#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CSTF2T	23283	broad.mit.edu	37	10	53458361	53458361	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr10:53458361C>T	ENST00000331173.4	-	1	994	c.949G>A	c.(949-951)Gga>Aga	p.G317R	PRKG1_ENST00000373980.4_Intron|PRKG1_ENST00000373985.1_Intron|PRKG1_ENST00000401604.2_Intron	NM_015235.2	NP_056050.1	Q9H0L4	CSTFT_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant	317	Gly-rich.				mRNA processing (GO:0006397)	intracellular (GO:0005622)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.G317R(1)		NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	30				COAD - Colon adenocarcinoma(2;0.00736)|Colorectal(2;0.00898)|all cancers(4;0.0188)|GBM - Glioblastoma multiforme(4;0.0778)|Epithelial(53;0.122)		GTCACGGGTCCGCGAGGTATA	0.567																																					p.G317R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G949A	10						.						72.0	68.0	70.0					10																	53458361		2203	4300	6503	53128367	SO:0001583	missense	23283	exon1			AB014589	CCDS7245.1	10q11	2013-02-12			ENSG00000177613	ENSG00000177613		"""RNA binding motif (RRM) containing"""	17086	protein-coding gene	gene with protein product		611968				12408968, 11113135	Standard	NM_015235		Approved	DKFZp434C1013, KIAA0689, CstF-64T	uc001jjp.3	Q9H0L4	OTTHUMG00000018246	ENST00000331173.4:c.949G>A	10.37:g.53458361C>T	ENSP00000332444:p.Gly317Arg	Somatic		Capture	Illumina HiSeq	Phase_I	53128367	NM_015235	B2RAR9|O75174|Q53HK6|Q7LGE8|Q8N6T1	Missense_Mutation	SNP	ENST00000331173.4	37	CCDS7245.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.169805	0.78452	.	.	ENSG00000177613	ENST00000331173	T	0.22539	1.95	4.7	4.7	0.59300	.	0.449653	0.22819	N	0.055255	T	0.41994	0.1183	L	0.55481	1.735	0.53688	D	0.999972	D	0.89917	1.0	D	0.97110	1.0	T	0.13737	-1.0498	10	0.52906	T	0.07	-7.9329	15.5353	0.75998	0.0:1.0:0.0:0.0	.	317	Q9H0L4	CSTFT_HUMAN	R	317	ENSP00000332444:G317R	ENSP00000332444:G317R	G	-	1	0	CSTF2T	53128367	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.116000	0.71571	2.613000	0.88420	0.655000	0.94253	GGA		CSTF2T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048097.1	NM_015235	
COL13A1	1305	broad.mit.edu	37	10	71700761	71700761	+	Silent	SNP	C	C	T	rs374512468		TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr10:71700761C>T	ENST00000398978.3	+	34	2355	c.1863C>T	c.(1861-1863)gaC>gaT	p.D621D	COL13A1_ENST00000522165.1_Intron|COL13A1_ENST00000357811.3_Intron|COL13A1_ENST00000520267.1_Silent_p.D549D|COL13A1_ENST00000398968.3_Silent_p.D602D|COL13A1_ENST00000354547.3_Silent_p.D599D|COL13A1_ENST00000398971.3_Silent_p.D606D|COL13A1_ENST00000517713.1_Intron|COL13A1_ENST00000398972.3_Silent_p.D607D|COL13A1_ENST00000356340.3_Silent_p.D621D|COL13A1_ENST00000398964.3_Silent_p.D592D|COL13A1_ENST00000520133.1_Intron|COL13A1_ENST00000398966.3_Silent_p.D599D|COL13A1_ENST00000398974.3_Silent_p.D609D|COL13A1_ENST00000398973.3_Intron|COL13A1_ENST00000398969.3_Silent_p.D549D	NM_001130103.1	NP_001123575.1			collagen, type XIII, alpha 1									p.D621D(1)|p.D604D(1)		endometrium(5)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	28						CAGGTTTGGACGGCAGGCCTG	0.582																																					p.D549D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1647T	10						.	C	,,,,,	0,4062		0,0,2031	203.0	225.0	218.0		1863,1647,,1797,,	4.9	1.0	10		218	1,8339		0,1,4169	no	coding-synonymous,coding-synonymous,intron,coding-synonymous,intron,intron	COL13A1	NM_001130103.1,NM_080798.3,NM_080800.3,NM_080801.3,NM_080802.3,NM_080805.3	,,,,,	0,1,6200	TT,TC,CC		0.012,0.0,0.0081	,,,,,	621/718,549/646,,599/696,,	71700761	1,12401	2031	4170	6201	71370767	SO:0001819	synonymous_variant	1305	exon29			AJ293624	CCDS44419.1, CCDS44423.1, CCDS44424.1, CCDS44425.1, CCDS44427.1, CCDS44428.1, CCDS44423.2, CCDS44424.2, CCDS44425.2, CCDS44427.2, CCDS44428.2	10q22	2013-01-16			ENSG00000197467	ENSG00000197467		"""Collagens"""	2190	protein-coding gene	gene with protein product		120350					Standard	NM_001130103		Approved		uc001jql.3	Q5TAT6	OTTHUMG00000018394	ENST00000398978.3:c.1863C>T	10.37:g.71700761C>T		Somatic		Capture	Illumina HiSeq	Phase_I	71370767	NM_080798		Silent	SNP	ENST00000398978.3	37	CCDS44419.1	.	.	.	.	.	.	.	.	.	.	C	8.814	0.936051	0.18206	0.0	1.2E-4	ENSG00000197467	ENST00000398975	.	.	.	4.9	4.9	0.64082	.	.	.	.	.	T	0.73853	0.3640	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73720	-0.3894	4	.	.	.	-13.1173	18.095	0.89487	0.0:1.0:0.0:0.0	.	.	.	.	M	151	.	.	T	+	2	0	COL13A1	71370767	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	6.110000	0.71535	2.259000	0.74868	0.655000	0.94253	ACG		COL13A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048468.1	NM_005203	
FAM24B	196792	broad.mit.edu	37	10	124608836	124608836	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr10:124608836C>T	ENST00000368898.3	-	4	502	c.212G>A	c.(211-213)tGt>tAt	p.C71Y	CUZD1_ENST00000368904.1_De_novo_Start_OutOfFrame|CUZD1_ENST00000545804.1_Intron|FAM24B_ENST00000368896.1_Missense_Mutation_p.C71Y|FAM24B_ENST00000462859.1_5'UTR	NM_152644.2	NP_689857.2	Q8N5W8	FA24B_HUMAN	family with sequence similarity 24, member B	71						extracellular region (GO:0005576)		p.C71Y(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4		all_neural(114;0.0765)|Lung NSC(174;0.163)|all_lung(145;0.205)		Colorectal(40;0.136)|COAD - Colon adenocarcinoma(40;0.141)		ATATCCTTCACAGCACTGCAG	0.502																																					p.C71Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G212A	10						.						146.0	122.0	130.0					10																	124608836		2203	4300	6503	124598826	SO:0001583	missense	50624	exon4			BC031343	CCDS31303.1	10q26.13	2004-05-27			ENSG00000213185	ENSG00000213185			23475	protein-coding gene	gene with protein product						12477932	Standard	NM_152644		Approved	MGC45962, AC073585.2	uc021qai.1	Q8N5W8	OTTHUMG00000019194	ENST00000368898.3:c.212G>A	10.37:g.124608836C>T	ENSP00000357894:p.Cys71Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	124598826	NM_152644	Q5JPG1	De_novo_Start_OutOfFrame	SNP	ENST00000368898.3	37	CCDS31303.1	.	.	.	.	.	.	.	.	.	.	C	11.76	1.736144	0.30774	.	.	ENSG00000213185	ENST00000368898;ENST00000368896	T;T	0.50548	0.74;0.74	3.12	2.2	0.27929	.	0.169266	0.28700	N	0.014426	T	0.40196	0.1107	.	.	.	0.09310	N	1	P	0.44946	0.846	B	0.43445	0.42	T	0.26224	-1.0109	9	0.56958	D	0.05	.	7.7345	0.28806	0.248:0.752:0.0:0.0	.	71	Q8N5W8	FA24B_HUMAN	Y	71	ENSP00000357894:C71Y;ENSP00000357892:C71Y	ENSP00000357892:C71Y	C	-	2	0	FAM24B	124598826	0.787000	0.28750	0.004000	0.12327	0.001000	0.01503	1.526000	0.35964	0.853000	0.35312	0.467000	0.42956	TGT		FAM24B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050825.1	NM_152644	
ATM	472	broad.mit.edu	37	11	108115600	108115600	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr11:108115600C>T	ENST00000452508.2	+	8	937	c.748C>T	c.(748-750)Cga>Tga	p.R250*	ATM_ENST00000278616.4_Nonsense_Mutation_p.R250*			Q13315	ATM_HUMAN	ATM serine/threonine kinase	250			R -> Q. {ECO:0000269|PubMed:17344846}.		brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.R250*(4)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	CTTTCGAATTCGAGTGTGTGA	0.338			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.R250X		yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	.	4	Substitution - Nonsense(4)	large_intestine(2)|kidney(2)	c.C748T	11	GRCh37	CM030188|CS991299	ATM	M|S		.						123.0	114.0	117.0					11																	108115600		2200	4298	6498	107620810	SO:0001587	stop_gained	472	exon7	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.748C>T	11.37:g.108115600C>T	ENSP00000388058:p.Arg250*	Somatic		Capture	Illumina HiSeq	Phase_I	107620810	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Nonsense_Mutation	SNP	ENST00000452508.2	37	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	C	38	6.953864	0.97960	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	.	.	.	5.33	3.43	0.39272	.	0.499073	0.19940	N	0.102677	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.6503	0.45645	0.1323:0.7986:0.0:0.0691	.	.	.	.	X	250	.	ENSP00000278616:R250X	R	+	1	2	ATM	107620810	1.000000	0.71417	0.203000	0.23512	0.947000	0.59692	2.176000	0.42500	0.725000	0.32318	0.650000	0.86243	CGA		ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
INSC	387755	broad.mit.edu	37	11	15267467	15267467	+	Missense_Mutation	SNP	C	C	T	rs199686458		TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr11:15267467C>T	ENST00000379554.3	+	13	1667	c.1621C>T	c.(1621-1623)Cgt>Tgt	p.R541C	INSC_ENST00000424273.1_Missense_Mutation_p.R452C|INSC_ENST00000379556.3_Missense_Mutation_p.R494C|INSC_ENST00000528567.1_Missense_Mutation_p.A520V|INSC_ENST00000447214.2_3'UTR|INSC_ENST00000525218.1_Missense_Mutation_p.R452C|INSC_ENST00000530161.1_Missense_Mutation_p.R494C	NM_001031853.3	NP_001027024.3	Q1MX18	INSC_HUMAN	inscuteable homolog (Drosophila)	541					establishment of mitotic spindle orientation (GO:0000132)|lung epithelial cell differentiation (GO:0060487)|nervous system development (GO:0007399)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)		p.R541C(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(3)|lung(24)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49						GGCTGCTCTGCGTAGATTGGC	0.542													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19461	0.0		0.0	False		,,,				2504	0.0				p.R494C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1480T	11						.	C	CYS/ARG,CYS/ARG	0,4102		0,0,2051	111.0	113.0	113.0		1621,1480	5.2	1.0	11		113	2,8356		0,2,4177	yes	missense,missense	INSC	NM_001031853.3,NM_001042536.1	180,180	0,2,6228	TT,TC,CC		0.0239,0.0,0.0161	probably-damaging,probably-damaging	541/580,494/533	15267467	2,12458	2051	4179	6230	15224043	SO:0001583	missense	387755	exon13			AB231744	CCDS41621.1, CCDS41622.1, CCDS60735.1, CCDS60736.1	11p15.2	2014-02-05			ENSG00000188487	ENSG00000188487			33116	protein-coding gene	gene with protein product	"""inscuteable spindle orientation adaptor protein"""	610668				16458856	Standard	NM_001031853		Approved		uc001mly.4	Q1MX18	OTTHUMG00000165838	ENST00000379554.3:c.1621C>T	11.37:g.15267467C>T	ENSP00000368872:p.Arg541Cys	Somatic		Capture	Illumina HiSeq	Phase_I	15224043	NM_001042536	A0PJX5|Q1MX19|Q3C1V6|Q4AC95|Q4AC96|Q4AC97|Q4AC98	Missense_Mutation	SNP	ENST00000379554.3	37	CCDS41621.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.4|22.4	4.282012|4.282012	0.80692|0.80692	0.0|0.0	2.39E-4|2.39E-4	ENSG00000188487|ENSG00000188487	ENST00000528567|ENST00000379554;ENST00000379556;ENST00000424273;ENST00000530161;ENST00000525218	T|T;T;T;T;T	0.32988|0.50001	1.43|0.76;0.76;0.76;0.76;0.76	6.17|6.17	5.21|5.21	0.72293|0.72293	.|Armadillo-like helical (1);Armadillo-type fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.64305|0.64305	0.2586|0.2586	L|L	0.53249|0.53249	1.67|1.67	0.58432|0.58432	D|D	0.999995|0.999995	P|D;D;D	0.52170|0.89917	0.951|1.0;1.0;1.0	B|D;D;D	0.40134|0.91635	0.32|0.999;0.996;0.999	T|T	0.64837|0.64837	-0.6313|-0.6313	9|10	0.87932|0.87932	D|D	0|0	-16.2309|-16.2309	15.3417|15.3417	0.74303|0.74303	0.1403:0.8597:0.0:0.0|0.1403:0.8597:0.0:0.0	.|.	520|529;452;541	A0PJX5|Q1MX18-5;Q1MX18-4;Q1MX18	.|.;.;INSC_HUMAN	V|C	520|541;494;452;494;452	ENSP00000435022:A520V|ENSP00000368872:R541C;ENSP00000368874:R494C;ENSP00000389161:R452C;ENSP00000436194:R494C;ENSP00000436113:R452C	ENSP00000435022:A520V|ENSP00000368872:R541C	A|R	+|+	2|1	0|0	INSC|INSC	15224043|15224043	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	2.726000|2.726000	0.47302|0.47302	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GCG|CGT		INSC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386590.1	NM_001031853	
ZNHIT2	741	broad.mit.edu	37	11	64883979	64883979	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr11:64883979C>A	ENST00000310597.4	-	1	1191	c.1147G>T	c.(1147-1149)Gag>Tag	p.E383*	AP003068.12_ENST00000527789.1_RNA	NM_014205.2	NP_055020.1	Q9UHR6	ZNHI2_HUMAN	zinc finger, HIT-type containing 2	383							metal ion binding (GO:0046872)	p.E383*(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(1)	6						CAAAGCCGCTCCAGCTCCCCA	0.627																																					p.E383X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1147T	11						.						58.0	63.0	61.0					11																	64883979		2201	4297	6498	64640555	SO:0001587	stop_gained	741	exon1				CCDS8094.1	11q13	2012-08-08	2010-09-15	2004-07-14	ENSG00000174276	ENSG00000174276		"""Zinc fingers, HIT-type"""	1177	protein-coding gene	gene with protein product		604575	"""chromosome 11 open reading frame 5"", ""zinc finger, HIT domain containing 2"""	C11orf5			Standard	NM_014205		Approved	FON	uc001ocw.3	Q9UHR6	OTTHUMG00000165604	ENST00000310597.4:c.1147G>T	11.37:g.64883979C>A	ENSP00000308548:p.Glu383*	Somatic		Capture	Illumina HiSeq	Phase_I	64640555	NM_014205	Q3SY14|Q8IUV0	Nonsense_Mutation	SNP	ENST00000310597.4	37	CCDS8094.1	.	.	.	.	.	.	.	.	.	.	C	16.34	3.096386	0.56075	.	.	ENSG00000174276	ENST00000310597	.	.	.	4.79	4.79	0.61399	.	0.286130	0.28077	U	0.016688	.	.	.	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-14.8125	13.1907	0.59709	0.0:1.0:0.0:0.0	.	.	.	.	X	383	.	ENSP00000308548:E383X	E	-	1	0	ZNHIT2	64640555	1.000000	0.71417	1.000000	0.80357	0.233000	0.25261	2.923000	0.48868	2.482000	0.83794	0.561000	0.74099	GAG		ZNHIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385260.1	NM_014205	
ENDOD1	23052	broad.mit.edu	37	11	94861651	94861651	+	Silent	SNP	T	T	G			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr11:94861651T>G	ENST00000278505.4	+	2	529	c.411T>G	c.(409-411)tcT>tcG	p.S137S		NM_015036.2	NP_055851.1	O94919	ENDD1_HUMAN	endonuclease domain containing 1	137						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.S137S(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.00824)				ACCTTGATTCTGATTACCAAA	0.488																																					p.S137S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T411G	11						.						112.0	112.0	112.0					11																	94861651		2009	4172	6181	94501299	SO:0001819	synonymous_variant	23052	exon2			BC026191	CCDS41699.1	11q21	2010-03-19			ENSG00000149218	ENSG00000149218			29129	protein-coding gene	gene with protein product						10048485	Standard	NM_015036		Approved	KIAA0830	uc001pfh.3	O94919	OTTHUMG00000167835	ENST00000278505.4:c.411T>G	11.37:g.94861651T>G		Somatic		Capture	Illumina HiSeq	Phase_I	94501299	NM_015036	A8K6K8|Q6GQY5|Q8TAQ8	Silent	SNP	ENST00000278505.4	37	CCDS41699.1																																																																																				ENDOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396545.1	NM_015036	
OPCML	4978	broad.mit.edu	37	11	132307150	132307150	+	Silent	SNP	C	C	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr11:132307150C>T	ENST00000331898.7	-	4	1208	c.630G>A	c.(628-630)gcG>gcA	p.A210A	OPCML_ENST00000524381.1_Silent_p.A203A|OPCML_ENST00000541867.1_Silent_p.A210A|OPCML_ENST00000374778.4_Silent_p.A169A|OPCML_ENST00000529038.1_5'UTR	NM_002545.3	NP_002536.1	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion molecule-like	210	Ig-like C2-type 2.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)|opioid receptor signaling pathway (GO:0038003)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	opioid receptor activity (GO:0004985)	p.A210A(1)		endometrium(5)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|skin(2)|urinary_tract(8)	47	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		GCACATCGGGCGCAGCGACAT	0.552																																					p.A203A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G609A	11						.						129.0	113.0	118.0					11																	132307150		2201	4297	6498	131812360	SO:0001819	synonymous_variant	4978	exon5			BX537377	CCDS8492.1, CCDS31722.1	11q25	2013-01-11	2001-11-28		ENSG00000183715	ENSG00000183715		"""Immunoglobulin superfamily / I-set domain containing"""	8143	protein-coding gene	gene with protein product	"""IgLON family member 1"""	600632	"""opioid-binding protein/cell adhesion molecule-like"""			8244387	Standard	XM_005271578		Approved	OPCM, OBCAM, IGLON1	uc001qgs.3	Q14982	OTTHUMG00000163658	ENST00000331898.7:c.630G>A	11.37:g.132307150C>T		Somatic		Capture	Illumina HiSeq	Phase_I	131812360	NM_001012393	B2CZX2|B7ZLQ1|Q17RN7|Q7Z3W6	Silent	SNP	ENST00000331898.7	37	CCDS8492.1																																																																																				OPCML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374689.3	NM_001012393	
IFFO1	25900	broad.mit.edu	37	12	6657973	6657974	+	Frame_Shift_Ins	INS	-	-	C	rs371982613		TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr12:6657973_6657974insC	ENST00000396840.2	-	5	1130_1131	c.1089_1090insG	c.(1087-1092)gggcggfs	p.R364fs	IFFO1_ENST00000336604.4_Frame_Shift_Ins_p.R367fs|IFFO1_ENST00000436152.2_Frame_Shift_Ins_p.R60fs|IFFO1_ENST00000465801.1_Frame_Shift_Ins_p.R60fs|IFFO1_ENST00000356896.4_Frame_Shift_Ins_p.R367fs			Q0D2I5	IFFO1_HUMAN	intermediate filament family orphan 1	364						intermediate filament (GO:0005882)		p.R364fs*19(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	20						TCCCGCTTCCGCCCCCCCATGG	0.673																																					p.R375fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1123_1124insG	12						.		,,	8,4256		0,8,2124					,,	3.7	1.0			20	15,8229		0,15,4107	no	frameshift,frameshift,frameshift	IFFO1	NM_080730.4,NM_001193457.1,NM_001039670.2	,,	0,23,6231	A1A1,A1R,RR		0.182,0.1876,0.1839	,,	,,		23,12485				6528235	SO:0001589	frameshift_variant	25900	exon6			AF124432	CCDS8550.1, CCDS41741.1, CCDS8550.2, CCDS73425.1	12p13.31	2013-01-16	2008-09-11	2008-09-11	ENSG00000010295	ENSG00000010295		"""Intermediate filament family orphans"""	24970	protein-coding gene	gene with protein product		610495	"""intermediate filament family orphan"""	IFFO		8771189, 3052284	Standard	NM_001193457		Approved	HOM-TES-103	uc010sfe.2	Q0D2I5	OTTHUMG00000141264	ENST00000396840.2:c.1090dupG	12.37:g.6657980_6657980dupC	ENSP00000380052:p.Arg364fs	Somatic		Capture	Illumina HiSeq	Phase_I	6528234	NM_001193457	Q24JT6|Q7L5J9|Q7Z5X4|Q9BQ46	Frame_Shift_Ins	INS	ENST00000396840.2	37																																																																																					IFFO1-008	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000280428.1	NM_080730	
SSH1	54434	broad.mit.edu	37	12	109205065	109205065	+	Silent	SNP	G	G	A	rs542173852		TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr12:109205065G>A	ENST00000326495.5	-	6	534	c.441C>T	c.(439-441)agC>agT	p.S147S	SSH1_ENST00000546812.1_5'UTR|SSH1_ENST00000551165.1_Silent_p.S147S|SSH1_ENST00000360239.3_5'UTR|SSH1_ENST00000326470.5_Silent_p.S158S	NM_018984.3	NP_061857.3	Q8WYL5	SSH1_HUMAN	slingshot protein phosphatase 1	147					actin cytoskeleton organization (GO:0030036)|cell morphogenesis (GO:0000902)|cellular response to ATP (GO:0071318)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of cellular protein metabolic process (GO:0032268)|regulation of lamellipodium assembly (GO:0010591)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.S147S(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TTTTCGTGTCGCTCCACAGTC	0.493													G|||	1	0.000199681	0.0008	0.0	5008	,	,		23716	0.0		0.0	False		,,,				2504	0.0				p.S158S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C474T	12						.						178.0	145.0	156.0					12																	109205065		2203	4300	6503	107729194	SO:0001819	synonymous_variant	54434	exon5			BC062341	CCDS9121.1, CCDS53825.1, CCDS55882.1	12q24.12	2013-03-05	2013-03-05			ENSG00000084112		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30579	protein-coding gene	gene with protein product		606778	"""slingshot homolog 1 (Drosophila)"""			10718198, 11832213	Standard	NM_018984		Approved	KIAA1298	uc001tnm.3	Q8WYL5	OTTHUMG00000169371	ENST00000326495.5:c.441C>T	12.37:g.109205065G>A		Somatic		Capture	Illumina HiSeq	Phase_I	107729194	NM_001161331	Q6P6C0|Q8N9A7|Q8WYL3|Q8WYL4|Q9P2P8	Silent	SNP	ENST00000326495.5	37	CCDS9121.1																																																																																				SSH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403724.1	NM_018984	
