#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCC2	1244	hgsc.bcm.edu	37	10	101567923	101567923	+	Silent	SNP	C	C	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr10:101567923C>T	ENST00000370449.4	+	13	1865	c.1752C>T	c.(1750-1752)acC>acT	p.T584T		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	584	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)	p.T584T(1)		NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	CCTCCATTACCCTCTTCAATA	0.488																																					p.T584T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1752T	10						.						282.0	244.0	257.0					10																	101567923		2203	4300	6503	101557913	SO:0001819	synonymous_variant	1244	exon13			U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.1752C>T	10.37:g.101567923C>T		Somatic		Capture	SOLID	Phase_I	101557913	NM_000392	B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Silent	SNP	ENST00000370449.4	37	CCDS7484.1																																																																																				ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049825.1	NM_000392	
SEC31B	25956	hgsc.bcm.edu	37	10	102269148	102269148	+	Silent	SNP	C	C	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr10:102269148C>T	ENST00000370345.3	-	4	421	c.324G>A	c.(322-324)tcG>tcA	p.S108S	NDUFB8_ENST00000557395.1_Intron|SEC31B_ENST00000370329.5_Silent_p.S108S|SEC31B_ENST00000535773.1_Intron|NDUFB8_ENST00000531258.1_Intron|SEC31B_ENST00000451524.1_Silent_p.S108S	NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	108					protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)		p.S108S(1)		NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		GCTCCTTCCCCGAAGACAGGA	0.517											OREG0020441	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S108S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G324A	10						.						111.0	115.0	114.0					10																	102269148		2203	4300	6503	102259138	SO:0001819	synonymous_variant	25956	exon4			AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.324G>A	10.37:g.102269148C>T		Somatic	1365	Capture	SOLID	Phase_I	102259138	NM_015490	B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Silent	SNP	ENST00000370345.3	37	CCDS7495.1																																																																																				SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051198.1	NM_015490	
TACC2	10579	hgsc.bcm.edu	37	10	123954587	123954587	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr10:123954587C>T	ENST00000369005.1	+	8	6207	c.5867C>T	c.(5866-5868)cCg>cTg	p.P1956L	TACC2_ENST00000515273.1_Missense_Mutation_p.P1960L|TACC2_ENST00000358010.1_Missense_Mutation_p.P102L|TACC2_ENST00000493951.1_3'UTR|TACC2_ENST00000453444.2_Missense_Mutation_p.P1960L|TACC2_ENST00000515603.1_Missense_Mutation_p.P1911L|TACC2_ENST00000369001.1_5'UTR|TACC2_ENST00000369000.1_5'UTR|TACC2_ENST00000334433.3_Missense_Mutation_p.P1956L|TACC2_ENST00000260733.3_Missense_Mutation_p.P34L|TACC2_ENST00000368999.1_Missense_Mutation_p.P34L|TACC2_ENST00000513429.1_Missense_Mutation_p.P102L|TACC2_ENST00000360561.3_Missense_Mutation_p.P34L|TACC2_ENST00000369004.3_Missense_Mutation_p.P34L	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	1956	Pro-rich.				astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)	p.P1956L(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				TTTGAGACCCCGGAGTCAACG	0.617																																					p.P34L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C101T	10						.						98.0	102.0	101.0					10																	123954587		2203	4300	6503	123944577	SO:0001583	missense	10579	exon2			AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.5867C>T	10.37:g.123954587C>T	ENSP00000358001:p.Pro1956Leu	Somatic		Capture	SOLID	Phase_I	123944577	NM_006997	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	ENST00000369005.1	37	CCDS7626.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.318606	0.81469	.	.	ENSG00000138162	ENST00000369005;ENST00000513429;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000358010;ENST00000453444;ENST00000340076;ENST00000360561;ENST00000368999;ENST00000369004;ENST00000260733;ENST00000514539	T;T;T;T;T;T;T;T;T;T;T;T	0.52526	0.66;0.66;1.71;2.81;0.66;0.66;1.71;0.66;0.66;0.66;0.66;0.66	4.75	4.75	0.60458	.	0.000000	0.32608	N	0.005872	T	0.65678	0.2714	M	0.62723	1.935	0.58432	D	0.999996	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;0.999;0.999;0.999;0.999;1.0;1.0;0.999	T	0.69544	-0.5117	10	0.87932	D	0	-12.3254	14.7498	0.69516	0.0:1.0:0.0:0.0	.	51;1960;34;1911;34;34;102;1956	E9PGB3;E9PBC6;D6RAA5;E7EMZ9;O95359-6;O95359-1;O95359-5;O95359	.;.;.;.;.;.;.;TACC2_HUMAN	L	1956;102;1960;1911;1956;102;1960;1946;34;34;34;34;51	ENSP00000358001:P1956L;ENSP00000425062:P102L;ENSP00000424467:P1960L;ENSP00000427618:P1911L;ENSP00000334280:P1956L;ENSP00000350701:P102L;ENSP00000395048:P1960L;ENSP00000353763:P34L;ENSP00000357995:P34L;ENSP00000422815:P34L;ENSP00000260733:P34L;ENSP00000420967:P51L	ENSP00000260733:P34L	P	+	2	0	TACC2	123944577	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	5.166000	0.64965	2.201000	0.70794	0.556000	0.70494	CCG		TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1		
EDRF1	26098	hgsc.bcm.edu	37	10	127451878	127451878	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr10:127451878T>A	ENST00000356792.4	+	25	3786	c.3554T>A	c.(3553-3555)aTc>aAc	p.I1185N	C10orf137_ENST00000337623.3_Missense_Mutation_p.I1151N	NM_001202438.1	NP_001189367.1	Q3B7T1	EDRF1_HUMAN		1185					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.I1151N(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(20)|ovary(8)|pancreas(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	61		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				AGCAATAACATCGAAGATGAC	0.433																																					p.I1151N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3452A	10						.						85.0	80.0	82.0					10																	127451878		2203	4300	6503	127441868	SO:0001583	missense	26098	exon24																														ENST00000356792.4:c.3554T>A	10.37:g.127451878T>A	ENSP00000349244:p.Ile1185Asn	Somatic		Capture	SOLID	Phase_I	127441868	NM_015608	B2RC65|Q3KR40|Q4G190|Q5VZQ4|Q8IZ74|Q9Y3W4	Missense_Mutation	SNP	ENST00000356792.4	37	CCDS55733.1	.	.	.	.	.	.	.	.	.	.	T	7.747	0.702548	0.15172	.	.	ENSG00000107938	ENST00000356792;ENST00000337623	T;T	0.43294	0.95;0.95	5.07	-7.49	0.01355	.	2.061400	0.02006	N	0.046699	T	0.17619	0.0423	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.10268	-1.0637	10	0.18276	T	0.48	.	4.1201	0.10101	0.1412:0.3694:0.3485:0.1409	.	1185;532;1151	Q3B7T1;Q5VZQ1;Q3B7T1-5	EDRF1_HUMAN;.;.	N	1185;1151	ENSP00000349244:I1185N;ENSP00000336727:I1151N	ENSP00000336727:I1151N	I	+	2	0	C10orf137	127441868	0.000000	0.05858	0.000000	0.03702	0.250000	0.25880	-1.284000	0.02793	-0.885000	0.03971	0.460000	0.39030	ATC		C10orf137-007	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388539.1		
SUV39H2	79723	hgsc.bcm.edu	37	10	14943193	14943193	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr10:14943193G>A	ENST00000354919.6	+	5	1058	c.1058G>A	c.(1057-1059)cGa>cAa	p.R353Q	DCLRE1C_ENST00000378289.4_Intron|SUV39H2_ENST00000313519.5_Missense_Mutation_p.R293Q|SUV39H2_ENST00000378325.3_Missense_Mutation_p.R173Q	NM_001193424.1	NP_001180353.1	Q9H5I1	SUV92_HUMAN	suppressor of variegation 3-9 homolog 2 (Drosophila)	353	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cell differentiation (GO:0030154)|chromatin assembly or disassembly (GO:0006333)|chromatin remodeling (GO:0006338)|histone H3-K9 dimethylation (GO:0036123)|histone H3-K9 trimethylation (GO:0036124)|male meiosis (GO:0007140)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|chromosome, centromeric region (GO:0000775)|nuclear heterochromatin (GO:0005720)	chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.R293Q(1)		breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)	19						CGTCTTCCCCGAATAGCATTG	0.373																																					p.R113Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G338A	10						.						138.0	128.0	131.0					10																	14943193		2203	4300	6503	14983199	SO:0001583	missense	79723	exon5			AK027067	CCDS7104.1, CCDS53493.1, CCDS53494.1	10p13	2011-07-01			ENSG00000152455	ENSG00000152455		"""Chromatin-modifying enzymes / K-methyltransferases"""	17287	protein-coding gene	gene with protein product		606503				11094092	Standard	NM_001193424		Approved	FLJ23414, KMT1B	uc021png.1	Q9H5I1	OTTHUMG00000017718	ENST00000354919.6:c.1058G>A	10.37:g.14943193G>A	ENSP00000346997:p.Arg353Gln	Somatic		Capture	SOLID	Phase_I	14983199	NM_001193427	D3DRT4|Q5JSS4|Q5JSS5|Q6I9Y3|Q8ND06	Missense_Mutation	SNP	ENST00000354919.6	37	CCDS53494.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.5|29.5	5.009943|5.009943	0.93346|0.93346	.|.	.|.	ENSG00000152455|ENSG00000152455	ENST00000358298|ENST00000433779;ENST00000378325;ENST00000354919;ENST00000313519	.|D;D;D;D	.|0.81996	.|-1.56;-1.56;-1.56;-1.56	5.87|5.87	5.87|5.87	0.94306|0.94306	.|SET domain (3);	.|0.000000	.|0.64402	.|D	.|0.000008	D|D	0.83894|0.83894	0.5353|0.5353	M|M	0.90082|0.90082	3.085|3.085	0.80722|0.80722	D|D	1|1	.|B;P	.|0.48407	.|0.105;0.91	.|B;B	.|0.28385	.|0.057;0.089	D|D	0.87589|0.87589	0.2489|0.2489	5|10	.|0.52906	.|T	.|0.07	.|.	19.5705|19.5705	0.95413|0.95413	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|353;173	.|Q9H5I1;Q9H5I1-3	.|SUV92_HUMAN;.	K|Q	119|113;173;353;293	.|ENSP00000388968:R113Q;ENSP00000367576:R173Q;ENSP00000346997:R353Q;ENSP00000319208:R293Q	.|ENSP00000319208:R293Q	E|R	+|+	1|2	0|0	SUV39H2|SUV39H2	14983199|14983199	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.522000|9.522000	0.98032|0.98032	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GAA|CGA		SUV39H2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046947.2	NM_024670	
ZEB1	6935	hgsc.bcm.edu	37	10	31809580	31809580	+	Silent	SNP	A	A	G			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr10:31809580A>G	ENST00000320985.10	+	7	1427	c.1317A>G	c.(1315-1317)aaA>aaG	p.K439K	ZEB1_ENST00000560721.2_Silent_p.K419K|ZEB1_ENST00000446923.2_Silent_p.K423K|ZEB1_ENST00000542815.3_Silent_p.K372K|ZEB1_ENST00000559858.1_3'UTR|ZEB1_ENST00000361642.5_Silent_p.K440K			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	439					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.K439K(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				TTGCATCCAAAGAACAAGAAA	0.373																																					p.K419K	Ovarian(40;423 959 14296 36701 49589)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1257G	10						.						80.0	76.0	77.0					10																	31809580		2203	4300	6503	31849586	SO:0001819	synonymous_variant	6935	exon6			AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.1317A>G	10.37:g.31809580A>G		Somatic		Capture	SOLID	Phase_I	31849586	NM_001174093	B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Silent	SNP	ENST00000320985.10	37	CCDS7169.1																																																																																				ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419083.2	NM_030751	
TLL2	7093	hgsc.bcm.edu	37	10	98133400	98133400	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr10:98133400G>A	ENST00000357947.3	-	19	2840	c.2615C>T	c.(2614-2616)tCg>tTg	p.S872L		NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	872	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.S872L(2)		NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		TGAGGCATCCGAATAAAACCT	0.597																																					p.S872L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2615T	10						.						76.0	76.0	76.0					10																	98133400		2203	4300	6503	98123390	SO:0001583	missense	7093	exon19			AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.2615C>T	10.37:g.98133400G>A	ENSP00000350630:p.Ser872Leu	Somatic		Capture	SOLID	Phase_I	98123390	NM_012465	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Missense_Mutation	SNP	ENST00000357947.3	37	CCDS7449.1	.	.	.	.	.	.	.	.	.	.	G	34	5.362335	0.95877	.	.	ENSG00000095587	ENST00000357947	T	0.47177	0.85	4.85	4.85	0.62838	CUB (5);	0.000000	0.41097	D	0.000957	D	0.82356	0.5019	H	0.99074	4.42	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.89913	0.4053	10	0.87932	D	0	.	17.4922	0.87707	0.0:0.0:1.0:0.0	.	872	Q9Y6L7	TLL2_HUMAN	L	872	ENSP00000350630:S872L	ENSP00000350630:S872L	S	-	2	0	TLL2	98123390	1.000000	0.71417	0.746000	0.31095	0.988000	0.76386	9.601000	0.98297	2.677000	0.91161	0.561000	0.74099	TCG		TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1		
EBF3	253738	hgsc.bcm.edu	37	10	131638591	131638591	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr10:131638591C>G	ENST00000355311.5	-	15	1749	c.1677G>C	c.(1675-1677)caG>caC	p.Q559H	MIR4297_ENST00000579857.1_RNA|EBF3_ENST00000368648.3_Missense_Mutation_p.Q514H			Q9H4W6	COE3_HUMAN	early B-cell factor 3	559					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q514H(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		AGGCGCTCTTCTGTTTCACTG	0.612																																					p.Q514H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1542C	10						.						40.0	37.0	38.0					10																	131638591		2197	4296	6493	131528581	SO:0001583	missense	253738	exon15				CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.1677G>C	10.37:g.131638591C>G	ENSP00000347463:p.Gln559His	Somatic		Capture	SOLID	Phase_I	131528581	NM_001005463	A0AUY1|Q5T6H9|Q9H4W5	Missense_Mutation	SNP	ENST00000355311.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.06|16.06	3.016958|3.016958	0.54576|0.54576	.|.	.|.	ENSG00000108001|ENSG00000108001	ENST00000440978|ENST00000355311;ENST00000368648	.|T;T	.|0.58940	.|0.3;0.3	4.53|4.53	3.49|3.49	0.39957|0.39957	.|.	.|0.115769	.|0.64402	.|D	.|0.000009	T|T	0.69708|0.69708	0.3141|0.3141	M|M	0.85542|0.85542	2.76|2.76	0.45318|0.45318	D|D	0.998315|0.998315	.|P	.|0.46952	.|0.887	.|P	.|0.57548	.|0.823	T|T	0.69624|0.69624	-0.5095|-0.5095	5|10	.|0.62326	.|D	.|0.03	-8.7356|-8.7356	4.7854|4.7854	0.13222|0.13222	0.0:0.1954:0.0:0.8046|0.0:0.1954:0.0:0.8046	.|.	.|514	.|Q9H4W6-2	.|.	Q|H	121|559;514	.|ENSP00000347463:Q559H;ENSP00000357637:Q514H	.|ENSP00000347463:Q559H	E|Q	-|-	1|3	0|2	EBF3|EBF3	131528581|131528581	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	2.296000|2.296000	0.43584|0.43584	0.869000|0.869000	0.35703|0.35703	0.462000|0.462000	0.41574|0.41574	GAA|CAG		EBF3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051015.2	NM_001005463	
GALNT18	374378	hgsc.bcm.edu	37	11	11454217	11454217	+	Silent	SNP	G	G	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr11:11454217G>A	ENST00000227756.4	-	3	957	c.546C>T	c.(544-546)ccC>ccT	p.P182P		NM_198516.2	NP_940918.2	Q6P9A2	GLT18_HUMAN	polypeptide N-acetylgalactosaminyltransferase 18	182	Catalytic subdomain A.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.P182P(1)									GCAGATGTGGGGGCGTGCGTT	0.572																																					p.P182P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C546T	11						.						95.0	78.0	84.0					11																	11454217		2201	4294	6495	11410793	SO:0001819	synonymous_variant	374378	exon3			AK055111	CCDS7807.1	11p15	2014-03-13	2014-03-13	2013-01-25	ENSG00000110328	ENSG00000110328	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	30488	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 18"""	615136	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 4"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18"""	GALNTL4		22186971	Standard	NM_198516		Approved	MGC71806, GALNT15, GalNAc-T18	uc001mjo.2	Q6P9A2	OTTHUMG00000165707	ENST00000227756.4:c.546C>T	11.37:g.11454217G>A		Somatic		Capture	SOLID	Phase_I	11410793	NM_198516	O95903|Q8NDY9	Silent	SNP	ENST00000227756.4	37	CCDS7807.1																																																																																				GALNT18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385848.1	NM_198516	
RERGL	79785	hgsc.bcm.edu	37	12	18242171	18242171	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr12:18242171A>G	ENST00000229002.2	-	2	253	c.47T>C	c.(46-48)gTt>gCt	p.V16A	RERGL_ENST00000536890.1_Intron|RERGL_ENST00000541632.1_Intron|RERGL_ENST00000538724.1_Intron	NM_024730.2	NP_079006.1	Q9H628	RERGL_HUMAN	RERG/RAS-like	16	Small GTPase-like.				GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)	p.V16A(1)		endometrium(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	17						ACCTTTTGTAACAGAAACAGA	0.328																																					p.V16A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T47C	12						.						84.0	76.0	79.0					12																	18242171		2202	4297	6499	18133438	SO:0001583	missense	79785	exon2			AK026308	CCDS8679.1, CCDS66332.1	12p12.3	2014-08-12			ENSG00000111404	ENSG00000111404			26213	protein-coding gene	gene with protein product						24127187	Standard	NM_001286201		Approved	FLJ22655	uc001rdq.3	Q9H628	OTTHUMG00000168820	ENST00000229002.2:c.47T>C	12.37:g.18242171A>G	ENSP00000229002:p.Val16Ala	Somatic		Capture	SOLID	Phase_I	18133438	NM_024730		Missense_Mutation	SNP	ENST00000229002.2	37	CCDS8679.1	.	.	.	.	.	.	.	.	.	.	A	10.70	1.424419	0.25639	.	.	ENSG00000111404	ENST00000229002	T	0.73897	-0.79	4.26	3.09	0.35607	.	2.034730	0.03094	N	0.160160	T	0.58148	0.2102	N	0.08118	0	0.09310	N	0.999998	B	0.16396	0.017	B	0.17098	0.017	T	0.48875	-0.8996	10	0.36615	T	0.2	.	7.7442	0.28858	0.7742:0.2258:0.0:0.0	.	16	Q9H628	RERGL_HUMAN	A	16	ENSP00000229002:V16A	ENSP00000229002:V16A	V	-	2	0	RERGL	18133438	0.005000	0.15991	0.005000	0.12908	0.146000	0.21551	0.764000	0.26532	0.947000	0.37659	0.383000	0.25322	GTT		RERGL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000401198.1	NM_024730	
WNK1	65125	hgsc.bcm.edu	37	12	994296	994296	+	Silent	SNP	T	T	G			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr12:994296T>G	ENST00000315939.6	+	19	4969	c.4326T>G	c.(4324-4326)gtT>gtG	p.V1442V	WNK1_ENST00000530271.2_Silent_p.V1940V|WNK1_ENST00000340908.4_Silent_p.V1035V|WNK1_ENST00000537687.1_Silent_p.V1702V|WNK1_ENST00000535572.1_Silent_p.V1195V	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	1442					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)	p.V1442V(1)		breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			AGATCGTTGTTTCTAGTACAG	0.473																																					p.V1702V	Colon(19;451 567 6672 12618 28860)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T5106G	12						.						142.0	142.0	142.0					12																	994296		2203	4300	6503	864557	SO:0001819	synonymous_variant	65125	exon19			AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.4326T>G	12.37:g.994296T>G		Somatic		Capture	SOLID	Phase_I	864557	NM_001184985	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Silent	SNP	ENST00000315939.6	37	CCDS8506.1																																																																																				WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206683.1	NM_018979	
R3HDM2	22864	hgsc.bcm.edu	37	12	57663139	57663139	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr12:57663139C>A	ENST00000347140.3	-	16	2029	c.1639G>T	c.(1639-1641)Ggt>Tgt	p.G547C	RP11-123K3.4_ENST00000548184.1_3'UTR|R3HDM2_ENST00000402412.1_Missense_Mutation_p.G561C|R3HDM2_ENST00000441731.2_Missense_Mutation_p.G242C|R3HDM2_ENST00000358907.2_Missense_Mutation_p.G547C|R3HDM2_ENST00000413953.2_Missense_Mutation_p.G274C|R3HDM2_ENST00000403821.2_Missense_Mutation_p.G581C|R3HDM2_ENST00000546843.1_5'Flank			Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	547	Gln-rich.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.G208C(1)|p.G547C(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	22						AGCTGCTGACCACGTTGGGGG	0.512																																					p.G547C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1639T	12						.						83.0	88.0	87.0					12																	57663139		2203	4300	6503	55949406	SO:0001583	missense	22864	exon14			AB023219	CCDS8937.2	12q13.3	2012-11-19			ENSG00000179912	ENSG00000179912			29167	protein-coding gene	gene with protein product							Standard	NM_014925		Approved	KIAA1002	uc009zpm.1	Q9Y2K5	OTTHUMG00000171568	ENST00000347140.3:c.1639G>T	12.37:g.57663139C>A	ENSP00000317903:p.Gly547Cys	Somatic		Capture	SOLID	Phase_I	55949406	NM_014925	Q2M1T9|Q3ZCT5	Missense_Mutation	SNP	ENST00000347140.3	37	CCDS8937.2	.	.	.	.	.	.	.	.	.	.	C	15.70	2.909732	0.52439	.	.	ENSG00000179912	ENST00000413953;ENST00000393811;ENST00000347140;ENST00000402412;ENST00000358907;ENST00000441731;ENST00000429355;ENST00000403821	T;T;T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91	5.0	3.18	0.36537	.	0.258611	0.36444	N	0.002587	T	0.33527	0.0866	N	0.14661	0.345	0.32778	N	0.502865	D;D;P;P;P	0.55800	0.969;0.973;0.845;0.845;0.924	P;P;B;B;P	0.53146	0.719;0.533;0.43;0.43;0.54	T	0.45687	-0.9244	10	0.59425	D	0.04	-2.6698	6.9105	0.24333	0.0:0.6611:0.0:0.3389	.	274;581;561;547;274	B4DDZ2;B5MCG9;B5MCU0;Q9Y2K5;E9PAL1	.;.;.;R3HD2_HUMAN;.	C	274;274;547;561;547;242;312;581	ENSP00000409146:G274C;ENSP00000377400:G274C;ENSP00000317903:G547C;ENSP00000385839:G561C;ENSP00000351784:G547C;ENSP00000408536:G242C;ENSP00000394676:G312C;ENSP00000385169:G581C	ENSP00000317903:G547C	G	-	1	0	R3HDM2	55949406	0.990000	0.36364	1.000000	0.80357	0.999000	0.98932	0.798000	0.27014	0.817000	0.34445	0.655000	0.94253	GGT		R3HDM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326570.2	NM_014925	
