#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PPRC1	23082	broad.mit.edu	37	10	103899635	103899635	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr10:103899635G>A	ENST00000278070.2	+	5	1409	c.1370G>A	c.(1369-1371)cGa>cAa	p.R457Q	PPRC1_ENST00000413464.2_Missense_Mutation_p.R457Q|PPRC1_ENST00000370012.1_5'Flank	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	457	Necessary for interaction with CREB1 and NRF1 and for transcriptional coactivation.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R457Q(1)		central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		CAGAGAGCTCGAAAGGGCAGG	0.597																																					p.R457Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1370A	10						.						55.0	52.0	53.0					10																	103899635		2203	4300	6503	103889625	SO:0001583	missense	23082	exon5			AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.1370G>A	10.37:g.103899635G>A	ENSP00000278070:p.Arg457Gln	Somatic		Capture	Illumina HiSeq	Phase_I	103889625	NM_015062	Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Missense_Mutation	SNP	ENST00000278070.2	37	CCDS7529.1	.	.	.	.	.	.	.	.	.	.	G	17.11	3.304770	0.60305	.	.	ENSG00000148840	ENST00000278070;ENST00000413464	T;T	0.38722	1.12;1.12	6.03	2.73	0.32206	.	0.550027	0.17427	N	0.174619	T	0.25827	0.0629	L	0.32530	0.975	0.26452	N	0.975583	B;B;B	0.31817	0.231;0.341;0.231	B;B;B	0.21151	0.022;0.033;0.022	T	0.09997	-1.0649	10	0.33940	T	0.23	.	7.4616	0.27298	0.1636:0.0:0.6964:0.14	.	457;337;457	E7EVG6;Q5VV67-2;Q5VV67	.;.;PPRC1_HUMAN	Q	457	ENSP00000278070:R457Q;ENSP00000399743:R457Q	ENSP00000278070:R457Q	R	+	2	0	PPRC1	103889625	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.584000	0.36589	0.862000	0.35528	0.555000	0.69702	CGA		PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050021.1	NM_015062	
PITRM1	10531	broad.mit.edu	37	10	3207621	3207621	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr10:3207621G>A	ENST00000224949.4	-	5	551	c.517C>T	c.(517-519)Cgc>Tgc	p.R173C	PITRM1-AS1_ENST00000598280.1_RNA|PITRM1_ENST00000380989.2_Missense_Mutation_p.R173C|PITRM1_ENST00000451104.2_Missense_Mutation_p.R141C|PITRM1-AS1_ENST00000601046.1_RNA			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1	173					positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.R173C(1)		breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						TCCAGCTCGCGTAAACATGGG	0.393																																					p.R173C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C517T	10						.						93.0	94.0	94.0					10																	3207621		1880	4120	6000	3197621	SO:0001583	missense	10531	exon5			AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.517C>T	10.37:g.3207621G>A	ENSP00000224949:p.Arg173Cys	Somatic		Capture	Illumina HiSeq	Phase_I	3197621	NM_014889	B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	Missense_Mutation	SNP	ENST00000224949.4	37	CCDS59208.1	.	.	.	.	.	.	.	.	.	.	G	16.56	3.158781	0.57368	.	.	ENSG00000107959	ENST00000224949;ENST00000380980;ENST00000380989;ENST00000451104	T;T;T	0.30448	1.53;1.53;1.53	5.37	3.23	0.37069	Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);Peptidase M16, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.59662	0.2210	M	0.86573	2.825	0.58432	D	0.999997	D;D;D;D;D;D	0.76494	0.998;0.998;0.999;0.999;0.999;0.999	P;D;D;D;D;D	0.72338	0.772;0.953;0.921;0.969;0.969;0.977	T	0.70605	-0.4826	10	0.87932	D	0	.	15.2762	0.73742	0.0:0.0:0.654:0.346	.	166;141;173;173;173;166	E9PDX6;E7ES23;Q5JRX3-2;C9JSL2;Q5JRX3;B4DH07	.;.;.;.;PREP_HUMAN;.	C	173;166;173;141	ENSP00000224949:R173C;ENSP00000370377:R173C;ENSP00000401201:R141C	ENSP00000224949:R173C	R	-	1	0	PITRM1	3197621	1.000000	0.71417	0.989000	0.46669	0.773000	0.43773	3.316000	0.51960	1.200000	0.43188	0.586000	0.80456	CGC		PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046469.2		
ZNF518A	9849	broad.mit.edu	37	10	97919838	97919838	+	RNA	SNP	A	A	C			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr10:97919838A>C	ENST00000534948.1	+	0	4616							Q6AHZ1	Z518A_HUMAN	zinc finger protein 518A						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K1253N(2)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	24		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		CTTCCAAAAAAATTTTTTCAA	0.333																																					p.K1253N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A3759C	10						.						28.0	30.0	29.0					10																	97919838		1782	4039	5821	97909828			9849	exon6			AB002333	CCDS73170.1	10q23.33	2012-08-08	2007-12-07	2007-12-07	ENSG00000177853	ENSG00000177853		"""Zinc fingers, C2H2-type"""	29009	protein-coding gene	gene with protein product			"""zinc finger protein 518"""	ZNF518		9205841	Standard	NM_014803		Approved	KIAA0335	uc001klp.3	Q6AHZ1	OTTHUMG00000018828		10.37:g.97919838A>C		Somatic		Capture	Illumina HiSeq	Phase_I	97909828	NM_014803	A0PJI5|O15044|Q32MP4	Missense_Mutation	SNP	ENST00000534948.1	37																																																																																					ZNF518A-202	KNOWN	basic	processed_transcript	processed_transcript		NM_014803	
PDCD11	22984	broad.mit.edu	37	10	105181166	105181166	+	Missense_Mutation	SNP	C	C	T	rs145404572	byFrequency	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr10:105181166C>T	ENST00000369797.3	+	17	2433	c.2339C>T	c.(2338-2340)gCg>gTg	p.A780V		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	780	S1 motif 8. {ECO:0000255|PROSITE- ProRule:PRU00180}.		A -> S (in dbSNP:rs11591914).		mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)	p.A780V(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		CAGACAGTAGCGGCAAAGGTG	0.537													C|||	2	0.000399361	0.0008	0.0	5008	,	,		16448	0.001		0.0	False		,,,				2504	0.0				p.A780V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2339T	10						.						67.0	57.0	60.0					10																	105181166		2203	4300	6503	105171156	SO:0001583	missense	22984	exon17			D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.2339C>T	10.37:g.105181166C>T	ENSP00000358812:p.Ala780Val	Somatic		Capture	Illumina HiSeq	Phase_I	105171156	NM_014976	Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	ENST00000369797.3	37	CCDS31276.1	2	9.157509157509158E-4	1	0.0020325203252032522	0	0.0	1	0.0017482517482517483	0	0.0	C	0.013	-1.639427	0.00799	.	.	ENSG00000148843	ENST00000369797;ENST00000543503	T	0.42900	0.96	5.74	2.05	0.26809	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);RNA-binding domain, S1 (1);Ribosomal protein S1, RNA-binding domain (2);	0.496053	0.24443	N	0.038497	T	0.11623	0.0283	N	0.00303	-1.675	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.29366	-1.0014	10	0.16420	T	0.52	-11.4892	12.0084	0.53272	0.0:0.1304:0.0:0.8696	.	780	Q14690	RRP5_HUMAN	V	780	ENSP00000358812:A780V	ENSP00000358812:A780V	A	+	2	0	PDCD11	105171156	1.000000	0.71417	0.040000	0.18447	0.041000	0.13682	3.097000	0.50251	0.521000	0.28445	-1.421000	0.01109	GCG		PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050151.1		
SORL1	6653	broad.mit.edu	37	11	121360759	121360759	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr11:121360759A>T	ENST00000260197.7	+	5	827	c.698A>T	c.(697-699)aAg>aTg	p.K233M	SORL1_ENST00000532451.1_3'UTR	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	233					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)	p.K233M(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		CAGCTGTGGAAGTCAGATGAC	0.428																																					p.K233M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A698T	11						.						208.0	166.0	180.0					11																	121360759		2203	4299	6502	120865969	SO:0001583	missense	6653	exon5			Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.698A>T	11.37:g.121360759A>T	ENSP00000260197:p.Lys233Met	Somatic		Capture	Illumina HiSeq	Phase_I	120865969	NM_003105	B2RNX7|Q92856	Missense_Mutation	SNP	ENST00000260197.7	37	CCDS8436.1	.	.	.	.	.	.	.	.	.	.	a	18.66	3.671055	0.67814	.	.	ENSG00000137642	ENST00000260197	T	0.23552	1.9	5.68	4.43	0.53597	VPS10 (1);	0.050237	0.85682	D	0.000000	T	0.30479	0.0766	L	0.33485	1.01	0.80722	D	1	D	0.67145	0.996	P	0.55871	0.786	T	0.01600	-1.1315	10	0.30854	T	0.27	.	11.5368	0.50641	0.9247:0.0:0.0753:0.0	.	233	Q92673	SORL_HUMAN	M	233	ENSP00000260197:K233M	ENSP00000260197:K233M	K	+	2	0	SORL1	120865969	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	4.876000	0.63079	0.963000	0.38082	0.529000	0.55759	AAG		SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	