HSPB8	26353	broad.mit.edu	37	12	119617203	119617203	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr12:119617203G>A	ENST00000281938.2	+	1	757	c.86G>A	c.(85-87)cGc>cAc	p.R29H	RP11-64B16.4_ENST00000535921.1_RNA|RP11-64B16.3_ENST00000538405.1_RNA	NM_014365.2	NP_055180.1	Q9UJY1	HSPB8_HUMAN	heat shock 22kDa protein 8	29					cell death (GO:0008219)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	identical protein binding (GO:0042802)	p.R29H(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(9)|skin(1)	14	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CTCTCCTCTCGCCTGCTGGAT	0.657																																					p.R29H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G86A	12						.						114.0	130.0	125.0					12																	119617203		2203	4300	6503	118101586	SO:0001583	missense	26353	exon1			AF191017	CCDS9189.1	12q24.23	2014-09-17	2004-04-23					"""Heat shock proteins / HSPB"""	30171	protein-coding gene	gene with protein product		608014	"""heat shock 27kDa protein 8"""			10833516, 11085516	Standard	NM_014365		Approved	H11, E2IG1, HSP22, HspB8	uc001txb.3	Q9UJY1		ENST00000281938.2:c.86G>A	12.37:g.119617203G>A	ENSP00000281938:p.Arg29His	Somatic		Capture	Illumina HiSeq	Phase_I	118101586	NM_014365	B2R6A6|Q6FIH3|Q9UKS3	Missense_Mutation	SNP	ENST00000281938.2	37	CCDS9189.1	.	.	.	.	.	.	.	.	.	.	G	30	5.057370	0.93846	.	.	ENSG00000152137	ENST00000281938	D	0.90324	-2.65	4.42	4.42	0.53409	.	0.000000	0.85682	D	0.000000	D	0.90728	0.7090	L	0.61036	1.89	0.80722	D	1	D	0.56746	0.977	P	0.47206	0.541	D	0.90679	0.4604	9	.	.	.	.	17.2157	0.86943	0.0:0.0:1.0:0.0	.	29	Q9UJY1	HSPB8_HUMAN	H	29	ENSP00000281938:R29H	.	R	+	2	0	HSPB8	118101586	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.143000	0.77348	2.294000	0.77228	0.563000	0.77884	CGC		HSPB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401647.1	NM_014365	
KRAS	3845	broad.mit.edu	37	12	25398281	25398281	+	Missense_Mutation	SNP	C	C	T	rs112445441		TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr12:25398281C>T	ENST00000256078.4	-	2	101	c.38G>A	c.(37-39)gGc>gAc	p.G13D	KRAS_ENST00000556131.1_Missense_Mutation_p.G13D|KRAS_ENST00000311936.3_Missense_Mutation_p.G13D|KRAS_ENST00000557334.1_Missense_Mutation_p.G13D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	13			G -> D (in a breast carcinoma cell line and GASC; somatic mutation). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:3627975}.|G -> R (in pylocytic astrocytoma; somatic mutation; increase activation of the Ras pathway). {ECO:0000269|PubMed:16247081}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G13D(3223)|p.G13V(33)|p.G13A(28)|p.G13E(3)|p.G13I(1)|p.G13N(1)|p.G13_V14>DI(1)|p.G13R(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CTTGCCTACGCCACCAGCTCC	0.338	G13D(DLD1_LARGE_INTESTINE)|G13D(DV90_LUNG)|G13D(HCT116_LARGE_INTESTINE)|G13D(HCT15_LARGE_INTESTINE)|G13D(LOVO_LARGE_INTESTINE)|G13D(MDAMB231_BREAST)|G13D(NCIH647_LUNG)|G13D(NCIH747_LARGE_INTESTINE)|G13D(NOMO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G13D(T84_LARGE_INTESTINE)|G13D(TOLEDO_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G13D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,lung,NS,Substitution - Missense,-1 	.	3291	Substitution - Missense(3290)|Complex - compound substitution(1)	large_intestine(2808)|haematopoietic_and_lymphoid_tissue(94)|lung(92)|endometrium(54)|soft_tissue(38)|ovary(38)|stomach(32)|pancreas(30)|thyroid(27)|biliary_tract(21)|prostate(20)|breast(10)|cervix(4)|gastrointestinal_tract_(site_indeterminate)(3)|upper_aerodigestive_tract(3)|urinary_tract(3)|liver(3)|salivary_gland(3)|small_intestine(3)|oesophagus(2)|skin(1)|genital_tract(1)|bone(1)	c.G38A	12						.						88.0	78.0	82.0					12																	25398281		2203	4300	6503	25289548	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.38G>A	12.37:g.25398281C>T	ENSP00000256078:p.Gly13Asp	Somatic		Capture	Illumina HiSeq	Phase_I	25289548	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.867862	0.91587	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	D;T;T;T	0.82803	-1.65;-0.7;-0.7;-0.7	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90079	0.6901	M	0.93062	3.375	0.80722	D	1	B;P	0.43314	0.215;0.803	B;P	0.46172	0.175;0.506	D	0.92106	0.5692	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	13;13	P01116-2;P01116	.;RASK_HUMAN	D	13	ENSP00000308495:G13D;ENSP00000452512:G13D;ENSP00000256078:G13D;ENSP00000451856:G13D	ENSP00000256078:G13D	G	-	2	0	KRAS	25289548	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGC		KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
FMNL3	91010	broad.mit.edu	37	12	50052249	50052249	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr12:50052249C>T	ENST00000293590.5	-	6	814	c.581G>A	c.(580-582)cGc>cAc	p.R194H	FMNL3_ENST00000335154.5_Missense_Mutation_p.R194H|FMNL3_ENST00000550488.1_Missense_Mutation_p.R194H|FMNL3_ENST00000352151.5_Intron			Q8IVF7	FMNL3_HUMAN	formin-like 3	194	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)	GTPase activating protein binding (GO:0032794)	p.R194H(1)		breast(4)|endometrium(7)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|stomach(1)	39						GCGCGCAGAGCGAGCGAGGCT	0.627																																					p.R194H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G581A	12						.						52.0	60.0	57.0					12																	50052249		2141	4241	6382	48338516	SO:0001583	missense	91010	exon6			AK128195	CCDS41780.1, CCDS44874.1	12q13.12	2006-04-10							23698	protein-coding gene	gene with protein product						12684686	Standard	NM_198900		Approved	DKFZp762B245, MGC45819, WBP3	uc001ruv.1	Q8IVF7	OTTHUMG00000169651	ENST00000293590.5:c.581G>A	12.37:g.50052249C>T	ENSP00000293590:p.Arg194His	Somatic		Capture	Illumina HiSeq	Phase_I	48338516	NM_175736	B0JZA7|Q6ZRJ1	Missense_Mutation	SNP	ENST00000293590.5	37		.	.	.	.	.	.	.	.	.	.	C	23.2	4.383307	0.82792	.	.	ENSG00000161791	ENST00000335154;ENST00000550488;ENST00000293590	T;T;T	0.81078	-1.45;-1.45;-1.45	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	D	0.90058	0.6895	M	0.83953	2.67	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.90068	0.4161	10	0.44086	T	0.13	.	17.409	0.87480	0.0:1.0:0.0:0.0	.	194	Q8IVF7-3	.	H	194	ENSP00000335655:R194H;ENSP00000447479:R194H;ENSP00000293590:R194H	ENSP00000293590:R194H	R	-	2	0	FMNL3	48338516	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	5.805000	0.69143	2.507000	0.84556	0.467000	0.42956	CGC		FMNL3-201	KNOWN	basic	protein_coding	protein_coding		NM_175736	
CAND1	55832	broad.mit.edu	37	12	67700368	67700368	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr12:67700368T>A	ENST00000545606.1	+	10	3357	c.2920T>A	c.(2920-2922)Ttg>Atg	p.L974M		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	974					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)		p.L974M(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		TAAGGGGTACTTGATATCAGG	0.368																																					p.L974M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2920A	12						.						73.0	75.0	74.0					12																	67700368		2203	4300	6503	65986635	SO:0001583	missense	55832	exon10				CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.2920T>A	12.37:g.67700368T>A	ENSP00000442318:p.Leu974Met	Somatic		Capture	Illumina HiSeq	Phase_I	65986635	NM_018448	B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Missense_Mutation	SNP	ENST00000545606.1	37	CCDS8977.1	.	.	.	.	.	.	.	.	.	.	T	15.22	2.770060	0.49680	.	.	ENSG00000111530	ENST00000545606;ENST00000299218;ENST00000544619	T;T	0.38401	1.14;1.14	5.76	5.76	0.90799	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.63861	0.2547	M	0.83774	2.66	0.80722	D	1	D;D	0.89917	0.978;1.0	D;D	0.80764	0.923;0.994	T	0.67734	-0.5594	9	.	.	.	-6.7556	16.0706	0.80928	0.0:0.0:0.0:1.0	.	806;974	Q86VP6-2;Q86VP6	.;CAND1_HUMAN	M	974;974;514	ENSP00000442318:L974M;ENSP00000444089:L514M	.	L	+	1	2	CAND1	65986635	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	2.632000	0.46511	2.191000	0.70037	0.482000	0.46254	TTG		CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402105.1	NM_018448	
MYF5	4617	broad.mit.edu	37	12	81111115	81111115	+	Silent	SNP	C	C	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr12:81111115C>T	ENST00000228644.3	+	1	425	c.273C>T	c.(271-273)cgC>cgT	p.R91R		NM_005593.2	NP_005584.2	P13349	MYF5_HUMAN	myogenic factor 5	91	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				camera-type eye development (GO:0043010)|cartilage condensation (GO:0001502)|embryonic skeletal system morphogenesis (GO:0048704)|extracellular matrix organization (GO:0030198)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|muscle tissue morphogenesis (GO:0060415)|ossification (GO:0001503)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)	protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)	p.R91R(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(8)|lung(15)|ovary(2)|pancreas(1)	30						CCACTATGCGCGAGCGGAGGC	0.612																																					p.R91R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C273T	12						.						45.0	41.0	42.0					12																	81111115		2203	4299	6502	79635246	SO:0001819	synonymous_variant	4617	exon1				CCDS9020.1	12q21	2013-05-21			ENSG00000111049	ENSG00000111049		"""Basic helix-loop-helix proteins"""	7565	protein-coding gene	gene with protein product		159990				8978788, 12105204	Standard	NM_005593		Approved	bHLHc2	uc001szg.2	P13349	OTTHUMG00000170166	ENST00000228644.3:c.273C>T	12.37:g.81111115C>T		Somatic		Capture	Illumina HiSeq	Phase_I	79635246	NM_005593	Q6ISR9	Silent	SNP	ENST00000228644.3	37	CCDS9020.1																																																																																				MYF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407757.1	NM_005593	
ANAPC5	51433	broad.mit.edu	37	12	121766193	121766193	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr12:121766193C>T	ENST00000261819.3	-	10	1351	c.1230G>A	c.(1228-1230)tgG>tgA	p.W410*	ANAPC5_ENST00000441917.2_Nonsense_Mutation_p.W298*|ANAPC5_ENST00000541887.1_Nonsense_Mutation_p.W397*|ANAPC5_ENST00000344395.4_Nonsense_Mutation_p.W298*|ANAPC5_ENST00000535482.1_Nonsense_Mutation_p.W76*|ANAPC5_ENST00000544314.1_5'UTR	NM_016237.4	NP_057321.2	Q9UJX4	APC5_HUMAN	anaphase promoting complex subunit 5	410					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)	p.W410*(1)		breast(6)|endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(3)	31	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GGCTGTGTTTCCAGTGCAGGA	0.562																																					p.W298X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G894A	12						.						149.0	114.0	126.0					12																	121766193		2203	4300	6503	120250576	SO:0001587	stop_gained	51433	exon10			AF191339	CCDS9220.1, CCDS45000.1	12q24.31	2014-08-12			ENSG00000089053	ENSG00000089053		"""Anaphase promoting complex subunits"""	15713	protein-coding gene	gene with protein product		606948				9469815	Standard	NM_016237		Approved	APC5	uc001uag.3	Q9UJX4	OTTHUMG00000169157	ENST00000261819.3:c.1230G>A	12.37:g.121766193C>T	ENSP00000261819:p.Trp410*	Somatic		Capture	Illumina HiSeq	Phase_I	120250576	NM_001137559	E9PFB2|Q8N4H7|Q9BQD4	Nonsense_Mutation	SNP	ENST00000261819.3	37	CCDS9220.1	.	.	.	.	.	.	.	.	.	.	C	37	6.627967	0.97718	.	.	ENSG00000089053	ENST00000441917;ENST00000541887;ENST00000261819;ENST00000535482;ENST00000544314;ENST00000344395	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	19.3813	0.94536	0.0:1.0:0.0:0.0	.	.	.	.	X	298;397;410;76;12;298	.	ENSP00000261819:W410X	W	-	3	0	ANAPC5	120250576	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.077000	0.76814	2.824000	0.97209	0.655000	0.94253	TGG		ANAPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402582.1		
SAP18	10284	broad.mit.edu	37	13	21721351	21721351	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr13:21721351C>A	ENST00000607003.1	+	4	364	c.332C>A	c.(331-333)tCt>tAt	p.S111Y	SAP18_ENST00000382533.4_Missense_Mutation_p.S130Y			O00422	SAP18_HUMAN	Sin3A-associated protein, 18kDa	111	Involved in splicing regulation activity.				mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription corepressor activity (GO:0003714)	p.S111Y(1)		kidney(1)|large_intestine(1)|lung(4)	6		all_cancers(29;2.16e-20)|all_epithelial(30;2.97e-18)|all_lung(29;4.58e-16)|Lung SC(185;0.0262)|Breast(139;0.147)		all cancers(112;9.79e-05)|Epithelial(112;0.000292)|OV - Ovarian serous cystadenocarcinoma(117;0.00276)|Lung(94;0.0941)		AGCACCATGTCTGGCAGAAAG	0.438																																					p.S130Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C389A	13						.						105.0	104.0	105.0					13																	21721351		2203	4300	6503	20619351	SO:0001583	missense	10284	exon4			U96915	CCDS9295.2	13q12.11	2008-02-05	2006-02-02		ENSG00000150459	ENSG00000150459			10530	protein-coding gene	gene with protein product		602949	"""sin3A-associated protein, 18kDa"""			9150135	Standard	NM_005870		Approved	SAP18p, 2HOR0202, MGC27131	uc001uns.3	O00422	OTTHUMG00000016535	ENST00000607003.1:c.332C>A	13.37:g.21721351C>A	ENSP00000475925:p.Ser111Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	20619351	NM_005870	B2R494|Q2TTR4|Q6IAW9|Q8N606|Q9UF14	Missense_Mutation	SNP	ENST00000607003.1	37		.	.	.	.	.	.	.	.	.	.	C	23.6	4.434471	0.83776	.	.	ENSG00000150459	ENST00000382533	.	.	.	5.87	5.02	0.67125	.	0.000000	0.85682	D	0.000000	D	0.83046	0.5169	M	0.87456	2.885	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.82750	-0.0303	9	0.22109	T	0.4	-12.752	16.4939	0.84209	0.1319:0.8681:0.0:0.0	.	111	O00422	SAP18_HUMAN	Y	130	.	ENSP00000371973:S130Y	S	+	2	0	SAP18	20619351	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	7.640000	0.83355	1.475000	0.48197	0.655000	0.94253	TCT		SAP18-009	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000470725.1	NM_005870	
PABPC3	5042	broad.mit.edu	37	13	25670809	25670809	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr13:25670809T>G	ENST00000281589.3	+	1	510	c.473T>G	c.(472-474)aTg>aGg	p.M158R		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	158	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)	p.M158R(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		ATTAAAAAAATGAACGGAATG	0.408																																					p.M158R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T473G	13						.						117.0	116.0	116.0					13																	25670809		2203	4300	6503	24568809	SO:0001583	missense	5042	exon1			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.473T>G	13.37:g.25670809T>G	ENSP00000281589:p.Met158Arg	Somatic		Capture	Illumina HiSeq	Phase_I	24568809	NM_030979	Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	37	CCDS9311.1	.	.	.	.	.	.	.	.	.	.	T	14.23	2.473409	0.43942	.	.	ENSG00000151846	ENST00000281589	T	0.17854	2.25	0.546	0.546	0.17196	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.56097	U	0.000023	T	0.38558	0.1045	M	0.87456	2.885	0.49483	D	0.999796	D	0.76494	0.999	D	0.76071	0.987	T	0.19484	-1.0304	10	0.87932	D	0	.	5.327	0.15913	0.0:1.0E-4:0.0:0.9999	.	158	Q9H361	PABP3_HUMAN	R	158	ENSP00000281589:M158R	ENSP00000281589:M158R	M	+	2	0	PABPC3	24568809	1.000000	0.71417	0.583000	0.28640	0.125000	0.20455	3.874000	0.56101	0.469000	0.27268	0.254000	0.18369	ATG		PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979	
SLITRK1	114798	broad.mit.edu	37	13	84454048	84454048	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr13:84454048T>A	ENST00000377084.2	-	1	2480	c.1595A>T	c.(1594-1596)gAg>gTg	p.E532V		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	532	LRRCT 2.				adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)		p.E532V(1)		NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		GCAGGAGCACTCCCAGGGGTT	0.547																																					p.E532V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1595T	13						.						54.0	54.0	54.0					13																	84454048		2203	4300	6503	83352049	SO:0001583	missense	114798	exon1			AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1595A>T	13.37:g.84454048T>A	ENSP00000366288:p.Glu532Val	Somatic		Capture	Illumina HiSeq	Phase_I	83352049	NM_052910	Q5U5I6|Q96SF9	Missense_Mutation	SNP	ENST00000377084.2	37	CCDS9464.1	.	.	.	.	.	.	.	.	.	.	T	14.02	2.409862	0.42715	.	.	ENSG00000178235	ENST00000377084	T	0.50813	0.73	5.22	5.22	0.72569	Cysteine-rich flanking region, C-terminal (1);	0.051933	0.64402	D	0.000001	T	0.49558	0.1564	L	0.54323	1.7	0.54753	D	0.999986	B	0.22983	0.078	B	0.34536	0.185	T	0.50833	-0.8781	10	0.54805	T	0.06	-15.6625	14.208	0.65746	0.0:0.0:0.0:1.0	.	532	Q96PX8	SLIK1_HUMAN	V	532	ENSP00000366288:E532V	ENSP00000366288:E532V	E	-	2	0	SLITRK1	83352049	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.104000	0.64026	0.533000	0.62120	GAG		SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910	
RASGRP1	10125	broad.mit.edu	37	15	38800144	38800144	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr15:38800144C>T	ENST00000310803.5	-	9	1202	c.1025G>A	c.(1024-1026)cGa>cAa	p.R342Q	RASGRP1_ENST00000559830.1_Missense_Mutation_p.R342Q|RASGRP1_ENST00000558164.1_Missense_Mutation_p.R342Q|RASGRP1_ENST00000561180.1_Missense_Mutation_p.R393Q|RASGRP1_ENST00000450598.2_Missense_Mutation_p.R342Q|RASGRP1_ENST00000539159.1_Missense_Mutation_p.R294Q|RP11-102L12.2_ENST00000560231.1_RNA	NM_001128602.1|NM_005739.3	NP_001122074.1|NP_005730.2	O95267	GRP1_HUMAN	RAS guanyl releasing protein 1 (calcium and DAG-regulated)	342	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of Rho GTPase activity (GO:0032862)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|platelet activation (GO:0030168)|Ras protein signal transduction (GO:0007265)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)|secretory granule localization (GO:0032252)|signal transduction (GO:0007165)|vesicle transport along microtubule (GO:0047496)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)	p.R342Q(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20		all_cancers(109;6.38e-17)|all_epithelial(112;5.51e-15)|Lung NSC(122;2.12e-11)|all_lung(180;5.63e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;1.97e-07)|BRCA - Breast invasive adenocarcinoma(123;0.00248)		TCCATAGGCTCGCCGGTAATT	0.532																																					p.R342Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1025A	15						.						55.0	54.0	55.0					15																	38800144		2026	4185	6211	36587436	SO:0001583	missense	10125	exon9			AF106071	CCDS45221.1, CCDS45222.1	15q15	2013-01-10				ENSG00000172575		"""EF-hand domain containing"""	9878	protein-coding gene	gene with protein product		603962				10087292, 9789079	Standard	NM_005739		Approved	CalDAG-GEFII, RASGRP	uc001zke.4	O95267		ENST00000310803.5:c.1025G>A	15.37:g.38800144C>T	ENSP00000310244:p.Arg342Gln	Somatic		Capture	Illumina HiSeq	Phase_I	36587436	NM_005739	Q56CZ0|Q58G75|Q59HB1|Q5I3A8|Q6GV31|Q6NX39|Q7LDG6|Q9UI94|Q9UNN9	Missense_Mutation	SNP	ENST00000310803.5	37	CCDS45222.1	.	.	.	.	.	.	.	.	.	.	C	18.54	3.646740	0.67358	.	.	ENSG00000172575	ENST00000310803;ENST00000450598;ENST00000415523;ENST00000431814;ENST00000539159;ENST00000414708;ENST00000541438	T;T;T;T	0.28255	1.62;1.62;1.62;1.62	5.13	5.13	0.70059	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.249894	0.38217	N	0.001767	T	0.25901	0.0631	N	0.20328	0.56	0.53005	D	0.999963	B;P;P;P	0.50819	0.113;0.766;0.817;0.939	B;B;B;B	0.43155	0.016;0.392;0.317;0.41	T	0.03651	-1.1016	10	0.48119	T	0.1	-10.6811	18.782	0.91937	0.0:1.0:0.0:0.0	.	342;342;342;342	C9JM27;C9JCE5;O95267;O95267-2	.;.;GRP1_HUMAN;.	Q	342;342;342;342;294;342;342	ENSP00000310244:R342Q;ENSP00000388540:R342Q;ENSP00000444762:R294Q;ENSP00000413105:R342Q	ENSP00000310244:R342Q	R	-	2	0	RASGRP1	36587436	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	4.799000	0.62517	2.653000	0.90120	0.561000	0.74099	CGA		RASGRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418223.1	NM_005739	
MAPKBP1	23005	broad.mit.edu	37	15	42103107	42103107	+	Missense_Mutation	SNP	G	G	A	rs201805153		TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr15:42103107G>A	ENST00000456763.2	+	4	429	c.233G>A	c.(232-234)cGg>cAg	p.R78Q	MAPKBP1_ENST00000260357.7_5'UTR|MAPKBP1_ENST00000507762.1_3'UTR|MAPKBP1_ENST00000514566.1_Missense_Mutation_p.R78Q|MAPKBP1_ENST00000457542.2_Missense_Mutation_p.R78Q|MAPKBP1_ENST00000221214.6_Missense_Mutation_p.R78Q	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	78								p.R78Q(1)		breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		TTCAATCCCCGGAAACACAAA	0.557													g|||	1	0.000199681	0.0	0.0	5008	,	,		18824	0.0		0.001	False		,,,				2504	0.0				p.R78Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G233A	15						.						167.0	152.0	157.0					15																	42103107		2203	4300	6503	39890399	SO:0001583	missense	23005	exon4			AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.233G>A	15.37:g.42103107G>A	ENSP00000393099:p.Arg78Gln	Somatic		Capture	Illumina HiSeq	Phase_I	39890399	NM_014994	A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Missense_Mutation	SNP	ENST00000456763.2	37	CCDS45239.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	g	18.27	3.587896	0.66105	.	.	ENSG00000137802	ENST00000457542;ENST00000221214;ENST00000456763;ENST00000514566;ENST00000510535	T;T;T;T;T	0.56941	5.04;0.43;5.04;5.04;2.32	5.03	4.1	0.47936	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.221418	0.41294	D	0.000906	T	0.36663	0.0975	L	0.27053	0.805	0.80722	D	1	B;P;B	0.36990	0.066;0.577;0.176	B;B;B	0.29942	0.024;0.109;0.052	T	0.40327	-0.9569	10	0.51188	T	0.08	-19.5738	13.8788	0.63670	0.0747:0.0:0.9253:0.0	.	78;78;78	O60336-2;O60336;O60336-6	.;MABP1_HUMAN;.	Q	78	ENSP00000397570:R78Q;ENSP00000221214:R78Q;ENSP00000393099:R78Q;ENSP00000426154:R78Q;ENSP00000422132:R78Q	ENSP00000221214:R78Q	R	+	2	0	MAPKBP1	39890399	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.247000	0.43151	2.608000	0.88229	0.655000	0.94253	CGG		MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359745.1	NM_014994	