EPYC	1833	hgsc.bcm.edu	37	12	91365636	91365636	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr12:91365636A>C	ENST00000261172.3	-	5	735	c.643T>G	c.(643-645)Ttt>Gtt	p.F215V		NM_004950.4	NP_004941.2	Q99645	EPYC_HUMAN	epiphycan	215					female pregnancy (GO:0007565)	proteinaceous extracellular matrix (GO:0005578)	glycosaminoglycan binding (GO:0005539)	p.F215V(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(8)|skin(2)	18						ATATCAATAAATGTCAAAGTG	0.373																																					p.F215V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T643G	12						.						100.0	93.0	96.0					12																	91365636		2203	4300	6503	89889767	SO:0001583	missense	1833	exon5			AF031658	CCDS31870.1	12q21	2010-03-19	2006-11-21	2006-11-21	ENSG00000083782	ENSG00000083782		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	3053	protein-coding gene	gene with protein product	"""epiphycan proteoglycan"""	601657	"""dermatan sulphate proteoglycan 3"", ""dermatan sulfate proteoglycan 3"""	DSPG3		8975717	Standard	NM_004950		Approved	Pg-Lb, SLRR3B	uc001tbk.3	Q99645	OTTHUMG00000170072	ENST00000261172.3:c.643T>G	12.37:g.91365636A>C	ENSP00000261172:p.Phe215Val	Somatic		Capture	SOLID	Phase_I	89889767	NM_004950	A8K3M7|Q8NEJ5	Missense_Mutation	SNP	ENST00000261172.3	37	CCDS31870.1	.	.	.	.	.	.	.	.	.	.	A	15.34	2.804185	0.50315	.	.	ENSG00000083782	ENST00000261172;ENST00000551767	T;T	0.02197	4.4;4.4	6.03	6.03	0.97812	.	0.101355	0.64402	D	0.000002	T	0.01835	0.0058	N	0.10707	0.03	0.43924	D	0.996577	B	0.18310	0.027	B	0.22152	0.038	T	0.62263	-0.6891	10	0.15066	T	0.55	.	16.5582	0.84512	1.0:0.0:0.0:0.0	.	215	Q99645	EPYC_HUMAN	V	215	ENSP00000261172:F215V;ENSP00000448272:F215V	ENSP00000261172:F215V	F	-	1	0	EPYC	89889767	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.083000	0.64456	2.308000	0.77769	0.533000	0.62120	TTT		EPYC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407146.2	NM_004950	
USPL1	10208	hgsc.bcm.edu	37	13	31233051	31233051	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr13:31233051T>C	ENST00000255304.4	+	9	3179	c.2837T>C	c.(2836-2838)aTt>aCt	p.I946T		NM_005800.4	NP_005791.3	Q5W0Q7	USPL1_HUMAN	ubiquitin specific peptidase like 1	946					Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|protein desumoylation (GO:0016926)	Cajal body (GO:0015030)|extracellular space (GO:0005615)	SUMO binding (GO:0032183)|SUMO-specific isopeptidase activity (GO:0070140)	p.I946T(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(15)|pancreas(3)|skin(3)	34		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)		CCATATCCAATTGATATTGCC	0.413																																					p.I946T	Ovarian(60;318 1180 1554 28110 31601)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2837C	13						.						140.0	141.0	141.0					13																	31233051		2203	4300	6503	30131051	SO:0001583	missense	10208	exon9			X59131	CCDS9336.1	13q12-q14	2012-11-14	2005-11-24	2005-11-24	ENSG00000132952	ENSG00000132952			20294	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 22"""	C13orf22		22878415	Standard	NM_005800		Approved	bA121O19.1, D13S106E	uc001utc.2	Q5W0Q7	OTTHUMG00000016675	ENST00000255304.4:c.2837T>C	13.37:g.31233051T>C	ENSP00000255304:p.Ile946Thr	Somatic		Capture	SOLID	Phase_I	30131051	NM_005800	Q14109|Q6AI45|Q8IY30|Q8IYE8	Missense_Mutation	SNP	ENST00000255304.4	37	CCDS9336.1	.	.	.	.	.	.	.	.	.	.	T	12.04	1.817283	0.32145	.	.	ENSG00000132952	ENST00000255304	T	0.35605	1.3	5.49	5.49	0.81192	.	0.170192	0.50627	D	0.000112	T	0.51346	0.1669	M	0.66939	2.045	0.27856	N	0.940557	D	0.55605	0.972	P	0.53490	0.727	T	0.54118	-0.8341	10	0.87932	D	0	-16.9825	15.5937	0.76562	0.0:0.0:0.0:1.0	.	946	Q5W0Q7	USPL1_HUMAN	T	946	ENSP00000255304:I946T	ENSP00000255304:I946T	I	+	2	0	USPL1	30131051	1.000000	0.71417	0.018000	0.16275	0.001000	0.01503	3.821000	0.55700	2.084000	0.62774	0.533000	0.62120	ATT		USPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044369.1	NM_005800	
NPAS3	64067	hgsc.bcm.edu	37	14	34269535	34269535	+	Silent	SNP	C	C	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr14:34269535C>A	ENST00000356141.4	+	12	2022	c.2022C>A	c.(2020-2022)tcC>tcA	p.S674S	NPAS3_ENST00000551492.1_Silent_p.S679S|NPAS3_ENST00000346562.2_Silent_p.S642S|NPAS3_ENST00000548645.1_Silent_p.S644S|NPAS3_ENST00000357798.5_Silent_p.S661S			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	674					locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)	p.S661S(1)|p.S642S(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		GGGAGATCTCCAGGAACGAGT	0.637																																					p.S642S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1926A	14						.						70.0	74.0	73.0					14																	34269535		2203	4300	6503	33339286	SO:0001819	synonymous_variant	64067	exon11			AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.2022C>A	14.37:g.34269535C>A		Somatic		Capture	SOLID	Phase_I	33339286	NM_022123	Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Silent	SNP	ENST00000356141.4	37	CCDS53891.1																																																																																				NPAS3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276645.1		
CYP46A1	10858	hgsc.bcm.edu	37	14	100165832	100165832	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr14:100165832G>T	ENST00000261835.3	+	4	416	c.312G>T	c.(310-312)aaG>aaT	p.K104N	CYP46A1_ENST00000423126.2_Missense_Mutation_p.K7N	NM_006668.1	NP_006659.1	Q9Y6A2	CP46A_HUMAN	cytochrome P450, family 46, subfamily A, polypeptide 1	104					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cholesterol catabolic process (GO:0006707)|nervous system development (GO:0007399)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	cholesterol 24-hydroxylase activity (GO:0033781)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid hydroxylase activity (GO:0008395)	p.K104N(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|prostate(1)|skin(1)	25		Melanoma(154;0.0866)|all_epithelial(191;0.179)				AGTACAACAAGGACTCCAAGA	0.507																																					p.K104N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G312T	14						.						301.0	289.0	293.0					14																	100165832		2203	4300	6503	99235585	SO:0001583	missense	10858	exon4			AF094480	CCDS9954.1	14q32.2	2013-05-03	2003-02-14	2003-02-28	ENSG00000036530	ENSG00000036530		"""Cytochrome P450s"""	2641	protein-coding gene	gene with protein product		604087	"""cytochrome P450, subfamily 46 (cholesterol 24-hydroxylase)"""	CYP46		10377398	Standard	NM_006668		Approved		uc001ygo.3	Q9Y6A2	OTTHUMG00000171510	ENST00000261835.3:c.312G>T	14.37:g.100165832G>T	ENSP00000261835:p.Lys104Asn	Somatic		Capture	SOLID	Phase_I	99235585	NM_006668	B4DHP8|E7EQG9|Q8N2B0	Missense_Mutation	SNP	ENST00000261835.3	37	CCDS9954.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.77|19.77	3.890138|3.890138	0.72524|0.72524	.|.	.|.	ENSG00000036530|ENSG00000036530	ENST00000380228|ENST00000261835;ENST00000423126	.|T;T	.|0.71934	.|-0.38;-0.61	5.5|5.5	4.61|4.61	0.57282|0.57282	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.81341	.|0.4802	M|M	0.72118|0.72118	2.19|2.19	0.52501|0.52501	D|D	0.999952|0.999952	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;0.999	.|T	.|0.81986	.|-0.0681	.|10	.|0.54805	.|T	.|0.06	.|.	10.5905|10.5905	0.45306|0.45306	0.0891:0.0:0.9109:0.0|0.0891:0.0:0.9109:0.0	.|.	.|104;75	.|Q9Y6A2;Q59ER2	.|CP46A_HUMAN;.	X|N	91|104;7	.|ENSP00000261835:K104N;ENSP00000405779:K7N	.|ENSP00000261835:K104N	G|K	+|+	1|3	0|2	CYP46A1|CYP46A1	99235585|99235585	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	2.596000|2.596000	0.46205|0.46205	1.475000|1.475000	0.48197|0.48197	0.643000|0.643000	0.83706|0.83706	GGA|AAG		CYP46A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413814.1		
ATP10A	57194	hgsc.bcm.edu	37	15	26026187	26026187	+	Silent	SNP	C	C	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr15:26026187C>A	ENST00000356865.6	-	2	744	c.633G>T	c.(631-633)gtG>gtT	p.V211V		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	211					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.V211V(1)		NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		AGCCGCGGACCACCTGCCGCC	0.617																																					p.V211V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G633T	15						.						65.0	68.0	67.0					15																	26026187		2203	4300	6503	23577280	SO:0001819	synonymous_variant	57194	exon2			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.633G>T	15.37:g.26026187C>A		Somatic		Capture	SOLID	Phase_I	23577280	NM_024490	Q4G0S9|Q969I4	Silent	SNP	ENST00000356865.6	37	CCDS32178.1																																																																																				ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	
ANPEP	290	hgsc.bcm.edu	37	15	90347197	90347197	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr15:90347197C>T	ENST00000300060.6	-	7	1529	c.1216G>A	c.(1216-1218)Gac>Aac	p.D406N	ANPEP_ENST00000558177.1_5'Flank	NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	406	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)	p.D406N(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	AGCCACAGGTCATTCCACCAC	0.622																																					p.D406N	NSCLC(30;827 977 2459 19669 26125)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1216A	15						.						78.0	66.0	70.0					15																	90347197		2200	4299	6499	88148201	SO:0001583	missense	290	exon7			M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.1216G>A	15.37:g.90347197C>T	ENSP00000300060:p.Asp406Asn	Somatic		Capture	SOLID	Phase_I	88148201	NM_001150	Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Missense_Mutation	SNP	ENST00000300060.6	37	CCDS10356.1	.	.	.	.	.	.	.	.	.	.	C	33	5.260009	0.95368	.	.	ENSG00000166825	ENST00000300060	T	0.06068	3.35	4.58	4.58	0.56647	Peptidase M1, membrane alanine aminopeptidase, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.24586	0.0596	M	0.74467	2.265	0.58432	D	0.999997	D	0.76494	0.999	D	0.76071	0.987	T	0.01169	-1.1430	10	0.72032	D	0.01	.	14.8727	0.70471	0.0:1.0:0.0:0.0	.	406	P15144	AMPN_HUMAN	N	406	ENSP00000300060:D406N	ENSP00000300060:D406N	D	-	1	0	ANPEP	88148201	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	7.772000	0.85439	2.098000	0.63641	0.313000	0.20887	GAC		ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313425.1		
KRT15	3866	hgsc.bcm.edu	37	17	39674782	39674782	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr17:39674782G>C	ENST00000254043.3	-	1	3883	c.298C>G	c.(298-300)Ctc>Gtc	p.L100V	KRT15_ENST00000393981.3_5'Flank|KRT15_ENST00000393976.2_Missense_Mutation_p.L100V|KRT15_ENST00000393974.3_5'UTR	NM_002275.3	NP_002266	P19012	K1C15_HUMAN	keratin 15	100	Gly-rich.|Head.				epidermis development (GO:0008544)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)	p.L100V(1)		NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16		Breast(137;0.000286)				CCAGAGAGGAGaccaccatcg	0.582																																					p.L100V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C298G	17						.						284.0	272.0	276.0					17																	39674782		2203	4300	6503	36928308	SO:0001583	missense	3866	exon1				CCDS11398.1	17q21.2	2013-06-20			ENSG00000171346	ENSG00000171346		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6421	protein-coding gene	gene with protein product	"""keratin-15, basic"", ""keratin-15, beta"", ""type I cytoskeletal 15"", ""cytokeratin 15"""	148030				16831889	Standard	NM_002275		Approved	K15, CK15, K1CO	uc002hwy.3	P19012	OTTHUMG00000133435	ENST00000254043.3:c.298C>G	17.37:g.39674782G>C	ENSP00000254043:p.Leu100Val	Somatic		Capture	SOLID	Phase_I	36928308	NM_002275	B3KQY1|B3KRA2|E0CX14|Q53XV8|Q9BUG4	Missense_Mutation	SNP	ENST00000254043.3	37	CCDS11398.1	.	.	.	.	.	.	.	.	.	.	G	12.63	1.995910	0.35226	.	.	ENSG00000171346	ENST00000254043;ENST00000393976	D;D	0.93859	-3.3;-3.3	5.07	5.07	0.68467	.	0.000000	0.44483	D	0.000458	D	0.93835	0.8028	L	0.54323	1.7	0.80722	D	1	D	0.58620	0.983	P	0.51016	0.656	D	0.93558	0.6892	10	0.46703	T	0.11	.	18.6371	0.91383	0.0:0.0:1.0:0.0	.	100	P19012	K1C15_HUMAN	V	100	ENSP00000254043:L100V;ENSP00000377546:L100V	ENSP00000254043:L100V	L	-	1	0	KRT15	36928308	0.990000	0.36364	0.996000	0.52242	0.493000	0.33554	2.310000	0.43708	2.653000	0.90120	0.561000	0.74099	CTC		KRT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257301.1	NM_002275	
WNT3	7473	hgsc.bcm.edu	37	17	44846106	44846106	+	Silent	SNP	C	C	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr17:44846106C>T	ENST00000225512.5	-	4	810	c.648G>A	c.(646-648)gaG>gaA	p.E216E		NM_030753.4	NP_110380.1	P56703	WNT3_HUMAN	wingless-type MMTV integration site family, member 3	216					anterior/posterior axis specification (GO:0009948)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell fate commitment (GO:0045165)|cell morphogenesis (GO:0000902)|cellular response to retinoic acid (GO:0071300)|dorsal/ventral axis specification (GO:0009950)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|gamete generation (GO:0007276)|head morphogenesis (GO:0060323)|limb bud formation (GO:0060174)|mammary gland epithelium development (GO:0061180)|mesoderm formation (GO:0001707)|negative regulation of axon extension involved in axon guidance (GO:0048843)|neuron differentiation (GO:0030182)|positive regulation of collateral sprouting in absence of injury (GO:0048697)|positive regulation of gene expression (GO:0010628)|Spemann organizer formation at the anterior end of the primitive streak (GO:0060064)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)	p.E216E(1)		endometrium(2)|large_intestine(6)|lung(4)|prostate(1)	13			BRCA - Breast invasive adenocarcinoma(9;0.0257)			AGGTCTTCACCTCACAGCTGC	0.597																																					p.E216E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G648A	17						.						79.0	82.0	81.0					17																	44846106		2203	4300	6503	42201275	SO:0001819	synonymous_variant	7473	exon4			AY009397	CCDS11505.1	17q21-q22	2013-02-28				ENSG00000108379		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12782	protein-coding gene	gene with protein product	"""WNT-3 proto-oncogene protein"""	165330		INT4		8244403	Standard	NM_030753		Approved	MGC131950, MGC138321, MGC138323	uc002ikv.3	P56703		ENST00000225512.5:c.648G>A	17.37:g.44846106C>T		Somatic		Capture	SOLID	Phase_I	42201275	NM_030753	Q2M237|Q9H1J9	Silent	SNP	ENST00000225512.5	37	CCDS11505.1																																																																																				WNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440427.1	NM_030753	
PRKCA	5578	hgsc.bcm.edu	37	17	64492338	64492338	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr17:64492338C>A	ENST00000413366.3	+	3	251	c.225C>A	c.(223-225)caC>caA	p.H75Q		NM_002737.2	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	75					activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|chondrocyte differentiation (GO:0002062)|desmosome assembly (GO:0002159)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|histone H3-T6 phosphorylation (GO:0035408)|inactivation of MAPK activity (GO:0000188)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA metabolic process (GO:0016071)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|peptidyl-serine autophosphorylation (GO:0036289)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of dense core granule biogenesis (GO:2000707)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of muscle contraction (GO:0006937)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of the force of heart contraction (GO:0002026)|response to interleukin-1 (GO:0070555)|rhodopsin mediated signaling pathway (GO:0016056)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|enzyme binding (GO:0019899)|histone kinase activity (H3-T6 specific) (GO:0035403)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|zinc ion binding (GO:0008270)	p.H75Q(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Ingenol Mebutate(DB05013)|Phosphatidylserine(DB00144)|Tamoxifen(DB00675)|Vitamin E(DB00163)	TTGTGGTCCACAAGAGGTGCC	0.383																																					p.H75Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C225A	17						.						129.0	114.0	119.0					17																	64492338		2203	4300	6503	61922800	SO:0001583	missense	5578	exon3				CCDS11664.1	17q22-q24	2009-07-10				ENSG00000154229	2.7.11.1		9393	protein-coding gene	gene with protein product		176960		PKCA			Standard	NM_002737		Approved		uc002jfp.1	P17252		ENST00000413366.3:c.225C>A	17.37:g.64492338C>A	ENSP00000408695:p.His75Gln	Somatic		Capture	SOLID	Phase_I	61922800	NM_002737	B5BU22|Q15137|Q32M72|Q96RE4	Missense_Mutation	SNP	ENST00000413366.3	37	CCDS11664.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.992958	0.74703	.	.	ENSG00000154229	ENST00000413366	D	0.99557	-6.16	5.68	4.69	0.59074	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.088054	0.44902	U	0.000416	D	0.99832	0.9924	H	0.99368	4.535	0.58432	D	0.999994	D	0.89917	1.0	D	0.97110	1.0	D	0.96487	0.9361	10	0.87932	D	0	.	14.3466	0.66668	0.0:0.9265:0.0:0.0735	.	75	P17252	KPCA_HUMAN	Q	75	ENSP00000408695:H75Q	ENSP00000408695:H75Q	H	+	3	2	PRKCA	61922800	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.590000	0.46154	1.505000	0.48720	0.650000	0.86243	CAC		PRKCA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446976.1		
TP53	7157	hgsc.bcm.edu	37	17	7577094	7577094	+	Missense_Mutation	SNP	G	G	A	rs28934574		TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr17:7577094G>A	ENST00000269305.4	-	8	1033	c.844C>T	c.(844-846)Cgg>Tgg	p.R282W	TP53_ENST00000420246.2_Missense_Mutation_p.R282W|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.R282W|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.R282W|TP53_ENST00000359597.4_Missense_Mutation_p.R282W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	282	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		DR -> EW (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in a sporadic cancer; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|Ref.22}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; dbSNP:rs28934574). {ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R282W(401)|p.R282G(29)|p.0?(8)|p.R282fs*24(4)|p.R282R(3)|p.?(2)|p.D281fs*63(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.D281_R282insXX(1)|p.C275fs*20(1)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.D281_R282delDR(1)|p.G279fs*59(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.R282fs*63(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCTGTGCGCCGGTCTCTCCCA	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R282W	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,-2 	.	463	Substitution - Missense(430)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(5)|Insertion - Frameshift(4)|Substitution - coding silent(3)|Unknown(2)|Complex - frameshift(2)|Complex - compound substitution(2)|Insertion - In frame(1)	large_intestine(136)|oesophagus(49)|upper_aerodigestive_tract(43)|stomach(33)|central_nervous_system(29)|breast(29)|lung(26)|ovary(21)|skin(20)|urinary_tract(16)|haematopoietic_and_lymphoid_tissue(16)|pancreas(10)|biliary_tract(5)|liver(5)|bone(5)|vulva(4)|prostate(4)|endometrium(3)|peritoneum(2)|thyroid(2)|NS(2)|autonomic_ganglia(1)|soft_tissue(1)|salivary_gland(1)	c.C844T	17	GRCh37	CM056413|CM920678	TP53	M	rs28934574	.	G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	83.0	71.0	75.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	844,844,844,844,448,448,448	1.5	0.3	17	dbSNP_125	75	2,8598	2.2+/-6.3	1,0,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	101,101,101,101,101,101,101	1,0,6502	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	282/394,282/394,282/347,282/342,150/262,150/210,150/215	7577094	2,13004	2203	4300	6503	7517819	SO:0001583	missense	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.844C>T	17.37:g.7577094G>A	ENSP00000269305:p.Arg282Trp	Somatic		Capture	SOLID	Phase_I	7517819	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.057525	0.76074	0.0	2.33E-4	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.75	1.49	0.22878	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	M	0.89968	3.075	0.58432	A	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.998;1.0;0.999	D	0.97713	1.0192	9	0.87932	D	0	-12.0909	8.7508	0.34613	0.0:0.1376:0.5833:0.2792	rs28934574	282;282;282;282	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	W	282;282;282;282;282;271;150	ENSP00000352610:R282W;ENSP00000269305:R282W;ENSP00000398846:R282W;ENSP00000391127:R282W;ENSP00000391478:R282W;ENSP00000425104:R150W	ENSP00000269305:R282W	R	-	1	2	TP53	7517819	1.000000	0.71417	0.327000	0.25402	0.901000	0.52897	4.477000	0.60223	0.174000	0.19809	0.462000	0.41574	CGG		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
WBP2	23558	hgsc.bcm.edu	37	17	73847706	73847706	+	Silent	SNP	G	G	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr17:73847706G>A	ENST00000591399.1	-	3	535	c.111C>T	c.(109-111)aaC>aaT	p.N37N	WBP2_ENST00000590221.1_Silent_p.N37N|WBP2_ENST00000254806.3_Silent_p.N37N|WBP2_ENST00000585462.1_Silent_p.N15N|WBP2_ENST00000433525.2_Silent_p.N37N|WBP2_ENST00000344296.4_Silent_p.N15N|WBP2_ENST00000590450.1_5'UTR			Q969T9	WBP2_HUMAN	WW domain binding protein 2	37	GRAM.				cellular response to estrogen stimulus (GO:0071391)|establishment of protein localization (GO:0045184)|positive regulation of gene expression, epigenetic (GO:0045815)|positive regulation of histone H3-K14 acetylation (GO:0071442)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nuclear chromatin (GO:0000790)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription coactivator activity (GO:0001105)	p.N37N(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	7			all cancers(21;2.61e-06)|Epithelial(20;2.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			CTTCTGGCACGTTCTTCATGT	0.493																																					p.N37N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C111T	17						.						319.0	261.0	281.0					17																	73847706		2203	4300	6503	71359301	SO:0001819	synonymous_variant	23558	exon2			U79458	CCDS11731.1	17q25	2008-02-01				ENSG00000132471			12738	protein-coding gene	gene with protein product		606962				7644498	Standard	NM_012478		Approved	WBP-2	uc002jps.3	Q969T9		ENST00000591399.1:c.111C>T	17.37:g.73847706G>A		Somatic		Capture	SOLID	Phase_I	71359301	NM_012478	O95638	Silent	SNP	ENST00000591399.1	37	CCDS11731.1																																																																																				WBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448862.1	NM_012478	
