#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CUBN	8029	broad.mit.edu	37	10	17142210	17142210	+	Missense_Mutation	SNP	C	C	T	rs145380076		TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr10:17142210C>T	ENST00000377833.4	-	14	1624	c.1559G>A	c.(1558-1560)cGg>cAg	p.R520Q		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	520	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.R520Q(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GGATTCTAACCGGAAAAAAGT	0.383																																					p.R520Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1559A	10						.						70.0	72.0	71.0					10																	17142210		2203	4300	6503	17182216	SO:0001583	missense	8029	exon14			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.1559G>A	10.37:g.17142210C>T	ENSP00000367064:p.Arg520Gln	Somatic		Capture	Illumina HiSeq	Phase_I	17182216	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	C	0.390	-0.924062	0.02377	.	.	ENSG00000107611	ENST00000377833	T	0.17370	2.28	5.51	-1.31	0.09230	CUB (5);	0.577503	0.14251	N	0.331463	T	0.04272	0.0118	N	0.02142	-0.665	0.47153	D	0.999338	B	0.13594	0.008	B	0.09377	0.004	T	0.44267	-0.9339	10	0.07482	T	0.82	.	5.8002	0.18410	0.11:0.2577:0.0:0.6323	.	520	O60494	CUBN_HUMAN	Q	520	ENSP00000367064:R520Q	ENSP00000367064:R520Q	R	-	2	0	CUBN	17182216	0.493000	0.26035	0.009000	0.14445	0.095000	0.18619	0.769000	0.26604	-0.519000	0.06444	-0.312000	0.09012	CGG		CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
YME1L1	10730	broad.mit.edu	37	10	27443118	27443118	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr10:27443118C>T	ENST00000326799.3	-	1	170	c.22G>A	c.(22-24)Gtg>Atg	p.V8M	MASTL_ENST00000375940.4_5'Flank|YME1L1_ENST00000376016.3_Missense_Mutation_p.V8M|MASTL_ENST00000342386.6_5'Flank|MASTL_ENST00000375946.4_5'Flank|YME1L1_ENST00000477432.1_Missense_Mutation_p.V8M|YME1L1_ENST00000375972.3_Missense_Mutation_p.V8M	NM_139312.2	NP_647473.1	Q96TA2	YMEL1_HUMAN	YME1-like 1 ATPase	8					cell proliferation (GO:0008283)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|mitochondrion organization (GO:0007005)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.V8M(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23						TGGGGTTGCACCGTGCTCGAC	0.627																																					p.V8M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G22A	10						.						58.0	50.0	52.0					10																	27443118		2198	4292	6490	27483124	SO:0001583	missense	10730	exon1			AJ132637	CCDS7151.1, CCDS7152.1, CCDS58072.1	10p14	2013-06-10	2013-06-10		ENSG00000136758	ENSG00000136758		"""ATPases / AAA-type"""	12843	protein-coding gene	gene with protein product		607472	"""YME1 (S.cerevisiae)-like 1"", ""YME1-like 1 (S. cerevisiae)"""			22262461	Standard	NM_139312		Approved		uc001itj.3	Q96TA2	OTTHUMG00000017853	ENST00000326799.3:c.22G>A	10.37:g.27443118C>T	ENSP00000318480:p.Val8Met	Somatic		Capture	Illumina HiSeq	Phase_I	27483124	NM_014263	B4DNM1|D3DRV8|D3DRV9|Q5T8D9|Q9H1Q0|Q9UMR9	Missense_Mutation	SNP	ENST00000326799.3	37	CCDS7152.1	.	.	.	.	.	.	.	.	.	.	C	15.90	2.968336	0.53614	.	.	ENSG00000136758	ENST00000376016;ENST00000326799;ENST00000375969;ENST00000375972;ENST00000427324	D;D;D	0.94687	-3.26;-3.49;-3.26	5.9	5.9	0.94986	.	0.207799	0.41001	D	0.000963	D	0.95014	0.8386	L	0.27053	0.805	0.34146	D	0.666924	B;D;P;P	0.89917	0.435;1.0;0.859;0.498	B;D;B;B	0.91635	0.088;0.999;0.329;0.216	D	0.96953	0.9696	10	0.62326	D	0.03	-0.3865	15.7665	0.78131	0.0:1.0:0.0:0.0	.	8;8;8;8	B4DNM1;Q6PJ89;Q96TA2-2;Q96TA2	.;.;.;YMEL1_HUMAN	M	8	ENSP00000365184:V8M;ENSP00000318480:V8M;ENSP00000365139:V8M	ENSP00000318480:V8M	V	-	1	0	YME1L1	27483124	1.000000	0.71417	1.000000	0.80357	0.458000	0.32498	3.781000	0.55394	2.786000	0.95864	0.561000	0.74099	GTG		YME1L1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047306.1	NM_139312	
PDCD11	22984	broad.mit.edu	37	10	105172894	105172894	+	Missense_Mutation	SNP	G	G	A	rs148850392	byFrequency	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr10:105172894G>A	ENST00000369797.3	+	9	1094	c.1000G>A	c.(1000-1002)Gtc>Atc	p.V334I		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	334	S1 motif 3. {ECO:0000255|PROSITE- ProRule:PRU00180}.				mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)	p.V334I(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		CATCCTTTGCGTCCATCCTCG	0.597																																					p.V334I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1000A	10						.	G	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	111.0	91.0	98.0		1000	2.5	0.2	10	dbSNP_134	98	11,8589	8.4+/-32.0	0,11,4289	yes	missense	PDCD11	NM_014976.1	29	0,12,6491	AA,AG,GG		0.1279,0.0227,0.0923	probably-damaging	334/1872	105172894	12,12994	2203	4300	6503	105162884	SO:0001583	missense	22984	exon9			D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.1000G>A	10.37:g.105172894G>A	ENSP00000358812:p.Val334Ile	Somatic		Capture	Illumina HiSeq	Phase_I	105162884	NM_014976	Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	ENST00000369797.3	37	CCDS31276.1	.	.	.	.	.	.	.	.	.	.	G	8.701	0.909814	0.17833	2.27E-4	0.001279	ENSG00000148843	ENST00000369797;ENST00000543503	T	0.19105	2.17	5.47	2.49	0.30216	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);RNA-binding domain, S1 (1);Ribosomal protein S1, RNA-binding domain (1);	0.315524	0.33813	N	0.004530	T	0.19685	0.0473	M	0.62154	1.92	0.09310	N	1	B	0.18968	0.032	B	0.10450	0.005	T	0.23190	-1.0195	10	0.22706	T	0.39	-9.325	9.5711	0.39429	0.3434:0.0:0.6566:0.0	.	334	Q14690	RRP5_HUMAN	I	334	ENSP00000358812:V334I	ENSP00000358812:V334I	V	+	1	0	PDCD11	105162884	0.000000	0.05858	0.179000	0.23059	0.674000	0.39518	-0.165000	0.09968	0.250000	0.21479	0.467000	0.42956	GTC		PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050151.1		
ATP5L	10632	broad.mit.edu	37	11	118279754	118279754	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr11:118279754A>T	ENST00000300688.3	+	3	765	c.253A>T	c.(253-255)Atg>Ttg	p.M85L	ATP5L_ENST00000529770.1_3'UTR|ATP5L_ENST00000524422.1_Intron	NM_006476.4	NP_006467.4	O75964	ATP5L_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G	85					ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, coupling factor F(o) (GO:0000276)|mitochondrion (GO:0005739)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)	p.M85L(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(3)	7	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)		TGAGGTGTTGATGTGGTTTTA	0.323																																					p.M85L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A253T	11						.						113.0	105.0	107.0					11																	118279754		2200	4296	6496	117784964	SO:0001583	missense	10632	exon3			AF092124	CCDS8397.1	11q23.3	2012-10-12	2010-06-11		ENSG00000167283	ENSG00000167283		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	14247	protein-coding gene	gene with protein product			"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit g"", ""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G"""			11230166, 11042152	Standard	NR_033759		Approved	ATP5JG	uc001psx.3	O75964		ENST00000300688.3:c.253A>T	11.37:g.118279754A>T	ENSP00000300688:p.Met85Leu	Somatic		Capture	Illumina HiSeq	Phase_I	117784964	NM_006476	A8K0K3|Q96BV6|Q9UBZ7	Missense_Mutation	SNP	ENST00000300688.3	37	CCDS8397.1	.	.	.	.	.	.	.	.	.	.	A	17.51	3.406729	0.62399	.	.	ENSG00000167283	ENST00000300688	.	.	.	5.9	4.77	0.60923	.	0.103637	0.85682	D	0.000000	T	0.70316	0.3210	M	0.87900	2.915	0.80722	D	1	B	0.27380	0.177	B	0.35312	0.2	T	0.64504	-0.6392	9	0.11485	T	0.65	-14.4277	11.6151	0.51086	0.9303:0.0:0.0697:0.0	.	85	O75964	ATP5L_HUMAN	L	85	.	ENSP00000300688:M85L	M	+	1	0	ATP5L	117784964	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.552000	0.90682	1.056000	0.40484	0.528000	0.53228	ATG		ATP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389220.1	NM_006476	
OR10G4	390264	broad.mit.edu	37	11	123887117	123887117	+	Missense_Mutation	SNP	C	C	T	rs201358968	byFrequency	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr11:123887117C>T	ENST00000320891.4	+	1	836	c.836C>T	c.(835-837)aCg>aTg	p.T279M		NM_001004462.1	NP_001004462.1	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G, member 4	279						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T279M(2)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)|skin(4)|stomach(6)|upper_aerodigestive_tract(1)	48		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		ACTGTGCTGACGCCCCTTCTC	0.473													-|||	2	0.000399361	0.0	0.0029	5008	,	,		19664	0.0		0.0	False		,,,				2504	0.0				p.T279M												.	.	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)	c.C836T	11						.	C	MET/THR	0,4402		0,0,2201	108.0	93.0	98.0		836	2.6	0.5	11		98	3,8595		0,3,4296	yes	missense	OR10G4	NM_001004462.1	81	0,3,6497	TT,TC,CC		0.0349,0.0,0.0231	probably-damaging	279/312	123887117	3,12997	2201	4299	6500	123392327	SO:0001583	missense	390264	exon1			AB065757	CCDS31702.1	11q24.1	2012-08-09			ENSG00000254737	ENSG00000254737		"""GPCR / Class A : Olfactory receptors"""	14809	protein-coding gene	gene with protein product							Standard	NM_001004462		Approved		uc010sac.2	Q8NGN3	OTTHUMG00000165966	ENST00000320891.4:c.836C>T	11.37:g.123887117C>T	ENSP00000325076:p.Thr279Met	Somatic		Capture	Illumina HiSeq	Phase_I	123392327	NM_001004462	Q6IEW0	Missense_Mutation	SNP	ENST00000320891.4	37	CCDS31702.1	.	.	.	.	.	.	.	.	.	.	N	11.01	1.513019	0.27123	0.0	3.49E-4	ENSG00000254737	ENST00000320891	T	0.38401	1.14	3.48	2.56	0.30785	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40640	N	0.001050	T	0.62429	0.2427	M	0.90309	3.105	0.22996	N	0.998452	D	0.76494	0.999	D	0.72338	0.977	T	0.56275	-0.8006	10	0.87932	D	0	.	10.2744	0.43501	0.0:0.8997:0.0:0.1003	.	279	Q8NGN3	O10G4_HUMAN	M	279	ENSP00000325076:T279M	ENSP00000325076:T279M	T	+	2	0	OR10G4	123392327	0.000000	0.05858	0.491000	0.27477	0.069000	0.16628	0.831000	0.27476	0.809000	0.34255	0.580000	0.79431	ACG		OR10G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387268.1	NM_001004462	
TRIM5	85363	broad.mit.edu	37	11	5701072	5701072	+	Silent	SNP	G	G	T	rs536510027	byFrequency	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr11:5701072G>T	ENST00000380034.3	-	2	592	c.336C>A	c.(334-336)gtC>gtA	p.V112V	TRIM5_ENST00000396853.4_Silent_p.V112V|TRIM5_ENST00000380027.1_Silent_p.V112V|TRIM5_ENST00000483835.1_5'UTR|TRIM5_ENST00000396855.3_Silent_p.V112V|TRIM5_ENST00000396847.3_Silent_p.V112V|TRIM5_ENST00000305836.5_Silent_p.V112V	NM_033034.2|NM_033092.2	NP_149023.2|NP_149083.2	Q9C035	TRIM5_HUMAN	tripartite motif containing 5	112			V -> F (in dbSNP:rs11601507). {ECO:0000269|Ref.9}.		activation of innate immune response (GO:0002218)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein K63-linked ubiquitination (GO:0070534)|protein trimerization (GO:0070206)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|signaling pattern recognition receptor activity (GO:0008329)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.V112V(2)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)|Lung NSC(207;0.138)|all_lung(207;0.221)		Epithelial(150;7.21e-09)|BRCA - Breast invasive adenocarcinoma(625;0.139)		GCCAGCAAATGACCTTCCCGT	0.547																																					p.V112V												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C336A	11						.						172.0	150.0	157.0					11																	5701072		2201	4297	6498	5657648	SO:0001819	synonymous_variant	85363	exon2			AF220025	CCDS31392.1, CCDS31393.1, CCDS31394.1	11p15	2014-06-03	2011-01-25		ENSG00000132256	ENSG00000132256		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16276	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM5"", ""tripartite motif protein TRIM"""	608487	"""tripartite motif-containing 5"""			11331580	Standard	NM_033034		Approved	RNF88, TRIM5alpha	uc001mbm.2	Q9C035	OTTHUMG00000066893	ENST00000380034.3:c.336C>A	11.37:g.5701072G>T		Somatic		Capture	Illumina HiSeq	Phase_I	5657648	NM_033092	A6NGQ1|A8WFA8|D3DQS8|D3DQS9|G3GJY1|Q2MLV4|Q2MLV8|Q2MLV9|Q2MLW1|Q2MLW3|Q2MLW4|Q2MLW6|Q2MLW7|Q2MLX1|Q2MLX2|Q2MLX3|Q2MLX5|Q2MLY3|Q2MLY4|Q2V6Q6|Q6GX26|Q8WU46|Q96SR5|Q9C031|Q9C032|Q9C033|Q9C034	Silent	SNP	ENST00000380034.3	37	CCDS31393.1																																																																																				TRIM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000143360.3	NM_033034	
CHKA	1119	broad.mit.edu	37	11	67832022	67832022	+	Missense_Mutation	SNP	A	A	C	rs145358463		TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr11:67832022A>C	ENST00000265689.4	-	10	1228	c.1202T>G	c.(1201-1203)aTa>aGa	p.I401R	CHKA_ENST00000356135.5_Missense_Mutation_p.I383R|CHKA_ENST00000533728.1_5'Flank	NM_001277.2	NP_001268.2	P35790	CHKA_HUMAN	choline kinase alpha	401					CDP-choline pathway (GO:0006657)|choline metabolic process (GO:0019695)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|choline binding (GO:0033265)|choline kinase activity (GO:0004103)|cholinesterase activity (GO:0004104)|drug binding (GO:0008144)|ethanolamine kinase activity (GO:0004305)|signal transducer activity (GO:0004871)	p.I401R(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	13					Choline(DB00122)	TTCTTCTTTTATAATGGATTT	0.299																																					p.I383R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1148G	11						.						67.0	69.0	68.0					11																	67832022		2199	4291	6490	67588598	SO:0001583	missense	1119	exon9			D10704	CCDS8178.1, CCDS8179.1	11q13.1	2008-02-05	2004-04-19	2004-04-21	ENSG00000110721	ENSG00000110721	2.7.1.32		1937	protein-coding gene	gene with protein product		118491	"""choline kinase"""	CHK		1618328, 15003397	Standard	NM_001277		Approved	CKI	uc001onj.3	P35790	OTTHUMG00000167424	ENST00000265689.4:c.1202T>G	11.37:g.67832022A>C	ENSP00000265689:p.Ile401Arg	Somatic		Capture	Illumina HiSeq	Phase_I	67588598	NM_212469	Q8NE29	Missense_Mutation	SNP	ENST00000265689.4	37	CCDS8178.1	.	.	.	.	.	.	.	.	.	.	A	5.918	0.353404	0.11182	.	.	ENSG00000110721	ENST00000265689;ENST00000356135	T;T	0.65549	-0.16;-0.16	5.67	4.55	0.56014	Protein kinase-like domain (1);	0.378221	0.29760	N	0.011276	T	0.43700	0.1259	N	0.17674	0.51	0.45634	D	0.998566	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.002	T	0.21008	-1.0258	10	0.16896	T	0.51	-10.847	10.8192	0.46595	0.925:0.0:0.075:0.0	.	383;401	P35790-2;P35790	.;CHKA_HUMAN	R	401;383	ENSP00000265689:I401R;ENSP00000348454:I383R	ENSP00000265689:I401R	I	-	2	0	CHKA	67588598	0.151000	0.22747	0.637000	0.29366	0.504000	0.33889	3.433000	0.52834	0.990000	0.38787	0.533000	0.62120	ATA		CHKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394570.1	NM_001277	
GRM5	2915	broad.mit.edu	37	11	88301104	88301104	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr11:88301104C>G	ENST00000305447.4	-	7	1896	c.1747G>C	c.(1747-1749)Gct>Cct	p.A583P	GRM5_ENST00000418177.2_Missense_Mutation_p.A583P|GRM5_ENST00000305432.5_Missense_Mutation_p.A583P|GRM5_ENST00000455756.2_Missense_Mutation_p.A583P|GRM5_ENST00000393297.1_Missense_Mutation_p.A583P	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	583					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.A583P(1)		NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	AACACCACAGCTGCAATGGGT	0.493																																					p.A583P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1747C	11						.						64.0	61.0	62.0					11																	88301104		2201	4299	6500	87940752	SO:0001583	missense	2915	exon8			D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.1747G>C	11.37:g.88301104C>G	ENSP00000306138:p.Ala583Pro	Somatic		Capture	Illumina HiSeq	Phase_I	87940752	NM_000842	Q6J164	Missense_Mutation	SNP	ENST00000305447.4	37	CCDS44694.1	.	.	.	.	.	.	.	.	.	.	C	12.75	2.031338	0.35797	.	.	ENSG00000168959	ENST00000418177;ENST00000455756;ENST00000305432;ENST00000305447;ENST00000393297	D;D;D;D;D	0.88431	-2.34;-2.35;-2.35;-2.34;-2.38	5.71	5.71	0.89125	GPCR, family 3, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.91385	0.7282	L	0.28556	0.865	0.80722	D	1	D;B	0.89917	1.0;0.355	D;B	0.87578	0.998;0.057	D	0.89795	0.3971	9	.	.	.	.	19.8631	0.96790	0.0:1.0:0.0:0.0	.	583;583	P41594-2;P41594	.;GRM5_HUMAN	P	583	ENSP00000402912:A583P;ENSP00000405690:A583P;ENSP00000305905:A583P;ENSP00000306138:A583P;ENSP00000376975:A583P	.	A	-	1	0	GRM5	87940752	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.999000	0.70665	2.709000	0.92574	0.655000	0.94253	GCT		GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259226.1	NM_000842	
NCAPD3	23310	broad.mit.edu	37	11	134054798	134054798	+	Splice_Site	SNP	C	C	G			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr11:134054798C>G	ENST00000534548.2	-	18	2399	c.2335G>C	c.(2335-2337)Gat>Cat	p.D779H	RP11-700F16.3_ENST00000531710.1_RNA	NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	779					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)	p.D779H(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		AGACACTCACCAGTCACTTTG	0.433																																					p.D779H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2335C	11						.						298.0	308.0	305.0					11																	134054798		2201	4297	6498	133560008	SO:0001630	splice_region_variant	23310	exon18			AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.2335+1G>C	11.37:g.134054798C>G		Somatic		Capture	Illumina HiSeq	Phase_I	133560008	NM_015261	A6NFS2|Q4KMQ9	Missense_Mutation	SNP	ENST00000534548.2	37	CCDS31723.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.483981	0.84854	.	.	ENSG00000151503	ENST00000534548	T	0.66995	-0.24	5.86	5.86	0.93980	Armadillo-like helical (1);Armadillo-type fold (1);	0.353901	0.35124	N	0.003422	T	0.72977	0.3528	M	0.65975	2.015	0.80722	D	1	D	0.65815	0.995	P	0.53185	0.72	T	0.73148	-0.4074	9	.	.	.	-6.3925	12.6481	0.56746	0.0:0.9246:0.0:0.0754	.	779	P42695	CNDD3_HUMAN	H	779	ENSP00000433681:D779H	.	D	-	1	0	NCAPD3	133560008	1.000000	0.71417	0.969000	0.41365	0.931000	0.56810	4.838000	0.62803	2.775000	0.95449	0.655000	0.94253	GAT		NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393575.2	NM_015261	Missense_Mutation
C12orf42	374470	broad.mit.edu	37	12	103695938	103695938	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr12:103695938G>A	ENST00000378113.2	-	6	1256	c.1031C>T	c.(1030-1032)aCg>aTg	p.T344M	C12orf42_ENST00000548883.1_Missense_Mutation_p.T344M|C12orf42_ENST00000315192.8_Intron|C12orf42_ENST00000548048.1_Missense_Mutation_p.T277M	NM_001099336.1	NP_001092806.1	Q96LP6	CL042_HUMAN	chromosome 12 open reading frame 42	344								p.T344M(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)	22						TGAACAAACCGTATGGAAACG	0.562																																					p.T344M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1031T	12						.						55.0	62.0	60.0					12																	103695938		1839	4082	5921	102220068	SO:0001583	missense	374470	exon6			AK058052	CCDS44963.1	12q23.2	2012-05-30			ENSG00000179088	ENSG00000179088			24729	protein-coding gene	gene with protein product							Standard	NM_001099336		Approved	FLJ25323	uc001tjt.2	Q96LP6	OTTHUMG00000169988	ENST00000378113.2:c.1031C>T	12.37:g.103695938G>A	ENSP00000367353:p.Thr344Met	Somatic		Capture	Illumina HiSeq	Phase_I	102220068	NM_001099336	Q49A64|Q4G0S2	Missense_Mutation	SNP	ENST00000378113.2	37	CCDS44963.1	.	.	.	.	.	.	.	.	.	.	G	11.36	1.614632	0.28712	.	.	ENSG00000179088	ENST00000548883;ENST00000548048;ENST00000378113	T;T;T	0.58210	0.35;0.35;0.35	5.06	-2.38	0.06622	.	0.843870	0.09924	N	0.738078	T	0.33702	0.0872	L	0.29908	0.895	0.25549	N	0.987105	P	0.46578	0.88	B	0.41894	0.369	T	0.23084	-1.0198	10	0.52906	T	0.07	-1.7934	2.1918	0.03901	0.1673:0.1325:0.1206:0.5795	.	344	Q96LP6	CL042_HUMAN	M	344;277;344	ENSP00000447908:T344M;ENSP00000449362:T277M;ENSP00000367353:T344M	ENSP00000367353:T344M	T	-	2	0	C12orf42	102220068	1.000000	0.71417	0.987000	0.45799	0.222000	0.24845	0.833000	0.27504	-0.284000	0.09102	0.655000	0.94253	ACG		C12orf42-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406754.1	NM_198521	
GCN1L1	10985	broad.mit.edu	37	12	120591164	120591164	+	Silent	SNP	G	G	A	rs148374886	byFrequency	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr12:120591164G>A	ENST00000300648.6	-	33	3927	c.3915C>T	c.(3913-3915)aaC>aaT	p.N1305N	MIR4498_ENST00000577599.1_RNA	NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	1305					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)	p.N1305N(1)		NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CATTGGGCGCGTTCTTCAGGA	0.562													G|||	6	0.00119808	0.0045	0.0	5008	,	,		20875	0.0		0.0	False		,,,				2504	0.0				p.N1305N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3915T	12						.	G		8,4176		0,8,2084	70.0	75.0	73.0		3915	-7.2	0.6	12	dbSNP_134	73	0,8438		0,0,4219	no	coding-synonymous	GCN1L1	NM_006836.1		0,8,6303	AA,AG,GG		0.0,0.1912,0.0634		1305/2672	120591164	8,12614	2092	4219	6311	119075547	SO:0001819	synonymous_variant	10985	exon33			U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.3915C>T	12.37:g.120591164G>A		Somatic		Capture	Illumina HiSeq	Phase_I	119075547	NM_006836	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Silent	SNP	ENST00000300648.6	37	CCDS41847.1																																																																																				GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1		
CDCA3	83461	broad.mit.edu	37	12	6958846	6958846	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr12:6958846C>G	ENST00000538862.2	-	4	1328	c.427G>C	c.(427-429)Gag>Cag	p.E143Q	USP5_ENST00000389231.5_5'Flank|CDCA3_ENST00000535406.1_Missense_Mutation_p.E143Q|CDCA3_ENST00000604599.1_5'Flank|USP5_ENST00000229268.8_5'Flank|CDCA3_ENST00000540683.1_Missense_Mutation_p.E143Q|CDCA3_ENST00000422785.3_Missense_Mutation_p.E143Q|CDCA3_ENST00000229265.6_Missense_Mutation_p.E118Q			Q99618	CDCA3_HUMAN	cell division cycle associated 3	143					mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)		p.E143Q(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(1)|stomach(1)	8						GAGGGGAACTCAGTCTGGTTC	0.552																																					p.E143Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G427C	12						.						69.0	72.0	71.0					12																	6958846		2203	4300	6503	6829107	SO:0001583	missense	83461	exon4			BG354576	CCDS8565.1, CCDS73428.1	12p13.31	2010-07-20				ENSG00000111665			14624	protein-coding gene	gene with protein product	"""trigger of mitotic entry 1"""	607749				9074930, 12188893	Standard	XR_242988		Approved	TOME-1, GRCC8	uc001qrg.2	Q99618		ENST00000538862.2:c.427G>C	12.37:g.6958846C>G	ENSP00000442068:p.Glu143Gln	Somatic		Capture	Illumina HiSeq	Phase_I	6829107	NM_031299	A8K5V6|D3DUS6	Missense_Mutation	SNP	ENST00000538862.2	37	CCDS8565.1	.	.	.	.	.	.	.	.	.	.	C	13.50	2.257111	0.39896	.	.	ENSG00000237240;ENSG00000111665;ENSG00000111665;ENSG00000111665;ENSG00000111665	ENST00000422785;ENST00000229265;ENST00000538862;ENST00000535406;ENST00000540683	.	.	.	5.34	2.48	0.30137	.	0.284743	0.32386	N	0.006162	T	0.41858	0.1177	M	0.65975	2.015	0.09310	N	0.999998	B;B	0.20550	0.046;0.043	B;B	0.27796	0.081;0.083	T	0.32613	-0.9900	9	0.32370	T	0.25	-10.2716	5.5531	0.17101	0.0:0.6623:0.1628:0.1749	.	143;143	Q99618;F8WDL1	CDCA3_HUMAN;.	Q	143;118;143;143;143	.	ENSP00000229265:E118Q	E	-	1	0	U47924.25;CDCA3	6829107	1.000000	0.71417	0.179000	0.23059	0.446000	0.32137	1.101000	0.31037	0.461000	0.27071	-0.157000	0.13467	GAG		CDCA3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401940.2	NM_031299	