MYO1E	4643	broad.mit.edu	37	15	59464132	59464132	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr15:59464132T>A	ENST00000288235.4	-	22	2843	c.2444A>T	c.(2443-2445)aAa>aTa	p.K815I	MIR2116_ENST00000517221.1_RNA	NM_004998.3	NP_004989.2	Q12965	MYO1E_HUMAN	myosin IE	815	Myosin tail. {ECO:0000255}.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)	p.K815I(1)		breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(6)|lung(10)|pancreas(2)|prostate(1)|urinary_tract(1)	33				all cancers(107;0.207)		TATCTCGATTTTCCGCTTCAG	0.542																																					p.K815I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2444T	15						.						151.0	132.0	139.0					15																	59464132		2191	4291	6482	57251424	SO:0001583	missense	4643	exon22			U14391	CCDS32254.1	15q21-q22	2011-09-27				ENSG00000157483		"""Myosins / Myosin superfamily : Class I"""	7599	protein-coding gene	gene with protein product	"""myosin-IC"""	601479				8884266	Standard	NM_004998		Approved	MYO1C, HuncM-IC, MGC104638	uc002aga.4	Q12965		ENST00000288235.4:c.2444A>T	15.37:g.59464132T>A	ENSP00000288235:p.Lys815Ile	Somatic		Capture	Illumina HiSeq	Phase_I	57251424	NM_004998	Q14778	Missense_Mutation	SNP	ENST00000288235.4	37	CCDS32254.1	.	.	.	.	.	.	.	.	.	.	T	10.89	1.479844	0.26511	.	.	ENSG00000157483	ENST00000288235	T	0.39787	1.06	5.05	-0.29	0.12847	Myosin tail 2 (1);	0.386506	0.29980	N	0.010704	T	0.64046	0.2563	M	0.88979	2.995	0.21473	N	0.999675	P	0.45126	0.851	D	0.64506	0.926	T	0.58255	-0.7668	10	0.72032	D	0.01	.	10.0207	0.42041	0.0:0.4447:0.0:0.5553	.	815	Q12965	MYO1E_HUMAN	I	815	ENSP00000288235:K815I	ENSP00000288235:K815I	K	-	2	0	MYO1E	57251424	0.003000	0.15002	0.191000	0.23289	0.369000	0.29798	0.095000	0.15127	-0.201000	0.10284	-0.366000	0.07423	AAA		MYO1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416024.1	NM_004998	
GRIN2A	2903	broad.mit.edu	37	16	10031934	10031934	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr16:10031934C>T	ENST00000396573.2	-	4	1198	c.889G>A	c.(889-891)Ggc>Agc	p.G297S	GRIN2A_ENST00000330684.3_Missense_Mutation_p.G297S|GRIN2A_ENST00000396575.2_Missense_Mutation_p.G297S|GRIN2A_ENST00000535259.1_Missense_Mutation_p.G140S|GRIN2A_ENST00000404927.2_Missense_Mutation_p.G297S|GRIN2A_ENST00000562109.1_Missense_Mutation_p.G297S|GRIN2A_ENST00000566670.1_5'Flank	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	297					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.G297S(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GTTAGGATGCCAATGCCGTCC	0.572																																					p.G297S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G889A	16						.						89.0	68.0	75.0					16																	10031934		2197	4300	6497	9939435	SO:0001583	missense	2903	exon3				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.889G>A	16.37:g.10031934C>T	ENSP00000379818:p.Gly297Ser	Somatic		Capture	Illumina HiSeq	Phase_I	9939435	NM_001134408	O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	c	22.0	4.233296	0.79688	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.05382	3.45;3.45;3.45;3.45;3.45	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.06371	0.0164	L	0.28274	0.84	0.58432	D	0.999997	B;B;P	0.37423	0.235;0.277;0.594	B;B;B	0.35859	0.09;0.145;0.212	T	0.50171	-0.8859	9	.	.	.	.	18.0961	0.89490	0.0:1.0:0.0:0.0	.	140;297;297	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	S	297;297;140;297;297	ENSP00000379818:G297S;ENSP00000385872:G297S;ENSP00000441572:G140S;ENSP00000332549:G297S;ENSP00000379820:G297S	.	G	-	1	0	GRIN2A	9939435	1.000000	0.71417	0.997000	0.53966	0.553000	0.35397	5.905000	0.69893	2.582000	0.87167	0.561000	0.74099	GGC		GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
MYH1	4619	broad.mit.edu	37	17	10404045	10404045	+	Missense_Mutation	SNP	C	C	T	rs142605633	byFrequency	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr17:10404045C>T	ENST00000226207.5	-	28	3857	c.3763G>A	c.(3763-3765)Gct>Act	p.A1255T	RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1255					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.A1255T(1)		NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						TCTTCTAGAGCGCGGCACATC	0.453																																					p.A1255T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3763A	17						.	C	THR/ALA	0,4406		0,0,2203	146.0	129.0	135.0		3763	3.1	0.1	17	dbSNP_134	135	2,8598	2.2+/-6.3	0,2,4298	yes	missense	MYH1	NM_005963.3	58	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	1255/1940	10404045	2,13004	2203	4300	6503	10344770	SO:0001583	missense	4619	exon28				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.3763G>A	17.37:g.10404045C>T	ENSP00000226207:p.Ala1255Thr	Somatic		Capture	Illumina HiSeq	Phase_I	10344770	NM_005963	Q14CA4|Q9Y622	Missense_Mutation	SNP	ENST00000226207.5	37	CCDS11155.1	.	.	.	.	.	.	.	.	.	.	C	2.155	-0.393510	0.04899	0.0	2.33E-4	ENSG00000109061	ENST00000226207	D	0.82433	-1.61	5.45	3.12	0.35913	Myosin tail (1);	0.320500	0.22216	N	0.063022	T	0.47930	0.1472	N	0.00468	-1.46	0.26872	N	0.967733	B	0.02656	0.0	B	0.04013	0.001	T	0.49103	-0.8974	10	0.02654	T	1	.	9.6684	0.39998	0.0:0.2075:0.0:0.7925	.	1255	P12882	MYH1_HUMAN	T	1255	ENSP00000226207:A1255T	ENSP00000226207:A1255T	A	-	1	0	MYH1	10344770	0.018000	0.18449	0.146000	0.22360	0.752000	0.42762	0.160000	0.16462	0.445000	0.26639	-0.300000	0.09419	GCT		MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963	
MAP2K4	6416	broad.mit.edu	37	17	11998898	11998898	+	Missense_Mutation	SNP	C	C	T	rs375500789		TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr17:11998898C>T	ENST00000353533.5	+	4	463	c.400C>T	c.(400-402)Cgg>Tgg	p.R134W	MAP2K4_ENST00000581941.1_3'UTR|MAP2K4_ENST00000415385.3_Missense_Mutation_p.R145W	NM_003010.2	NP_003001.1	P45985	MP2K4_HUMAN	mitogen-activated protein kinase kinase 4	134	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron apoptotic process (GO:0043525)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|nucleus (GO:0005634)|perikaryon (GO:0043204)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.0?(10)|p.R134W(2)|p.?(1)		NS(1)|biliary_tract(2)|breast(22)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(26)|lung(15)|ovary(8)|pancreas(11)|skin(3)|stomach(2)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	100		all_cancers(5;0.0413)|Breast(5;0.000625)|all_epithelial(5;0.00978)|all_lung(20;0.0449)|Lung NSC(33;0.163)		Epithelial(2;4.12e-09)|all cancers(2;6.86e-07)|BRCA - Breast invasive adenocarcinoma(2;8.74e-07)|Colorectal(4;5.32e-05)|COAD - Colon adenocarcinoma(4;0.0039)|READ - Rectum adenocarcinoma(10;0.0681)		CCAGAGAATTCGGTCAACAGT	0.338			"""D, Mis, N"""		"""pancreatic, breast, colorectal"""																																p.R134W			Rec	yes		17	17p11.2	6416	mitogen-activated protein kinase kinase 4		E	.	.	13	Whole gene deletion(10)|Substitution - Missense(2)|Unknown(1)	breast(4)|ovary(4)|large_intestine(2)|biliary_tract(1)|skin(1)|pancreas(1)	c.C400T	17						.						112.0	109.0	110.0					17																	11998898		2203	4300	6503	11939623	SO:0001583	missense	6416	exon4			L36870	CCDS11162.1, CCDS62095.1	17p12	2012-03-23			ENSG00000065559	ENSG00000065559	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6844	protein-coding gene	gene with protein product		601335		SERK1		7716521	Standard	NM_003010		Approved	MEK4, JNKK1, PRKMK4, MKK4	uc002gnj.3	P45985		ENST00000353533.5:c.400C>T	17.37:g.11998898C>T	ENSP00000262445:p.Arg134Trp	Somatic		Capture	Illumina HiSeq	Phase_I	11939623	NM_003010	B2R7N7|B3KYB2|D3DTS5|Q5U0B8|Q6FHX4|Q6P9H2|Q6PIE6	Missense_Mutation	SNP	ENST00000353533.5	37	CCDS11162.1	.	.	.	.	.	.	.	.	.	.	C	14.66	2.600257	0.46423	.	.	ENSG00000065559	ENST00000353533;ENST00000415385;ENST00000538465;ENST00000536413	T;T	0.66815	-0.23;-0.23	5.97	4.94	0.65067	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.83454	0.5258	M	0.87456	2.885	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.997;0.997	D	0.85848	0.1402	10	0.87932	D	0	.	14.9277	0.70893	0.1438:0.8562:0.0:0.0	.	6;145;134	B7ZA62;P45985-2;P45985	.;.;MP2K4_HUMAN	W	134;145;111;6	ENSP00000262445:R134W;ENSP00000410402:R145W	ENSP00000262445:R134W	R	+	1	2	MAP2K4	11939623	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.735000	0.62051	2.835000	0.97688	0.591000	0.81541	CGG		MAP2K4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000441226.1		
DLX4	1748	broad.mit.edu	37	17	48050478	48050478	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr17:48050478C>T	ENST00000240306.3	+	2	620	c.325C>T	c.(325-327)Cgc>Tgc	p.R109C	DLX4_ENST00000411890.2_Missense_Mutation_p.R37C|DLX4_ENST00000503410.1_3'UTR	NM_138281.2	NP_612138.1	Q92988	DLX4_HUMAN	distal-less homeobox 4	109					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R109C(1)		central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(3)	10						CTCCGAGCGGCGCCCTCAGGC	0.667																																					p.R37C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C109T	17						.						27.0	34.0	31.0					17																	48050478		2203	4300	6503	45405477	SO:0001583	missense	1748	exon1				CCDS11555.1, CCDS45728.1	17q21.33	2011-06-20			ENSG00000108813	ENSG00000108813		"""Homeoboxes / ANTP class : NKL subclass"""	2917	protein-coding gene	gene with protein product		601911		DLX7, DLX9			Standard	NM_138281		Approved	DLX8, BP1	uc002ipv.3	Q92988	OTTHUMG00000161839	ENST00000240306.3:c.325C>T	17.37:g.48050478C>T	ENSP00000240306:p.Arg109Cys	Somatic		Capture	Illumina HiSeq	Phase_I	45405477	NM_001934	D3DTX2|D3DTX3|O60480|Q13265|Q6PJK0|Q9HBE0	Missense_Mutation	SNP	ENST00000240306.3	37	CCDS11555.1	.	.	.	.	.	.	.	.	.	.	C	13.45	2.242043	0.39598	.	.	ENSG00000108813	ENST00000240306;ENST00000411890	D;D	0.95724	-2.96;-3.79	4.65	1.36	0.22044	Homeodomain-related (1);Homeodomain-like (1);	.	.	.	.	D	0.93180	0.7828	M	0.76328	2.33	0.09310	N	1	B;B	0.15141	0.012;0.004	B;B	0.10450	0.005;0.002	D	0.87008	0.2121	9	0.72032	D	0.01	-1.378	4.5273	0.11988	0.1943:0.6023:0.0:0.2034	.	37;109	Q92988-2;Q92988	.;DLX4_HUMAN	C	109;37	ENSP00000240306:R109C;ENSP00000410622:R37C	ENSP00000240306:R109C	R	+	1	0	DLX4	45405477	0.173000	0.23056	0.000000	0.03702	0.011000	0.07611	2.384000	0.44362	0.437000	0.26423	0.655000	0.94253	CGC		DLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366214.1		
VMP1	81671	broad.mit.edu	37	17	57812727	57812727	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr17:57812727G>T	ENST00000262291.4	+	3	415	c.105G>T	c.(103-105)agG>agT	p.R35S	VMP1_ENST00000545362.1_Missense_Mutation_p.R35S|VMP1_ENST00000539763.1_Intron|VMP1_ENST00000537567.1_5'UTR|VMP1_ENST00000536180.1_5'UTR	NM_030938.3	NP_112200.2	Q96GC9	VMP1_HUMAN	vacuole membrane protein 1	35					autophagy (GO:0006914)|cell junction assembly (GO:0034329)|embryo implantation (GO:0007566)|regulation of autophagy (GO:0010506)|single organismal cell-cell adhesion (GO:0016337)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|pre-autophagosomal structure (GO:0000407)		p.R35S(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|skin(2)	16						AAAAGAAGAGGAGGGAGCGGG	0.388																																					p.R35S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G105T	17						.						82.0	76.0	78.0					17																	57812727		2203	4300	6503	55167509	SO:0001583	missense	81671	exon3				CCDS11619.1	17q23.1	2014-05-20	2011-03-02	2011-03-02	ENSG00000062716	ENSG00000062716			29559	protein-coding gene	gene with protein product	"""ectopic P-granules autophagy protein 3 homolog (C. elegans)"", ""transport and golgi organization 5 homolog (Drosophila)"""	611753	"""transmembrane protein 49"""	TMEM49		11230166, 11785947	Standard	NM_030938		Approved	EPG3, TANGO5	uc002ixu.4	Q96GC9	OTTHUMG00000179882	ENST00000262291.4:c.105G>T	17.37:g.57812727G>T	ENSP00000262291:p.Arg35Ser	Somatic		Capture	Illumina HiSeq	Phase_I	55167509	NM_030938	B4DVV9|Q9H0P4|Q9P089	Missense_Mutation	SNP	ENST00000262291.4	37	CCDS11619.1	.	.	.	.	.	.	.	.	.	.	G	11.59	1.684381	0.29872	.	.	ENSG00000062716	ENST00000262291;ENST00000545362	.	.	.	5.46	1.1	0.20463	.	0.144593	0.64402	D	0.000005	T	0.29190	0.0726	N	0.19112	0.55	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.03795	-1.1003	9	0.21540	T	0.41	-4.5525	4.9922	0.14220	0.4528:0.1555:0.3917:0.0	.	35;35	F5H2J3;Q96GC9	.;VMP1_HUMAN	S	35	.	ENSP00000262291:R35S	R	+	3	2	VMP1	55167509	1.000000	0.71417	0.993000	0.49108	0.934000	0.57294	2.241000	0.43097	0.350000	0.24002	0.591000	0.81541	AGG		VMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448793.1	NM_030938	
ABCA10	10349	broad.mit.edu	37	17	67149983	67149983	+	Silent	SNP	G	G	A			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr17:67149983G>A	ENST00000269081.4	-	33	4863	c.3954C>T	c.(3952-3954)ctC>ctT	p.L1318L	ABCA10_ENST00000416101.2_3'UTR|ABCA10_ENST00000519732.1_5'UTR	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	1318	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.L1318L(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					GTGAAATACTGAGAGCAGCAT	0.408																																					p.L1318L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3954T	17						.						159.0	166.0	163.0					17																	67149983		2203	4300	6503	64661578	SO:0001819	synonymous_variant	10349	exon33			AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.3954C>T	17.37:g.67149983G>A		Somatic		Capture	Illumina HiSeq	Phase_I	64661578	NM_080282	C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Silent	SNP	ENST00000269081.4	37	CCDS11684.1																																																																																				ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379881.4	NM_080282	
LLGL2	3993	broad.mit.edu	37	17	73565329	73565329	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr17:73565329G>A	ENST00000392550.3	+	14	1621	c.1504G>A	c.(1504-1506)Gac>Aac	p.D502N	LLGL2_ENST00000167462.5_Missense_Mutation_p.D502N|LLGL2_ENST00000577200.1_Missense_Mutation_p.D502N	NM_001031803.1	NP_001026973.1	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 (Drosophila)	502					cell cycle (GO:0007049)|cell division (GO:0051301)|exocytosis (GO:0006887)|regulation of establishment or maintenance of cell polarity (GO:0032878)	cytoplasm (GO:0005737)	PDZ domain binding (GO:0030165)	p.D502N(1)		NS(1)|breast(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			CTACAGTGATGACCCCCGGCT	0.672																																					p.D502N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1504A	17						.						60.0	64.0	63.0					17																	73565329		2203	4300	6503	71076924	SO:0001583	missense	3993	exon14			X87342	CCDS11725.1, CCDS32733.1, CCDS45776.1	17q25.1	2013-01-10	2001-11-28			ENSG00000073350		"""WD repeat domain containing"""	6629	protein-coding gene	gene with protein product			"""lethal giant larvae (Drosophila) homolog 2"""				Standard	XR_243659		Approved	HGL	uc002joh.3	Q6P1M3		ENST00000392550.3:c.1504G>A	17.37:g.73565329G>A	ENSP00000376333:p.Asp502Asn	Somatic		Capture	Illumina HiSeq	Phase_I	71076924	NM_001031803	Q14521|Q9BR62	Missense_Mutation	SNP	ENST00000392550.3	37	CCDS32733.1	.	.	.	.	.	.	.	.	.	.	G	14.19	2.462049	0.43736	.	.	ENSG00000073350	ENST00000167462;ENST00000392550;ENST00000545227	T;T	0.46819	0.86;0.86	5.29	3.29	0.37713	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.69602	0.3129	M	0.85542	2.76	0.58432	D	0.999997	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.997;0.999;1.0;1.0	T	0.73164	-0.4069	10	0.87932	D	0	-14.5691	11.982	0.53125	0.1423:0.0:0.8577:0.0	.	129;491;491;502;502	B4DVR9;B3KX47;G3V1I9;Q6P1M3-2;Q6P1M3	.;.;.;.;L2GL2_HUMAN	N	502;502;491	ENSP00000167462:D502N;ENSP00000376333:D502N	ENSP00000167462:D502N	D	+	1	0	LLGL2	71076924	1.000000	0.71417	0.149000	0.22428	0.990000	0.78478	9.807000	0.99171	0.615000	0.30124	0.555000	0.69702	GAC		LLGL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447633.1	NM_004524	
THOC1	9984	broad.mit.edu	37	18	252542	252542	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr18:252542G>A	ENST00000261600.6	-	9	681	c.674C>T	c.(673-675)aCg>aTg	p.T225M	THOC1_ENST00000582313.1_5'UTR	NM_005131.2	NP_005122.2	Q96FV9	THOC1_HUMAN	THO complex 1	225					apoptotic process (GO:0006915)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of isotype switching to IgA isotypes (GO:0048297)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|regulation of DNA recombination (GO:0000018)|regulation of DNA-templated transcription, elongation (GO:0032784)|replication fork processing (GO:0031297)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	DNA binding (GO:0003677)|RNA binding (GO:0003723)	p.T225M(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	20		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				AACTCACCACGTTGTTGGAGC	0.398																																					p.T225M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C674T	18						.						145.0	136.0	139.0					18																	252542		1867	4102	5969	242542	SO:0001583	missense	9984	exon9			AK055354	CCDS45820.1	18p11.32	2013-02-11			ENSG00000079134	ENSG00000079134		"""THO complex subunits"""	19070	protein-coding gene	gene with protein product		606930				11979277	Standard	NM_005131		Approved	P84, HPR1	uc002kkj.4	Q96FV9		ENST00000261600.6:c.674C>T	18.37:g.252542G>A	ENSP00000261600:p.Thr225Met	Somatic		Capture	Illumina HiSeq	Phase_I	242542	NM_005131	B2RBP6|Q15219|Q64I72|Q64I73	Missense_Mutation	SNP	ENST00000261600.6	37	CCDS45820.1	.	.	.	.	.	.	.	.	.	.	G	16.48	3.136087	0.56936	.	.	ENSG00000079134	ENST00000261600	.	.	.	5.44	3.55	0.40652	.	0.221642	0.45606	D	0.000356	T	0.51126	0.1656	M	0.67397	2.05	0.34241	D	0.677694	P;P	0.48407	0.851;0.91	B;P	0.45037	0.429;0.467	T	0.65249	-0.6214	9	0.49607	T	0.09	.	8.8745	0.35337	0.0:0.3448:0.5317:0.1236	.	225;225	Q96FV9-2;Q96FV9	.;THOC1_HUMAN	M	225	.	ENSP00000261600:T225M	T	-	2	0	THOC1	242542	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	2.490000	0.45294	2.714000	0.92807	0.650000	0.86243	ACG		THOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440348.5	NM_005131	
RALBP1	10928	broad.mit.edu	37	18	9524700	9524700	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr18:9524700A>C	ENST00000019317.4	+	5	1385	c.1162A>C	c.(1162-1164)Atg>Ctg	p.M388L	RALBP1_ENST00000383432.3_Missense_Mutation_p.M388L			Q15311	RBP1_HUMAN	ralA binding protein 1	388					ATP catabolic process (GO:0006200)|chemotaxis (GO:0006935)|positive regulation of Cdc42 GTPase activity (GO:0043089)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|transport (GO:0006810)	cytosol (GO:0005829)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ATPase activity, coupled to movement of substances (GO:0043492)|GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)	p.M388L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(3)|upper_aerodigestive_tract(1)	14					Carbamazepine(DB00564)|Doxorubicin(DB00997)|Sorafenib(DB00398)|Vincristine(DB00541)	CATGGCCACGATGCCCACGCT	0.532																																					p.M388L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1162C	18						.						53.0	46.0	48.0					18																	9524700		2203	4300	6503	9514700	SO:0001583	missense	10928	exon5			L42542	CCDS11845.1	18p11.22	2006-04-22			ENSG00000017797	ENSG00000017797			9841	protein-coding gene	gene with protein product		605801				7673236	Standard	NM_006788		Approved	RLIP76, RIP1, RIP	uc002koc.3	Q15311	OTTHUMG00000131596	ENST00000019317.4:c.1162A>C	18.37:g.9524700A>C	ENSP00000019317:p.Met388Leu	Somatic		Capture	Illumina HiSeq	Phase_I	9514700	NM_006788	D3DUI0	Missense_Mutation	SNP	ENST00000019317.4	37	CCDS11845.1	.	.	.	.	.	.	.	.	.	.	A	16.18	3.051620	0.55218	.	.	ENSG00000017797	ENST00000019317;ENST00000383432	T;T	0.09630	2.96;2.96	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.10766	0.0263	L	0.34521	1.04	0.54753	D	0.999985	B	0.18968	0.032	B	0.23419	0.046	T	0.16394	-1.0404	10	0.23891	T	0.37	0.2236	15.9209	0.79570	1.0:0.0:0.0:0.0	.	388	Q15311	RBP1_HUMAN	L	388	ENSP00000019317:M388L;ENSP00000372924:M388L	ENSP00000019317:M388L	M	+	1	0	RALBP1	9514700	1.000000	0.71417	0.943000	0.38184	0.988000	0.76386	9.109000	0.94291	2.210000	0.71456	0.533000	0.62120	ATG		RALBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254479.1	NM_006788	