DNMT1	1786	hgsc.bcm.edu	37	19	10246814	10246814	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr19:10246814C>G	ENST00000340748.4	-	37	4826	c.4591G>C	c.(4591-4593)Gag>Cag	p.E1531Q	DNMT1_ENST00000540357.1_Missense_Mutation_p.E1534Q|DNMT1_ENST00000359526.4_Missense_Mutation_p.E1547Q			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	1531	Catalytic.|Interaction with the PRC2/EED-EZH2 complex. {ECO:0000250}.|SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.E1531Q(2)		breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	CCCATGGGCTCGGGGTTGGTG	0.642																																					p.E1547Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G4639C	19						.						41.0	42.0	42.0					19																	10246814		2203	4300	6503	10107814	SO:0001583	missense	1786	exon38			X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.4591G>C	19.37:g.10246814C>G	ENSP00000345739:p.Glu1531Gln	Somatic		Capture	SOLID	Phase_I	10107814	NM_001130823	A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Missense_Mutation	SNP	ENST00000340748.4	37	CCDS12228.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.077980	0.76528	.	.	ENSG00000130816	ENST00000359526;ENST00000540357;ENST00000340748;ENST00000541266	T;T;T	0.42513	0.97;0.97;0.97	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.59169	0.2174	L	0.54323	1.7	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.51973	-0.8637	10	0.21540	T	0.41	-25.2475	17.5034	0.87738	0.0:1.0:0.0:0.0	.	1534;1547;1531	F5GX68;P26358-2;P26358	.;.;DNMT1_HUMAN	Q	1547;1534;1531;1399	ENSP00000352516:E1547Q;ENSP00000440457:E1534Q;ENSP00000345739:E1531Q	ENSP00000345739:E1531Q	E	-	1	0	DNMT1	10107814	1.000000	0.71417	0.984000	0.44739	0.980000	0.70556	7.377000	0.79668	2.426000	0.82243	0.555000	0.69702	GAG		DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451166.1	NM_001379	
CALR	811	hgsc.bcm.edu	37	19	13054418	13054418	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr19:13054418G>A	ENST00000316448.5	+	8	1101	c.1028G>A	c.(1027-1029)gGc>gAc	p.G343D	RAD23A_ENST00000316856.3_5'Flank|RAD23A_ENST00000586534.1_5'Flank|RAD23A_ENST00000592268.1_5'Flank|RAD23A_ENST00000541222.1_5'Flank|CTC-425F1.4_ENST00000589120.1_RNA	NM_004343.3	NP_004334.1	P27797	CALR_HUMAN	calreticulin	343	C-domain.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cellular calcium ion homeostasis (GO:0006874)|cellular protein metabolic process (GO:0044267)|cellular response to lithium ion (GO:0071285)|cellular senescence (GO:0090398)|chaperone-mediated protein folding (GO:0061077)|cortical actin cytoskeleton organization (GO:0030866)|endoplasmic reticulum unfolded protein response (GO:0030968)|glucocorticoid receptor signaling pathway (GO:0042921)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|peptide antigen assembly with MHC class I protein complex (GO:0002502)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of phagocytosis (GO:0050766)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|post-translational protein modification (GO:0043687)|protein export from nucleus (GO:0006611)|protein folding (GO:0006457)|protein localization to nucleus (GO:0034504)|protein maturation by protein folding (GO:0022417)|protein N-linked glycosylation via asparagine (GO:0018279)|protein stabilization (GO:0050821)|regulation of apoptotic process (GO:0042981)|regulation of meiosis (GO:0040020)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to testosterone (GO:0033574)|sequestering of calcium ion (GO:0051208)|spermatogenesis (GO:0007283)	acrosomal vesicle (GO:0001669)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|intracellular (GO:0005622)|membrane (GO:0016020)|MHC class I peptide loading complex (GO:0042824)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasmic reticulum (GO:0016529)	androgen receptor binding (GO:0050681)|calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|chaperone binding (GO:0051087)|complement component C1q binding (GO:0001849)|DNA binding (GO:0003677)|glycoprotein binding (GO:0001948)|hormone binding (GO:0042562)|integrin binding (GO:0005178)|iron ion binding (GO:0005506)|mRNA binding (GO:0003729)|peptide binding (GO:0042277)|poly(A) RNA binding (GO:0044822)|protein binding involved in protein folding (GO:0044183)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)	p.G343D(1)		kidney(1)|large_intestine(3)|lung(5)|ovary(1)	10					Antihemophilic Factor(DB00025)|Melatonin(DB01065)|Tenecteplase(DB00031)	GAGGAGTTTGGCAACGAGACG	0.592																																					p.G343D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1028A	19						.						154.0	121.0	132.0					19																	13054418		2203	4300	6503	12915418	SO:0001583	missense	811	exon8			M84739	CCDS12288.1	19p13.3-p13.2	2014-09-17				ENSG00000179218			1455	protein-coding gene	gene with protein product	"""Sicca syndrome antigen A (autoantigen Ro; calreticulin)"", ""autoantigen Ro"""	109091				2365822	Standard	NM_004343		Approved	RO, SSA, cC1qR, CRT, FLJ26680	uc002mvu.2	P27797		ENST00000316448.5:c.1028G>A	19.37:g.13054418G>A	ENSP00000320866:p.Gly343Asp	Somatic		Capture	SOLID	Phase_I	12915418	NM_004343	Q6IAT4|Q9UDG2	Missense_Mutation	SNP	ENST00000316448.5	37	CCDS12288.1	.	.	.	.	.	.	.	.	.	.	G	17.56	3.421058	0.62622	.	.	ENSG00000179218	ENST00000316448;ENST00000539083	T	0.50813	0.73	5.6	4.56	0.56223	Concanavalin A-like lectin/glucanase (1);	0.054510	0.85682	D	0.000000	T	0.48409	0.1498	L	0.61036	1.89	0.80722	D	1	D	0.54047	0.964	B	0.43867	0.434	T	0.55823	-0.8080	10	0.87932	D	0	-24.7712	12.9742	0.58529	0.0789:0.0:0.9211:0.0	.	343	P27797	CALR_HUMAN	D	343;222	ENSP00000320866:G343D	ENSP00000320866:G343D	G	+	2	0	CALR	12915418	1.000000	0.71417	0.965000	0.40720	0.785000	0.44390	7.706000	0.84615	1.363000	0.46019	0.561000	0.74099	GGC		CALR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451952.1	NM_004343	
HIPK4	147746	hgsc.bcm.edu	37	19	40895718	40895718	+	Missense_Mutation	SNP	C	C	T	rs199527408		TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr19:40895718C>T	ENST00000291823.2	-	1	376	c.92G>A	c.(91-93)cGg>cAg	p.R31Q		NM_144685.3	NP_653286.2	Q8NE63	HIPK4_HUMAN	homeodomain interacting protein kinase 4	31	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				histone phosphorylation (GO:0016572)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|regulation of signal transduction by p53 class mediator (GO:1901796)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R31Q(2)		breast(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	20			Lung(22;4.95e-05)|LUSC - Lung squamous cell carcinoma(20;0.000292)			GCCCGTGCTCCGCCGCCAGCC	0.607													C|||	1	0.000199681	0.0	0.0	5008	,	,		16657	0.0		0.001	False		,,,				2504	0.0				p.R31Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G92A	19						.						105.0	84.0	91.0					19																	40895718		2203	4300	6503	45587558	SO:0001583	missense	147746	exon1			BC034501	CCDS12555.1	19q13.2	2008-02-05				ENSG00000160396			19007	protein-coding gene	gene with protein product		611712					Standard	NM_144685		Approved	FLJ32818	uc002onp.3	Q8NE63		ENST00000291823.2:c.92G>A	19.37:g.40895718C>T	ENSP00000291823:p.Arg31Gln	Somatic		Capture	SOLID	Phase_I	45587558	NM_144685	A8K863|Q96M54	Missense_Mutation	SNP	ENST00000291823.2	37	CCDS12555.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	35	5.526443	0.96431	.	.	ENSG00000160396	ENST00000291823	T	0.65364	-0.15	5.14	5.14	0.70334	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.43416	D	0.000562	T	0.70753	0.3260	L	0.28740	0.885	0.45662	D	0.99858	D	0.89917	1.0	D	0.87578	0.998	T	0.73780	-0.3875	10	0.72032	D	0.01	.	17.5357	0.87830	0.0:1.0:0.0:0.0	.	31	Q8NE63	HIPK4_HUMAN	Q	31	ENSP00000291823:R31Q	ENSP00000291823:R31Q	R	-	2	0	HIPK4	45587558	0.610000	0.26983	0.984000	0.44739	0.991000	0.79684	5.884000	0.69729	2.673000	0.90976	0.563000	0.77884	CGG		HIPK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462593.1	NM_144685	
HNRNPUL1	11100	hgsc.bcm.edu	37	19	41787095	41787095	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr19:41787095G>C	ENST00000392006.3	+	7	1087	c.914G>C	c.(913-915)gGa>gCa	p.G305A	HNRNPUL1_ENST00000593587.1_Missense_Mutation_p.G205A|HNRNPUL1_ENST00000378215.4_Intron|HNRNPUL1_ENST00000263367.3_Missense_Mutation_p.G216A|HNRNPUL1_ENST00000595018.1_Missense_Mutation_p.G205A|HNRNPUL1_ENST00000352456.3_Missense_Mutation_p.G205A|HNRNPUL1_ENST00000602130.1_Missense_Mutation_p.G305A	NM_007040.3	NP_008971.2	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	305	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.|Necessary for interaction with TP53.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.G305A(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	29						TATGGCTATGGAGGCACTGGG	0.502																																					p.G205A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G614C	19						.						97.0	76.0	83.0					19																	41787095		2203	4300	6503	46478935	SO:0001583	missense	11100	exon7			AJ007509	CCDS12576.1, CCDS12577.1	19q13.2	2013-06-12		2008-04-18	ENSG00000105323	ENSG00000105323			17011	protein-coding gene	gene with protein product	"""E1B 55kDa associated protein 5"""	605800		HNRPUL1		9733834, 12489984	Standard	XM_005258459		Approved	E1B-AP5, E1BAP5, FLJ12944	uc002oqb.4	Q9BUJ2	OTTHUMG00000182740	ENST00000392006.3:c.914G>C	19.37:g.41787095G>C	ENSP00000375863:p.Gly305Ala	Somatic		Capture	SOLID	Phase_I	46478935	NM_144732	B3KMW7|O76022|Q6ZSZ0|Q7L8P4|Q8N6Z4|Q96G37|Q9HAL3|Q9UG75	Missense_Mutation	SNP	ENST00000392006.3	37	CCDS12576.1	.	.	.	.	.	.	.	.	.	.	G	32	5.189824	0.94923	.	.	ENSG00000105323	ENST00000352456;ENST00000392006;ENST00000263367	T;T;T	0.68765	-0.35;-0.35;-0.35	5.86	5.86	0.93980	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	T	0.80994	0.4731	M	0.79614	2.46	0.58432	D	0.999995	P;P;D;P;D	0.58970	0.94;0.88;0.984;0.763;0.968	P;P;P;P;P	0.60068	0.868;0.758;0.827;0.74;0.853	T	0.80770	-0.1234	10	0.49607	T	0.09	-11.875	18.9646	0.92691	0.0:0.0:1.0:0.0	.	216;205;305;305;205	B7Z4B8;A8K3W4;Q9BUJ2-2;Q9BUJ2;Q9BUJ2-4	.;.;.;HNRL1_HUMAN;.	A	205;305;216	ENSP00000340857:G205A;ENSP00000375863:G305A;ENSP00000263367:G216A	ENSP00000263367:G216A	G	+	2	0	HNRNPUL1	46478935	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.513000	0.53414	2.771000	0.95319	0.563000	0.77884	GGA		HNRNPUL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463406.1	NM_144732, NM_007040	
SPAG17	200162	hgsc.bcm.edu	37	1	118530485	118530485	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr1:118530485G>A	ENST00000336338.5	-	40	5706	c.5641C>T	c.(5641-5643)Cgc>Tgc	p.R1881C		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1881						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)		p.R1881C(1)		NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		TCTTTCCAGCGTTTTGAGGAT	0.413																																					p.R1881C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5641T	1						.						169.0	153.0	159.0					1																	118530485		2203	4300	6503	118332008	SO:0001583	missense	200162	exon40				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.5641C>T	1.37:g.118530485G>A	ENSP00000337804:p.Arg1881Cys	Somatic		Capture	SOLID	Phase_I	118332008	NM_206996	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	37	CCDS899.1	.	.	.	.	.	.	.	.	.	.	G	9.572	1.121353	0.20877	.	.	ENSG00000155761	ENST00000336338;ENST00000437255	T	0.19394	2.15	4.33	0.569	0.17340	.	1.870170	0.01986	N	0.045190	T	0.13543	0.0328	L	0.51422	1.61	0.09310	N	1	D	0.63880	0.993	P	0.50896	0.653	T	0.07751	-1.0756	10	0.72032	D	0.01	.	5.2111	0.15316	0.1032:0.0:0.3961:0.5006	.	1881	Q6Q759	SPG17_HUMAN	C	1881;361	ENSP00000337804:R1881C	ENSP00000337804:R1881C	R	-	1	0	SPAG17	118332008	0.000000	0.05858	0.011000	0.14972	0.012000	0.07955	-0.287000	0.08388	-0.003000	0.14444	0.655000	0.94253	CGC		SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996	
ITGA10	8515	hgsc.bcm.edu	37	1	145532479	145532479	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr1:145532479G>A	ENST00000369304.3	+	9	1107	c.932G>A	c.(931-933)cGg>cAg	p.R311Q	ITGA10_ENST00000481236.1_3'UTR|ITGA10_ENST00000538811.1_Missense_Mutation_p.R180Q|ITGA10_ENST00000539363.1_Missense_Mutation_p.R168Q	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	311	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)	p.R311Q(1)		NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TACCTCCGGCGGCAGCGAGAT	0.473																																					p.R311Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G932A	1						.						121.0	116.0	118.0					1																	145532479		2203	4300	6503	144243836	SO:0001583	missense	8515	exon9			AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.932G>A	1.37:g.145532479G>A	ENSP00000358310:p.Arg311Gln	Somatic		Capture	SOLID	Phase_I	144243836	NM_003637	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	ENST00000369304.3	37	CCDS918.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.659554	0.88154	.	.	ENSG00000143127	ENST00000369304;ENST00000543043;ENST00000539363;ENST00000538811	T;T;T	0.54675	0.56;0.56;0.56	5.12	5.12	0.69794	von Willebrand factor, type A (3);	0.150302	0.41938	D	0.000797	T	0.62648	0.2445	M	0.61703	1.905	0.54753	D	0.999983	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.998;0.999	T	0.58763	-0.7579	10	0.33940	T	0.23	.	16.4367	0.83878	0.0:0.0:1.0:0.0	.	277;180;168;311	F5H3T9;F5GY13;B2RTV5;O75578	.;.;.;ITA10_HUMAN	Q	311;277;168;180	ENSP00000358310:R311Q;ENSP00000439894:R168Q;ENSP00000440011:R180Q	ENSP00000358310:R311Q	R	+	2	0	ITGA10	144243836	0.990000	0.36364	1.000000	0.80357	0.992000	0.81027	5.161000	0.64935	2.573000	0.86826	0.561000	0.74099	CGG		ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038537.2	NM_003637	
NBPF14	25832	hgsc.bcm.edu	37	1	148004716	148004716	+	Silent	SNP	C	C	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr1:148004716C>A	ENST00000369219.1	-	22	2614	c.2598G>T	c.(2596-2598)ccG>ccT	p.P866P				Q5TI25	NBPFE_HUMAN	neuroblastoma breakpoint family, member 14	866	NBPF 10. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)		p.P866P(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(23)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	42	all_hematologic(923;0.032)					AGTACATTGACGGAGTCGAAT	0.433																																					p.P866P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2598T	1						.						133.0	202.0	179.0					1																	148004716		2126	4261	6387	146471340	SO:0001819	synonymous_variant	25832	exon22			AK092351		1q21.1	2013-01-17			ENSG00000122497			"""neuroblastoma breakpoint family"""	25232	protein-coding gene	gene with protein product		614003				8619474, 9110174, 16079250	Standard	NM_015383		Approved	DJ328E19.C1.1	uc021owp.2	Q5TI25	OTTHUMG00000013900	ENST00000369219.1:c.2598G>T	1.37:g.148004716C>A		Somatic		Capture	SOLID	Phase_I	146471340	NM_015383	Q5TI23|Q8IX76|Q9UJI9	Silent	SNP	ENST00000369219.1	37		.	.	.	.	.	.	.	.	.	.	c	0.518	-0.863374	0.02590	.	.	ENSG00000122497	ENST00000310701	.	.	.	0.445	-0.891	0.10573	.	.	.	.	.	T	0.08179	0.0204	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.37596	-0.9699	3	.	.	.	.	.	.	.	.	.	.	.	L	872	.	.	R	-	2	0	NBPF14	146471340	0.023000	0.18921	0.001000	0.08648	0.006000	0.05464	-1.510000	0.02262	-0.810000	0.04375	-1.085000	0.02201	CGT		NBPF14-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_015383	
PEAR1	375033	hgsc.bcm.edu	37	1	156876478	156876478	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr1:156876478C>G	ENST00000338302.3	+	7	675	c.450C>G	c.(448-450)tgC>tgG	p.C150W	PEAR1_ENST00000292357.7_Missense_Mutation_p.C150W			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	150					recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)		p.C150W(1)		breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CCTGCAGCTGCGGCAACAACA	0.612																																					p.C150W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C450G	1						.						110.0	96.0	100.0					1																	156876478		2203	4300	6503	155143102	SO:0001583	missense	375033	exon6			AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.450C>G	1.37:g.156876478C>G	ENSP00000344465:p.Cys150Trp	Somatic		Capture	SOLID	Phase_I	155143102	NM_001080471	Q8TEK2	Missense_Mutation	SNP	ENST00000338302.3	37	CCDS30892.1	.	.	.	.	.	.	.	.	.	.	C	16.50	3.140421	0.56936	.	.	ENSG00000187800	ENST00000338302;ENST00000455314;ENST00000292357	T;T;T	0.67865	-0.29;-0.29;-0.29	4.81	-4.21	0.03812	.	0.000000	0.53938	D	0.000050	D	0.84629	0.5514	H	0.99752	4.75	0.80722	D	1	D;P	0.89917	1.0;0.921	D;P	0.97110	1.0;0.499	D	0.86358	0.1715	10	0.87932	D	0	.	12.5203	0.56056	0.0:0.5987:0.0:0.4013	.	12;150	Q8N780;Q5VY43	.;PEAR1_HUMAN	W	150	ENSP00000344465:C150W;ENSP00000389742:C150W;ENSP00000292357:C150W	ENSP00000292357:C150W	C	+	3	2	PEAR1	155143102	0.032000	0.19561	0.863000	0.33907	0.867000	0.49689	-0.924000	0.03996	-1.082000	0.03101	-0.258000	0.10820	TGC		PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098937.2	NM_001080471	
ADAMTS4	9507	hgsc.bcm.edu	37	1	161165403	161165403	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr1:161165403A>T	ENST00000367996.5	-	4	1541	c.1113T>A	c.(1111-1113)caT>caA	p.H371Q	ADAMTS4_ENST00000478394.1_5'UTR	NM_005099.4	NP_005090.3	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 4	371	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|protease binding (GO:0002020)|zinc ion binding (GO:0008270)	p.H371Q(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(20)|ovary(4)|prostate(3)|skin(1)|urinary_tract(1)	43	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)		Tinzaparin(DB06822)	TGGAGTTGTCATGGAGCATGT	0.547																																					p.H371Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1113A	1						.						168.0	140.0	149.0					1																	161165403		2203	4300	6503	159432027	SO:0001583	missense	9507	exon4			AB014588	CCDS1223.1	1q31-q32	2008-02-05	2005-08-19		ENSG00000158859	ENSG00000158859		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	220	protein-coding gene	gene with protein product		603876	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 4"""			10094461	Standard	NM_005099		Approved	KIAA0688, ADAMTS-2, ADMP-1	uc001fyt.4	O75173	OTTHUMG00000034349	ENST00000367996.5:c.1113T>A	1.37:g.161165403A>T	ENSP00000356975:p.His371Gln	Somatic		Capture	SOLID	Phase_I	159432027	NM_005099	Q5VTW2|Q6P4Q8|Q6UWA8|Q9UN83	Missense_Mutation	SNP	ENST00000367996.5	37	CCDS1223.1	.	.	.	.	.	.	.	.	.	.	A	19.41	3.821988	0.71028	.	.	ENSG00000158859	ENST00000367996	D	0.97161	-4.27	4.77	-0.247	0.13019	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.64402	D	0.000006	D	0.98409	0.9471	H	0.97103	3.94	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97820	1.0256	10	0.87932	D	0	.	9.3967	0.38406	0.5493:0.0:0.4507:0.0	.	371	O75173	ATS4_HUMAN	Q	371	ENSP00000356975:H371Q	ENSP00000356975:H371Q	H	-	3	2	ADAMTS4	159432027	0.406000	0.25344	0.995000	0.50966	0.991000	0.79684	-0.086000	0.11233	-0.213000	0.10094	0.459000	0.35465	CAT		ADAMTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083066.2	NM_005099	
HMCN1	83872	hgsc.bcm.edu	37	1	186121926	186121926	+	Missense_Mutation	SNP	G	G	A	rs112526907		TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr1:186121926G>A	ENST00000271588.4	+	96	15170	c.14941G>A	c.(14941-14943)Gat>Aat	p.D4981N	HMCN1_ENST00000367492.2_Missense_Mutation_p.D4981N	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4981	Nidogen G2 beta-barrel. {ECO:0000255|PROSITE-ProRule:PRU00348}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.D4981N(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CTTGGATTCCGATGGTTCTTT	0.428													G|||	1	0.000199681	0.0	0.0	5008	,	,		18974	0.0		0.001	False		,,,				2504	0.0				p.D4981N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G14941A	1						.						229.0	205.0	213.0					1																	186121926		2203	4300	6503	184388549	SO:0001583	missense	83872	exon96			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.14941G>A	1.37:g.186121926G>A	ENSP00000271588:p.Asp4981Asn	Somatic		Capture	SOLID	Phase_I	184388549	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	24.3	4.515396	0.85389	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.35421	1.31;1.31	5.9	5.9	0.94986	G2 nidogen/fibulin G2F (2);Green fluorescent protein-like (1);	0.000000	0.85682	D	0.000000	T	0.55878	0.1948	L	0.42581	1.335	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.51068	-0.8752	10	0.52906	T	0.07	.	20.2789	0.98501	0.0:0.0:1.0:0.0	.	4981	Q96RW7	HMCN1_HUMAN	N	4981	ENSP00000271588:D4981N;ENSP00000356462:D4981N	ENSP00000271588:D4981N	D	+	1	0	HMCN1	184388549	1.000000	0.71417	0.882000	0.34594	0.475000	0.33008	7.676000	0.84012	2.788000	0.95919	0.650000	0.86243	GAT		HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
