProRule:PRU00821}.				inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)	p.Y251Y(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(7)|ovary(2)|upper_aerodigestive_tract(3)	34						CGAAGCGCACGTAGGAGGAGT	0.652																																					p.Y251Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C753T	2						.						66.0	64.0	65.0					2																	65541139		2203	4300	6503	65394643	SO:0001819	synonymous_variant	200734	exon6			AF052178	CCDS33211.1, CCDS46308.1	2p14	2003-06-02			ENSG00000198369	ENSG00000198369			17722	protein-coding gene	gene with protein product		609292					Standard	NM_181784		Approved	Spred-2, FLJ21897, FLJ31917	uc002sdr.4	Q7Z698	OTTHUMG00000152737	ENST00000356388.4:c.753C>T	2.37:g.65541139G>A		Somatic		Capture	SOLID	Phase_I	65394643	NM_181784	A1L3V4|B7Z5K7|D6W5F7|E9PEP0|Q2NKX6	Silent	SNP	ENST00000356388.4	37	CCDS33211.1																																																																																				SPRED2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000327632.1		
GBX2	2637	hgsc.bcm.edu	37	2	237074648	237074648	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr2:237074648C>T	ENST00000306318.4	-	2	1353	c.956G>A	c.(955-957)cGg>cAg	p.R319Q	GBX2_ENST00000551105.1_3'UTR|GBX2_ENST00000465889.1_5'UTR|AC079135.1_ENST00000483218.1_RNA|AC079135.1_ENST00000415226.1_RNA	NM_001485.2	NP_001476.2	P52951	GBX2_HUMAN	gastrulation brain homeobox 2	319					autonomic nervous system development (GO:0048483)|axon guidance (GO:0007411)|cerebellar granule cell precursor proliferation (GO:0021930)|cerebellum development (GO:0021549)|forebrain neuron development (GO:0021884)|inner ear morphogenesis (GO:0042472)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|patterning of blood vessels (GO:0001569)|rhombomere 2 development (GO:0021568)|thalamus development (GO:0021794)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R319Q(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7		Breast(86;0.00235)|Renal(207;0.00339)|all_hematologic(139;0.00357)|all_lung(227;0.0616)|Acute lymphoblastic leukemia(138;0.0775)|Ovarian(221;0.089)|Lung NSC(271;0.179)		Epithelial(121;4.5e-25)|OV - Ovarian serous cystadenocarcinoma(60;5.16e-11)|BRCA - Breast invasive adenocarcinoma(100;3.4e-05)|Lung(119;0.00195)|LUSC - Lung squamous cell carcinoma(224;0.00471)		CTTAGGGTTCCGGGAGGGCTC	0.592																																					p.R319Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G956A	2						.						122.0	112.0	115.0					2																	237074648		2203	4300	6503	236739387	SO:0001583	missense	2637	exon2			AF118452	CCDS2515.1	2q37.2	2012-03-09	2005-12-22		ENSG00000168505	ENSG00000168505		"""Homeoboxes / ANTP class : HOXL subclass"""	4186	protein-coding gene	gene with protein product		601135	"""gastrulation brain homeo box 2"""			9346236, 8838315	Standard	XM_005246071		Approved		uc002vvw.1	P52951	OTTHUMG00000133294	ENST00000306318.4:c.956G>A	2.37:g.237074648C>T	ENSP00000302251:p.Arg319Gln	Somatic		Capture	SOLID	Phase_I	236739387	NM_001485	B2RPH7|O43833|Q53RX5|Q9Y5Y1	Missense_Mutation	SNP	ENST00000306318.4	37	CCDS2515.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.334566	0.81801	.	.	ENSG00000168505	ENST00000306318	D	0.91894	-2.93	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	D	0.88470	0.6445	L	0.41236	1.265	0.80722	D	1	P	0.42973	0.796	B	0.38156	0.266	D	0.88924	0.3368	10	0.42905	T	0.14	-18.1377	17.5569	0.87894	0.0:1.0:0.0:0.0	.	319	P52951	GBX2_HUMAN	Q	319	ENSP00000302251:R319Q	ENSP00000302251:R319Q	R	-	2	0	GBX2	236739387	0.999000	0.42202	0.984000	0.44739	0.996000	0.88848	7.692000	0.84203	2.133000	0.65898	0.561000	0.74099	CGG		GBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257078.3	NM_001485	
UROC1	131669	hgsc.bcm.edu	37	3	126207087	126207087	+	Missense_Mutation	SNP	G	G	A	rs199874583		TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr3:126207087G>A	ENST00000290868.2	-	18	1797	c.1744C>T	c.(1744-1746)Cgc>Tgc	p.R582C	UROC1_ENST00000383579.3_Missense_Mutation_p.R642C	NM_144639.2	NP_653240.1	Q96N76	HUTU_HUMAN	urocanate hydratase 1	582					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	urocanate hydratase activity (GO:0016153)	p.R582C(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(1)|skin(1)	39				GBM - Glioblastoma multiforme(114;0.17)		GTGGCTCCGCGACAGGCATCT	0.612																																					p.R582C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1744T	3						.						