SHC2	25759	broad.mit.edu	37	19	434833	434834	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr19:434833_434834insC	ENST00000264554.6	-	8	984_985	c.985_986insG	c.(985-987)gacfs	p.D329fs		NM_012435.2	NP_036567.2	P98077	SHC2_HUMAN	SHC (Src homology 2 domain containing) transforming protein 2	329	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				activation of MAPK activity (GO:0000187)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)	cytosol (GO:0005829)		p.D690fs*107(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	21		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCCTCCTCGTCCCCCCAGGCC	0.663																																					p.D329fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.986_987insG	19						.																																			385834	SO:0001589	frameshift_variant	25759	exon8			AB001451	CCDS45891.1	19p13.3	2013-02-14				ENSG00000129946		"""SH2 domain containing"""	29869	protein-coding gene	gene with protein product	"""neuronal Shc adaptor homolog"""	605217				7527937, 9507002	Standard	NM_012435		Approved	SLI, SCK, SHCB	uc002loq.4	P98077		ENST00000264554.6:c.986dupG	19.37:g.434839_434839dupC	ENSP00000264554:p.Asp329fs	Somatic		Capture	Illumina HiSeq	Phase_I	385833	NM_012435	O60230|Q9NPL5|Q9UCX4	Frame_Shift_Ins	INS	ENST00000264554.6	37	CCDS45891.1																																																																																				SHC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451840.3		
SEMA6B	10501	broad.mit.edu	37	19	4554434	4554434	+	Missense_Mutation	SNP	C	C	T	rs370318420		TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr19:4554434C>T	ENST00000586582.1	-	9	1047	c.737G>A	c.(736-738)cGg>cAg	p.R246Q	SEMA6B_ENST00000586965.1_Missense_Mutation_p.R246Q|SEMA6B_ENST00000301293.3_Missense_Mutation_p.R246Q	NM_032108.3	NP_115484.2	Q9H3T3	SEM6B_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B	246	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.R246Q(1)		breast(1)|central_nervous_system(2)|large_intestine(4)|lung(11)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		CGCAATCTCCCGGAAGAAGAA	0.562																																					p.R246Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G737A	19						.		GLN/ARG	0,4406		0,0,2203	87.0	75.0	79.0		737	3.8	1.0	19		79	1,8597		0,1,4298	no	missense	SEMA6B	NM_032108.3	43	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	246/889	4554434	1,13003	2203	4299	6502	4505434	SO:0001583	missense	10501	exon9			AB022433	CCDS12131.1	19p13.3	2008-07-22				ENSG00000167680		"""Semaphorins"""	10739	protein-coding gene	gene with protein product	"""Sema VIb"", ""semaphorin Z"", ""semaphorin VIB"""	608873		SEMAN		9361278	Standard	NM_032108		Approved	semaZ, SEMA-VIB, SEM-SEMA-Y	uc010dud.2	Q9H3T3		ENST00000586582.1:c.737G>A	19.37:g.4554434C>T	ENSP00000467290:p.Arg246Gln	Somatic		Capture	Illumina HiSeq	Phase_I	4505434	NM_032108	A5PKU4|F6IB19|Q9NRK9	Missense_Mutation	SNP	ENST00000586582.1	37	CCDS12131.1	.	.	.	.	.	.	.	.	.	.	.	26.9	4.785328	0.90282	0.0	1.16E-4	ENSG00000167680	ENST00000301293;ENST00000301292	T	0.12569	2.67	3.77	3.77	0.43336	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	U	0.000000	T	0.48840	0.1522	H	0.95539	3.685	0.37960	D	0.932958	D;D	0.89917	0.999;1.0	P;D	0.97110	0.888;1.0	T	0.69300	-0.5181	10	0.66056	D	0.02	.	14.3189	0.66470	0.0:1.0:0.0:0.0	.	246;246	B4DT36;Q9H3T3	.;SEM6B_HUMAN	Q	246	ENSP00000301293:R246Q	ENSP00000301292:R246Q	R	-	2	0	SEMA6B	4505434	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	7.487000	0.81328	1.956000	0.56807	0.298000	0.19748	CGG		SEMA6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458656.2	NM_032108	
CASP14	23581	broad.mit.edu	37	19	15163075	15163075	+	Missense_Mutation	SNP	C	C	T	rs77227419	byFrequency	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr19:15163075C>T	ENST00000427043.3	+	2	321	c.13C>T	c.(13-15)Cgg>Tgg	p.R5W	AC004699.1_ENST00000411269.1_RNA|CASP14_ENST00000221740.1_Missense_Mutation_p.R5W	NM_012114.2	NP_036246.1	P31944	CASPE_HUMAN	caspase 14, apoptosis-related cysteine peptidase	5					cornification (GO:0070268)|epidermis development (GO:0008544)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinization (GO:0031424)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)	p.R5W(2)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(3)	26						GAGCAATCCGCGGTCTTTGGA	0.502													C|||	9	0.00179712	0.0068	0.0	5008	,	,		16614	0.0		0.0	False		,,,				2504	0.0				p.R5W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C13T	19						.	C	TRP/ARG	17,4389		0,17,2186	89.0	74.0	79.0		13	-0.8	0.0	19	dbSNP_131	79	0,8600		0,0,4300	yes	missense	CASP14	NM_012114.2	101	0,17,6486	TT,TC,CC		0.0,0.3858,0.1307	probably-damaging	5/243	15163075	17,12989	2203	4300	6503	15024075	SO:0001583	missense	23581	exon2				CCDS12323.1	19p13.1	2008-07-16	2005-08-17			ENSG00000105141			1502	protein-coding gene	gene with protein product	"""apoptosis-related cysteine protease"""	605848	"""caspase 14, apoptosis-related cysteine protease"""			10203698, 9792675	Standard	NM_012114		Approved	MICE, MGC119078, MGC119079	uc010dzv.2	P31944		ENST00000427043.3:c.13C>T	19.37:g.15163075C>T	ENSP00000393417:p.Arg5Trp	Somatic		Capture	Illumina HiSeq	Phase_I	15024075	NM_012114	O95823|Q3SYC9	Missense_Mutation	SNP	ENST00000427043.3	37	CCDS12323.1	5	0.0022893772893772895	5	0.01016260162601626	0	0.0	0	0.0	0	0.0	.	11.21	1.572012	0.28092	0.003858	0.0	ENSG00000105141	ENST00000427043;ENST00000221740	T;T	0.02944	4.1;4.1	4.2	-0.76	0.11041	.	4.671220	0.00166	N	0.000014	T	0.01124	0.0037	N	0.08118	0	0.09310	N	1	D	0.56968	0.978	B	0.38106	0.265	T	0.29212	-1.0019	10	0.59425	D	0.04	.	1.9888	0.03442	0.3634:0.3547:0.1773:0.1047	.	5	P31944	CASPE_HUMAN	W	5	ENSP00000393417:R5W;ENSP00000221740:R5W	ENSP00000221740:R5W	R	+	1	2	CASP14	15024075	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.245000	0.18142	0.082000	0.17018	0.491000	0.48974	CGG		CASP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465663.1	NM_012114	
ARHGEF18	23370	broad.mit.edu	37	19	7511947	7511947	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr19:7511947G>A	ENST00000359920.6	+	5	1319	c.1066G>A	c.(1066-1068)Gag>Aag	p.E356K	CTD-2207O23.3_ENST00000593531.1_Silent_p.G313G|ARHGEF18_ENST00000319670.9_Missense_Mutation_p.E198K	NM_001130955.1	NP_001124427.1	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 18	356	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transforming growth factor beta receptor signaling pathway (GO:0007179)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.E198K(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	23		Renal(5;0.0902)				TGAAAATGGGGAGAGAATGAA	0.353																																					p.E198K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G592A	19						.						81.0	79.0	79.0					19																	7511947		2203	4300	6503	7417947	SO:0001583	missense	23370	exon6			AK074372	CCDS12177.1, CCDS45946.1	19p13.3	2013-01-10	2009-06-12			ENSG00000104880		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	17090	protein-coding gene	gene with protein product	"""Rho-specific guanine nucleotide exchange factor p114"""		"""rho/rac guanine nucleotide exchange factor (GEF) 18"""			9628581, 11318610	Standard	NM_015318		Approved	P114-RhoGEF, KIAA0521, MGC15913	uc002mgi.3	Q6ZSZ5		ENST00000359920.6:c.1066G>A	19.37:g.7511947G>A	ENSP00000352995:p.Glu356Lys	Somatic		Capture	Illumina HiSeq	Phase_I	7417947	NM_015318	A8MV62|B5ME81|O60274|Q6DD92	Missense_Mutation	SNP	ENST00000359920.6	37	CCDS45946.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.425360	0.83667	.	.	ENSG00000104880	ENST00000319670;ENST00000359920	T;T	0.68903	-0.36;-0.36	4.85	4.85	0.62838	Dbl homology (DH) domain (5);	0.105878	0.41097	D	0.000953	T	0.75895	0.3912	M	0.90650	3.135	0.58432	D	0.999999	P	0.40602	0.723	B	0.42625	0.393	T	0.81940	-0.0703	10	0.62326	D	0.03	-18.7463	15.4853	0.75560	0.0:0.0:1.0:0.0	.	356	Q6ZSZ5	ARHGI_HUMAN	K	198;356	ENSP00000319200:E198K;ENSP00000352995:E356K	ENSP00000319200:E198K	E	+	1	0	ARHGEF18	7417947	1.000000	0.71417	0.984000	0.44739	0.838000	0.47535	7.878000	0.87231	2.235000	0.73313	0.561000	0.74099	GAG		ARHGEF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000436340.1	NM_015318	
SIGLEC12	89858	broad.mit.edu	37	19	52003321	52003321	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr19:52003321G>T	ENST00000291707.3	-	2	716	c.661C>A	c.(661-663)Ctc>Atc	p.L221I	SIGLEC12_ENST00000598614.1_Missense_Mutation_p.L103I	NM_053003.2	NP_443729.1	Q96PQ1	SIG12_HUMAN	sialic acid binding Ig-like lectin 12 (gene/pseudogene)	221	Ig-like V-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.L221I(1)		NS(2)|biliary_tract(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(1)|lung(23)|ovary(4)|prostate(2)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)	61		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		CCAAGGAGGAGGAATCGACCG	0.542																																					p.L103I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C307A	19						.						131.0	120.0	124.0					19																	52003321		2203	4300	6503	56695133	SO:0001583	missense	89858	exon1			AF282256	CCDS12833.1, CCDS59416.1	19q13.41	2013-01-29	2011-06-29	2004-10-20	ENSG00000254521	ENSG00000254521		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15482	protein-coding gene	gene with protein product		606094	"""SIGLEC-like 1"", ""sialic acid binding Ig-like lectin 12"""	SIGLECL1		11409877, 11328818, 21555517	Standard	NM_053003		Approved	SLG, S2V, Siglec-XII, Siglec-12, Siglec-L1	uc002pwx.1	Q96PQ1	OTTHUMG00000165524	ENST00000291707.3:c.661C>A	19.37:g.52003321G>T	ENSP00000291707:p.Leu221Ile	Somatic		Capture	Illumina HiSeq	Phase_I	56695133	NM_033329	Q8IYH7	Missense_Mutation	SNP	ENST00000291707.3	37	CCDS12833.1	.	.	.	.	.	.	.	.	.	.	.	1.228	-0.624914	0.03636	.	.	ENSG00000254521	ENST00000291707	T	0.64803	-0.12	0.735	-0.466	0.12153	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	1.117400	0.07015	U	0.825818	T	0.44307	0.1287	N	0.02916	-0.46	0.09310	N	1	D;B	0.58268	0.982;0.391	P;B	0.55871	0.786;0.257	T	0.31861	-0.9928	10	0.23302	T	0.38	.	3.1203	0.06388	0.3517:0.0:0.6483:0.0	.	221;103	Q96PQ1;Q96PQ1-2	SIG12_HUMAN;.	I	221	ENSP00000291707:L221I	ENSP00000291707:L221I	L	-	1	0	SIGLEC12	56695133	0.003000	0.15002	0.003000	0.11579	0.015000	0.08874	-0.444000	0.06854	-0.121000	0.11787	0.399000	0.26434	CTC		SIGLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384641.2	NM_053003	
SYPL2	284612	broad.mit.edu	37	1	110018224	110018224	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr1:110018224G>A	ENST00000369872.3	+	3	367	c.151G>A	c.(151-153)Ggg>Agg	p.G51R	SYPL2_ENST00000401021.3_Missense_Mutation_p.G51R|SYPL2_ENST00000475497.1_3'UTR	NM_001040709.1	NP_001035799.1	Q5VXT5	SYPL2_HUMAN	synaptophysin-like 2	51	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cellular calcium ion homeostasis (GO:0006874)|substantia nigra development (GO:0021762)	integral component of synaptic vesicle membrane (GO:0030285)	transporter activity (GO:0005215)	p.G51R(1)		breast(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	16		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Colorectal(144;0.0129)|Lung(183;0.0436)|READ - Rectum adenocarcinoma(129;0.0698)|Epithelial(280;0.0808)|all cancers(265;0.0869)|LUSC - Lung squamous cell carcinoma(189;0.231)		TTTCGCCTTCGGGTCCTGTGG	0.542																																					p.G51R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G151A	1						.						62.0	67.0	65.0					1																	110018224		1963	4145	6108	109819747	SO:0001583	missense	284612	exon3			AK131459	CCDS41365.1	1p13.3	2008-02-05			ENSG00000143028	ENSG00000143028			27638	protein-coding gene	gene with protein product	"""mitsugumin-29"""					12975309	Standard	NM_001040709		Approved	Mg29	uc001dxp.3	Q5VXT5	OTTHUMG00000010969	ENST00000369872.3:c.151G>A	1.37:g.110018224G>A	ENSP00000358888:p.Gly51Arg	Somatic		Capture	Illumina HiSeq	Phase_I	109819747	NM_001040709	A8K0E8|A8KAL7|I0IT67|Q6ZMX1	Missense_Mutation	SNP	ENST00000369872.3	37	CCDS41365.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.879282	0.91740	.	.	ENSG00000143028	ENST00000401021;ENST00000369872	T;T	0.34472	1.36;1.36	5.87	5.87	0.94306	Marvel (1);MARVEL-like domain (1);	0.048597	0.85682	D	0.000000	T	0.49983	0.1589	L	0.52573	1.65	0.52099	D	0.999942	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77557	0.99;0.979;0.975	T	0.48328	-0.9045	10	0.87932	D	0	.	18.9775	0.92743	0.0:0.0:1.0:0.0	.	51;51;51	B4DYR7;Q5VXT5;Q5VXT5-2	.;SYPL2_HUMAN;.	R	51	ENSP00000383805:G51R;ENSP00000358888:G51R	ENSP00000358888:G51R	G	+	1	0	SYPL2	109819747	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.119000	0.77145	2.785000	0.95823	0.655000	0.94253	GGG		SYPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030191.1	NM_001006603	
MAN1A2	10905	broad.mit.edu	37	1	117944820	117944820	+	Silent	SNP	A	A	G			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr1:117944820A>G	ENST00000356554.3	+	2	1050	c.315A>G	c.(313-315)gaA>gaG	p.E105E	MAN1A2_ENST00000482811.1_Intron	NM_006699.3	NP_006690.1	O60476	MA1A2_HUMAN	mannosidase, alpha, class 1A, member 2	105					cellular protein metabolic process (GO:0044267)|lung alveolus development (GO:0048286)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.E105E(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	27	Lung SC(450;0.225)	all_cancers(81;7.9e-06)|all_epithelial(167;7.39e-07)|all_lung(203;2.84e-06)|Lung NSC(69;1.99e-05)		Lung(183;0.0688)|Kidney(133;0.114)|LUSC - Lung squamous cell carcinoma(189;0.223)|KIRC - Kidney renal clear cell carcinoma(1967;0.237)|Colorectal(144;0.243)		AAGAGGAAGAACGTCTGAGAA	0.348																																					p.E105E	Ovarian(33;199 881 8228 13687 31538)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A315G	1						.						59.0	63.0	62.0					1																	117944820		2200	4299	6499	117746343	SO:0001819	synonymous_variant	10905	exon2			AF027156	CCDS895.1	1p13	2008-02-05			ENSG00000198162	ENSG00000198162			6822	protein-coding gene	gene with protein product		604345				9592125	Standard	NM_006699		Approved	MAN1B	uc001ehd.1	O60476	OTTHUMG00000012149	ENST00000356554.3:c.315A>G	1.37:g.117944820A>G		Somatic		Capture	Illumina HiSeq	Phase_I	117746343	NM_006699	Q9H510	Silent	SNP	ENST00000356554.3	37	CCDS895.1																																																																																				MAN1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033593.1	NM_006699	
FCGR3A	2214	broad.mit.edu	37	1	161569551	161569551	+	Intron	SNP	C	C	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr1:161569551C>T	ENST00000540048.1	-	2	94				FCGR2C_ENST00000543859.1_RNA|FCGR2B_ENST00000367960.5_Intron|FCGR2B_ENST00000403078.3_Intron|FCGR2C_ENST00000466542.2_RNA|FCGR2B_ENST00000367962.4_Intron|RP11-25K21.6_ENST00000537821.2_RNA|FCGR2B_ENST00000428605.2_Intron			P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor (CD16a)						Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	AAAACATCTACCTGACTCTTC	0.453																																					p.Y310Y												.	.	0			c.C930T	1						.						54.0	54.0	54.0					1																	161569551		2190	4293	6483	159836175	SO:0001627	intron_variant	9103	exon7			BC036723	CCDS1232.1, CCDS44266.1	1q23	2014-09-17	2005-02-02		ENSG00000203747	ENSG00000203747		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3619	protein-coding gene	gene with protein product		146740	"""Fc fragment of IgG, low affinity IIIa, receptor for (CD16)"""	FCGR3, FCG3		2139735	Standard	NM_001127592		Approved	CD16, CD16a	uc001gar.3	P08637	OTTHUMG00000034466	ENST00000540048.1:c.61+30606G>A	1.37:g.161569551C>T		Somatic		Capture	Illumina HiSeq	Phase_I	159836175	NM_201563	A2N6W9|Q53FJ0|Q53FL6|Q5EBR4|Q65ZM6|Q6PIJ0	Silent	SNP	ENST00000540048.1	37																																																																																					FCGR3A-203	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_000569	
MACF1	23499	broad.mit.edu	37	1	39823509	39823509	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr1:39823509T>G	ENST00000372915.3	+	44	11989	c.11902T>G	c.(11902-11904)Tta>Gta	p.L3968V	MACF1_ENST00000539005.1_Missense_Mutation_p.L1901V|MACF1_ENST00000564288.1_Missense_Mutation_p.L3963V|MACF1_ENST00000567887.1_Missense_Mutation_p.L4000V|MACF1_ENST00000545844.1_Missense_Mutation_p.L1901V|MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000289893.4_Missense_Mutation_p.L2403V|MACF1_ENST00000317713.7_Missense_Mutation_p.L1901V|MACF1_ENST00000361689.2_Missense_Mutation_p.L1901V			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	3968					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.L2403V(1)|p.L1901V(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AATTGGAAACTTAGTAAAGGA	0.428																																					p.L1901V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T5701G	1						.						74.0	70.0	71.0					1																	39823509		2203	4300	6503	39596096	SO:0001583	missense	23499	exon41			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.11902T>G	1.37:g.39823509T>G	ENSP00000362006:p.Leu3968Val	Somatic		Capture	Illumina HiSeq	Phase_I	39596096	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.20|11.20	1.569278|1.569278	0.28003|0.28003	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000372925|ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893	.|T;T;T;T;T;T	.|0.34472	.|1.36;1.36;1.36;1.36;1.36;1.36	6.07|6.07	2.48|2.48	0.30137|0.30137	.|.	0.283763|0.283763	0.25055|0.25055	N|N	0.033500|0.033500	T|T	0.19765|0.19765	0.0475|0.0475	L|L	0.35723|0.35723	1.085|1.085	0.80722|0.80722	D|D	1|1	.|B;B;B;B	.|0.33212	.|0.402;0.04;0.009;0.003	.|B;B;B;B	.|0.36335	.|0.222;0.051;0.026;0.029	T|T	0.19745|0.19745	-1.0296|-1.0296	6|10	.|0.02654	.|T	.|1	.|.	1.8268|1.8268	0.03122|0.03122	0.1351:0.1467:0.1407:0.5775|0.1351:0.1467:0.1407:0.5775	.|.	.|3968;1901;1901;1866	.|Q9UPN3;F8W8Q1;Q9UPN3-2;Q9UPN3-3	.|MACF1_HUMAN;.;.;.	R|V	1034|1901;3968;1901;1901;1901;2403	.|ENSP00000439537:L1901V;ENSP00000362006:L3968V;ENSP00000354573:L1901V;ENSP00000313438:L1901V;ENSP00000444364:L1901V;ENSP00000289893:L2403V	.|ENSP00000289893:L2403V	L|L	+|+	2|1	0|2	MACF1|MACF1	39596096|39596096	0.522000|0.522000	0.26266|0.26266	0.996000|0.996000	0.52242|0.52242	0.987000|0.987000	0.75469|0.75469	1.003000|1.003000	0.29809|0.29809	0.508000|0.508000	0.28173|0.28173	0.533000|0.533000	0.62120|0.62120	CTT|TTA		MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
GBP5	115362	broad.mit.edu	37	1	89726432	89726432	+	Silent	SNP	G	G	A			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr1:89726432G>A	ENST00000370459.3	-	11	1843	c.1716C>T	c.(1714-1716)caC>caT	p.H572H	GBP5_ENST00000471171.1_5'UTR|GBP5_ENST00000343435.5_Silent_p.H572H|RP4-620F22.2_ENST00000437128.1_RNA			Q96PP8	GBP5_HUMAN	guanylate binding protein 5	572	Required for tetramerization. {ECO:0000250}.					cytoplasm (GO:0005737)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)	p.H572H(1)		breast(1)|endometrium(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)	24				all cancers(265;0.00784)|Epithelial(280;0.0286)		TCCTCTGGGCGTGCTGGAGCT	0.408																																					p.H572H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1716T	1						.						203.0	185.0	191.0					1																	89726432		2203	4300	6503	89499020	SO:0001819	synonymous_variant	115362	exon11			AF430642	CCDS722.1	1p22.2	2008-02-05			ENSG00000154451	ENSG00000154451			19895	protein-coding gene	gene with protein product		611467					Standard	NM_052942		Approved		uc001dnd.3	Q96PP8	OTTHUMG00000010006	ENST00000370459.3:c.1716C>T	1.37:g.89726432G>A		Somatic		Capture	Illumina HiSeq	Phase_I	89499020	NM_001134486	B2RCE1|Q86TM5	Silent	SNP	ENST00000370459.3	37	CCDS722.1																																																																																				GBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027700.1	NM_052942	