KCNT2	343450	hgsc.bcm.edu	37	1	196285041	196285041	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr1:196285041T>C	ENST00000294725.9	-	21	3379	c.2464A>G	c.(2464-2466)Aac>Gac	p.N822D	KCNT2_ENST00000609185.1_Missense_Mutation_p.N748D|KCNT2_ENST00000367433.5_Missense_Mutation_p.N798D|KCNT2_ENST00000367431.4_Missense_Mutation_p.N748D|KCNT2_ENST00000451324.2_3'UTR|KCNT2_ENST00000498426.1_5'UTR			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	822					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)	p.N822D(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						GTCTGCACGTTCACAATGGTT	0.448																																					p.N822D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2464G	1						.						144.0	117.0	126.0					1																	196285041		2203	4300	6503	194551664	SO:0001583	missense	343450	exon21			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.2464A>G	1.37:g.196285041T>C	ENSP00000294725:p.Asn822Asp	Somatic		Capture	SOLID	Phase_I	194551664	NM_198503	Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	ENST00000294725.9	37	CCDS1384.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.133039	0.77662	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000294725	T;T;T	0.75477	-0.94;-0.94;-0.94	5.87	5.87	0.94306	.	0.000000	0.64402	D	0.000002	D	0.84915	0.5578	M	0.75447	2.3	0.80722	D	1	D;D;D;D;D	0.69078	0.991;0.997;0.992;0.992;0.991	P;D;D;D;P	0.63703	0.776;0.917;0.917;0.917;0.776	D	0.86207	0.1622	10	0.59425	D	0.04	-23.8441	16.2853	0.82717	0.0:0.0:0.0:1.0	.	822;780;798;748;822	A9LNM6;Q6UVM3-4;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;.;KCNT2_HUMAN	D	798;748;822	ENSP00000356403:N798D;ENSP00000356401:N748D;ENSP00000294725:N822D	ENSP00000294725:N822D	N	-	1	0	KCNT2	194551664	1.000000	0.71417	0.063000	0.19743	0.841000	0.47740	7.997000	0.88414	2.236000	0.73375	0.528000	0.53228	AAC		KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503	
ZBTB41	360023	hgsc.bcm.edu	37	1	197160979	197160979	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr1:197160979A>T	ENST00000367405.4	-	2	1239	c.1171T>A	c.(1171-1173)Tgt>Agt	p.C391S	ZBTB41_ENST00000467322.1_5'UTR	NM_194314.2	NP_919290.2	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41	391					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C391S(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(11)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	40						CAAATATCACACTCAAAGGGC	0.353																																					p.C391S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1171A	1						.						81.0	73.0	76.0					1																	197160979		2203	4300	6503	195427602	SO:0001583	missense	360023	exon2				CCDS30960.1	1q31.3	2013-01-08			ENSG00000177888	ENSG00000177888		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	24819	protein-coding gene	gene with protein product							Standard	NM_194314		Approved	FRBZ1, FLJ36199, DKFZp686C06120, ZNF924	uc001gtx.1	Q5SVQ8	OTTHUMG00000036275	ENST00000367405.4:c.1171T>A	1.37:g.197160979A>T	ENSP00000356375:p.Cys391Ser	Somatic		Capture	SOLID	Phase_I	195427602	NM_194314	A2RUA8|Q6MZT8|Q6ZR25|Q7Z4T1|Q8IZ99	Missense_Mutation	SNP	ENST00000367405.4	37	CCDS30960.1	.	.	.	.	.	.	.	.	.	.	A	27.7	4.856400	0.91355	.	.	ENSG00000177888	ENST00000367405	D	0.85171	-1.95	5.89	5.89	0.94794	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.294789	0.23821	U	0.044224	D	0.95395	0.8505	H	0.97214	3.96	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.96956	0.9698	10	0.87932	D	0	.	16.3603	0.83259	1.0:0.0:0.0:0.0	.	391	Q5SVQ8	ZBT41_HUMAN	S	391	ENSP00000356375:C391S	ENSP00000356375:C391S	C	-	1	0	ZBTB41	195427602	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.855000	0.92236	2.260000	0.74910	0.529000	0.55759	TGT		ZBTB41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088249.2	NM_194314	
PTPRC	5788	hgsc.bcm.edu	37	1	198711403	198711403	+	Silent	SNP	C	C	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr1:198711403C>A	ENST00000367376.2	+	25	2769	c.2598C>A	c.(2596-2598)gcC>gcA	p.A866A	PTPRC_ENST00000352140.3_Silent_p.A818A|PTPRC_ENST00000594404.1_Silent_p.A705A|PTPRC_ENST00000442510.2_Silent_p.A868A|PTPRC_ENST00000348564.6_Silent_p.A707A	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	866	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.A866A(1)		breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						GAATTGATGCCATGCTAGAAG	0.468																																					p.A705A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2115A	1						.						232.0	212.0	219.0					1																	198711403		2203	4300	6503	196978026	SO:0001819	synonymous_variant	5788	exon22			Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.2598C>A	1.37:g.198711403C>A		Somatic		Capture	SOLID	Phase_I	196978026	NM_080921	A8K7W6|Q16614|Q9H0Y6	Silent	SNP	ENST00000367376.2	37																																																																																					PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
DDX59	83479	hgsc.bcm.edu	37	1	200635457	200635457	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr1:200635457G>A	ENST00000331314.6	-	2	625	c.412C>T	c.(412-414)Caa>Taa	p.Q138*	DDX59_ENST00000447706.2_Nonsense_Mutation_p.Q138*|DDX59_ENST00000367348.3_Nonsense_Mutation_p.Q138*	NM_001031725.4	NP_001026895.2	Q5T1V6	DDX59_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 59	138						cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)	p.Q138*(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|liver(1)|lung(9)|ovary(3)	21						TCCTTAACTTGTAGAAGATGT	0.418																																					p.Q138X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C412T	1						.						97.0	98.0	97.0					1																	200635457		2203	4300	6503	198902080	SO:0001587	stop_gained	83479	exon2			BC041801	CCDS30964.1	1q32.1	2010-07-14			ENSG00000118197	ENSG00000118197		"""Zinc fingers, HIT-type"", ""DEAD-boxes"""	25360	protein-coding gene	gene with protein product		615464					Standard	NM_001031725		Approved	DKFZP564B1023, ZNHIT5	uc009wzk.3	Q5T1V6	OTTHUMG00000035725	ENST00000331314.6:c.412C>T	1.37:g.200635457G>A	ENSP00000330460:p.Gln138*	Somatic		Capture	SOLID	Phase_I	198902080	NM_001031725	Q6PJL2|Q8IVW3|Q9H0W3	Nonsense_Mutation	SNP	ENST00000331314.6	37	CCDS30964.1	.	.	.	.	.	.	.	.	.	.	G	19.60	3.858461	0.71834	.	.	ENSG00000118197	ENST00000447706;ENST00000367348;ENST00000331314;ENST00000436897	.	.	.	5.09	4.17	0.49024	.	0.473603	0.25711	N	0.028810	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	-4.9898	14.9352	0.70948	0.0:0.0:0.8556:0.1444	.	.	.	.	X	138	.	ENSP00000330460:Q138X	Q	-	1	0	DDX59	198902080	0.695000	0.27747	0.035000	0.18076	0.854000	0.48673	2.939000	0.48995	1.130000	0.42092	0.555000	0.69702	CAA		DDX59-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086883.2	NM_001031725.4	
NFASC	23114	hgsc.bcm.edu	37	1	204943415	204943415	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr1:204943415G>A	ENST00000401399.1	+	12	1587	c.1388G>A	c.(1387-1389)cGa>cAa	p.R463Q	NFASC_ENST00000367170.4_Missense_Mutation_p.R463Q|NFASC_ENST00000339876.6_Missense_Mutation_p.R463Q|NFASC_ENST00000338586.6_Missense_Mutation_p.R463Q|NFASC_ENST00000367169.4_Missense_Mutation_p.R463Q|NFASC_ENST00000403080.1_Missense_Mutation_p.R463Q|NFASC_ENST00000360049.4_Missense_Mutation_p.R474Q|NFASC_ENST00000367172.4_Missense_Mutation_p.R463Q|NFASC_ENST00000367171.4_Missense_Mutation_p.R463Q|NFASC_ENST00000539706.1_Missense_Mutation_p.R474Q|NFASC_ENST00000404076.1_Missense_Mutation_p.R457Q|NFASC_ENST00000338515.6_Missense_Mutation_p.R463Q|NFASC_ENST00000404907.1_Missense_Mutation_p.R474Q|NFASC_ENST00000513543.1_Missense_Mutation_p.R474Q			O94856	NFASC_HUMAN	neurofascin	463	Ig-like C2-type 5.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)		p.R474Q(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CCCACACTGCGATGGTAAGTT	0.572																																					p.R474Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1421A	1						.						68.0	45.0	52.0					1																	204943415		2203	4300	6503	203210038	SO:0001583	missense	23114	exon11			AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.1388G>A	1.37:g.204943415G>A	ENSP00000385637:p.Arg463Gln	Somatic		Capture	SOLID	Phase_I	203210038	NM_001160331	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	ENST00000401399.1	37	CCDS53460.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.2|24.2	4.501656|4.501656	0.85176|0.85176	.|.	.|.	ENSG00000163531|ENSG00000163531	ENST00000367173|ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000339876;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000367169;ENST00000403080;ENST00000404076;ENST00000401399;ENST00000404907;ENST00000513543;ENST00000430393	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.66280	.|-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2	5.54|5.54	5.54|5.54	0.83059|0.83059	.|.	.|0.000000	.|0.42682	.|D	.|0.000680	T|T	0.63803|0.63803	0.2542|0.2542	N|N	0.10809|0.10809	0.05|0.05	0.80722|0.80722	D|D	1|1	.|D;P;D;P;B;P;D	.|0.89917	.|0.994;0.888;0.999;0.822;0.407;0.661;1.0	.|P;B;D;B;B;B;D	.|0.91635	.|0.804;0.212;0.96;0.212;0.029;0.212;0.999	T|T	0.62656|0.62656	-0.6808|-0.6808	5|10	.|0.20046	.|T	.|0.44	.|.	19.0836|19.0836	0.93192|0.93192	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|474;474;559;463;463;474;463	.|O94856-11;O94856-8;B4DRH7;F8W791;O94856-9;O94856-3;O94856-2	.|.;.;.;.;.;.;.	N|Q	433|463;463;463;463;463;463;474;474;474;463;463;457;463;474;474;450	.|ENSP00000356140:R463Q;ENSP00000356139:R463Q;ENSP00000356138:R463Q;ENSP00000342128:R463Q;ENSP00000344786:R463Q;ENSP00000343509:R463Q;ENSP00000438614:R474Q;ENSP00000353154:R474Q;ENSP00000356137:R463Q;ENSP00000384875:R463Q;ENSP00000385676:R457Q;ENSP00000385637:R463Q;ENSP00000384061:R474Q;ENSP00000425908:R474Q;ENSP00000415031:R450Q	.|ENSP00000295776:R474Q	D|R	+|+	1|2	0|0	NFASC|NFASC	203210038|203210038	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.938000|0.938000	0.57974|0.57974	9.168000|9.168000	0.94781|0.94781	2.612000|2.612000	0.88384|0.88384	0.585000|0.585000	0.79938|0.79938	GAT|CGA		NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388	
NBPF3	84224	hgsc.bcm.edu	37	1	21808256	21808256	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr1:21808256G>A	ENST00000318249.5	+	13	1950	c.1600G>A	c.(1600-1602)Gtg>Atg	p.V534M	NBPF3_ENST00000454000.2_Missense_Mutation_p.V464M|NBPF3_ENST00000342104.5_Missense_Mutation_p.V522M|NBPF3_ENST00000318220.6_Missense_Mutation_p.V478M	NM_032264.3	NP_115640.1	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	534	NBPF 4. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)		p.V534M(2)		breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	20		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TTCTCTTGACGTGGATGGTGA	0.463																																					p.V534M												.	.	2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	c.G1600A	1						.						41.0	26.0	31.0					1																	21808256		2162	4260	6422	21680843	SO:0001583	missense	84224	exon13			BC024011	CCDS216.1, CCDS57976.1, CCDS57977.1	1p36.12	2013-01-17			ENSG00000142794	ENSG00000142794		"""neuroblastoma breakpoint family"""	25076	protein-coding gene	gene with protein product		612992				11230166, 16079250	Standard	NM_032264		Approved	AE2	uc001ber.4	Q9H094	OTTHUMG00000002944	ENST00000318249.5:c.1600G>A	1.37:g.21808256G>A	ENSP00000316782:p.Val534Met	Somatic		Capture	SOLID	Phase_I	21680843	NM_032264	A8K965|B4DSP2|I3L0I8|Q3BBW1|Q5VTG2|Q5VTG3|Q5VTG4|Q8IX78|Q8ND86|Q8TC96	Missense_Mutation	SNP	ENST00000318249.5	37	CCDS216.1	.	.	.	.	.	.	.	.	.	.	.	0.342	-0.949941	0.02285	.	.	ENSG00000142794	ENST00000454000;ENST00000318220;ENST00000318249;ENST00000342104;ENST00000434838	T;T;T;T;T	0.11821	2.74;2.74;2.74;2.74;2.74	0.583	-1.17	0.09648	DUF1220 (2);	.	.	.	.	T	0.18676	0.0448	L	0.35644	1.08	0.09310	N	1	P;D;P	0.69078	0.914;0.997;0.622	B;D;B	0.65773	0.328;0.938;0.092	T	0.14587	-1.0467	8	0.52906	T	0.07	.	.	.	.	.	464;522;534	B4DSP2;Q9H094-3;Q9H094	.;.;NBPF3_HUMAN	M	464;478;534;522;478	ENSP00000415711:V464M;ENSP00000316739:V478M;ENSP00000316782:V534M;ENSP00000340336:V522M;ENSP00000391865:V478M	ENSP00000316739:V478M	V	+	1	0	NBPF3	21680843	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.194000	0.17135	-1.238000	0.02535	-1.595000	0.00837	GTG		NBPF3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_032264	
TMCC2	9911	hgsc.bcm.edu	37	1	205241128	205241128	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr1:205241128C>T	ENST00000358024.3	+	5	2395	c.2006C>T	c.(2005-2007)aCg>aTg	p.T669M	TMCC2_ENST00000330675.7_Missense_Mutation_p.T444M|TMCC2_ENST00000545499.1_Missense_Mutation_p.T591M|TMCC2_ENST00000329800.7_Missense_Mutation_p.T429M|TMCC2_ENST00000495538.1_3'UTR	NM_014858.3	NP_055673.2	O75069	TMCC2_HUMAN	transmembrane and coiled-coil domain family 2	669						integral component of membrane (GO:0016021)		p.T669M(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(3)|pancreas(1)|skin(1)|urinary_tract(1)	20	Breast(84;0.0871)		BRCA - Breast invasive adenocarcinoma(75;0.117)			AACTTCATCACGCCCCTCATG	0.617																																					p.T669M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2006T	1						.						250.0	189.0	210.0					1																	205241128		2203	4300	6503	203507751	SO:0001583	missense	9911	exon5			AB001596	CCDS30984.1, CCDS55676.1, CCDS73010.1	1q32.1	2008-02-05	2005-07-13		ENSG00000133069	ENSG00000133069		"""Transmembrane and coiled-coil domain containing"""	24239	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 2"""			9455484	Standard	NM_014858		Approved	HUCEP11, FLJ38497	uc021pia.1	O75069	OTTHUMG00000037195	ENST00000358024.3:c.2006C>T	1.37:g.205241128C>T	ENSP00000350718:p.Thr669Met	Somatic		Capture	SOLID	Phase_I	203507751	NM_014858	A2RRH3|B7Z1P7|Q6ZN09	Missense_Mutation	SNP	ENST00000358024.3	37	CCDS30984.1	.	.	.	.	.	.	.	.	.	.	C	17.55	3.418026	0.62622	.	.	ENSG00000133069	ENST00000358024;ENST00000545499;ENST00000330675;ENST00000329800	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	5.18	4.27	0.50696	.	0.051366	0.85682	D	0.000000	T	0.46367	0.1389	N	0.20401	0.57	0.46874	D	0.999233	D;D;D	0.76494	0.996;0.999;0.999	P;P;D	0.71656	0.789;0.866;0.974	T	0.37056	-0.9722	10	0.29301	T	0.29	.	13.6804	0.62481	0.0:0.9248:0.0:0.0752	.	429;444;669	G5E963;B2RAX5;O75069	.;.;TMCC2_HUMAN	M	669;591;444;429	ENSP00000350718:T669M;ENSP00000437943:T591M;ENSP00000331842:T444M;ENSP00000329436:T429M	ENSP00000329436:T429M	T	+	2	0	TMCC2	203507751	0.998000	0.40836	1.000000	0.80357	0.991000	0.79684	3.889000	0.56212	1.403000	0.46800	0.655000	0.94253	ACG		TMCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090383.1	NM_014858	
JMJD4	65094	hgsc.bcm.edu	37	1	227922372	227922372	+	Silent	SNP	G	G	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr1:227922372G>A	ENST00000366758.3	-	2	545	c.546C>T	c.(544-546)ctC>ctT	p.L182L	JMJD4_ENST00000438896.2_Silent_p.L182L|SNAP47_ENST00000366759.4_5'Flank|SNAP47_ENST00000366760.1_Intron|JMJD4_ENST00000485807.1_5'Flank|SNAP47_ENST00000315781.5_5'Flank	NM_023007.2	NP_075383.2	Q9H9V9	JMJD4_HUMAN	jumonji domain containing 4	182								p.L182L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	9		Prostate(94;0.0885)				GCCAGTCTTTGAGGTAGAGAC	0.572																																					p.L182L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C546T	1						.						167.0	145.0	152.0					1																	227922372		2203	4300	6503	225988995	SO:0001819	synonymous_variant	65094	exon2			AK022579	CCDS1561.1, CCDS59203.1	1q42.13	2008-02-05			ENSG00000081692	ENSG00000081692			25724	protein-coding gene	gene with protein product						12477932	Standard	NM_023007		Approved	FLJ12517	uc001hrb.3	Q9H9V9	OTTHUMG00000037698	ENST00000366758.3:c.546C>T	1.37:g.227922372G>A		Somatic		Capture	SOLID	Phase_I	225988995	NM_023007	Q5TBZ1|Q5TBZ6|Q9H970	Silent	SNP	ENST00000366758.3	37	CCDS1561.1	.	.	.	.	.	.	.	.	.	.	.	11.83	1.756148	0.31137	.	.	ENSG00000081692	ENST00000438896	T	0.48201	0.82	4.55	3.61	0.41365	.	.	.	.	.	T	0.48040	0.1478	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.36237	-0.9756	5	.	.	.	-50.7201	8.1223	0.30978	0.0:0.1733:0.6479:0.1789	.	.	.	.	L	175	ENSP00000387830:S175L	.	S	-	2	0	JMJD4	225988995	0.979000	0.34478	1.000000	0.80357	0.994000	0.84299	0.076000	0.14712	0.998000	0.38996	0.555000	0.69702	TCA		JMJD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091970.1	NM_023007	
ERO1LB	56605	hgsc.bcm.edu	37	1	236416724	236416724	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr1:236416724C>T	ENST00000354619.5	-	3	505	c.304G>A	c.(304-306)Gag>Aag	p.E102K	ERO1LB_ENST00000327333.8_Missense_Mutation_p.E102K	NM_019891.3	NP_063944.3	Q86YB8	ERO1B_HUMAN	ERO1-like beta (S. cerevisiae)	102					4-hydroxyproline metabolic process (GO:0019471)|cell redox homeostasis (GO:0045454)|extracellular matrix organization (GO:0030198)|glucose homeostasis (GO:0042593)|insulin processing (GO:0030070)|protein folding (GO:0006457)|protein maturation by protein folding (GO:0022417)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|unfolded protein binding (GO:0051082)	p.E102K(1)		NS(1)|endometrium(3)|large_intestine(8)|lung(8)|skin(2)|urinary_tract(1)	23	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.123)|Acute lymphoblastic leukemia(190;0.205)|Prostate(94;0.219)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Flavin adenine dinucleotide(DB03147)	TATTATACCTCTGGACAGGGC	0.383																																					p.E102K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G304A	1						.						48.0	46.0	47.0					1																	236416724		2203	4300	6503	234483347	SO:0001583	missense	56605	exon3			AF252538	CCDS31064.1	1q42.2-q43	2008-02-05			ENSG00000086619	ENSG00000086619			14355	protein-coding gene	gene with protein product		615437				10818100	Standard	NM_019891		Approved	ERO1-L(beta)	uc001hxt.3	Q86YB8	OTTHUMG00000039955	ENST00000354619.5:c.304G>A	1.37:g.236416724C>T	ENSP00000346635:p.Glu102Lys	Somatic		Capture	SOLID	Phase_I	234483347	NM_019891	B4DF57|Q5T1H4|Q8IZ11|Q9NR62	Missense_Mutation	SNP	ENST00000354619.5	37	CCDS31064.1	.	.	.	.	.	.	.	.	.	.	C	18.70	3.680446	0.68042	.	.	ENSG00000086619	ENST00000354619;ENST00000327333	T;T	0.48201	0.82;0.82	5.65	5.65	0.86999	.	0.155531	0.56097	N	0.000026	T	0.57989	0.2091	M	0.84773	2.715	0.80722	D	1	B;B	0.20550	0.046;0.013	B;B	0.26693	0.04;0.072	T	0.57791	-0.7750	10	0.45353	T	0.12	-4.6606	18.4833	0.90819	0.0:1.0:0.0:0.0	.	102;102	B4DF57;Q86YB8	.;ERO1B_HUMAN	K	102	ENSP00000346635:E102K;ENSP00000377574:E102K	ENSP00000377574:E102K	E	-	1	0	ERO1LB	234483347	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	5.379000	0.66196	2.662000	0.90505	0.561000	0.74099	GAG		ERO1LB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096371.1	NM_019891	
PIK3CD	5293	hgsc.bcm.edu	37	1	9784120	9784120	+	Silent	SNP	C	C	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr1:9784120C>T	ENST00000377346.4	+	21	2883	c.2688C>T	c.(2686-2688)agC>agT	p.S896S	PIK3CD_ENST00000361110.2_Silent_p.S920S|PIK3CD_ENST00000536656.1_Silent_p.S920S	NM_005026.3	NP_005017.3	O00329	PK3CD_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta	896	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|B cell chemotaxis (GO:0035754)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|cytokine production (GO:0001816)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell chemotaxis (GO:0002551)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|natural killer cell activation (GO:0030101)|natural killer cell chemotaxis (GO:0035747)|natural killer cell differentiation (GO:0001779)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|respiratory burst involved in defense response (GO:0002679)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|mast cell granule (GO:0042629)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)	p.S896S(1)		central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)	Caffeine(DB00201)	ATCGGCACAGCGACAACATCA	0.632																																					p.S896S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2688T	1						.						179.0	166.0	170.0					1																	9784120		2203	4300	6503	9706707	SO:0001819	synonymous_variant	5293	exon21				CCDS104.1	1p36.2	2014-09-17	2012-07-13		ENSG00000171608	ENSG00000171608	2.7.1.153		8977	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase, catalytic, delta polypeptide"", ""phosphoinositide-3-kinase C"""	602839	"""phosphoinositide-3-kinase, catalytic, delta polypeptide"""			9113989, 9455486	Standard	NM_005026		Approved	p110D	uc001aqb.4	O00329	OTTHUMG00000001450	ENST00000377346.4:c.2688C>T	1.37:g.9784120C>T		Somatic		Capture	SOLID	Phase_I	9706707	NM_005026	A6NCG0|G1FFP1|O15445|Q5SR49	Silent	SNP	ENST00000377346.4	37	CCDS104.1																																																																																				PIK3CD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004235.1	NM_005026	