EPS8	2059	broad.mit.edu	37	12	15818787	15818787	+	Silent	SNP	G	G	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr12:15818787G>A	ENST00000281172.5	-	8	1075	c.639C>T	c.(637-639)ccC>ccT	p.P213P	EPS8_ENST00000543612.1_Silent_p.P213P|EPS8_ENST00000543523.1_Silent_p.P213P	NM_004447.5	NP_004438.3	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway substrate 8	213					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|actin filament bundle assembly (GO:0051017)|actin polymerization-dependent cell motility (GO:0070358)|adult locomotory behavior (GO:0008344)|barbed-end actin filament capping (GO:0051016)|behavioral response to ethanol (GO:0048149)|cell proliferation (GO:0008283)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|exit from mitosis (GO:0010458)|positive regulation of signal transduction (GO:0009967)|Rac protein signal transduction (GO:0016601)|regulation of actin filament length (GO:0030832)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|ruffle membrane (GO:0032587)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actin binding (GO:0003779)|Rac GTPase binding (GO:0048365)|SH3/SH2 adaptor activity (GO:0005070)	p.P213P(1)		NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		CAGGAGCTCTGGGTGGAGGCG	0.493																																					p.P213P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C639T	12						.						48.0	50.0	49.0					12																	15818787		2203	4300	6503	15710054	SO:0001819	synonymous_variant	2059	exon8			U12535	CCDS31753.1	12p12.3	2008-05-02				ENSG00000151491			3420	protein-coding gene	gene with protein product		600206				8084614	Standard	NM_004447		Approved		uc001rdb.3	Q12929		ENST00000281172.5:c.639C>T	12.37:g.15818787G>A		Somatic		Capture	Illumina HiSeq	Phase_I	15710054	NM_004447	A6NMC3|A8K6W2|A8KA66|B4DX66|Q8N6J0	Silent	SNP	ENST00000281172.5	37	CCDS31753.1																																																																																				EPS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401093.1		
METTL7A	25840	broad.mit.edu	37	12	51323839	51323839	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr12:51323839G>A	ENST00000548553.1	+	3	1622	c.641G>A	c.(640-642)cGg>cAg	p.R214Q	METTL7A_ENST00000332160.4_Missense_Mutation_p.R214Q			Q9H8H3	MET7A_HUMAN	methyltransferase like 7A	214						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|membrane (GO:0016020)	methyltransferase activity (GO:0008168)	p.R214Q(1)		endometrium(1)|large_intestine(4)|lung(4)|upper_aerodigestive_tract(1)	10						GCCCTGGAGCGGGCCAGCTTC	0.547																																					p.R214Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G641A	12						.						79.0	79.0	79.0					12																	51323839		2203	4300	6503	49610106	SO:0001583	missense	25840	exon2				CCDS8804.1	12q13.12	2013-06-20			ENSG00000185432	ENSG00000185432			24550	protein-coding gene	gene with protein product						12975309	Standard	XM_006719332		Approved	DKFZP586A0522	uc001rxb.3	Q9H8H3	OTTHUMG00000169484	ENST00000548553.1:c.641G>A	12.37:g.51323839G>A	ENSP00000448785:p.Arg214Gln	Somatic		Capture	Illumina HiSeq	Phase_I	49610106	NM_014033	Q9H7R3|Q9UHZ7|Q9Y422	Missense_Mutation	SNP	ENST00000548553.1	37	CCDS8804.1	.	.	.	.	.	.	.	.	.	.	G	10.76	1.441835	0.25900	.	.	ENSG00000185432	ENST00000548553;ENST00000332160;ENST00000433599	T;T	0.18338	2.22;2.22	5.61	-4.74	0.03249	.	1.731360	0.03088	N	0.159399	T	0.10852	0.0265	N	0.16016	0.355	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.31943	-0.9925	10	0.13853	T	0.58	-8.1188	14.7983	0.69894	0.6438:0.0:0.3562:0.0	.	214	Q9H8H3	MET7A_HUMAN	Q	214;214;145	ENSP00000448785:R214Q;ENSP00000331787:R214Q	ENSP00000331787:R214Q	R	+	2	0	METTL7A	49610106	0.000000	0.05858	0.001000	0.08648	0.849000	0.48306	-0.491000	0.06474	-1.200000	0.02662	0.655000	0.94253	CGG		METTL7A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404294.2	NM_014033	
RDH16	8608	broad.mit.edu	37	12	57345981	57345981	+	Silent	SNP	C	C	T	rs372244884		TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr12:57345981C>T	ENST00000398138.3	-	4	1642	c.786G>A	c.(784-786)tcG>tcA	p.S262S	RDH16_ENST00000360752.4_5'UTR	NM_003708.3	NP_003699.3	O75452	RDH16_HUMAN	retinol dehydrogenase 16 (all-trans)	262					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	electron carrier activity (GO:0009055)|retinol dehydrogenase activity (GO:0004745)	p.S262S(2)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)	16						TGGTCACCAACGACAGATCCT	0.502													C|||	1	0.000199681	0.0008	0.0	5008	,	,		22190	0.0		0.0	False		,,,				2504	0.0				p.S262S	GBM(179;741 2921 43105 45298)											.	.	2	Substitution - coding silent(2)	large_intestine(1)|kidney(1)	c.G786A	12						.	C		1,4251		0,1,2125	90.0	100.0	97.0		786	0.1	0.0	12		97	0,8496		0,0,4248	no	coding-synonymous	RDH16	NM_003708.3		0,1,6373	TT,TC,CC		0.0,0.0235,0.0078		262/318	57345981	1,12747	2126	4248	6374	55632248	SO:0001819	synonymous_variant	8608	exon4				CCDS41797.1	12q13.3	2011-09-14	2006-05-09			ENSG00000139547		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	29674	protein-coding gene	gene with protein product	"""microsomal NAD+ dependent retinol dehydrogenase 4"", ""short chain dehydrogenase/reductase family 9C, member 8"""		"""retinol dehydrogenase 16 (all-trans and 13-cis)"""			9677409, 10329026, 19027726	Standard	NM_003708		Approved	RODH-4, SDR9C8	uc001smi.4	O75452		ENST00000398138.3:c.786G>A	12.37:g.57345981C>T		Somatic		Capture	Illumina HiSeq	Phase_I	55632248	NM_003708	Q9UNV2	Silent	SNP	ENST00000398138.3	37	CCDS41797.1																																																																																				RDH16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410898.1	NM_003708	
SLC6A15	55117	broad.mit.edu	37	12	85255570	85255570	+	Silent	SNP	G	G	A	rs140619291	byFrequency	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr12:85255570G>A	ENST00000266682.5	-	12	2575	c.2034C>T	c.(2032-2034)caC>caT	p.H678H	SLC6A15_ENST00000309283.7_3'UTR|SLC6A15_ENST00000552192.1_Silent_p.H571H	NM_182767.5	NP_877499.1	Q9H2J7	S6A15_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 15	678					amino acid transport (GO:0006865)|ion transport (GO:0006811)|leucine transport (GO:0015820)|neurotransmitter transport (GO:0006836)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)|proline:sodium symporter activity (GO:0005298)	p.H678H(1)		kidney(1)|large_intestine(18)|lung(15)|ovary(1)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	44						GTATTTTTCCGTGAATGAGGC	0.433													G|||	3	0.000599042	0.0	0.0	5008	,	,		17036	0.003		0.0	False		,,,				2504	0.0				p.H678H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2034T	12						.	G	,	2,4404	4.2+/-10.8	0,2,2201	122.0	119.0	120.0		1713,2034	-5.1	1.0	12	dbSNP_134	120	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	SLC6A15	NM_001146335.1,NM_182767.4	,	0,3,6500	AA,AG,GG		0.0116,0.0454,0.0231	,	571/624,678/731	85255570	3,13003	2203	4300	6503	83779701	SO:0001819	synonymous_variant	55117	exon12			AF265577	CCDS9026.1, CCDS9027.1, CCDS53816.1	12q21.31	2013-07-15	2008-09-02		ENSG00000072041	ENSG00000072041		"""Solute carriers"""	13621	protein-coding gene	gene with protein product	"""homolog of rat orphan transporter v7-3"", ""sodium/chloride dependent neurotransmitter transporter Homo sapiens orphan neurotransmitter transporter NTT7"""	607971	"""solute carrier family 6 (neurotransmitter transporter), member 15"""			10471414, 11112352, 16185194	Standard	NM_182767		Approved	hv7-3, NTT73, FLJ10316, V7-3, SBAT1	uc001szv.4	Q9H2J7	OTTHUMG00000169742	ENST00000266682.5:c.2034C>T	12.37:g.85255570G>A		Somatic		Capture	Illumina HiSeq	Phase_I	83779701	NM_182767	A8K592|B7Z2P7|E7ESJ5|Q9H9F5	Silent	SNP	ENST00000266682.5	37	CCDS9026.1																																																																																				SLC6A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405678.1	NM_018057, NM_182767	
DNAH10	196385	broad.mit.edu	37	12	124272483	124272483	+	Silent	SNP	G	G	T			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr12:124272483G>T	ENST00000409039.3	+	10	1396	c.1371G>T	c.(1369-1371)cgG>cgT	p.R457R		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	457	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R457R(1)|p.R275R(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		AGTTTGACCGGAAGCGGCTGT	0.597																																					p.R457R												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1371T	12						.						53.0	43.0	46.0					12																	124272483		2203	4300	6503	122838436	SO:0001819	synonymous_variant	196385	exon10			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.1371G>T	12.37:g.124272483G>T		Somatic		Capture	Illumina HiSeq	Phase_I	122838436	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	ENST00000409039.3	37	CCDS9255.2																																																																																				DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
RB1	5925	broad.mit.edu	37	13	49033946	49033946	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr13:49033946A>G	ENST00000267163.4	+	20	2221	c.2083A>G	c.(2083-2085)Atg>Gtg	p.M695V		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	695	Domain B.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(11)|p.M695V(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GTATGAACTCATGAGAGACAG	0.413		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																											p.M695V		yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	.	.	27	Whole gene deletion(15)|Unknown(11)|Substitution - Missense(1)	bone(10)|breast(5)|haematopoietic_and_lymphoid_tissue(4)|adrenal_gland(1)|large_intestine(1)|eye(1)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|lung(1)|liver(1)	c.A2083G	13						.						80.0	74.0	76.0					13																	49033946		2203	4300	6503	47931947	SO:0001583	missense	5925	exon20	Familial Cancer Database		M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.2083A>G	13.37:g.49033946A>G	ENSP00000267163:p.Met695Val	Somatic		Capture	Illumina HiSeq	Phase_I	47931947	NM_000321	A8K5E3|P78499|Q5VW46|Q8IZL4	Missense_Mutation	SNP	ENST00000267163.4	37	CCDS31973.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.596761	0.86953	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	D	0.91740	-2.9	5.48	5.48	0.80851	Retinoblastoma-associated protein, B-box (1);Cyclin-like (3);	0.000000	0.85682	D	0.000000	D	0.95159	0.8431	M	0.73319	2.225	0.80722	D	1	D	0.65815	0.995	D	0.63488	0.915	D	0.95650	0.8706	10	0.87932	D	0	-17.3092	15.5642	0.76277	1.0:0.0:0.0:0.0	.	695	P06400	RB_HUMAN	V	674;695	ENSP00000267163:M695V	ENSP00000267163:M695V	M	+	1	0	RB1	47931947	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.005000	0.76323	2.086000	0.62901	0.477000	0.44152	ATG		RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1		
ATP10A	57194	broad.mit.edu	37	15	25924611	25924611	+	Silent	SNP	C	C	A	rs149560828		TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr15:25924611C>A	ENST00000356865.6	-	21	4488	c.4377G>T	c.(4375-4377)acG>acT	p.T1459T		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1459					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.T1459T(1)		NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		CAAGCTGCTCCGTCCGGGAGA	0.572																																					p.T1459T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4377T	15						.						54.0	54.0	54.0					15																	25924611		2203	4300	6503	23475704	SO:0001819	synonymous_variant	57194	exon21			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.4377G>T	15.37:g.25924611C>A		Somatic		Capture	Illumina HiSeq	Phase_I	23475704	NM_024490	Q4G0S9|Q969I4	Silent	SNP	ENST00000356865.6	37	CCDS32178.1																																																																																				ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	
KIAA1024	23251	broad.mit.edu	37	15	79749974	79749974	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr15:79749974G>T	ENST00000305428.3	+	2	1560	c.1485G>T	c.(1483-1485)caG>caT	p.Q495H		NM_015206.2	NP_056021.1	Q9UPX6	K1024_HUMAN	KIAA1024	495						integral component of membrane (GO:0016021)		p.Q495H(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(2)|pancreas(2)|prostate(1)	49						CCTCTGGTCAGGGCAAGTACA	0.537																																					p.Q495H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1485T	15						.						96.0	79.0	85.0					15																	79749974		2196	4293	6489	77537029	SO:0001583	missense	23251	exon2			AB028947	CCDS32306.1	15q25.1	2007-12-12				ENSG00000169330			29172	protein-coding gene	gene with protein product						10470851	Standard	NM_015206		Approved		uc002bew.1	Q9UPX6		ENST00000305428.3:c.1485G>T	15.37:g.79749974G>T	ENSP00000307461:p.Gln495His	Somatic		Capture	Illumina HiSeq	Phase_I	77537029	NM_015206	A7MD43	Missense_Mutation	SNP	ENST00000305428.3	37	CCDS32306.1	.	.	.	.	.	.	.	.	.	.	G	10.38	1.334886	0.24253	.	.	ENSG00000169330	ENST00000305428	T	0.33865	1.39	4.92	3.99	0.46301	.	0.496732	0.23600	N	0.046442	T	0.35913	0.0948	M	0.65975	2.015	0.36637	D	0.876634	P	0.46277	0.875	P	0.44732	0.459	T	0.41910	-0.9482	9	.	.	.	.	4.5655	0.12184	0.0882:0.1527:0.6017:0.1574	.	495	Q9UPX6	K1024_HUMAN	H	495	ENSP00000307461:Q495H	.	Q	+	3	2	KIAA1024	77537029	0.994000	0.37717	0.989000	0.46669	0.106000	0.19336	1.026000	0.30103	1.032000	0.39892	0.491000	0.48974	CAG		KIAA1024-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416718.1	NM_015206	
ZNF629	23361	broad.mit.edu	37	16	30793957	30793957	+	Silent	SNP	C	C	T			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr16:30793957C>T	ENST00000262525.4	-	3	1899	c.1692G>A	c.(1690-1692)ccG>ccA	p.P564P	RP11-2C24.6_ENST00000575562.1_RNA	NM_001080417.1	NP_001073886.1	Q9UEG4	ZN629_HUMAN	zinc finger protein 629	564					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P564P(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(3)|urinary_tract(1)	22			Colorectal(24;0.198)			GCTTGGCTCCCGGCGGCGGGG	0.647																																					p.P564P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1692A	16						.						28.0	28.0	28.0					16																	30793957		1964	4112	6076	30701458	SO:0001819	synonymous_variant	23361	exon3			AB002324	CCDS45463.1	16p11.2	2013-01-08				ENSG00000102870		"""Zinc fingers, C2H2-type"""	29008	protein-coding gene	gene with protein product			"""zinc finger protein 65"""	ZNF65		9205841	Standard	NM_001080417		Approved	KIAA0326	uc002dzs.1	Q9UEG4		ENST00000262525.4:c.1692G>A	16.37:g.30793957C>T		Somatic		Capture	Illumina HiSeq	Phase_I	30701458	NM_001080417	Q15938	Silent	SNP	ENST00000262525.4	37	CCDS45463.1																																																																																				ZNF629-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434291.1	NM_015309	
HYDIN	54768	broad.mit.edu	37	16	71008137	71008137	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr16:71008137C>G	ENST00000393567.2	-	33	5126	c.4976G>C	c.(4975-4977)aGa>aCa	p.R1659T		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	1659					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.R1610T(1)|p.R1658T(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TGGGTCAAATCTCACTTCAAA	0.458																																					p.R1658T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G4973C	16						.						18.0	18.0	18.0					16																	71008137		1818	4064	5882	69565638	SO:0001583	missense	54768	exon33			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.4976G>C	16.37:g.71008137C>G	ENSP00000377197:p.Arg1659Thr	Somatic		Capture	Illumina HiSeq	Phase_I	69565638	NM_032821	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	C	4.376	0.069264	0.08436	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00753	5.74	4.81	2.76	0.32466	.	0.283844	0.16109	U	0.229207	T	0.00754	0.0025	L	0.33137	0.985	0.80722	D	1	P	0.37330	0.59	B	0.38954	0.286	T	0.69910	-0.5017	10	0.11794	T	0.64	.	7.092	0.25289	0.0:0.7041:0.0:0.2959	.	1658	F8WD23	.	T	1659;1658	ENSP00000377197:R1659T	ENSP00000313052:R1658T	R	-	2	0	HYDIN	69565638	0.548000	0.26473	0.998000	0.56505	0.274000	0.26718	1.233000	0.32648	1.085000	0.41206	0.505000	0.49811	AGA		HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
MYH3	4621	broad.mit.edu	37	17	10541653	10541653	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr17:10541653C>A	ENST00000583535.1	-	27	3523	c.3436G>T	c.(3436-3438)Gag>Tag	p.E1146*	MYH3_ENST00000226209.7_Nonsense_Mutation_p.E1146*	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	1146					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)	p.E1146*(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						TCGCTCAGCTCCTCCAGCTCC	0.637																																					p.E1146X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G3436T	17						.						34.0	36.0	35.0					17																	10541653		2203	4300	6503	10482378	SO:0001587	stop_gained	4621	exon26				CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.3436G>T	17.37:g.10541653C>A	ENSP00000464317:p.Glu1146*	Somatic		Capture	Illumina HiSeq	Phase_I	10482378	NM_002470	Q15492	Nonsense_Mutation	SNP	ENST00000583535.1	37	CCDS11157.1	.	.	.	.	.	.	.	.	.	.	C	43	10.238455	0.99366	.	.	ENSG00000109063	ENST00000226209	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.661	0.95871	0.0:1.0:0.0:0.0	.	.	.	.	X	1146	.	ENSP00000226209:E1146X	E	-	1	0	MYH3	10482378	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	7.776000	0.85560	2.714000	0.92807	0.563000	0.77884	GAG		MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2	NM_002470	
VTN	7448	broad.mit.edu	37	17	26695960	26695960	+	Silent	SNP	G	G	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr17:26695960G>A	ENST00000226218.4	-	5	1377	c.759C>T	c.(757-759)aaC>aaT	p.N253N	TMEM199_ENST00000509083.1_Intron|SARM1_ENST00000379061.4_Intron|CTB-96E2.2_ENST00000555059.2_5'Flank|SARM1_ENST00000457710.3_5'Flank|CTB-96E2.3_ENST00000591482.1_RNA|VTN_ENST00000438614.1_5'Flank|VTN_ENST00000536498.1_De_novo_Start_InFrame	NM_000638.3	NP_000629.3	P04004	VTNC_HUMAN	vitronectin	253					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endopeptidase activity (GO:0010951)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein binding (GO:0032092)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of wound healing (GO:0090303)|regulation of complement activation (GO:0030449)|smooth muscle cell-matrix adhesion (GO:0061302)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|blood microparticle (GO:0072562)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.N253N(1)		kidney(2)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	13	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Abciximab(DB00054)	CTGCATCCACGTTGTCCGGGA	0.592																																					p.N253N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C759T	17						.						96.0	92.0	93.0					17																	26695960		2203	4300	6503	23720087	SO:0001819	synonymous_variant	7448	exon5			BC005046	CCDS11229.1	17q11.2	2014-08-08	2006-02-10		ENSG00000109072	ENSG00000109072		"""Endogenous ligands"""	12724	protein-coding gene	gene with protein product	"""serum spreading factor"", ""somatomedin B"", ""complement S-protein"""	193190	"""vitronectin (serum spreading factor, somatomedin B, complement S-protein)"""			2447940	Standard	NM_000638		Approved	VN	uc002hbc.3	P04004	OTTHUMG00000132500	ENST00000226218.4:c.759C>T	17.37:g.26695960G>A		Somatic		Capture	Illumina HiSeq	Phase_I	23720087	NM_000638	B2R7G0|P01141|Q9BSH7	Silent	SNP	ENST00000226218.4	37	CCDS11229.1																																																																																				VTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255680.2	NM_000638	
C17orf47	284083	broad.mit.edu	37	17	56620511	56620511	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr17:56620511G>A	ENST00000321691.3	-	1	1218	c.1037C>T	c.(1036-1038)cCa>cTa	p.P346L	RP11-112H10.4_ENST00000580769.1_RNA|RP11-112H10.4_ENST00000580589.1_RNA|SEPT4_ENST00000412945.3_5'Flank|SEPT4_ENST00000457347.2_5'Flank|RP11-112H10.4_ENST00000578022.1_RNA	NM_001038704.2	NP_001033793	Q8NEP4	CQ047_HUMAN	chromosome 17 open reading frame 47	346								p.P346L(1)		NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	24	Medulloblastoma(34;0.127)|all_neural(34;0.237)					ATGGTGAGTTGGCTCTACTGA	0.532																																					p.P346L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1037T	17						.						137.0	121.0	127.0					17																	56620511		2203	4300	6503	53975510	SO:0001583	missense	284083	exon1				CCDS32691.1	17q23.2	2012-10-11			ENSG00000181013	ENSG00000181013			26844	protein-coding gene	gene with protein product							Standard	NM_001038704		Approved	FLJ40121	uc002iwq.2	Q8NEP4	OTTHUMG00000179244	ENST00000321691.3:c.1037C>T	17.37:g.56620511G>A	ENSP00000354874:p.Pro346Leu	Somatic		Capture	Illumina HiSeq	Phase_I	53975510	NM_001038704	Q8N821	Missense_Mutation	SNP	ENST00000321691.3	37	CCDS32691.1	.	.	.	.	.	.	.	.	.	.	G	7.998	0.754683	0.15778	.	.	ENSG00000181013	ENST00000321691	T	0.28666	1.6	4.21	0.633	0.17712	.	1.621520	0.03943	N	0.287162	T	0.14700	0.0355	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.19128	-1.0315	10	0.27785	T	0.31	-0.1284	2.0739	0.03619	0.1149:0.2:0.4799:0.2052	.	346	Q8NEP4	CQ047_HUMAN	L	346	ENSP00000354874:P346L	ENSP00000354874:P346L	P	-	2	0	C17orf47	53975510	0.000000	0.05858	0.001000	0.08648	0.044000	0.14063	0.024000	0.13555	0.453000	0.26858	0.462000	0.41574	CCA		C17orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445443.1	NM_001038704	
SCN4A	6329	broad.mit.edu	37	17	62049740	62049740	+	Missense_Mutation	SNP	G	G	A	rs150158100	byFrequency	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr17:62049740G>A	ENST00000435607.1	-	2	440	c.364C>T	c.(364-366)Cgc>Tgc	p.R122C	SCN4A_ENST00000578147.1_Missense_Mutation_p.R122C|CTC-264K15.6_ENST00000577329.1_lincRNA	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	122					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.R122C(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATGGCCCCGCGCCTGACTACG	0.612													G|||	2	0.000399361	0.0	0.0	5008	,	,		21174	0.0		0.002	False		,,,				2504	0.0				p.R122C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C364T	17						.						64.0	68.0	66.0					17																	62049740		2155	4262	6417	59403472	SO:0001583	missense	6329	exon2			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.364C>T	17.37:g.62049740G>A	ENSP00000396320:p.Arg122Cys	Somatic		Capture	Illumina HiSeq	Phase_I	59403472	NM_000334	Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	ENST00000435607.1	37	CCDS45761.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	G	14.04	2.415786	0.42817	.	.	ENSG00000007314	ENST00000435607	D	0.97186	-4.28	4.23	3.24	0.37175	.	0.190420	0.45606	D	0.000353	D	0.98257	0.9423	M	0.91561	3.22	0.58432	D	0.999998	D	0.89917	1.0	D	0.63033	0.91	D	0.98352	1.0544	10	0.87932	D	0	.	10.3651	0.44019	0.0:0.0:0.5026:0.4974	.	122	P35499	SCN4A_HUMAN	C	122	ENSP00000396320:R122C	ENSP00000396320:R122C	R	-	1	0	SCN4A	59403472	1.000000	0.71417	0.864000	0.33941	0.208000	0.24298	4.663000	0.61532	0.965000	0.38133	0.313000	0.20887	CGC		SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_000334	