ZNF326	284695	broad.mit.edu	37	1	90473060	90473060	+	Silent	SNP	C	C	T	rs142094932		TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr1:90473060C>T	ENST00000340281.4	+	5	509	c.366C>T	c.(364-366)ttC>ttT	p.F122F	ZNF326_ENST00000455342.2_Intron|ZNF326_ENST00000370447.3_Intron	NM_182976.2	NP_892021.1	Q5BKZ1	ZN326_HUMAN	zinc finger protein 326	122	Gly-rich.|Mediates transcriptional activation. {ECO:0000250}.				mRNA processing (GO:0006397)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, elongation (GO:0032784)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	DBIRD complex (GO:0044609)|nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)|zinc ion binding (GO:0008270)	p.F122F(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(7)|ovary(1)	25		all_lung(203;0.0116)|Lung NSC(277;0.0417)		all cancers(265;0.00728)|Epithelial(280;0.0265)		TTGACTCTTTCGGAGGTAGAA	0.493																																					p.F122F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C366T	1						.	C		1,4405	2.1+/-5.4	0,1,2202	140.0	150.0	147.0		366	4.9	1.0	1	dbSNP_134	147	0,8600		0,0,4300	no	coding-synonymous	ZNF326	NM_182976.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		122/583	90473060	1,13005	2203	4300	6503	90245648	SO:0001819	synonymous_variant	284695	exon5			BC013102	CCDS727.1, CCDS728.1	1p22	2012-04-19			ENSG00000162664	ENSG00000162664		"""Zinc fingers, C2H2-type"""	14104	protein-coding gene	gene with protein product	"""ZNF-protein interacting with nuclear mRNPs and DBC1"""	614601				22446626	Standard	NM_182976		Approved	Zfp326, ZAN75, FLJ20403, ZIRD	uc001dnq.2	Q5BKZ1	OTTHUMG00000010675	ENST00000340281.4:c.366C>T	1.37:g.90473060C>T		Somatic		Capture	Illumina HiSeq	Phase_I	90245648	NM_182976	A8MYX1|B4DLN0|B4E179|Q5VW93|Q5VW94|Q5VW96|Q5VW97|Q6NSA2|Q7Z638|Q7Z6C2	Silent	SNP	ENST00000340281.4	37	CCDS727.1																																																																																				ZNF326-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029428.2	NM_181781	
BRDT	676	broad.mit.edu	37	1	92442915	92442915	+	Missense_Mutation	SNP	G	G	A	rs142308966		TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr1:92442915G>A	ENST00000362005.3	+	7	1352	c.934G>A	c.(934-936)Gtt>Att	p.V312I	BRDT_ENST00000394530.3_Missense_Mutation_p.V266I|BRDT_ENST00000370389.2_Missense_Mutation_p.V239I|BRDT_ENST00000399546.2_Missense_Mutation_p.V312I|BRDT_ENST00000402388.1_Missense_Mutation_p.V312I|BRDT_ENST00000484781.1_3'UTR	NM_001242805.1	NP_001229734	Q58F21	BRDT_HUMAN	bromodomain, testis-specific	312	Bromo 2. {ECO:0000255|PROSITE- ProRule:PRU00035}.				cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|histone displacement (GO:0001207)|male meiosis (GO:0007140)|male meiosis I (GO:0007141)|mRNA processing (GO:0006397)|positive regulation of transcription during meiosis (GO:0051039)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|transcription coactivator activity (GO:0003713)	p.V312I(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(24)|ovary(1)|prostate(4)|skin(2)|stomach(2)|urinary_tract(2)	56		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		CTACTATGACGTTGTCAAAAA	0.323																																					p.V312I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G934A	1						.						68.0	70.0	69.0					1																	92442915		2203	4294	6497	92215503	SO:0001583	missense	676	exon6			AF019085	CCDS735.1, CCDS55615.1, CCDS55616.1, CCDS72820.1	1p22.1	2010-12-23			ENSG00000137948	ENSG00000137948			1105	protein-coding gene	gene with protein product	"""cancer/testis antigen 9"""	602144				9367677	Standard	NM_001726		Approved	BRD6, CT9	uc010osz.2	Q58F21	OTTHUMG00000010113	ENST00000362005.3:c.934G>A	1.37:g.92442915G>A	ENSP00000354568:p.Val312Ile	Somatic		Capture	Illumina HiSeq	Phase_I	92215503	NM_207189	A6NF68|B7Z811|B7Z890|B7ZAX7|D3DT32|O14789|Q05DQ4|Q6P5T1|Q7Z4A6|Q8IWI6	Missense_Mutation	SNP	ENST00000362005.3	37	CCDS735.1	.	.	.	.	.	.	.	.	.	.	A	2.047	-0.418568	0.04766	.	.	ENSG00000137948	ENST00000362005;ENST00000370389;ENST00000399546;ENST00000539070;ENST00000394530;ENST00000426141;ENST00000402388	T;T;T;T;T;T	0.26810	1.71;1.71;1.71;1.71;1.71;1.71	5.88	-0.779	0.10973	Bromodomain (5);Bromodomain, conserved site (1);	0.641330	0.15262	N	0.271734	T	0.02230	0.0069	N	0.02765	-0.5	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.45220	-0.9276	10	0.02654	T	1	-2.2149	13.4445	0.61134	0.4227:0.0:0.5773:0.0	.	266;266;316;312	B7ZAX7;B7Z811;B7Z890;Q58F21	.;.;.;BRDT_HUMAN	I	312;239;312;312;266;312;312	ENSP00000354568:V312I;ENSP00000359416:V239I;ENSP00000387822:V312I;ENSP00000378038:V266I;ENSP00000404969:V312I;ENSP00000384051:V312I	ENSP00000354568:V312I	V	+	1	0	BRDT	92215503	0.920000	0.31207	0.015000	0.15790	0.920000	0.55202	1.123000	0.31308	-0.349000	0.08274	-0.972000	0.02603	GTT		BRDT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027980.2	NM_207189	
KIAA1804	84451	broad.mit.edu	37	1	233497907	233497907	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr1:233497907G>A	ENST00000366624.3	+	5	1681	c.1420G>A	c.(1420-1422)Gtg>Atg	p.V474M	MLK4_ENST00000366623.3_Missense_Mutation_p.V474M	NM_032435.2	NP_115811.2												p.V474M(2)									CGAGATCGACGTGCTGGAGCG	0.542																																					p.V474M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1420A	1						.						59.0	58.0	58.0					1																	233497907		2203	4300	6503	231564530	SO:0001583	missense	84451	exon5																														ENST00000366624.3:c.1420G>A	1.37:g.233497907G>A	ENSP00000355583:p.Val474Met	Somatic		Capture	Illumina HiSeq	Phase_I	231564530	NM_032435		Missense_Mutation	SNP	ENST00000366624.3	37	CCDS1598.1	.	.	.	.	.	.	.	.	.	.	G	18.89	3.720169	0.68844	.	.	ENSG00000143674	ENST00000366623;ENST00000366624	T;T	0.76060	-0.87;-0.99	4.88	4.88	0.63580	.	0.000000	0.64402	D	0.000002	T	0.81093	0.4751	M	0.65975	2.015	0.80722	D	1	D;D	0.63880	0.975;0.993	P;P	0.61003	0.636;0.882	T	0.79482	-0.1785	10	0.35671	T	0.21	.	11.6727	0.51411	0.0808:0.0:0.9192:0.0	.	474;474	Q5TCX8;Q5TCX8-2	M3KL4_HUMAN;.	M	474	ENSP00000355582:V474M;ENSP00000355583:V474M	ENSP00000355582:V474M	V	+	1	0	RP5-862P8.2	231564530	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.610000	0.74178	2.525000	0.85131	0.655000	0.94253	GTG		MLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092495.1		
SSTR4	6754	broad.mit.edu	37	20	23016359	23016359	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr20:23016359C>T	ENST00000255008.3	+	1	303	c.239C>T	c.(238-240)aCg>aTg	p.T80M	RP4-753D10.3_ENST00000440921.1_RNA	NM_001052.2	NP_001043.2	P31391	SSR4_HUMAN	somatostatin receptor 4	80					arachidonic acid metabolic process (GO:0019369)|cell migration (GO:0016477)|cellular response to glucocorticoid stimulus (GO:0071385)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|negative regulation of cell proliferation (GO:0008285)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)	p.T80M(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	32	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)					AAGATGAAGACGGCTACCAAC	0.632																																					p.T80M	Esophageal Squamous(15;850 1104 16640)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C239T	20						.						128.0	135.0	133.0					20																	23016359		2203	4300	6503	22964359	SO:0001583	missense	6754	exon1				CCDS42856.1	20p11.21	2014-07-11			ENSG00000132671	ENSG00000132671		"""GPCR / Class A : Somatostatin receptors"""	11333	protein-coding gene	gene with protein product		182454				8483934	Standard	NM_001052		Approved		uc002wsr.2	P31391	OTTHUMG00000032054	ENST00000255008.3:c.239C>T	20.37:g.23016359C>T	ENSP00000255008:p.Thr80Met	Somatic		Capture	Illumina HiSeq	Phase_I	22964359	NM_001052	Q17RM1|Q17RM3|Q9UIY1	Missense_Mutation	SNP	ENST00000255008.3	37	CCDS42856.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.223631	0.79576	.	.	ENSG00000132671	ENST00000255008	T	0.46819	0.86	3.58	3.58	0.41010	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	U	0.000005	T	0.74222	0.3688	M	0.92970	3.365	0.58432	D	0.999995	D	0.89917	1.0	D	0.79784	0.993	T	0.82368	-0.0492	10	0.87932	D	0	.	14.3291	0.66541	0.0:1.0:0.0:0.0	.	80	P31391	SSR4_HUMAN	M	80	ENSP00000255008:T80M	ENSP00000255008:T80M	T	+	2	0	SSTR4	22964359	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	5.256000	0.65468	1.811000	0.52892	0.561000	0.74099	ACG		SSTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078308.1		
TBC1D8	11138	broad.mit.edu	37	2	101654162	101654162	+	Silent	SNP	G	G	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr2:101654162G>T	ENST00000376840.4	-	8	1238	c.1239C>A	c.(1237-1239)ctC>ctA	p.L413L	TBC1D8_ENST00000409318.1_Silent_p.L428L			O95759	TBCD8_HUMAN	TBC1 domain family, member 8 (with GRAM domain)	413					blood circulation (GO:0008015)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)	p.L428L(1)|p.L413L(1)		breast(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	32						AATGAAACACGAGTGAAGCCT	0.468																																					p.L413L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1239A	2						.						96.0	98.0	97.0					2																	101654162		1990	4178	6168	101020594	SO:0001819	synonymous_variant	11138	exon8			AB024057	CCDS46375.1	2q12.1	2011-11-30			ENSG00000204634	ENSG00000204634			17791	protein-coding gene	gene with protein product	"""BUB2-like protein 1"", ""vascular Rab-GAP/TBC-containing protein"""					10373574	Standard	NM_001102426		Approved	HBLP1, VRP, AD3	uc010fiv.3	O95759	OTTHUMG00000153040	ENST00000376840.4:c.1239C>A	2.37:g.101654162G>T		Somatic		Capture	Illumina HiSeq	Phase_I	101020594	NM_001102426	A6NDL4|A8K9W1|B9A6K4|Q53SQ4|Q9UQ32	Silent	SNP	ENST00000376840.4	37	CCDS46375.1																																																																																				TBC1D8-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376092.1	NM_007063	
HOXD12	3238	broad.mit.edu	37	2	176965450	176965450	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr2:176965450C>T	ENST00000406506.2	+	2	847	c.775C>T	c.(775-777)Cgc>Tgc	p.R259C	HOXD12_ENST00000404162.2_3'UTR			P35452	HXD12_HUMAN	homeobox D12	259					embryonic digit morphogenesis (GO:0042733)|pattern specification process (GO:0007389)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)	p.R259C(1)		central_nervous_system(1)|large_intestine(1)|lung(7)|ovary(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)		GAAGAAGAAGCGCGTGGTGCT	0.572																																					p.R259C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C775T	2						.						37.0	38.0	38.0					2																	176965450		1982	4195	6177	176673696	SO:0001583	missense	3238	exon2				CCDS46456.1	2q31.1	2011-06-20	2005-12-22		ENSG00000170178	ENSG00000170178		"""Homeoboxes / ANTP class : HOXL subclass"""	5135	protein-coding gene	gene with protein product		142988	"""homeo box D12"""	HOX4H		1675198, 1973146	Standard	NM_021193		Approved		uc010zev.1	P35452	OTTHUMG00000150358	ENST00000406506.2:c.775C>T	2.37:g.176965450C>T	ENSP00000385586:p.Arg259Cys	Somatic		Capture	Illumina HiSeq	Phase_I	176673696	NM_021193	B5MCP0|Q0VAD7|Q0VAD8|Q9NS03	Missense_Mutation	SNP	ENST00000406506.2	37	CCDS46456.1	.	.	.	.	.	.	.	.	.	.	C	18.60	3.658983	0.67586	.	.	ENSG00000170178	ENST00000406506	D	0.96745	-4.11	5.76	3.72	0.42706	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98362	0.9456	M	0.91972	3.26	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99671	1.0996	10	0.87932	D	0	.	15.2119	0.73230	0.3498:0.6502:0.0:0.0	.	259	P35452	HXD12_HUMAN	C	259	ENSP00000385586:R259C	ENSP00000385586:R259C	R	+	1	0	HOXD12	176673696	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.900000	0.39828	1.375000	0.46248	0.655000	0.94253	CGC		HOXD12-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359253.2	NM_021193	
ZDBF2	57683	broad.mit.edu	37	2	207172207	207172207	+	Silent	SNP	C	C	T	rs370841894	byFrequency	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr2:207172207C>T	ENST00000374423.3	+	5	3341	c.2955C>T	c.(2953-2955)caC>caT	p.H985H		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	985							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.H985H(2)		endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						GAGAAAAGCACGCTGAATTCC	0.393													C|||	4	0.000798722	0.0023	0.0	5008	,	,		19470	0.0		0.0	False		,,,				2504	0.001				p.H985H												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C2955T	2						.	C		6,3754		0,6,1874	77.0	76.0	76.0		2955	-4.3	0.0	2		76	0,8214		0,0,4107	no	coding-synonymous	ZDBF2	NM_020923.1		0,6,5981	TT,TC,CC		0.0,0.1596,0.0501		985/2355	207172207	6,11968	1880	4107	5987	206880452	SO:0001819	synonymous_variant	57683	exon5			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.2955C>T	2.37:g.207172207C>T		Somatic		Capture	Illumina HiSeq	Phase_I	206880452	NM_020923	Q6ZNP7|Q6ZSN8	Silent	SNP	ENST00000374423.3	37	CCDS46501.1																																																																																				ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923	
SMARCAL1	50485	broad.mit.edu	37	2	217279488	217279488	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr2:217279488C>G	ENST00000357276.4	+	3	391	c.61C>G	c.(61-63)Ctg>Gtg	p.L21V	SMARCAL1_ENST00000358207.5_Missense_Mutation_p.L21V|AC098820.2_ENST00000457694.1_RNA	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	21	Mediates interaction with RPA2.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)	p.L21V(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		ACAAAAGGCTCTGGCCCGCAG	0.493									Schimke Immuno-Osseous Dysplasia																												p.L21V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C61G	2						.						87.0	99.0	95.0					2																	217279488		2203	4300	6503	216987733	SO:0001583	missense	50485	exon3	Familial Cancer Database	SIOD	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.61C>G	2.37:g.217279488C>G	ENSP00000349823:p.Leu21Val	Somatic		Capture	Illumina HiSeq	Phase_I	216987733	NM_014140	A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Missense_Mutation	SNP	ENST00000357276.4	37	CCDS2403.1	.	.	.	.	.	.	.	.	.	.	C	19.16	3.773596	0.69992	.	.	ENSG00000138375	ENST00000430374;ENST00000357276;ENST00000444508;ENST00000358207;ENST00000434435	T;T;T;T;T	0.23754	1.89;1.89;1.89;1.89;1.89	5.64	4.75	0.60458	.	0.000000	0.64402	D	0.000008	T	0.33118	0.0852	L	0.27053	0.805	0.32921	D	0.515838	D	0.76494	0.999	D	0.75020	0.985	T	0.47262	-0.9131	10	0.87932	D	0	-12.1314	7.196	0.25853	0.0:0.7391:0.0:0.2609	.	21	Q9NZC9	SMAL1_HUMAN	V	21	ENSP00000405077:L21V;ENSP00000349823:L21V;ENSP00000398969:L21V;ENSP00000350940:L21V;ENSP00000402967:L21V	ENSP00000349823:L21V	L	+	1	2	SMARCAL1	216987733	0.998000	0.40836	1.000000	0.80357	0.979000	0.70002	0.793000	0.26944	1.359000	0.45940	0.563000	0.77884	CTG		SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256671.2		
CATIP	375307	broad.mit.edu	37	2	219227497	219227497	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr2:219227497A>G	ENST00000289388.3	+	6	531	c.502A>G	c.(502-504)Atc>Gtc	p.I168V	C2orf62_ENST00000481940.1_Intron	NM_198559.1	NP_940961.1	Q7Z7H3	CATIP_HUMAN		168					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.I168V(1)		endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16		Renal(207;0.0915)		Epithelial(149;8.08e-07)|all cancers(144;0.000146)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTGGAGCTCAATCAAGGGCTT	0.597																																					p.I168V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A502G	2						.						85.0	79.0	81.0					2																	219227497		2203	4300	6503	218935741	SO:0001583	missense	375307	exon6																														ENST00000289388.3:c.502A>G	2.37:g.219227497A>G	ENSP00000289388:p.Ile168Val	Somatic		Capture	Illumina HiSeq	Phase_I	218935741	NM_198559		Missense_Mutation	SNP	ENST00000289388.3	37	CCDS2414.1	.	.	.	.	.	.	.	.	.	.	A	6.077	0.382523	0.11524	.	.	ENSG00000158428	ENST00000289388	.	.	.	4.55	-5.01	0.02991	.	0.835022	0.10742	N	0.639322	T	0.26412	0.0645	L	0.44542	1.39	0.09310	N	1	B	0.20780	0.048	B	0.21708	0.036	T	0.23583	-1.0184	9	0.44086	T	0.13	-18.4332	2.2888	0.04133	0.189:0.4382:0.1536:0.2191	.	168	Q7Z7H3	CB062_HUMAN	V	168	.	ENSP00000289388:I168V	I	+	1	0	C2orf62	218935741	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.068000	0.11561	-1.194000	0.02684	-0.290000	0.09829	ATC		C2orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256771.1		
APPL1	26060	broad.mit.edu	37	3	57303587	57303587	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr3:57303587C>T	ENST00000288266.3	+	22	2149	c.2002C>T	c.(2002-2004)Cgg>Tgg	p.R668W	ASB14_ENST00000487349.1_3'UTR|ASB14_ENST00000389601.3_3'UTR	NM_012096.2	NP_036228.1	Q9UKG1	DP13A_HUMAN	adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1	668					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|insulin receptor signaling pathway (GO:0008286)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|regulation of glucose import (GO:0046324)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle membrane (GO:0012506)	identical protein binding (GO:0042802)|protein kinase B binding (GO:0043422)	p.R668W(2)		breast(3)|endometrium(3)|kidney(3)|large_intestine(10)|liver(2)|lung(4)|prostate(2)	27				KIRC - Kidney renal clear cell carcinoma(284;0.0124)|Kidney(284;0.0144)		AGAACAAAGTCGGTTGATAGC	0.423																																					p.R668W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2002T	3						.						109.0	104.0	106.0					3																	57303587		2203	4300	6503	57278627	SO:0001583	missense	26060	exon22			AB037849	CCDS2882.1	3p21.1-p14.3	2013-01-11			ENSG00000157500	ENSG00000157500		"""Pleckstrin homology (PH) domain containing"""	24035	protein-coding gene	gene with protein product		604299				10490823, 17030088	Standard	NM_012096		Approved	APPL	uc003dio.3	Q9UKG1	OTTHUMG00000133756	ENST00000288266.3:c.2002C>T	3.37:g.57303587C>T	ENSP00000288266:p.Arg668Trp	Somatic		Capture	Illumina HiSeq	Phase_I	57278627	NM_012096	Q9P2B9	Missense_Mutation	SNP	ENST00000288266.3	37	CCDS2882.1	.	.	.	.	.	.	.	.	.	.	C	19.62	3.862194	0.71949	.	.	ENSG00000157500	ENST00000288266	T	0.11495	2.77	5.65	4.75	0.60458	.	0.000000	0.85682	D	0.000000	T	0.23806	0.0576	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.02009	-1.1230	10	0.87932	D	0	.	16.1283	0.81408	0.1347:0.8653:0.0:0.0	.	668	Q9UKG1	DP13A_HUMAN	W	668	ENSP00000288266:R668W	ENSP00000288266:R668W	R	+	1	2	APPL1	57278627	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	5.679000	0.68160	1.468000	0.48064	0.563000	0.77884	CGG		APPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258196.2	NM_012096	
KALRN	8997	broad.mit.edu	37	3	123987813	123987813	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr3:123987813G>A	ENST00000240874.3	+	5	831	c.674G>A	c.(673-675)cGg>cAg	p.R225Q	KALRN_ENST00000460856.1_Missense_Mutation_p.R225Q|KALRN_ENST00000360013.3_Missense_Mutation_p.R225Q	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	225					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R225Q(2)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						GGCTCTCGGCGGCTCATTGAC	0.627																																					p.R225Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G674A	3						.						30.0	30.0	30.0					3																	123987813		2203	4300	6503	125470503	SO:0001583	missense	8997	exon5			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.674G>A	3.37:g.123987813G>A	ENSP00000240874:p.Arg225Gln	Somatic		Capture	Illumina HiSeq	Phase_I	125470503	NM_003947	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	ENST00000240874.3	37	CCDS3027.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.7|24.7	4.555073|4.555073	0.86231|0.86231	.|.	.|.	ENSG00000160145|ENSG00000160145	ENST00000448253;ENST00000354186|ENST00000460856;ENST00000240874;ENST00000360013	.|T;T;T	.|0.40756	.|1.02;1.02;1.02	5.46|5.46	5.46|5.46	0.80206|0.80206	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.37571|0.37571	0.1008|0.1008	M|M	0.62723|0.62723	1.935|1.935	0.80722|0.80722	D|D	1|1	.|B;P;P	.|0.39181	.|0.197;0.663;0.501	.|B;B;B	.|0.28232	.|0.04;0.041;0.087	T|T	0.30592|0.30592	-0.9973|-0.9973	5|10	.|0.13108	.|T	.|0.6	.|.	19.5125|19.5125	0.95148|0.95148	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|225;225;225	.|C9IZQ6;O60229;O60229-2	.|.;KALRN_HUMAN;.	S|Q	253;203|225	.|ENSP00000418611:R225Q;ENSP00000240874:R225Q;ENSP00000353109:R225Q	.|ENSP00000240874:R225Q	G|R	+|+	1|2	0|0	KALRN|KALRN	125470503|125470503	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.893000|0.893000	0.52053|0.52053	5.636000|5.636000	0.67848|0.67848	2.840000|2.840000	0.97914|0.97914	0.655000|0.655000	0.94253|0.94253	GGC|CGG		KALRN-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258843.4	NM_003947	