C1orf101	257044	hgsc.bcm.edu	37	1	244681984	244681984	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr1:244681984G>A	ENST00000366534.4	+	8	574	c.520G>A	c.(520-522)Gag>Aag	p.E174K	C1orf101_ENST00000473875.1_Intron|C1orf101_ENST00000366533.4_Missense_Mutation_p.E174K|C1orf101_ENST00000366531.3_Missense_Mutation_p.E23K	NM_001130957.1	NP_001124429.1	Q5SY80	CA101_HUMAN	chromosome 1 open reading frame 101	174						CatSper complex (GO:0036128)		p.E174K(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	36	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)			TTCTTCAAATGAGAAAATGAG	0.299																																					p.E174K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G520A	1						.						37.0	42.0	40.0					1																	244681984		2194	4294	6488	242748607	SO:0001583	missense	257044	exon8			BC032859	CCDS1625.1, CCDS44340.1, CCDS55693.1	1q44	2012-12-20			ENSG00000179397	ENSG00000179397			28491	protein-coding gene	gene with protein product						12477932	Standard	NM_173807		Approved	MGC33370	uc001iam.3	Q5SY80	OTTHUMG00000040103	ENST00000366534.4:c.520G>A	1.37:g.244681984G>A	ENSP00000355492:p.Glu174Lys	Somatic		Capture	SOLID	Phase_I	242748607	NM_173807	B4DZR4|B7Z7X5|E9PEA3|Q8IYZ6	Missense_Mutation	SNP	ENST00000366534.4	37	CCDS44340.1	.	.	.	.	.	.	.	.	.	.	G	1.372	-0.585690	0.03827	.	.	ENSG00000179397	ENST00000391841;ENST00000366534;ENST00000366533;ENST00000366531	T;T	0.30182	1.54;1.54	4.79	-3.07	0.05363	.	3.065990	0.00610	N	0.000414	T	0.24736	0.0600	L	0.40543	1.245	0.09310	N	1	B;B	0.24426	0.103;0.103	B;B	0.25140	0.058;0.058	T	0.18461	-1.0336	10	0.37606	T	0.19	.	5.4656	0.16642	0.4375:0.303:0.2595:0.0	.	174;174	Q5SY80;Q5SY80-2	CA101_HUMAN;.	K	174;174;174;23	ENSP00000355492:E174K;ENSP00000355491:E174K	ENSP00000355489:E23K	E	+	1	0	C1orf101	242748607	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.127000	0.01315	-0.437000	0.07243	0.650000	0.86243	GAG		C1orf101-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096701.1	NM_173807	
BPIFB3	359710	hgsc.bcm.edu	37	20	31647798	31647798	+	Missense_Mutation	SNP	G	G	A	rs199515506		TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr20:31647798G>A	ENST00000375494.3	+	4	488	c.488G>A	c.(487-489)cGc>cAc	p.R163H	AL121756.1_ENST00000579962.1_RNA	NM_182658.1	NP_872599.1	P59826	BPIB3_HUMAN	BPI fold containing family B, member 3	163	Leu-rich.				innate immune response (GO:0045087)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)	p.R163H(1)									ATCCTCAAGCGCTGCAGCACG	0.637																																					p.R163H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G488A	20						.						91.0	80.0	84.0					20																	31647798		2203	4300	6503	31111459	SO:0001583	missense	359710	exon4			AF549189	CCDS13212.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186190	ENSG00000186190		"""BPI fold containing"""	16178	protein-coding gene	gene with protein product		615717	"""chromosome 20 open reading frame 185"""	C20orf185		11971875, 21787333	Standard	NM_182658		Approved	dJ726C3.4, LPLUNC3, RYA3	uc002wym.1	P59826	OTTHUMG00000032234	ENST00000375494.3:c.488G>A	20.37:g.31647798G>A	ENSP00000364643:p.Arg163His	Somatic		Capture	SOLID	Phase_I	31111459	NM_182658	Q5TDX7	Missense_Mutation	SNP	ENST00000375494.3	37	CCDS13212.1	.	.	.	.	.	.	.	.	.	.	G	18.11	3.549703	0.65311	.	.	ENSG00000186190	ENST00000375494	T	0.04454	3.62	4.79	4.79	0.61399	.	0.444204	0.21454	N	0.074286	T	0.12689	0.0308	L	0.47716	1.5	0.32794	N	0.500816	D	0.71674	0.998	P	0.61070	0.883	T	0.02519	-1.1147	10	0.41790	T	0.15	-16.8523	13.2098	0.59817	0.0:0.0:1.0:0.0	.	163	P59826	BPIB3_HUMAN	H	163	ENSP00000364643:R163H	ENSP00000364643:R163H	R	+	2	0	BPIFB3	31111459	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	3.068000	0.50018	2.481000	0.83766	0.561000	0.74099	CGC		BPIFB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078654.2	NM_182658	
ZNF217	7764	hgsc.bcm.edu	37	20	52198292	52198292	+	Silent	SNP	C	C	T	rs374457302		TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr20:52198292C>T	ENST00000371471.2	-	2	1499	c.1074G>A	c.(1072-1074)gcG>gcA	p.A358A	ZNF217_ENST00000540425.1_5'Flank|ZNF217_ENST00000302342.3_Silent_p.A358A			O75362	ZN217_HUMAN	zinc finger protein 217	358					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.A358A(2)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			CCACGGAGGGCGCTTCGCCGT	0.557																																					p.A358A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1074A	20						.	C		1,4405	2.1+/-5.4	0,1,2202	115.0	117.0	117.0		1074	4.8	0.3	20		117	0,8600		0,0,4300	no	coding-synonymous	ZNF217	NM_006526.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		358/1049	52198292	1,13005	2203	4300	6503	51631699	SO:0001819	synonymous_variant	7764	exon1			AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.1074G>A	20.37:g.52198292C>T		Somatic		Capture	SOLID	Phase_I	51631699	NM_006526	E1P5Y6|Q14DB8	Silent	SNP	ENST00000371471.2	37	CCDS13443.1																																																																																				ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079757.2	NM_006526	
TIAM1	7074	hgsc.bcm.edu	37	21	32508329	32508329	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr21:32508329A>T	ENST00000286827.3	-	24	4276	c.3805T>A	c.(3805-3807)Ttg>Atg	p.L1269M	TIAM1_ENST00000541036.1_Missense_Mutation_p.L1209M	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	1269	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L1269M(2)		autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						GTAGTGTGCAAAAGCAGGTCT	0.488																																					p.L1269M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T3805A	21						.						85.0	80.0	82.0					21																	32508329		2203	4300	6503	31430200	SO:0001583	missense	7074	exon24				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.3805T>A	21.37:g.32508329A>T	ENSP00000286827:p.Leu1269Met	Somatic		Capture	SOLID	Phase_I	31430200	NM_003253	B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	37	CCDS13609.1	.	.	.	.	.	.	.	.	.	.	A	14.62	2.589263	0.46110	.	.	ENSG00000156299	ENST00000286827;ENST00000541036	T;T	0.46819	0.86;0.89	5.49	3.02	0.34903	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.000000	0.64402	D	0.000003	T	0.52821	0.1758	L	0.39397	1.21	0.51012	D	0.999906	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.998	T	0.44360	-0.9333	10	0.23302	T	0.38	.	8.1876	0.31348	0.8148:0.0:0.1852:0.0	.	1209;1209;1269	F5GZ53;B7ZLR6;Q13009	.;.;TIAM1_HUMAN	M	1269;1209	ENSP00000286827:L1269M;ENSP00000441570:L1209M	ENSP00000286827:L1269M	L	-	1	2	TIAM1	31430200	0.061000	0.20836	0.958000	0.39756	0.998000	0.95712	0.527000	0.22987	0.964000	0.38108	0.533000	0.62120	TTG		TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253	
TMEM182	130827	hgsc.bcm.edu	37	2	103431426	103431426	+	Silent	SNP	A	A	G			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr2:103431426A>G	ENST00000412401.2	+	5	894	c.689A>G	c.(688-690)tAa>tGa	p.*230*	TMEM182_ENST00000409528.1_Silent_p.*134*|TMEM182_ENST00000409173.1_Silent_p.*187*|TMEM182_ENST00000486293.1_Intron	NM_144632.3	NP_653233.3	Q6ZP80	TM182_HUMAN	transmembrane protein 182	0						integral component of membrane (GO:0016021)		p.*230*(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)	11						ATACATCACTAAATCAACTGT	0.348																																					p.X230X												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A689G	2						.						75.0	72.0	73.0					2																	103431426		2203	4300	6503	102797858	SO:0001819	synonymous_variant	130827	exon5			AK054856	CCDS2064.1	2q12.1	2009-08-25			ENSG00000170417	ENSG00000170417			26391	protein-coding gene	gene with protein product						12477932	Standard	NM_144632		Approved	FLJ30294	uc010fjb.3	Q6ZP80	OTTHUMG00000130779	ENST00000412401.2:c.689A>G	2.37:g.103431426A>G		Somatic		Capture	SOLID	Phase_I	102797858	NM_144632	C9JML7|Q3B7B8|Q53TT9|Q6GMU0|Q8WW45|Q96NR4	Silent	SNP	ENST00000412401.2	37	CCDS2064.1																																																																																				TMEM182-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253293.1	NM_144632	
NT5C1B	93034	hgsc.bcm.edu	37	2	18768433	18768433	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr2:18768433G>A	ENST00000359846.2	-	3	204	c.127C>T	c.(127-129)Cgt>Tgt	p.R43C	NT5C1B_ENST00000600945.1_Missense_Mutation_p.R43C|NT5C1B-RDH14_ENST00000532967.1_Missense_Mutation_p.R43C|NT5C1B_ENST00000460052.1_Intron|NT5C1B_ENST00000304081.4_Intron	NM_001002006.2|NM_001199086.1|NM_001199087.1|NM_001199088.1	NP_001002006.1|NP_001186015.1|NP_001186016.1|NP_001186017.1	Q96P26	5NT1B_HUMAN	5'-nucleotidase, cytosolic IB	43					nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)	p.R43C(1)		endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				TTGACTGCACGCCTCATCTGA	0.567																																					p.R43C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C127T	2						.						45.0	36.0	39.0					2																	18768433		2203	4300	6503	18631914	SO:0001583	missense	93034	exon3			AF356185	CCDS33149.1, CCDS33150.1	2p24.2	2010-08-13			ENSG00000185013	ENSG00000185013	3.1.3.5		17818	protein-coding gene	gene with protein product		610526				11690631	Standard	NM_033253		Approved	AIRP, CN-IB		Q96P26	OTTHUMG00000151765	ENST00000359846.2:c.127C>T	2.37:g.18768433G>A	ENSP00000352904:p.Arg43Cys	Somatic		Capture	SOLID	Phase_I	18631914	NM_001199104	B5MCR0|B7ZVX7|Q53RX2|Q8N9W3|Q8NA26|Q96DU5|Q96KE6|Q96M25|Q96SA3	Missense_Mutation	SNP	ENST00000359846.2	37	CCDS33150.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.209982	0.79240	.	.	ENSG00000250741;ENSG00000185013;ENSG00000185013	ENST00000532967;ENST00000359846;ENST00000416783	.	.	.	5.39	5.39	0.77823	.	0.473849	0.18290	N	0.145760	T	0.52041	0.1710	N	0.14661	0.345	0.39825	D	0.972898	D;D;D	0.76494	0.999;0.999;0.999	P;P;P	0.58130	0.685;0.685;0.833	T	0.58696	-0.7591	9	0.87932	D	0	-9.291	14.5287	0.67909	0.0:0.0:1.0:0.0	.	43;43;43	B4DZ86;Q96P26;Q96P26-4	.;5NT1B_HUMAN;.	C	43	.	ENSP00000352904:R43C	R	-	1	0	NT5C1B-RDH14;NT5C1B	18631914	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.235000	0.58666	2.809000	0.96659	0.467000	0.42956	CGT		NT5C1B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000323822.1		
GALNT5	11227	hgsc.bcm.edu	37	2	158152266	158152266	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr2:158152266A>T	ENST00000259056.4	+	4	2318	c.1833A>T	c.(1831-1833)aaA>aaT	p.K611N		NM_014568.1	NP_055383.1	Q7Z7M9	GALT5_HUMAN	polypeptide N-acetylgalactosaminyltransferase 5	611					cellular protein metabolic process (GO:0044267)|glycosaminoglycan biosynthetic process (GO:0006024)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.K611N(1)		breast(4)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	56						GTAGAAAGAAAGTGGCCTGTC	0.378																																					p.K611N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1833T	2						.						191.0	180.0	184.0					2																	158152266		2203	4300	6503	157860512	SO:0001583	missense	11227	exon4			AJ245539	CCDS2203.1	2q24.1	2014-03-13	2014-03-13		ENSG00000136542	ENSG00000136542	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4127	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 5"""	615129	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)"""			10545594	Standard	NM_014568		Approved	GalNAc-T5	uc002tzg.3	Q7Z7M9	OTTHUMG00000131965	ENST00000259056.4:c.1833A>T	2.37:g.158152266A>T	ENSP00000259056:p.Lys611Asn	Somatic		Capture	SOLID	Phase_I	157860512	NM_014568	A5PKZ1|Q9UGK7|Q9UHL6	Missense_Mutation	SNP	ENST00000259056.4	37	CCDS2203.1	.	.	.	.	.	.	.	.	.	.	A	15.54	2.863778	0.51482	.	.	ENSG00000136542	ENST00000259056	T	0.58940	0.3	5.63	3.18	0.36537	Glycosyl transferase, family 2 (1);	0.046814	0.85682	D	0.000000	T	0.37999	0.1024	N	0.11201	0.11	0.37179	D	0.903418	P	0.40282	0.711	B	0.41412	0.356	T	0.38542	-0.9656	10	0.44086	T	0.13	.	8.9525	0.35799	0.7664:0.0:0.2336:0.0	.	611	Q7Z7M9	GALT5_HUMAN	N	611	ENSP00000259056:K611N	ENSP00000259056:K611N	K	+	3	2	GALNT5	157860512	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	0.981000	0.29526	0.463000	0.27118	-0.408000	0.06270	AAA		GALNT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254925.2	NM_014568	
MYO1B	4430	hgsc.bcm.edu	37	2	192255042	192255042	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr2:192255042A>T	ENST00000392318.3	+	18	2053	c.1806A>T	c.(1804-1806)aaA>aaT	p.K602N	MYO1B_ENST00000392316.1_Missense_Mutation_p.K602N|MYO1B_ENST00000339514.4_Missense_Mutation_p.K602N|MYO1B_ENST00000304164.4_Missense_Mutation_p.K602N|MYO1B_ENST00000439065.2_5'Flank	NM_001130158.1	NP_001123630.1	O43795	MYO1B_HUMAN	myosin IB	602	Myosin motor.				actin filament bundle assembly (GO:0051017)|actin filament organization (GO:0007015)|actin filament-based movement (GO:0030048)|metabolic process (GO:0008152)|post-Golgi vesicle-mediated transport (GO:0006892)	actin filament (GO:0005884)|brush border (GO:0005903)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.K602N(1)		NS(1)|central_nervous_system(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(19)|ovary(1)	55			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			ATGATAAAAAAGCAGCACACA	0.428																																					p.K602N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1806T	2						.						123.0	121.0	122.0					2																	192255042		2203	4300	6503	191963287	SO:0001583	missense	4430	exon18			L29138	CCDS2311.1, CCDS46477.1	2q12-q34	2011-09-27			ENSG00000128641	ENSG00000128641		"""Myosins / Myosin superfamily : Class I"""	7596	protein-coding gene	gene with protein product		606537				8022818, 8449985	Standard	NM_012223		Approved	myr1	uc010fsg.2	O43795	OTTHUMG00000132718	ENST00000392318.3:c.1806A>T	2.37:g.192255042A>T	ENSP00000376132:p.Lys602Asn	Somatic		Capture	SOLID	Phase_I	191963287	NM_012223	O43794|Q7Z6L5	Missense_Mutation	SNP	ENST00000392318.3	37	CCDS46477.1	.	.	.	.	.	.	.	.	.	.	A	19.72	3.880808	0.72294	.	.	ENSG00000128641	ENST00000339514;ENST00000392318;ENST00000304164;ENST00000392316	D;D;D;D	0.89415	-2.51;-2.51;-2.51;-2.51	5.54	-3.72	0.04411	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.93510	0.7929	M	0.85542	2.76	0.80722	D	1	D;D	0.71674	0.998;0.973	D;D	0.69654	0.965;0.913	D	0.92419	0.5944	10	0.62326	D	0.03	.	17.0979	0.86641	0.32:0.0:0.68:0.0	.	602;602	O43795;O43795-2	MYO1B_HUMAN;.	N	602	ENSP00000341903:K602N;ENSP00000376132:K602N;ENSP00000306382:K602N;ENSP00000376130:K602N	ENSP00000306382:K602N	K	+	3	2	MYO1B	191963287	0.992000	0.36948	0.912000	0.35992	0.834000	0.47266	0.360000	0.20250	-0.882000	0.03987	-0.256000	0.11100	AAA		MYO1B-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334774.1	NM_012223	
HECW2	57520	hgsc.bcm.edu	37	2	197171284	197171284	+	Silent	SNP	C	C	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr2:197171284C>T	ENST00000260983.3	-	13	2924	c.2742G>A	c.(2740-2742)acG>acA	p.T914T	HECW2_ENST00000409111.1_Silent_p.T558T	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	914	Interaction with TP73.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.T914T(1)		biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						GTAACAGCAACGTGATCCTGG	0.517																																					p.T914T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2742A	2						.						146.0	131.0	136.0					2																	197171284		2203	4300	6503	196879529	SO:0001819	synonymous_variant	57520	exon13			AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.2742G>A	2.37:g.197171284C>T		Somatic		Capture	SOLID	Phase_I	196879529	NM_020760	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Silent	SNP	ENST00000260983.3	37	CCDS33354.1																																																																																				HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760	
ALK	238	hgsc.bcm.edu	37	2	29450510	29450510	+	Silent	SNP	G	G	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr2:29450510G>T	ENST00000389048.3	-	17	3750	c.2844C>A	c.(2842-2844)ccC>ccA	p.P948P	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	948					activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.P948P(1)	ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	CATCCATTTCGGGGTCATTGT	0.512			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.P948P		yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2844A	2						.						183.0	169.0	174.0					2																	29450510		2203	4300	6503	29304014	SO:0001819	synonymous_variant	238	exon17	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.2844C>A	2.37:g.29450510G>T		Somatic		Capture	SOLID	Phase_I	29304014	NM_004304	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Silent	SNP	ENST00000389048.3	37	CCDS33172.1																																																																																				ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1	NM_004304	
ALK	238	hgsc.bcm.edu	37	2	29519818	29519818	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr2:29519818C>T	ENST00000389048.3	-	9	2659	c.1753G>A	c.(1753-1755)Gcc>Acc	p.A585T	ALK_ENST00000431873.1_Intron|ALK_ENST00000498037.1_5'UTR	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	585	MAM 2. {ECO:0000255|PROSITE- ProRule:PRU00128}.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.A585T(1)	ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	TCATAGGCGGCGACATGCCAG	0.552			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.A585T		yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1753A	2						.						150.0	116.0	128.0					2																	29519818		2203	4300	6503	29373322	SO:0001583	missense	238	exon9	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.1753G>A	2.37:g.29519818C>T	ENSP00000373700:p.Ala585Thr	Somatic		Capture	SOLID	Phase_I	29373322	NM_004304	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Missense_Mutation	SNP	ENST00000389048.3	37	CCDS33172.1	.	.	.	.	.	.	.	.	.	.	C	10.86	1.471024	0.26423	.	.	ENSG00000171094	ENST00000389048	T	0.02050	4.48	5.2	3.36	0.38483	Concanavalin A-like lectin/glucanase (1);MAM domain (2);	0.000000	0.45867	U	0.000337	T	0.01558	0.0050	L	0.32530	0.975	0.25576	N	0.986846	P	0.46277	0.875	B	0.30855	0.121	T	0.52895	-0.8514	9	.	.	.	.	7.9422	0.29965	0.0:0.7521:0.1611:0.0868	.	585	Q9UM73	ALK_HUMAN	T	585	ENSP00000373700:A585T	.	A	-	1	0	ALK	29373322	0.622000	0.27085	0.017000	0.16124	0.076000	0.17211	1.078000	0.30754	0.554000	0.29061	0.563000	0.77884	GCC		ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1	NM_004304	
CNGA3	1261	hgsc.bcm.edu	37	2	99013469	99013469	+	Silent	SNP	C	C	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr2:99013469C>T	ENST00000272602.2	+	7	1875	c.1836C>T	c.(1834-1836)atC>atT	p.I612I	CNGA3_ENST00000436404.2_Silent_p.I594I|CNGA3_ENST00000409937.1_Silent_p.I616I|CNGA3_ENST00000393504.1_Silent_p.I612I			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	612					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)	p.I612I(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						ACAACCTGATCGATGAGGAGC	0.607																																					p.I612I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1836T	2						.						32.0	32.0	32.0					2																	99013469		2203	4300	6503	98379901	SO:0001819	synonymous_variant	1261	exon8			S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.1836C>T	2.37:g.99013469C>T		Somatic		Capture	SOLID	Phase_I	98379901	NM_001298	E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Silent	SNP	ENST00000272602.2	37	CCDS2034.1																																																																																				CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	NM_001298	
DLX2	1746	hgsc.bcm.edu	37	2	172967247	172967247	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr2:172967247C>T	ENST00000234198.4	-	1	381	c.20G>A	c.(19-21)aGt>aAt	p.S7N	DLX2_ENST00000466293.2_Missense_Mutation_p.S7N|AC104801.1_ENST00000448117.1_lincRNA	NM_004405.3	NP_004396.1	Q07687	DLX2_HUMAN	distal-less homeobox 2	7					brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|cartilage development (GO:0051216)|cerebral cortex GABAergic interneuron fate commitment (GO:0021893)|embryonic cranial skeleton morphogenesis (GO:0048701)|hippocampus development (GO:0021766)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb development (GO:0021772)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|subpallium development (GO:0021544)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded RNA binding (GO:0003727)	p.S7N(1)		endometrium(1)|large_intestine(1)|lung(6)|ovary(2)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.216)			AGCCACTAGACTGTCAAAGAC	0.692																																					p.S7N	GBM(188;775 2993 11256 23072)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G20A	2						.						22.0	20.0	21.0					2																	172967247		1928	3737	5665	172675493	SO:0001583	missense	1746	exon1			U51003	CCDS2248.1	2q31.1	2011-06-20	2005-12-22		ENSG00000115844	ENSG00000115844		"""Homeoboxes / ANTP class : NKL subclass"""	2915	protein-coding gene	gene with protein product		126255	"""distal-less homeo box 2"""			1354641	Standard	NM_004405		Approved	TES-1	uc002uhn.3	Q07687	OTTHUMG00000132276	ENST00000234198.4:c.20G>A	2.37:g.172967247C>T	ENSP00000234198:p.Ser7Asn	Somatic		Capture	SOLID	Phase_I	172675493	NM_004405	B4DMK4|B7ZA14	Missense_Mutation	SNP	ENST00000234198.4	37	CCDS2248.1	.	.	.	.	.	.	.	.	.	.	C	14.96	2.692815	0.48202	.	.	ENSG00000115844	ENST00000234198;ENST00000466293	D;D	0.92911	-2.6;-3.13	4.51	4.51	0.55191	.	0.047558	0.85682	D	0.000000	T	0.81819	0.4903	N	0.08118	0	0.40406	D	0.979708	B;B	0.24317	0.003;0.101	B;B	0.17098	0.005;0.017	T	0.78795	-0.2064	10	0.32370	T	0.25	-9.9179	11.4959	0.50408	0.0:0.9108:0.0:0.0892	.	7;7	B7ZA14;Q07687	.;DLX2_HUMAN	N	7	ENSP00000234198:S7N;ENSP00000446904:S7N	ENSP00000234198:S7N	S	-	2	0	DLX2	172675493	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	0.854000	0.27791	2.040000	0.60383	0.561000	0.74099	AGT		DLX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255368.3		