130.0	128.0	129.0					3																	126207087		2203	4300	6503	127689777	SO:0001583	missense	131669	exon18			AK055862	CCDS3038.1, CCDS54636.1	3q21.2	2012-08-21	2012-08-21		ENSG00000159650	ENSG00000159650	4.2.1.49		26444	protein-coding gene	gene with protein product	"""urocanase 1"""	613012	"""urocanase domain containing 1"""			19304569	Standard	NM_144639		Approved	FLJ31300, HMFN0320	uc010hsi.2	Q96N76	OTTHUMG00000162753	ENST00000290868.2:c.1744C>T	3.37:g.126207087G>A	ENSP00000290868:p.Arg582Cys	Somatic		Capture	SOLID	Phase_I	127689777	NM_144639	E9PE13|Q14C64|Q68CJ7	Missense_Mutation	SNP	ENST00000290868.2	37	CCDS3038.1	.	.	.	.	.	.	.	.	.	.	G	16.13	3.037335	0.54896	.	.	ENSG00000159650	ENST00000290868;ENST00000383579	T;T	0.46819	0.86;0.86	5.46	3.56	0.40772	Urocanase domain (2);	0.000000	0.85682	D	0.000000	T	0.68403	0.2997	M	0.87827	2.91	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.71520	-0.4568	10	0.87932	D	0	-13.3842	8.09	0.30795	0.0846:0.0:0.7579:0.1575	.	642;582	E9PE13;Q96N76	.;HUTU_HUMAN	C	582;642	ENSP00000290868:R582C;ENSP00000373073:R642C	ENSP00000290868:R582C	R	-	1	0	UROC1	127689777	1.000000	0.71417	0.770000	0.31555	0.413000	0.31143	2.962000	0.49176	1.295000	0.44724	0.591000	0.81541	CGC		UROC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370325.2	NM_144639	
FAT4	79633	hgsc.bcm.edu	37	4	126355455	126355455	+	Silent	SNP	T	T	C			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr4:126355455T>C	ENST00000394329.3	+	7	7087	c.7074T>C	c.(7072-7074)aaT>aaC	p.N2358N	FAT4_ENST00000335110.5_Silent_p.N656N	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2358	Cadherin 22. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.N2358N(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						ATGATGTCAATGACAATGTCC	0.383																																					p.N2358N												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T7074C	4						.						187.0	158.0	168.0					4																	126355455		2203	4300	6503	126574905	SO:0001819	synonymous_variant	79633	exon7			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.7074T>C	4.37:g.126355455T>C		Somatic		Capture	SOLID	Phase_I	126574905	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	37	CCDS3732.3																																																																																				FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
GLRB	2743	hgsc.bcm.edu	37	4	158065029	158065029	+	Silent	SNP	C	C	T	rs147320218		TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr4:158065029C>T	ENST00000264428.4	+	8	1092	c.822C>T	c.(820-822)taC>taT	p.Y274Y	GLRB_ENST00000512619.1_Intron|GLRB_ENST00000509282.1_Silent_p.Y274Y|GLRB_ENST00000541722.1_Silent_p.Y274Y	NM_000824.4	NP_000815.1	P48167	GLRB_HUMAN	glycine receptor, beta	274					acrosome reaction (GO:0007340)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|extracellular-glycine-gated ion channel activity (GO:0016933)|glycine binding (GO:0016594)	p.Y274Y(1)		central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(6)|skin(5)|upper_aerodigestive_tract(1)	27	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0564)|COAD - Colon adenocarcinoma(41;0.0642)|Kidney(143;0.0707)	Enflurane(DB00228)|Glycine(DB00145)|Lindane(DB00431)	TGGGGGTCTACGCCCCAACTC	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		17032	0.0		0.001	False		,,,				2504	0.0				p.Y274Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C822T	4						.	C	,,	1,4405	2.1+/-5.4	0,1,2202	182.0	139.0	153.0		822,822,822	-11.9	0.1	4	dbSNP_134	153	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous,coding-synonymous,coding-synonymous	GLRB	NM_000824.4,NM_001166060.1,NM_001166061.1	,,	0,4,6499	TT,TC,CC		0.0349,0.0227,0.0308	,,	274/498,274/498,274/304	158065029	4,13002	2203	4300	6503	158284479	SO:0001819	synonymous_variant	2743	exon8			U33267	CCDS3796.1, CCDS54813.1	4q31.3	2008-02-05			ENSG00000109738	ENSG00000109738			4329	protein-coding gene	gene with protein product		138492				9676428, 8717357	Standard	NM_000824		Approved		uc003ipj.2	P48167	OTTHUMG00000161954	ENST00000264428.4:c.822C>T	4.37:g.158065029C>T		Somatic		Capture	SOLID	Phase_I	158284479	NM_001166060	A8K3K2|D3DP23|F5GWE1	Silent	SNP	ENST00000264428.4	37	CCDS3796.1																																																																																				GLRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366507.1	NM_000824	