MMAA	166785	broad.mit.edu	37	4	146575272	146575272	+	Missense_Mutation	SNP	C	C	T	rs141974563		TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr4:146575272C>T	ENST00000281317.5	+	6	2156	c.946C>T	c.(946-948)Cgt>Tgt	p.R316C	MMAA_ENST00000541599.1_Missense_Mutation_p.R35C	NM_172250.2	NP_758454.1	Q8IVH4	MMAA_HUMAN	methylmalonic aciduria (cobalamin deficiency) cblA type	316					cellular lipid metabolic process (GO:0044255)|cobalamin biosynthetic process (GO:0009236)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)	GTP binding (GO:0005525)|hydrolase activity (GO:0016787)	p.R316C(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)	17	all_hematologic(180;0.151)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ACTCCGCAAACGTTCACAAGT	0.423																																					p.R316C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C946T	4						.	C	CYS/ARG	0,4406		0,0,2203	153.0	142.0	146.0		946	4.6	1.0	4	dbSNP_134	146	1,8599	1.2+/-3.3	0,1,4299	no	missense	MMAA	NM_172250.2	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	316/419	146575272	1,13005	2203	4300	6503	146794722	SO:0001583	missense	166785	exon6			AF524841	CCDS3766.1	4q31.1	2011-05-12	2005-07-11			ENSG00000151611			18871	protein-coding gene	gene with protein product		607481	"""methylmalonic aciduria (cobalamin deficiency) type A"""			12438653	Standard	NM_172250		Approved	cblA	uc003ikh.4	Q8IVH4		ENST00000281317.5:c.946C>T	4.37:g.146575272C>T	ENSP00000281317:p.Arg316Cys	Somatic		Capture	Illumina HiSeq	Phase_I	146794722	NM_172250	B3KX40|Q495G7	Missense_Mutation	SNP	ENST00000281317.5	37	CCDS3766.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.230880	0.79688	0.0	1.16E-4	ENSG00000151611	ENST00000281317;ENST00000537246;ENST00000541599	D;D	0.90504	-2.68;-2.68	5.49	4.64	0.57946	.	0.172614	0.53938	D	0.000056	D	0.95689	0.8598	M	0.89095	3.005	0.58432	D	0.999996	D	0.89917	1.0	D	0.72075	0.976	D	0.96201	0.9145	10	0.72032	D	0.01	-11.7306	14.4595	0.67440	0.0:0.9289:0.0:0.0711	.	316	Q8IVH4	MMAA_HUMAN	C	316;316;35	ENSP00000281317:R316C;ENSP00000442284:R35C	ENSP00000281317:R316C	R	+	1	0	MMAA	146794722	1.000000	0.71417	0.957000	0.39632	0.982000	0.71751	3.485000	0.53208	1.312000	0.45043	0.650000	0.86243	CGT		MMAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364668.2		
PPP2R2C	5522	broad.mit.edu	37	4	6382753	6382753	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr4:6382753G>A	ENST00000382599.4	-	2	355	c.139C>T	c.(139-141)Cgg>Tgg	p.R47W	PPP2R2C_ENST00000314348.8_5'UTR|PPP2R2C_ENST00000507294.1_Missense_Mutation_p.R40W|PPP2R2C_ENST00000335585.5_Missense_Mutation_p.R47W|PPP2R2C_ENST00000515571.1_Missense_Mutation_p.R30W|PPP2R2C_ENST00000506140.1_Missense_Mutation_p.R40W			Q9Y2T4	2ABG_HUMAN	protein phosphatase 2, regulatory subunit B, gamma	47					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)	p.R47W(1)		central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	28						ATGACGACCCGGCCGCCCTTG	0.647																																					p.R47W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C139T	4						.						45.0	36.0	39.0					4																	6382753		2203	4300	6503	6433654	SO:0001583	missense	5522	exon2			AF086924	CCDS3388.1, CCDS56304.1, CCDS56305.1, CCDS3387.1	4p16.1	2013-01-10	2010-04-14		ENSG00000074211	ENSG00000074211	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9306	protein-coding gene	gene with protein product	"""PP2A subunit B isoform gamma"""	605997	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform"""			10574460, 10945473	Standard	NM_020416		Approved	PR52, IMYPNO, MGC33570, PR55G	uc003gja.3	Q9Y2T4	OTTHUMG00000090445	ENST00000382599.4:c.139C>T	4.37:g.6382753G>A	ENSP00000372042:p.Arg47Trp	Somatic		Capture	Illumina HiSeq	Phase_I	6433654	NM_020416	A8MSY7|B7Z3Y1|Q7Z4V7|Q8NEC4|Q9H3G7	Missense_Mutation	SNP	ENST00000382599.4	37		.	.	.	.	.	.	.	.	.	.	G	21.0	4.077310	0.76415	.	.	ENSG00000074211	ENST00000335585;ENST00000506140;ENST00000515571;ENST00000382599;ENST00000507294	T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52	4.02	3.15	0.36227	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.61350	0.2340	M	0.91717	3.235	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.70149	-0.4951	10	0.87932	D	0	-33.236	12.2817	0.54767	0.0:0.0:0.8293:0.1707	.	40;143;47;30;47	B7Z3Y1;Q59GC6;Q9Y2T4;Q9Y2T4-3;Q9Y2T4-2	.;.;2ABG_HUMAN;.;.	W	47;40;30;47;40	ENSP00000335083:R47W;ENSP00000423649:R40W;ENSP00000422374:R30W;ENSP00000372042:R47W;ENSP00000425247:R40W	ENSP00000335083:R47W	R	-	1	2	PPP2R2C	6433654	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.742000	0.55097	0.997000	0.38969	0.462000	0.41574	CGG		PPP2R2C-001	NOVEL	overlapping_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206889.2	NM_181876	
TEC	7006	broad.mit.edu	37	4	48165756	48165756	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr4:48165756C>T	ENST00000381501.3	-	8	857	c.700G>A	c.(700-702)Gta>Ata	p.V234I		NM_003215.2	NP_003206.2	P42680	TEC_HUMAN	tec protein tyrosine kinase	234	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				B cell receptor signaling pathway (GO:0050853)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of platelet activation (GO:0010543)|tissue regeneration (GO:0042246)	cell-cell junction (GO:0005911)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.V234I(1)		breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)	31						TTTCCCGTTACGTAATTACTT	0.279																																					p.V234I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G700A	4						.						69.0	62.0	64.0					4																	48165756		2188	4269	6457	47860513	SO:0001583	missense	7006	exon8			D29767	CCDS3481.1	4p12	2013-02-14			ENSG00000135605	ENSG00000135605		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	11719	protein-coding gene	gene with protein product		600583				7934162	Standard	NM_003215		Approved	PSCTK4	uc003gxz.3	P42680	OTTHUMG00000128623	ENST00000381501.3:c.700G>A	4.37:g.48165756C>T	ENSP00000370912:p.Val234Ile	Somatic		Capture	Illumina HiSeq	Phase_I	47860513	NM_003215	B7ZKZ6|Q3MIS5	Missense_Mutation	SNP	ENST00000381501.3	37	CCDS3481.1	.	.	.	.	.	.	.	.	.	.	C	18.89	3.719590	0.68844	.	.	ENSG00000135605	ENST00000381501	T	0.29142	1.58	5.69	5.69	0.88448	Src homology-3 domain (3);	0.129327	0.51477	D	0.000096	T	0.58878	0.2153	M	0.75447	2.3	0.48696	D	0.999698	D	0.89917	1.0	D	0.80764	0.994	T	0.59295	-0.7481	10	0.59425	D	0.04	.	19.7977	0.96492	0.0:1.0:0.0:0.0	.	234	P42680	TEC_HUMAN	I	234	ENSP00000370912:V234I	ENSP00000370912:V234I	V	-	1	0	TEC	47860513	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.626000	0.67777	2.692000	0.91855	0.491000	0.48974	GTA		TEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250492.3		
PRMT9	90826	broad.mit.edu	37	4	148594942	148594942	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr4:148594942A>C	ENST00000322396.6	-	3	664	c.422T>G	c.(421-423)tTt>tGt	p.F141C	PRMT10_ENST00000541232.1_Missense_Mutation_p.F28C	NM_138364.2	NP_612373.2	Q6P2P2	ANM9_HUMAN		141	SAM-dependent MTase PRMT-type 1. {ECO:0000255|PROSITE-ProRule:PRU01015}.					cytoplasm (GO:0005737)	protein methyltransferase activity (GO:0008276)	p.F141C(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28						AACACGATAAAAATTCTCCTT	0.393																																					p.F141C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T422G	4						.						94.0	95.0	94.0					4																	148594942		2203	4300	6503	148814392	SO:0001583	missense	90826	exon3																														ENST00000322396.6:c.422T>G	4.37:g.148594942A>C	ENSP00000314396:p.Phe141Cys	Somatic		Capture	Illumina HiSeq	Phase_I	148814392	NM_138364	A8KA39|B3KU92|Q6ZR58|Q8N383|Q9BT55|Q9NT98	Missense_Mutation	SNP	ENST00000322396.6	37	CCDS3771.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.341358	0.81911	.	.	ENSG00000164169	ENST00000322396;ENST00000541232	T;T	0.63255	-0.03;1.75	5.37	5.37	0.77165	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.74989	0.3789	L	0.57536	1.79	0.58432	D	0.999996	D	0.89917	1.0	D	0.70487	0.969	T	0.75448	-0.3314	10	0.45353	T	0.12	.	15.3765	0.74610	1.0:0.0:0.0:0.0	.	141	Q6P2P2	ANM10_HUMAN	C	141;28	ENSP00000314396:F141C;ENSP00000439508:F28C	ENSP00000314396:F141C	F	-	2	0	PRMT10	148814392	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.948000	0.93006	2.045000	0.60652	0.533000	0.62120	TTT		PRMT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364650.1		
APC	324	broad.mit.edu	37	5	112175174	112175174	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr5:112175174G>T	ENST00000457016.1	+	16	4263	c.3883G>T	c.(3883-3885)Gaa>Taa	p.E1295*	APC_ENST00000508376.2_Nonsense_Mutation_p.E1295*|APC_ENST00000257430.4_Nonsense_Mutation_p.E1295*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1295	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.E1295*(4)|p.T1293fs*2(1)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GACGACACAGGAAGCAGATTC	0.378		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.E1277X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,right,Substitution - Nonsense,0 	.	7	Substitution - Nonsense(4)|Deletion - Frameshift(2)|Unknown(1)	large_intestine(5)|soft_tissue(1)|skin(1)	c.G3829T	5						.						55.0	57.0	56.0					5																	112175174		2202	4300	6502	112203073	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3883G>T	5.37:g.112175174G>T	ENSP00000413133:p.Glu1295*	Somatic		Capture	Illumina HiSeq	Phase_I	112203073	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	G	38	6.678343	0.97755	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.73	3.87	0.44632	.	0.307464	0.33691	N	0.004641	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-9.0118	10.9173	0.47144	0.0711:0.1319:0.797:0.0	.	.	.	.	X	1295	.	.	E	+	1	0	APC	112203073	0.969000	0.33509	0.998000	0.56505	0.989000	0.77384	1.129000	0.31381	1.497000	0.48584	0.655000	0.94253	GAA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
MCC	4163	broad.mit.edu	37	5	112406861	112406861	+	Missense_Mutation	SNP	C	C	T	rs578122540		TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr5:112406861C>T	ENST00000302475.4	-	10	1848	c.1285G>A	c.(1285-1287)Gag>Aag	p.E429K	MCC_ENST00000408903.3_Missense_Mutation_p.E619K|MCC_ENST00000514701.3_5'UTR|MCC_ENST00000515367.2_Missense_Mutation_p.E366K	NM_002387.2	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers	429					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.E429K(1)|p.E619K(1)		endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		CTCATCCTCTCGGCATTGCTT	0.488													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19792	0.0		0.0	False		,,,				2504	0.0				p.E619K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1855A	5						.						269.0	224.0	239.0					5																	112406861		2202	4300	6502	112434760	SO:0001583	missense	4163	exon12				CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000302475.4:c.1285G>A	5.37:g.112406861C>T	ENSP00000305617:p.Glu429Lys	Somatic		Capture	Illumina HiSeq	Phase_I	112434760	NM_001085377	D3DT05|Q6ZR04	Missense_Mutation	SNP	ENST00000302475.4	37	CCDS4111.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.304452	0.81136	.	.	ENSG00000171444	ENST00000302475;ENST00000515367;ENST00000408903	T;T;T	0.57595	0.39;0.39;0.39	4.93	4.93	0.64822	Usher syndrome type-1C protein-binding protein 1, PDZ domain (1);	0.000000	0.85682	D	0.000000	T	0.68879	0.3049	L	0.52905	1.665	0.80722	D	1	D;P;D;D	0.76494	0.996;0.911;0.995;0.999	D;P;D;D	0.71656	0.974;0.635;0.97;0.911	T	0.71935	-0.4442	10	0.72032	D	0.01	-25.2469	18.4994	0.90876	0.0:1.0:0.0:0.0	.	429;391;619;429	B7Z6G0;B3KTX0;P23508-2;P23508	.;.;.;CRCM_HUMAN	K	429;366;619	ENSP00000305617:E429K;ENSP00000421615:E366K;ENSP00000386227:E619K	ENSP00000305617:E429K	E	-	1	0	MCC	112434760	1.000000	0.71417	0.309000	0.25155	0.951000	0.60555	6.180000	0.71981	2.449000	0.82847	0.591000	0.81541	GAG		MCC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250736.3	NM_001085377	
PCDHB8	56128	broad.mit.edu	37	5	140558277	140558277	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr5:140558277C>T	ENST00000239444.2	+	1	907	c.662C>T	c.(661-663)cCg>cTg	p.P221L	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	221	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P221L(1)		NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGTGGCTCTCCGCCCAGATCT	0.522																																					p.P221L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C662T	5						.						104.0	135.0	125.0					5																	140558277		2203	4297	6500	140538461	SO:0001583	missense	56128	exon1			AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.662C>T	5.37:g.140558277C>T	ENSP00000239444:p.Pro221Leu	Somatic		Capture	Illumina HiSeq	Phase_I	140538461	NM_019120	B9EGV1	Missense_Mutation	SNP	ENST00000239444.2	37	CCDS4250.1	.	.	.	.	.	.	.	.	.	.	c	13.10	2.136943	0.37728	.	.	ENSG00000120322	ENST00000239444	T	0.57436	0.4	4.25	3.36	0.38483	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.75722	0.3888	H	0.97240	3.965	0.43678	D	0.996112	D	0.60160	0.987	P	0.54401	0.751	T	0.82784	-0.0286	9	0.66056	D	0.02	.	12.0568	0.53540	0.0:0.9123:0.0:0.0877	.	221	Q9UN66	PCDB8_HUMAN	L	221	ENSP00000239444:P221L	ENSP00000239444:P221L	P	+	2	0	PCDHB8	140538461	1.000000	0.71417	0.789000	0.31954	0.150000	0.21749	4.629000	0.61290	0.740000	0.32651	0.585000	0.79938	CCG		PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2	NM_019120	
PCDHB13	56123	broad.mit.edu	37	5	140593773	140593773	+	Silent	SNP	G	G	A			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr5:140593773G>A	ENST00000341948.4	+	1	265	c.78G>A	c.(76-78)gcG>gcA	p.A26A		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	26					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A26A(1)		NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TATCTCTGGCGGGCGCGGCGG	0.522																																					p.A26A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G78A	5						.						22.0	22.0	22.0					5																	140593773		2192	4272	6464	140573957	SO:0001819	synonymous_variant	56123	exon1			AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.78G>A	5.37:g.140593773G>A		Somatic		Capture	Illumina HiSeq	Phase_I	140573957	NM_018933	A8K9V6	Silent	SNP	ENST00000341948.4	37	CCDS4255.1																																																																																				PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	NM_018933	
PCDHGA3	56112	broad.mit.edu	37	5	140725113	140725113	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr5:140725113G>A	ENST00000253812.6	+	1	1513	c.1513G>A	c.(1513-1515)Gtc>Atc	p.V505I	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	505	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V505I(1)		breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTCCTCCTTCGTCTCTATCAA	0.552																																					p.V505I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1513A	5						.						70.0	79.0	76.0					5																	140725113		2115	4263	6378	140705297	SO:0001583	missense	56112	exon1			AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.1513G>A	5.37:g.140725113G>A	ENSP00000253812:p.Val505Ile	Somatic		Capture	Illumina HiSeq	Phase_I	140705297	NM_018916	Q9Y5D4	Missense_Mutation	SNP	ENST00000253812.6	37	CCDS47290.1	.	.	.	.	.	.	.	.	.	.	.	7.652	0.683080	0.14907	.	.	ENSG00000254245	ENST00000253812	T	0.60920	0.15	5.36	-3.5	0.04710	Cadherin (4);Cadherin-like (1);	0.000000	0.30338	U	0.009846	T	0.28167	0.0695	N	0.13198	0.31	0.09310	N	1	B;B	0.23891	0.093;0.051	B;B	0.23716	0.048;0.044	T	0.07751	-1.0756	10	0.27785	T	0.31	.	2.5247	0.04689	0.3725:0.1919:0.3386:0.0969	.	505;505	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	I	505	ENSP00000253812:V505I	ENSP00000253812:V505I	V	+	1	0	PCDHGA3	140705297	0.000000	0.05858	0.006000	0.13384	0.858000	0.48976	-0.554000	0.06006	-1.035000	0.03291	0.563000	0.77884	GTC		PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916	
PRDM9	56979	broad.mit.edu	37	5	23526987	23526987	+	Missense_Mutation	SNP	C	C	G	rs74710141	byFrequency	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr5:23526987C>G	ENST00000296682.3	+	11	1972	c.1790C>G	c.(1789-1791)aCt>aGt	p.T597S		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	597					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)	p.T597S(4)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						GTCCTCCTCACTCACCAGAGG	0.592										HNSCC(3;0.000094)																											p.T597S												.	.	4	Substitution - Missense(4)	prostate(2)|large_intestine(1)|skin(1)	c.C1790G	5						.						35.0	40.0	38.0					5																	23526987		2099	4214	6313	23562744	SO:0001583	missense	56979	exon11			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.1790C>G	5.37:g.23526987C>G	ENSP00000296682:p.Thr597Ser	Somatic		Capture	Illumina HiSeq	Phase_I	23562744	NM_020227	B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	c	0.001	-4.068388	0.00002	.	.	ENSG00000164256	ENST00000296682;ENST00000253473	T	0.17370	2.28	2.19	-4.37	0.03633	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	3.313900	0.00997	N	0.003618	T	0.06600	0.0169	N	0.04508	-0.205	0.09310	N	1	B	0.09022	0.002	B	0.15870	0.014	T	0.28808	-1.0032	10	0.07644	T	0.81	8.589	2.3158	0.04198	0.3795:0.3034:0.2155:0.1015	.	597	Q9NQV7	PRDM9_HUMAN	S	597;363	ENSP00000296682:T597S	ENSP00000253473:T363S	T	+	2	0	PRDM9	23562744	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-20.000000	0.00000	-6.326000	0.00005	-5.695000	0.00000	ACT		PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227	
C5orf42	65250	broad.mit.edu	37	5	37183070	37183070	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr5:37183070T>C	ENST00000508244.1	-	25	5306	c.5213A>G	c.(5212-5214)aAc>aGc	p.N1738S	C5orf42_ENST00000274258.7_Missense_Mutation_p.N619S|C5orf42_ENST00000425232.2_Missense_Mutation_p.N1738S			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	1738						integral component of membrane (GO:0016021)		p.N619S(1)|p.N1738S(1)		breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			GCCAAAAGTGTTTAGTGCTAA	0.378																																					p.N1738S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A5213G	5						.						106.0	102.0	103.0					5																	37183070		2203	4300	6503	37218827	SO:0001583	missense	65250	exon26				CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.5213A>G	5.37:g.37183070T>C	ENSP00000421690:p.Asn1738Ser	Somatic		Capture	Illumina HiSeq	Phase_I	37218827	NM_023073	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	37	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	T	11.94	1.787445	0.31593	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.17854	2.25;2.25;2.25;2.25	5.19	-1.48	0.08745	.	1.276180	0.05435	N	0.546714	T	0.08891	0.0220	N	0.14661	0.345	0.09310	N	1	B;B	0.10296	0.003;0.003	B;B	0.10450	0.005;0.005	T	0.34254	-0.9836	10	0.27785	T	0.31	.	3.1076	0.06347	0.1093:0.3522:0.1126:0.426	.	1738;619	E9PH94;Q9H799	.;CE042_HUMAN	S	1738;1738;619;786;619	ENSP00000421690:N1738S;ENSP00000389014:N1738S;ENSP00000274258:N619S;ENSP00000424223:N786S	ENSP00000274258:N619S	N	-	2	0	C5orf42	37218827	0.000000	0.05858	0.000000	0.03702	0.130000	0.20726	0.082000	0.14847	-0.522000	0.06417	-0.256000	0.11100	AAC		C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
KIF4B	285643	broad.mit.edu	37	5	154393469	154393469	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr5:154393469G>A	ENST00000435029.4	+	1	210	c.50G>A	c.(49-51)cGc>cAc	p.R17H		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	17	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)	p.R17H(2)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CTGCGTTGTCGCCCTCTGGTC	0.542																																					p.R17H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G50A	5						.						123.0	116.0	118.0					5																	154393469		2203	4300	6503	154373662	SO:0001583	missense	285643	exon1			AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.50G>A	5.37:g.154393469G>A	ENSP00000387875:p.Arg17His	Somatic		Capture	Illumina HiSeq	Phase_I	154373662	NM_001099293		Missense_Mutation	SNP	ENST00000435029.4	37	CCDS47324.1	.	.	.	.	.	.	.	.	.	.	g	18.22	3.576762	0.65878	.	.	ENSG00000226650	ENST00000435029	D	0.85171	-1.95	1.48	1.48	0.22813	Kinesin, motor domain (4);	.	.	.	.	D	0.95149	0.8428	H	0.99719	4.725	0.58432	D	0.999992	D	0.89917	1.0	D	0.97110	1.0	D	0.93917	0.7202	9	0.87932	D	0	.	8.8832	0.35387	0.0:0.0:1.0:0.0	.	17	Q2VIQ3	KIF4B_HUMAN	H	17	ENSP00000387875:R17H	ENSP00000387875:R17H	R	+	2	0	KIF4B	154373662	1.000000	0.71417	0.993000	0.49108	0.970000	0.65996	4.834000	0.62774	1.138000	0.42230	0.563000	0.77884	CGC		KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1		