VIL1	7429	hgsc.bcm.edu	37	2	219289054	219289054	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr2:219289054G>A	ENST00000248444.5	+	3	218	c.130G>A	c.(130-132)Gac>Aac	p.D44N	VIL1_ENST00000392114.2_Intron|VIL1_ENST00000440053.1_Missense_Mutation_p.D44N	NM_007127.2	NP_009058.2	P09327	VILI_HUMAN	villin 1	44	Core.|Necessary for homodimerization.				actin filament capping (GO:0051693)|actin filament depolymerization (GO:0030042)|actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cytoplasmic actin-based contraction involved in cell motility (GO:0060327)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell differentiation (GO:0030855)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell migration (GO:0010634)|protein complex assembly (GO:0006461)|regulation of actin nucleation (GO:0051125)|regulation of cell shape (GO:0008360)|regulation of lamellipodium morphogenesis (GO:2000392)|regulation of wound healing (GO:0061041)|response to bacterium (GO:0009617)	actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|microvillus (GO:0005902)|ruffle (GO:0001726)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|identical protein binding (GO:0042802)|lysophosphatidic acid binding (GO:0035727)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)	p.D44N(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Renal(207;0.0474)		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTTCGATGGTGACTGCTACAT	0.597																																					p.D44N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G130A	2						.						92.0	85.0	87.0					2																	219289054		2203	4300	6503	218997298	SO:0001583	missense	7429	exon3			X12901	CCDS2417.1	2q35	2012-10-02			ENSG00000127831	ENSG00000127831			12690	protein-coding gene	gene with protein product		193040		VIL		2846586	Standard	NM_007127		Approved	D2S1471	uc002via.3	P09327	OTTHUMG00000133112	ENST00000248444.5:c.130G>A	2.37:g.219289054G>A	ENSP00000248444:p.Asp44Asn	Somatic		Capture	SOLID	Phase_I	218997298	NM_007127	B2R9A7|Q53S11|Q96AC8	Missense_Mutation	SNP	ENST00000248444.5	37	CCDS2417.1	.	.	.	.	.	.	.	.	.	.	G	31	5.077450	0.94000	.	.	ENSG00000127831	ENST00000248444;ENST00000454069;ENST00000440053	T;T;T	0.26660	1.72;1.72;1.72	4.16	4.16	0.48862	Gelsolin domain (1);	0.000000	0.64402	D	0.000001	T	0.60779	0.2295	M	0.92691	3.335	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.995;1.0	T	0.72984	-0.4125	10	0.62326	D	0.03	-36.9637	16.6391	0.85068	0.0:0.0:1.0:0.0	.	44;44	Q96AC8;P09327	.;VILI_HUMAN	N	44	ENSP00000248444:D44N;ENSP00000412657:D44N;ENSP00000409270:D44N	ENSP00000248444:D44N	D	+	1	0	VIL1	218997298	1.000000	0.71417	0.999000	0.59377	0.935000	0.57460	9.468000	0.97676	2.163000	0.67991	0.313000	0.20887	GAC		VIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256778.3	NM_007127	
SPATA12	353324	hgsc.bcm.edu	37	3	57108238	57108238	+	Silent	SNP	C	C	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr3:57108238C>T	ENST00000334325.1	+	2	1191	c.516C>T	c.(514-516)tgC>tgT	p.C172C	ARHGEF3_ENST00000338458.4_Intron	NM_181727.1	NP_859078.1	Q7Z6I5	SPT12_HUMAN	spermatogenesis associated 12	172								p.C172C(1)		large_intestine(2)|lung(1)	3				KIRC - Kidney renal clear cell carcinoma(284;0.0111)|Kidney(284;0.0129)		CTGAGGGCTGCTTTGTCAGGT	0.483																																					p.C172C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C516T	3						.						119.0	117.0	118.0					3																	57108238		2202	4300	6502	57083278	SO:0001819	synonymous_variant	353324	exon2			AY221117	CCDS2879.1	3p21.2	2012-09-19			ENSG00000186451	ENSG00000186451			23221	protein-coding gene	gene with protein product		609869				22981541, 17251597	Standard	NM_181727		Approved		uc003dij.1	Q7Z6I5	OTTHUMG00000158862	ENST00000334325.1:c.516C>T	3.37:g.57108238C>T		Somatic		Capture	SOLID	Phase_I	57083278	NM_181727	A0AVA8|B2RMW1	Silent	SNP	ENST00000334325.1	37	CCDS2879.1																																																																																				SPATA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352457.2	NM_181727	
CNTN3	5067	hgsc.bcm.edu	37	3	74350896	74350896	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr3:74350896A>C	ENST00000263665.6	-	14	1874	c.1847T>G	c.(1846-1848)cTc>cGc	p.L616R		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	616	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.L616R(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		TTTCCAAGAGAGTTGGGCTGT	0.458																																					p.L616R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1847G	3						.						324.0	284.0	298.0					3																	74350896		2203	4300	6503	74433586	SO:0001583	missense	5067	exon14			AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.1847T>G	3.37:g.74350896A>C	ENSP00000263665:p.Leu616Arg	Somatic		Capture	SOLID	Phase_I	74433586	NM_020872	B9EK50|Q9H039	Missense_Mutation	SNP	ENST00000263665.6	37	CCDS33790.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.199839	0.79015	.	.	ENSG00000113805	ENST00000263665	T	0.66995	-0.24	5.98	4.8	0.61643	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.067389	0.64402	D	0.000015	D	0.89044	0.6603	H	0.99299	4.505	0.45366	D	0.998351	D	0.89917	1.0	D	0.81914	0.995	D	0.92445	0.5965	10	0.87932	D	0	.	13.379	0.60757	0.8685:0.1315:0.0:0.0	.	616	Q9P232	CNTN3_HUMAN	R	616	ENSP00000263665:L616R	ENSP00000263665:L616R	L	-	2	0	CNTN3	74433586	0.997000	0.39634	0.780000	0.31762	0.995000	0.86356	8.615000	0.90920	1.055000	0.40461	0.482000	0.46254	CTC		CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352306.1	NM_020872	
EPHA3	2042	hgsc.bcm.edu	37	3	89390178	89390178	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr3:89390178T>A	ENST00000336596.2	+	4	1152	c.927T>A	c.(925-927)aaT>aaA	p.N309K	EPHA3_ENST00000452448.2_Missense_Mutation_p.N309K|EPHA3_ENST00000494014.1_Missense_Mutation_p.N309K	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	309	Cys-rich.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.N309K(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		GTGAGAATAATTACTTCCGGG	0.453										TSP Lung(6;0.00050)																											p.N309K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T927A	3						.						164.0	162.0	163.0					3																	89390178		2203	4300	6503	89472868	SO:0001583	missense	2042	exon4			M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.927T>A	3.37:g.89390178T>A	ENSP00000337451:p.Asn309Lys	Somatic		Capture	SOLID	Phase_I	89472868	NM_005233	Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	37	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	T	14.21	2.466100	0.43839	.	.	ENSG00000044524	ENST00000336596;ENST00000452448;ENST00000494014	D;D;D	0.97731	-4.51;-4.51;-4.51	6.17	5.01	0.66863	.	0.086238	0.85682	D	0.000000	D	0.95373	0.8498	L	0.51422	1.61	0.54753	D	0.999985	B;B	0.34372	0.451;0.356	B;B	0.36922	0.112;0.236	D	0.92603	0.6093	9	.	.	.	.	8.1682	0.31239	0.0:0.0663:0.136:0.7977	.	309;309	P29320;P29320-2	EPHA3_HUMAN;.	K	309	ENSP00000337451:N309K;ENSP00000399926:N309K;ENSP00000419190:N309K	.	N	+	3	2	EPHA3	89472868	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.685000	0.37659	1.132000	0.42129	0.533000	0.62120	AAT		EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233	
DNAJC13	23317	hgsc.bcm.edu	37	3	132185189	132185189	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr3:132185189A>C	ENST00000260818.6	+	19	2263	c.2015A>C	c.(2014-2016)gAg>gCg	p.E672A	DNAJC13_ENST00000486798.1_3'UTR	NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	672					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)		p.E55A(1)|p.E672A(1)		breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						CTCGTACCTGAGAAGGATGCT	0.393																																					p.E672A												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A2015C	3						.						108.0	105.0	106.0					3																	132185189		2203	4300	6503	133667879	SO:0001583	missense	23317	exon19			AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.2015A>C	3.37:g.132185189A>C	ENSP00000260818:p.Glu672Ala	Somatic		Capture	SOLID	Phase_I	133667879	NM_015268	Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Missense_Mutation	SNP	ENST00000260818.6	37	CCDS33857.1	.	.	.	.	.	.	.	.	.	.	A	16.75	3.208547	0.58343	.	.	ENSG00000138246	ENST00000260818	T	0.35421	1.31	5.76	5.76	0.90799	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.29458	0.0734	L	0.41824	1.3	0.80722	D	1	P;P	0.43885	0.82;0.816	B;B	0.37198	0.243;0.175	T	0.04635	-1.0937	10	0.28530	T	0.3	.	15.0496	0.71858	1.0:0.0:0.0:0.0	.	672;672	A7E2Y5;O75165	.;DJC13_HUMAN	A	672	ENSP00000260818:E672A	ENSP00000260818:E672A	E	+	2	0	DNAJC13	133667879	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.949000	0.93012	2.192000	0.70111	0.455000	0.32223	GAG		DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356807.2	NM_015268	
GABRG1	2565	hgsc.bcm.edu	37	4	46060622	46060622	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr4:46060622C>T	ENST00000295452.4	-	6	810	c.643G>A	c.(643-645)Gaa>Aaa	p.E215K		NM_173536.3	NP_775807.2	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 1	215					gamma-aminobutyric acid signaling pathway (GO:0007214)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.E215K(1)		breast(2)|central_nervous_system(5)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(2)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	76				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TACTCAATTTCATTTTTAGGG	0.358																																					p.E215K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G643A	4						.						54.0	53.0	54.0					4																	46060622		2203	4299	6502	45755379	SO:0001583	missense	2565	exon6			BC031087	CCDS3470.1	4p12	2012-06-22			ENSG00000163285	ENSG00000163285		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4086	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma"""	137166				1321425	Standard	NM_173536		Approved		uc003gxb.3	Q8N1C3	OTTHUMG00000128609	ENST00000295452.4:c.643G>A	4.37:g.46060622C>T	ENSP00000295452:p.Glu215Lys	Somatic		Capture	SOLID	Phase_I	45755379	NM_173536	Q5H9T8	Missense_Mutation	SNP	ENST00000295452.4	37	CCDS3470.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.667409	0.88348	.	.	ENSG00000163285	ENST00000295452;ENST00000540030	T	0.80123	-1.34	5.83	5.83	0.93111	Neurotransmitter-gated ion-channel ligand-binding (3);	0.101306	0.64402	D	0.000003	D	0.85919	0.5809	M	0.64404	1.975	0.58432	D	0.999999	P	0.51791	0.948	P	0.53360	0.724	D	0.86784	0.1981	10	0.87932	D	0	.	19.1642	0.93548	0.0:1.0:0.0:0.0	.	215	Q8N1C3	GBRG1_HUMAN	K	215	ENSP00000295452:E215K	ENSP00000295452:E215K	E	-	1	0	GABRG1	45755379	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.747000	0.85070	2.775000	0.95449	0.650000	0.86243	GAA		GABRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250470.1	NM_173536	
TLL1	7092	hgsc.bcm.edu	37	4	166996115	166996115	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr4:166996115T>A	ENST00000061240.2	+	17	2921	c.2274T>A	c.(2272-2274)aaT>aaA	p.N758K	TLL1_ENST00000507499.1_Missense_Mutation_p.N781K	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	758	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.N758K(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		AATGCCGTAATGGATTTGTGC	0.398																																					p.N758K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2274A	4						.						295.0	242.0	260.0					4																	166996115		2203	4300	6503	167215565	SO:0001583	missense	7092	exon17			AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.2274T>A	4.37:g.166996115T>A	ENSP00000061240:p.Asn758Lys	Somatic		Capture	SOLID	Phase_I	167215565	NM_012464	B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	ENST00000061240.2	37	CCDS3811.1	.	.	.	.	.	.	.	.	.	.	T	11.62	1.692981	0.30052	.	.	ENSG00000038295	ENST00000061240;ENST00000507499	D;D	0.96104	-3.91;-3.91	5.72	-1.34	0.09143	EGF-like region, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.059985	0.64402	U	0.000005	D	0.83216	0.5206	N	0.03084	-0.415	0.80722	D	1	P;P	0.48911	0.917;0.732	B;B	0.38921	0.285;0.204	T	0.77107	-0.2710	10	0.46703	T	0.11	.	6.3797	0.21527	0.0:0.271:0.1183:0.6106	.	781;758	E9PD25;O43897	.;TLL1_HUMAN	K	758;781	ENSP00000061240:N758K;ENSP00000426082:N781K	ENSP00000061240:N758K	N	+	3	2	TLL1	167215565	0.977000	0.34250	0.850000	0.33497	0.002000	0.02628	0.093000	0.15086	-0.339000	0.08401	-0.417000	0.06048	AAT		TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1		
APC	324	hgsc.bcm.edu	37	5	112175390	112175390	+	Nonsense_Mutation	SNP	C	C	T	rs121913328		TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr5:112175390C>T	ENST00000457016.1	+	16	4479	c.4099C>T	c.(4099-4101)Cag>Tag	p.Q1367*	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Nonsense_Mutation_p.Q1367*|APC_ENST00000257430.4_Nonsense_Mutation_p.Q1367*			P25054	APC_HUMAN	adenomatous polyposis coli	1367	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q1367*(26)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AAGTGGTGCTCAGACACCCAA	0.453	Q1367*(C2BBE1_LARGE_INTESTINE)	12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q1349X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,colon,Substitution - Nonsense,0 	.	28	Substitution - Nonsense(26)|Unknown(1)|Deletion - Frameshift(1)	large_intestine(26)|soft_tissue(1)|skin(1)	c.C4045T	5	GRCh37	CM940072	APC	M	rs121913328	.						75.0	73.0	74.0					5																	112175390		2202	4300	6502	112203289	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4099C>T	5.37:g.112175390C>T	ENSP00000413133:p.Gln1367*	Somatic		Capture	SOLID	Phase_I	112203289	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	41	8.623019	0.98890	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	5.3	0.74995	.	0.166931	0.56097	D	0.000040	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-7.8965	17.2482	0.87034	0.0:0.8741:0.1259:0.0	.	.	.	.	X	1367	.	.	Q	+	1	0	APC	112203289	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.223000	0.72257	1.603000	0.50134	0.655000	0.94253	CAG		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
SLC23A1	9963	hgsc.bcm.edu	37	5	138714334	138714334	+	Silent	SNP	C	C	T	rs267600365		TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr5:138714334C>T	ENST00000348729.3	-	10	1159	c.1113G>A	c.(1111-1113)ggG>ggA	p.G371G	SLC23A1_ENST00000353963.3_Silent_p.G375G|SLC23A1_ENST00000503919.1_5'Flank	NM_005847.4	NP_005838	Q9UHI7	S23A1_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 1	371					brain development (GO:0007420)|dehydroascorbic acid transport (GO:0070837)|L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|lung development (GO:0030324)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|brush border (GO:0005903)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular organelle (GO:0043229)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dehydroascorbic acid transporter activity (GO:0033300)|L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium ion transmembrane transporter activity (GO:0015081)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)	p.G375G(1)		biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(5)|ovary(1)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		Vitamin C(DB00126)	TGCCCAATAGCCCCGCGATGA	0.597																																					p.G371G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1113A	5						.						63.0	51.0	55.0					5																	138714334		2203	4300	6503	138742233	SO:0001819	synonymous_variant	9963	exon10			AF058317	CCDS4212.1, CCDS4213.1	5q31.2	2013-07-18	2013-07-18	2003-03-21	ENSG00000170482	ENSG00000170482		"""Solute carriers"""	10974	protein-coding gene	gene with protein product		603790	"""solute carrier family 23 (nucleobase transporters), member 2"""	SLC23A2		9804989, 10331392	Standard	NM_005847		Approved	YSPL3, SVCT1	uc003leg.3	Q9UHI7	OTTHUMG00000129228	ENST00000348729.3:c.1113G>A	5.37:g.138714334C>T		Somatic		Capture	SOLID	Phase_I	138742233	NM_005847	O95191|Q8WWB6|Q9UGH4|Q9UI39	Silent	SNP	ENST00000348729.3	37	CCDS4212.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.601|7.601	0.672817|0.672817	0.14776|0.14776	.|.	.|.	ENSG00000170482|ENSG00000170482	ENST00000504513|ENST00000453898	.|.	.|.	.|.	4.71|4.71	-1.74|-1.74	0.08056|0.08056	.|.	.|0.050775	.|0.85682	.|D	.|0.000000	T|T	0.16342|0.16342	0.0393|0.0393	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.30937|0.30937	-0.9961|-0.9961	4|6	.|0.05525	.|T	.|0.97	-15.0116|-15.0116	1.9182|1.9182	0.03301|0.03301	0.128:0.3406:0.1254:0.406|0.128:0.3406:0.1254:0.406	.|.	.|.	.|.	.|.	T|D	118|326	.|.	.|ENSP00000406720:G326D	A|G	-|-	1|2	0|0	SLC23A1|SLC23A1	138742233|138742233	0.012000|0.012000	0.17670|0.17670	0.076000|0.076000	0.20297|0.20297	0.701000|0.701000	0.40568|0.40568	-0.779000|-0.779000	0.04659|0.04659	-0.656000|-0.656000	0.05380|0.05380	0.561000|0.561000	0.74099|0.74099	GCT|GGC		SLC23A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000374185.1	NM_152685	
PCDHB1	29930	hgsc.bcm.edu	37	5	140431259	140431259	+	Silent	SNP	C	C	T	rs538415948		TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr5:140431259C>T	ENST00000306549.3	+	1	281	c.204C>T	c.(202-204)tcC>tcT	p.S68S		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	68	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S68S(2)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGCTGGTTTCCGAGGGCAACA	0.577													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15783	0.0		0.0	False		,,,				2504	0.0				p.S68S												.	.	2	Substitution - coding silent(2)	upper_aerodigestive_tract(1)|large_intestine(1)	c.C204T	5						.						50.0	53.0	52.0					5																	140431259		2203	4300	6503	140411443	SO:0001819	synonymous_variant	29930	exon1			AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.204C>T	5.37:g.140431259C>T		Somatic		Capture	SOLID	Phase_I	140411443	NM_013340	Q2M257	Silent	SNP	ENST00000306549.3	37	CCDS4243.1																																																																																				PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251822.2	NM_013340	
PCDHGA2	56113	hgsc.bcm.edu	37	5	140719701	140719701	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr5:140719701A>G	ENST00000394576.2	+	1	1163	c.1163A>G	c.(1162-1164)gAg>gGg	p.E388G	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	388	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E388G(1)		breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCACTCCCCGAGGATCTTCCT	0.428																																					p.E388G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1163G	5						.						78.0	80.0	79.0					5																	140719701		2203	4300	6503	140699885	SO:0001583	missense	56113	exon1			AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.1163A>G	5.37:g.140719701A>G	ENSP00000378077:p.Glu388Gly	Somatic		Capture	SOLID	Phase_I	140699885	NM_032009	Q52LL6|Q9Y5D5	Missense_Mutation	SNP	ENST00000394576.2	37	CCDS47289.1	.	.	.	.	.	.	.	.	.	.	.	0.011	-1.735444	0.00681	.	.	ENSG00000081853	ENST00000394576	T	0.57752	0.38	5.03	5.03	0.67393	Cadherin (4);Cadherin-like (1);	0.173379	0.26903	U	0.021902	T	0.24431	0.0592	N	0.03324	-0.35	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.09377	0.002;0.004	T	0.16158	-1.0412	10	0.07990	T	0.79	.	9.3279	0.38003	0.9182:0.0:0.0818:0.0	.	388;388	Q9Y5H1-2;Q9Y5H1	.;PCDG2_HUMAN	G	388	ENSP00000378077:E388G	ENSP00000378077:E388G	E	+	2	0	PCDHGA2	140699885	0.000000	0.05858	0.033000	0.17914	0.005000	0.04900	-0.185000	0.09684	2.025000	0.59659	0.459000	0.35465	GAG		PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	NM_018915	
APC	324	hgsc.bcm.edu	37	5	112174840	112174840	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr5:112174840T>A	ENST00000457016.1	+	16	3929	c.3549T>A	c.(3547-3549)taT>taA	p.Y1183*	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Nonsense_Mutation_p.Y1183*|APC_ENST00000257430.4_Nonsense_Mutation_p.Y1183*			P25054	APC_HUMAN	adenomatous polyposis coli	1183	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Y1183*(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GTTTAAAATATGCCACAGATA	0.343		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Y1165X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	2	Substitution - Nonsense(1)|Unknown(1)	large_intestine(1)|skin(1)	c.T3495A	5						.						79.0	85.0	83.0					5																	112174840		2197	4296	6493	112202739	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3549T>A	5.37:g.112174840T>A	ENSP00000413133:p.Tyr1183*	Somatic		Capture	SOLID	Phase_I	112202739	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	T	28.0	4.884628	0.91814	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.76	0.83	0.18854	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-15.8248	10.2282	0.43238	0.0:0.3311:0.0:0.6689	.	.	.	.	X	1183	.	.	Y	+	3	2	APC	112202739	0.032000	0.19561	0.408000	0.26446	0.506000	0.33950	-0.147000	0.10234	0.132000	0.18615	0.533000	0.62120	TAT		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PCDH12	51294	hgsc.bcm.edu	37	5	141335357	141335357	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr5:141335357G>A	ENST00000231484.3	-	1	3270	c.2060C>T	c.(2059-2061)aCc>aTc	p.T687I	AC005740.6_ENST00000607378.1_RNA|PCDH12_ENST00000512221.1_5'Flank	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	687	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T687I(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGGGCTCGGGTCTGTAAGGG	0.592																																					p.T687I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2060T	5						.						30.0	28.0	29.0					5																	141335357		2203	4300	6503	141315541	SO:0001583	missense	51294	exon1			AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.2060C>T	5.37:g.141335357G>A	ENSP00000231484:p.Thr687Ile	Somatic		Capture	SOLID	Phase_I	141315541	NM_016580	Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Missense_Mutation	SNP	ENST00000231484.3	37	CCDS4269.1	.	.	.	.	.	.	.	.	.	.	G	13.44	2.238193	0.39598	.	.	ENSG00000113555	ENST00000231484	T	0.53857	0.6	5.24	4.34	0.51931	Cadherin (4);Cadherin-like (1);	0.055419	0.64402	D	0.000001	T	0.76169	0.3950	M	0.90483	3.12	0.50171	D	0.999854	D	0.76494	0.999	D	0.75484	0.986	T	0.81782	-0.0775	10	0.87932	D	0	.	13.3887	0.60811	0.0:0.159:0.841:0.0	.	687	Q9NPG4	PCD12_HUMAN	I	687	ENSP00000231484:T687I	ENSP00000231484:T687I	T	-	2	0	PCDH12	141315541	1.000000	0.71417	0.899000	0.35326	0.251000	0.25915	4.262000	0.58847	1.387000	0.46486	0.655000	0.94253	ACC		PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251858.1	NM_016580	