SLC43A3	29015	broad.mit.edu	37	11	57185285	57185285	+	Missense_Mutation	SNP	G	G	A	rs201915801		TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr11:57185285G>A	ENST00000395123.2	-	8	911	c.607C>T	c.(607-609)Cgc>Tgc	p.R203C	SLC43A3_ENST00000528098.1_5'UTR|SLC43A3_ENST00000529554.1_Missense_Mutation_p.R203C|SLC43A3_ENST00000352187.1_Missense_Mutation_p.R203C|SLC43A3_ENST00000395124.1_Missense_Mutation_p.R203C|SLC43A3_ENST00000533524.1_Missense_Mutation_p.R216C	NM_001278201.1|NM_014096.2	NP_001265130.1|NP_054815.2	Q8NBI5	S43A3_HUMAN	solute carrier family 43, member 3	203					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)		p.R203C(1)		central_nervous_system(1)|endometrium(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	27						AGGAAAGTGCGTGCTACATGC	0.537													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19315	0.0		0.0	False		,,,				2504	0.0				p.R203C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C607T	11						.						109.0	97.0	101.0					11																	57185285		2201	4296	6497	56941861	SO:0001583	missense	5553	exon8			AL157431	CCDS7956.1, CCDS60784.1	11q11	2013-05-22			ENSG00000134802	ENSG00000134802		"""Solute carriers"""	17466	protein-coding gene	gene with protein product	"""likely ortholog of mouse embryonic epithelial gene 1"""					7531438, 11704567	Standard	NM_017611		Approved	SEEEG-1, Eeg1, DKFZp762A227, FOAP-13, PRO1659	uc001nki.3	Q8NBI5	OTTHUMG00000167113	ENST00000395123.2:c.607C>T	11.37:g.57185285G>A	ENSP00000378555:p.Arg203Cys	Somatic		Capture	Illumina HiSeq	Phase_I	56941861	NM_199329	B4DNR8|E7EQD2|Q9NSS4	Missense_Mutation	SNP	ENST00000395123.2	37	CCDS7956.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	19.34	3.809051	0.70797	.	.	ENSG00000134802	ENST00000395123;ENST00000395124;ENST00000352187;ENST00000529554;ENST00000533524;ENST00000530005	T;T;T;T;T;T	0.80566	-1.39;-1.39;-1.39;-1.39;-1.39;0.35	5.48	5.48	0.80851	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.90116	0.6912	M	0.83483	2.645	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.996;0.998;0.996	D	0.89383	0.3683	10	0.38643	T	0.18	-17.5211	17.1335	0.86733	0.0:0.0:1.0:0.0	.	203;216;203;203	B4DV87;E7EQD2;Q8NBI5;A8K2X6	.;.;S43A3_HUMAN;.	C	203;203;203;203;216;203	ENSP00000378555:R203C;ENSP00000378556:R203C;ENSP00000337561:R203C;ENSP00000436254:R203C;ENSP00000434515:R216C;ENSP00000435893:R203C	ENSP00000337561:R203C	R	-	1	0	SLC43A3	56941861	1.000000	0.71417	0.118000	0.21660	0.644000	0.38419	4.872000	0.63050	2.586000	0.87340	0.462000	0.41574	CGC		SLC43A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000393057.1	NM_017611	
KCNJ1	3758	broad.mit.edu	37	11	128709642	128709642	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr11:128709642G>A	ENST00000392664.2	-	2	670	c.554C>T	c.(553-555)cCc>cTc	p.P185L	KCNJ1_ENST00000324036.3_Missense_Mutation_p.P166L|KCNJ1_ENST00000392666.1_Missense_Mutation_p.P166L|KCNJ1_ENST00000392665.2_Missense_Mutation_p.P166L|KCNJ1_ENST00000440599.2_Missense_Mutation_p.P166L	NM_000220.4	NP_000211.1	P48048	KCNJ1_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 1	185					cardiovascular system development (GO:0072358)|excretion (GO:0007588)|kidney development (GO:0001822)|post-embryonic development (GO:0009791)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of G-protein activated inward rectifier potassium channel activity (GO:1900128)|renal sodium ion absorption (GO:0070294)|synaptic transmission (GO:0007268)|tissue homeostasis (GO:0001894)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|inward rectifier potassium channel activity (GO:0005242)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.P185L(1)		breast(2)|endometrium(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)	23	all_hematologic(175;0.0641)	all_lung(97;4.89e-06)|Lung NSC(97;9.34e-06)|Breast(109;0.00123)|all_hematologic(192;0.00793)|Renal(330;0.0112)|all_neural(223;0.0189)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;4.05e-06)|LUSC - Lung squamous cell carcinoma(976;0.008)|Lung(977;0.00942)	Bethanidine(DB00217)|Glimepiride(DB00222)|Glyburide(DB01016)|Glycodiazine(DB01382)|Minoxidil(DB00350)|Tolazamide(DB00839)|Tolbutamide(DB01124)|Yohimbine(DB01392)	ACGTTTTTTGGGCCTGGAGAT	0.468																																					p.P166L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C497T	11						.						79.0	75.0	76.0					11																	128709642		2201	4296	6497	128214852	SO:0001583	missense	3758	exon3			BC063109	CCDS8476.1, CCDS8477.1	11q24	2011-07-05			ENSG00000151704	ENSG00000151704		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6255	protein-coding gene	gene with protein product		600359				7680431, 8190102, 16382105	Standard	NM_153765		Approved	Kir1.1, ROMK1	uc001qeo.2	P48048	OTTHUMG00000048247	ENST00000392664.2:c.554C>T	11.37:g.128709642G>A	ENSP00000376432:p.Pro185Leu	Somatic		Capture	Illumina HiSeq	Phase_I	128214852	NM_153765	B2RMR4|Q6LD67	Missense_Mutation	SNP	ENST00000392664.2	37	CCDS8476.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.824768	0.90955	.	.	ENSG00000151704	ENST00000392665;ENST00000392666;ENST00000440599;ENST00000324036;ENST00000392664	D;D;D;D;D	0.95171	-3.63;-3.63;-3.63;-3.63;-3.63	5.98	5.98	0.97165	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.202538	0.53938	D	0.000058	D	0.98036	0.9353	M	0.92122	3.275	0.80722	D	1	D	0.76494	0.999	D	0.70016	0.967	D	0.98287	1.0511	10	0.87932	D	0	.	20.4464	0.99123	0.0:0.0:1.0:0.0	.	185	P48048	IRK1_HUMAN	L	166;166;166;166;185	ENSP00000376433:P166L;ENSP00000376434:P166L;ENSP00000406320:P166L;ENSP00000316233:P166L;ENSP00000376432:P185L	ENSP00000316233:P166L	P	-	2	0	KCNJ1	128214852	1.000000	0.71417	0.970000	0.41538	0.988000	0.76386	9.852000	0.99516	2.838000	0.97847	0.514000	0.50259	CCC		KCNJ1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386233.1	NM_000220	
PPFIA2	8499	broad.mit.edu	37	12	81734925	81734926	+	In_Frame_Ins	INS	-	-	GGG			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	-	-	-	GGG	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr12:81734925_81734926insGGG	ENST00000549396.1	-	20	2484_2485	c.2324_2325insCCC	c.(2323-2325)cct>ccCCCt	p.775_775P>PP	PPFIA2_ENST00000541570.2_In_Frame_Ins_p.342_342P>PP|PPFIA2_ENST00000541017.1_5'UTR|PPFIA2_ENST00000550359.2_In_Frame_Ins_p.622_622P>PP|PPFIA2_ENST00000407050.4_In_Frame_Ins_p.701_701P>PP|PPFIA2_ENST00000545296.2_Intron|PPFIA2_ENST00000548586.1_In_Frame_Ins_p.775_775P>PP|PPFIA2_ENST00000552948.1_In_Frame_Ins_p.775_775P>PP|PPFIA2_ENST00000550584.2_In_Frame_Ins_p.775_775P>PP|PPFIA2_ENST00000549325.1_In_Frame_Ins_p.757_757P>PP|PPFIA2_ENST00000333447.7_In_Frame_Ins_p.757_757P>PP|PPFIA2_ENST00000443686.3_In_Frame_Ins_p.676_676P>PP	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	775					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)		p.P777_T778insP(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						GGGTAGGAGGAGGAGAAGTTTC	0.436																																					p.P775delinsPP												.	.	1	Insertion - In frame(1)	large_intestine(1)	c.2325_2326insCCC	12						.																																			80259057	SO:0001652	inframe_insertion	8499	exon20			AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.2324_2325insCCC	12.37:g.81734925_81734926insGGG	ENSP00000450337:p.Pro777dup	Somatic		Capture	Illumina HiSeq	Phase_I	80259056	NM_003625	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	In_Frame_Ins	INS	ENST00000549396.1	37	CCDS55857.1																																																																																				PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408030.1		
NAA25	80018	broad.mit.edu	37	12	112485550	112485550	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr12:112485550G>A	ENST00000261745.4	-	17	2173	c.1925C>T	c.(1924-1926)cCa>cTa	p.P642L		NM_024953.3	NP_079229.2	Q14CX7	NAA25_HUMAN	N(alpha)-acetyltransferase 25, NatB auxiliary subunit	642						cytoplasm (GO:0005737)		p.P642L(1)		autonomic_ganglia(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(1)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	46						ATCTTCTTCTGGCCTAAGGTT	0.348																																					p.P642L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1925T	12						.						236.0	248.0	244.0					12																	112485550		2203	4300	6503	110969933	SO:0001583	missense	80018	exon17			AB054990	CCDS9159.1	12q24.13	2013-10-11	2010-01-14	2010-01-14		ENSG00000111300		"""N(alpha)-acetyltransferase subunits"""	25783	protein-coding gene	gene with protein product		612755	"""chromosome 12 open reading frame 30"""	C12orf30		19660095	Standard	NM_024953		Approved	FLJ13089	uc001ttm.3	Q14CX7	OTTHUMG00000169638	ENST00000261745.4:c.1925C>T	12.37:g.112485550G>A	ENSP00000261745:p.Pro642Leu	Somatic		Capture	Illumina HiSeq	Phase_I	110969933	NM_024953	A0JLU7|Q6MZH1|Q7Z4N6|Q9H911	Missense_Mutation	SNP	ENST00000261745.4	37	CCDS9159.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.990319	0.93106	.	.	ENSG00000111300	ENST00000261745	T	0.43688	0.94	5.71	5.71	0.89125	.	0.056738	0.64402	D	0.000001	T	0.63663	0.2530	M	0.83223	2.63	0.80722	D	1	D;D	0.58268	0.982;0.982	P;P	0.55055	0.767;0.767	T	0.65010	-0.6272	10	0.44086	T	0.13	-9.3324	19.8505	0.96738	0.0:0.0:1.0:0.0	.	642;642	A8K8X0;Q14CX7	.;NAA25_HUMAN	L	642	ENSP00000261745:P642L	ENSP00000261745:P642L	P	-	2	0	NAA25	110969933	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	9.476000	0.97823	2.688000	0.91661	0.655000	0.94253	CCA		NAA25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405205.1	NM_024953	