OVCA2	124641	broad.mit.edu	37	17	1946040	1946040	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr17:1946040delT	ENST00000572195.1	+	2	341	c.326delT	c.(325-327)ctgfs	p.L109fs	DPH1_ENST00000570477.1_3'UTR|DPH1_ENST00000263083.6_3'UTR|RP11-667K14.4_ENST00000572404.1_RNA|RP11-667K14.3_ENST00000572790.1_lincRNA	NM_080822.2	NP_543012.1	Q8WZ82	OVCA2_HUMAN	ovarian tumor suppressor candidate 2	109					metabolic process (GO:0008152)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)	p.L109fs*16(1)									CTGAACAGGCTGGGGCCTTTT	0.642											OREG0024078	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L109fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.326delT	17						.						48.0	46.0	46.0					17																	1946040		2203	4300	6503	1892790	SO:0001589	frameshift_variant	124641	exon2			AF321875	CCDS11015.1	17p13.3	2012-10-08			ENSG00000262664	ENSG00000262664			24203	protein-coding gene	gene with protein product	"""candidate tumor suppressor in ovarian cancer 2"""	607896				11979432, 8616839, 16368187	Standard	NM_080822		Approved		uc002ftx.3	Q8WZ82	OTTHUMG00000132471	ENST00000572195.1:c.326delT	17.37:g.1946040delT	ENSP00000461388:p.Leu109fs	Somatic	599	Capture	Illumina HiSeq	Phase_I	1892790	NM_080822	Q86XN3|Q8IW87|Q9UCX9	Frame_Shift_Del	DEL	ENST00000572195.1	37	CCDS11015.1																																																																																				OVCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255636.5	NM_080822	
RNF213	57674	broad.mit.edu	37	17	78319745	78319745	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr17:78319745G>A	ENST00000582970.1	+	29	7753	c.7610G>A	c.(7609-7611)cGt>cAt	p.R2537H	RNF213_ENST00000336301.6_Missense_Mutation_p.R610H|RNF213_ENST00000508628.2_Missense_Mutation_p.R2586H	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	2537					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R610H(1)|p.R2586H(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			ATGATCTGCCGTTTGGAGTCA	0.562																																					p.R2586H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G7757A	17						.						85.0	82.0	83.0					17																	78319745		2203	4300	6503	75934340	SO:0001583	missense	57674	exon30			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.7610G>A	17.37:g.78319745G>A	ENSP00000464087:p.Arg2537His	Somatic		Capture	Illumina HiSeq	Phase_I	75934340	NM_020914	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	G	10.09	1.255469	0.22965	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.23950	1.88	5.13	5.13	0.70059	ATPase, AAA+ type, core (1);	0.063927	0.64402	D	0.000010	T	0.56217	0.1970	M	0.82517	2.595	0.44927	D	0.997946	D	0.71674	0.998	D	0.74023	0.982	T	0.61898	-0.6968	10	0.72032	D	0.01	.	18.7595	0.91845	0.0:0.0:1.0:0.0	.	610	Q63HN8	RN213_HUMAN	H	2537;2586;610	ENSP00000338218:R610H	ENSP00000338218:R610H	R	+	2	0	RNF213	75934340	1.000000	0.71417	0.154000	0.22540	0.039000	0.13416	7.647000	0.83462	2.646000	0.89796	0.655000	0.94253	CGT		RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
MEP1B	4225	broad.mit.edu	37	18	29782965	29782965	+	Silent	SNP	G	G	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr18:29782965G>A	ENST00000269202.6	+	6	407	c.360G>A	c.(358-360)aaG>aaA	p.K120K	MEP1B_ENST00000581447.1_Silent_p.K120K	NM_005925.2	NP_005916.2	Q16820	MEP1B_HUMAN	meprin A, beta	120	Metalloprotease.				digestion (GO:0007586)|inflammatory response (GO:0006954)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.K120K(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						CAGTGTTCAAGGGCAGTGGGT	0.423																																					p.K120K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G360A	18						.						81.0	79.0	80.0					18																	29782965		1904	4134	6038	28036963	SO:0001819	synonymous_variant	4225	exon6			X81333	CCDS45846.1	18q12.2-q12.3	2003-12-17				ENSG00000141434	3.4.24.18		7020	protein-coding gene	gene with protein product		600389				7774936	Standard	NM_005925		Approved		uc002kxj.4	Q16820		ENST00000269202.6:c.360G>A	18.37:g.29782965G>A		Somatic		Capture	Illumina HiSeq	Phase_I	28036963	NM_005925	B7ZM35|B9EGL6|Q670J1	Silent	SNP	ENST00000269202.6	37	CCDS45846.1																																																																																				MEP1B-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447755.1	NM_005925	
C2CD4C	126567	broad.mit.edu	37	19	408319	408320	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr19:408319_408320insC	ENST00000332235.6	-	2	215_216	c.42_43insG	c.(40-45)gggtctfs	p.S15fs		NM_001136263.1	NP_001129735.1	Q8TF44	C2C4C_HUMAN	C2 calcium-dependent domain containing 4C	15								p.S15fs*13(1)		large_intestine(1)|pancreas(1)	2						TTTTCCCCAGACCCCCGAAGCC	0.653																																					p.S15fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.43_44insG	19						.																																			359320	SO:0001589	frameshift_variant	126567	exon2			AB075837	CCDS45890.1	19p13.3	2009-09-28	2009-09-28	2009-09-28		ENSG00000183186			29417	protein-coding gene	gene with protein product	"""nuclear localized factor 3"""	610336	"""KIAA1957"", ""family with sequence similarity 148, member C"""	KIAA1957, FAM148C		11853319	Standard	NM_001136263		Approved	NLF3	uc002loo.3	Q8TF44		ENST00000332235.6:c.43dupG	19.37:g.408324_408324dupC	ENSP00000328677:p.Ser15fs	Somatic		Capture	Illumina HiSeq	Phase_I	359319	NM_001136263	Q8N3H7	Frame_Shift_Ins	INS	ENST00000332235.6	37	CCDS45890.1																																																																																				C2CD4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451789.2	XM_065166	
CCDC159	126075	broad.mit.edu	37	19	11460668	11460668	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr19:11460668A>T	ENST00000588790.1	+	5	557	c.110A>T	c.(109-111)gAg>gTg	p.E37V	CCDC159_ENST00000458408.1_Missense_Mutation_p.E37V			P0C7I6	CC159_HUMAN	coiled-coil domain containing 159	152								p.E37V(1)		endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	5						TGTGAACTTGAGTCACTCAAG	0.592																																					p.E37V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A110T	19						.						56.0	58.0	57.0					19																	11460668		1933	4135	6068	11321668	SO:0001583	missense	126075	exon3			BC038439	CCDS45976.1	19p13.2	2010-02-17			ENSG00000183401	ENSG00000183401			26996	protein-coding gene	gene with protein product							Standard	NM_001080503		Approved		uc010xlt.2	P0C7I6		ENST00000588790.1:c.110A>T	19.37:g.11460668A>T	ENSP00000468232:p.Glu37Val	Somatic		Capture	Illumina HiSeq	Phase_I	11321668	NM_001080503	B4DEG3|B4DWR8|B4E133|B7ZAM4	Missense_Mutation	SNP	ENST00000588790.1	37	CCDS45976.1	.	.	.	.	.	.	.	.	.	.	A	15.98	2.992153	0.54041	.	.	ENSG00000183401	ENST00000458408;ENST00000427879	T	0.53206	0.63	5.49	5.49	0.81192	.	.	.	.	.	T	0.63558	0.2521	L	0.59436	1.845	0.34556	D	0.711837	D;D;D;D;D	0.89917	1.0;0.998;0.999;0.998;0.999	D;D;D;D;D	0.72075	0.975;0.943;0.976;0.943;0.976	T	0.73920	-0.3830	9	0.52906	T	0.07	-31.7045	13.1113	0.59275	1.0:0.0:0.0:0.0	.	152;152;36;37;37	P0C7I6;P0C7I6-4;P0C7I6-3;P0C7I6-2;P0C7I6-5	CC159_HUMAN;.;.;.;.	V	37;152	ENSP00000402239:E37V	ENSP00000390400:E152V	E	+	2	0	CCDC159	11321668	1.000000	0.71417	1.000000	0.80357	0.087000	0.18053	4.900000	0.63252	2.079000	0.62486	0.533000	0.62120	GAG		CCDC159-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458761.1	NM_001080503	
CCDC159	126075	broad.mit.edu	37	19	11461550	11461550	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr19:11461550G>A	ENST00000588790.1	+	7	740	c.293G>A	c.(292-294)cGg>cAg	p.R98Q	CCDC159_ENST00000458408.1_Missense_Mutation_p.R98Q			P0C7I6	CC159_HUMAN	coiled-coil domain containing 159	213								p.R98Q(1)		endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	5						GAGCAGGGCCGGCAGGAGCTG	0.662																																					p.R98Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G293A	19						.						10.0	14.0	13.0					19																	11461550		1997	4074	6071	11322550	SO:0001583	missense	126075	exon5			BC038439	CCDS45976.1	19p13.2	2010-02-17			ENSG00000183401	ENSG00000183401			26996	protein-coding gene	gene with protein product							Standard	NM_001080503		Approved		uc010xlt.2	P0C7I6		ENST00000588790.1:c.293G>A	19.37:g.11461550G>A	ENSP00000468232:p.Arg98Gln	Somatic		Capture	Illumina HiSeq	Phase_I	11322550	NM_001080503	B4DEG3|B4DWR8|B4E133|B7ZAM4	Missense_Mutation	SNP	ENST00000588790.1	37	CCDS45976.1	.	.	.	.	.	.	.	.	.	.	G	10.16	1.272620	0.23221	.	.	ENSG00000183401	ENST00000458408;ENST00000427879	T	0.45668	0.89	5.05	-8.88	0.00789	.	.	.	.	.	T	0.15176	0.0366	N	0.05124	-0.11	0.09310	N	1	B;B;B;B;B	0.19706	0.038;0.011;0.038;0.001;0.038	B;B;B;B;B	0.10450	0.005;0.002;0.003;0.001;0.003	T	0.20638	-1.0269	9	0.48119	T	0.1	-15.9405	3.3957	0.07304	0.3334:0.1043:0.4574:0.105	.	213;213;97;98;98	P0C7I6;P0C7I6-4;P0C7I6-3;P0C7I6-2;P0C7I6-5	CC159_HUMAN;.;.;.;.	Q	98;213	ENSP00000402239:R98Q	ENSP00000390400:R213Q	R	+	2	0	CCDC159	11322550	0.000000	0.05858	0.269000	0.24586	0.501000	0.33797	-1.230000	0.02942	-1.524000	0.01764	-1.305000	0.01319	CGG		CCDC159-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458761.1	NM_001080503	
CNN1	1264	broad.mit.edu	37	19	11660241	11660241	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr19:11660241C>T	ENST00000252456.2	+	6	816	c.605C>T	c.(604-606)gCg>gTg	p.A202V	CNN1_ENST00000544952.1_Missense_Mutation_p.A182V|CNN1_ENST00000592923.1_Missense_Mutation_p.A152V|CNN1_ENST00000535659.2_Missense_Mutation_p.A152V	NM_001299.4	NP_001290.2	P51911	CNN1_HUMAN	calponin 1, basic, smooth muscle	202					actomyosin structure organization (GO:0031032)|regulation of smooth muscle contraction (GO:0006940)	cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)		p.A202V(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(2)	9						CTGGACCAGGCGACCATCAGC	0.682																																					p.A202V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C605T	19						.						42.0	43.0	43.0					19																	11660241		2203	4300	6503	11521241	SO:0001583	missense	1264	exon6			U37019	CCDS12263.1	19p13.2-p13.1	2008-07-16				ENSG00000130176			2155	protein-coding gene	gene with protein product		600806				8526917, 9332369	Standard	XM_005259741		Approved	SMCC, Sm-Calp	uc002msc.1	P51911		ENST00000252456.2:c.605C>T	19.37:g.11660241C>T	ENSP00000252456:p.Ala202Val	Somatic		Capture	Illumina HiSeq	Phase_I	11521241	NM_001299	B2R868|B4DUX6|O00638|Q15416|Q8IY93|Q99438	Missense_Mutation	SNP	ENST00000252456.2	37	CCDS12263.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.888931	0.91814	.	.	ENSG00000130176	ENST00000252456;ENST00000535659;ENST00000544952	T;T;T	0.33865	1.39;1.39;1.39	5.21	5.21	0.72293	.	0.053759	0.85682	D	0.000000	T	0.35740	0.0942	L	0.39898	1.24	0.48395	D	0.999646	P	0.50943	0.94	B	0.43251	0.413	T	0.26710	-1.0095	10	0.66056	D	0.02	-48.1972	17.5118	0.87762	0.0:1.0:0.0:0.0	.	202	P51911	CNN1_HUMAN	V	202;152;182	ENSP00000252456:A202V;ENSP00000442031:A152V;ENSP00000437470:A182V	ENSP00000252456:A202V	A	+	2	0	CNN1	11521241	1.000000	0.71417	0.999000	0.59377	0.952000	0.60782	5.602000	0.67612	2.442000	0.82660	0.471000	0.43371	GCG		CNN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458854.1	NM_001299	
NOTCH3	4854	broad.mit.edu	37	19	15290210	15290210	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr19:15290210G>T	ENST00000263388.2	-	21	3500	c.3425C>A	c.(3424-3426)gCc>gAc	p.A1142D		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1142	EGF-like 29; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.A1142D(1)		breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GAGATAGCGGGCCACGAGGTC	0.607																																					p.A1142D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3425A	19						.						91.0	83.0	86.0					19																	15290210		2203	4300	6503	15151210	SO:0001583	missense	4854	exon21			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.3425C>A	19.37:g.15290210G>T	ENSP00000263388:p.Ala1142Asp	Somatic		Capture	Illumina HiSeq	Phase_I	15151210	NM_000435	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	37	CCDS12326.1	.	.	.	.	.	.	.	.	.	.	G	18.84	3.709091	0.68615	.	.	ENSG00000074181	ENST00000263388;ENST00000539383	D	0.92048	-2.96	4.3	3.22	0.36961	EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.87541	0.6203	N	0.15975	0.35	0.39945	D	0.974462	B;P	0.38110	0.025;0.618	B;P	0.47251	0.019;0.542	D	0.87179	0.2226	9	0.48119	T	0.1	.	10.3836	0.44125	0.0:0.4689:0.5311:0.0	.	1093;1142	Q59FL3;Q9UM47	.;NOTC3_HUMAN	D	1142;1092	ENSP00000263388:A1142D	ENSP00000263388:A1142D	A	-	2	0	NOTCH3	15151210	0.000000	0.05858	1.000000	0.80357	0.875000	0.50365	0.930000	0.28858	1.934000	0.56057	0.561000	0.74099	GCC		NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435	
OR10H2	26538	broad.mit.edu	37	19	15839060	15839060	+	Silent	SNP	C	C	T			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr19:15839060C>T	ENST00000305899.3	+	1	227	c.207C>T	c.(205-207)tcC>tcT	p.S69S		NM_013939.2	NP_039227.1	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H, member 2	69						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S69S(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(1)	27	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					TCTCAGTCTCCGAGATCCTCT	0.627																																					p.S69S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C207T	19						.						210.0	170.0	183.0					19																	15839060		2203	4300	6503	15700060	SO:0001819	synonymous_variant	26538	exon1			AC004597	CCDS12333.1	19p13.1	2012-08-09				ENSG00000171942		"""GPCR / Class A : Olfactory receptors"""	8173	protein-coding gene	gene with protein product							Standard	NM_013939		Approved		uc002nbm.2	O60403		ENST00000305899.3:c.207C>T	19.37:g.15839060C>T		Somatic		Capture	Illumina HiSeq	Phase_I	15700060	NM_013939	Q6IFQ1|Q96R58	Silent	SNP	ENST00000305899.3	37	CCDS12333.1																																																																																				OR10H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460917.1		
OR10H1	26539	broad.mit.edu	37	19	15918641	15918641	+	Silent	SNP	G	G	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr19:15918641G>A	ENST00000334920.2	-	1	295	c.207C>T	c.(205-207)tcC>tcT	p.S69S		NM_013940.2	NP_039228.1	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H, member 1	69						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S69S(1)		cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|skin(2)|urinary_tract(1)	29						AGAGGATCTCGGAGACGGAGA	0.637																																					p.S69S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C207T	19						.						92.0	84.0	87.0					19																	15918641		2196	4286	6482	15779641	SO:0001819	synonymous_variant	26539	exon1			AC004510	CCDS12335.1	19p13.1	2012-08-09				ENSG00000186723		"""GPCR / Class A : Olfactory receptors"""	8172	protein-coding gene	gene with protein product							Standard	NM_013940		Approved		uc002nbq.2	Q9Y4A9		ENST00000334920.2:c.207C>T	19.37:g.15918641G>A		Somatic		Capture	Illumina HiSeq	Phase_I	15779641	NM_013940	Q6IFQ2|Q96R59	Silent	SNP	ENST00000334920.2	37	CCDS12335.1																																																																																				OR10H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460364.1		
PLEKHA4	57664	broad.mit.edu	37	19	49368858	49368858	+	Missense_Mutation	SNP	G	G	A	rs201547716		TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr19:49368858G>A	ENST00000263265.6	-	3	649	c.94C>T	c.(94-96)Cgg>Tgg	p.R32W	PLEKHA4_ENST00000355496.5_Missense_Mutation_p.R32W	NM_020904.2	NP_065955.2	Q9H4M7	PKHA4_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4	32						cytoplasm (GO:0005737)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)	p.R32W(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	30		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;0.000108)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00027)|all cancers(93;0.00084)|GBM - Glioblastoma multiforme(486;0.0244)|Epithelial(262;0.0364)		TTTACTGCCCGGGTGGGCTTC	0.597													G|||	1	0.000199681	0.0	0.0	5008	,	,		16811	0.001		0.0	False		,,,				2504	0.0				p.R32W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C94T	19						.						89.0	70.0	76.0					19																	49368858		2203	4300	6503	54060670	SO:0001583	missense	57664	exon3			AY007233	CCDS12737.1, CCDS54291.1	19q13.33	2013-01-10	2002-01-14			ENSG00000105559		"""Pleckstrin homology (PH) domain containing"""	14339	protein-coding gene	gene with protein product		607769	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 4"""			11001876	Standard	NM_020904		Approved	PEPP1	uc002pkx.3	Q9H4M7		ENST00000263265.6:c.94C>T	19.37:g.49368858G>A	ENSP00000263265:p.Arg32Trp	Somatic		Capture	Illumina HiSeq	Phase_I	54060670	NM_020904	Q8N4M8|Q8N658	Missense_Mutation	SNP	ENST00000263265.6	37	CCDS12737.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	19.35	3.810631	0.70797	.	.	ENSG00000105559	ENST00000263265;ENST00000355496	T;T	0.20598	2.63;2.06	5.04	2.79	0.32731	.	0.000000	0.50627	D	0.000112	T	0.43077	0.1231	M	0.70595	2.14	0.37784	D	0.927104	D;D	0.89917	1.0;1.0	D;D	0.78314	0.984;0.991	T	0.49560	-0.8927	10	0.87932	D	0	.	12.1172	0.53872	0.0:0.0:0.6892:0.3107	.	32;32	Q9H4M7-2;Q9H4M7	.;PKHA4_HUMAN	W	32	ENSP00000263265:R32W;ENSP00000347683:R32W	ENSP00000263265:R32W	R	-	1	2	PLEKHA4	54060670	0.270000	0.24152	0.990000	0.47175	0.992000	0.81027	0.785000	0.26830	0.575000	0.29434	0.563000	0.77884	CGG		PLEKHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466216.1		
ZNF160	90338	broad.mit.edu	37	19	53572104	53572104	+	Silent	SNP	T	T	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr19:53572104T>A	ENST00000429604.1	-	7	2098	c.1683A>T	c.(1681-1683)ggA>ggT	p.G561G	ZNF160_ENST00000418871.1_Silent_p.G561G|ZNF160_ENST00000599056.1_Silent_p.G561G|ZNF160_ENST00000601421.1_Silent_p.G525G	NM_001102603.1|NM_198893.2	NP_001096073.1|NP_942596.1	Q9HCG1	ZN160_HUMAN	zinc finger protein 160	561					hemopoiesis (GO:0030097)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G561G(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	35				GBM - Glioblastoma multiforme(134;0.02)		AAGGTTTCTCTCCAGAATGAA	0.398																																					p.G561G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1683T	19						.						83.0	85.0	84.0					19																	53572104		2203	4300	6503	58263916	SO:0001819	synonymous_variant	90338	exon7			X78928	CCDS12859.1	19q13.42	2013-01-08				ENSG00000170949		"""Zinc fingers, C2H2-type"", ""-"""	12948	protein-coding gene	gene with protein product		600398				7774943, 7865130	Standard	NM_198893		Approved	HZF5, F11, KR18, HKr18, FLJ00032, KIAA1611	uc002qar.4	Q9HCG1		ENST00000429604.1:c.1683A>T	19.37:g.53572104T>A		Somatic		Capture	Illumina HiSeq	Phase_I	58263916	NM_198893	Q14589|Q504Q8|Q96JC5|Q9BVY9|Q9H7N6	Silent	SNP	ENST00000429604.1	37	CCDS12859.1																																																																																				ZNF160-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463994.2	NM_033288	
ZNF470	388566	broad.mit.edu	37	19	57089722	57089722	+	Missense_Mutation	SNP	T	T	A	rs35077804	byFrequency	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr19:57089722T>A	ENST00000330619.8	+	6	2611	c.1925T>A	c.(1924-1926)aTt>aAt	p.I642N	ZNF470_ENST00000601902.1_Intron|ZNF470_ENST00000391709.3_Missense_Mutation_p.I642N	NM_001001668.3	NP_001001668.3	Q6ECI4	ZN470_HUMAN	zinc finger protein 470	642			I -> T (in dbSNP:rs35077804).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I642N(1)		endometrium(7)|large_intestine(12)|lung(11)|ovary(1)|pancreas(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	41		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0294)		CATCAGAGAATTCATACAGGA	0.403																																					p.I642N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1925A	19						.						80.0	78.0	79.0					19																	57089722		2203	4300	6503	61781534	SO:0001583	missense	388566	exon6			AK129686	CCDS33122.1	19q13.43	2013-01-08				ENSG00000197016		"""Zinc fingers, C2H2-type"", ""-"""	22220	protein-coding gene	gene with protein product						15302581	Standard	NM_001001668		Approved	CZF-1, FLJ26175	uc002qnl.4	Q6ECI4		ENST00000330619.8:c.1925T>A	19.37:g.57089722T>A	ENSP00000333223:p.Ile642Asn	Somatic		Capture	Illumina HiSeq	Phase_I	61781534	NM_001001668	A8MTW0|B9EGU1|Q6ZPA1|Q9Y2N9	Missense_Mutation	SNP	ENST00000330619.8	37	CCDS33122.1	.	.	.	.	.	.	.	.	.	.	T	12.29	1.892627	0.33442	.	.	ENSG00000197016	ENST00000391709;ENST00000330619	T;T	0.09073	3.02;3.02	3.92	1.75	0.24633	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10337	0.0253	M	0.63169	1.94	0.22701	N	0.998832	B	0.16802	0.019	B	0.22386	0.039	T	0.24012	-1.0172	9	0.54805	T	0.06	.	6.8055	0.23774	0.0:0.2968:0.0:0.7032	.	642	Q6ECI4	ZN470_HUMAN	N	642	ENSP00000375590:I642N;ENSP00000333223:I642N	ENSP00000333223:I642N	I	+	2	0	ZNF470	61781534	0.001000	0.12720	0.998000	0.56505	0.976000	0.68499	0.867000	0.27968	0.573000	0.29400	0.459000	0.35465	ATT		ZNF470-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459707.2	NM_001001668	
FLG	2312	broad.mit.edu	37	1	152284549	152284549	+	Missense_Mutation	SNP	G	G	C	rs141646551	byFrequency	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr1:152284549G>C	ENST00000368799.1	-	3	2848	c.2813C>G	c.(2812-2814)aCa>aGa	p.T938R	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	938	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.T938R(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCGCCTGCTTGTCCTGGACCC	0.572									Ichthyosis				-|||	170	0.0339457	0.0	0.0403	5008	,	,		21979	0.0754		0.007	False		,,,				2504	0.0603				p.T938R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2813G	1						.						325.0	297.0	306.0					1																	152284549		2203	4300	6503	150551173	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.2813C>G	1.37:g.152284549G>C	ENSP00000357789:p.Thr938Arg	Somatic		Capture	Illumina HiSeq	Phase_I	150551173	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	-	5.712	0.315925	0.10789	.	.	ENSG00000143631	ENST00000368799;ENST00000392689	T	0.04083	3.71	3.85	0.458	0.16670	.	.	.	.	.	T	0.01124	0.0037	L	0.38531	1.155	0.09310	N	1	B	0.14805	0.011	B	0.23018	0.043	T	0.48163	-0.9059	9	0.30854	T	0.27	.	2.2232	0.03978	0.119:0.1996:0.4931:0.1882	.	938	P20930	FILA_HUMAN	R	938;145	ENSP00000357789:T938R	ENSP00000357789:T938R	T	-	2	0	FLG	150551173	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-1.641000	0.02007	0.119000	0.18210	0.473000	0.43528	ACA		FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
NBPF1	55672	broad.mit.edu	37	1	16892277	16892277	+	Missense_Mutation	SNP	G	G	A	rs368729374		TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr1:16892277G>A	ENST00000430580.2	-	27	3802	c.2915C>T	c.(2914-2916)gCa>gTa	p.A972V		NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1	972	NBPF 6. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		AGGCTCTACTGCCTCCAGCAG	0.498																																					p.Q974X												.	.	0			c.C2920T	1						.						20.0	16.0	18.0					1																	16892277		1476	2583	4059	16764864	SO:0001583	missense	55672	exon27			AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.2915C>T	1.37:g.16892277G>A	ENSP00000474456:p.Ala972Val	Somatic		Capture	Illumina HiSeq	Phase_I	16764864	NM_017940	Q8N4E8|Q9C0H0	Missense_Mutation	SNP	ENST00000430580.2	37																																																																																					NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000106436.3	NM_017940	