REV3L	5980	hgsc.bcm.edu	37	6	111678232	111678232	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr6:111678232G>C	ENST00000358835.3	-	19	7623	c.7169C>G	c.(7168-7170)gCa>gGa	p.A2390G	REV3L_ENST00000368802.3_Missense_Mutation_p.A2390G|REV3L_ENST00000435970.1_Missense_Mutation_p.A2312G|REV3L_ENST00000368805.1_Missense_Mutation_p.A2390G			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	2390					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)	p.A2312G(1)		NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		TATTATATTTGCAATTTCATG	0.318								DNA polymerases (catalytic subunits)																													p.A2390G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C7169G	6						.						85.0	94.0	91.0					6																	111678232		2203	4300	6503	111784925	SO:0001583	missense	5980	exon18			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.7169C>G	6.37:g.111678232G>C	ENSP00000351697:p.Ala2390Gly	Somatic		Capture	SOLID	Phase_I	111784925	NM_002912	O43214|Q5TC33	Missense_Mutation	SNP	ENST00000358835.3	37	CCDS5091.2	.	.	.	.	.	.	.	.	.	.	G	12.56	1.974989	0.34848	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970;ENST00000543871	T;T;T;T	0.09911	2.93;2.93;2.93;2.93	5.93	4.96	0.65561	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.371628	0.27851	N	0.017592	T	0.02888	0.0086	L	0.29908	0.895	0.30294	N	0.790105	B	0.22851	0.076	B	0.29440	0.102	T	0.35574	-0.9783	10	0.37606	T	0.19	-0.6038	3.9381	0.09314	0.3165:0.0:0.6835:0.0	.	2390	O60673	DPOLZ_HUMAN	G	2390;2390;2390;2312;463	ENSP00000357792:A2390G;ENSP00000357795:A2390G;ENSP00000351697:A2390G;ENSP00000402003:A2312G	ENSP00000351697:A2390G	A	-	2	0	REV3L	111784925	0.994000	0.37717	1.000000	0.80357	0.996000	0.88848	4.564000	0.60830	2.805000	0.96524	0.655000	0.94253	GCA		REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
LAMA2	3908	hgsc.bcm.edu	37	6	129591855	129591855	+	Silent	SNP	C	C	T	rs144580350		TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr6:129591855C>T	ENST00000421865.2	+	17	2458	c.2409C>T	c.(2407-2409)gaC>gaT	p.D803D		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	803	Laminin EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)	p.D803D(1)		NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		CCTCTGAAGACTGTCAACCCT	0.423																																					p.D803D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2409T	6						.	C	,	0,4406		0,0,2203	143.0	132.0	136.0		2409,2409	3.8	1.0	6	dbSNP_134	136	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	LAMA2	NM_000426.3,NM_001079823.1	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	803/3123,803/3119	129591855	1,13005	2203	4300	6503	129633548	SO:0001819	synonymous_variant	3908	exon17			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.2409C>T	6.37:g.129591855C>T		Somatic		Capture	SOLID	Phase_I	129633548	NM_001079823	Q14736|Q5VUM2|Q93022	Silent	SNP	ENST00000421865.2	37	CCDS5138.1																																																																																				LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1		
TRIM27	5987	hgsc.bcm.edu	37	6	28876838	28876838	+	Silent	SNP	A	A	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr6:28876838A>T	ENST00000377199.3	-	5	1154	c.798T>A	c.(796-798)ccT>ccA	p.P266P	TRIM27_ENST00000377194.3_Silent_p.P266P|TRIM27_ENST00000498117.1_5'Flank	NM_006510.4	NP_006501.1	P14373	TRI27_HUMAN	tripartite motif containing 27	266					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell proliferation (GO:0008283)|innate immune response (GO:0045087)|interferon-gamma secretion (GO:0072643)|negative regulation of adaptive immune response (GO:0002820)|negative regulation of calcium ion import (GO:0090281)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of interleukin-2 secretion (GO:1900041)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein K63-linked ubiquitination (GO:0070534)|protein trimerization (GO:0070206)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P266P(1)		endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						GTGTGATCCAAGGTTCAGGAA	0.388			T	RET	papillary thyroid																																p.P266P			Dom	yes		6	6p22	5987	tripartite motif-containing 27		E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T798A	6						.						79.0	81.0	80.0					6																	28876838		2203	4300	6503	28984817	SO:0001819	synonymous_variant	5987	exon5			Z58939	CCDS4654.1	6p22	2013-01-09	2011-01-25	2006-09-26	ENSG00000204713	ENSG00000204713		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9975	protein-coding gene	gene with protein product		602165	"""ret finger protein"", ""tripartite motif-containing 27"""	RFP		8114113	Standard	NM_006510		Approved	RNF76	uc003nlr.3	P14373	OTTHUMG00000031215	ENST00000377199.3:c.798T>A	6.37:g.28876838A>T		Somatic		Capture	SOLID	Phase_I	28984817	NM_006510	A2BE15|Q5RJA8|Q5ST26|Q6LA73|Q6NXR9|Q9BZY6|Q9UJL3	Silent	SNP	ENST00000377199.3	37	CCDS4654.1																																																																																				TRIM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076442.2	NM_030950	
UBE3D	90025	hgsc.bcm.edu	37	6	83763888	83763888	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr6:83763888C>G	ENST00000369747.3	-	3	466	c.344G>C	c.(343-345)gGt>gCt	p.G115A		NM_198920.1	NP_944602.1	Q7Z6J8	UBE3D_HUMAN	ubiquitin protein ligase E3D	115					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)	p.G115A(1)									TATGACTTCACCGCAGGATTG	0.328																																					p.G115A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G344C	6						.						105.0	100.0	102.0					6																	83763888		2203	4300	6503	83820607	SO:0001583	missense	90025	exon3			AL137544	CCDS34491.1	6q15	2012-02-24	2012-02-24	2012-02-24	ENSG00000118420	ENSG00000118420			21381	protein-coding gene	gene with protein product	"""UBCH10 binding protein with a hect-like domain"""	612495	"""chromosome 6 open reading frame 157"", ""ubiquitin-conjugating enzyme E2C binding protein"""	C6orf157, UBE2CBP		15749827	Standard	NM_198920		Approved	DKFZp434A1520, H10BH, YJR141W	uc003pjp.2	Q7Z6J8	OTTHUMG00000015108	ENST00000369747.3:c.344G>C	6.37:g.83763888C>G	ENSP00000358762:p.Gly115Ala	Somatic		Capture	SOLID	Phase_I	83820607	NM_198920	B4DP63|Q5T4W2|Q6IPR4|Q75UG0|Q9NT42	Missense_Mutation	SNP	ENST00000369747.3	37	CCDS34491.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.019871	0.75275	.	.	ENSG00000118420	ENST00000369747	T	0.29917	1.55	5.44	5.44	0.79542	.	0.097576	0.64402	D	0.000002	T	0.46698	0.1406	M	0.74258	2.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	T	0.26744	-1.0094	10	0.21014	T	0.42	-22.4018	18.0456	0.89331	0.0:1.0:0.0:0.0	.	115;115	D6RD24;Q7Z6J8	.;UB2CB_HUMAN	A	115	ENSP00000358762:G115A	ENSP00000358762:G115A	G	-	2	0	UBE2CBP	83820607	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	4.852000	0.62904	2.558000	0.86282	0.655000	0.94253	GGT		UBE3D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041347.7	NM_198920	
TNFAIP3	7128	hgsc.bcm.edu	37	6	138200345	138200345	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr6:138200345C>G	ENST00000237289.4	+	7	1829	c.1763C>G	c.(1762-1764)gCt>gGt	p.A588G		NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	588	Interaction with TNIP1. {ECO:0000250}.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)|p.A588G(2)|p.P587fs*93(1)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		GACGCCCCTGCTGGCTGCCTG	0.617			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																p.A588G	GBM(130;153 1739 22295 28918 47987)		Rec	yes		6	6q23	7128	"""tumor necrosis factor, alpha-induced protein 3"""		L	.	.	28	Whole gene deletion(25)|Substitution - Missense(2)|Deletion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(27)|large_intestine(1)	c.C1763G	6						.						48.0	54.0	52.0					6																	138200345		2203	4300	6503	138242038	SO:0001583	missense	7128	exon7			M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.1763C>G	6.37:g.138200345C>G	ENSP00000237289:p.Ala588Gly	Somatic		Capture	SOLID	Phase_I	138242038	NM_006290	B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Missense_Mutation	SNP	ENST00000237289.4	37	CCDS5187.1	.	.	.	.	.	.	.	.	.	.	C	9.817	1.184776	0.21870	.	.	ENSG00000118503	ENST00000237289;ENST00000535574;ENST00000544646	T	0.22945	1.93	5.7	5.7	0.88788	.	0.617332	0.18476	N	0.140073	T	0.08582	0.0213	N	0.22421	0.69	0.09310	N	1	B	0.12013	0.005	B	0.11329	0.006	T	0.11867	-1.0570	10	0.17369	T	0.5	-0.0152	17.9984	0.89191	0.0:1.0:0.0:0.0	.	588	P21580	TNAP3_HUMAN	G	588	ENSP00000237289:A588G	ENSP00000237289:A588G	A	+	2	0	TNFAIP3	138242038	0.002000	0.14202	0.134000	0.22075	0.125000	0.20455	1.441000	0.35035	2.695000	0.91970	0.655000	0.94253	GCT		TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042414.1		
RELN	5649	hgsc.bcm.edu	37	7	103202326	103202326	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr7:103202326A>G	ENST00000428762.1	-	35	5444	c.5285T>C	c.(5284-5286)gTt>gCt	p.V1762A	RELN_ENST00000343529.5_Missense_Mutation_p.V1762A|RELN_ENST00000424685.2_Missense_Mutation_p.V1762A	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1762					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.V1762A(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GGCCAGTACAACATTATCAAT	0.453																																					p.V1762A	NSCLC(146;835 1944 15585 22231 52158)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T5285C	7						.						87.0	75.0	79.0					7																	103202326		2203	4300	6503	102989562	SO:0001583	missense	5649	exon35				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.5285T>C	7.37:g.103202326A>G	ENSP00000392423:p.Val1762Ala	Somatic		Capture	SOLID	Phase_I	102989562	NM_005045	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	A	16.01	3.001010	0.54254	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.25085	1.82;1.82;1.82	5.78	5.78	0.91487	Neuraminidase (1);	0.000000	0.85682	D	0.000000	T	0.42877	0.1222	M	0.78049	2.395	0.58432	D	0.999994	P;B	0.51147	0.942;0.387	P;B	0.49421	0.61;0.09	T	0.47471	-0.9115	10	0.87932	D	0	.	16.1099	0.81255	1.0:0.0:0.0:0.0	.	1762;1762	P78509-2;P78509	.;RELN_HUMAN	A	1762	ENSP00000392423:V1762A;ENSP00000345694:V1762A;ENSP00000388446:V1762A	ENSP00000345694:V1762A	V	-	2	0	RELN	102989562	1.000000	0.71417	0.857000	0.33713	0.328000	0.28507	8.711000	0.91396	2.215000	0.71742	0.460000	0.39030	GTT		RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
EPHA1	2041	hgsc.bcm.edu	37	7	143095520	143095520	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr7:143095520A>T	ENST00000275815.3	-	7	1444	c.1358T>A	c.(1357-1359)cTg>cAg	p.L453Q		NM_005232.4	NP_005223.4	P21709	EPHA1_HUMAN	EPH receptor A1	453	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of Rho GTPase activity (GO:0032862)|angiogenesis (GO:0001525)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of cell migration (GO:0030336)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|regulation of Rac GTPase activity (GO:0032314)|substrate adhesion-dependent cell spreading (GO:0034446)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transmembrane-ephrin receptor activity (GO:0005005)	p.L453Q(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(21)|ovary(4)|skin(1)|stomach(1)|urinary_tract(3)	51	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				CACCAGTCTCAGAGACAGGCC	0.552																																					p.L453Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1358A	7						.						51.0	55.0	53.0					7																	143095520		2203	4300	6503	142805642	SO:0001583	missense	2041	exon7			M18391	CCDS5884.1	7q32-q36	2013-02-11	2004-10-28		ENSG00000146904	ENSG00000146904	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3385	protein-coding gene	gene with protein product		179610	"""EphA1"""	EPHT, EPHT1		9267020	Standard	NM_005232		Approved	EPH	uc003wcz.3	P21709	OTTHUMG00000155894	ENST00000275815.3:c.1358T>A	7.37:g.143095520A>T	ENSP00000275815:p.Leu453Gln	Somatic		Capture	SOLID	Phase_I	142805642	NM_005232	A1L3V3|B5A966|B5A967|Q15405	Missense_Mutation	SNP	ENST00000275815.3	37	CCDS5884.1	.	.	.	.	.	.	.	.	.	.	A	18.12	3.553819	0.65425	.	.	ENSG00000146904	ENST00000275815	T	0.58797	0.31	5.08	5.08	0.68730	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.145674	0.31784	N	0.007061	T	0.70176	0.3194	M	0.68317	2.08	0.35647	D	0.811499	D	0.71674	0.998	D	0.70487	0.969	T	0.78735	-0.2088	10	0.87932	D	0	.	8.5727	0.33578	0.8284:0.0:0.0:0.1716	.	453	P21709	EPHA1_HUMAN	Q	453	ENSP00000275815:L453Q	ENSP00000275815:L453Q	L	-	2	0	EPHA1	142805642	0.944000	0.32072	1.000000	0.80357	0.980000	0.70556	1.543000	0.36147	2.038000	0.60285	0.533000	0.62120	CTG		EPHA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342154.1		
EPHA1	2041	hgsc.bcm.edu	37	7	143095525	143095525	+	Silent	SNP	C	C	G			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr7:143095525C>G	ENST00000275815.3	-	7	1439	c.1353G>C	c.(1351-1353)ctG>ctC	p.L451L		NM_005232.4	NP_005223.4	P21709	EPHA1_HUMAN	EPH receptor A1	451	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of Rho GTPase activity (GO:0032862)|angiogenesis (GO:0001525)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of cell migration (GO:0030336)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|regulation of Rac GTPase activity (GO:0032314)|substrate adhesion-dependent cell spreading (GO:0034446)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transmembrane-ephrin receptor activity (GO:0005005)	p.L451L(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(21)|ovary(4)|skin(1)|stomach(1)|urinary_tract(3)	51	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				GTCTCAGAGACAGGCCTGACA	0.547																																					p.L451L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1353C	7						.						51.0	55.0	54.0					7																	143095525		2203	4300	6503	142805647	SO:0001819	synonymous_variant	2041	exon7			M18391	CCDS5884.1	7q32-q36	2013-02-11	2004-10-28		ENSG00000146904	ENSG00000146904	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3385	protein-coding gene	gene with protein product		179610	"""EphA1"""	EPHT, EPHT1		9267020	Standard	NM_005232		Approved	EPH	uc003wcz.3	P21709	OTTHUMG00000155894	ENST00000275815.3:c.1353G>C	7.37:g.143095525C>G		Somatic		Capture	SOLID	Phase_I	142805647	NM_005232	A1L3V3|B5A966|B5A967|Q15405	Silent	SNP	ENST00000275815.3	37	CCDS5884.1																																																																																				EPHA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342154.1		
HNRNPA2B1	3181	hgsc.bcm.edu	37	7	26236037	26236037	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr7:26236037G>T	ENST00000354667.4	-	7	846	c.678C>A	c.(676-678)aaC>aaA	p.N226K	HNRNPA2B1_ENST00000356674.7_Missense_Mutation_p.N214K	NM_031243.2	NP_112533.1	P22626	ROA2_HUMAN	heterogeneous nuclear ribonucleoprotein A2/B1	226	Gly-rich.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA intronic binding (GO:0097157)|RNA binding (GO:0003723)|single-stranded telomeric DNA binding (GO:0043047)	p.N214K(1)	HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22						CTCCTCTAAAGTTACTTCCTG	0.403			T	ETV1	prostate																																p.N226K			Dom	yes		7	7p15	3181	heterogeneous nuclear ribonucleoprotein A2/B1		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C678A	7						.						73.0	71.0	72.0					7																	26236037		2203	4300	6503	26202562	SO:0001583	missense	3181	exon7			D28877	CCDS5397.1, CCDS43557.1	7p15	2013-02-12		2007-08-16	ENSG00000122566	ENSG00000122566		"""RNA binding motif (RRM) containing"""	5033	protein-coding gene	gene with protein product		600124		HNRPA2B1		8029005	Standard	NM_002137		Approved		uc003sxr.4	P22626	OTTHUMG00000023471	ENST00000354667.4:c.678C>A	7.37:g.26236037G>T	ENSP00000346694:p.Asn226Lys	Somatic		Capture	SOLID	Phase_I	26202562	NM_031243	A8K064|P22627|Q9UC98|Q9UDJ2	Missense_Mutation	SNP	ENST00000354667.4	37	CCDS43557.1	.	.	.	.	.	.	.	.	.	.	G	14.75	2.628372	0.46944	.	.	ENSG00000122566	ENST00000354667;ENST00000356674	D;D	0.86097	-2.07;-2.07	6.02	2.76	0.32466	.	0.000000	0.64402	D	0.000001	D	0.85159	0.5633	L	0.56199	1.76	0.28793	N	0.899179	P;P	0.48016	0.904;0.845	P;P	0.52793	0.709;0.515	T	0.78497	-0.2181	10	0.44086	T	0.13	.	8.843	0.35153	0.3737:0.0:0.6263:0.0	.	214;226	P22626-2;P22626	.;ROA2_HUMAN	K	226;214	ENSP00000346694:N226K;ENSP00000349101:N214K	ENSP00000346694:N226K	N	-	3	2	HNRNPA2B1	26202562	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	0.983000	0.29552	0.805000	0.34159	0.650000	0.86243	AAC		HNRNPA2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214109.1	NM_002137	
C7orf43	55262	hgsc.bcm.edu	37	7	99752697	99752697	+	Silent	SNP	C	C	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr7:99752697C>A	ENST00000316937.3	-	11	1865	c.1680G>T	c.(1678-1680)gtG>gtT	p.V560V	C7orf43_ENST00000498638.1_5'Flank|C7orf43_ENST00000419841.1_Silent_p.V328V|C7orf43_ENST00000394035.2_Silent_p.V136V|MIR4658_ENST00000584344.1_RNA|C7orf43_ENST00000457641.1_Silent_p.V291V	NM_018275.3	NP_060745.3	Q8WVR3	CG043_HUMAN	chromosome 7 open reading frame 43	560								p.V560V(1)		breast(1)|endometrium(3)|large_intestine(3)|lung(2)|prostate(1)	10	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CCAGAGACAACACAGCCTTGT	0.627																																					p.V560V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1680T	7						.						70.0	68.0	69.0					7																	99752697		2203	4300	6503	99590633	SO:0001819	synonymous_variant	55262	exon11				CCDS5687.1	7q22.1	2011-11-25			ENSG00000146826	ENSG00000146826			25604	protein-coding gene	gene with protein product						12477932	Standard	NM_018275		Approved	FLJ10925	uc003utr.3	Q8WVR3	OTTHUMG00000154862	ENST00000316937.3:c.1680G>T	7.37:g.99752697C>A		Somatic		Capture	SOLID	Phase_I	99590633	NM_018275	A4D2A9|D6W5U4|Q9BQJ1|Q9BUB6|Q9NV47	Silent	SNP	ENST00000316937.3	37	CCDS5687.1	.	.	.	.	.	.	.	.	.	.	C	4.713	0.132498	0.09032	.	.	ENSG00000146826	ENST00000456769	T	0.55588	0.51	4.67	2.87	0.33458	.	0.210801	0.31415	N	0.007689	T	0.58278	0.2111	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57980	-0.7717	7	0.72032	D	0.01	-14.442	7.2211	0.25988	0.0:0.7978:0.0:0.2022	.	.	.	.	F	466	ENSP00000389672:V466F	ENSP00000389672:V466F	V	-	1	0	C7orf43	99590633	0.973000	0.33851	0.907000	0.35723	0.805000	0.45488	-0.032000	0.12266	0.583000	0.29574	-0.224000	0.12420	GTT		C7orf43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337395.2	NM_018275	
ABCF2	10061	hgsc.bcm.edu	37	7	150921141	150921141	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr7:150921141C>T	ENST00000287844.2	-	4	536	c.427G>A	c.(427-429)Gac>Aac	p.D143N	ABCF2_ENST00000222388.2_Missense_Mutation_p.D143N|ABCF2_ENST00000473874.1_5'Flank	NM_007189.1	NP_009120.1	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 2	143	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transporter activity (GO:0005215)	p.D143N(1)		breast(1)|central_nervous_system(1)|large_intestine(4)|lung(15)|ovary(1)|skin(2)	24			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGGTAGATGTCGATGTGCTCA	0.552																																					p.D143N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G427A	7						.						116.0	98.0	104.0					7																	150921141		2203	4300	6503	150552074	SO:0001583	missense	10061	exon4			AJ005016	CCDS5922.1, CCDS5923.1	7q36.1	2012-03-14			ENSG00000033050	ENSG00000033050		"""ATP binding cassette transporters / subfamily F"""	71	protein-coding gene	gene with protein product		612510				8894702	Standard	NM_007189		Approved	EST133090, ABC28, M-ABC1, HUSSY-18	uc003wjo.1	Q9UG63	OTTHUMG00000154570	ENST00000287844.2:c.427G>A	7.37:g.150921141C>T	ENSP00000287844:p.Asp143Asn	Somatic		Capture	SOLID	Phase_I	150552074	NM_005692	O60864|Q75MJ0|Q75MJ1|Q96TE8	Missense_Mutation	SNP	ENST00000287844.2	37	CCDS5923.1	.	.	.	.	.	.	.	.	.	.	C	36	5.636420	0.96693	.	.	ENSG00000033050	ENST00000222388;ENST00000287844;ENST00000468073;ENST00000441774	D;D;T;T	0.92099	-2.92;-2.97;3.9;3.9	5.81	5.81	0.92471	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.96722	0.8930	M	0.86343	2.81	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.96838	0.9616	10	0.72032	D	0.01	-10.0637	19.0707	0.93134	0.0:1.0:0.0:0.0	.	143;143	Q9UG63;Q75MJ1	ABCF2_HUMAN;.	N	143	ENSP00000222388:D143N;ENSP00000287844:D143N;ENSP00000419720:D143N;ENSP00000395785:D143N	ENSP00000222388:D143N	D	-	1	0	ABCF2	150552074	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.549000	0.82163	2.746000	0.94184	0.655000	0.94253	GAC		ABCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336086.1	NM_005692	