MAP7	9053	broad.mit.edu	37	6	136742910	136742911	+	Frame_Shift_Ins	INS	-	-	TA			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr6:136742910_136742911insTA	ENST00000354570.3	-	2	504_505	c.94_95insTA	c.(94-96)aagfs	p.K32fs	MAP7_ENST00000544465.1_Frame_Shift_Ins_p.K17fs|MAP7_ENST00000454590.1_Frame_Shift_Ins_p.K54fs|MAP7_ENST00000432797.2_5'UTR|MAP7_ENST00000438100.2_Frame_Shift_Ins_p.K54fs	NM_001198616.1|NM_001198617.1|NM_001198619.1|NM_003980.4	NP_001185545.1|NP_001185546.1|NP_001185548.1|NP_003971.1	Q14244	MAP7_HUMAN	microtubule-associated protein 7	32					cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|establishment or maintenance of cell polarity (GO:0007163)|fertilization (GO:0009566)|germ cell development (GO:0007281)|glycosphingolipid metabolic process (GO:0006687)|homeostasis of number of cells (GO:0048872)|Leydig cell differentiation (GO:0033327)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nucleus organization (GO:0006997)|organ growth (GO:0035265)|protein localization to plasma membrane (GO:0072659)|response to osmotic stress (GO:0006970)|response to retinoic acid (GO:0032526)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)|structural molecule activity (GO:0005198)	p.K32fs*51(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(11)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00199)|OV - Ovarian serous cystadenocarcinoma(155;0.00643)		GGCATTTTTCTTATCTTGCACT	0.381																																					p.K32fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.95_96insTA	6						.																																			136784604	SO:0001589	frameshift_variant	9053	exon2			X73882	CCDS5178.1, CCDS56452.1, CCDS56453.1, CCDS56454.1, CCDS56455.1, CCDS75527.1, CCDS75528.1, CCDS75529.1	6q23.2	2008-07-28			ENSG00000135525	ENSG00000135525			6869	protein-coding gene	gene with protein product		604108				8408219	Standard	NM_003980		Approved	E-MAP-115	uc011edg.2	Q14244	OTTHUMG00000015646	ENST00000354570.3:c.93_94dupTA	6.37:g.136742911_136742912dupTA	ENSP00000346581:p.Lys32fs	Somatic		Capture	Illumina HiSeq	Phase_I	136784603	NM_001198617	B7Z290|B7Z400|B7Z5S7|B7Z9U7|C9JPS0|E9PCP3|F5H1E2|Q7Z6S0|Q8TAU5|Q9NY82|Q9NY83	Frame_Shift_Ins	INS	ENST00000354570.3	37	CCDS5178.1																																																																																				MAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042382.2	NM_003980	
KLC4	89953	broad.mit.edu	37	6	43034792	43034792	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr6:43034792G>A	ENST00000394056.2	+	7	1345	c.850G>A	c.(850-852)Gag>Aag	p.E284K	KLC4_ENST00000458460.2_Missense_Mutation_p.E284K|KLC4_ENST00000347162.5_Missense_Mutation_p.E284K|KLC4_ENST00000259708.3_Missense_Mutation_p.E302K|KLC4_ENST00000394058.1_Missense_Mutation_p.E284K|KLC4_ENST00000453940.2_Missense_Mutation_p.E207K|KLC4_ENST00000479388.1_Missense_Mutation_p.E284K			Q9NSK0	KLC4_HUMAN	kinesin light chain 4	284						cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)	p.E284K(1)		endometrium(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(4)	23			all cancers(41;0.00169)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0376)|KIRC - Kidney renal clear cell carcinoma(2;0.0453)			TAGCATCCGGGAGAGCACCTT	0.557																																					p.E284K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G850A	6						.						112.0	94.0	100.0					6																	43034792		2203	4300	6503	43142770	SO:0001583	missense	89953	exon6			AK055293	CCDS4882.1, CCDS4883.1, CCDS47429.1, CCDS75459.1	6p21.1	2013-01-10	2005-09-13	2005-09-13	ENSG00000137171	ENSG00000137171		"""Tetratricopeptide (TTC) repeat domain containing"""	21624	protein-coding gene	gene with protein product			"""kinesin-like 8"""	KNSL8			Standard	NM_001289034		Approved	bA387M24.3	uc003otw.1	Q9NSK0	OTTHUMG00000014720	ENST00000394056.2:c.850G>A	6.37:g.43034792G>A	ENSP00000377620:p.Glu284Lys	Somatic		Capture	Illumina HiSeq	Phase_I	43142770	NM_201521	B3KNY4|B3KPI3|B3KSQ3|B4DME9|Q66K28|Q96EG6	Missense_Mutation	SNP	ENST00000394056.2	37	CCDS4883.1	.	.	.	.	.	.	.	.	.	.	G	36	5.840966	0.97009	.	.	ENSG00000137171	ENST00000347162;ENST00000453940;ENST00000470728;ENST00000458460;ENST00000259708;ENST00000479388;ENST00000394056;ENST00000394058	T;T;T;T;T;T;T;T	0.79554	-0.06;-1.28;-0.07;-0.07;-0.06;-0.06;-0.06;-0.06	5.92	5.92	0.95590	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.64402	D	0.000006	D	0.83372	0.5240	L	0.41492	1.28	0.58432	D	0.999999	P;D;D;D	0.69078	0.517;0.996;0.991;0.997	B;D;D;D	0.78314	0.399;0.989;0.991;0.951	T	0.79624	-0.1726	10	0.31617	T	0.26	-12.365	19.9271	0.97107	0.0:0.0:1.0:0.0	.	207;302;284;284	B4DME9;Q9NSK0-3;Q9NSK0;Q96EG6	.;.;KLC4_HUMAN;.	K	284;207;262;284;302;284;284;284	ENSP00000340221:E284K;ENSP00000395806:E207K;ENSP00000417652:E262K;ENSP00000410358:E284K;ENSP00000259708:E302K;ENSP00000418031:E284K;ENSP00000377620:E284K;ENSP00000377622:E284K	ENSP00000259708:E302K	E	+	1	0	KLC4	43142770	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.782000	0.99034	2.809000	0.96659	0.557000	0.71058	GAG		KLC4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040579.2	NM_138343	
TFR2	7036	broad.mit.edu	37	7	100218697	100218697	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr7:100218697C>T	ENST00000462107.1	-	19	2476	c.2189G>A	c.(2188-2190)cGc>cAc	p.R730H	TFR2_ENST00000223051.3_Missense_Mutation_p.R730H|TFR2_ENST00000544242.1_Missense_Mutation_p.R271H|TFR2_ENST00000431692.1_3'UTR			Q9UP52	TFR2_HUMAN	transferrin receptor 2	730					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transferrin receptor activity (GO:0004998)	p.R730H(2)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)				Gallium nitrate(DB05260)	GAAGATGTGGCGGAACGGGGA	0.682																																					p.R730H												.	.	2	Substitution - Missense(2)	large_intestine(1)|pancreas(1)	c.G2189A	7						.						16.0	18.0	18.0					7																	100218697		2162	4264	6426	100056633	SO:0001583	missense	7036	exon18			AF053356	CCDS34707.1	7q22	2003-01-27			ENSG00000106327	ENSG00000106327			11762	protein-coding gene	gene with protein product		604720				9799793, 12130528	Standard	NM_003227		Approved	HFE3, TFRC2	uc003uvv.1	Q9UP52	OTTHUMG00000159598	ENST00000462107.1:c.2189G>A	7.37:g.100218697C>T	ENSP00000420525:p.Arg730His	Somatic		Capture	Illumina HiSeq	Phase_I	100056633	NM_003227	A6NGM7|O75422|Q1HE13|Q9HA99|Q9NX67	Missense_Mutation	SNP	ENST00000462107.1	37	CCDS34707.1	.	.	.	.	.	.	.	.	.	.	C	35	5.484930	0.96323	.	.	ENSG00000106327	ENST00000223051;ENST00000462107;ENST00000544242	T;T;T	0.68479	-0.33;-0.33;-0.33	5.39	5.39	0.77823	Transferrin receptor-like, dimerisation domain (3);	0.000000	0.85682	D	0.000000	T	0.80711	0.4675	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81892	-0.0724	10	0.87932	D	0	-22.1464	16.7045	0.85368	0.0:1.0:0.0:0.0	.	730	Q9UP52	TFR2_HUMAN	H	730;730;271	ENSP00000223051:R730H;ENSP00000420525:R730H;ENSP00000443656:R271H	ENSP00000223051:R730H	R	-	2	0	TFR2	100056633	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.993000	0.76245	2.810000	0.96702	0.650000	0.86243	CGC		TFR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356392.3	NM_003227	
CARD11	84433	broad.mit.edu	37	7	2946435	2946435	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr7:2946435C>T	ENST00000396946.4	-	25	3705	c.3302G>A	c.(3301-3303)cGc>cAc	p.R1101H		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	1101	Guanylate kinase-like.				Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)	p.R1094H(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		CCGGCACACGCGCAGGAACTC	0.672			Mis		DLBCL																																p.R1101H			Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3302A	7						.						51.0	41.0	45.0					7																	2946435		2203	4300	6503	2912961	SO:0001583	missense	84433	exon25			AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.3302G>A	7.37:g.2946435C>T	ENSP00000380150:p.Arg1101His	Somatic		Capture	Illumina HiSeq	Phase_I	2912961	NM_032415	A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	37	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	C	15.65	2.897137	0.52121	.	.	ENSG00000198286	ENST00000396946	T	0.18338	2.22	3.86	2.95	0.34219	.	0.081921	0.43579	D	0.000553	T	0.18882	0.0453	L	0.50333	1.59	0.39646	D	0.970398	D	0.64830	0.994	P	0.47162	0.54	T	0.03086	-1.1074	10	0.72032	D	0.01	-22.1086	8.3646	0.32378	0.0:0.756:0.1536:0.0904	.	1101	Q9BXL7	CAR11_HUMAN	H	1101	ENSP00000380150:R1101H	ENSP00000380150:R1101H	R	-	2	0	CARD11	2912961	0.657000	0.27393	0.991000	0.47740	0.707000	0.40811	1.312000	0.33574	1.704000	0.51252	0.511000	0.50034	CGC		CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415	
STK31	56164	broad.mit.edu	37	7	23810649	23810649	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr7:23810649T>A	ENST00000355870.3	+	14	1858	c.1739T>A	c.(1738-1740)aTa>aAa	p.I580K	STK31_ENST00000354639.3_Missense_Mutation_p.I557K|STK31_ENST00000433467.2_Missense_Mutation_p.I580K|STK31_ENST00000428484.1_Missense_Mutation_p.I557K|STK31_ENST00000405627.3_3'UTR	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	580						acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)	p.I580K(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						GACAAGGAGATAATTTCAAAT	0.358																																					p.I557K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1670A	7						.						173.0	173.0	173.0					7																	23810649		2203	4300	6503	23777174	SO:0001583	missense	56164	exon14			AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.1739T>A	7.37:g.23810649T>A	ENSP00000348132:p.Ile580Lys	Somatic		Capture	Illumina HiSeq	Phase_I	23777174	NM_001122833	B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Missense_Mutation	SNP	ENST00000355870.3	37	CCDS5386.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.454972	0.84209	.	.	ENSG00000196335	ENST00000355870;ENST00000433467;ENST00000354639;ENST00000428484	T;T;T;T	0.76316	-1.01;0.72;-1.0;-1.0	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.86789	0.6017	M	0.68952	2.095	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.998	D	0.88241	0.2910	10	0.87932	D	0	-7.733	15.2746	0.73732	0.0:0.0:0.0:1.0	.	580;580	B4DZ06;Q9BXU1	.;STK31_HUMAN	K	580;580;557;557	ENSP00000348132:I580K;ENSP00000411852:I580K;ENSP00000346660:I557K;ENSP00000406146:I557K	ENSP00000346660:I557K	I	+	2	0	STK31	23777174	1.000000	0.71417	0.971000	0.41717	0.978000	0.69477	4.974000	0.63771	2.083000	0.62718	0.528000	0.53228	ATA		STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214036.2	NM_031414	
SLC37A3	84255	broad.mit.edu	37	7	140051177	140051177	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr7:140051177C>T	ENST00000326232.9	-	9	981	c.778G>A	c.(778-780)Gaa>Aaa	p.E260K	SLC37A3_ENST00000429996.2_3'UTR|SLC37A3_ENST00000447932.2_Missense_Mutation_p.E260K|SLC37A3_ENST00000340308.3_Missense_Mutation_p.E260K	NM_207113.1	NP_996996.1	Q8NCC5	SPX3_HUMAN	solute carrier family 37, member 3	260					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)	p.E260K(1)		endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|stomach(3)	24	Melanoma(164;0.0142)					TATTCGTCTTCATTTTCACCA	0.428																																					p.E260K	Esophageal Squamous(133;211 1716 4665 11387 37873)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G778A	7						.						169.0	156.0	160.0					7																	140051177		2203	4300	6503	139697646	SO:0001583	missense	84255	exon9			AK074823	CCDS5858.1, CCDS5859.1, CCDS75669.1	7q34	2013-07-17	2013-07-17		ENSG00000157800	ENSG00000157800		"""Solute carriers"""	20651	protein-coding gene	gene with protein product							Standard	NM_001287498		Approved	DKFZp761N0624	uc003vvo.3	Q8NCC5	OTTHUMG00000157343	ENST00000326232.9:c.778G>A	7.37:g.140051177C>T	ENSP00000321498:p.Glu260Lys	Somatic		Capture	Illumina HiSeq	Phase_I	139697646	NM_032295	Q6PIU7|Q86SS4|Q9BQG7	Missense_Mutation	SNP	ENST00000326232.9	37	CCDS5859.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.6|22.6	4.312637|4.312637	0.81358|0.81358	.|.	.|.	ENSG00000157800|ENSG00000157800	ENST00000340308;ENST00000447932;ENST00000326232|ENST00000485734	T;T;T|.	0.18960|.	2.18;2.44;2.44|.	5.2|5.2	5.2|5.2	0.72013|0.72013	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);|.	0.298518|.	0.38272|.	N|.	0.001756|.	T|T	0.66376|0.66376	0.2783|0.2783	L|L	0.39245|0.39245	1.2|1.2	0.80722|0.80722	D|D	1|1	B;B;B|.	0.23058|.	0.006;0.079;0.015|.	B;B;B|.	0.17433|.	0.007;0.011;0.018|.	T|T	0.61893|0.61893	-0.6969|-0.6969	10|5	0.08599|.	T|.	0.76|.	-38.7391|-38.7391	18.7136|18.7136	0.91667|0.91667	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	260;260;260|.	Q8NCC5-2;Q8NCC5-3;Q8NCC5|.	.;.;SPX3_HUMAN|.	K|I	260|38	ENSP00000343358:E260K;ENSP00000397481:E260K;ENSP00000321498:E260K|.	ENSP00000321498:E260K|.	E|M	-|-	1|3	0|0	SLC37A3|SLC37A3	139697646|139697646	1.000000|1.000000	0.71417|0.71417	0.949000|0.949000	0.38748|0.38748	0.642000|0.642000	0.38348|0.38348	5.941000|5.941000	0.70195|0.70195	2.575000|2.575000	0.86900|0.86900	0.563000|0.563000	0.77884|0.77884	GAA|ATG		SLC37A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348492.1	NM_032295	
DKK4	27121	broad.mit.edu	37	8	42232377	42232377	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr8:42232377T>G	ENST00000220812.2	-	3	503	c.317A>C	c.(316-318)gAg>gCg	p.E106A		NM_014420.2	NP_055235.1	Q9UBT3	DKK4_HUMAN	dickkopf WNT signaling pathway inhibitor 4	106					multicellular organismal development (GO:0007275)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)		p.E106A(1)		NS(1)|endometrium(1)|large_intestine(7)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	14	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;2.58e-12)|Lung NSC(13;4.24e-11)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.1)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;3.48e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00523)|Lung(22;0.00597)|LUSC - Lung squamous cell carcinoma(45;0.024)			GCCATCTTGCTCATCAAGCTG	0.453																																					p.E106A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A317C	8						.						263.0	238.0	246.0					8																	42232377		2203	4300	6503	42351534	SO:0001583	missense	27121	exon3			AF177397	CCDS6130.1	8p11.2-p11.1	2013-05-15	2013-05-15		ENSG00000104371	ENSG00000104371			2894	protein-coding gene	gene with protein product		605417	"""dickkopf (Xenopus laevis) homolog 4"", ""dickkopf homolog 4 (Xenopus laevis)"""			10570958, 11701963	Standard	NM_014420		Approved		uc003xpb.3	Q9UBT3	OTTHUMG00000164167	ENST00000220812.2:c.317A>C	8.37:g.42232377T>G	ENSP00000220812:p.Glu106Ala	Somatic		Capture	Illumina HiSeq	Phase_I	42351534	NM_014420	Q3KNX0|Q9Y4C3	Missense_Mutation	SNP	ENST00000220812.2	37	CCDS6130.1	.	.	.	.	.	.	.	.	.	.	T	4.677	0.125787	0.08931	.	.	ENSG00000104371	ENST00000543914;ENST00000220812	T	0.30981	1.51	5.3	-1.52	0.08637	.	0.384718	0.25065	N	0.033401	T	0.09949	0.0244	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.10450	0.005	T	0.15263	-1.0443	10	0.19590	T	0.45	-12.8825	0.9355	0.01344	0.1515:0.2665:0.157:0.425	.	106	Q9UBT3	DKK4_HUMAN	A	106	ENSP00000220812:E106A	ENSP00000220812:E106A	E	-	2	0	DKK4	42351534	0.013000	0.17824	0.000000	0.03702	0.001000	0.01503	-0.012000	0.12699	-0.429000	0.07329	-0.256000	0.11100	GAG		DKK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377563.1		
MOS	4342	broad.mit.edu	37	8	57026217	57026217	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr8:57026217C>T	ENST00000311923.1	-	1	324	c.325G>A	c.(325-327)Gta>Ata	p.V109I		NM_005372.1	NP_005363.1	P00540	MOS_HUMAN	v-mos Moloney murine sarcoma viral oncogene homolog	109	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|chromatin organization (GO:0006325)|establishment of meiotic spindle orientation (GO:0051296)|MAPK cascade (GO:0000165)|meiotic spindle organization (GO:0000212)|negative regulation of metaphase/anaphase transition of meiotic cell cycle (GO:1902103)|protein autophosphorylation (GO:0046777)|regulation of meiosis (GO:0040020)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein serine/threonine kinase activity (GO:0004674)	p.V109I(1)		breast(1)|central_nervous_system(1)|large_intestine(5)|lung(12)|ovary(1)|urinary_tract(2)	22			Epithelial(17;0.00117)|all cancers(17;0.00879)			AGCCTTGCTACGTTGAGCTCA	0.592																																					p.V109I	Esophageal Squamous(124;373 2870 4778)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G325A	8						.						113.0	103.0	106.0					8																	57026217		2203	4300	6503	57188771	SO:0001583	missense	4342	exon1				CCDS6164.1	8q11	2012-10-02			ENSG00000172680	ENSG00000172680			7199	protein-coding gene	gene with protein product		190060				9552420	Standard	NM_005372		Approved		uc011leb.2	P00540	OTTHUMG00000164299	ENST00000311923.1:c.325G>A	8.37:g.57026217C>T	ENSP00000310722:p.Val109Ile	Somatic		Capture	Illumina HiSeq	Phase_I	57188771	NM_005372	Q3KPG9|Q3KPH0	Missense_Mutation	SNP	ENST00000311923.1	37	CCDS6164.1	.	.	.	.	.	.	.	.	.	.	C	13.67	2.305306	0.40795	.	.	ENSG00000172680	ENST00000311923	T	0.64085	-0.08	5.47	-5.19	0.02832	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.560526	0.16507	N	0.211404	T	0.37128	0.0992	N	0.03304	-0.355	0.20074	N	0.999938	B	0.16166	0.016	B	0.17979	0.02	T	0.02860	-1.1101	10	0.25106	T	0.35	.	21.0975	0.99946	0.0:0.8848:0.0:0.1152	.	109	P00540	MOS_HUMAN	I	109	ENSP00000310722:V109I	ENSP00000310722:V109I	V	-	1	0	MOS	57188771	1.000000	0.71417	0.022000	0.16811	0.892000	0.51952	0.861000	0.27885	-0.923000	0.03785	0.551000	0.68910	GTA		MOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378174.1	NM_005372	
MSC	9242	broad.mit.edu	37	8	72755898	72755898	+	Silent	SNP	G	G	A			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr8:72755898G>A	ENST00000325509.4	-	1	805	c.516C>T	c.(514-516)taC>taT	p.Y172Y	RP11-383H13.1_ENST00000537896.1_Missense_Mutation_p.V88I|RP11-383H13.1_ENST00000521467.1_Intron|MSC_ENST00000518440.1_5'Flank|RP11-383H13.1_ENST00000524152.1_5'UTR	NM_005098.3	NP_005089.2	O60682	MUSC_HUMAN	musculin	172					branchiomeric skeletal muscle development (GO:0014707)|diaphragm development (GO:0060539)|palate development (GO:0060021)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.Y172Y(1)		endometrium(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(4)|skin(2)	26	Breast(64;0.176)		Epithelial(68;0.137)|BRCA - Breast invasive adenocarcinoma(89;0.203)			CTGGGTGCACGTAGCCGTTCT	0.662											OREG0018826	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y172Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C516T	8						.						35.0	38.0	37.0					8																	72755898		2200	4298	6498	72918452	SO:0001819	synonymous_variant	9242	exon1				CCDS43746.1	8q13.3	2013-06-07	2010-04-28		ENSG00000178860	ENSG00000178860		"""Basic helix-loop-helix proteins"""	7321	protein-coding gene	gene with protein product	"""activated B-cell factor-1"""	603628	"""musculin (activated B-cell factor-1)"""			9584154, 10198176	Standard	NM_005098		Approved	ABF-1, bHLHa22	uc003xyx.1	O60682	OTTHUMG00000164489	ENST00000325509.4:c.516C>T	8.37:g.72755898G>A		Somatic	1140	Capture	Illumina HiSeq	Phase_I	72918452	NM_005098	O75946|Q53XZ2|Q9BRE7	Silent	SNP	ENST00000325509.4	37	CCDS43746.1	.	.	.	.	.	.	.	.	.	.	G	13.80	2.345920	0.41599	.	.	ENSG00000235531	ENST00000537896	.	.	.	5.07	2.28	0.28536	.	.	.	.	.	T	0.62998	0.2474	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61133	-0.7124	5	0.87932	D	0	.	7.7727	0.29019	0.3266:0.0:0.6734:0.0	.	.	.	.	I	88	.	ENSP00000440866:V88I	V	+	1	0	RP11-383H13.1	72918452	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.574000	0.46016	0.175000	0.19841	0.555000	0.69702	GTA		MSC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378974.1	NM_005098	