SPTA1	6708	broad.mit.edu	37	1	158595941	158595941	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr1:158595941T>C	ENST00000368147.4	-	42	6085	c.5905A>G	c.(5905-5907)Aaa>Gaa	p.K1969E		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1969					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.K1969E(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CTCACCTGTTTTGCCAGAAGA	0.388																																					p.K1969E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A5905G	1						.						114.0	113.0	114.0					1																	158595941		1918	4122	6040	156862565	SO:0001583	missense	6708	exon42			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.5905A>G	1.37:g.158595941T>C	ENSP00000357129:p.Lys1969Glu	Somatic		Capture	Illumina HiSeq	Phase_I	156862565	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	T	17.62	3.435329	0.62955	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.57273	0.41;0.41	4.93	4.93	0.64822	.	0.245199	0.20991	N	0.082023	T	0.67543	0.2904	M	0.83774	2.66	0.37530	D	0.917887	D	0.89917	1.0	D	0.91635	0.999	T	0.74472	-0.3654	10	0.87932	D	0	.	12.577	0.56369	0.0:0.0:0.0:1.0	.	1969	P02549	SPTA1_HUMAN	E	1969;1966	ENSP00000357130:K1969E;ENSP00000357129:K1966E	ENSP00000357129:K1966E	K	-	1	0	SPTA1	156862565	1.000000	0.71417	0.999000	0.59377	0.258000	0.26162	5.820000	0.69250	2.068000	0.61886	0.460000	0.39030	AAA		SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
KLHL20	27252	broad.mit.edu	37	1	173720985	173720985	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr1:173720985G>A	ENST00000209884.4	+	4	816	c.680G>A	c.(679-681)aGt>aAt	p.S227N	KLHL20_ENST00000546011.1_Missense_Mutation_p.S38N	NM_014458.3	NP_055273.2	Q9Y2M5	KLH20_HUMAN	kelch-like family member 20	227	BACK.				cytoskeleton organization (GO:0007010)|Golgi to endosome transport (GO:0006895)|negative regulation of apoptotic process (GO:0043066)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K33-linked ubiquitination (GO:1990390)|protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|response to interferon-alpha (GO:0035455)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|PML body (GO:0016605)|trans-Golgi network (GO:0005802)	interferon-gamma binding (GO:0019964)|ubiquitin-protein transferase activity (GO:0004842)	p.S227N(1)		breast(3)|endometrium(6)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|upper_aerodigestive_tract(1)	34						AACGTTCGCAGTGAAGAACAA	0.398																																					p.S227N	GBM(159;862 2695 6559 23041)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G680A	1						.						105.0	93.0	97.0					1																	173720985		2203	4300	6503	171987608	SO:0001583	missense	27252	exon4			AB026190	CCDS1310.1	1q25.1	2013-01-30	2013-01-30		ENSG00000076321	ENSG00000076321		"""Kelch-like"", ""BTB/POZ domain containing"""	25056	protein-coding gene	gene with protein product			"""kelch-like 20 (Drosophila)"""			14668487, 20389280	Standard	NM_014458		Approved	KLEIP, KHLHX	uc001gjc.3	Q9Y2M5	OTTHUMG00000040548	ENST00000209884.4:c.680G>A	1.37:g.173720985G>A	ENSP00000209884:p.Ser227Asn	Somatic		Capture	Illumina HiSeq	Phase_I	171987608	NM_014458	B3KMA0|B4DUR0|Q5TZF2|Q5ZF45|Q9H457	Missense_Mutation	SNP	ENST00000209884.4	37	CCDS1310.1	.	.	.	.	.	.	.	.	.	.	G	15.62	2.888183	0.52014	.	.	ENSG00000076321	ENST00000546011;ENST00000209884	T;T	0.70045	-0.45;-0.45	5.38	5.38	0.77491	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	T	0.53126	0.1777	L	0.58969	1.84	0.80722	D	1	B;B	0.29378	0.243;0.131	B;B	0.24974	0.054;0.057	T	0.57423	-0.7814	10	0.46703	T	0.11	.	17.892	0.88875	0.0:0.0:1.0:0.0	.	38;227	B4DUR0;Q9Y2M5	.;KLH20_HUMAN	N	38;227	ENSP00000443121:S38N;ENSP00000209884:S227N	ENSP00000209884:S227N	S	+	2	0	KLHL20	171987608	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.404000	0.97306	2.490000	0.84030	0.591000	0.81541	AGT		KLHL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097582.1	NM_014458	
DYRK3	8444	broad.mit.edu	37	1	206821697	206821697	+	Missense_Mutation	SNP	G	G	A	rs200229954		TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr1:206821697G>A	ENST00000367109.2	+	3	1322	c.1154G>A	c.(1153-1155)cGc>cAc	p.R385H	DYRK3_ENST00000367106.1_Missense_Mutation_p.R365H|DYRK3_ENST00000489878.1_Intron|DYRK3_ENST00000367108.3_Missense_Mutation_p.R365H	NM_003582.2	NP_003573.2	O43781	DYRK3_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3	385	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				erythrocyte differentiation (GO:0030218)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.R350H(1)|p.R385H(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(9)|lung(8)|skin(1)|stomach(2)	25	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			TTAGGAAGCCGCTACAGCACA	0.473																																					p.R385H	Melanoma(164;427 2622 26826 51707)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1154A	1						.						86.0	93.0	91.0					1																	206821697		2203	4300	6503	204888320	SO:0001583	missense	8444	exon3			Y12735	CCDS30999.1, CCDS31000.1	1q32	2008-07-18			ENSG00000143479	ENSG00000143479	2.7.12.1		3094	protein-coding gene	gene with protein product	"""regulatory erythroid kinase"", ""dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 5"", ""protein kinase Dyrk3"""	603497				9748265	Standard	NM_003582		Approved	RED, REDK, hYAK3-2	uc001hej.3	O43781	OTTHUMG00000036339	ENST00000367109.2:c.1154G>A	1.37:g.206821697G>A	ENSP00000356076:p.Arg385His	Somatic		Capture	Illumina HiSeq	Phase_I	204888320	NM_003582	D3DT79|Q7Z752|Q9HBY6|Q9HBY7	Missense_Mutation	SNP	ENST00000367109.2	37	CCDS30999.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.339621	0.81911	.	.	ENSG00000143479	ENST00000367109;ENST00000367108;ENST00000367106	T;T;T	0.65549	-0.16;-0.16;-0.16	5.3	5.3	0.74995	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.67524	0.2902	N	0.21240	0.645	0.80722	D	1	D;D	0.76494	0.997;0.999	D;P	0.63793	0.918;0.907	T	0.71286	-0.4638	10	0.72032	D	0.01	.	18.1141	0.89545	0.0:0.0:1.0:0.0	.	385;365	O43781;O43781-2	DYRK3_HUMAN;.	H	385;365;365	ENSP00000356076:R385H;ENSP00000356075:R365H;ENSP00000356073:R365H	ENSP00000356073:R365H	R	+	2	0	DYRK3	204888320	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	7.807000	0.86032	2.760000	0.94817	0.549000	0.68633	CGC		DYRK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088458.1	NM_003582	
OBSCN	84033	broad.mit.edu	37	1	228482576	228482576	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr1:228482576G>A	ENST00000422127.1	+	43	11535	c.11491G>A	c.(11491-11493)Gtg>Atg	p.V3831M	OBSCN_ENST00000570156.2_Missense_Mutation_p.V4260M|OBSCN_ENST00000284548.11_Missense_Mutation_p.V3831M|RP5-1139B12.4_ENST00000602778.1_RNA|OBSCN_ENST00000359599.6_Missense_Mutation_p.V2678M|OBSCN_ENST00000366707.4_Missense_Mutation_p.V950M|OBSCN_ENST00000366709.4_Missense_Mutation_p.V950M	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	3831	Ig-like 39.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.V4114M(1)|p.V3885M(1)		NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGCGGCCCCCGTGGAGTGGAG	0.602																																					p.V3831M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G11491A	1						.						112.0	116.0	115.0					1																	228482576		1982	4146	6128	226549199	SO:0001583	missense	84033	exon43			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.11491G>A	1.37:g.228482576G>A	ENSP00000409493:p.Val3831Met	Somatic		Capture	Illumina HiSeq	Phase_I	226549199	NM_052843	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.015207	0.75161	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709;ENST00000359599	T;T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06;-1.06	5.22	5.22	0.72569	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000003	D	0.90841	0.7123	M	0.90870	3.155	0.51767	D	0.999938	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92243	0.5802	10	0.66056	D	0.02	.	18.973	0.92722	0.0:0.0:1.0:0.0	.	3831;3831	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	M	3831;3831;950;950;2678	ENSP00000284548:V3831M;ENSP00000409493:V3831M;ENSP00000355668:V950M;ENSP00000355670:V950M;ENSP00000352613:V2678M	ENSP00000284548:V3831M	V	+	1	0	OBSCN	226549199	1.000000	0.71417	0.955000	0.39395	0.003000	0.03518	9.527000	0.98044	2.720000	0.93068	0.563000	0.77884	GTG		OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
RHD	6007	broad.mit.edu	37	1	25627527	25627527	+	Missense_Mutation	SNP	G	G	A	rs17418091		TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr1:25627527G>A	ENST00000328664.4	+	4	732	c.577G>A	c.(577-579)Gag>Aag	p.E193K	RHD_ENST00000454452.2_Missense_Mutation_p.E193K|RHD_ENST00000423253.1_3'UTR|RHD_ENST00000423810.2_Missense_Mutation_p.E193K|RHD_ENST00000342055.5_Missense_Mutation_p.E193K|RHD_ENST00000568195.1_Missense_Mutation_p.E193K|RHD_ENST00000417538.2_Missense_Mutation_p.E193K|RHD_ENST00000357542.4_Missense_Mutation_p.E193K	NM_001282867.1|NM_016124.3	NP_001269796.1|NP_057208	Q02161	RHD_HUMAN	Rh blood group, D antigen	193			E -> K (in dbSNP:rs17418091).			integral component of plasma membrane (GO:0005887)	ammonium transmembrane transporter activity (GO:0008519)	p.E193K(1)		breast(2)|large_intestine(4)|lung(7)|prostate(1)	14		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.39e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000332)|BRCA - Breast invasive adenocarcinoma(304;0.000438)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000908)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GCCTCTACCCGAGGGAACGGA	0.527																																					p.E193K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G577A	1						.	G	LYS/GLU,LYS/GLU	0,4242		0,0,2121	215.0	148.0	172.0		577,577	-7.9	0.0	1	dbSNP_123	172	1,7479		0,1,3739	no	missense,missense	RHD	NM_001127691.1,NM_016124.3	56,56	0,1,5860	AA,AG,GG		0.0134,0.0,0.0085	benign,benign	193/322,193/418	25627527	1,11721	2121	3740	5861	25500114	SO:0001583	missense	6007	exon4			AB012623	CCDS262.1, CCDS53285.1, CCDS60027.1, CCDS60028.1, CCDS60029.1, CCDS60030.1, CCDS60031.1	1p36.11	2014-07-19	2013-10-02		ENSG00000187010	ENSG00000187010		"""CD molecules"", ""Blood group antigens"""	10009	protein-coding gene	gene with protein product		111680	"""Rhesus blood group, D antigen"", ""Rh blood group, D antigen"""	RH		8220426	Standard	NM_016124		Approved	Rh30a, Rh4, RhPI, RhII, DIIIc, CD240D	uc001bjz.3	Q02161	OTTHUMG00000003476	ENST00000328664.4:c.577G>A	1.37:g.25627527G>A	ENSP00000331871:p.Glu193Lys	Somatic		Capture	Illumina HiSeq	Phase_I	25500114	NM_001127691	Q02162|Q07618|Q16147|Q16235|Q16355|Q5VSK0|Q5XLS9|Q5XLT1|Q5XLT2|Q9NPK0|Q9UQ20|Q9UQ21|Q9UQ22|Q9UQ23	Missense_Mutation	SNP	ENST00000328664.4	37	CCDS262.1	.	.	.	.	.	.	.	.	.	.	.	0.240	-1.014575	0.02095	0.0	1.34E-4	ENSG00000187010	ENST00000328664;ENST00000419831;ENST00000454452;ENST00000342055;ENST00000357542;ENST00000417538;ENST00000423810	T;T;T;T;T;T	0.20069	2.1;2.1;2.1;2.1;2.1;2.1	3.95	-7.89	0.01174	Ammonium transporter AmtB-like (3);	3.503140	0.00766	N	0.001164	T	0.05227	0.0139	N	0.01505	-0.83	0.09310	N	1	B;B;B;B;B;B;B;B	0.11235	0.001;0.0;0.004;0.001;0.0;0.001;0.002;0.0	B;B;B;B;B;B;B;B	0.13407	0.002;0.001;0.009;0.002;0.001;0.001;0.006;0.001	T	0.21008	-1.0258	10	0.05959	T	0.93	8.0803	3.0402	0.06135	0.1981:0.1136:0.4646:0.2237	rs17418091	193;193;193;193;193;193;193;193	B4DLT8;Q5XLT1;Q5XLS9;Q5XLT2;Q5XLT3;E7EVW1;Q5XLT0;Q02161	.;.;.;.;.;.;.;RHD_HUMAN	K	193	ENSP00000331871:E193K;ENSP00000413849:E193K;ENSP00000339577:E193K;ENSP00000350150:E193K;ENSP00000396420:E193K;ENSP00000399640:E193K	ENSP00000331871:E193K	E	+	1	0	RHD	25500114	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.842000	0.04354	-3.458000	0.00159	-2.434000	0.00213	GAG		RHD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009660.5	NM_016124	
NCDN	23154	broad.mit.edu	37	1	36030904	36030904	+	Silent	SNP	G	G	C			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr1:36030904G>C	ENST00000373243.2	+	7	2213	c.1830G>C	c.(1828-1830)cgG>cgC	p.R610R	NCDN_ENST00000373253.3_Silent_p.R593R|NCDN_ENST00000356090.4_Silent_p.R610R	NM_014284.2	NP_055099.1	Q9UBB6	NCDN_HUMAN	neurochondrin	610					bone resorption (GO:0045453)|neuron projection development (GO:0031175)|regulation of neuronal synaptic plasticity (GO:0048168)	cytosol (GO:0005829)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)		p.R593R(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|pancreas(1)|skin(2)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				ACGTGGCGCGGGCCACCCCGG	0.637																																					p.R593R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1779C	1						.						95.0	100.0	99.0					1																	36030904		2203	4300	6503	35803491	SO:0001819	synonymous_variant	23154	exon7			AB011179	CCDS392.1, CCDS30672.1	1p34.3	2008-02-05			ENSG00000020129	ENSG00000020129			17597	protein-coding gene	gene with protein product		608458				15007648	Standard	NM_014284		Approved	NCDN-1, NCDN-2	uc001bza.3	Q9UBB6	OTTHUMG00000059204	ENST00000373243.2:c.1830G>C	1.37:g.36030904G>C		Somatic		Capture	Illumina HiSeq	Phase_I	35803491	NM_001014841	D3DPR9|Q9UBY2|Q9Y4A6|Q9Y4D9	Silent	SNP	ENST00000373243.2	37	CCDS392.1																																																																																				NCDN-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131298.1	NM_014284	
LRRIQ3	127255	broad.mit.edu	37	1	74507367	74507367	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr1:74507367T>A	ENST00000395089.1	-	6	1247	c.1248A>T	c.(1246-1248)aaA>aaT	p.K416N	LRRIQ3_ENST00000354431.4_Missense_Mutation_p.K416N			A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	416								p.K416N(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						ATGTTCGGAGTTTCATACCAG	0.368																																					p.K416N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1248T	1						.						140.0	127.0	131.0					1																	74507367		1844	4082	5926	74279955	SO:0001583	missense	127255	exon7			BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620			28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44		12477932	Standard	NM_001105659		Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.1248A>T	1.37:g.74507367T>A	ENSP00000378524:p.Lys416Asn	Somatic		Capture	Illumina HiSeq	Phase_I	74279955	NM_001105659	A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	Missense_Mutation	SNP	ENST00000395089.1	37	CCDS41350.1	.	.	.	.	.	.	.	.	.	.	T	10.93	1.490794	0.26774	.	.	ENSG00000162620	ENST00000395089;ENST00000354431	T;T	0.09538	2.97;2.97	5.77	-3.32	0.04973	.	0.638626	0.13858	N	0.357873	T	0.01189	0.0039	L	0.32530	0.975	0.09310	N	1	B	0.32829	0.386	B	0.24269	0.052	T	0.46596	-0.9180	10	0.13470	T	0.59	.	0.7247	0.00946	0.3595:0.1498:0.123:0.3678	.	416	A6PVS8	LRIQ3_HUMAN	N	416	ENSP00000378524:K416N;ENSP00000346414:K416N	ENSP00000346414:K416N	K	-	3	2	LRRIQ3	74279955	0.550000	0.26489	0.016000	0.15963	0.157000	0.22087	0.100000	0.15231	-0.356000	0.08187	0.477000	0.44152	AAA		LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316539.1	NM_145258	
FNBP1L	54874	broad.mit.edu	37	1	94000447	94000447	+	Silent	SNP	C	C	T			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr1:94000447C>T	ENST00000271234.7	+	9	1123	c.972C>T	c.(970-972)ctC>ctT	p.L324L	FNBP1L_ENST00000260506.8_Silent_p.L324L|FNBP1L_ENST00000370253.2_Silent_p.L324L|FNBP1L_ENST00000604705.1_Silent_p.L324L|FNBP1L_ENST00000370256.4_Silent_p.L324L	NM_001164473.2	NP_001157945.1	Q5T0N5	FBP1L_HUMAN	formin binding protein 1-like	324	Interaction with CDC42.				autophagy (GO:0006914)|clathrin-mediated endocytosis (GO:0072583)|membrane budding (GO:0006900)|membrane invagination (GO:0010324)|membrane tubulation (GO:0097320)|positive regulation of filopodium assembly (GO:0051491)|vesicle organization (GO:0016050)|vesicle transport along actin filament (GO:0030050)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)	p.L324L(1)		breast(2)|kidney(2)|large_intestine(4)|lung(2)|urinary_tract(1)	11		all_lung(203;0.00206)|Lung NSC(277;0.00902)|Melanoma(281;0.155)		all cancers(265;0.00666)|GBM - Glioblastoma multiforme(16;0.0378)|Epithelial(280;0.111)		AATTGTGGCTCTTTGGAAAGA	0.388																																					p.L324L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C972T	1						.						39.0	37.0	38.0					1																	94000447		1856	4093	5949	93773035	SO:0001819	synonymous_variant	54874	exon9				CCDS53343.1, CCDS53344.1, CCDS60192.1	1p22.1	2008-02-05	2004-11-16	2004-11-17	ENSG00000137942	ENSG00000137942			20851	protein-coding gene	gene with protein product		608848	"""chromosome 1 open reading frame 39"""	C1orf39		14654988	Standard	NM_017737		Approved	TOCA1, FLJ20275	uc010otk.2	Q5T0N5	OTTHUMG00000010863	ENST00000271234.7:c.972C>T	1.37:g.94000447C>T		Somatic		Capture	Illumina HiSeq	Phase_I	93773035	NM_001024948	J3QSS4|Q5T0N6|Q6B097|Q6P653|Q6R4Q4|Q9NXG1	Silent	SNP	ENST00000271234.7	37	CCDS53343.1																																																																																				FNBP1L-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_017737	
FMN2	56776	broad.mit.edu	37	1	240492661	240492661	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr1:240492661A>G	ENST00000319653.9	+	10	4560	c.4330A>G	c.(4330-4332)Atc>Gtc	p.I1444V	FMN2_ENST00000545751.1_Missense_Mutation_p.I40V	NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1444	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)	p.I1587V(1)		NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			ACTGTCACTAATCCCCAACTT	0.353																																					p.I1444V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4330G	1						.						165.0	154.0	158.0					1																	240492661		2203	4300	6503	238559284	SO:0001583	missense	56776	exon10			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.4330A>G	1.37:g.240492661A>G	ENSP00000318884:p.Ile1444Val	Somatic		Capture	Illumina HiSeq	Phase_I	238559284	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	A	26.6	4.752857	0.89753	.	.	ENSG00000155816	ENST00000319653;ENST00000441342;ENST00000545751;ENST00000537355	T;T;T	0.18502	2.21;2.21;2.21	5.65	5.65	0.86999	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.64402	D	0.000014	T	0.34832	0.0911	L	0.42581	1.335	0.80722	D	1	P;B;D;D	0.76494	0.592;0.421;0.999;0.999	B;B;D;D	0.85130	0.306;0.31;0.997;0.995	T	0.02282	-1.1183	10	0.44086	T	0.13	.	15.8761	0.79162	1.0:0.0:0.0:0.0	.	40;90;73;1444	B4DP05;F5H2C1;B4DN09;Q9NZ56	.;.;.;FMN2_HUMAN	V	1444;90;40;71	ENSP00000318884:I1444V;ENSP00000388922:I90V;ENSP00000437918:I40V	ENSP00000318884:I1444V	I	+	1	0	FMN2	238559284	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.288000	0.96055	2.139000	0.66308	0.533000	0.62120	ATC		FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
CENPB	1059	broad.mit.edu	37	20	3766001	3766001	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr20:3766001G>A	ENST00000379751.4	-	1	1336	c.1130C>T	c.(1129-1131)cCt>cTt	p.P377L	CDC25B_ENST00000379598.5_5'Flank|CDC25B_ENST00000344256.6_5'Flank	NM_001810.5	NP_001801.1	P07199	CENPB_HUMAN	centromere protein B, 80kDa	377					regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)	centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|satellite DNA binding (GO:0003696)|sequence-specific DNA binding (GO:0043565)	p.P377L(1)		kidney(1)|large_intestine(2)|lung(4)|skin(1)	8						TATGTCCGAAGGCTCCACTGC	0.642																																					p.P377L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1130T	20						.						13.0	12.0	12.0					20																	3766001		2199	4297	6496	3714001	SO:0001583	missense	1059	exon1			X05299	CCDS13064.1	20p13	2013-11-05	2002-08-29		ENSG00000125817	ENSG00000125817			1852	protein-coding gene	gene with protein product		117140	"""centromere protein B (80kD)"""			8406460, 11884609	Standard	NM_001810		Approved		uc002wjk.3	P07199	OTTHUMG00000031761	ENST00000379751.4:c.1130C>T	20.37:g.3766001G>A	ENSP00000369075:p.Pro377Leu	Somatic		Capture	Illumina HiSeq	Phase_I	3714001	NM_001810	Q96EI4	Missense_Mutation	SNP	ENST00000379751.4	37	CCDS13064.1	.	.	.	.	.	.	.	.	.	.	g	17.57	3.422358	0.62622	.	.	ENSG00000125817	ENST00000379751	T	0.43294	0.95	4.52	4.52	0.55395	.	0.624337	0.13186	U	0.407128	T	0.47967	0.1474	L	0.28400	0.85	0.42066	D	0.991189	D	0.54601	0.967	P	0.57960	0.83	T	0.47302	-0.9128	10	0.66056	D	0.02	-5.005	12.7498	0.57302	0.0:0.0:1.0:0.0	.	377	P07199	CENPB_HUMAN	L	377	ENSP00000369075:P377L	ENSP00000369075:P377L	P	-	2	0	CENPB	3714001	0.994000	0.37717	0.984000	0.44739	0.952000	0.60782	2.986000	0.49370	2.064000	0.61679	0.479000	0.44913	CCT		CENPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077772.2	NM_001810	
CCDC117	150275	broad.mit.edu	37	22	29182240	29182240	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr22:29182240C>T	ENST00000249064.4	+	5	942	c.766C>T	c.(766-768)Cct>Tct	p.P256S	CCDC117_ENST00000443309.2_Missense_Mutation_p.P124S|CCDC117_ENST00000448492.2_Missense_Mutation_p.P238S|CCDC117_ENST00000421503.2_Missense_Mutation_p.P181S	NM_001284263.1|NM_001284265.1|NM_173510.2	NP_001271192.1|NP_001271194.1|NP_775781.1	Q8IWD4	CC117_HUMAN	coiled-coil domain containing 117	256								p.P256S(1)		breast(1)|kidney(1)|large_intestine(4)|upper_aerodigestive_tract(1)	7						GTTTTCGGAACCTCGGCCAAC	0.438																																					p.P256S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C766T	22						.						93.0	89.0	90.0					22																	29182240		2203	4300	6503	27512240	SO:0001583	missense	150275	exon5			AK091133	CCDS13846.1, CCDS63435.1, CCDS63436.1	22q12.1	2006-06-27			ENSG00000159873	ENSG00000159873			26599	protein-coding gene	gene with protein product						12477932	Standard	NM_001284263		Approved	FLJ33814	uc003aeb.3	Q8IWD4	OTTHUMG00000151091	ENST00000249064.4:c.766C>T	22.37:g.29182240C>T	ENSP00000249064:p.Pro256Ser	Somatic		Capture	Illumina HiSeq	Phase_I	27512240	NM_173510	A8K0F1|B7Z2V1|B7Z860|Q6ICA7|Q8N278	Missense_Mutation	SNP	ENST00000249064.4	37	CCDS13846.1	.	.	.	.	.	.	.	.	.	.	C	15.04	2.716721	0.48622	.	.	ENSG00000159873	ENST00000249064;ENST00000448492;ENST00000421503;ENST00000443309	T;T;T;T	0.31247	1.51;1.52;1.5;1.53	5.94	4.87	0.63330	.	0.273852	0.36002	N	0.002854	T	0.15392	0.0371	N	0.19112	0.55	0.30464	N	0.773998	P;P;P	0.38597	0.639;0.639;0.639	B;B;B	0.30029	0.11;0.11;0.11	T	0.07290	-1.0780	10	0.28530	T	0.3	.	9.0311	0.36260	0.0:0.7641:0.1526:0.0833	.	181;238;256	B7Z2V1;B7Z860;Q8IWD4	.;.;CC117_HUMAN	S	256;238;181;124	ENSP00000249064:P256S;ENSP00000389478:P238S;ENSP00000387827:P181S;ENSP00000399363:P124S	ENSP00000249064:P256S	P	+	1	0	CCDC117	27512240	1.000000	0.71417	0.997000	0.53966	0.447000	0.32167	1.603000	0.36794	2.816000	0.96949	0.561000	0.74099	CCT		CCDC117-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321258.1	NM_173510	