APC	324	hgsc.bcm.edu	37	5	112163652	112163652	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr5:112163652C>A	ENST00000457016.1	+	13	1955	c.1575C>A	c.(1573-1575)tgC>tgA	p.C525*	APC_ENST00000257430.4_Nonsense_Mutation_p.C525*|CTC-554D6.1_ENST00000520401.1_Missense_Mutation_p.A21E|APC_ENST00000508376.2_Nonsense_Mutation_p.C525*			P25054	APC_HUMAN	adenomatous polyposis coli	525	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.C525*(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TGAAAGGCTGCATGAGAGCAC	0.348		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.C507X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	2	Substitution - Nonsense(1)|Unknown(1)	large_intestine(1)|skin(1)	c.C1521A	5						.						90.0	88.0	88.0					5																	112163652		2202	4300	6502	112191551	SO:0001587	stop_gained	324	exon11	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.1575C>A	5.37:g.112163652C>A	ENSP00000413133:p.Cys525*	Somatic		Capture	SOLID	Phase_I	112191551	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	38	7.036883	0.98017	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.43	4.33	0.51752	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.1749	12.8833	0.58030	0.0:0.8886:0.0:0.1114	.	.	.	.	X	525;507;525;525;525	.	ENSP00000257430:C525X	C	+	3	2	APC	112191551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.379000	0.44318	2.703000	0.92315	0.650000	0.86243	TGC		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APC	324	hgsc.bcm.edu	37	5	112175639	112175639	+	Nonsense_Mutation	SNP	C	C	T	rs121913332		TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr5:112175639C>T	ENST00000457016.1	+	16	4728	c.4348C>T	c.(4348-4350)Cga>Tga	p.R1450*	APC_ENST00000257430.4_Nonsense_Mutation_p.R1450*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Nonsense_Mutation_p.R1450*			P25054	APC_HUMAN	adenomatous polyposis coli	1450	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R1450*(153)|p.?(1)|p.P1424fs*19(1)|p.K1192fs*3(1)|p.R1450fs*22(1)|p.S1436fs*22(1)|p.R1450fs*5(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCAAACCAAGCGAGAAGTACC	0.478	R1450*(LS123_LARGE_INTESTINE)|R1450*(MKN74_STOMACH)|R1450*(SW1417_LARGE_INTESTINE)|R1450*(SW837_LARGE_INTESTINE)	12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R1432X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,rectum,Substitution - Nonsense,0 	.	159	Substitution - Nonsense(153)|Deletion - Frameshift(4)|Unknown(1)|Insertion - Frameshift(1)	large_intestine(136)|stomach(13)|soft_tissue(4)|small_intestine(3)|endometrium(1)|skin(1)|pancreas(1)	c.C4294T	5	GRCh37	CM930030	APC	M	rs121913332	.						102.0	90.0	94.0					5																	112175639		2202	4300	6502	112203538	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4348C>T	5.37:g.112175639C>T	ENSP00000413133:p.Arg1450*	Somatic		Capture	SOLID	Phase_I	112203538	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	41	8.651223	0.98901	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	4.2	0.49525	.	0.600559	0.18052	N	0.153248	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.0649	14.037	0.64651	0.426:0.574:0.0:0.0	.	.	.	.	X	1450	.	.	R	+	1	2	APC	112203538	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.171000	0.50824	1.564000	0.49628	0.655000	0.94253	CGA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
ADAMTS19	171019	hgsc.bcm.edu	37	5	129019948	129019948	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr5:129019948G>A	ENST00000274487.4	+	18	2927	c.2782G>A	c.(2782-2784)Gat>Aat	p.D928N	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	928	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.D928N(1)		NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		GGAAGATTGCGATGCCACTTG	0.403																																					p.D928N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2782A	5						.						78.0	74.0	75.0					5																	129019948		2203	4300	6503	129047847	SO:0001583	missense	171019	exon18			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.2782G>A	5.37:g.129019948G>A	ENSP00000274487:p.Asp928Asn	Somatic		Capture	SOLID	Phase_I	129047847	NM_133638		Missense_Mutation	SNP	ENST00000274487.4	37	CCDS4146.1	.	.	.	.	.	.	.	.	.	.	G	12.74	2.028928	0.35797	.	.	ENSG00000145808	ENST00000274487	T	0.60920	0.15	4.56	2.77	0.32553	.	0.227351	0.37393	N	0.002109	T	0.36853	0.0982	N	0.17082	0.46	0.34979	D	0.753911	B	0.14438	0.01	B	0.06405	0.002	T	0.36040	-0.9764	9	.	.	.	.	10.9237	0.47180	0.1578:0.0:0.8422:0.0	.	928	Q8TE59	ATS19_HUMAN	N	928	ENSP00000274487:D928N	.	D	+	1	0	ADAMTS19	129047847	0.960000	0.32886	0.934000	0.37439	0.982000	0.71751	1.628000	0.37060	0.839000	0.34971	-0.143000	0.13931	GAT		ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
SASH1	23328	hgsc.bcm.edu	37	6	148846474	148846474	+	Silent	SNP	C	C	T			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr6:148846474C>T	ENST00000367467.3	+	11	1732	c.1257C>T	c.(1255-1257)caC>caT	p.H419H	AL033378.1_ENST00000411390.2_RNA	NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	419					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)	p.H419H(1)		breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		GCTCTCTGCACGTTGGCAGTA	0.438																																					p.H419H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1257T	6						.						198.0	183.0	188.0					6																	148846474		2203	4300	6503	148888167	SO:0001819	synonymous_variant	23328	exon11			AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.1257C>T	6.37:g.148846474C>T		Somatic		Capture	SOLID	Phase_I	148888167	NM_015278	Q5TGN5|Q8TAI0|Q9H7R7	Silent	SNP	ENST00000367467.3	37	CCDS5212.1																																																																																				SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042619.1	NM_015278	