FGF6	2251	broad.mit.edu	37	12	4554551	4554551	+	Silent	SNP	G	G	A	rs202212518		TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr12:4554551G>A	ENST00000228837.2	-	1	229	c.186C>T	c.(184-186)cgC>cgT	p.R62R		NM_020996.1	NP_066276.2	P10767	FGF6_HUMAN	fibroblast growth factor 6	62					angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|myoblast differentiation (GO:0045445)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|sarcolemma (GO:0042383)	growth factor activity (GO:0008083)	p.R62R(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)			CTAGCCCGGCGCGAGACCTGG	0.652													G|||	1	0.000199681	0.0	0.0	5008	,	,		17362	0.001		0.0	False		,,,				2504	0.0				p.R62R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C186T	12						.						86.0	81.0	83.0					12																	4554551		2203	4300	6503	4424812	SO:0001819	synonymous_variant	2251	exon1			X63454	CCDS8527.1	12p13	2014-01-30				ENSG00000111241		"""Endogenous ligands"""	3684	protein-coding gene	gene with protein product		134921				16597617	Standard	NM_020996		Approved		uc001qmr.1	P10767		ENST00000228837.2:c.186C>T	12.37:g.4554551G>A		Somatic		Capture	Illumina HiSeq	Phase_I	4424812	NM_020996	Q0VAE1	Silent	SNP	ENST00000228837.2	37	CCDS8527.1																																																																																				FGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398939.1	NM_020996	
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000556131.1_Missense_Mutation_p.G12C|KRAS_ENST00000311936.3_Missense_Mutation_p.G12C|KRAS_ENST00000557334.1_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12C	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,+1 	.	5144	Substitution - Missense(5142)|Insertion - In frame(2)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	c.G34T	12	GRCh37	CM076251	KRAS	M	rs121913530	.						93.0	83.0	86.0					12																	25398285		2203	4300	6503	25289552	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	Somatic		Capture	Illumina HiSeq	Phase_I	25289552	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
KRT6A	3853	broad.mit.edu	37	12	52886927	52886927	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr12:52886927G>A	ENST00000330722.6	-	1	114	c.46C>T	c.(46-48)Cgg>Tgg	p.R16W		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	16	Head.				cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)	p.R16W(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		CTGAAACCCCGGCGGCTGCTG	0.652																																					p.R16W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C46T	12						.						18.0	24.0	22.0					12																	52886927		2159	4229	6388	51173194	SO:0001583	missense	3853	exon1			BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.46C>T	12.37:g.52886927G>A	ENSP00000369317:p.Arg16Trp	Somatic		Capture	Illumina HiSeq	Phase_I	51173194	NM_005554	A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Missense_Mutation	SNP	ENST00000330722.6	37	CCDS41786.1	.	.	.	.	.	.	.	.	.	.	G	10.33	1.319937	0.23994	.	.	ENSG00000205420	ENST00000330722	T	0.76316	-1.01	5.05	-0.648	0.11464	.	0.102760	0.40908	D	0.000991	T	0.75295	0.3830	M	0.89601	3.045	0.09310	N	0.999998	P	0.50617	0.937	B	0.40565	0.333	T	0.69778	-0.5053	10	0.66056	D	0.02	.	5.1459	0.14985	0.0662:0.1712:0.4034:0.3593	.	16	P02538	K2C6A_HUMAN	W	16	ENSP00000369317:R16W	ENSP00000369317:R16W	R	-	1	2	KRT6A	51173194	0.000000	0.05858	0.010000	0.14722	0.559000	0.35586	0.300000	0.19156	-0.019000	0.14055	-0.264000	0.10439	CGG		KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404978.2	NM_005554	
RASSF9	9182	broad.mit.edu	37	12	86198974	86198974	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr12:86198974G>A	ENST00000361228.3	-	2	1182	c.814C>T	c.(814-816)Cga>Tga	p.R272*		NM_005447.3	NP_005438.2	O75901	RASF9_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 9	272					endosomal transport (GO:0016197)|protein targeting (GO:0006605)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|trans-Golgi network transport vesicle membrane (GO:0012510)	transporter activity (GO:0005215)	p.R272*(2)		endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TATTTCAGTCGTTCTTCCAGC	0.398																																					p.R272X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C814T	12						.						113.0	108.0	110.0					12																	86198974		1886	4108	5994	84723105	SO:0001587	stop_gained	9182	exon2				CCDS44950.1	12q21.31	2008-02-22	2008-02-22	2008-02-22		ENSG00000198774			15739	protein-coding gene	gene with protein product		610383	"""peptidylglycine alpha-amidating monooxygenase COOH-terminal interactor"""	PAMCI		9837933, 18272789	Standard	NM_005447		Approved	P-CIP1	uc001taf.1	O75901	OTTHUMG00000169831	ENST00000361228.3:c.814C>T	12.37:g.86198974G>A	ENSP00000354884:p.Arg272*	Somatic		Capture	Illumina HiSeq	Phase_I	84723105	NM_005447	B3KMQ4|Q8N5U8	Nonsense_Mutation	SNP	ENST00000361228.3	37	CCDS44950.1	.	.	.	.	.	.	.	.	.	.	G	18.72	3.685307	0.68157	.	.	ENSG00000198774	ENST00000361228	.	.	.	4.9	1.88	0.25563	.	0.581472	0.16373	U	0.217227	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	-15.3805	10.6117	0.45425	0.0:0.1108:0.2861:0.6031	.	.	.	.	X	272	.	ENSP00000354884:R272X	R	-	1	2	RASSF9	84723105	0.009000	0.17119	0.003000	0.11579	0.198000	0.23893	0.492000	0.22435	0.148000	0.19059	-0.188000	0.12872	CGA		RASSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406109.1		
ATP6V0A2	23545	broad.mit.edu	37	12	124239011	124239011	+	Silent	SNP	C	C	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr12:124239011C>T	ENST00000330342.3	+	18	2468	c.2220C>T	c.(2218-2220)atC>atT	p.I740I	ATP6V0A2_ENST00000544833.1_Silent_p.I22I	NM_012463.3	NP_036595.2	Q9Y487	VPP2_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a2	740					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|immune response (GO:0006955)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)	p.I740I(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.000625)|all cancers(50;0.00775)		TCCATTCCATCGAGTACTGTC	0.453																																					p.I740I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2220T	12						.						119.0	106.0	111.0					12																	124239011		2203	4300	6503	122804964	SO:0001819	synonymous_variant	23545	exon18			AF112972	CCDS9254.1	12q24.31	2010-04-21	2006-01-20		ENSG00000185344	ENSG00000185344		"""ATPases / V-type"""	18481	protein-coding gene	gene with protein product	"""infantile malignant osteopetrosis"""	611716	"""infantile malignant osteopetrosis"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 2"", ""ATPase, H+ transporting, lysosomal V0 subunit A2"""			2247090, 18157129	Standard	NM_012463		Approved	TJ6, a2, TJ6s, TJ6M, ATP6a2, J6B7, ATP6N1D, Vph1, Stv1	uc001ufr.3	Q9Y487	OTTHUMG00000168723	ENST00000330342.3:c.2220C>T	12.37:g.124239011C>T		Somatic		Capture	Illumina HiSeq	Phase_I	122804964	NM_012463	A8K026|Q6NUM0	Silent	SNP	ENST00000330342.3	37	CCDS9254.1																																																																																				ATP6V0A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400765.2	NM_012463	
ELMSAN1	91748	broad.mit.edu	37	14	74196574	74196574	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr14:74196574G>C	ENST00000286523.5	-	4	2646	c.1864C>G	c.(1864-1866)Ccc>Gcc	p.P622A	ELMSAN1_ENST00000394071.2_Missense_Mutation_p.P622A	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1	622					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.P622A(1)									GAGTAGACGGGAGGGGCGATG	0.637																																					p.P622A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1864G	14						.						57.0	56.0	56.0					14																	74196574		2203	4300	6503	73266327	SO:0001583	missense	91748	exon4			BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.1864C>G	14.37:g.74196574G>C	ENSP00000286523:p.Pro622Ala	Somatic		Capture	Illumina HiSeq	Phase_I	73266327	NM_001043318	Q6PK13|Q6PK59|Q6ZS23	Missense_Mutation	SNP	ENST00000286523.5	37	CCDS9819.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.901546	0.52227	.	.	ENSG00000156030	ENST00000394071;ENST00000286523;ENST00000423556;ENST00000435371	T;T;T;T	0.14144	2.53;2.53;2.53;2.53	5.4	5.4	0.78164	.	0.195138	0.36591	N	0.002518	T	0.17323	0.0416	N	0.19112	0.55	0.50039	D	0.999848	B;D	0.62365	0.089;0.991	B;P	0.60541	0.037;0.876	T	0.05354	-1.0890	10	0.08381	T	0.77	-11.8994	14.7518	0.69530	0.0:0.1443:0.8557:0.0	.	622;622	A0PJD3;Q6PJG2	.;CN043_HUMAN	A	622	ENSP00000377634:P622A;ENSP00000286523:P622A;ENSP00000407767:P622A;ENSP00000402380:P622A	ENSP00000286523:P622A	P	-	1	0	C14orf43	73266327	0.999000	0.42202	0.989000	0.46669	0.808000	0.45660	2.677000	0.46892	2.511000	0.84671	0.579000	0.79373	CCC		ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317793.1	NM_194278	