TMEFF1	8577	broad.mit.edu	37	9	103310154	103310154	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr9:103310154G>T	ENST00000374879.4	+	6	1121	c.689G>T	c.(688-690)aGg>aTg	p.R230M	TMEFF1_ENST00000334943.6_Missense_Mutation_p.R191M|MSANTD3-TMEFF1_ENST00000502978.1_Missense_Mutation_p.K193N	NM_003692.4	NP_003683.2	Q8IYR6	TEFF1_HUMAN	transmembrane protein with EGF-like and two follistatin-like domains 1	230	Kazal-like 2. {ECO:0000255|PROSITE- ProRule:PRU00798}.				multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R230M(1)		NS(1)|kidney(1)|large_intestine(7)|lung(9)|stomach(1)	19		Acute lymphoblastic leukemia(62;0.0452)				ATTGATATAAGGCATCTTGGT	0.323																																					p.R230M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G689T	9						.						126.0	119.0	121.0					9																	103310154		2203	4299	6502	102349975	SO:0001583	missense	8577	exon6			U19878	CCDS6750.1	9q31	2010-05-04			ENSG00000241697	ENSG00000241697			11866	protein-coding gene	gene with protein product	"""tomoregulin-1"", ""cancer/testis antigen family 120, member 1"""	603421		C9orf2		9730596	Standard	NM_003692		Approved	H7365, CT120.1		Q8IYR6	OTTHUMG00000020367	ENST00000374879.4:c.689G>T	9.37:g.103310154G>T	ENSP00000364013:p.Arg230Met	Somatic		Capture	Illumina HiSeq	Phase_I	102349975	NM_003692	Q13086|Q8N3T8	Missense_Mutation	SNP	ENST00000374879.4	37	CCDS6750.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.02|15.02	2.710690|2.710690	0.48517|0.48517	.|.	.|.	ENSG00000251349|ENSG00000241697	ENST00000502978|ENST00000334943;ENST00000374879	.|T;T	.|0.04194	.|3.68;3.68	5.98|5.98	5.98|5.98	0.97165|0.97165	.|Proteinase inhibitor I1, Kazal (1);Protease inhibitor, Kazal-type (1);	.|0.046510	.|0.85682	.|D	.|0.000000	T|T	0.06234|0.06234	0.0161|0.0161	N|N	0.20766|0.20766	0.605|0.605	0.47407|0.47407	D|D	0.999414|0.999414	.|B;D	.|0.54207	.|0.056;0.965	.|B;P	.|0.51135	.|0.063;0.66	T|T	0.51084|0.51084	-0.8750|-0.8750	5|10	.|0.29301	.|T	.|0.29	-18.2008|-18.2008	11.245|11.245	0.48991|0.48991	0.0824:0.0:0.9176:0.0|0.0824:0.0:0.9176:0.0	.|.	.|230;191	.|Q8IYR6;Q8IYR6-2	.|TEFF1_HUMAN;.	N|M	193|191;230	.|ENSP00000334447:R191M;ENSP00000364013:R230M	.|ENSP00000334447:R191M	K|R	+|+	3|2	2|0	C9orf30-TMEFF1|TMEFF1	102349975|102349975	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	5.298000|5.298000	0.65710|0.65710	2.838000|2.838000	0.97847|0.97847	0.591000|0.591000	0.81541|0.81541	AAG|AGG		TMEFF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053418.1	NM_003692	
SVEP1	79987	broad.mit.edu	37	9	113241943	113241943	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr9:113241943T>C	ENST00000401783.2	-	13	2795	c.2459A>G	c.(2458-2460)gAa>gGa	p.E820G	SVEP1_ENST00000374469.1_Missense_Mutation_p.E797G|SVEP1_ENST00000302728.8_Missense_Mutation_p.E820G|SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000374461.1_Missense_Mutation_p.E797G	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	820					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)	p.E820G(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						CTCAAATGCTTCAGAAAACTT	0.378																																					p.E820G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2459G	9						.						254.0	244.0	247.0					9																	113241943		1847	4087	5934	112281764	SO:0001583	missense	79987	exon13			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.2459A>G	9.37:g.113241943T>C	ENSP00000384917:p.Glu820Gly	Somatic		Capture	Illumina HiSeq	Phase_I	112281764	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	T	13.54	2.268952	0.40095	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728;ENST00000374461	T;T;T;T	0.79247	-1.1;-1.11;-1.25;1.08	5.62	4.46	0.54185	.	0.298786	0.38326	N	0.001722	T	0.65616	0.2708	L	0.31664	0.95	0.29366	N	0.864323	B;B;B	0.23442	0.085;0.0;0.001	B;B;B	0.19666	0.026;0.001;0.002	T	0.56842	-0.7912	10	0.25751	T	0.34	.	12.2795	0.54755	0.0:0.0:0.1472:0.8528	.	820;820;820	E9PBN8;Q4LDE5;Q4LDE5-2	.;SVEP1_HUMAN;.	G	820;797;820;797	ENSP00000384917:E820G;ENSP00000363593:E797G;ENSP00000304118:E820G;ENSP00000363585:E797G	ENSP00000304118:E820G	E	-	2	0	SVEP1	112281764	0.999000	0.42202	0.985000	0.45067	0.894000	0.52154	3.584000	0.53936	0.941000	0.37499	0.455000	0.32223	GAA		SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
ASTN2	23245	broad.mit.edu	37	9	119976945	119976945	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr9:119976945C>T	ENST00000313400.4	-	3	807	c.707G>A	c.(706-708)cGt>cAt	p.R236H	ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000373996.3_Missense_Mutation_p.R236H|ASTN2_ENST00000361209.2_Missense_Mutation_p.R236H			O75129	ASTN2_HUMAN	astrotactin 2	236					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)		p.R236H(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						GATGCGGCGACGCTTCTGCCA	0.637																																					p.R236H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G707A	9						.						55.0	51.0	52.0					9																	119976945		2203	4300	6503	119016766	SO:0001583	missense	23245	exon3			AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.707G>A	9.37:g.119976945C>T	ENSP00000314038:p.Arg236His	Somatic		Capture	Illumina HiSeq	Phase_I	119016766	NM_014010	A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	37		.	.	.	.	.	.	.	.	.	.	C	26.1	4.709341	0.89018	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000361209	T;T;T	0.15372	2.49;2.49;2.43	5.51	5.51	0.81932	.	0.000000	0.64402	D	0.000002	T	0.24890	0.0604	L	0.27053	0.805	0.53005	D	0.999964	D;D;D	0.71674	0.996;0.994;0.998	P;P;P	0.62382	0.681;0.483;0.901	T	0.00942	-1.1506	9	.	.	.	-10.8852	13.3768	0.60743	0.0:0.9237:0.0:0.0763	.	236;236;236	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	H	236	ENSP00000314038:R236H;ENSP00000363108:R236H;ENSP00000354504:R236H	.	R	-	2	0	ASTN2	119016766	1.000000	0.71417	0.954000	0.39281	0.838000	0.47535	6.050000	0.71063	2.599000	0.87857	0.655000	0.94253	CGT		ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010	
TRAF2	7186	broad.mit.edu	37	9	139815531	139815531	+	Silent	SNP	G	G	A	rs146825488	byFrequency	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr9:139815531G>A	ENST00000247668.2	+	9	1054	c.1002G>A	c.(1000-1002)gcG>gcA	p.A334A	TRAF2_ENST00000359662.3_Silent_p.A386A|TRAF2_ENST00000536468.1_Silent_p.A334A	NM_021138.3	NP_066961.2	Q12933	TRAF2_HUMAN	TNF receptor-associated factor 2	334					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular protein complex assembly (GO:0043623)|cellular response to nitric oxide (GO:0071732)|innate immune response (GO:0045087)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of neuron death (GO:1901215)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|programmed necrotic cell death (GO:0097300)|protein autoubiquitination (GO:0051865)|protein catabolic process (GO:0030163)|protein complex assembly (GO:0006461)|protein heterooligomerization (GO:0051291)|protein homotrimerization (GO:0070207)|protein K63-linked ubiquitination (GO:0070534)|regulation of apoptotic process (GO:0042981)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of immunoglobulin secretion (GO:0051023)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|membrane raft (GO:0045121)|ubiquitin ligase complex (GO:0000151)	CD40 receptor binding (GO:0005174)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein phosphatase binding (GO:0019903)|signal transducer activity (GO:0004871)|sphingolipid binding (GO:0046625)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A334A(1)		breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.229)	OV - Ovarian serous cystadenocarcinoma(145;4.48e-06)|Epithelial(140;9.55e-06)		AGGACCTGGCGATGGCTGACT	0.612													G|||	27	0.00539137	0.0197	0.0	5008	,	,		19428	0.0		0.001	False		,,,				2504	0.0				p.A334A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1002A	9						.	G		49,4357	50.9+/-86.3	1,47,2155	85.0	64.0	71.0		1002	-5.6	1.0	9	dbSNP_134	71	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	TRAF2	NM_021138.3		1,48,6454	AA,AG,GG		0.0116,1.1121,0.3844		334/502	139815531	50,12956	2203	4300	6503	138935352	SO:0001819	synonymous_variant	7186	exon9			U12597	CCDS7013.1	9q34	2013-01-09			ENSG00000127191	ENSG00000127191		"""RING-type (C3HC4) zinc fingers"""	12032	protein-coding gene	gene with protein product		601895				7639698	Standard	NM_021138		Approved	TRAP3	uc004cjv.3	Q12933	OTTHUMG00000020952	ENST00000247668.2:c.1002G>A	9.37:g.139815531G>A		Somatic		Capture	Illumina HiSeq	Phase_I	138935352	NM_021138	A8K107|B4DPJ7|Q7Z337|Q96NT2	Silent	SNP	ENST00000247668.2	37	CCDS7013.1																																																																																				TRAF2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055166.1	NM_021138	
B4GALT1	2683	broad.mit.edu	37	9	33166779	33166779	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr9:33166779C>A	ENST00000379731.4	-	1	575	c.389G>T	c.(388-390)tGc>tTc	p.C130F	RP11-326F20.5_ENST00000426270.1_RNA|B4GALT1_ENST00000535206.1_Missense_Mutation_p.C130F|RP11-326F20.5_ENST00000442432.1_RNA	NM_001497.3	NP_001488.2	P15291	B4GT1_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1	130					acute inflammatory response (GO:0002526)|angiogenesis involved in wound healing (GO:0060055)|binding of sperm to zona pellucida (GO:0007339)|branching morphogenesis of an epithelial tube (GO:0048754)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|development of secondary sexual characteristics (GO:0045136)|epithelial cell development (GO:0002064)|extracellular matrix organization (GO:0030198)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|lactose biosynthetic process (GO:0005989)|leukocyte migration (GO:0050900)|mammary gland development (GO:0030879)|multicellular organism reproduction (GO:0032504)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|oligosaccharide biosynthetic process (GO:0009312)|penetration of zona pellucida (GO:0007341)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of acrosome reaction (GO:0060046)|regulation of cellular component movement (GO:0051270)|single fertilization (GO:0007338)|small molecule metabolic process (GO:0044281)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|desmosome (GO:0030057)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|glycocalyx (GO:0030112)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi trans cisterna (GO:0000138)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alpha-tubulin binding (GO:0043014)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|beta-tubulin binding (GO:0048487)|galactosyltransferase activity (GO:0008378)|lactose synthase activity (GO:0004461)|manganese ion binding (GO:0030145)|N-acetyllactosamine synthase activity (GO:0003945)|protein homodimerization activity (GO:0042803)|UDP-galactosyltransferase activity (GO:0035250)	p.C130F(1)		endometrium(1)|large_intestine(7)|lung(4)|prostate(1)|skin(1)	14			LUSC - Lung squamous cell carcinoma(29;0.0084)	GBM - Glioblastoma multiforme(74;0.121)	N-Acetyl-D-glucosamine(DB00141)	CTCCTCAGGGCAGGCGGGCAG	0.687																																					p.C130F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G389T	9						.						19.0	26.0	24.0					9																	33166779		2194	4278	6472	33156779	SO:0001583	missense	2683	exon1			X14085	CCDS6535.1	9p13	2013-02-19			ENSG00000086062	ENSG00000086062	2.4.1.22	"""Beta 4-glycosyltransferases"""	924	protein-coding gene	gene with protein product		137060		GGTB2		9597550	Standard	NM_001497		Approved	beta4Gal-T1	uc003zsg.2	P15291	OTTHUMG00000019764	ENST00000379731.4:c.389G>T	9.37:g.33166779C>A	ENSP00000369055:p.Cys130Phe	Somatic		Capture	Illumina HiSeq	Phase_I	33156779	NM_001497	B2R710|D3DRL2|Q12909|Q12910|Q12911|Q14456|Q14509|Q14523	Missense_Mutation	SNP	ENST00000379731.4	37	CCDS6535.1	.	.	.	.	.	.	.	.	.	.	C	19.32	3.805347	0.70682	.	.	ENSG00000086062	ENST00000535206;ENST00000379731;ENST00000541701	T;T	0.25085	1.82;1.82	4.33	3.41	0.39046	.	0.224065	0.47852	D	0.000218	T	0.57725	0.2073	H	0.95224	3.64	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.65397	-0.6178	10	0.87932	D	0	-15.1055	7.4702	0.27344	0.0:0.8808:0.0:0.1192	.	130	P15291	B4GT1_HUMAN	F	130;130;87	ENSP00000440341:C130F;ENSP00000369055:C130F	ENSP00000369055:C130F	C	-	2	0	B4GALT1	33156779	0.936000	0.31750	0.994000	0.49952	0.839000	0.47603	1.551000	0.36233	2.101000	0.63845	0.455000	0.32223	TGC		B4GALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052039.1	NM_001497	
CACNA1B	774	broad.mit.edu	37	9	140919528	140919528	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chr9:140919528G>A	ENST00000371372.1	+	20	3335	c.3190G>A	c.(3190-3192)Gtc>Atc	p.V1064I	CACNA1B_ENST00000545473.1_Missense_Mutation_p.V48I|CACNA1B_ENST00000371363.1_Missense_Mutation_p.V1064I|CACNA1B_ENST00000371367.5_Missense_Mutation_p.V48I|CACNA1B_ENST00000371355.4_Missense_Mutation_p.V1065I|CACNA1B_ENST00000277549.5_Missense_Mutation_p.V256I|CACNA1B_ENST00000371357.1_Missense_Mutation_p.V1065I|CACNA1B_ENST00000277551.2_Missense_Mutation_p.V1064I	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1064					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)	p.V1064I(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	TCAGCGGAACGTCACTCGCAT	0.592																																					p.V1064I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3190A	9						.						72.0	81.0	78.0					9																	140919528		2172	4263	6435	140039349	SO:0001583	missense	774	exon20			AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.3190G>A	9.37:g.140919528G>A	ENSP00000360423:p.Val1064Ile	Somatic		Capture	Illumina HiSeq	Phase_I	140039349	NM_000718	B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	37	CCDS59522.1	.	.	.	.	.	.	.	.	.	.	G	17.78	3.473424	0.63737	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355;ENST00000371367;ENST00000545473	T;T;T;T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94;0.94;0.94;0.94	5.02	5.02	0.67125	.	11.358800	0.00166	N	0.000000	T	0.34454	0.0898	L	0.37630	1.12	0.33656	D	0.609106	B;B;P	0.38335	0.414;0.414;0.627	B;B;B	0.24394	0.034;0.034;0.053	T	0.50898	-0.8773	10	0.05959	T	0.93	.	18.3374	0.90293	0.0:0.0:1.0:0.0	.	1064;1065;1064	B1AQK4;B1AQK7;B1AQK6	.;.;.	I	1064;1064;256;1064;1065;1065;48;48	ENSP00000360423:V1064I;ENSP00000277551:V1064I;ENSP00000277549:V256I;ENSP00000360414:V1064I;ENSP00000360408:V1065I;ENSP00000360406:V1065I;ENSP00000360418:V48I;ENSP00000441232:V48I	ENSP00000277549:V256I	V	+	1	0	CACNA1B	140039349	1.000000	0.71417	0.983000	0.44433	0.878000	0.50629	4.545000	0.60698	2.327000	0.79052	0.561000	0.74099	GTC		CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	
KLHL34	257240	broad.mit.edu	37	X	21675045	21675046	+	Frame_Shift_Ins	INS	-	-	C	rs139183650	byFrequency	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	-	-	-	C	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chrX:21675045_21675046insC	ENST00000379499.2	-	1	1402_1403	c.861_862insG	c.(859-864)gggcgcfs	p.R288fs		NM_153270.1	NP_695002.1	Q8N239	KLH34_HUMAN	kelch-like family member 34	288						extracellular space (GO:0005615)		p.R288fs*9(1)		cervix(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	26						CGTGCCCTGCGCCCCCCCACCA	0.693																																					p.R288fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.862_863insG	X						.																																			21584967	SO:0001589	frameshift_variant	257240	exon1			AK092279	CCDS14199.1	Xp22.12	2013-02-22	2013-02-22		ENSG00000185915	ENSG00000185915		"""Kelch-like"", ""BTB/POZ domain containing"""	26634	protein-coding gene	gene with protein product			"""kelch-like 34 (Drosophila)"""				Standard	NM_153270		Approved	FLJ34960, RP11-450P7.3	uc004czz.1	Q8N239	OTTHUMG00000021234	ENST00000379499.2:c.862dupG	X.37:g.21675052_21675052dupC	ENSP00000368813:p.Arg288fs	Somatic		Capture	Illumina HiSeq	Phase_I	21584966	NM_153270		Frame_Shift_Ins	INS	ENST00000379499.2	37	CCDS14199.1																																																																																				KLHL34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056022.1	NM_153270	
TRPC5	7224	broad.mit.edu	37	X	111155953	111155953	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chrX:111155953C>T	ENST00000262839.2	-	3	1384	c.466G>A	c.(466-468)Gaa>Aaa	p.E156K		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	156					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.E156K(2)		biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TTGATGATTTCGTAGTTGTTG	0.512																																					p.E156K												.	.	2	Substitution - Missense(2)	large_intestine(1)|pancreas(1)	c.G466A	X						.						121.0	102.0	109.0					X																	111155953		2203	4300	6503	111042609	SO:0001583	missense	7224	exon3			AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.466G>A	X.37:g.111155953C>T	ENSP00000262839:p.Glu156Lys	Somatic		Capture	Illumina HiSeq	Phase_I	111042609	NM_012471	B2RP53|O75233|Q5JXY8|Q9Y514	Missense_Mutation	SNP	ENST00000262839.2	37	CCDS14561.1	.	.	.	.	.	.	.	.	.	.	C	34	5.319307	0.95682	.	.	ENSG00000072315	ENST00000262839	T	0.68479	-0.33	5.43	5.43	0.79202	Ankyrin repeat-containing domain (2);	0.000000	0.85682	D	0.000000	D	0.82678	0.5089	M	0.78344	2.41	0.80722	D	1	D;D	0.76494	0.995;0.999	P;D	0.76071	0.905;0.987	D	0.85118	0.0967	10	0.87932	D	0	-27.7824	18.2995	0.90158	0.0:1.0:0.0:0.0	.	157;156	Q59G51;Q9UL62	.;TRPC5_HUMAN	K	156	ENSP00000262839:E156K	ENSP00000262839:E156K	E	-	1	0	TRPC5	111042609	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.818000	0.86416	2.260000	0.74910	0.529000	0.55759	GAA		TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057945.1	NM_012471	
SLC25A43	203427	broad.mit.edu	37	X	118587023	118587023	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chrX:118587023C>A	ENST00000217909.7	+	5	1365	c.1021C>A	c.(1021-1023)Cta>Ata	p.L341I	SLC25A43_ENST00000488158.1_3'UTR|SLC25A43_ENST00000336249.7_3'UTR	NM_145305.2	NP_660348.2	Q8WUT9	S2543_HUMAN	solute carrier family 25, member 43	341					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)		p.L341I(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|skin(1)	9						AAAACCAACTCTATAAAATGG	0.423																																					p.L341I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1021A	X						.						64.0	65.0	64.0					X																	118587023		2203	4300	6503	118471051	SO:0001583	missense	203427	exon5			BC019584	CCDS14577.1	Xq24	2013-05-22			ENSG00000077713	ENSG00000077713		"""Solute carriers"""	30557	protein-coding gene	gene with protein product		300641				16949250	Standard	NM_145305		Approved		uc004erd.3	Q8WUT9	OTTHUMG00000022272	ENST00000217909.7:c.1021C>A	X.37:g.118587023C>A	ENSP00000217909:p.Leu341Ile	Somatic		Capture	Illumina HiSeq	Phase_I	118471051	NM_145305	O75854|Q8N9L5	Missense_Mutation	SNP	ENST00000217909.7	37	CCDS14577.1	.	.	.	.	.	.	.	.	.	.	C	12.84	2.057170	0.36277	.	.	ENSG00000077713	ENST00000217909;ENST00000326714	T	0.79554	-1.28	5.24	1.1	0.20463	.	.	.	.	.	T	0.66127	0.2758	L	0.33485	1.01	0.51767	D	0.999936	B	0.16166	0.016	B	0.15870	0.014	T	0.59752	-0.7395	9	0.66056	D	0.02	.	3.1673	0.06540	0.1198:0.5402:0.1158:0.2241	.	341	Q8WUT9	S2543_HUMAN	I	341;289	ENSP00000217909:L341I	ENSP00000217909:L341I	L	+	1	2	SLC25A43	118471051	0.024000	0.19004	0.826000	0.32828	0.523000	0.34469	-0.206000	0.09398	0.408000	0.25621	0.600000	0.82982	CTA		SLC25A43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058028.1	NM_145305	
RHOXF2B	727940	broad.mit.edu	37	X	119211113	119211113	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3727-01A-01W-0899-10	TCGA-AG-3727-10A-01W-0901-10	g.chrX:119211113C>T	ENST00000371402.2	-	2	409	c.220G>A	c.(220-222)Ggc>Agc	p.G74S	RP4-755D9.1_ENST00000553843.1_RNA	NM_001099685.1	NP_001093155.1	P0C7M4	RHF2B_HUMAN	Rhox homeobox family, member 2B	74					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.G74S(1)		kidney(1)|large_intestine(2)|skin(3)|upper_aerodigestive_tract(1)	7						TCTTCTCCGCCGCCATCTTTT	0.592																																					p.G74S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G220A	X						.						14.0	17.0	16.0					X																	119211113		1929	3759	5688	119095141	SO:0001583	missense	727940	exon2				CCDS43985.1	Xq24	2011-06-20			ENSG00000203989	ENSG00000203989		"""Homeoboxes / PRD class"""	33519	protein-coding gene	gene with protein product							Standard	NM_001099685		Approved		uc004esj.4	P0C7M4	OTTHUMG00000022288	ENST00000371402.2:c.220G>A	X.37:g.119211113C>T	ENSP00000360455:p.Gly74Ser	Somatic		Capture	Illumina HiSeq	Phase_I	119095141	NM_032498		Missense_Mutation	SNP	ENST00000371402.2	37	CCDS43985.1	.	.	.	.	.	.	.	.	.	.	-	14.07	2.425452	0.43020	.	.	ENSG00000203989	ENST00000371402	D	0.91686	-2.89	1.81	0.878	0.19150	.	.	.	.	.	D	0.89663	0.6780	N	0.19112	0.55	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.79579	-0.1745	9	0.16420	T	0.52	.	5.5064	0.16856	0.0:0.6505:0.3495:0.0	.	74	P0C7M4	RHF2B_HUMAN	S	74	ENSP00000360455:G74S	ENSP00000360455:G74S	G	-	1	0	RHOXF2B	119095141	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-0.436000	0.06922	0.213000	0.20722	0.488000	0.48403	GGC		RHOXF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058081.2	NM_001099685	