EIF3D	8664	broad.mit.edu	37	22	36908574	36908574	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr22:36908574T>C	ENST00000216190.8	-	13	1652	c.1282A>G	c.(1282-1284)Aac>Gac	p.N428D	EIF3D_ENST00000405442.1_Missense_Mutation_p.N428D|EIF3D_ENST00000541106.1_Missense_Mutation_p.N379D|EIF3D_ENST00000478547.1_5'Flank	NM_003753.3	NP_003744.1			eukaryotic translation initiation factor 3, subunit D									p.N428D(1)		cervix(1)|endometrium(2)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	15						TTGTAGCTGTTGTTCTTCAGC	0.567																																					p.N428D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1282G	22						.						105.0	89.0	94.0					22																	36908574		2203	4300	6503	35238520	SO:0001583	missense	8664	exon13			U54558	CCDS13930.1	22q13.1	2007-07-27	2007-07-27	2007-07-27	ENSG00000100353	ENSG00000100353			3278	protein-coding gene	gene with protein product		603915	"""eukaryotic translation initiation factor 3, subunit 7 zeta, 66/67kDa"""	EIF3S7		9341143	Standard	NM_003753		Approved	eIF3-p66, eIF3-zeta, eIF3d	uc003apr.3	O15371	OTTHUMG00000150599	ENST00000216190.8:c.1282A>G	22.37:g.36908574T>C	ENSP00000216190:p.Asn428Asp	Somatic		Capture	Illumina HiSeq	Phase_I	35238520	NM_003753		Missense_Mutation	SNP	ENST00000216190.8	37	CCDS13930.1	.	.	.	.	.	.	.	.	.	.	T	29.9	5.048789	0.93740	.	.	ENSG00000100353	ENST00000216190;ENST00000397177;ENST00000541106;ENST00000405442;ENST00000426531;ENST00000458572	.	.	.	5.52	5.52	0.82312	.	0.167930	0.64402	D	0.000005	D	0.85613	0.5737	M	0.92169	3.28	0.80722	D	1	D;D	0.69078	0.997;0.995	D;D	0.74348	0.978;0.983	D	0.89171	0.3537	9	0.87932	D	0	-0.5557	15.8129	0.78578	0.0:0.0:0.0:1.0	.	379;428	B4DVY1;O15371	.;EIF3D_HUMAN	D	428;413;379;428;81;115	.	ENSP00000216190:N428D	N	-	1	0	EIF3D	35238520	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.432000	0.80349	2.318000	0.78349	0.523000	0.50628	AAC		EIF3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319026.1		
CACNA1I	8911	broad.mit.edu	37	22	40015370	40015370	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr22:40015370G>A	ENST00000402142.3	+	4	538	c.538G>A	c.(538-540)Gtg>Atg	p.V180M	CACNA1I_ENST00000401624.1_Missense_Mutation_p.V180M|CACNA1I_ENST00000407673.1_Missense_Mutation_p.V180M|CACNA1I_ENST00000400164.3_Missense_Mutation_p.V180M|CACNA1I_ENST00000404898.1_Missense_Mutation_p.V180M|CACNA1I_ENST00000336649.4_Missense_Mutation_p.V180M	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	180					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.V180M(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	CATCCGCACCGTGCGCGTCCT	0.612																																					p.V180M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G538A	22						.						111.0	114.0	113.0					22																	40015370		2190	4279	6469	38345316	SO:0001583	missense	8911	exon4			AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.538G>A	22.37:g.40015370G>A	ENSP00000385019:p.Val180Met	Somatic		Capture	Illumina HiSeq	Phase_I	38345316	NM_021096	B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Missense_Mutation	SNP	ENST00000402142.3	37	CCDS46710.1	.	.	.	.	.	.	.	.	.	.	-	17.60	3.430234	0.62844	.	.	ENSG00000100346	ENST00000402142;ENST00000404898;ENST00000401624;ENST00000407673;ENST00000336649;ENST00000400164	D;D;D;D;D;D	0.98602	-5.02;-5.02;-5.02;-5.02;-5.02;-5.02	5.11	5.11	0.69529	Ion transport (1);	0.154977	0.41938	D	0.000791	D	0.98451	0.9484	M	0.67625	2.065	0.51233	D	0.999919	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.98871	1.0766	10	0.10636	T	0.68	.	17.3138	0.87217	0.0:0.0:1.0:0.0	.	180;180;180;180	Q9P0X4-3;Q9P0X4-2;Q9P0X4-4;Q9P0X4	.;.;.;CAC1I_HUMAN	M	180	ENSP00000385019:V180M;ENSP00000384093:V180M;ENSP00000383887:V180M;ENSP00000385680:V180M;ENSP00000337829:V180M;ENSP00000383028:V180M	ENSP00000337829:V180M	V	+	1	0	CACNA1I	38345316	1.000000	0.71417	0.989000	0.46669	0.179000	0.23085	7.102000	0.77005	2.405000	0.81733	0.556000	0.70494	GTG		CACNA1I-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321290.1	NM_001003406	
POLR1B	84172	broad.mit.edu	37	2	113333220	113333220	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr2:113333220G>A	ENST00000263331.5	+	15	3902	c.3322G>A	c.(3322-3324)Gat>Aat	p.D1108N	POLR1B_ENST00000541869.1_Missense_Mutation_p.D1146N|POLR1B_ENST00000537335.1_Missense_Mutation_p.D897N|POLR1B_ENST00000417433.2_Missense_Mutation_p.D1052N|POLR1B_ENST00000409894.3_Missense_Mutation_p.D925N	NM_019014.4	NP_061887.2	Q9H9Y6	RPA2_HUMAN	polymerase (RNA) I polypeptide B, 128kDa	1108					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)	p.D1108N(1)		breast(3)|endometrium(9)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42						TGACACTATCGATACTGTTTC	0.433																																					p.D1052N	Ovarian(16;256 576 9537 23969 41147)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3154A	2						.						131.0	117.0	122.0					2																	113333220		2203	4300	6503	113049691	SO:0001583	missense	84172	exon14			AK001678	CCDS2097.1, CCDS46395.1, CCDS62988.1, CCDS62989.1, CCDS62990.1	2q13	2013-01-21			ENSG00000125630	ENSG00000125630		"""RNA polymerase subunits"""	20454	protein-coding gene	gene with protein product		602000					Standard	NM_001137604		Approved	Rpo1-2, FLJ21921, FLJ10816, RPA2	uc002thw.2	Q9H9Y6	OTTHUMG00000131314	ENST00000263331.5:c.3322G>A	2.37:g.113333220G>A	ENSP00000263331:p.Asp1108Asn	Somatic		Capture	Illumina HiSeq	Phase_I	113049691	NM_001137604	B7Z6Y7|B7Z823|F5GZX4|F8W898|Q2TAM4|Q585T5|Q6ZRR2|Q9H9D3	Missense_Mutation	SNP	ENST00000263331.5	37	CCDS2097.1	.	.	.	.	.	.	.	.	.	.	G	17.71	3.455806	0.63401	.	.	ENSG00000125630	ENST00000263331;ENST00000541869;ENST00000409894;ENST00000537335;ENST00000417433	T;T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0;-1.0	5.37	5.37	0.77165	RNA polymerase Rpb2, domain 7 (1);	0.302177	0.39985	N	0.001204	T	0.69106	0.3074	L	0.43923	1.385	0.40330	D	0.978916	P;B;B;P	0.46064	0.872;0.007;0.007;0.827	B;B;B;B	0.40982	0.234;0.005;0.016;0.345	T	0.70219	-0.4932	10	0.33141	T	0.24	-35.4586	17.9067	0.88920	0.0:0.0:1.0:0.0	.	1146;925;1052;1108	F5GZX4;F8W898;Q9H9Y6-2;Q9H9Y6	.;.;.;RPA2_HUMAN	N	1108;1146;925;897;1052	ENSP00000263331:D1108N;ENSP00000444136:D1146N;ENSP00000387143:D925N;ENSP00000437914:D897N;ENSP00000405358:D1052N	ENSP00000263331:D1108N	D	+	1	0	POLR1B	113049691	1.000000	0.71417	0.937000	0.37676	0.985000	0.73830	6.254000	0.72460	2.507000	0.84556	0.557000	0.71058	GAT		POLR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254083.1	NM_019014	
POTEE	445582	broad.mit.edu	37	2	132021766	132021766	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr2:132021766A>C	ENST00000356920.5	+	15	2832	c.2738A>C	c.(2737-2739)aAa>aCa	p.K913T	POTEE_ENST00000358087.5_3'UTR|PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000303908.3_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	913	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.K913T(1)									CGTGACATCAAAGAGAAGCTG	0.602																																					p.K913T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2738C	2						.						73.0	77.0	75.0					2																	132021766		1926	3862	5788	131738236	SO:0001583	missense	445582	exon15			AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.2738A>C	2.37:g.132021766A>C	ENSP00000439189:p.Lys913Thr	Somatic		Capture	Illumina HiSeq	Phase_I	131738236	NM_001083538	Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	ENST00000356920.5	37	CCDS46414.1	.	.	.	.	.	.	.	.	.	.	.	15.85	2.956333	0.53293	.	.	ENSG00000188219	ENST00000356920	D	0.97850	-4.57	.	.	.	.	.	.	.	.	D	0.99177	0.9715	H	0.99884	4.89	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.96111	0.9077	8	0.87932	D	0	.	4.5487	0.12098	0.9994:0.0:6.0E-4:0.0	.	913	Q6S8J3	POTEE_HUMAN	T	913	ENSP00000439189:K913T	ENSP00000439189:K913T	K	+	2	0	AC131180.1	131738236	1.000000	0.71417	0.327000	0.25402	0.329000	0.28539	6.177000	0.71961	0.103000	0.17682	0.102000	0.15555	AAA		POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538	
SATB2	23314	broad.mit.edu	37	2	200173513	200173513	+	Silent	SNP	G	G	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr2:200173513G>A	ENST00000417098.1	-	10	2526	c.1710C>T	c.(1708-1710)caC>caT	p.H570H	SATB2_ENST00000457245.1_Silent_p.H570H|SATB2_ENST00000443023.1_Silent_p.H511H|SATB2_ENST00000428695.1_Silent_p.H452H|SATB2_ENST00000260926.5_Silent_p.H570H	NM_001172509.1	NP_001165980.1	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	570					cartilage development (GO:0051216)|cellular response to organic substance (GO:0071310)|chromatin remodeling (GO:0006338)|embryonic pattern specification (GO:0009880)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|osteoblast development (GO:0002076)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)	p.H570H(2)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(40)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						GCTGGACCACGTGTTGCATGC	0.607																																					p.H570H	Colon(30;262 767 11040 24421 36230)											.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C1710T	2						.						162.0	133.0	143.0					2																	200173513		2203	4300	6503	199881758	SO:0001819	synonymous_variant	23314	exon10			AB028957	CCDS2327.1	2q33.1	2011-06-20	2007-02-15		ENSG00000119042	ENSG00000119042		"""Homeoboxes / CUT class"""	21637	protein-coding gene	gene with protein product		608148	"""SATB family member 2"""				Standard	NM_015265		Approved	KIAA1034, FLJ21474	uc002uva.2	Q9UPW6	OTTHUMG00000132767	ENST00000417098.1:c.1710C>T	2.37:g.200173513G>A		Somatic		Capture	Illumina HiSeq	Phase_I	199881758	NM_001172509	A8K5Z8|Q3ZB87|Q4V763	Silent	SNP	ENST00000417098.1	37	CCDS2327.1																																																																																				SATB2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256140.1	NM_015265	
SNED1	25992	broad.mit.edu	37	2	241988533	241988533	+	Silent	SNP	C	C	T			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr2:241988533C>T	ENST00000310397.8	+	11	1599	c.1599C>T	c.(1597-1599)acC>acT	p.T533T	SNED1_ENST00000401884.1_Silent_p.T533T|SNED1_ENST00000342631.6_Silent_p.T533T|SNED1_ENST00000405547.3_Silent_p.T533T|SNED1_ENST00000469006.1_3'UTR|AC005237.4_ENST00000458377.1_RNA	NM_001080437.1	NP_001073906.1	Q8TER0	SNED1_HUMAN	sushi, nidogen and EGF-like domains 1	533					cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.T533T(1)		NS(1)|breast(1)|central_nervous_system(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	24		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		TCTGCCACACCGACCACAATG	0.632																																					p.T533T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1599T	2						.						17.0	22.0	21.0					2																	241988533		2061	4178	6239	241637206	SO:0001819	synonymous_variant	25992	exon11			AK074062	CCDS46562.1	2q37.3	2014-01-28			ENSG00000162804	ENSG00000162804		"""Fibronectin type III domain containing"""	24696	protein-coding gene	gene with protein product						12477932	Standard	NM_001080437		Approved	FLJ00133, SST3, Snep	uc002wah.1	Q8TER0	OTTHUMG00000151803	ENST00000310397.8:c.1599C>T	2.37:g.241988533C>T		Somatic		Capture	Illumina HiSeq	Phase_I	241637206	NM_001080437	B5MDC3|B7WNK6|B7WPM0|Q336F4|Q336F5|Q8N369|Q8TEP7	Silent	SNP	ENST00000310397.8	37	CCDS46562.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.422|8.422	0.846688|0.846688	0.16963|0.16963	.|.	.|.	ENSG00000162804|ENSG00000162804	ENST00000431690|ENST00000401644	.|.	.|.	.|.	5.09|5.09	-10.2|-10.2	0.00374|0.00374	.|.	.|.	.|.	.|.	.|.	T|.	0.41834|.	0.1176|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.50734|.	-0.8793|.	4|.	.|.	.|.	.|.	.|.	5.3|5.3	0.15773|0.15773	0.3374:0.1178:0.4338:0.111|0.3374:0.1178:0.4338:0.111	.|.	.|.	.|.	.|.	L|X	191|230	.|.	.|.	P|R	+|+	2|1	0|2	SNED1|SNED1	241637206|241637206	0.000000|0.000000	0.05858|0.05858	0.254000|0.254000	0.24359|0.24359	0.985000|0.985000	0.73830|0.73830	-6.121000|-6.121000	0.00080|0.00080	-2.954000|-2.954000	0.00292|0.00292	0.563000|0.563000	0.77884|0.77884	CCG|CGA		SNED1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323935.2	XM_059482	
FSTL1	11167	broad.mit.edu	37	3	120128473	120128473	+	Missense_Mutation	SNP	C	C	T	rs554312023		TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr3:120128473C>T	ENST00000295633.3	-	6	724	c.368G>A	c.(367-369)cGt>cAt	p.R123H	FSTL1_ENST00000424703.2_Missense_Mutation_p.R88H	NM_007085.4	NP_009016.1	Q12841	FSTL1_HUMAN	follistatin-like 1	123					BMP signaling pathway (GO:0030509)|response to starvation (GO:0042594)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.R123H(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|skin(1)	20				GBM - Glioblastoma multiforme(114;0.189)		GATGATGCGACGTCGGAGCTC	0.502													C|||	1	0.000199681	0.0008	0.0	5008	,	,		22184	0.0		0.0	False		,,,				2504	0.0				p.R123H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G368A	3						.						94.0	88.0	90.0					3																	120128473		2203	4300	6503	121611163	SO:0001583	missense	11167	exon6			U06863	CCDS2998.1	3q13.33	2013-01-10			ENSG00000163430	ENSG00000163430		"""EF-hand domain containing"""	3972	protein-coding gene	gene with protein product		605547				7957230, 9786430	Standard	NM_007085		Approved	FRP, FSL1	uc003eds.3	Q12841	OTTHUMG00000159440	ENST00000295633.3:c.368G>A	3.37:g.120128473C>T	ENSP00000295633:p.Arg123His	Somatic		Capture	Illumina HiSeq	Phase_I	121611163	NM_007085	A8K523|B4DTT5|D3DN90|Q549Z0	Missense_Mutation	SNP	ENST00000295633.3	37	CCDS2998.1	.	.	.	.	.	.	.	.	.	.	C	15.56	2.870192	0.51588	.	.	ENSG00000163430	ENST00000295633;ENST00000539471;ENST00000424703;ENST00000469005	T;T;T	0.23950	2.4;1.88;2.44	5.24	3.45	0.39498	.	0.341398	0.34507	N	0.003916	T	0.19327	0.0464	L	0.38175	1.15	0.40669	D	0.98219	B;B	0.24483	0.104;0.051	B;B	0.15052	0.011;0.012	T	0.04140	-1.0974	10	0.42905	T	0.14	-9.9698	10.6484	0.45634	0.0:0.8459:0.0:0.1541	.	88;123	B4DTT5;Q12841	.;FSTL1_HUMAN	H	123;66;88;123	ENSP00000295633:R123H;ENSP00000394355:R88H;ENSP00000418505:R123H	ENSP00000295633:R123H	R	-	2	0	FSTL1	121611163	0.005000	0.15991	0.999000	0.59377	0.992000	0.81027	0.611000	0.24268	0.614000	0.30107	-0.136000	0.14681	CGT		FSTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355399.1	NM_007085	
ACAD9	28976	broad.mit.edu	37	3	128616497	128616497	+	Missense_Mutation	SNP	C	C	T	rs377547811		TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr3:128616497C>T	ENST00000308982.7	+	6	658	c.577C>T	c.(577-579)Cgg>Tgg	p.R193W	ACAD9_ENST00000511526.1_3'UTR	NM_014049.4	NP_054768.2	Q9H845	ACAD9_HUMAN	acyl-CoA dehydrogenase family, member 9	193						dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)	p.R193W(1)		central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	30						AGCCTCAATCCGGAGCAGAGC	0.498																																					p.R193W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C577T	3						.	C	TRP/ARG	3,4403	6.2+/-15.9	0,3,2200	142.0	101.0	115.0		577	4.8	1.0	3		115	2,8598	2.2+/-6.3	0,2,4298	no	missense	ACAD9	NM_014049.4	101	0,5,6498	TT,TC,CC		0.0233,0.0681,0.0384	probably-damaging	193/622	128616497	5,13001	2203	4300	6503	130099187	SO:0001583	missense	28976	exon6			AF078854	CCDS3053.1	3q21.3	2013-05-24	2010-04-30		ENSG00000177646	ENSG00000177646		"""Mitochondrial respiratory chain complex assembly factors"""	21497	protein-coding gene	gene with protein product		611103	"""acyl-Coenzyme A dehydrogenase family, member 9"""			12359260, 21057504, 20816094	Standard	NM_014049		Approved	NPD002, MGC14452	uc003ela.4	Q9H845	OTTHUMG00000159942	ENST00000308982.7:c.577C>T	3.37:g.128616497C>T	ENSP00000312618:p.Arg193Trp	Somatic		Capture	Illumina HiSeq	Phase_I	130099187	NM_014049	D3DNB8|Q8WXX3	Missense_Mutation	SNP	ENST00000308982.7	37	CCDS3053.1	.	.	.	.	.	.	.	.	.	.	C	15.73	2.919819	0.52653	6.81E-4	2.33E-4	ENSG00000177646	ENST00000308982;ENST00000334167	D	0.99113	-5.44	5.67	4.79	0.61399	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (2);	0.675448	0.16256	N	0.222461	D	0.99180	0.9716	M	0.91196	3.185	0.20307	N	0.999917	D;D	0.64830	0.987;0.994	P;P	0.55011	0.766;0.713	D	0.96843	0.9619	10	0.87932	D	0	.	13.5417	0.61679	0.1661:0.8339:0.0:0.0	.	70;193	Q9H9W4;Q9H845	.;ACAD9_HUMAN	W	193;60	ENSP00000312618:R193W	ENSP00000312618:R193W	R	+	1	2	ACAD9	130099187	1.000000	0.71417	0.961000	0.40146	0.198000	0.23893	2.045000	0.41250	1.366000	0.46076	0.555000	0.69702	CGG		ACAD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358405.1	NM_014049	
DAZL	1618	broad.mit.edu	37	3	16638500	16638500	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr3:16638500delT	ENST00000399444.2	-	5	646	c.353delA	c.(352-354)aatfs	p.N118fs	DAZL_ENST00000250863.8_Frame_Shift_Del_p.N138fs	NM_001351.3	NP_001342.2	Q92904	DAZL_HUMAN	deleted in azoospermia-like	118	Homodimerization. {ECO:0000250}.				female meiosis II (GO:0007147)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|oocyte maturation (GO:0001556)|positive regulation of meiosis (GO:0045836)|positive regulation of translational initiation (GO:0045948)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|polysome (GO:0005844)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|translation activator activity (GO:0008494)	p.N118fs*41(1)	RAF1/DAZL(2)	endometrium(1)|large_intestine(3)|lung(4)|prostate(3)	11						CTCACATAAATTTTGTTTCCT	0.289																																					p.N118fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.353delA	3						.						69.0	68.0	68.0					3																	16638500		1969	4195	6164	16613504	SO:0001589	frameshift_variant	1618	exon5			BC027595	CCDS43059.1, CCDS54556.1	3p24	2013-02-12			ENSG00000092345	ENSG00000092345		"""RNA binding motif (RRM) containing"""	2685	protein-coding gene	gene with protein product		601486		DAZLA		8896558	Standard	NM_001351		Approved	DAZH, SPGYLA, MGC26406, DAZL1	uc003cbb.3	Q92904	OTTHUMG00000157050	ENST00000399444.2:c.353delA	3.37:g.16638500delT	ENSP00000382373:p.Asn118fs	Somatic		Capture	Illumina HiSeq	Phase_I	16613504	NM_001351	O15396|Q5HYB4|Q92909	Frame_Shift_Del	DEL	ENST00000399444.2	37	CCDS43059.1																																																																																				DAZL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347261.2	NM_001351	
CTNNB1	1499	broad.mit.edu	37	3	41275654	41275654	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr3:41275654C>T	ENST00000349496.5	+	10	1829	c.1549C>T	c.(1549-1551)Ctt>Ttt	p.L517F	CTNNB1_ENST00000396183.3_Missense_Mutation_p.L517F|CTNNB1_ENST00000453024.1_Missense_Mutation_p.L510F|CTNNB1_ENST00000396185.3_Missense_Mutation_p.L517F|CTNNB1_ENST00000405570.1_Missense_Mutation_p.L517F	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	517					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.L517F(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		GATTCGAAATCTTGCCCTTTG	0.458		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.L517F	Colon(6;3 56 14213 18255)		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1549T	3						.						155.0	136.0	142.0					3																	41275654		2203	4300	6503	41250658	SO:0001583	missense	1499	exon10	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.1549C>T	3.37:g.41275654C>T	ENSP00000344456:p.Leu517Phe	Somatic		Capture	Illumina HiSeq	Phase_I	41250658	NM_001098210	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.457254	0.84317	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	T;T;T;T;T	0.72505	-0.66;-0.66;-0.66;-0.66;-0.66	5.96	5.96	0.96718	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.88897	0.6562	M	0.94101	3.495	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.73708	0.941;0.981	D	0.90257	0.4298	10	0.62326	D	0.03	-16.2857	20.422	0.99049	0.0:1.0:0.0:0.0	.	445;517	B4DSW9;P35222	.;CTNB1_HUMAN	F	517;517;517;510;517	ENSP00000385604:L517F;ENSP00000379486:L517F;ENSP00000344456:L517F;ENSP00000411226:L510F;ENSP00000379488:L517F	ENSP00000344456:L517F	L	+	1	0	CTNNB1	41250658	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.964000	0.63701	2.832000	0.97577	0.655000	0.94253	CTT		CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
ALS2CL	259173	broad.mit.edu	37	3	46713452	46713452	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr3:46713452G>A	ENST00000318962.4	-	24	2689	c.2606C>T	c.(2605-2607)tCg>tTg	p.S869L	ALS2CL_ENST00000383742.3_Missense_Mutation_p.S216L|ALS2CL_ENST00000415953.1_Missense_Mutation_p.S869L	NM_147129.3	NP_667340.2	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like	869	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				endosome organization (GO:0007032)|protein localization (GO:0008104)	cytoplasmic membrane-bounded vesicle (GO:0016023)	GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S869L(1)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(3)|stomach(2)	29				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		CAATACCCTCGACACCGTGCC	0.637																																					p.S869L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2606T	3						.						121.0	101.0	108.0					3																	46713452		2203	4300	6503	46688456	SO:0001583	missense	259173	exon24			AK074118	CCDS2743.1, CCDS43080.1	3p21.31	2008-01-30			ENSG00000178038	ENSG00000178038			20605	protein-coding gene	gene with protein product		612402				15388334, 8889548, 17239822	Standard	NM_147129		Approved	FLJ36525, RN49018, DKFZp686I0110	uc003cqb.2	Q60I27	OTTHUMG00000128673	ENST00000318962.4:c.2606C>T	3.37:g.46713452G>A	ENSP00000313670:p.Ser869Leu	Somatic		Capture	Illumina HiSeq	Phase_I	46688456	NM_001190707	Q32MA1|Q6AI56|Q6ZNC5|Q6ZNC7|Q6ZTL4|Q86YD2|Q8N9U1|Q8NAL7	Missense_Mutation	SNP	ENST00000318962.4	37	CCDS2743.1	.	.	.	.	.	.	.	.	.	.	G	12.16	1.854134	0.32791	.	.	ENSG00000178038	ENST00000318962;ENST00000415953;ENST00000383742	T;T;T	0.32753	1.44;1.44;1.44	4.76	3.88	0.44766	Vacuolar sorting protein 9 (2);	0.000000	0.56097	D	0.000040	T	0.36991	0.0987	N	0.21373	0.66	0.34981	D	0.754087	D	0.89917	1.0	D	0.87578	0.998	T	0.43845	-0.9366	10	0.29301	T	0.29	.	10.6094	0.45412	0.0941:0.0:0.9059:0.0	.	869	Q60I27	AL2CL_HUMAN	L	869;869;216	ENSP00000313670:S869L;ENSP00000413223:S869L;ENSP00000373248:S216L	ENSP00000313670:S869L	S	-	2	0	ALS2CL	46688456	1.000000	0.71417	0.760000	0.31359	0.027000	0.11550	4.398000	0.59697	1.221000	0.43506	0.650000	0.86243	TCG		ALS2CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250567.3	NM_147129	
RAB6B	51560	broad.mit.edu	37	3	133583485	133583485	+	Splice_Site	SNP	G	G	A	rs373466732		TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr3:133583485G>A	ENST00000285208.4	-	2	421	c.72C>T	c.(70-72)gtC>gtT	p.V24V	RAB6B_ENST00000486858.1_Splice_Site_p.V11V|RAB6B_ENST00000543906.1_Splice_Site_p.V24V|RAB6B_ENST00000469959.1_Splice_Site_p.V24V	NM_016577.3	NP_057661.3	Q9NRW1	RAB6B_HUMAN	RAB6B, member RAS oncogene family	24					GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)	p.V24V(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)	11						ACGTCTTCCCGACTGCAAAAC	0.473																																					p.V24V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C72T	3						.	G		0,4406		0,0,2203	208.0	177.0	187.0		72	-2.5	1.0	3		187	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous-near-splice	RAB6B	NM_016577.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		24/209	133583485	1,13005	2203	4300	6503	135066175	SO:0001630	splice_region_variant	51560	exon2			AF166492	CCDS3082.1	3q22.1	2008-05-15			ENSG00000154917	ENSG00000154917		"""RAB, member RAS oncogene"""	14902	protein-coding gene	gene with protein product		615852					Standard	NM_016577		Approved		uc003epy.3	Q9NRW1	OTTHUMG00000159749	ENST00000285208.4:c.71-1C>T	3.37:g.133583485G>A		Somatic		Capture	Illumina HiSeq	Phase_I	135066175	NM_016577	B2R5Z9|B7Z337|D3DND3|Q92929	Silent	SNP	ENST00000285208.4	37	CCDS3082.1																																																																																				RAB6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357152.1		Silent