DUOX1	53905	broad.mit.edu	37	15	45454506	45454506	+	Silent	SNP	C	C	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr15:45454506C>T	ENST00000321429.4	+	32	4586	c.4179C>T	c.(4177-4179)acC>acT	p.T1393T	CTD-2651B20.1_ENST00000558039.1_lincRNA|DUOX1_ENST00000389037.3_Silent_p.T1393T|DUOX1_ENST00000561166.1_Silent_p.T1039T	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	1393					cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)	p.T1393T(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		TTGGGGTCACCCCTTTTGCCT	0.547																																					p.T1393T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4179T	15						.						150.0	130.0	137.0					15																	45454506		2198	4298	6496	43241798	SO:0001819	synonymous_variant	53905	exon32			AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.4179C>T	15.37:g.45454506C>T		Somatic		Capture	Illumina HiSeq	Phase_I	43241798	NM_017434	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Silent	SNP	ENST00000321429.4	37	CCDS32221.1																																																																																				DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416251.1	NM_017434	
UNC13C	440279	broad.mit.edu	37	15	54305554	54305554	+	Missense_Mutation	SNP	C	C	T	rs536918048		TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr15:54305554C>T	ENST00000260323.11	+	1	454	c.454C>T	c.(454-456)Cgc>Tgc	p.R152C	UNC13C_ENST00000537900.1_Missense_Mutation_p.R152C|UNC13C_ENST00000545554.1_Missense_Mutation_p.R152C	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	152					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)	p.R152C(2)		breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GCCAGTTAGACGCAACAGAAA	0.468													C|||	1	0.000199681	0.0	0.0	5008	,	,		20857	0.0		0.0	False		,,,				2504	0.001				p.R152C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C454T	15						.						87.0	87.0	87.0					15																	54305554		2020	4188	6208	52092846	SO:0001583	missense	440279	exon1			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.454C>T	15.37:g.54305554C>T	ENSP00000260323:p.Arg152Cys	Somatic		Capture	Illumina HiSeq	Phase_I	52092846	NM_001080534	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	C	15.54	2.864614	0.51482	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	D;D;D	0.83673	-1.75;-1.75;-1.75	5.16	5.16	0.70880	.	.	.	.	.	D	0.86957	0.6058	L	0.32530	0.975	0.58432	D	0.999999	D	0.89917	1.0	D	0.73708	0.981	D	0.88664	0.3191	9	0.87932	D	0	.	17.6434	0.88143	0.0:1.0:0.0:0.0	.	152	Q8NB66	UN13C_HUMAN	C	152	ENSP00000260323:R152C;ENSP00000438156:R152C;ENSP00000442569:R152C	ENSP00000260323:R152C	R	+	1	0	UNC13C	52092846	1.000000	0.71417	0.522000	0.27862	0.365000	0.29674	4.576000	0.60915	2.394000	0.81467	0.655000	0.94253	CGC		UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
SMAD3	4088	broad.mit.edu	37	15	67473630	67473630	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr15:67473630A>G	ENST00000327367.4	+	6	1020	c.710A>G	c.(709-711)tAc>tGc	p.Y237C	SMAD3_ENST00000439724.3_Missense_Mutation_p.Y193C|SMAD3_ENST00000540846.2_Missense_Mutation_p.Y132C|SMAD3_ENST00000537194.2_Missense_Mutation_p.Y42C	NM_005902.3	NP_005893.1	P84022	SMAD3_HUMAN	SMAD family member 3	237	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell-cell junction organization (GO:0045216)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|embryonic pattern specification (GO:0009880)|endoderm development (GO:0007492)|evasion or tolerance of host defenses by virus (GO:0019049)|extrinsic apoptotic signaling pathway (GO:0097191)|gene expression (GO:0010467)|heart looping (GO:0001947)|immune response (GO:0006955)|immune system development (GO:0002520)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|lens fiber cell differentiation (GO:0070306)|liver development (GO:0001889)|mesoderm formation (GO:0001707)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)|nodal signaling pathway (GO:0038092)|osteoblast development (GO:0002076)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta3 production (GO:0032916)|primary miRNA processing (GO:0031053)|protein stabilization (GO:0050821)|regulation of binding (GO:0051098)|regulation of epithelial cell proliferation (GO:0050678)|regulation of immune response (GO:0050776)|regulation of striated muscle tissue development (GO:0016202)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|somitogenesis (GO:0001756)|T cell activation (GO:0042110)|thyroid gland development (GO:0030878)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transdifferentiation (GO:0060290)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transport (GO:0006810)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nuclear inner membrane (GO:0005637)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|bHLH transcription factor binding (GO:0043425)|chromatin DNA binding (GO:0031490)|co-SMAD binding (GO:0070410)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y237C(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(11)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(7;0.125)		TCCATCTCCTACTACGAGCTG	0.612																																					p.Y193C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A578G	15						.						80.0	61.0	68.0					15																	67473630		2201	4299	6500	65260684	SO:0001583	missense	4088	exon6			BC050743	CCDS10222.1, CCDS45288.1, CCDS53950.1, CCDS53951.1	15q21-q22	2006-11-06	2006-11-06	2004-05-26	ENSG00000166949	ENSG00000166949		"""SMADs"""	6769	protein-coding gene	gene with protein product		603109	"""MAD, mothers against decapentaplegic homolog 3 (Drosophila)"", ""SMAD, mothers against DPP homolog 3 (Drosophila)"""	MADH3		8774881, 8673135	Standard	NM_001145102		Approved	JV15-2, HsT17436	uc002aqj.3	P84022	OTTHUMG00000133230	ENST00000327367.4:c.710A>G	15.37:g.67473630A>G	ENSP00000332973:p.Tyr237Cys	Somatic		Capture	Illumina HiSeq	Phase_I	65260684	NM_001145103	A8K4B6|B7Z4Z5|B7Z6M9|B7Z9Q2|F5H383|O09064|O09144|O14510|O35273|Q92940|Q93002|Q9GKR4	Missense_Mutation	SNP	ENST00000327367.4	37	CCDS10222.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.576616	0.86645	.	.	ENSG00000166949	ENST00000327367;ENST00000535241;ENST00000540846;ENST00000439724;ENST00000537194	D;D;D;D	0.99706	-6.47;-6.47;-6.47;-6.47	5.1	5.1	0.69264	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.99832	0.9924	H	0.97516	4.02	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96608	0.9450	10	0.87932	D	0	.	15.1773	0.72924	1.0:0.0:0.0:0.0	.	193;237	B7Z4Z5;P84022	.;SMAD3_HUMAN	C	237;237;132;193;42	ENSP00000332973:Y237C;ENSP00000437757:Y132C;ENSP00000401133:Y193C;ENSP00000445348:Y42C	ENSP00000332973:Y237C	Y	+	2	0	SMAD3	65260684	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.164000	0.94755	2.035000	0.60131	0.454000	0.30748	TAC		SMAD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256967.2	NM_005902	
TMC3	342125	broad.mit.edu	37	15	81625262	81625262	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr15:81625262C>T	ENST00000359440.5	-	22	2936	c.2801G>A	c.(2800-2802)cGc>cAc	p.R934H	RP11-761I4.3_ENST00000559781.1_RNA|TMC3_ENST00000558726.1_Missense_Mutation_p.R935H|RP11-761I4.3_ENST00000560973.1_RNA|RP11-761I4.3_ENST00000560851.1_RNA	NM_001080532.1	NP_001074001.1			transmembrane channel-like 3									p.R938H(1)		autonomic_ganglia(2)|breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	34						GGGAGGCTGGCGGGGGACCCG	0.552																																					p.R934H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2801A	15						.						35.0	38.0	37.0					15																	81625262		1942	4106	6048	79412317	SO:0001583	missense	342125	exon22			AY263163	CCDS45324.1	15q24.3	2006-11-24				ENSG00000188869			22995	protein-coding gene	gene with protein product						12906855, 12812529	Standard	NM_001080532		Approved		uc021ssk.1	Q7Z5M5		ENST00000359440.5:c.2801G>A	15.37:g.81625262C>T	ENSP00000352413:p.Arg934His	Somatic		Capture	Illumina HiSeq	Phase_I	79412317	NM_001080532		Missense_Mutation	SNP	ENST00000359440.5	37	CCDS45324.1	.	.	.	.	.	.	.	.	.	.	C	6.093	0.385429	0.11524	.	.	ENSG00000188869	ENST00000359440	T	0.61158	0.13	4.94	-9.89	0.00464	.	1.218680	0.06653	N	0.763174	T	0.24005	0.0581	N	0.04880	-0.145	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.08027	-1.0742	10	0.13470	T	0.59	0.504	3.5438	0.07820	0.1756:0.433:0.2085:0.1828	.	934	Q7Z5M5	TMC3_HUMAN	H	934	ENSP00000352413:R934H	ENSP00000352413:R934H	R	-	2	0	TMC3	79412317	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.397000	0.07269	-3.958000	0.00087	-0.165000	0.13383	CGC		TMC3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417795.3	NM_181841	