JARID2	3720	hgsc.bcm.edu	37	6	15487765	15487765	+	Missense_Mutation	SNP	C	C	T	rs375479047		TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr6:15487765C>T	ENST00000341776.2	+	6	1142	c.898C>T	c.(898-900)Cgg>Tgg	p.R300W	JARID2_ENST00000397311.3_Missense_Mutation_p.R128W|JARID2_ENST00000541660.1_Missense_Mutation_p.R262W	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	300					central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.R300W(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				TCAGGACTTACGGAAACAGGT	0.592																																					p.R300W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C898T	6						.						22.0	24.0	23.0					6																	15487765		2203	4300	6503	15595744	SO:0001583	missense	3720	exon6			U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.898C>T	6.37:g.15487765C>T	ENSP00000341280:p.Arg300Trp	Somatic		Capture	SOLID	Phase_I	15595744	NM_004973	A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	ENST00000341776.2	37	CCDS4533.1	.	.	.	.	.	.	.	.	.	.	C	19.91	3.914234	0.72983	.	.	ENSG00000008083	ENST00000538175;ENST00000341776;ENST00000397311;ENST00000541660	T;T;T	0.36520	1.25;1.25;1.25	5.17	3.25	0.37280	.	0.053996	0.64402	D	0.000001	T	0.34948	0.0915	L	0.29908	0.895	0.47476	D	0.999434	D;D;D	0.89917	1.0;1.0;0.998	D;D;P	0.74674	0.973;0.984;0.803	T	0.34378	-0.9831	10	0.87932	D	0	-11.8615	13.0654	0.59030	0.4525:0.5475:0.0:0.0	.	262;164;300	F5H590;B7Z7X9;Q92833	.;.;JARD2_HUMAN	W	164;300;128;262	ENSP00000341280:R300W;ENSP00000380478:R128W;ENSP00000444623:R262W	ENSP00000341280:R300W	R	+	1	2	JARID2	15595744	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	0.909000	0.28558	1.284000	0.44531	0.561000	0.74099	CGG		JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039926.1	NM_004973	
GLP1R	2740	hgsc.bcm.edu	37	6	39033490	39033490	+	Missense_Mutation	SNP	C	C	T	rs201355669		TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr6:39033490C>T	ENST00000373256.4	+	4	330	c.287C>T	c.(286-288)cCg>cTg	p.P96L		NM_002062.3	NP_002053.3	P43220	GLP1R_HUMAN	glucagon-like peptide 1 receptor	96					activation of adenylate cyclase activity (GO:0007190)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|learning or memory (GO:0007611)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of heart contraction (GO:0008016)|regulation of insulin secretion (GO:0050796)|response to stress (GO:0006950)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucagon receptor activity (GO:0004967)|transmembrane signaling receptor activity (GO:0004888)	p.P96L(1)		breast(5)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	31					Exenatide(DB01276)|Glucagon recombinant(DB00040)|Liraglutide(DB06655)	ACCCCAGTGCCGCAGGGCCAC	0.647																																					p.P96L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C287T	6						.						27.0	22.0	24.0					6																	39033490		2195	4289	6484	39141468	SO:0001583	missense	2740	exon4				CCDS4839.1	6p21	2012-08-10			ENSG00000112164	ENSG00000112164		"""GPCR / Class B : Glucagon receptors"""	4324	protein-coding gene	gene with protein product		138032					Standard	NM_002062		Approved		uc003ooj.4	P43220	OTTHUMG00000014638	ENST00000373256.4:c.287C>T	6.37:g.39033490C>T	ENSP00000362353:p.Pro96Leu	Somatic		Capture	SOLID	Phase_I	39141468	NM_002062	Q2M229|Q99669	Missense_Mutation	SNP	ENST00000373256.4	37	CCDS4839.1	.	.	.	.	.	.	.	.	.	.	C	9.366	1.069280	0.20147	.	.	ENSG00000112164	ENST00000373256	T	0.63417	-0.04	4.97	0.234	0.15390	GPCR, family 2, extracellular hormone receptor domain (3);	0.599918	0.14760	N	0.300046	T	0.17789	0.0427	N	0.20685	0.6	0.25144	N	0.990475	B	0.02656	0.0	B	0.01281	0.0	T	0.13710	-1.0499	10	0.22109	T	0.4	.	3.7531	0.08575	0.1598:0.2357:0.0:0.6045	.	96	P43220	GLP1R_HUMAN	L	96	ENSP00000362353:P96L	ENSP00000362353:P96L	P	+	2	0	GLP1R	39141468	0.190000	0.23276	0.998000	0.56505	0.921000	0.55340	0.236000	0.17967	0.747000	0.32809	-0.696000	0.03686	CCG		GLP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040443.1		