POU4F2	5458	broad.mit.edu	37	4	147560536	147560536	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr4:147560536G>T	ENST00000281321.3	+	1	492	c.244G>T	c.(244-246)Ggg>Tgg	p.G82W	AC093887.1_ENST00000584185.1_RNA	NM_004575.2	NP_004566.2	Q12837	PO4F2_HUMAN	POU class 4 homeobox 2	82	Poly-Gly.				axon extension (GO:0048675)|axon guidance (GO:0007411)|intracellular estrogen receptor signaling pathway (GO:0030520)|MAPK cascade (GO:0000165)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.G82W(1)		NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)					cagcggcggcgggggcTCGGA	0.677																																					p.G82W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G244T	4						.						13.0	17.0	16.0					4																	147560536		2146	4239	6385	147779986	SO:0001583	missense	5458	exon1			U06233	CCDS34074.1	4q31.22	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9219	protein-coding gene	gene with protein product		113725	"""POU domain, class 4, transcription factor 2"", ""POU domain class 4, transcription factor 2"""	BRN3B		8332509	Standard	NM_004575		Approved	Brn-3b	uc003ikv.3	Q12837		ENST00000281321.3:c.244G>T	4.37:g.147560536G>T	ENSP00000281321:p.Gly82Trp	Somatic		Capture	Illumina HiSeq	Phase_I	147779986	NM_004575	B1PJR6|B2RC84|Q13883|Q14987	Missense_Mutation	SNP	ENST00000281321.3	37	CCDS34074.1	.	.	.	.	.	.	.	.	.	.	G	16.66	3.184756	0.57909	.	.	ENSG00000151615	ENST00000281321	D	0.90385	-2.66	4.78	4.78	0.61160	.	0.483231	0.19289	N	0.117942	D	0.91257	0.7244	N	0.22421	0.69	0.42466	D	0.992803	D	0.89917	1.0	D	0.87578	0.998	D	0.91803	0.5453	10	0.66056	D	0.02	.	13.2213	0.59890	0.0:0.0:1.0:0.0	.	82	Q12837	PO4F2_HUMAN	W	82	ENSP00000281321:G82W	ENSP00000281321:G82W	G	+	1	0	POU4F2	147779986	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	2.409000	0.44583	2.481000	0.83766	0.561000	0.74099	GGG		POU4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367020.1	NM_004575	
FBXW7	55294	broad.mit.edu	37	4	153249384	153249384	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr4:153249384C>T	ENST00000281708.4	-	9	2623	c.1394G>A	c.(1393-1395)cGt>cAt	p.R465H	FBXW7_ENST00000296555.5_Missense_Mutation_p.R347H|FBXW7_ENST00000263981.5_Missense_Mutation_p.R385H|FBXW7_ENST00000393956.3_Missense_Mutation_p.R289H|FBXW7_ENST00000603841.1_Missense_Mutation_p.R465H|FBXW7_ENST00000603548.1_Missense_Mutation_p.R465H	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	465			R -> C (in a acute lymphoblastic leukemia cell line). {ECO:0000269|PubMed:11565033}.|R -> H (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.R465H(69)|p.R385H(16)|p.R226H(16)|p.R465L(4)|p.R347H(4)|p.R465Y(2)|p.?(1)|p.R385L(1)|p.R226L(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				ATGCATACAACGCACAGTGGA	0.408			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.R385H			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	FBXW7,large_intestine,NS,Substitution - Missense,0 	.	114	Substitution - Missense(113)|Unknown(1)	haematopoietic_and_lymphoid_tissue(40)|large_intestine(39)|endometrium(24)|lung(5)|ovary(4)|cervix(1)|biliary_tract(1)	c.G1154A	4						.						253.0	218.0	230.0					4																	153249384		2203	4300	6503	153468834	SO:0001583	missense	55294	exon8			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1394G>A	4.37:g.153249384C>T	ENSP00000281708:p.Arg465His	Somatic		Capture	Illumina HiSeq	Phase_I	153468834	NM_018315	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	C	32	5.178201	0.94846	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	6.05	6.05	0.98169	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.63827	0.2544	L	0.56124	1.755	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	T	0.62469	-0.6848	10	0.87932	D	0	-17.2313	20.6013	0.99457	0.0:1.0:0.0:0.0	.	289;465;347;385	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	H	465;347;385;289	ENSP00000281708:R465H;ENSP00000296555:R347H;ENSP00000263981:R385H;ENSP00000377528:R289H	ENSP00000263981:R385H	R	-	2	0	FBXW7	153468834	1.000000	0.71417	0.960000	0.40013	0.996000	0.88848	7.818000	0.86416	2.878000	0.98634	0.650000	0.86243	CGT		FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
TRAPPC11	60684	broad.mit.edu	37	4	184587552	184587552	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr4:184587552A>C	ENST00000334690.6	+	3	549	c.347A>C	c.(346-348)gAg>gCg	p.E116A	TRAPPC11_ENST00000357207.4_Missense_Mutation_p.E116A	NM_021942.5	NP_068761.4	Q7Z392	TPC11_HUMAN	trafficking protein particle complex 11	116					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)		p.E116A(1)									AAGCAGTCTGAGTGCGCCACC	0.478																																					p.E116A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A347C	4						.						116.0	112.0	113.0					4																	184587552		2203	4300	6503	184824546	SO:0001583	missense	60684	exon3				CCDS34112.1, CCDS47166.1	4q35.1	2011-12-12	2011-12-12	2011-12-12	ENSG00000168538	ENSG00000168538		"""Trafficking protein particle complex"""	25751	protein-coding gene	gene with protein product	"""gryzun homolog (Drosophila)"", ""foie gras homolog (zebrafish)"""	614138	"""chromosome 4 open reading frame 41"""	C4orf41		19942856, 21525244	Standard	NM_021942		Approved	FLJ12716, gry, foigr	uc003ivx.3	Q7Z392	OTTHUMG00000160673	ENST00000334690.6:c.347A>C	4.37:g.184587552A>C	ENSP00000335371:p.Glu116Ala	Somatic		Capture	Illumina HiSeq	Phase_I	184824546	NM_199053	A4QPB8|B2RCD6|Q5U5I7|Q6FI73|Q86T25|Q9H0L1|Q9H5K9|Q9H8Q1|Q9H9I7	Missense_Mutation	SNP	ENST00000334690.6	37	CCDS34112.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.986849	0.74589	.	.	ENSG00000168538	ENST00000334690;ENST00000357207;ENST00000360109	.	.	.	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.57272	0.2042	L	0.56280	1.765	0.80722	D	1	P;P	0.45715	0.787;0.865	B;B	0.43478	0.241;0.421	T	0.58707	-0.7589	9	0.39692	T	0.17	.	15.6867	0.77415	1.0:0.0:0.0:0.0	.	116;116	Q7Z392;Q7Z392-3	TPC11_HUMAN;.	A	116	.	ENSP00000335371:E116A	E	+	2	0	C4orf41	184824546	1.000000	0.71417	0.293000	0.24932	0.993000	0.82548	9.158000	0.94723	2.109000	0.64355	0.460000	0.39030	GAG		TRAPPC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361654.2	NM_021942	
FRYL	285527	broad.mit.edu	37	4	48549744	48549744	+	Missense_Mutation	SNP	C	C	T	rs372020475		TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr4:48549744C>T	ENST00000503238.1	-	38	4930	c.4931G>A	c.(4930-4932)cGc>cAc	p.R1644H	FRYL_ENST00000537810.1_Missense_Mutation_p.R1644H|FRYL_ENST00000358350.4_Missense_Mutation_p.R1644H|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000507873.2_5'UTR			O94915	FRYL_HUMAN	FRY-like	1644					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)			p.R1644H(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						CAGAAGCAGGCGTTTACAATG	0.398																																					p.R1644H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4931A	4						.	C	HIS/ARG	0,3750		0,0,1875	86.0	82.0	83.0		4931	5.5	1.0	4		83	1,8197		0,1,4098	no	missense	FRYL	NM_015030.1	29	0,1,5973	TT,TC,CC		0.0122,0.0,0.0084	benign	1644/3014	48549744	1,11947	1875	4099	5974	48244501	SO:0001583	missense	285527	exon41			AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.4931G>A	4.37:g.48549744C>T	ENSP00000426064:p.Arg1644His	Somatic		Capture	Illumina HiSeq	Phase_I	48244501	NM_015030	O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	ENST00000503238.1	37	CCDS43227.1	.	.	.	.	.	.	.	.	.	.	C	15.88	2.963991	0.53507	0.0	1.22E-4	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810	T;T;T	0.04917	3.53;3.53;3.53	5.53	5.53	0.82687	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.10981	0.0268	M	0.66939	2.045	0.80722	D	1	B;P;P	0.47350	0.021;0.894;0.87	B;B;B	0.42593	0.019;0.392;0.33	T	0.01512	-1.1336	10	0.45353	T	0.12	.	13.7137	0.62682	0.0:0.9264:0.0:0.0736	.	475;1644;1644	Q6ZR29;O94915;F5GX82	.;FRYL_HUMAN;.	H	1644	ENSP00000426064:R1644H;ENSP00000351113:R1644H;ENSP00000441114:R1644H	ENSP00000351113:R1644H	R	-	2	0	FRYL	48244501	1.000000	0.71417	1.000000	0.80357	0.099000	0.18886	5.735000	0.68587	2.596000	0.87737	0.460000	0.39030	CGC		FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		
LPHN3	23284	broad.mit.edu	37	4	62936364	62936364	+	Missense_Mutation	SNP	C	C	T	rs371830824		TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr4:62936364C>T	ENST00000514591.1	+	25	4477	c.4148C>T	c.(4147-4149)cCg>cTg	p.P1383L	LPHN3_ENST00000509896.1_3'UTR|LPHN3_ENST00000508693.1_3'UTR|LPHN3_ENST00000545650.1_Missense_Mutation_p.P1383L|LPHN3_ENST00000506746.1_Missense_Mutation_p.P1485L|LPHN3_ENST00000507164.1_3'UTR|LPHN3_ENST00000514157.1_3'UTR|LPHN3_ENST00000514996.1_Missense_Mutation_p.P1417L|LPHN3_ENST00000507625.1_Missense_Mutation_p.P1442L|LPHN3_ENST00000506700.1_3'UTR|LPHN3_ENST00000504896.1_3'UTR|LPHN3_ENST00000508946.1_Missense_Mutation_p.P1426L|LPHN3_ENST00000511324.1_3'UTR|RP11-84A1.3_ENST00000509461.1_RNA|LPHN3_ENST00000512091.2_3'UTR|RP11-84A1.3_ENST00000504135.1_RNA|LPHN3_ENST00000506720.1_Missense_Mutation_p.P1494L|RP11-84A1.3_ENST00000506704.1_RNA			Q9HAR2	LPHN3_HUMAN	latrophilin 3	1361					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)	p.P1383L(1)		breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						ACCAGCATGCCGACACTGGCT	0.537																																					p.P1383L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4148T	4						.	C	LEU/PRO	1,1383		0,1,691	23.0	30.0	28.0		4148	5.4	1.0	4		28	0,3182		0,0,1591	no	missense	LPHN3	NM_015236.4	98	0,1,2282	TT,TC,CC		0.0,0.0723,0.0219	probably-damaging	1383/1470	62936364	1,4565	692	1591	2283	62618959	SO:0001583	missense	23284	exon23			AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.4148C>T	4.37:g.62936364C>T	ENSP00000422533:p.Pro1383Leu	Somatic		Capture	Illumina HiSeq	Phase_I	62618959	NM_015236	E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	37	CCDS54768.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.972159	0.74246	7.23E-4	0.0	ENSG00000150471	ENST00000514591;ENST00000545650;ENST00000295349;ENST00000507625;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	T;T;T;T;T;T;T	0.79033	-1.18;-1.18;-1.23;-0.9;-0.93;-0.94;-0.92	5.39	5.39	0.77823	GPCR, family 2, latrophilin, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.88040	0.6330	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.88960	0.3393	10	0.87932	D	0	.	19.1541	0.93503	0.0:1.0:0.0:0.0	.	1383;1361	E9PE04;Q9HAR2	.;LPHN3_HUMAN	L	1383;1383;1361;1442;1426;1494;1485;1417	ENSP00000422533:P1383L;ENSP00000439831:P1383L;ENSP00000421372:P1442L;ENSP00000421627:P1426L;ENSP00000420931:P1494L;ENSP00000425884:P1485L;ENSP00000424258:P1417L	ENSP00000295349:P1361L	P	+	2	0	LPHN3	62618959	1.000000	0.71417	0.956000	0.39512	0.970000	0.65996	5.680000	0.68168	2.535000	0.85469	0.591000	0.81541	CCG		LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1		
UGT2A3	79799	broad.mit.edu	37	4	69816848	69816848	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr4:69816848T>C	ENST00000251566.4	-	1	661	c.631A>G	c.(631-633)Aat>Gat	p.N211D	UGT2A3_ENST00000420231.2_5'UTR	NM_024743.3	NP_079019.3	Q6UWM9	UD2A3_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide A3	211					cellular glucuronidation (GO:0052695)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.N211D(1)		NS(1)|breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(7)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						AGCATTGAATTTTTTACTCTT	0.393																																					p.N211D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A631G	4						.						52.0	53.0	53.0					4																	69816848		2203	4299	6502	69851437	SO:0001583	missense	79799	exon1				CCDS3525.1	4q13.2	2010-12-14			ENSG00000135220	ENSG00000135220		"""UDP glucuronosyltransferases"""	28528	protein-coding gene	gene with protein product							Standard	NM_024743		Approved	FLJ21934	uc003hef.2	Q6UWM9	OTTHUMG00000129408	ENST00000251566.4:c.631A>G	4.37:g.69816848T>C	ENSP00000251566:p.Asn211Asp	Somatic		Capture	Illumina HiSeq	Phase_I	69851437	NM_024743	Q9H6S4	Missense_Mutation	SNP	ENST00000251566.4	37	CCDS3525.1	.	.	.	.	.	.	.	.	.	.	T	15.73	2.919144	0.52546	.	.	ENSG00000135220	ENST00000251566	T	0.73363	-0.74	4.74	4.74	0.60224	.	0.000000	0.85682	D	0.000000	D	0.90652	0.7068	H	0.98238	4.18	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93270	0.6651	10	0.87932	D	0	.	12.2413	0.54544	0.0:0.0:0.0:1.0	.	211	Q6UWM9	UD2A3_HUMAN	D	211	ENSP00000251566:N211D	ENSP00000251566:N211D	N	-	1	0	UGT2A3	69851437	1.000000	0.71417	0.810000	0.32431	0.029000	0.11900	6.329000	0.72920	1.996000	0.58369	0.482000	0.46254	AAT		UGT2A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251564.1	NM_024743	
SORBS2	8470	broad.mit.edu	37	4	186545170	186545170	+	Silent	SNP	G	G	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr4:186545170G>A	ENST00000284776.7	-	13	1910	c.1401C>T	c.(1399-1401)tcC>tcT	p.S467S	SORBS2_ENST00000431808.1_Silent_p.S467S|SORBS2_ENST00000498125.1_Intron|SORBS2_ENST00000418609.1_Silent_p.S371S|SORBS2_ENST00000355634.5_Silent_p.S567S|SORBS2_ENST00000319471.9_Intron|SORBS2_ENST00000393528.3_Intron|SORBS2_ENST00000437304.2_Intron|SORBS2_ENST00000449407.2_Intron|SORBS2_ENST00000448662.2_Intron	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	467					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)	p.S467S(1)		endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		AGATCACCTCGGAGTTCATCA	0.592																																					p.S467S	Esophageal Squamous(153;41 2433 9491 36028)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1401T	4						.						98.0	89.0	92.0					4																	186545170		2203	4300	6503	186782164	SO:0001819	synonymous_variant	8470	exon13				CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.1401C>T	4.37:g.186545170G>A		Somatic		Capture	Illumina HiSeq	Phase_I	186782164	NM_021069	A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Silent	SNP	ENST00000284776.7	37	CCDS3845.1																																																																																				SORBS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347944.3	NM_003603	
PAPD7	11044	broad.mit.edu	37	5	6739912	6739912	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr5:6739912C>T	ENST00000230859.6	+	4	334	c.205C>T	c.(205-207)Cgg>Tgg	p.R69W		NM_001171805.1|NM_001171806.1|NM_006999.4	NP_001165276.1|NP_001165277.1|NP_008930.1	Q5XG87	PAPD7_HUMAN	PAP associated domain containing 7	299	Ala-rich.				double-strand break repair (GO:0006302)|mitotic chromosome condensation (GO:0007076)|response to drug (GO:0042493)|sister chromatid cohesion (GO:0007062)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|SMC family protein binding (GO:0043221)	p.R69W(1)		cervix(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						GCAAGCCCTGCGGAAGCACAA	0.587																																					p.R69W	NSCLC(7;212 333 5667 23379 46547)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C205T	5						.						94.0	79.0	84.0					5																	6739912		2203	4300	6503	6792912	SO:0001583	missense	11044	exon4			AF089896	CCDS3871.1	5p15	2010-11-18	2010-01-19	2010-01-19	ENSG00000112941	ENSG00000112941			16705	protein-coding gene	gene with protein product	"""topoisomerase-related function protein 4-1"", ""polymerase (DNA-directed) sigma"", ""DNA polymerase kappa"", ""TUTase5"""	605198	"""polymerase (DNA directed) sigma"""	POLS		10066793, 10926539	Standard	NM_006999		Approved	POLK, TRF4, LAK-1, TRF4-1	uc003jdx.1	Q5XG87	OTTHUMG00000090457	ENST00000230859.6:c.205C>T	5.37:g.6739912C>T	ENSP00000230859:p.Arg69Trp	Somatic		Capture	Illumina HiSeq	Phase_I	6792912	NM_001171805	A8K1E2|M1JCE6|O43289|Q17RZ1|Q9Y6C1	Missense_Mutation	SNP	ENST00000230859.6	37	CCDS3871.1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.028173	0.54790	.	.	ENSG00000112941	ENST00000230859	T	0.50001	0.76	5.14	5.14	0.70334	Nucleotidyl transferase domain (1);	0.130709	0.45126	D	0.000396	T	0.47673	0.1458	M	0.78916	2.43	0.50813	D	0.999893	P;P	0.42961	0.795;0.629	B;B	0.36922	0.236;0.112	T	0.56920	-0.7899	10	0.59425	D	0.04	-9.9064	11.9054	0.52708	0.2982:0.7018:0.0:0.0	.	69;69	B7ZLL4;Q5XG87	.;PAPD7_HUMAN	W	69	ENSP00000230859:R69W	ENSP00000230859:R69W	R	+	1	2	PAPD7	6792912	0.977000	0.34250	1.000000	0.80357	0.999000	0.98932	1.912000	0.39946	2.379000	0.81126	0.655000	0.94253	CGG		PAPD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206904.1	NM_006999	
NUP155	9631	broad.mit.edu	37	5	37304852	37304852	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr5:37304852T>G	ENST00000231498.3	-	27	3354	c.3151A>C	c.(3151-3153)Aag>Cag	p.K1051Q	NUP155_ENST00000513532.1_Missense_Mutation_p.K987Q|NUP155_ENST00000381843.2_Missense_Mutation_p.K992Q|NUP155_ENST00000502533.1_5'UTR	NM_153485.1	NP_705618.1	O75694	NU155_HUMAN	nucleoporin 155kDa	1051					atrial cardiac muscle cell action potential (GO:0086014)|carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear envelope organization (GO:0006998)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)	p.K1051Q(1)		endometrium(1)|kidney(16)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	62	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TGTAGCAGCTTATCTGCAAGG	0.318																																					p.K1051Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3151C	5						.						125.0	129.0	128.0					5																	37304852		2203	4300	6503	37340609	SO:0001583	missense	9631	exon27			AJ007558	CCDS3921.1, CCDS43310.1, CCDS64142.1	5p13.1	2008-02-05	2002-08-29		ENSG00000113569	ENSG00000113569			8063	protein-coding gene	gene with protein product		606694	"""nucleoporin 155kD"""			10191094	Standard	NM_153485		Approved	KIAA0791, N155	uc003jku.1	O75694	OTTHUMG00000090803	ENST00000231498.3:c.3151A>C	5.37:g.37304852T>G	ENSP00000231498:p.Lys1051Gln	Somatic		Capture	Illumina HiSeq	Phase_I	37340609	NM_153485	Q9UBE9|Q9UFL5	Missense_Mutation	SNP	ENST00000231498.3	37	CCDS3921.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.492599	0.84962	.	.	ENSG00000113569	ENST00000231498;ENST00000381843;ENST00000434056;ENST00000513532	T;T;T	0.77620	-1.1;-1.1;-1.11	5.54	5.54	0.83059	Nucleoporin, Nup133/Nup155-like, C-terminal (1);	0.042164	0.85682	D	0.000000	D	0.83385	0.5243	L	0.59436	1.845	0.80722	D	1	D;P	0.60160	0.987;0.615	P;P	0.61003	0.882;0.536	T	0.80953	-0.1152	10	0.23891	T	0.37	-3.2149	15.6762	0.77326	0.0:0.0:0.0:1.0	.	987;1051	E9PF10;O75694	.;NU155_HUMAN	Q	1051;992;1013;987	ENSP00000231498:K1051Q;ENSP00000371265:K992Q;ENSP00000422019:K987Q	ENSP00000231498:K1051Q	K	-	1	0	NUP155	37340609	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	5.880000	0.69698	2.102000	0.63906	0.533000	0.62120	AAG		NUP155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207593.2	NM_153485, NM_004298	
C7	730	broad.mit.edu	37	5	40981662	40981662	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr5:40981662C>T	ENST00000313164.9	+	18	2878	c.2519C>T	c.(2518-2520)gCg>gTg	p.A840V		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	840	Factor I module (FIM) 2.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)		p.A840V(1)					Ovarian(839;0.0112)				CCTTGTGCTGCGGAAACCCAG	0.587																																					p.A840V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2519T	5						.						46.0	47.0	46.0					5																	40981662		2040	4204	6244	41017419	SO:0001583	missense	730	exon18			J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.2519C>T	5.37:g.40981662C>T	ENSP00000322061:p.Ala840Val	Somatic		Capture	Illumina HiSeq	Phase_I	41017419	NM_000587	Q6P3T5|Q92489	Missense_Mutation	SNP	ENST00000313164.9	37	CCDS47201.1	.	.	.	.	.	.	.	.	.	.	c	13.06	2.125489	0.37533	.	.	ENSG00000112936	ENST00000313164	T	0.64260	-0.09	5.74	-5.23	0.02798	Factor I / membrane attack complex (1);	1.556280	0.03611	N	0.234835	T	0.48607	0.1509	L	0.50333	1.59	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.21109	-1.0255	10	0.46703	T	0.11	1.2935	0.658	0.00838	0.1938:0.2244:0.2745:0.3073	.	840	P10643	CO7_HUMAN	V	840	ENSP00000322061:A840V	ENSP00000322061:A840V	A	+	2	0	C7	41017419	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-3.236000	0.00546	-1.157000	0.02815	-1.944000	0.00493	GCG		C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317680.1		
GPR98	84059	broad.mit.edu	37	5	90072351	90072351	+	Missense_Mutation	SNP	T	T	C	rs370746571		TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr5:90072351T>C	ENST00000405460.2	+	61	12581	c.12485T>C	c.(12484-12486)aTt>aCt	p.I4162T		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	4162	Calx-beta 28. {ECO:0000305|PubMed:11606593}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.I4162T(1)		NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CACATCCTCATTGGGGAACCC	0.393																																					p.I4162T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T12485C	5						.	T	THR/ILE	1,3805		0,1,1902	118.0	117.0	117.0		12485	5.1	0.7	5		117	0,8266		0,0,4133	no	missense	GPR98	NM_032119.3	89	0,1,6035	CC,CT,TT		0.0,0.0263,0.0083	probably-damaging	4162/6307	90072351	1,12071	1903	4133	6036	90108107	SO:0001583	missense	84059	exon61			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.12485T>C	5.37:g.90072351T>C	ENSP00000384582:p.Ile4162Thr	Somatic		Capture	Illumina HiSeq	Phase_I	90108107	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	T	13.63	2.295754	0.40594	2.63E-4	0.0	ENSG00000164199	ENST00000405460;ENST00000296619	T	0.27256	1.68	5.13	5.13	0.70059	.	0.143828	0.64402	D	0.000010	T	0.24890	0.0604	M	0.62723	1.935	0.80722	D	1	P	0.39480	0.675	B	0.28553	0.091	T	0.10042	-1.0647	10	0.54805	T	0.06	.	14.9054	0.70715	0.0:0.0:0.0:1.0	.	4162	Q8WXG9	GPR98_HUMAN	T	4162	ENSP00000384582:I4162T	ENSP00000296619:I4162T	I	+	2	0	GPR98	90108107	1.000000	0.71417	0.725000	0.30721	0.138000	0.21146	6.944000	0.75940	2.055000	0.61198	0.519000	0.50382	ATT		GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
APC	324	broad.mit.edu	37	5	112175390	112175390	+	Nonsense_Mutation	SNP	C	C	T	rs121913328		TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr5:112175390C>T	ENST00000457016.1	+	16	4479	c.4099C>T	c.(4099-4101)Cag>Tag	p.Q1367*	APC_ENST00000257430.4_Nonsense_Mutation_p.Q1367*|APC_ENST00000508376.2_Nonsense_Mutation_p.Q1367*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1367	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q1367*(26)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AAGTGGTGCTCAGACACCCAA	0.453	Q1367*(C2BBE1_LARGE_INTESTINE)	12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q1349X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,colon,Substitution - Nonsense,0 	.	28	Substitution - Nonsense(26)|Unknown(1)|Deletion - Frameshift(1)	large_intestine(26)|soft_tissue(1)|skin(1)	c.C4045T	5	GRCh37	CM940072	APC	M	rs121913328	.						75.0	73.0	74.0					5																	112175390		2202	4300	6502	112203289	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4099C>T	5.37:g.112175390C>T	ENSP00000413133:p.Gln1367*	Somatic		Capture	Illumina HiSeq	Phase_I	112203289	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	41	8.623019	0.98890	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	5.3	0.74995	.	0.166931	0.56097	D	0.000040	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-7.8965	17.2482	0.87034	0.0:0.8741:0.1259:0.0	.	.	.	.	X	1367	.	.	Q	+	1	0	APC	112203289	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.223000	0.72257	1.603000	0.50134	0.655000	0.94253	CAG		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