ESCO2	157570	hgsc.bcm.edu	37	8	27646463	27646463	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr8:27646463C>T	ENST00000305188.8	+	7	1469	c.1231C>T	c.(1231-1233)Cac>Tac	p.H411Y	ESCO2_ENST00000397418.2_Missense_Mutation_p.H59Y	NM_001017420.2	NP_001017420.1	Q56NI9	ESCO2_HUMAN	establishment of sister chromatid cohesion N-acetyltransferase 2	411					chromosome segregation (GO:0007059)|double-strand break repair (GO:0006302)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|post-translational protein acetylation (GO:0034421)|protein localization to chromatin (GO:0071168)|regulation of DNA replication (GO:0006275)	chromatin (GO:0000785)|chromocenter (GO:0010369)|Golgi apparatus (GO:0005794)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|XY body (GO:0001741)	lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|metal ion binding (GO:0046872)	p.H411Y(1)		autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Ovarian(32;0.000953)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|KIRC - Kidney renal clear cell carcinoma(542;0.0955)|Kidney(114;0.115)|Colorectal(74;0.132)		TGTACAGCATCACCACAGGTT	0.408									SC Phocomelia syndrome																												p.H411Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1231T	8						.						123.0	112.0	116.0					8																	27646463		2203	4300	6503	27702382	SO:0001583	missense	157570	exon7	Familial Cancer Database	SC-Pseudothalidomide s., incl.: Roberts s.	AF306679	CCDS34872.1	8p21.1	2013-05-02	2013-05-02		ENSG00000171320	ENSG00000171320			27230	protein-coding gene	gene with protein product		609353	"""Roberts syndrome"", ""establishment of cohesion 1 homolog 2 (S. cerevisiae)"""	RBS		15958495, 16775838, 15821733, 16380922	Standard	XR_247122		Approved	EFO2	uc003xgg.3	Q56NI9	OTTHUMG00000163901	ENST00000305188.8:c.1231C>T	8.37:g.27646463C>T	ENSP00000306999:p.His411Tyr	Somatic		Capture	SOLID	Phase_I	27702382	NM_001017420	B3KW59|Q49AP4	Missense_Mutation	SNP	ENST00000305188.8	37	CCDS34872.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.943597	0.92593	.	.	ENSG00000171320	ENST00000305188;ENST00000397418	T;T	0.80824	-1.22;-1.42	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	D	0.92625	0.7657	M	0.94101	3.495	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93738	0.7047	10	0.87932	D	0	-11.5793	18.0507	0.89347	0.0:1.0:0.0:0.0	.	411	Q56NI9	ESCO2_HUMAN	Y	411;59	ENSP00000306999:H411Y;ENSP00000380563:H59Y	ENSP00000306999:H411Y	H	+	1	0	ESCO2	27702382	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	7.137000	0.77295	2.861000	0.98227	0.655000	0.94253	CAC		ESCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376276.1	NM_001017420	
ADAM18	8749	hgsc.bcm.edu	37	8	39564369	39564369	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr8:39564369T>A	ENST00000265707.5	+	18	2008	c.1963T>A	c.(1963-1965)Ttc>Atc	p.F655I	ADAM18_ENST00000541111.1_Missense_Mutation_p.F69I|ADAM18_ENST00000379866.1_Missense_Mutation_p.F631I|ADAM18_ENST00000523755.1_3'UTR	NM_014237.2	NP_055052.1	Q9Y3Q7	ADA18_HUMAN	ADAM metallopeptidase domain 18	655					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.F655I(1)		NS(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(31)|ovary(1)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)	71		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			AGATTGTAAATTCCAGTTTGG	0.343																																					p.F655I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1963A	8						.						95.0	97.0	97.0					8																	39564369		2203	4299	6502	39683526	SO:0001583	missense	8749	exon18			AJ133004	CCDS6113.1, CCDS55225.1	8p11.22	2008-08-07	2005-08-18		ENSG00000168619	ENSG00000168619		"""ADAM metallopeptidase domain containing"""	196	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 18"""			12200459	Standard	NM_014237		Approved	tMDCIII, ADAM27	uc003xni.3	Q9Y3Q7	OTTHUMG00000164040	ENST00000265707.5:c.1963T>A	8.37:g.39564369T>A	ENSP00000265707:p.Phe655Ile	Somatic		Capture	SOLID	Phase_I	39683526	NM_014237	B2R9Y0|Q0VAI4|Q6IRW9|Q6UXJ9	Missense_Mutation	SNP	ENST00000265707.5	37	CCDS6113.1	.	.	.	.	.	.	.	.	.	.	T	11.90	1.776852	0.31411	.	.	ENSG00000168619	ENST00000265707;ENST00000379866;ENST00000541111	D;D;D	0.85411	-1.98;-1.98;-1.98	3.58	3.58	0.41010	.	0.169649	0.28515	N	0.015065	T	0.70395	0.3219	N	0.13043	0.29	0.24143	N	0.995721	B;B	0.09022	0.002;0.001	B;B	0.06405	0.002;0.001	T	0.57435	-0.7812	10	0.30854	T	0.27	.	8.8489	0.35188	0.0:0.0:0.0:1.0	.	631;655	Q9Y3Q7-2;Q9Y3Q7	.;ADA18_HUMAN	I	655;631;69	ENSP00000265707:F655I;ENSP00000369195:F631I;ENSP00000444729:F69I	ENSP00000265707:F655I	F	+	1	0	ADAM18	39683526	0.283000	0.24277	0.773000	0.31616	0.953000	0.61014	0.446000	0.21694	1.878000	0.54408	0.528000	0.53228	TTC		ADAM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376916.1	NM_014237	
SLC20A2	6575	hgsc.bcm.edu	37	8	42286360	42286360	+	Splice_Site	SNP	G	G	A	rs370590168		TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr8:42286360G>A	ENST00000342228.3	-	10	2079	c.1710C>T	c.(1708-1710)agC>agT	p.S570S	SLC20A2_ENST00000520262.1_Splice_Site_p.S570S|SLC20A2_ENST00000520179.1_Splice_Site_p.S570S	NM_006749.4	NP_006740.1	Q08357	S20A2_HUMAN	solute carrier family 20 (phosphate transporter), member 2	570					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|sodium:phosphate symporter activity (GO:0005436)|virus receptor activity (GO:0001618)	p.S570S(1)		breast(1)|endometrium(6)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|stomach(1)	26	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;5.73e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00419)|Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)			TCGTGAAGCCGCTGTGGGGGG	0.612													g|||	1	0.000199681	0.0008	0.0	5008	,	,		18029	0.0		0.0	False		,,,				2504	0.0				p.S570S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1710T	8						.	A		1,4405	4.2+/-10.8	0,1,2202	41.0	35.0	37.0		1710	-3.1	0.9	8		37	0,8600		0,0,4300	no	coding-synonymous-near-splice	SLC20A2	NM_006749.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		570/653	42286360	1,13005	2203	4300	6503	42405517	SO:0001630	splice_region_variant	6575	exon10				CCDS6132.1	8p11.21	2013-05-22			ENSG00000168575	ENSG00000168575		"""Solute carriers"""	10947	protein-coding gene	gene with protein product		158378		MLVAR, GLVR2		7745689, 16790504	Standard	NM_001257180		Approved	PiT-2, Glvr-2	uc010lxm.4	Q08357	OTTHUMG00000164169	ENST00000342228.3:c.1710-1C>T	8.37:g.42286360G>A		Somatic		Capture	SOLID	Phase_I	42405517	NM_006749		Silent	SNP	ENST00000342228.3	37	CCDS6132.1																																																																																				SLC20A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377578.1		Silent
DPY19L4	286148	hgsc.bcm.edu	37	8	95746943	95746943	+	Silent	SNP	A	A	G			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr8:95746943A>G	ENST00000414645.2	+	3	312	c.213A>G	c.(211-213)tcA>tcG	p.S71S		NM_181787.2	NP_861452.2	Q7Z388	D19L4_HUMAN	dpy-19-like 4 (C. elegans)	71						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)	p.S71S(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)	21	Breast(36;3.85e-06)					TCTACTTATCAGCATACCATG	0.363																																					p.S71S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A213G	8						.						94.0	87.0	89.0					8																	95746943		2203	4300	6503	95816119	SO:0001819	synonymous_variant	286148	exon3				CCDS34924.1	8q22.1	2006-11-24			ENSG00000156162	ENSG00000156162			27829	protein-coding gene	gene with protein product		613895					Standard	NM_181787		Approved		uc003ygx.2	Q7Z388	OTTHUMG00000164589	ENST00000414645.2:c.213A>G	8.37:g.95746943A>G		Somatic		Capture	SOLID	Phase_I	95816119	NM_181787	Q6ZW32|Q6ZW42|Q7Z329	Silent	SNP	ENST00000414645.2	37	CCDS34924.1																																																																																				DPY19L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379339.1	NM_181787	
KCNS2	3788	hgsc.bcm.edu	37	8	99440991	99440991	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr8:99440991C>A	ENST00000287042.4	+	2	1134	c.784C>A	c.(784-786)Ctt>Att	p.L262I	KCNS2_ENST00000521839.1_Missense_Mutation_p.L262I	NM_020697.2	NP_065748.1	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2	262					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.L262I(1)		autonomic_ganglia(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	31	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)			TGCCCTAAACCTTATTGACCT	0.522																																					p.L262I	Pancreas(138;844 2489 9202 24627)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C784A	8						.						219.0	214.0	216.0					8																	99440991		2203	4300	6503	99510167	SO:0001583	missense	3788	exon2			AB032970	CCDS6279.1	8q22	2011-07-05			ENSG00000156486	ENSG00000156486		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6301	protein-coding gene	gene with protein product		602906				9305895, 16382104	Standard	NM_020697		Approved	Kv9.2	uc003yin.3	Q9ULS6	OTTHUMG00000044337	ENST00000287042.4:c.784C>A	8.37:g.99440991C>A	ENSP00000287042:p.Leu262Ile	Somatic		Capture	SOLID	Phase_I	99510167	NM_020697	A8KAN1	Missense_Mutation	SNP	ENST00000287042.4	37	CCDS6279.1	.	.	.	.	.	.	.	.	.	.	C	0.092	-1.165453	0.01673	.	.	ENSG00000156486	ENST00000287042;ENST00000521839	D;D	0.98178	-4.77;-4.77	6.07	5.02	0.67125	Ion transport (1);	0.229427	0.35291	N	0.003307	D	0.88665	0.6498	N	0.00873	-1.125	0.30479	N	0.772502	B	0.14012	0.009	B	0.12837	0.008	T	0.81499	-0.0905	10	0.02654	T	1	.	8.4706	0.32982	0.1567:0.7338:0.0:0.1095	.	262	Q9ULS6	KCNS2_HUMAN	I	262	ENSP00000287042:L262I;ENSP00000430712:L262I	ENSP00000287042:L262I	L	+	1	0	KCNS2	99510167	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	1.217000	0.32455	2.884000	0.98904	0.655000	0.94253	CTT		KCNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103134.1	NM_020697	
CSMD3	114788	hgsc.bcm.edu	37	8	113331118	113331118	+	Silent	SNP	C	C	G	rs371684642		TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr8:113331118C>G	ENST00000297405.5	-	47	7552	c.7308G>C	c.(7306-7308)acG>acC	p.T2436T	CSMD3_ENST00000352409.3_Silent_p.T2366T|CSMD3_ENST00000343508.3_Silent_p.T2396T|CSMD3_ENST00000455883.2_Silent_p.T2332T	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2436	Sushi 13. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T2436T(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CTAATCTGCACGTCAGAATTG	0.353										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.T2436T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G7308C	8						.						108.0	100.0	103.0					8																	113331118		2203	4300	6503	113400294	SO:0001819	synonymous_variant	114788	exon47			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.7308G>C	8.37:g.113331118C>G		Somatic		Capture	SOLID	Phase_I	113400294	NM_198123	Q96PZ3	Silent	SNP	ENST00000297405.5	37	CCDS6315.1																																																																																				CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
MVB12B	89853	hgsc.bcm.edu	37	9	129154394	129154394	+	Silent	SNP	G	G	A			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chr9:129154394G>A	ENST00000361171.3	+	5	540	c.459G>A	c.(457-459)cgG>cgA	p.R153R	MVB12B_ENST00000535766.1_Silent_p.R146R|MVB12B_ENST00000545391.1_Silent_p.R153R|MVB12B_ENST00000436593.3_Silent_p.R138R	NM_033446.2	NP_258257.1	Q9H7P6	MB12B_HUMAN	multivesicular body subunit 12B	153	MABP. {ECO:0000255|PROSITE- ProRule:PRU00831}.				protein transport (GO:0015031)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cytosol (GO:0005829)|early endosome (GO:0005769)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	lipid binding (GO:0008289)	p.R153R(1)									TTATTCCACGGGATTCAACGG	0.458																																					p.R153R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G459A	9						.						142.0	153.0	149.0					9																	129154394		2203	4300	6503	128194215	SO:0001819	synonymous_variant	89853	exon5			AK000001	CCDS35142.1	9q34.12	2012-12-03	2012-12-03	2012-12-03	ENSG00000196814	ENSG00000196814			23368	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 28"", ""family with sequence similarity 125, member B"""	C9orf28, FAM125B		18005716, 20654576, 22232651	Standard	NM_033446		Approved	FLJ00001	uc004bqh.2	Q9H7P6	OTTHUMG00000020687	ENST00000361171.3:c.459G>A	9.37:g.129154394G>A		Somatic		Capture	SOLID	Phase_I	128194215	NM_001011703	Q8N6S7	Silent	SNP	ENST00000361171.3	37	CCDS35142.1																																																																																				MVB12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054110.1	XM_088525	
GUCY2F	2986	hgsc.bcm.edu	37	X	108691389	108691389	+	Missense_Mutation	SNP	C	C	T	rs372111572		TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chrX:108691389C>T	ENST00000218006.2	-	6	1769	c.1478G>A	c.(1477-1479)cGt>cAt	p.R493H		NM_001522.2	NP_001513.2	P51841	GUC2F_HUMAN	guanylate cyclase 2F, retinal	493					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)	p.R493H(1)		breast(3)|central_nervous_system(2)|endometrium(5)|kidney(6)|large_intestine(14)|lung(33)|prostate(3)|skin(1)	67						TTTATTTATACGACGCCTAAA	0.398																																					p.R493H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1478A	X						.	C	HIS/ARG	0,3835		0,0,0,1632,571	107.0	92.0	97.0		1478	-1.2	0.1	X		97	1,6727		0,0,1,2428,1871	no	missense	GUCY2F	NM_001522.2	29	0,0,1,4060,2442	TT,TC,T,CC,C		0.0149,0.0,0.0095	probably-damaging	493/1109	108691389	1,10562	2203	4300	6503	108578045	SO:0001583	missense	2986	exon6			L37378	CCDS14545.1	Xq22	2008-08-01			ENSG00000101890	ENSG00000101890			4691	protein-coding gene	gene with protein product	"""guanylate cyclase 2D-like, membrane (retina-specific)"""	300041				8838319, 7777544	Standard	NM_001522		Approved	GUC2DL, GC-F, RetGC-2, ROS-GC2, CYGF	uc004eod.4	P51841	OTTHUMG00000022184	ENST00000218006.2:c.1478G>A	X.37:g.108691389C>T	ENSP00000218006:p.Arg493His	Somatic		Capture	SOLID	Phase_I	108578045	NM_001522	Q9UJF1	Missense_Mutation	SNP	ENST00000218006.2	37	CCDS14545.1	.	.	.	.	.	.	.	.	.	.	C	12.74	2.029703	0.35797	0.0	1.49E-4	ENSG00000101890	ENST00000218006	T	0.79940	-1.32	4.48	-1.18	0.09617	.	0.404244	0.28077	N	0.016697	T	0.73822	0.3636	M	0.66297	2.02	0.31074	N	0.712702	B	0.18968	0.032	B	0.18263	0.021	T	0.64732	-0.6338	10	0.39692	T	0.17	.	9.2131	0.37331	0.0:0.4276:0.0:0.5724	.	493	P51841	GUC2F_HUMAN	H	493	ENSP00000218006:R493H	ENSP00000218006:R493H	R	-	2	0	GUCY2F	108578045	0.008000	0.16893	0.141000	0.22245	0.996000	0.88848	-0.064000	0.11636	-0.435000	0.07264	0.600000	0.82982	CGT		GUCY2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057884.1	NM_001522	
HTATSF1	27336	hgsc.bcm.edu	37	X	135579933	135579933	+	Silent	SNP	C	C	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chrX:135579933C>T	ENST00000218364.4	+	1	264	c.90C>T	c.(88-90)acC>acT	p.T30T	HTATSF1_ENST00000535601.1_Silent_p.T30T	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	30					regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.T30T(1)		NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					ATGGTGACACCCAGACCGATG	0.562																																					p.T30T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C90T	X						.						127.0	112.0	117.0					X																	135579933		2203	4300	6503	135407599	SO:0001819	synonymous_variant	27336	exon1			U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.90C>T	X.37:g.135579933C>T		Somatic		Capture	SOLID	Phase_I	135407599	NM_014500	D3DWG9|Q59G06|Q99730	Silent	SNP	ENST00000218364.4	37	CCDS14657.1																																																																																				HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058497.1	NM_014500	
POLA1	5422	hgsc.bcm.edu	37	X	24751927	24751927	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chrX:24751927G>T	ENST00000379059.3	+	17	1824	c.1809G>T	c.(1807-1809)gaG>gaT	p.E603D	POLA1_ENST00000493342.1_3'UTR|POLA1_ENST00000379068.3_Missense_Mutation_p.E609D	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	603					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)	p.E603D(2)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	AAGTCATTGAGAAAAAGGTAA	0.338																																					p.E603D												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1809T	X						.						46.0	45.0	45.0					X																	24751927		2201	4295	6496	24661848	SO:0001583	missense	5422	exon17				CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.1809G>T	X.37:g.24751927G>T	ENSP00000368349:p.Glu603Asp	Somatic		Capture	SOLID	Phase_I	24661848	NM_016937	Q86UQ7	Missense_Mutation	SNP	ENST00000379059.3	37	CCDS14214.1	.	.	.	.	.	.	.	.	.	.	G	6.693	0.496510	0.12762	.	.	ENSG00000101868	ENST00000379068;ENST00000379059	T;T	0.40756	1.02;1.02	4.81	-1.07	0.09968	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.497273	0.24054	N	0.041974	T	0.18173	0.0436	N	0.10809	0.05	0.09310	N	1	B	0.16396	0.017	B	0.20577	0.03	T	0.08994	-1.0695	10	0.38643	T	0.18	0.0	4.0849	0.09943	0.312:0.0:0.2758:0.4122	.	603	P09884	DPOLA_HUMAN	D	609;603	ENSP00000368358:E609D;ENSP00000368349:E603D	ENSP00000368349:E603D	E	+	3	2	POLA1	24661848	0.995000	0.38212	0.000000	0.03702	0.215000	0.24574	0.777000	0.26718	-0.154000	0.11118	0.422000	0.28245	GAG		POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056111.1	NM_016937	
MAOA	4128	hgsc.bcm.edu	37	X	43601277	43601277	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chrX:43601277C>G	ENST00000338702.3	+	12	1368	c.1245C>G	c.(1243-1245)atC>atG	p.I415M	MAOA_ENST00000542639.1_Missense_Mutation_p.I282M	NM_000240.3	NP_000231.1	P21397	AOFA_HUMAN	monoamine oxidase A	415					cellular biogenic amine metabolic process (GO:0006576)|dopamine catabolic process (GO:0042420)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	primary amine oxidase activity (GO:0008131)	p.I415I(1)|p.I415M(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	18					Almotriptan(DB00918)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Minaprine(DB00805)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Naratriptan(DB00952)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Riboflavin(DB00140)|Rizatriptan(DB00953)|Selegiline(DB01037)|Sertraline(DB01104)|Sumatriptan(DB00669)|Testosterone(DB00624)|Tranylcypromine(DB00752)|Zolmitriptan(DB00315)|Zonisamide(DB00909)	CTCCTGGGATCATGACTCAAT	0.463																																					p.I415M												.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(1)|skin(1)	c.C1245G	X						.						95.0	79.0	85.0					X																	43601277		2203	4300	6503	43486221	SO:0001583	missense	4128	exon12				CCDS14260.1, CCDS59163.1	Xp11.4-p11.3	2008-02-05			ENSG00000189221	ENSG00000189221	1.4.3.4		6833	protein-coding gene	gene with protein product		309850					Standard	NM_000240		Approved		uc004dfy.4	P21397	OTTHUMG00000021387	ENST00000338702.3:c.1245C>G	X.37:g.43601277C>G	ENSP00000340684:p.Ile415Met	Somatic		Capture	SOLID	Phase_I	43486221	NM_000240	B4DF46|Q16426	Missense_Mutation	SNP	ENST00000338702.3	37	CCDS14260.1	.	.	.	.	.	.	.	.	.	.	C	15.93	2.978020	0.53720	.	.	ENSG00000189221	ENST00000338702;ENST00000542639	D;D	0.92397	-3.03;-3.03	5.89	0.0491	0.14288	Amine oxidase (1);	0.043292	0.85682	D	0.000000	D	0.92925	0.7749	M	0.65677	2.01	0.53005	D	0.999968	D	0.55385	0.971	D	0.67382	0.951	D	0.89491	0.3757	10	0.72032	D	0.01	.	4.0196	0.09660	0.4057:0.1795:0.0:0.4148	.	415	P21397	AOFA_HUMAN	M	415;282	ENSP00000340684:I415M;ENSP00000440846:I282M	ENSP00000340684:I415M	I	+	3	3	MAOA	43486221	0.986000	0.35501	0.999000	0.59377	0.883000	0.51084	0.191000	0.17076	0.161000	0.19458	0.529000	0.55759	ATC		MAOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056300.1	NM_000240	
MAGEA10	4109	hgsc.bcm.edu	37	X	151303310	151303310	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3609-01A-02W-0833-10	TCGA-AG-3609-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	94da44f7-c745-4bfb-bf4d-4bf7d316b6a3	0ce8f81d-3acd-42b8-9188-e42cf9897f47	g.chrX:151303310G>C	ENST00000370323.4	-	4	1099	c.783C>G	c.(781-783)caC>caG	p.H261Q	RP11-1007I13.4_ENST00000509345.2_RNA|MAGEA10_ENST00000244096.3_Missense_Mutation_p.H261Q	NM_001251828.1|NM_021048.4	NP_001238757.1|NP_066386	P43363	MAGAA_HUMAN	melanoma antigen family A, 10	261	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					nucleus (GO:0005634)		p.H261Q(2)		endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					CATAAATGAGGTGCTCCATCC	0.532																																					p.H261Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)	c.C783G	X						.						85.0	80.0	82.0					X																	151303310		2203	4300	6503	151053966	SO:0001583	missense	4109	exon4				CCDS14705.1	Xq28	2009-03-13			ENSG00000124260	ENSG00000124260			6797	protein-coding gene	gene with protein product	"""MAGE-10 antigen"", ""melanoma-associated antigen 10"", ""cancer/testis antigen family 1, member 10"""	300343		MAGE10		8575766	Standard	NM_001011543		Approved	MGC10599, CT1.10	uc004ffl.3	P43363	OTTHUMG00000024180	ENST00000370323.4:c.783C>G	X.37:g.151303310G>C	ENSP00000359347:p.His261Gln	Somatic		Capture	SOLID	Phase_I	151053966	NM_021048		Missense_Mutation	SNP	ENST00000370323.4	37	CCDS14705.1	.	.	.	.	.	.	.	.	.	.	G	15.45	2.837727	0.50951	.	.	ENSG00000124260	ENST00000370323;ENST00000244096	T;T	0.05513	3.43;3.43	2.6	-0.415	0.12355	.	0.000000	0.85682	D	0.000000	T	0.23370	0.0565	H	0.95328	3.655	0.09310	N	1	D	0.64830	0.994	P	0.58520	0.84	T	0.07770	-1.0755	10	0.87932	D	0	.	5.3759	0.16164	0.4739:0.0:0.5261:0.0	.	261	P43363	MAGAA_HUMAN	Q	261	ENSP00000359347:H261Q;ENSP00000244096:H261Q	ENSP00000244096:H261Q	H	-	3	2	MAGEA10	151053966	0.005000	0.15991	0.000000	0.03702	0.547000	0.35210	-0.324000	0.07986	-0.235000	0.09767	0.292000	0.19580	CAC		MAGEA10-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060916.3	NM_021048	