NDUFAF4	29078	hgsc.bcm.edu	37	6	97344645	97344645	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr6:97344645G>C	ENST00000316149.7	-	2	294	c.215C>G	c.(214-216)tCc>tGc	p.S72C	NDUFAF4_ENST00000489477.1_5'UTR	NM_014165.3	NP_054884.1	Q9P032	NDUF4_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 4	72					mitochondrial respiratory chain complex I assembly (GO:0032981)	mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)		p.S72C(1)		large_intestine(5)|lung(3)|ovary(1)|skin(1)	10						AGGATCTTTGGAATCAACATA	0.358																																					p.S72C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C215G	6						.						146.0	147.0	147.0					6																	97344645		2203	4300	6503	97451366	SO:0001583	missense	29078	exon2			AF161474	CCDS5037.1	6q16.3	2012-10-12	2012-05-08	2009-03-18	ENSG00000123545	ENSG00000123545		"""Mitochondrial respiratory chain complex assembly factors"""	21034	protein-coding gene	gene with protein product		611776	"""chromosome 6 open reading frame 66"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 4"""	C6orf66		11042152, 18179882	Standard	NM_014165		Approved	HSPC125, bA22L21.1, My013, HRPAP20	uc003pow.3	Q9P032	OTTHUMG00000015246	ENST00000316149.7:c.215C>G	6.37:g.97344645G>C	ENSP00000358272:p.Ser72Cys	Somatic		Capture	SOLID	Phase_I	97451366	NM_014165	B2R4J5	Missense_Mutation	SNP	ENST00000316149.7	37	CCDS5037.1	.	.	.	.	.	.	.	.	.	.	G	19.57	3.852547	0.71719	.	.	ENSG00000123545	ENST00000316149	D	0.90324	-2.65	3.93	3.93	0.45458	.	0.000000	0.85682	D	0.000000	D	0.95595	0.8568	M	0.90369	3.11	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.96523	0.9387	10	0.87932	D	0	.	16.5355	0.84372	0.0:0.0:1.0:0.0	.	72	Q9P032	NDUF4_HUMAN	C	72	ENSP00000358272:S72C	ENSP00000358272:S72C	S	-	2	0	NDUFAF4	97451366	1.000000	0.71417	0.998000	0.56505	0.861000	0.49209	6.374000	0.73132	2.191000	0.70037	0.557000	0.71058	TCC		NDUFAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041567.1	NM_014165	
NOX3	50508	hgsc.bcm.edu	37	6	155750013	155750013	+	Missense_Mutation	SNP	G	G	A	rs563228632		TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr6:155750013G>A	ENST00000159060.2	-	9	1162	c.1060C>T	c.(1060-1062)Cgg>Tgg	p.R354W		NM_015718.2	NP_056533.1	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	354	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				detection of gravity (GO:0009590)|otolith development (GO:0048840)|superoxide anion generation (GO:0042554)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NADPH oxidase complex (GO:0043020)	superoxide-generating NADPH oxidase activity (GO:0016175)	p.R354W(1)		cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	45		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		CCTGCTGCCCGGATGTGCACG	0.622																																					p.R354W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1060T	6						.						55.0	58.0	57.0					6																	155750013		2203	4300	6503	155791705	SO:0001583	missense	50508	exon9			AF190122	CCDS5250.1	6q25.3	2008-05-15			ENSG00000074771	ENSG00000074771			7890	protein-coding gene	gene with protein product		607105				11376945	Standard	NM_015718		Approved	GP91-3	uc003qqm.3	Q9HBY0	OTTHUMG00000015883	ENST00000159060.2:c.1060C>T	6.37:g.155750013G>A	ENSP00000159060:p.Arg354Trp	Somatic		Capture	SOLID	Phase_I	155791705	NM_015718	Q9HBJ9	Missense_Mutation	SNP	ENST00000159060.2	37	CCDS5250.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.962220	0.74016	.	.	ENSG00000074771	ENST00000159060	D	0.93712	-3.27	5.78	3.89	0.44902	Riboflavin synthase-like beta-barrel (1);FAD-binding 8 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.101925	0.41500	D	0.000866	D	0.97742	0.9259	H	0.98048	4.135	0.44780	D	0.997787	D	0.89917	1.0	D	0.87578	0.998	D	0.99204	1.0874	10	0.87932	D	0	-21.0121	14.5669	0.68182	0.0:0.0:0.5795:0.4205	.	354	Q9HBY0	NOX3_HUMAN	W	354	ENSP00000159060:R354W	ENSP00000159060:R354W	R	-	1	2	NOX3	155791705	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.258000	0.51507	1.420000	0.47138	0.557000	0.71058	CGG		NOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042819.1		
AASS	10157	hgsc.bcm.edu	37	7	121769447	121769447	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr7:121769447T>C	ENST00000393376.1	-	2	450	c.355A>G	c.(355-357)Aat>Gat	p.N119D	AASS_ENST00000417368.2_Missense_Mutation_p.N119D|AASS_ENST00000473553.1_Intron			Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase	119	Lysine-ketoglutarate reductase.				cellular nitrogen compound metabolic process (GO:0034641)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity (GO:0047131)|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity (GO:0047130)	p.N119D(1)		autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(6)|large_intestine(12)|lung(27)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	54						AAGCCCATATTGGCCTCCTGA	0.308																																					p.N119D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A355G	7						.						