DAAM2	23500	broad.mit.edu	37	6	39846311	39846311	+	Missense_Mutation	SNP	C	C	T	rs375733561		TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr6:39846311C>T	ENST00000398904.2	+	13	1674	c.1492C>T	c.(1492-1494)Cgc>Tgc	p.R498C	DAAM2_ENST00000538976.1_Missense_Mutation_p.R498C|DAAM2_ENST00000274867.4_Missense_Mutation_p.R498C			Q86T65	DAAM2_HUMAN	dishevelled associated activator of morphogenesis 2	498					actin cytoskeleton organization (GO:0030036)|determination of left/right symmetry (GO:0007368)			p.R498C(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(18)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)	49	Ovarian(28;0.0355)|Colorectal(47;0.196)					CCAGGAGCTGCGCCAGGCTCG	0.567																																					p.R498C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1492T	6						.	C	CYS/ARG,CYS/ARG	0,4022		0,0,2011	26.0	32.0	30.0		1492,1492	4.5	1.0	6		30	1,8345		0,1,4172	no	missense,missense	DAAM2	NM_001201427.1,NM_015345.3	180,180	0,1,6183	TT,TC,CC		0.012,0.0,0.0081	probably-damaging,probably-damaging	498/1069,498/1068	39846311	1,12367	2011	4173	6184	39954289	SO:0001583	missense	23500	exon13			AB002379	CCDS54999.1, CCDS56426.1	6p21.1	2008-07-30			ENSG00000146122	ENSG00000146122			18143	protein-coding gene	gene with protein product		606627				11779461, 12632087	Standard	NM_015345		Approved	KIAA0381	uc003oow.3	Q86T65	OTTHUMG00000014653	ENST00000398904.2:c.1492C>T	6.37:g.39846311C>T	ENSP00000381876:p.Arg498Cys	Somatic		Capture	Illumina HiSeq	Phase_I	39954289	NM_015345	G5EA45|Q5T4T8|Q5T4U0|Q9NQI5|Q9Y4G0	Missense_Mutation	SNP	ENST00000398904.2	37	CCDS56426.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.439366	0.83885	0.0	1.2E-4	ENSG00000146122	ENST00000274867;ENST00000398904;ENST00000538976	T;T;T	0.76186	-1.0;-1.0;-1.0	5.46	4.53	0.55603	.	0.115379	0.64402	D	0.000020	T	0.74786	0.3762	L	0.53249	1.67	0.80722	D	1	D;D	0.76494	0.999;0.999	P;P	0.59288	0.855;0.719	T	0.77043	-0.2734	10	0.59425	D	0.04	.	12.6434	0.56721	0.2879:0.7121:0.0:0.0	.	498;498	G5EA45;Q86T65	.;DAAM2_HUMAN	C	498	ENSP00000274867:R498C;ENSP00000381876:R498C;ENSP00000437808:R498C	ENSP00000274867:R498C	R	+	1	0	DAAM2	39954289	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.211000	0.51137	2.552000	0.86080	0.555000	0.69702	CGC		DAAM2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280648.1		
CRISP1	167	broad.mit.edu	37	6	49819777	49819777	+	Silent	SNP	G	G	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr6:49819777G>A	ENST00000335847.4	-	3	233	c.132C>T	c.(130-132)atC>atT	p.I44I	CRISP1_ENST00000536021.1_Silent_p.I44I|CRISP1_ENST00000355791.2_Silent_p.I44I|CRISP1_ENST00000505118.1_Silent_p.I44I|CRISP1_ENST00000507853.1_Silent_p.I44I|CRISP1_ENST00000329411.5_Silent_p.I44I	NM_001131.2	NP_001122.2	P54107	CRIS1_HUMAN	cysteine-rich secretory protein 1	44					binding of sperm to zona pellucida (GO:0007339)|fusion of sperm to egg plasma membrane (GO:0007342)|regulation of acrosome reaction (GO:0060046)	extracellular space (GO:0005615)|nucleus (GO:0005634)	calcium channel regulator activity (GO:0005246)	p.I44I(2)		endometrium(1)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|upper_aerodigestive_tract(1)	27	Lung NSC(77;0.0358)					GTATATTAACGATCTCTTCTT	0.378																																					p.I44I												.	.	2	Substitution - coding silent(2)	large_intestine(1)|skin(1)	c.C132T	6						.						204.0	195.0	198.0					6																	49819777		2203	4300	6503	49927736	SO:0001819	synonymous_variant	167	exon3			D38451	CCDS4931.1, CCDS4932.1	6p21.2-p21.1	2008-02-05	2003-09-03	2003-09-05	ENSG00000124812	ENSG00000124812			304	protein-coding gene	gene with protein product		601193	"""acidic epididymal glycoprotein-like 1"""	AEGL1		8838800	Standard	NM_001131		Approved	CRISP-1, ARP, HUMARP, HSCRISP1D, HSCRISP1G	uc003ozw.2	P54107	OTTHUMG00000014827	ENST00000335847.4:c.132C>T	6.37:g.49819777G>A		Somatic		Capture	Illumina HiSeq	Phase_I	49927736	NM_001131	B5BU98|O00698|Q13248|Q14082|Q96SF6	Silent	SNP	ENST00000335847.4	37	CCDS4931.1																																																																																				CRISP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040875.2	NM_001131	
FAM83B	222584	broad.mit.edu	37	6	54735195	54735195	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr6:54735195C>T	ENST00000306858.7	+	2	267	c.151C>T	c.(151-153)Cga>Tga	p.R51*		NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	51								p.R51*(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					TGTCCAGGAACGAGTTTCAGA	0.388																																					p.R51X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C151T	6						.						110.0	112.0	111.0					6																	54735195		2203	4300	6503	54843154	SO:0001587	stop_gained	222584	exon2			AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.151C>T	6.37:g.54735195C>T	ENSP00000304078:p.Arg51*	Somatic		Capture	Illumina HiSeq	Phase_I	54843154	NM_001010872	Q2M1P3|Q96DQ2	Nonsense_Mutation	SNP	ENST00000306858.7	37	CCDS34479.1	.	.	.	.	.	.	.	.	.	.	C	34	5.346733	0.95807	.	.	ENSG00000168143	ENST00000306858	.	.	.	5.41	3.44	0.39384	.	0.130688	0.47852	D	0.000212	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.3111	8.3839	0.32488	0.3443:0.5395:0.1163:0.0	.	.	.	.	X	51	.	ENSP00000304078:R51X	R	+	1	2	FAM83B	54843154	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	1.096000	0.30976	1.358000	0.45922	0.460000	0.39030	CGA		FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040994.1	XM_294139	
PDE10A	10846	broad.mit.edu	37	6	165808723	165808723	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr6:165808723G>T	ENST00000366882.1	-	16	1576	c.1422C>A	c.(1420-1422)aaC>aaA	p.N474K	PDE10A_ENST00000354448.4_Missense_Mutation_p.N474K|PDE10A_ENST00000539869.2_Missense_Mutation_p.N484K			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	474					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)	p.N474K(1)		breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	CAGGCCACATGTTTTCAAAAG	0.338																																					p.N474K	Esophageal Squamous(22;308 615 5753 12038 40624)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1422A	6						.						73.0	72.0	72.0					6																	165808723		2203	4300	6503	165728713	SO:0001583	missense	10846	exon16			AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.1422C>A	6.37:g.165808723G>T	ENSP00000355847:p.Asn474Lys	Somatic		Capture	Illumina HiSeq	Phase_I	165728713	NM_006661	Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	ENST00000366882.1	37		.	.	.	.	.	.	.	.	.	.	G	6.598	0.478612	0.12521	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	T;T	0.75367	-0.93;-0.93	5.57	2.57	0.30868	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.298435	0.40144	N	0.001180	T	0.34337	0.0894	N	0.22421	0.69	0.36488	D	0.868235	B;B	0.18461	0.028;0.001	B;B	0.15870	0.014;0.0	T	0.12993	-1.0526	10	0.19590	T	0.45	.	4.3443	0.11126	0.2602:0.0:0.5511:0.1887	.	484;474	Q9ULW9;Q9Y233	.;PDE10_HUMAN	K	474;502;484;474;473	ENSP00000355847:N474K;ENSP00000346435:N474K	ENSP00000341187:N484K	N	-	3	2	PDE10A	165728713	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	0.519000	0.22862	1.363000	0.46019	0.650000	0.86243	AAC		PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1		
AKR1B15	441282	broad.mit.edu	37	7	134260639	134260639	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr7:134260639G>A	ENST00000457545.2	+	8	963	c.703G>A	c.(703-705)Gtt>Att	p.V235I	AKR1B15_ENST00000423958.1_Missense_Mutation_p.V207I	NM_001080538.2	NP_001074007.2	C9JRZ8	AK1BF_HUMAN	aldo-keto reductase family 1, member B15	235							oxidoreductase activity (GO:0016491)	p.V253I(1)|p.V207I(1)		endometrium(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|urinary_tract(1)	18						GGGCATCACCGTTACGGCCTA	0.488																																					p.V235I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G703A	7						.						73.0	60.0	64.0					7																	134260639		2202	4298	6500	133911179	SO:0001583	missense	441282	exon8				CCDS47715.1, CCDS47715.2	7q33	2009-09-09			ENSG00000227471	ENSG00000227471		"""Aldo-keto reductases"""	37281	protein-coding gene	gene with protein product							Standard	NM_001080538		Approved		uc011kpr.2	C9JRZ8	OTTHUMG00000155376	ENST00000457545.2:c.703G>A	7.37:g.134260639G>A	ENSP00000389289:p.Val235Ile	Somatic		Capture	Illumina HiSeq	Phase_I	133911179	NM_001080538	C9J3V2	Missense_Mutation	SNP	ENST00000457545.2	37	CCDS47715.2	.	.	.	.	.	.	.	.	.	.	G	2.857	-0.237039	0.05944	.	.	ENSG00000227471	ENST00000457545;ENST00000423958	T;T	0.23348	1.91;1.91	3.87	1.06	0.20224	NADP-dependent oxidoreductase domain (3);	.	.	.	.	T	0.17408	0.0418	L	0.41236	1.265	0.44462	D	0.997391	B;P	0.35481	0.344;0.504	B;B	0.35470	0.094;0.203	T	0.07868	-1.0750	9	0.17832	T	0.49	.	8.0939	0.30816	0.2791:0.0:0.7209:0.0	.	207;235	C9JRZ8-2;C9JRZ8	.;AK1BF_HUMAN	I	235;207	ENSP00000389289:V235I;ENSP00000397009:V207I	ENSP00000397009:V207I	V	+	1	0	AKR1B15	133911179	0.666000	0.27475	0.007000	0.13788	0.014000	0.08584	0.930000	0.28858	0.021000	0.15133	-0.255000	0.11280	GTT		AKR1B15-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339726.2		
PMS2	5395	broad.mit.edu	37	7	6017218	6017219	+	Splice_Site	DNP	CC	CC	TG			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	CC	CC					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr7:6017218_6017219CC>TG	ENST00000265849.7	-	14	2550_2551	c.2445_2446GG>CA	c.(2443-2448)tcGGtg>tcCAtg	p.V816M	PMS2_ENST00000382321.4_Splice_Site_p.V415M|PMS2_ENST00000441476.2_Splice_Site_p.V710M	NM_000535.5	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)	816					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|single base insertion or deletion binding (GO:0032138)	p.?(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(11)|lung(13)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		TCTTTACTTACCGACTTCCGGC	0.554			"""Mis, N, F"""			"""colorectal, endometrial, ovarian, medulloblastoma, glioma"""		Direct reversal of damage;Mismatch excision repair (MMR)	Turcot syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												.		yes	Rec		"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	7	7p22	5395	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)		E	.	.	1	Unknown(1)	large_intestine(1)	c.2445_2445CA	7						.																																			5983745	SO:0001630	splice_region_variant	5395	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III		CCDS5343.1	7p22.1	2014-09-17	2001-11-28		ENSG00000122512	ENSG00000122512			9122	protein-coding gene	gene with protein product		600259	"""postmeiotic segregation increased (S. cerevisiae) 2"""	PMSL2		8072530	Standard	NM_000535		Approved	H_DJ0042M02.9, HNPCC4	uc003spl.3	P54278	OTTHUMG00000023135	ENST00000265849.7:c.2445_2446delinsTG	7.37:g.6017218_6017219delinsTG		Somatic		Capture	Illumina HiSeq	Phase_I	5983744	NM_000535	B2R610|Q52LH6|Q5FBW9|Q5FBX1|Q5FBX2|Q75MR2	Splice_Site	DNP	ENST00000265849.7	37	CCDS5343.1																																																																																				PMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207353.3	NM_000535	Missense_Mutation
DPY19L1	23333	broad.mit.edu	37	7	34994377	34994377	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr7:34994377C>T	ENST00000310974.4	-	13	1178	c.1034G>A	c.(1033-1035)tGt>tAt	p.C345Y	DPY19L1_ENST00000462134.2_5'Flank	NM_015283.1	NP_056098.1	Q2PZI1	D19L1_HUMAN	dpy-19-like 1 (C. elegans)	345						integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring glycosyl groups (GO:0016757)	p.C345Y(1)		endometrium(3)|kidney(5)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	31						TAACCAAAAACATCCTTGAAT	0.279																																					p.C345Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1034A	7						.						25.0	21.0	22.0					7																	34994377		1790	4035	5825	34960902	SO:0001583	missense	23333	exon13			AB020684	CCDS43567.1	7p14.3-p14.2	2006-04-26			ENSG00000173852	ENSG00000173852			22205	protein-coding gene	gene with protein product		613892					Standard	NM_015283		Approved	KIAA0877	uc003tem.4	Q2PZI1	OTTHUMG00000154888	ENST00000310974.4:c.1034G>A	7.37:g.34994377C>T	ENSP00000308695:p.Cys345Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	34960902	NM_015283	O94954|Q4G151	Missense_Mutation	SNP	ENST00000310974.4	37	CCDS43567.1	.	.	.	.	.	.	.	.	.	.	C	4.819	0.152202	0.09185	.	.	ENSG00000173852	ENST00000310974;ENST00000446375	T;T	0.53423	0.62;0.62	5.17	5.17	0.71159	.	0.362487	0.32357	N	0.006209	T	0.36248	0.0960	L	0.47716	1.5	0.38355	D	0.944442	P	0.43885	0.82	B	0.39119	0.291	T	0.35076	-0.9803	10	0.02654	T	1	-10.3169	14.0434	0.64690	0.0:1.0:0.0:0.0	.	345	Q2PZI1	D19L1_HUMAN	Y	345;115	ENSP00000308695:C345Y;ENSP00000400510:C115Y	ENSP00000308695:C345Y	C	-	2	0	DPY19L1	34960902	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	1.713000	0.37951	2.687000	0.91594	0.591000	0.81541	TGT		DPY19L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337506.1		
SUGCT	79783	broad.mit.edu	37	7	40228168	40228168	+	Nonsense_Mutation	SNP	C	C	T	rs137852862	byFrequency	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr7:40228168C>T	ENST00000335693.4	+	4	345	c.322C>T	c.(322-324)Cga>Tga	p.R108*	C7orf10_ENST00000309930.5_Nonsense_Mutation_p.R108*|C7orf10_ENST00000401647.2_Nonsense_Mutation_p.R108*|C7orf10_ENST00000540834.1_Nonsense_Mutation_p.R101*	NM_001193313.1	NP_001180242.1	Q9HAC7	SUCHY_HUMAN		108					metabolic process (GO:0008152)	mitochondrion (GO:0005739)	succinate-hydroxymethylglutarate CoA-transferase activity (GO:0047369)	p.R108*(2)		endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)	18						CAGTGTTAACCGAAATAAAAA	0.333													C|||	2	0.000399361	0.0	0.0014	5008	,	,		14957	0.0		0.001	False		,,,				2504	0.0				p.R108X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C322T	7	GRCh37	CM085299	C7orf10	M	rs137852862	.	C	stop/ARG,stop/ARG,stop/ARG,stop/ARG	1,3661		0,1,1830	49.0	50.0	49.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	322,322,322,322	4.9	1.0	7	dbSNP_133	49	1,8155		0,1,4077	yes	stop-gained,stop-gained,stop-gained,stop-gained	C7orf10	NM_001193311.1,NM_001193312.1,NM_001193313.1,NM_024728.2	,,,	0,2,5907	TT,TC,CC		0.0123,0.0273,0.0169	,,,	108/472,108/398,108/446,108/435	40228168	2,11816	1831	4078	5909	40194693	SO:0001587	stop_gained	79783	exon4																														ENST00000335693.4:c.322C>T	7.37:g.40228168C>T	ENSP00000338475:p.Arg108*	Somatic		Capture	Illumina HiSeq	Phase_I	40194693	NM_001193312	A4D1W5|B4DR73|Q4KMW4|Q4KMW8|Q4KMZ0|Q8TE00|Q8TEY1	Nonsense_Mutation	SNP	ENST00000335693.4	37	CCDS55105.1	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0013192612137203166|0.0013192612137203166	C|C	21.7|21.7	4.183373|4.183373	0.78677|0.78677	2.73E-4|2.73E-4	1.23E-4|1.23E-4	ENSG00000175600|ENSG00000175600	ENST00000413931|ENST00000309930;ENST00000401647;ENST00000335693;ENST00000540834	.|.	.|.	.|.	5.77|5.77	4.88|4.88	0.63580|0.63580	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.33118|.	0.0852|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.35871|.	-0.9771|.	3|.	.|0.02654	.|T	.|1	-7.2377|-7.2377	12.5126|12.5126	0.56013|0.56013	0.4117:0.5883:0.0:0.0|0.4117:0.5883:0.0:0.0	.|.	.|.	.|.	.|.	L|X	119|108;108;108;101	.|.	.|ENSP00000312054:R108X	P|R	+|+	2|1	0|2	C7orf10|C7orf10	40194693|40194693	1.000000|1.000000	0.71417|0.71417	0.988000|0.988000	0.46212|0.46212	0.990000|0.990000	0.78478|0.78478	1.308000|1.308000	0.33528|0.33528	1.539000|1.539000	0.49286|0.49286	0.585000|0.585000	0.79938|0.79938	CCG|CGA		C7orf10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000338388.1		
SSC4D	136853	broad.mit.edu	37	7	76019551	76019551	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr7:76019551T>A	ENST00000275560.3	-	11	1900	c.1553A>T	c.(1552-1554)cAg>cTg	p.Q518L	SRCRB4D_ENST00000492979.2_5'UTR	NM_080744.1	NP_542782.1												p.Q518L(1)		autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(9)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	21						TGCGAGGGCCTGGCCACAGCC	0.652																																					p.Q518L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1553T	7						.						43.0	41.0	42.0					7																	76019551		2202	4300	6502	75857487	SO:0001583	missense	136853	exon11																														ENST00000275560.3:c.1553A>T	7.37:g.76019551T>A	ENSP00000275560:p.Gln518Leu	Somatic		Capture	Illumina HiSeq	Phase_I	75857487	NM_080744		Missense_Mutation	SNP	ENST00000275560.3	37	CCDS5585.1	.	.	.	.	.	.	.	.	.	.	T	12.88	2.070976	0.36566	.	.	ENSG00000146700	ENST00000275560	T	0.44083	0.93	5.81	0.805	0.18703	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.425454	0.25795	N	0.028248	T	0.23094	0.0558	N	0.13168	0.305	0.27635	N	0.94789	B	0.20164	0.042	B	0.32022	0.139	T	0.18745	-1.0327	10	0.25106	T	0.35	.	5.359	0.16077	0.0:0.2734:0.2582:0.4684	.	518	Q8WTU2	SRB4D_HUMAN	L	518	ENSP00000275560:Q518L	ENSP00000275560:Q518L	Q	-	2	0	SRCRB4D	75857487	0.000000	0.05858	1.000000	0.80357	0.992000	0.81027	-0.404000	0.07205	0.123000	0.18342	-0.256000	0.11100	CAG		SRCRB4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253001.3		
SAMD9L	219285	broad.mit.edu	37	7	92765029	92765029	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr7:92765029C>A	ENST00000318238.4	-	5	1472	c.256G>T	c.(256-258)Gat>Tat	p.D86Y	SAMD9L_ENST00000437805.1_Missense_Mutation_p.D86Y|SAMD9L_ENST00000411955.1_Missense_Mutation_p.D86Y	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	86					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)		p.D86Y(1)		central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			TGTCCCGGATCATGATTGTCA	0.373																																					p.D86Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G256T	7						.						130.0	145.0	140.0					7																	92765029		2203	4300	6503	92602965	SO:0001583	missense	219285	exon5			AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.256G>T	7.37:g.92765029C>A	ENSP00000326247:p.Asp86Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	92602965	NM_152703	A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	ENST00000318238.4	37	CCDS34681.1	.	.	.	.	.	.	.	.	.	.	C	15.91	2.973799	0.53720	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805;ENST00000394472	T;T;T	0.14144	2.53;2.53;2.53	4.5	0.0108	0.14084	.	0.653293	0.13839	N	0.359152	T	0.20577	0.0495	L	0.51422	1.61	0.09310	N	1	D;P	0.60160	0.987;0.785	P;P	0.55303	0.773;0.465	T	0.09357	-1.0678	10	0.66056	D	0.02	-6.9358	8.4698	0.32977	0.0:0.5326:0.0:0.4674	.	86;86	Q8IVG5-2;Q8IVG5	.;SAM9L_HUMAN	Y	86	ENSP00000326247:D86Y;ENSP00000405760:D86Y;ENSP00000408796:D86Y	ENSP00000326247:D86Y	D	-	1	0	SAMD9L	92602965	0.000000	0.05858	0.012000	0.15200	0.052000	0.14988	-0.478000	0.06575	0.050000	0.15949	0.460000	0.39030	GAT		SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341730.1	NM_152703	
ZBED6CL	113763	broad.mit.edu	37	7	150028109	150028109	+	Missense_Mutation	SNP	G	G	A	rs370437244		TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr7:150028109G>A	ENST00000343855.4	+	1	1172	c.616G>A	c.(616-618)Gtt>Att	p.V206I	LRRC61_ENST00000323078.7_Intron|LRRC61_ENST00000359623.4_Intron|LRRC61_ENST00000493307.1_Intron	NM_138434.2	NP_612443.1	Q96FA7	ZB6CL_HUMAN	ZBED6 C-terminal like	206								p.V206I(1)									GAATGAGACCGTTGGAGCCCA	0.582																																					p.V206I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G616A	7						.	G	,,ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	44.0	48.0	46.0		,,616	-2.0	0.0	7		46	0,8600		0,0,4300	no	intron,intron,missense	LRRC61,C7orf29	NM_001142928.1,NM_023942.2,NM_138434.2	,,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,benign	,,206/237	150028109	1,13005	2203	4300	6503	149659042	SO:0001583	missense	113763	exon1			BC011406	CCDS5900.1	7q35	2013-05-03	2013-05-03	2013-05-03	ENSG00000188707	ENSG00000188707			21720	protein-coding gene	gene with protein product		615252	"""chromosome 7 open reading frame 29"""	C7orf29		23533661	Standard	NM_138434		Approved			Q96FA7	OTTHUMG00000158328	ENST00000343855.4:c.616G>A	7.37:g.150028109G>A	ENSP00000343242:p.Val206Ile	Somatic		Capture	Illumina HiSeq	Phase_I	149659042	NM_138434		Missense_Mutation	SNP	ENST00000343855.4	37	CCDS5900.1	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.281545	0.00251	2.27E-4	0.0	ENSG00000188707	ENST00000343855	.	.	.	4.18	-1.95	0.07548	.	0.618525	0.12505	N	0.463038	T	0.18257	0.0438	N	0.12182	0.205	0.09310	N	1	B	0.14805	0.011	B	0.09377	0.004	T	0.32798	-0.9893	9	0.05525	T	0.97	.	9.9295	0.41514	0.6495:0.0:0.3505:0.0	.	206	Q96FA7	CG029_HUMAN	I	206	.	ENSP00000343242:V206I	V	+	1	0	C7orf29	149659042	0.000000	0.05858	0.030000	0.17652	0.084000	0.17831	0.134000	0.15932	-0.347000	0.08299	-1.034000	0.02401	GTT		ZBED6CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350702.1	NM_138434	
TRPS1	7227	broad.mit.edu	37	8	116632283	116632283	+	Start_Codon_SNP	SNP	C	C	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr8:116632283C>A	ENST00000220888.5	-	2	162	c.3G>T	c.(1-3)atG>atT	p.M1I	TRPS1_ENST00000519076.1_Start_Codon_SNP_p.M1I|TRPS1_ENST00000519674.1_Start_Codon_SNP_p.M1I|TRPS1_ENST00000520276.1_Missense_Mutation_p.M5I|TRPS1_ENST00000395715.3_Missense_Mutation_p.M14I			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	1					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.M1I(1)		autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			TTTTCCGGACCATATCTGCAA	0.413									Langer-Giedion syndrome																												p.M14I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G42T	8						.						50.0	47.0	48.0					8																	116632283		1838	4085	5923	116701458	SO:0001582	initiator_codon_variant	7227	exon3	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.3G>T	8.37:g.116632283C>A	ENSP00000220888:p.Met1Ile	Somatic		Capture	Illumina HiSeq	Phase_I	116701458	NM_014112	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	37		.	.	.	.	.	.	.	.	.	.	C	16.70	3.194592	0.58017	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276;ENST00000519674;ENST00000395713;ENST00000519815;ENST00000422939	D;D;D;D;T	0.99051	-5.1;-5.07;-5.37;-5.07;0.72	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.99312	0.9759	.	.	.	0.80722	D	1	P;P;P	0.48294	0.656;0.525;0.908	P;P;D	0.64144	0.679;0.48;0.922	D	0.99349	1.0914	9	0.87932	D	0	-9.5836	20.0966	0.97849	0.0:1.0:0.0:0.0	.	5;1;14	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	I	14;1;1;5;1;14;14;14	ENSP00000379065:M14I;ENSP00000220888:M1I;ENSP00000428910:M1I;ENSP00000428680:M5I;ENSP00000429174:M1I	ENSP00000220888:M1I	M	-	3	0	TRPS1	116701458	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.272000	0.78516	2.751000	0.94390	0.650000	0.86243	ATG		TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	Missense_Mutation