MYLK3	91807	broad.mit.edu	37	16	46771731	46771731	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr16:46771731A>G	ENST00000394809.4	-	3	1008	c.893T>C	c.(892-894)tTa>tCa	p.L298S	MYLK3_ENST00000536476.1_Intron	NM_182493.2	NP_872299.2	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	298					cardiac myofibril assembly (GO:0055003)|cellular response to interleukin-1 (GO:0071347)|positive regulation of sarcomere organization (GO:0060298)|protein phosphorylation (GO:0006468)|regulation of vascular permeability involved in acute inflammatory response (GO:0002528)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)	p.L349S(1)|p.L298S(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(5)|stomach(3)	37		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				GCCTTCCTCTAAGGGCTCAGG	0.667																																					p.L298S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T893C	16						.						70.0	69.0	70.0					16																	46771731		2203	4300	6503	45329232	SO:0001583	missense	91807	exon3			AJ247087	CCDS10723.2	16q11.2	2008-10-23			ENSG00000140795	ENSG00000140795			29826	protein-coding gene	gene with protein product	"""MLC kinase"""	612147				17885681	Standard	NM_182493		Approved	caMLCK, MLCK	uc002eei.4	Q32MK0	OTTHUMG00000132543	ENST00000394809.4:c.893T>C	16.37:g.46771731A>G	ENSP00000378288:p.Leu298Ser	Somatic		Capture	Illumina HiSeq	Phase_I	45329232	NM_182493	B5BUL9|B7Z5U8|Q32MK1|Q96DV1	Missense_Mutation	SNP	ENST00000394809.4	37	CCDS10723.2	.	.	.	.	.	.	.	.	.	.	A	0.020	-1.439046	0.01098	.	.	ENSG00000140795	ENST00000394809	T	0.65916	-0.18	4.75	0.458	0.16670	.	1.527450	0.04890	N	0.449400	T	0.29716	0.0742	N	0.02539	-0.55	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.27365	-1.0076	10	0.06236	T	0.91	.	3.456	0.07515	0.2975:0.0:0.5258:0.1766	.	298	Q32MK0	MYLK3_HUMAN	S	298	ENSP00000378288:L298S	ENSP00000378288:L298S	L	-	2	0	MYLK3	45329232	0.342000	0.24809	0.000000	0.03702	0.005000	0.04900	0.752000	0.26362	0.025000	0.15241	-0.912000	0.02778	TTA		MYLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255743.2	NM_182493	
HYDIN	54768	broad.mit.edu	37	16	70871736	70871736	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr16:70871736C>T	ENST00000393567.2	-	77	13249	c.13099G>A	c.(13099-13101)Gtg>Atg	p.V4367M		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	4367					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.V4366M(1)|p.V4318M(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GGCTTTACCACATCAACACGG	0.433																																					p.V4366M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G13096A	16						.						86.0	80.0	82.0					16																	70871736		1876	4114	5990	69429237	SO:0001583	missense	54768	exon77			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.13099G>A	16.37:g.70871736C>T	ENSP00000377197:p.Val4367Met	Somatic		Capture	Illumina HiSeq	Phase_I	69429237	NM_032821	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	C	14.51	2.557734	0.45590	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.47869	0.83	5.04	4.01	0.46588	.	0.333086	0.16838	U	0.197453	T	0.59756	0.2217	M	0.65975	2.015	0.80722	D	1	P	0.49961	0.93	P	0.61533	0.89	T	0.53294	-0.8459	10	0.28530	T	0.3	.	9.7648	0.40554	0.0:0.7758:0.1439:0.0802	.	4366	F8WD23	.	M	4367;4366	ENSP00000377197:V4367M	ENSP00000313052:V4366M	V	-	1	0	HYDIN	69429237	0.472000	0.25870	0.886000	0.34754	0.328000	0.28507	1.060000	0.30530	2.506000	0.84524	0.511000	0.50034	GTG		HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
TP53	7157	broad.mit.edu	37	17	7578454	7578454	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr17:7578454G>A	ENST00000269305.4	-	5	665	c.476C>T	c.(475-477)gCc>gTc	p.A159V	TP53_ENST00000413465.2_Missense_Mutation_p.A159V|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.A159V|TP53_ENST00000445888.2_Missense_Mutation_p.A159V|TP53_ENST00000359597.4_Missense_Mutation_p.A159V|TP53_ENST00000455263.2_Missense_Mutation_p.A159V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	159	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		A -> D (in sporadic cancers; somatic mutation).|A -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|A -> G (in sporadic cancers; somatic mutation).|A -> P (in sporadic cancers; somatic mutation).|A -> S (in sporadic cancers; somatic mutation).|A -> T (in sporadic cancers; somatic mutation).|A -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.A159V(33)|p.0?(8)|p.A159D(7)|p.R158fs(6)|p.R65fs(2)|p.R158_A159delRA(2)|p.R156_I162delRVRAMAI(2)|p.V157fs*9(2)|p.R26fs(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.V157_M160delVRAM(1)|p.R158fs*11(1)|p.A66V(1)|p.S149fs*72(1)|p.A159fs*21(1)|p.T155_A161delTRVRAMA(1)|p.A27V(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.A159_Q167delAMAIYKQSQ(1)|p.V157fs*21(1)|p.R158fs*8(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GATGGCCATGGCGCGGACGCG	0.627		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.A159V	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,large_intestine,colon,Substitution - Missense,0 	.	81	Substitution - Missense(42)|Deletion - In frame(12)|Complex(10)|Whole gene deletion(8)|Deletion - Frameshift(7)|Complex - frameshift(2)	central_nervous_system(15)|large_intestine(13)|lung(13)|stomach(6)|breast(6)|ovary(6)|oesophagus(4)|bone(4)|liver(4)|haematopoietic_and_lymphoid_tissue(3)|pancreas(2)|upper_aerodigestive_tract(1)|endometrium(1)|urinary_tract(1)|skin(1)|prostate(1)	c.C476T	17						.						50.0	51.0	51.0					17																	7578454		2203	4300	6503	7519179	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.476C>T	17.37:g.7578454G>A	ENSP00000269305:p.Ala159Val	Somatic		Capture	Illumina HiSeq	Phase_I	7519179	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	16.76	3.211949	0.58452	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99859	-7.23;-7.23;-7.23;-7.23;-7.23;-7.23;-7.23;-7.23;-7.23	5.59	2.42	0.29668	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.053992	0.64402	D	0.000001	D	0.99594	0.9853	L	0.49513	1.565	0.50171	D	0.999855	D;P;B;D;P;P;D	0.67145	0.984;0.881;0.358;0.989;0.832;0.769;0.996	P;P;B;P;P;P;P	0.59703	0.774;0.616;0.255;0.741;0.814;0.632;0.862	D	0.98152	1.0442	10	0.87932	D	0	-9.0177	10.7596	0.46258	0.0:0.2672:0.5942:0.1386	.	120;159;159;66;159;159;159	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	V	159;159;159;159;159;159;148;66;27;66;27;159	ENSP00000410739:A159V;ENSP00000352610:A159V;ENSP00000269305:A159V;ENSP00000398846:A159V;ENSP00000391127:A159V;ENSP00000391478:A159V;ENSP00000425104:A27V;ENSP00000423862:A66V;ENSP00000424104:A159V	ENSP00000269305:A159V	A	-	2	0	TP53	7519179	1.000000	0.71417	0.377000	0.26055	0.171000	0.22731	7.969000	0.87988	0.364000	0.24374	-0.176000	0.13171	GCC		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TTYH2	94015	broad.mit.edu	37	17	72249925	72249925	+	Missense_Mutation	SNP	C	C	T	rs114644256	byFrequency	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr17:72249925C>T	ENST00000269346.4	+	13	1551	c.1477C>T	c.(1477-1479)Cgc>Tgc	p.R493C	TTYH2_ENST00000529107.1_Missense_Mutation_p.R472C|TTYH2_ENST00000441391.2_Missense_Mutation_p.R172C	NM_032646.5	NP_116035.5	Q9BSA4	TTYH2_HUMAN	tweety family member 2	493						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)	p.R493C(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(14)|ovary(3)|pancreas(1)|stomach(3)|upper_aerodigestive_tract(1)	36						TAGGAACCCACGCTACGAGAA	0.557													C|||	57	0.0113818	0.0401	0.0058	5008	,	,		18357	0.0		0.0	False		,,,				2504	0.0				p.R493C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1477T	17						.	C	CYS/ARG,CYS/ARG	135,4271	97.1+/-135.8	2,131,2070	168.0	135.0	146.0		1477,514	4.8	1.0	17	dbSNP_132	146	4,8596	3.7+/-12.6	0,4,4296	yes	missense,missense	TTYH2	NM_032646.5,NM_052869.1	180,180	2,135,6366	TT,TC,CC		0.0465,3.064,1.0687	probably-damaging,probably-damaging	493/535,172/214	72249925	139,12867	2203	4300	6503	69761520	SO:0001583	missense	94015	exon13				CCDS32717.1, CCDS45770.1	17q25.1	2013-09-02	2013-09-02		ENSG00000141540	ENSG00000141540			13877	protein-coding gene	gene with protein product		608855	"""tweety (Drosophila) homolog 2"", ""tweety homolog 2 (Drosophila)"""			11597145	Standard	XM_005257824		Approved	C17orf29	uc002jkc.3	Q9BSA4	OTTHUMG00000166018	ENST00000269346.4:c.1477C>T	17.37:g.72249925C>T	ENSP00000269346:p.Arg493Cys	Somatic		Capture	Illumina HiSeq	Phase_I	69761520	NM_032646	B3KX97|Q3B7H8|Q3B7R9|Q6AWB4|Q8NBB7|Q96PK1	Missense_Mutation	SNP	ENST00000269346.4	37	CCDS32717.1	20	0.009157509157509158	17	0.034552845528455285	3	0.008287292817679558	0	0.0	0	0.0	C	22.8	4.333797	0.81801	0.03064	4.65E-4	ENSG00000141540	ENST00000269346;ENST00000529107;ENST00000441391	T;T;T	0.49139	0.79;0.79;0.79	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.45756	0.1358	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.69479	0.95;0.964	T	0.67233	-0.5722	10	0.87932	D	0	-28.8769	16.5959	0.84796	0.0:1.0:0.0:0.0	.	472;493	B4DKD1;Q9BSA4	.;TTYH2_HUMAN	C	493;472;172	ENSP00000269346:R493C;ENSP00000433089:R472C;ENSP00000394576:R172C	ENSP00000269346:R493C	R	+	1	0	TTYH2	69761520	1.000000	0.71417	0.982000	0.44146	0.891000	0.51852	4.897000	0.63231	2.205000	0.71048	0.563000	0.77884	CGC		TTYH2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387459.1		