60.0	59.0	59.0					7																	121769447		2203	4300	6503	121556683	SO:0001583	missense	10157	exon3			AF229180	CCDS5783.1	7q31.3	2010-12-14			ENSG00000008311	ENSG00000008311			17366	protein-coding gene	gene with protein product		605113				10775527	Standard	NM_005763		Approved	LORSDH, LKRSDH	uc003vkb.3	Q9UDR5	OTTHUMG00000157058	ENST00000393376.1:c.355A>G	7.37:g.121769447T>C	ENSP00000377040:p.Asn119Asp	Somatic		Capture	SOLID	Phase_I	121556683	NM_005763	O95462	Missense_Mutation	SNP	ENST00000393376.1	37	CCDS5783.1	.	.	.	.	.	.	.	.	.	.	.	26.6	4.754380	0.89843	.	.	ENSG00000008311	ENST00000393376;ENST00000417368	T;T	0.77489	-1.1;-1.1	5.3	5.3	0.74995	Alanine dehydrogenase/PNT, N-terminal (1);	0.134054	0.64402	D	0.000003	D	0.89959	0.6866	M	0.91140	3.18	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.90965	0.4815	10	0.42905	T	0.14	-18.6832	15.5046	0.75728	0.0:0.0:0.0:1.0	.	119	Q9UDR5	AASS_HUMAN	D	119	ENSP00000377040:N119D;ENSP00000403768:N119D	ENSP00000351834:N119D	N	-	1	0	AASS	121556683	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.986000	0.88173	2.126000	0.65437	0.482000	0.46254	AAT		AASS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347300.1	NM_005763	
WDR91	29062	hgsc.bcm.edu	37	7	134881005	134881005	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr7:134881005G>A	ENST00000354475.4	-	8	1166	c.1135C>T	c.(1135-1137)Cgg>Tgg	p.R379W	AC009542.2_ENST00000412549.2_RNA|WDR91_ENST00000423565.1_Missense_Mutation_p.R344W|WDR91_ENST00000485942.1_5'Flank|WDR91_ENST00000344400.5_Missense_Mutation_p.R379W	NM_014149.3	NP_054868.3	A4D1P6	WDR91_HUMAN	WD repeat domain 91	379								p.R379W(1)|p.R379R(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	40						GAGGATGCCCGAGTCAGTGGC	0.622																																					p.R379W												.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(1)|lung(1)	c.C1135T	7						.						47.0	48.0	47.0					7																	134881005		2203	4300	6503	134531545	SO:0001583	missense	29062	exon8			AF161534	CCDS34758.1	7q33	2013-01-09			ENSG00000105875	ENSG00000105875		"""WD repeat domain containing"""	24997	protein-coding gene	gene with protein product						11042152, 11230166	Standard	NM_014149		Approved	HSPC049	uc003vsp.2	A4D1P6	OTTHUMG00000155414	ENST00000354475.4:c.1135C>T	7.37:g.134881005G>A	ENSP00000346466:p.Arg379Trp	Somatic		Capture	SOLID	Phase_I	134531545	NM_014149	A6NK54|C9JMI4|Q6FI65|Q6MZQ1|Q6P4I1|Q96AE5|Q96G63|Q9H062|Q9H9B6|Q9NVG7|Q9NZY6	Missense_Mutation	SNP	ENST00000354475.4	37	CCDS34758.1	.	.	.	.	.	.	.	.	.	.	G	18.22	3.574753	0.65878	.	.	ENSG00000105875	ENST00000344400;ENST00000354475;ENST00000423565	T;T;T	0.66638	1.26;-0.22;0.36	5.76	2.54	0.30619	.	0.466175	0.21671	N	0.070875	T	0.65123	0.2661	L	0.29908	0.895	0.09310	N	1	D	0.69078	0.997	P	0.53490	0.727	T	0.61501	-0.7050	10	0.87932	D	0	-21.1383	14.1144	0.65144	0.0:0.0:0.4626:0.5374	.	379	A4D1P6	WDR91_HUMAN	W	379;379;344	ENSP00000340877:R379W;ENSP00000346466:R379W;ENSP00000392555:R344W	ENSP00000340877:R379W	R	-	1	2	WDR91	134531545	0.027000	0.19231	0.246000	0.24233	0.022000	0.10575	1.186000	0.32078	0.721000	0.32231	0.650000	0.86243	CGG		WDR91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340019.1	NM_014149	
TRPA1	8989	hgsc.bcm.edu	37	8	72964994	72964994	+	Missense_Mutation	SNP	C	C	A	rs373925434		TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr8:72964994C>A	ENST00000262209.4	-	14	1858	c.1651G>T	c.(1651-1653)Gca>Tca	p.A551S	RP11-383H13.1_ENST00000537896.1_3'UTR|RP11-383H13.1_ENST00000457356.4_3'UTR	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	551					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)	p.A551S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	AAGTGAAGTGCAGTGTTCTTT	0.448																																					p.A551S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1651T	8						.						111.0	95.0	101.0					8																	72964994		2203	4300	6503	73127548	SO:0001583	missense	8989	exon14			Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.1651G>T	8.37:g.72964994C>A	ENSP00000262209:p.Ala551Ser	Somatic		Capture	SOLID	Phase_I	73127548	NM_007332	A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	37	CCDS34908.1	.	.	.	.	.	.	.	.	.	.	C	17.69	3.452975	0.63290	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.75367	-0.93;-0.93	4.98	4.98	0.66077	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	D	0.85186	0.5639	M	0.70787	2.145	0.80722	D	1	D	0.69078	0.997	D	0.70716	0.97	D	0.84923	0.0855	10	0.42905	T	0.14	-4.5381	18.6199	0.91317	0.0:1.0:0.0:0.0	.	551	O75762	TRPA1_HUMAN	S	403;551	ENSP00000428151:A403S;ENSP00000262209:A551S	ENSP00000262209:A551S	A	-	1	0	TRPA1	73127548	1.000000	0.71417	0.143000	0.22291	0.154000	0.21943	6.881000	0.75584	2.466000	0.83321	0.585000	0.79938	GCA		TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	