SLC30A8	169026	broad.mit.edu	37	8	118183325	118183325	+	Silent	SNP	C	C	T			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr8:118183325C>T	ENST00000456015.2	+	7	882	c.882C>T	c.(880-882)gtC>gtT	p.V294V	SLC30A8_ENST00000519688.1_Silent_p.V245V|SLC30A8_ENST00000521243.1_Silent_p.V245V|SLC30A8_ENST00000427715.2_Silent_p.V245V	NM_173851.2	NP_776250.2	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 (zinc transporter), member 8	294					cellular zinc ion homeostasis (GO:0006882)|insulin secretion (GO:0030073)|positive regulation of insulin secretion (GO:0032024)|regulation of sequestering of zinc ion (GO:0061088)|regulation of vesicle-mediated transport (GO:0060627)|response to glucose (GO:0009749)|response to interferon-gamma (GO:0034341)|response to interleukin-1 (GO:0070555)|sequestering of zinc ion (GO:0032119)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)	p.V294V(2)		breast(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(18)|ovary(2)|pancreas(2)|skin(5)	41	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			TTTTAGCAGTCGACGGGGTGC	0.443																																					p.V294V	Ovarian(162;1202 1922 6011 16223 52092)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C882T	8						.						171.0	157.0	162.0					8																	118183325		2203	4300	6503	118252506	SO:0001819	synonymous_variant	169026	exon7				CCDS6322.1, CCDS55272.1	8q24.11	2014-08-12			ENSG00000164756			"""Solute carriers"""	20303	protein-coding gene	gene with protein product		611145					Standard	NM_001172811		Approved		uc003yoh.3	Q8IWU4	OTTHUMG00000164962	ENST00000456015.2:c.882C>T	8.37:g.118183325C>T		Somatic		Capture	Illumina HiSeq	Phase_I	118252506	NM_173851	A0AVP9|A5YM39|B4DPE0|Q8TCL3	Silent	SNP	ENST00000456015.2	37	CCDS6322.1																																																																																				SLC30A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381205.1	NM_173851	
MTBP	27085	broad.mit.edu	37	8	121463513	121463513	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr8:121463513T>G	ENST00000305949.1	+	4	421	c.376T>G	c.(376-378)Tgt>Ggt	p.C126G		NM_022045.4	NP_071328.2	Q96DY7	MTBP_HUMAN	MDM2 binding protein	126					cell cycle arrest (GO:0007050)|mitotic spindle checkpoint (GO:0071174)|negative regulation of cell proliferation (GO:0008285)|protein localization to kinetochore (GO:0034501)|traversing start control point of mitotic cell cycle (GO:0007089)	chromatin (GO:0000785)|kinetochore (GO:0000776)		p.C126G(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	30	Lung NSC(37;5.68e-08)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			TGCTGTTGAGTGTTTTGAAGA	0.313																																					p.C126G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T376G	8						.						106.0	110.0	108.0					8																	121463513		2203	4299	6502	121532694	SO:0001583	missense	27085	exon4				CCDS6333.1	8q24.1-q24.2	2014-03-03	2014-03-03		ENSG00000172167	ENSG00000172167			7417	protein-coding gene	gene with protein product		605927	"""MDM2 (mouse double minute 2)-binding protein, 104kD"", ""Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa"""			10906133, 11060448	Standard	NM_022045		Approved		uc003ypc.2	Q96DY7	OTTHUMG00000165040	ENST00000305949.1:c.376T>G	8.37:g.121463513T>G	ENSP00000303398:p.Cys126Gly	Somatic		Capture	Illumina HiSeq	Phase_I	121532694	NM_022045	B4DUR5|Q9HA89	Missense_Mutation	SNP	ENST00000305949.1	37	CCDS6333.1	.	.	.	.	.	.	.	.	.	.	T	7.985	0.752000	0.15778	.	.	ENSG00000172167	ENST00000305949	.	.	.	5.17	3.94	0.45596	.	0.288882	0.34986	N	0.003533	T	0.36690	0.0976	L	0.60455	1.87	0.27439	N	0.953762	P;P	0.46784	0.884;0.792	B;B	0.43658	0.426;0.194	T	0.18493	-1.0335	9	0.11794	T	0.64	-15.1118	9.1094	0.36718	0.2464:0.0:0.0:0.7536	.	126;126	Q96DY7;B4DUR5	MTBP_HUMAN;.	G	126	.	ENSP00000303398:C126G	C	+	1	0	MTBP	121532694	0.997000	0.39634	0.994000	0.49952	0.995000	0.86356	2.505000	0.45424	1.937000	0.56155	0.523000	0.50628	TGT		MTBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381530.1	NM_022045	
FAM83A	84985	broad.mit.edu	37	8	124195326	124195326	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr8:124195326A>G	ENST00000518448.1	+	2	2244	c.230A>G	c.(229-231)gAg>gGg	p.E77G	FAM83A_ENST00000536633.1_Missense_Mutation_p.E77G|U3_ENST00000408534.1_RNA|FAM83A_ENST00000318462.6_Missense_Mutation_p.E77G|FAM83A_ENST00000546351.1_Missense_Mutation_p.E77G|FAM83A_ENST00000522648.1_Missense_Mutation_p.E77G|FAM83A_ENST00000276699.6_Missense_Mutation_p.E77G|RP11-539E17.5_ENST00000522383.1_RNA			Q86UY5	FA83A_HUMAN	family with sequence similarity 83, member A	77								p.E77G(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(2)|skin(1)	17	Lung NSC(37;1.55e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			CAGGCCAGGGAGCCCCCGTGT	0.662																																					p.E77G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A230G	8						.						40.0	38.0	39.0					8																	124195326		2203	4300	6503	124264507	SO:0001583	missense	84985	exon1			BC052300	CCDS6339.1, CCDS6340.1, CCDS75784.1	8q24.13	2014-03-13			ENSG00000147689	ENSG00000147689			28210	protein-coding gene	gene with protein product						22886303	Standard	XM_005251087		Approved	MGC14128, BJ-TSA-9	uc003ypx.3	Q86UY5	OTTHUMG00000165083	ENST00000518448.1:c.230A>G	8.37:g.124195326A>G	ENSP00000428876:p.Glu77Gly	Somatic		Capture	Illumina HiSeq	Phase_I	124264507	NM_032899	Q71HL2|Q8N7I1|Q96I47	Missense_Mutation	SNP	ENST00000518448.1	37	CCDS6340.1	.	.	.	.	.	.	.	.	.	.	A	9.920	1.211912	0.22289	.	.	ENSG00000147689	ENST00000518448;ENST00000546351;ENST00000536633;ENST00000318462;ENST00000522648;ENST00000276699	T;T;T;T;T;T	0.12255	2.7;2.87;2.7;2.7;2.87;2.7	5.46	2.97	0.34412	.	0.536026	0.19922	N	0.103067	T	0.11879	0.0289	M	0.62016	1.91	0.27238	N	0.959212	B;B;B	0.12013	0.001;0.005;0.004	B;B;B	0.12156	0.004;0.004;0.007	T	0.24693	-1.0153	10	0.20519	T	0.43	-17.4172	3.6791	0.08304	0.6614:0.1367:0.071:0.131	.	77;77;77	Q86UY5-2;Q86UY5-3;Q86UY5	.;.;FA83A_HUMAN	G	77	ENSP00000428876:E77G;ENSP00000440565:E77G;ENSP00000445218:E77G;ENSP00000323034:E77G;ENSP00000427979:E77G;ENSP00000276699:E77G	ENSP00000276699:E77G	E	+	2	0	FAM83A	124264507	1.000000	0.71417	1.000000	0.80357	0.161000	0.22273	2.485000	0.45250	0.906000	0.36621	0.459000	0.35465	GAG		FAM83A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381737.1	NM_032899	
TRAPPC9	83696	broad.mit.edu	37	8	141285900	141285900	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr8:141285900G>T	ENST00000438773.2	-	15	2268	c.2135C>A	c.(2134-2136)cCt>cAt	p.P712H	TRAPPC9_ENST00000389328.4_Missense_Mutation_p.P810H|TRAPPC9_ENST00000389327.3_Missense_Mutation_p.P703H	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9	712					cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)		p.P810H(1)		breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						ACCAGAAGAAGGTTGCAATGA	0.338																																					p.P712H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2135A	8						.						67.0	63.0	65.0					8																	141285900		2203	4300	6503	141355082	SO:0001583	missense	83696	exon15			BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187	ENST00000438773.2:c.2135C>A	8.37:g.141285900G>T	ENSP00000405060:p.Pro712His	Somatic		Capture	Illumina HiSeq	Phase_I	141355082	NM_001160372	Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Missense_Mutation	SNP	ENST00000438773.2	37	CCDS55278.1	.	.	.	.	.	.	.	.	.	.	G	19.45	3.829930	0.71258	.	.	ENSG00000167632	ENST00000389328;ENST00000389327;ENST00000438773	.	.	.	4.43	4.43	0.53597	.	0.061273	0.64402	D	0.000003	T	0.74207	0.3686	L	0.51422	1.61	0.50813	D	0.999899	D;D;D;D	0.89917	0.996;1.0;0.994;0.999	D;D;P;D	0.77557	0.915;0.99;0.892;0.927	T	0.74945	-0.3491	9	0.45353	T	0.12	.	17.2723	0.87105	0.0:0.0:1.0:0.0	.	810;712;703;810	A6NIF0;Q96Q05;Q96Q05-3;Q96Q05-2	.;TPPC9_HUMAN;.;.	H	810;703;712	.	ENSP00000373978:P703H	P	-	2	0	TRAPPC9	141355082	1.000000	0.71417	0.414000	0.26521	0.981000	0.71138	5.368000	0.66133	2.299000	0.77371	0.650000	0.86243	CCT		TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377749.1	NM_031466	
COL27A1	85301	broad.mit.edu	37	9	117062385	117062385	+	Silent	SNP	A	A	T			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr9:117062385A>T	ENST00000356083.3	+	50	5011	c.4620A>T	c.(4618-4620)gcA>gcT	p.A1540A		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	1540	Collagen-like 15.|Pro-rich.|Triple-helical region.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.A1540A(1)		central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						CAGGAATGGCAGGTCTCTTCG	0.542																																					p.A1540A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A4620T	9						.						126.0	114.0	118.0					9																	117062385		2203	4300	6503	116102206	SO:0001819	synonymous_variant	85301	exon50			AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.4620A>T	9.37:g.117062385A>T		Somatic		Capture	Illumina HiSeq	Phase_I	116102206	NM_032888	Q66K43|Q96JF7	Silent	SNP	ENST00000356083.3	37	CCDS6802.1																																																																																				COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053763.1	NM_032888	
STXBP1	6812	broad.mit.edu	37	9	130444800	130444800	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr9:130444800G>C	ENST00000373299.1	+	18	1778	c.1663G>C	c.(1663-1665)Gag>Cag	p.E555Q	STXBP1_ENST00000373302.3_Missense_Mutation_p.E555Q|STXBP1_ENST00000481942.1_3'UTR	NM_001032221.3	NP_001027392.1	P61764	STXB1_HUMAN	syntaxin binding protein 1	555					axon target recognition (GO:0007412)|energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long term synaptic depression (GO:0060292)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|protein stabilization (GO:0050821)|protein transport (GO:0015031)|regulation of insulin secretion (GO:0050796)|regulation of SNARE complex assembly (GO:0035542)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|regulation of synaptic vesicle priming (GO:0010807)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|protein complex (GO:0043234)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|SNARE binding (GO:0000149)|syntaxin binding (GO:0019905)|syntaxin-1 binding (GO:0017075)	p.E555Q(2)		breast(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|skin(2)	23						CTGCGCCTACGAGGTGACCCA	0.622																																					p.E555Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1663C	9						.						97.0	77.0	84.0					9																	130444800		2203	4300	6503	129484621	SO:0001583	missense	6812	exon18			AF004563	CCDS6874.1, CCDS35146.1	9q34.1	2008-07-21			ENSG00000136854	ENSG00000136854			11444	protein-coding gene	gene with protein product	"""syntaxin-binding protein 1"""	602926				9545644	Standard	NM_001032221		Approved	hUNC18, MUNC18-1, UNC18, rbSec1	uc004brk.2	P61764	OTTHUMG00000020713	ENST00000373299.1:c.1663G>C	9.37:g.130444800G>C	ENSP00000362396:p.Glu555Gln	Somatic		Capture	Illumina HiSeq	Phase_I	129484621	NM_003165	B1AM97|Q28208|Q62759|Q64320|Q96TG8	Missense_Mutation	SNP	ENST00000373299.1	37	CCDS35146.1	.	.	.	.	.	.	.	.	.	.	G	34	5.372786	0.95923	.	.	ENSG00000136854	ENST00000535154;ENST00000373302;ENST00000541198;ENST00000373299	T;T	0.78595	-1.19;-1.19	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.86401	0.5924	M	0.71920	2.185	0.80722	D	1	D;D	0.67145	0.996;0.995	D;P	0.63877	0.919;0.868	D	0.86327	0.1696	10	0.49607	T	0.09	-24.127	17.1696	0.86826	0.0:0.0:1.0:0.0	.	555;555	P61764;P61764-2	STXB1_HUMAN;.	Q	509;555;387;555	ENSP00000362399:E555Q;ENSP00000362396:E555Q	ENSP00000362396:E555Q	E	+	1	0	STXBP1	129484621	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	9.731000	0.98807	2.644000	0.89710	0.561000	0.74099	GAG		STXBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054229.1	NM_003165	
PTPRD	5789	broad.mit.edu	37	9	8471084	8471084	+	Splice_Site	SNP	C	C	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr9:8471084C>A	ENST00000381196.4	-	28	3958	c.3415G>T	c.(3415-3417)Ggt>Tgt	p.G1139C	PTPRD_ENST00000355233.5_Splice_Site_p.G728C|PTPRD_ENST00000360074.4_Splice_Site_p.G1126C|PTPRD_ENST00000397617.3_Splice_Site_p.G718C|PTPRD_ENST00000356435.5_Splice_Site_p.G1139C|PTPRD_ENST00000486161.1_Splice_Site_p.G728C|PTPRD_ENST00000397606.3_Splice_Site_p.G718C|PTPRD_ENST00000358503.5_Splice_Site_p.G1117C|PTPRD_ENST00000540109.1_Splice_Site_p.G1139C|PTPRD_ENST00000537002.1_Splice_Site_p.G725C|PTPRD_ENST00000397611.3_Splice_Site_p.G725C	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1139					heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.G610C(1)|p.G1139C(1)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		ATGTAGTAACCTCTGCACAAG	0.388										TSP Lung(15;0.13)																											p.G725C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2173T	9						.						104.0	102.0	103.0					9																	8471084		2203	4300	6503	8461084	SO:0001630	splice_region_variant	5789	exon14			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.3414-1G>T	9.37:g.8471084C>A		Somatic		Capture	Illumina HiSeq	Phase_I	8461084	NM_001040712	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	37	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.399741	0.83120	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606	T;T;T;T;T;T;T;T;T;T;T	0.58358	0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34	5.72	5.72	0.89469	.	0.221960	0.45126	D	0.000397	T	0.54647	0.1871	N	0.19112	0.55	0.58432	D	0.999994	P;P;D;P;B;P;P;D;P	0.61080	0.747;0.897;0.984;0.776;0.0;0.903;0.801;0.989;0.7	P;B;P;B;B;P;P;P;B	0.57204	0.497;0.338;0.689;0.258;0.012;0.631;0.694;0.815;0.067	T	0.50083	-0.8869	9	.	.	.	.	19.4857	0.95027	0.0:1.0:0.0:0.0	.	718;723;728;728;725;725;1126;1139;1139	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	C	1139;1139;1126;1117;728;718;725;725;610;1139;728;718	ENSP00000370593:G1139C;ENSP00000348812:G1139C;ENSP00000353187:G1126C;ENSP00000351293:G1117C;ENSP00000347373:G728C;ENSP00000380741:G718C;ENSP00000380735:G725C;ENSP00000440515:G725C;ENSP00000438164:G1139C;ENSP00000417093:G728C;ENSP00000380731:G718C	.	G	-	1	0	PTPRD	8461084	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.447000	0.66606	2.711000	0.92665	0.655000	0.94253	GGT		PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3		Missense_Mutation
COL5A1	1289	broad.mit.edu	37	9	137712036	137712036	+	Silent	SNP	C	C	A	rs552985514		TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chr9:137712036C>A	ENST00000371817.3	+	58	4935	c.4521C>A	c.(4519-4521)ggC>ggA	p.G1507G		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	1507	Triple-helical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)	p.G1507G(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GTCTCCCTGGCCCCCAGGGCT	0.617																																					p.G1507G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4521A	9						.						82.0	77.0	79.0					9																	137712036		2203	4300	6503	136851857	SO:0001819	synonymous_variant	1289	exon58			D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.4521C>A	9.37:g.137712036C>A		Somatic		Capture	Illumina HiSeq	Phase_I	136851857	NM_000093	Q15094|Q5SUX4	Silent	SNP	ENST00000371817.3	37	CCDS6982.1																																																																																				COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	
HCCS	3052	broad.mit.edu	37	X	11139874	11139874	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chrX:11139874T>A	ENST00000321143.4	+	7	953	c.751T>A	c.(751-753)Tca>Aca	p.S251T	HCCS_ENST00000380763.3_Missense_Mutation_p.S251T|ARHGAP6_ENST00000534860.1_Intron|HCCS_ENST00000380762.4_Missense_Mutation_p.S251T	NM_001122608.2|NM_001171991.2|NM_005333.4	NP_001116080.1|NP_001165462.1|NP_005324.3	P53701	CCHL_HUMAN	holocytochrome c synthase	251					organ morphogenesis (GO:0009887)|oxidation-reduction process (GO:0055114)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	holocytochrome-c synthase activity (GO:0004408)|metal ion binding (GO:0046872)	p.S251T(1)		kidney(1)|large_intestine(3)|lung(3)	7						TGCCTTAGATTCACTTTCGGC	0.433																																					p.S251T	Ovarian(86;1338 1347 1462 10340 37882)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T751A	X						.						129.0	103.0	112.0					X																	11139874		2203	4300	6503	11049795	SO:0001583	missense	3052	exon7				CCDS14139.1	Xp22	2014-01-31	2010-05-11		ENSG00000004961	ENSG00000004961	4.4.1.17		4837	protein-coding gene	gene with protein product	"""cytochrome c heme-lyase"""	300056	"""holocytochrome c synthase (cytochrome c heme-lyase)"", ""microphthalamia with linear skin defects"""	MLS		8364577, 12444108	Standard	NM_001122608		Approved	CCHL	uc004cuj.3	P53701	OTTHUMG00000021128	ENST00000321143.4:c.751T>A	X.37:g.11139874T>A	ENSP00000326579:p.Ser251Thr	Somatic		Capture	Illumina HiSeq	Phase_I	11049795	NM_005333	B3KUS1|Q502X8	Missense_Mutation	SNP	ENST00000321143.4	37	CCDS14139.1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.938298	0.73557	.	.	ENSG00000004961	ENST00000321143;ENST00000380763;ENST00000380762	D;D;D	0.82711	-1.64;-1.64;-1.64	5.74	5.74	0.90152	.	0.112740	0.64402	D	0.000007	D	0.88089	0.6343	M	0.67700	2.07	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.86844	0.2019	10	0.35671	T	0.21	-6.6141	8.3086	0.32058	0.1785:0.0:0.0:0.8215	.	251	P53701	CCHL_HUMAN	T	251	ENSP00000326579:S251T;ENSP00000370140:S251T;ENSP00000370139:S251T	ENSP00000326579:S251T	S	+	1	0	HCCS	11049795	1.000000	0.71417	0.131000	0.22000	0.861000	0.49209	5.653000	0.67967	1.917000	0.55516	0.486000	0.48141	TCA		HCCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055742.1		
TENM1	10178	broad.mit.edu	37	X	123514919	123514919	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chrX:123514919G>A	ENST00000371130.3	-	31	7708	c.7645C>T	c.(7645-7647)Cgg>Tgg	p.R2549W	STAG2_ENST00000469481.1_Intron|TENM1_ENST00000422452.2_Missense_Mutation_p.R2556W	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	2549					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.R2551W(2)|p.R2551G(1)									GCAGCAAGCCGCCTGCTATCT	0.438																																					p.R2549W												.	.	3	Substitution - Missense(3)	large_intestine(2)|upper_aerodigestive_tract(1)	c.C7645T	X						.						77.0	73.0	74.0					X																	123514919		2203	4300	6503	123342600	SO:0001583	missense	10178	exon31			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.7645C>T	X.37:g.123514919G>A	ENSP00000360171:p.Arg2549Trp	Somatic		Capture	Illumina HiSeq	Phase_I	123342600	NM_014253	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	G	16.37	3.104619	0.56291	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.86366	-2.11;-2.08	5.83	4.96	0.65561	.	0.000000	0.85682	D	0.000000	D	0.92260	0.7545	M	0.63843	1.955	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.993;0.998;0.987	D	0.92731	0.6200	10	0.72032	D	0.01	.	15.4756	0.75478	0.0:0.0:0.8606:0.1394	.	2555;2556;2549	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	W	2549;2556	ENSP00000360171:R2549W;ENSP00000403954:R2556W	ENSP00000360171:R2549W	R	-	1	2	ODZ1	123342600	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.531000	0.67148	1.204000	0.43247	0.600000	0.82982	CGG		TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
SLC7A3	84889	broad.mit.edu	37	X	70146731	70146731	+	Silent	SNP	A	A	G			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chrX:70146731A>G	ENST00000374299.3	-	9	1591	c.1447T>C	c.(1447-1449)Ttg>Ctg	p.L483L	SLC7A3_ENST00000298085.4_Silent_p.L483L			Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 3	483					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)|L-lysine transmembrane transporter activity (GO:0015189)	p.L483L(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|urinary_tract(1)	31	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	TCACCAAGCAATGAGGAACAA	0.478													A|||	1	0.000264901	0.0008	0.0	3775	,	,		15919	0.0		0.0	False		,,,				2504	0.0				p.L483L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1447C	X						.						82.0	71.0	74.0					X																	70146731		2203	4300	6503	70063456	SO:0001819	synonymous_variant	84889	exon9			AF320612	CCDS14404.1	Xq12	2013-05-22			ENSG00000165349	ENSG00000165349		"""Solute carriers"""	11061	protein-coding gene	gene with protein product		300443				11591158	Standard	NM_001048164		Approved	CAT-3, ATRC3, FLJ14541	uc004dyn.3	Q8WY07	OTTHUMG00000021780	ENST00000374299.3:c.1447T>C	X.37:g.70146731A>G		Somatic		Capture	Illumina HiSeq	Phase_I	70063456	NM_032803	D3DVU7|Q5JQR2|Q8N185|Q8NCA7|Q96SZ7	Silent	SNP	ENST00000374299.3	37	CCDS14404.1																																																																																				SLC7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057080.1	NM_032803	
GPR174	84636	broad.mit.edu	37	X	78427423	78427423	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chrX:78427423G>T	ENST00000276077.1	+	1	955	c.919G>T	c.(919-921)Gat>Tat	p.D307Y		NM_032553.1	NP_115942.1	Q9BXC1	GP174_HUMAN	G protein-coupled receptor 174	307						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.D307Y(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	38						TTCAAGACAAGATTTGCATGA	0.403										HNSCC(63;0.18)																											p.D307Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G919T	X						.						110.0	93.0	99.0					X																	78427423		2203	4300	6503	78314079	SO:0001583	missense	84636	exon1			AF345567	CCDS14443.1	Xq13.3	2012-08-21			ENSG00000147138	ENSG00000147138		"""GPCR / Class A : Orphans"""	30245	protein-coding gene	gene with protein product		300903					Standard	NM_032553		Approved	FKSG79	uc004edg.1	Q9BXC1	OTTHUMG00000021898	ENST00000276077.1:c.919G>T	X.37:g.78427423G>T	ENSP00000276077:p.Asp307Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	78314079	NM_032553	Q2M3F7	Missense_Mutation	SNP	ENST00000276077.1	37	CCDS14443.1	.	.	.	.	.	.	.	.	.	.	g	13.21	2.170609	0.38315	.	.	ENSG00000147138	ENST00000276077	T	0.62639	0.01	5.25	5.25	0.73442	.	0.483859	0.22638	N	0.057493	T	0.45736	0.1357	N	0.08118	0	0.49687	D	0.999813	B	0.32010	0.351	B	0.32624	0.149	T	0.52660	-0.8546	10	0.59425	D	0.04	.	16.358	0.83243	0.0:0.0:1.0:0.0	.	307	Q9BXC1	GP174_HUMAN	Y	307	ENSP00000276077:D307Y	ENSP00000276077:D307Y	D	+	1	0	GPR174	78314079	1.000000	0.71417	1.000000	0.80357	0.724000	0.41520	8.346000	0.90060	2.172000	0.68678	0.534000	0.68092	GAT		GPR174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057327.1	NM_032553	
SLITRK2	84631	broad.mit.edu	37	X	144904613	144904613	+	Silent	SNP	T	T	C			TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3881-01A-01W-0899-10	TCGA-AG-3881-10A-01W-0901-10	g.chrX:144904613T>C	ENST00000370490.1	+	1	4925	c.670T>C	c.(670-672)Tta>Cta	p.L224L	SLITRK2_ENST00000413937.2_Silent_p.L224L|SLITRK2_ENST00000447897.2_Silent_p.L224L|SLITRK2_ENST00000428560.2_Silent_p.L224L|SLITRK2_ENST00000434188.2_Silent_p.L224L			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	224	LRRCT 1.				axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.L224L(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					CACTTGTGACTTACTTCCTCT	0.463																																					p.L224L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T670C	X						.						127.0	116.0	120.0					X																	144904613		2203	4300	6503	144712305	SO:0001819	synonymous_variant	84631	exon3			Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.670T>C	X.37:g.144904613T>C		Somatic		Capture	Illumina HiSeq	Phase_I	144712305	NM_001144006	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Silent	SNP	ENST00000370490.1	37	CCDS14680.1																																																																																				SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539	