MAN2B1	4125	broad.mit.edu	37	19	12759995	12759995	+	Silent	SNP	G	G	A			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr19:12759995G>A	ENST00000456935.2	-	20	2431	c.2391C>T	c.(2389-2391)cgC>cgT	p.R797R	CTD-2192J16.22_ENST00000597692.1_5'Flank|MAN2B1_ENST00000221363.4_Silent_p.R796R	NM_000528.3|NM_001173498.1	NP_000519.2|NP_001166969.1	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	797					cellular protein modification process (GO:0006464)|mannose metabolic process (GO:0006013)|protein deglycosylation (GO:0006517)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)	p.R797R(1)		breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						CCCCCTGGGAGCGGTCAGTCA	0.617																																					p.R797R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2391T	19						.						58.0	50.0	53.0					19																	12759995		2203	4300	6503	12620995	SO:0001819	synonymous_variant	4125	exon20				CCDS32919.1, CCDS54224.1	19p13.2	2013-09-20			ENSG00000104774	ENSG00000104774	3.2.1.24		6826	protein-coding gene	gene with protein product		609458		MANB			Standard	NM_000528		Approved	LAMAN	uc002mub.2	O00754	OTTHUMG00000156397	ENST00000456935.2:c.2391C>T	19.37:g.12759995G>A		Somatic		Capture	Illumina HiSeq	Phase_I	12620995	NM_000528	G5E928|O15330|Q16680|Q93094|Q9BW13	Silent	SNP	ENST00000456935.2	37	CCDS32919.1																																																																																				MAN2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344062.1		
PLIN4	729359	broad.mit.edu	37	19	4513405	4513405	+	Silent	SNP	G	G	A	rs142527003	byFrequency	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr19:4513405G>A	ENST00000301286.3	-	3	524	c.525C>T	c.(523-525)gcC>gcT	p.A175A		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	175	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)		p.A103A(1)		NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						TGTCCACACCGGCCTGTACGG	0.617													G|||	3	0.000599042	0.0	0.0	5008	,	,		20440	0.0		0.003	False		,,,				2504	0.0				p.A175A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C525T	19						.	G		0,4122		0,0,2061	82.0	89.0	87.0		525	-10.9	0.0	19	dbSNP_134	87	2,8380		0,2,4189	no	coding-synonymous	PLIN4	NM_001080400.1		0,2,6250	AA,AG,GG		0.0239,0.0,0.016		175/1358	4513405	2,12502	2061	4191	6252	4464405	SO:0001819	synonymous_variant	729359	exon3			AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.525C>T	19.37:g.4513405G>A		Somatic		Capture	Illumina HiSeq	Phase_I	4464405	NM_001080400	A6NEI2	Silent	SNP	ENST00000301286.3	37	CCDS45927.1																																																																																				PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1	XM_170901	
OR10H2	26538	broad.mit.edu	37	19	15839268	15839268	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr19:15839268C>T	ENST00000305899.3	+	1	435	c.415C>T	c.(415-417)Cgg>Tgg	p.R139W		NM_013939.2	NP_039227.1	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H, member 2	139						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R139W(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(1)	27	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					CATGAGCCCACGGGGCTGCGC	0.637																																					p.R139W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C415T	19						.						90.0	73.0	79.0					19																	15839268		2203	4300	6503	15700268	SO:0001583	missense	26538	exon1			AC004597	CCDS12333.1	19p13.1	2012-08-09				ENSG00000171942		"""GPCR / Class A : Olfactory receptors"""	8173	protein-coding gene	gene with protein product							Standard	NM_013939		Approved		uc002nbm.2	O60403		ENST00000305899.3:c.415C>T	19.37:g.15839268C>T	ENSP00000306095:p.Arg139Trp	Somatic		Capture	Illumina HiSeq	Phase_I	15700268	NM_013939	Q6IFQ1|Q96R58	Missense_Mutation	SNP	ENST00000305899.3	37	CCDS12333.1	.	.	.	.	.	.	.	.	.	.	.	13.86	2.363639	0.41902	.	.	ENSG00000171942	ENST00000305899	T	0.42900	0.96	3.4	1.15	0.20763	GPCR, rhodopsin-like superfamily (1);	0.152141	0.30969	N	0.008513	T	0.43389	0.1245	L	0.54908	1.71	0.09310	N	1	D	0.63046	0.992	P	0.56088	0.791	T	0.32851	-0.9891	10	0.59425	D	0.04	.	2.1438	0.03782	0.1997:0.487:0.195:0.1183	.	139	O60403	O10H2_HUMAN	W	139	ENSP00000306095:R139W	ENSP00000306095:R139W	R	+	1	2	OR10H2	15700268	0.000000	0.05858	0.010000	0.14722	0.691000	0.40173	-0.896000	0.04114	0.009000	0.14813	-0.336000	0.08194	CGG		OR10H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460917.1		
ZNF230	7773	broad.mit.edu	37	19	44514982	44514982	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr19:44514982A>G	ENST00000429154.2	+	5	1019	c.791A>G	c.(790-792)gAt>gGt	p.D264G		NM_006300.3	NP_006291.2	Q9UIE0	ZN230_HUMAN	zinc finger protein 230	264					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D264G(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(10)|skin(1)|stomach(3)|urinary_tract(2)	22		Prostate(69;0.0352)				TTCATTCACGATTTCCAGCTT	0.408																																					p.D264G	GBM(175;914 2069 22996 47111 52600)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A791G	19						.						116.0	121.0	119.0					19																	44514982		2203	4300	6503	49206822	SO:0001583	missense	7773	exon5			U95044	CCDS33044.1	19q13.31	2013-01-08				ENSG00000159882		"""Zinc fingers, C2H2-type"", ""-"""	13024	protein-coding gene	gene with protein product							Standard	NM_006300		Approved	FDZF2	uc002oyb.1	Q9UIE0		ENST00000429154.2:c.791A>G	19.37:g.44514982A>G	ENSP00000409318:p.Asp264Gly	Somatic		Capture	Illumina HiSeq	Phase_I	49206822	NM_006300	O15322|Q504X7|Q86W84|Q9P1U6	Missense_Mutation	SNP	ENST00000429154.2	37	CCDS33044.1	.	.	.	.	.	.	.	.	.	.	A	4.357	0.065705	0.08388	.	.	ENSG00000159882	ENST00000429154	T	0.07567	3.18	2.33	-2.31	0.06765	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02688	0.0081	N	0.03238	-0.38	0.09310	N	1	P	0.37548	0.599	B	0.32677	0.15	T	0.44483	-0.9325	9	0.30078	T	0.28	.	5.7688	0.18241	0.316:0.3818:0.3022:0.0	.	264	Q9UIE0	ZN230_HUMAN	G	264	ENSP00000409318:D264G	ENSP00000409318:D264G	D	+	2	0	ZNF230	49206822	0.000000	0.05858	0.000000	0.03702	0.092000	0.18411	-4.045000	0.00306	-0.113000	0.11958	0.172000	0.16884	GAT		ZNF230-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460456.1		
TRPM4	54795	broad.mit.edu	37	19	49684698	49684698	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr19:49684698C>T	ENST00000252826.5	+	10	1369	c.1243C>T	c.(1243-1245)Cgg>Tgg	p.R415W	TRPM4_ENST00000427978.2_Missense_Mutation_p.R415W|TRPM4_ENST00000601347.1_Intron|TRPM4_ENST00000355712.5_Intron	NM_017636.3	NP_060106.2	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel, subfamily M, member 4	415					calcium ion transmembrane transport (GO:0070588)|cardiac conduction (GO:0061337)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|protein sumoylation (GO:0016925)|regulation of membrane potential (GO:0042391)|regulation of T cell cytokine production (GO:0002724)|transmembrane transport (GO:0055085)|vasoconstriction (GO:0042310)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)	p.R415W(1)		breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(18)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	49		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		TGAACTCTTTCGGGGGGACAT	0.587																																					p.R415W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1243T	19						.						59.0	56.0	57.0					19																	49684698		2203	4300	6503	54376510	SO:0001583	missense	54795	exon10			AK000048	CCDS33073.1, CCDS56098.1	19q13.3	2011-12-14				ENSG00000130529		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17993	protein-coding gene	gene with protein product		606936				11535825, 16382100	Standard	NM_017636		Approved	FLJ20041	uc002pmw.3	Q8TD43		ENST00000252826.5:c.1243C>T	19.37:g.49684698C>T	ENSP00000252826:p.Arg415Trp	Somatic		Capture	Illumina HiSeq	Phase_I	54376510	NM_017636	A2RU25|Q7Z5D9|Q96L84|Q9NXV1	Missense_Mutation	SNP	ENST00000252826.5	37	CCDS33073.1	.	.	.	.	.	.	.	.	.	.	C	19.55	3.849165	0.71603	.	.	ENSG00000130529	ENST00000252826;ENST00000427978	D;D	0.83163	-1.69;-1.69	3.92	3.92	0.45320	.	0.139448	0.48286	D	0.000199	D	0.89543	0.6745	M	0.69823	2.125	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.72625	0.958;0.978;0.937	D	0.90113	0.4193	10	0.49607	T	0.09	-17.107	15.0744	0.72066	0.0:1.0:0.0:0.0	.	241;415;415	Q8TD43-2;Q8TD43-3;Q8TD43	.;.;TRPM4_HUMAN	W	415	ENSP00000252826:R415W;ENSP00000407492:R415W	ENSP00000252826:R415W	R	+	1	2	TRPM4	54376510	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.514000	0.45503	1.899000	0.54978	0.455000	0.32223	CGG		TRPM4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465543.2	NM_017636	