ABCA1	19	hgsc.bcm.edu	37	9	107556758	107556758	+	Missense_Mutation	SNP	C	C	T	rs372779604		TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr9:107556758C>T	ENST00000374736.3	-	40	5810	c.5416G>A	c.(5416-5418)Gtg>Atg	p.V1806M		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	1806					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)	p.V1806M(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	ATCAAGAACACGGACTTCAGG	0.448																																					p.V1806M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5416A	9						.	C	MET/VAL	0,4406		0,0,2203	88.0	80.0	83.0		5416	5.5	1.0	9		83	1,8599	1.2+/-3.3	0,1,4299	no	missense	ABCA1	NM_005502.3	21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1806/2262	107556758	1,13005	2203	4300	6503	106596579	SO:0001583	missense	19	exon40			AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.5416G>A	9.37:g.107556758C>T	ENSP00000363868:p.Val1806Met	Somatic		Capture	SOLID	Phase_I	106596579	NM_005502	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	37	CCDS6762.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.163143	0.78226	0.0	1.16E-4	ENSG00000165029	ENST00000374736	D	0.89343	-2.5	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.94991	0.8379	M	0.83384	2.64	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	D	0.95062	0.8196	10	0.72032	D	0.01	.	19.7532	0.96277	0.0:1.0:0.0:0.0	.	1806	O95477	ABCA1_HUMAN	M	1806	ENSP00000363868:V1806M	ENSP00000363868:V1806M	V	-	1	0	ABCA1	106596579	1.000000	0.71417	0.995000	0.50966	0.365000	0.29674	7.772000	0.85439	2.734000	0.93682	0.650000	0.86243	GTG		ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502	
DNM1	1759	hgsc.bcm.edu	37	9	130981460	130981460	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr9:130981460C>T	ENST00000372923.3	+	4	610	c.518C>T	c.(517-519)gCc>gTc	p.A173V	DNM1_ENST00000486160.1_Missense_Mutation_p.A173V|DNM1_ENST00000475805.1_Missense_Mutation_p.A173V|DNM1_ENST00000393594.3_Missense_Mutation_p.A173V|DNM1_ENST00000341179.7_Missense_Mutation_p.A173V	NM_004408.2	NP_004399.2	Q05193	DYN1_HUMAN	dynamin 1	173	Dynamin-type G.				endocytosis (GO:0006897)|endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)	extracellular vesicular exosome (GO:0070062)|membrane coat (GO:0030117)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.A173V(2)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(15)|lung(6)|ovary(2)|urinary_tract(2)	32						CTCATCCTGGCCGTGTCCCCC	0.607																																					p.A173V	GBM(113;146 1575 2722 28670 29921)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C518T	9						.						117.0	108.0	111.0					9																	130981460		2203	4300	6503	130021281	SO:0001583	missense	1759	exon4			L07807	CCDS6895.1, CCDS43882.1, CCDS75911.1, CCDS75912.1	9q34	2013-01-10			ENSG00000106976	ENSG00000106976		"""Pleckstrin homology (PH) domain containing"""	2972	protein-coding gene	gene with protein product		602377		DNM		2144893, 9143509	Standard	XM_005251763		Approved		uc022bob.1	Q05193	OTTHUMG00000020733	ENST00000372923.3:c.518C>T	9.37:g.130981460C>T	ENSP00000362014:p.Ala173Val	Somatic		Capture	SOLID	Phase_I	130021281	NM_001005336	A6NLM6|Q5SYX0|Q5SYX2|Q6P3T6|Q86VD2	Missense_Mutation	SNP	ENST00000372923.3	37	CCDS6895.1	.	.	.	.	.	.	.	.	.	.	C	36	5.681647	0.96774	.	.	ENSG00000106976	ENST00000475805;ENST00000341179;ENST00000372923;ENST00000393589;ENST00000393594;ENST00000486160	D;D;D;D;D	0.95205	-3.64;-3.64;-3.64;-3.64;-3.64	5.42	5.42	0.78866	Dynamin, GTPase domain (2);	0.000000	0.85682	D	0.000000	D	0.97483	0.9176	M	0.82193	2.58	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.995;0.997	D	0.98030	1.0376	10	0.87932	D	0	-13.2304	19.2078	0.93739	0.0:1.0:0.0:0.0	.	173;173;173	Q05193;Q05193-3;Q05193-2	DYN1_HUMAN;.;.	V	173;173;173;168;173;173	ENSP00000419225:A173V;ENSP00000345680:A173V;ENSP00000362014:A173V;ENSP00000377219:A173V;ENSP00000420045:A173V	ENSP00000345680:A173V	A	+	2	0	DNM1	130021281	1.000000	0.71417	0.984000	0.44739	0.920000	0.55202	7.818000	0.86416	2.532000	0.85374	0.462000	0.41574	GCC		DNM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054367.1	NM_004408	
ERMP1	79956	hgsc.bcm.edu	37	9	5787593	5787593	+	Splice_Site	SNP	C	C	A			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr9:5787593C>A	ENST00000339450.5	-	14	2476	c.2387G>T	c.(2386-2388)gGa>gTa	p.G796V	ERMP1_ENST00000381506.3_3'UTR|ERMP1_ENST00000214893.5_5'UTR|ERMP1_ENST00000543230.1_Splice_Site_p.M390I	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	796						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)	p.G796V(1)		endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		ATGGCTTGGTCCTGTAAGGTA	0.423																																					p.G796V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2387T	9						.						122.0	118.0	119.0					9																	5787593		2203	4300	6503	5777593	SO:0001630	splice_region_variant	79956	exon14			AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.2387-1G>T	9.37:g.5787593C>A		Somatic		Capture	SOLID	Phase_I	5777593	NM_024896	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Missense_Mutation	SNP	ENST00000339450.5	37	CCDS34983.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.31|10.31	1.315241|1.315241	0.23908|0.23908	.|.	.|.	ENSG00000099219|ENSG00000099219	ENST00000339450|ENST00000543230	T|.	0.57273|.	0.41|.	5.6|5.6	5.6|5.6	0.85130|0.85130	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.72669|0.72669	0.3489|0.3489	M|M	0.67397|0.67397	2.05|2.05	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.77004|.	0.989|.	T|T	0.65134|0.65134	-0.6242|-0.6242	10|6	0.42905|0.17832	T|T	0.14|0.49	.|.	19.577|19.577	0.95449|0.95449	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	796|.	Q7Z2K6|.	ERMP1_HUMAN|.	V|I	796|390	ENSP00000340427:G796V|.	ENSP00000340427:G796V|ENSP00000417474:M812I	G|M	-|-	2|3	0|0	ERMP1|ERMP1	5777593|5777593	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.230000|0.230000	0.25150|0.25150	6.848000|6.848000	0.75409|0.75409	2.798000|2.798000	0.96311|0.96311	0.650000|0.650000	0.86243|0.86243	GGA|ATG		ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	Missense_Mutation
C9orf171	389799	hgsc.bcm.edu	37	9	135374838	135374838	+	Silent	SNP	C	C	T	rs199521952	byFrequency	TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chr9:135374838C>T	ENST00000343036.2	+	4	531	c.483C>T	c.(481-483)cgC>cgT	p.R161R	C9orf171_ENST00000393216.2_Silent_p.R125R|C9orf171_ENST00000393215.3_Silent_p.R125R	NM_207417.1	NP_997300.1	Q6ZQR2	CI171_HUMAN	chromosome 9 open reading frame 171	161								p.R161R(1)		large_intestine(7)|lung(9)|ovary(4)|prostate(3)	23						CAATGAACCGCGGGGCGGTGA	0.612													C|||	2	0.000399361	0.0008	0.0	5008	,	,		17294	0.0		0.0	False		,,,				2504	0.001				p.R161R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C483T	9						.	C		0,4406		0,0,2203	72.0	73.0	73.0		483	-10.5	0.0	9		73	3,8597	2.2+/-6.3	0,3,4297	no	coding-synonymous	C9orf171	NM_207417.1		0,3,6500	TT,TC,CC		0.0349,0.0,0.0231		161/321	135374838	3,13003	2203	4300	6503	134364659	SO:0001819	synonymous_variant	389799	exon4			AK128819	CCDS6949.1, CCDS65167.1	9q34.13	2012-04-03			ENSG00000188523	ENSG00000188523			33776	protein-coding gene	gene with protein product							Standard	NM_207417		Approved	FLJ46082	uc004cbn.3	Q6ZQR2	OTTHUMG00000131684	ENST00000343036.2:c.483C>T	9.37:g.135374838C>T		Somatic		Capture	SOLID	Phase_I	134364659	NM_207417	Q147X1	Silent	SNP	ENST00000343036.2	37	CCDS6949.1																																																																																				C9orf171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254589.1	NM_207417	
SLC25A14	9016	hgsc.bcm.edu	37	X	129498622	129498622	+	Silent	SNP	G	G	A			TCGA-AG-3599-01A-02W-0833-10	TCGA-AG-3599-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	285b8163-5c9f-4376-a108-006f70d22299	2dc2ec42-f7b6-4030-b2d3-ca56cca9ea29	g.chrX:129498622G>A	ENST00000218197.5	+	7	842	c.615G>A	c.(613-615)caG>caA	p.Q205Q	SLC25A14_ENST00000361980.5_Silent_p.Q202Q|SLC25A14_ENST00000339231.3_Silent_p.Q233Q|SLC25A14_ENST00000543953.1_Silent_p.Q170Q|SLC25A14_ENST00000545805.1_Silent_p.Q205Q|SLC25A14_ENST00000467496.1_3'UTR	NM_001282195.1|NM_001282196.1|NM_001282198.1	NP_001269124.1|NP_001269125.1|NP_001269127.1	O95258	UCP5_HUMAN	solute carrier family 25 (mitochondrial carrier, brain), member 14	205					aerobic respiration (GO:0009060)|mitochondrial transport (GO:0006839)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)		p.Q205Q(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)	22						CAACTGCTCAGCGTGCTGCCA	0.418																																					p.Q205Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G615A	X						.						217.0	163.0	181.0					X																	129498622		2203	4300	6503	129326303	SO:0001819	synonymous_variant	9016	exon7			AF078544	CCDS14623.1, CCDS14624.1, CCDS76020.1, CCDS76021.1	Xq24	2013-05-22			ENSG00000102078	ENSG00000102078		"""Solute carriers"""	10984	protein-coding gene	gene with protein product		300242				9852133	Standard	XM_005262485		Approved	BMCP1, UCP5	uc004evp.1	O95258	OTTHUMG00000022394	ENST00000218197.5:c.615G>A	X.37:g.129498622G>A		Somatic		Capture	SOLID	Phase_I	129326303	NM_003951	D3DTG2|Q0VDH7|Q9HC60|Q9HC61	Silent	SNP	ENST00000218197.5	37	CCDS14623.1																																																																																				SLC25A14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058253.1	NM_022810, NM_003951	