KLK10	5655	broad.mit.edu	37	19	51519274	51519274	+	Silent	SNP	G	G	A	rs139432866		TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr19:51519274G>A	ENST00000309958.3	-	4	626	c.408C>T	c.(406-408)caC>caT	p.H136H	KLK10_ENST00000391805.1_Silent_p.H136H|KLK10_ENST00000358789.3_Silent_p.H136H|CTC-518B2.12_ENST00000596286.1_RNA	NM_002776.4	NP_002767.2	O43240	KLK10_HUMAN	kallikrein-related peptidase 10	136	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell cycle (GO:0007049)	extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.H136H(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	13		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00885)		ACATGAGATCGTGCTCATCCG	0.657													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15885	0.0		0.0	False		,,,				2504	0.0				p.H136H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C408T	19						.	G	,,	2,4384		0,2,2191	39.0	35.0	36.0		408,408,408	-5.7	0.8	19	dbSNP_134	36	0,8586		0,0,4293	no	coding-synonymous,coding-synonymous,coding-synonymous	KLK10	NM_001077500.1,NM_002776.4,NM_145888.2	,,	0,2,6484	AA,AG,GG		0.0,0.0456,0.0154	,,	136/277,136/277,136/277	51519274	2,12970	2193	4293	6486	56211086	SO:0001819	synonymous_variant	5655	exon4			AF024605	CCDS12817.1	19q13	2011-03-07	2006-10-27			ENSG00000129451		"""Kallikreins"""	6358	protein-coding gene	gene with protein product		602673	"""kallikrein 10"""	PRSSL1		8764136, 9533035, 16800724, 16800723, 10675891	Standard	NM_145888		Approved	NES1	uc002pva.3	O43240		ENST00000309958.3:c.408C>T	19.37:g.51519274G>A		Somatic		Capture	Illumina HiSeq	Phase_I	56211086	NM_002776	A6NC12|Q53YL3|Q99920|Q9GZW9	Silent	SNP	ENST00000309958.3	37	CCDS12817.1																																																																																				KLK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464337.2	NM_002776	
MISP	126353	broad.mit.edu	37	19	759987	759987	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr19:759987T>C	ENST00000215582.6	+	3	1962	c.1859T>C	c.(1858-1860)gTg>gCg	p.V620A		NM_173481.2	NP_775752.1	Q8IVT2	MISP_HUMAN	mitotic spindle positioning	620					mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.V620A(1)									GCGTGGACAGTGGAAGATCCA	0.597																																					p.V620A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1859C	19						.						121.0	103.0	109.0					19																	759987		2203	4300	6503	710987	SO:0001583	missense	126353	exon3			BC052236	CCDS12042.1	19p13.3	2014-06-25	2013-05-03	2013-05-03	ENSG00000099812	ENSG00000099812			27000	protein-coding gene	gene with protein product	"""mitotic interactor and substrate of Plk1"""	615289	"""chromosome 19 open reading frame 21"""	C19orf21		23574715, 23509069, 24475924	Standard	NM_173481		Approved	DKFZp686H18209, Caprice		Q8IVT2	OTTHUMG00000181786	ENST00000215582.6:c.1859T>C	19.37:g.759987T>C	ENSP00000215582:p.Val620Ala	Somatic		Capture	Illumina HiSeq	Phase_I	710987	NM_173481		Missense_Mutation	SNP	ENST00000215582.6	37	CCDS12042.1	.	.	.	.	.	.	.	.	.	.	T	7.183	0.590068	0.13812	.	.	ENSG00000099812	ENST00000215582	T	0.31769	1.48	4.81	-4.96	0.03038	.	1.047520	0.07567	N	0.917928	T	0.13072	0.0317	N	0.25144	0.715	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.38001	-0.9681	10	0.02654	T	1	-14.6643	5.0585	0.14546	0.1592:0.2221:0.0:0.6187	.	620	Q8IVT2	CS021_HUMAN	A	620	ENSP00000215582:V620A	ENSP00000215582:V620A	V	+	2	0	C19orf21	710987	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.932000	0.03963	-0.435000	0.07264	-1.405000	0.01134	GTG		MISP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457600.2	NM_173481	
ACTL9	284382	broad.mit.edu	37	19	8808159	8808159	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr19:8808159G>A	ENST00000324436.3	-	1	1013	c.893C>T	c.(892-894)cCg>cTg	p.P298L		NM_178525.3	NP_848620.3	Q8TC94	ACTL9_HUMAN	actin-like 9	298						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.P298L(1)		NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(15)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	36						CAGCAGCTCCGGACACTGGAA	0.652																																					p.P298L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C893T	19						.						37.0	40.0	39.0					19																	8808159		2203	4298	6501	8669159	SO:0001583	missense	284382	exon1				CCDS12207.1	19p13.2	2014-08-08			ENSG00000181786	ENSG00000181786			28494	protein-coding gene	gene with protein product							Standard	NM_178525		Approved	MGC33407	uc002mkl.2	Q8TC94	OTTHUMG00000182194	ENST00000324436.3:c.893C>T	19.37:g.8808159G>A	ENSP00000316674:p.Pro298Leu	Somatic		Capture	Illumina HiSeq	Phase_I	8669159	NM_178525	A8K893|Q6X960	Missense_Mutation	SNP	ENST00000324436.3	37	CCDS12207.1	.	.	.	.	.	.	.	.	.	.	g	26.1	4.706836	0.89018	.	.	ENSG00000181786	ENST00000324436	D	0.95588	-3.75	4.63	4.63	0.57726	.	0.148034	0.31102	N	0.008244	D	0.98267	0.9426	M	0.93898	3.47	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99222	1.0879	10	0.87932	D	0	.	16.5967	0.84798	0.0:0.0:1.0:0.0	.	298	Q8TC94	ACTL9_HUMAN	L	298	ENSP00000316674:P298L	ENSP00000316674:P298L	P	-	2	0	ACTL9	8669159	1.000000	0.71417	0.969000	0.41365	0.929000	0.56500	8.950000	0.93019	2.581000	0.87130	0.306000	0.20318	CCG		ACTL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459953.1	NM_178525	
MUC16	94025	broad.mit.edu	37	19	9019615	9019615	+	Missense_Mutation	SNP	C	C	T	rs375258130		TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr19:9019615C>T	ENST00000397910.4	-	22	37734	c.37531G>A	c.(37531-37533)Gtg>Atg	p.V12511M		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12513					cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.V12511M(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTGGTGGGCACAGAGGTCCGA	0.512																																					p.V12511M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G37531A	19						.	T	MET/VAL	0,3922		0,0,1961	152.0	133.0	139.0		37531	-2.9	0.0	19		139	1,8297		0,1,4148	no	missense	MUC16	NM_024690.2	21	0,1,6109	TT,TC,CC		0.0121,0.0,0.0082	probably-damaging	12511/14508	9019615	1,12219	1961	4149	6110	8880615	SO:0001583	missense	94025	exon22			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.37531G>A	19.37:g.9019615C>T	ENSP00000381008:p.Val12511Met	Somatic		Capture	Illumina HiSeq	Phase_I	8880615	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	1.154	-0.645881	0.03531	0.0	1.21E-4	ENSG00000181143	ENST00000397910	T	0.30448	1.53	1.43	-2.86	0.05717	.	.	.	.	.	T	0.13670	0.0331	N	0.20610	0.595	.	.	.	D	0.53462	0.96	B	0.38156	0.266	T	0.13845	-1.0494	8	0.87932	D	0	.	2.7421	0.05256	0.0:0.3733:0.2524:0.3742	.	12511	B5ME49	.	M	12511	ENSP00000381008:V12511M	ENSP00000381008:V12511M	V	-	1	0	MUC16	8880615	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.550000	0.06034	-0.749000	0.04747	-1.691000	0.00728	GTG		MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
SIGLECL1	284369	broad.mit.edu	37	19	51770648	51770648	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr19:51770648G>T	ENST00000316401.7	+	5	813	c.432G>T	c.(430-432)aaG>aaT	p.K144N	SIGLECL1_ENST00000593968.1_3'UTR|CTD-3187F8.2_ENST00000597569.1_RNA|SIGLECL1_ENST00000597824.1_Missense_Mutation_p.K50N	NM_173635.1	NP_775906.1	Q96PQ1	SIG12_HUMAN	SIGLEC family like 1	508	Ig-like V-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.K144N(1)									TCAGAAAGAAGCAGGCGAAGA	0.458																																					p.K144N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G432T	19						.						123.0	125.0	124.0					19																	51770648		2203	4300	6503	56462460	SO:0001583	missense	284369	exon5			AK097554	CCDS12827.1	19q13.33	2013-03-20	2012-07-20	2012-07-20	ENSG00000179213	ENSG00000179213			26856	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 75"", ""sialic acid binding Ig-like lectin 23, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 7"""	C19orf75, SIGLEC23P, SIGLECP7			Standard	NM_173635		Approved	FLJ40235	uc002pwb.1	Q8N7X8	OTTHUMG00000182881	ENST00000316401.7:c.432G>T	19.37:g.51770648G>T	ENSP00000321249:p.Lys144Asn	Somatic		Capture	Illumina HiSeq	Phase_I	56462460	NM_173635	Q8IYH7	Missense_Mutation	SNP	ENST00000316401.7	37	CCDS12827.1	.	.	.	.	.	.	.	.	.	.	G	14.88	2.667600	0.47677	.	.	ENSG00000179213	ENST00000316401	T	0.39056	1.1	3.7	-0.037	0.13886	.	1.565550	0.04098	N	0.312430	T	0.45657	0.1353	M	0.75615	2.305	0.09310	N	1	P;P	0.45126	0.851;0.462	B;B	0.44224	0.444;0.175	T	0.36163	-0.9759	10	0.59425	D	0.04	.	3.292	0.06952	0.1449:0.0:0.4084:0.4467	.	50;144	B7ZLS6;Q8N7X8	.;CS075_HUMAN	N	144	ENSP00000321249:K144N	ENSP00000321249:K144N	K	+	3	2	C19orf75	56462460	0.036000	0.19791	0.001000	0.08648	0.899000	0.52679	0.587000	0.23909	0.064000	0.16427	0.650000	0.86243	AAG		SIGLECL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464161.2	NM_173635	
NPPB	4879	broad.mit.edu	37	1	11918387	11918387	+	Missense_Mutation	SNP	C	C	T	rs143526178	byFrequency	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr1:11918387C>T	ENST00000376468.3	-	2	369	c.272G>A	c.(271-273)cGc>cAc	p.R91H		NM_002521.2	NP_002512.1	P16860	ANFB_HUMAN	natriuretic peptide B	91					body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|protein complex (GO:0043234)	diuretic hormone activity (GO:0008613)|hormone activity (GO:0005179)|receptor binding (GO:0005102)	p.R91H(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	11	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	Carvedilol(DB01136)	GACCATTTTGCGGTGCCCACG	0.642																																					p.R91H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G272A	1						.	T	HIS/ARG	3,4403	6.2+/-15.9	0,3,2200	49.0	46.0	47.0		272	-7.9	0.0	1	dbSNP_134	47	0,8600		0,0,4300	yes	missense	NPPB	NM_002521.2	29	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	probably-damaging	91/135	11918387	3,13003	2203	4300	6503	11840974	SO:0001583	missense	4879	exon2			BC025785	CCDS140.1	1p36.2	2014-01-30	2010-11-09		ENSG00000120937	ENSG00000120937		"""Endogenous ligands"""	7940	protein-coding gene	gene with protein product		600295	"""natriuretic peptide precursor B"""			2597152	Standard	NM_002521		Approved		uc001atj.3	P16860	OTTHUMG00000002389	ENST00000376468.3:c.272G>A	1.37:g.11918387C>T	ENSP00000365651:p.Arg91His	Somatic		Capture	Illumina HiSeq	Phase_I	11840974	NM_002521	B0ZBE9|Q6FGY0|Q9P2Q7	Missense_Mutation	SNP	ENST00000376468.3	37	CCDS140.1	.	.	.	.	.	.	.	.	.	.	c	11.17	1.559003	0.27827	6.81E-4	0.0	ENSG00000120937	ENST00000376468	T	0.25414	1.8	3.96	-7.91	0.01165	.	.	.	.	.	T	0.13841	0.0335	N	0.25647	0.755	0.09310	N	1	B	0.22414	0.069	B	0.15052	0.012	T	0.18085	-1.0348	9	0.24483	T	0.36	.	10.6283	0.45521	0.107:0.1661:0.0:0.727	.	91	P16860	ANFB_HUMAN	H	91	ENSP00000365651:R91H	ENSP00000365651:R91H	R	-	2	0	NPPB	11840974	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.301000	0.00133	-3.508000	0.00150	-1.979000	0.00458	CGC		NPPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006854.1	NM_002521	
POGZ	23126	broad.mit.edu	37	1	151384851	151384851	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr1:151384851C>T	ENST00000271715.2	-	11	2014	c.1700G>A	c.(1699-1701)tGg>tAg	p.W567*	POGZ_ENST00000531094.1_Nonsense_Mutation_p.W505*|POGZ_ENST00000392723.1_Nonsense_Mutation_p.W514*|POGZ_ENST00000368863.2_Nonsense_Mutation_p.W472*|POGZ_ENST00000409503.1_Nonsense_Mutation_p.W558*|POGZ_ENST00000361398.3_Nonsense_Mutation_p.W514*|POGZ_ENST00000491586.1_Nonsense_Mutation_p.W514*|POGZ_ENST00000540984.1_5'UTR	NM_001194937.1|NM_015100.3	NP_001181866.1|NP_055915.2	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	567					kinetochore assembly (GO:0051382)|mitotic sister chromatid cohesion (GO:0007064)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.W567*(1)|p.W514*(1)		NS(1)|breast(1)|endometrium(10)|kidney(3)|large_intestine(10)|liver(2)|lung(11)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	47	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TTCAAACGCCCATTCACAGAT	0.398																																					p.W472X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.G1415A	1						.						92.0	85.0	87.0					1																	151384851		2203	4300	6503	149651475	SO:0001587	stop_gained	23126	exon9			AB007930	CCDS997.1, CCDS998.1, CCDS44222.1, CCDS44222.2, CCDS53365.1, CCDS53366.1	1q21.1	2013-07-22			ENSG00000143442	ENSG00000143442			18801	protein-coding gene	gene with protein product	"""zinc finger protein 280E"", ""putative protein product of Nbla00003"""	614787				10976766	Standard	NM_015100		Approved	KIAA0461, ZNF635m, ZNF280E	uc001eyd.2	Q7Z3K3	OTTHUMG00000012499	ENST00000271715.2:c.1700G>A	1.37:g.151384851C>T	ENSP00000271715:p.Trp567*	Somatic		Capture	Illumina HiSeq	Phase_I	149651475	NM_145796	B4DTP8|B4DYL9|B7ZBY5|E9PM80|O75049|Q3LIC4|Q5SZS1|Q5SZS2|Q5SZS3|Q5SZS4|Q8TDZ7|Q9Y4X7	Nonsense_Mutation	SNP	ENST00000271715.2	37	CCDS997.1	.	.	.	.	.	.	.	.	.	.	C	37	6.034781	0.97221	.	.	ENSG00000143442	ENST00000392723;ENST00000271715;ENST00000361398;ENST00000368863;ENST00000409503;ENST00000531094;ENST00000491586;ENST00000529669	.	.	.	4.95	4.02	0.46733	.	0.000000	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	-8.1352	13.3574	0.60635	0.1589:0.8411:0.0:0.0	.	.	.	.	X	514;567;514;472;558;505;514;16	.	ENSP00000271715:W567X	W	-	2	0	POGZ	149651475	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.579000	0.53900	1.274000	0.44362	0.557000	0.71058	TGG		POGZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034915.2	NM_207171	
ARHGEF10L	55160	broad.mit.edu	37	1	17953898	17953898	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr1:17953898C>T	ENST00000361221.3	+	15	1643	c.1484C>T	c.(1483-1485)aCg>aTg	p.T495M	ARHGEF10L_ENST00000434513.1_Missense_Mutation_p.T495M|ARHGEF10L_ENST00000375420.3_Missense_Mutation_p.T253M|ARHGEF10L_ENST00000469726.1_3'UTR|ARHGEF10L_ENST00000167825.4_Missense_Mutation_p.T203M|ARHGEF10L_ENST00000452522.1_Missense_Mutation_p.T456M|ARHGEF10L_ENST00000375408.3_Missense_Mutation_p.T273M|ARHGEF10L_ENST00000375415.1_Missense_Mutation_p.T456M	NM_018125.3	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10-like	495	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.					cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.T495M(2)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	43		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		GAGCTGGAGACGCTGGCTGAG	0.622																																					p.T495M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1484T	1						.						43.0	46.0	45.0					1																	17953898		2203	4300	6503	17826485	SO:0001583	missense	55160	exon15			AB046846	CCDS182.1, CCDS30617.1	1p36.13	2011-11-16			ENSG00000074964	ENSG00000074964		"""Rho guanine nucleotide exchange factors"""	25540	protein-coding gene	gene with protein product	"""GrinchGEF"""	612494				10997877, 16112081	Standard	XM_005245923		Approved	FLJ10521, KIAA1626	uc001ban.3	Q9HCE6	OTTHUMG00000002514	ENST00000361221.3:c.1484C>T	1.37:g.17953898C>T	ENSP00000355060:p.Thr495Met	Somatic		Capture	Illumina HiSeq	Phase_I	17826485	NM_018125	B7ZKS1|Q17RW1|Q3YFJ4|Q5VXI5|Q5VXI6|Q66K51|Q6P0L7|Q8NAV5|Q9NVT3	Missense_Mutation	SNP	ENST00000361221.3	37	CCDS182.1	.	.	.	.	.	.	.	.	.	.	C	18.89	3.719917	0.68844	.	.	ENSG00000074964	ENST00000361221;ENST00000452522;ENST00000434513;ENST00000375415;ENST00000375420;ENST00000375408;ENST00000457829;ENST00000167825	T;T;T;T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09;-0.09;-0.09;1.52	4.94	4.94	0.65067	Dbl homology (DH) domain (5);	0.107908	0.64402	D	0.000007	T	0.76357	0.3976	M	0.77486	2.375	0.40610	D	0.981666	D;P;D;D;D;D;D;P	0.63046	0.979;0.882;0.992;0.969;0.979;0.987;0.969;0.956	P;B;P;P;P;P;P;P	0.58660	0.663;0.393;0.843;0.625;0.611;0.782;0.625;0.742	T	0.79460	-0.1794	10	0.52906	T	0.07	-24.3543	16.8823	0.86066	0.0:1.0:0.0:0.0	.	273;253;495;203;261;456;456;495	Q5VXI4;B4DTE2;Q9HCE6-5;Q9HCE6-4;B3KX74;Q9HCE6-3;Q9HCE6-2;Q9HCE6	.;.;.;.;.;.;.;ARGAL_HUMAN	M	495;456;495;456;253;273;273;203	ENSP00000355060:T495M;ENSP00000399401:T456M;ENSP00000394621:T495M;ENSP00000364564:T456M;ENSP00000364569:T253M;ENSP00000364557:T273M;ENSP00000167825:T203M	ENSP00000167825:T203M	T	+	2	0	ARHGEF10L	17826485	0.990000	0.36364	1.000000	0.80357	0.940000	0.58332	2.890000	0.48609	2.568000	0.86640	0.462000	0.41574	ACG		ARHGEF10L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007147.1	NM_018125	
FLG	2312	broad.mit.edu	37	1	152279751	152279751	+	Silent	SNP	A	A	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr1:152279751A>T	ENST00000368799.1	-	3	7646	c.7611T>A	c.(7609-7611)gcT>gcA	p.A2537A	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2537	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.A2537A(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCCGAGAGGAAGCTTCATGGT	0.587									Ichthyosis																												p.A2537A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T7611A	1						.						239.0	259.0	252.0					1																	152279751		2203	4299	6502	150546375	SO:0001819	synonymous_variant	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.7611T>A	1.37:g.152279751A>T		Somatic		Capture	Illumina HiSeq	Phase_I	150546375	NM_002016	Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	37	CCDS30860.1																																																																																				FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
CACNA1S	779	broad.mit.edu	37	1	201029943	201029943	+	Splice_Site	SNP	C	C	T	rs1800559		TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr1:201029943C>T	ENST00000362061.3	-	26	3483	c.3257G>A	c.(3256-3258)cGc>cAc	p.R1086H	CACNA1S_ENST00000367338.3_Splice_Site_p.R1086H	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	1086			R -> H (in MHS5; dbSNP:rs1800559). {ECO:0000269|PubMed:9199552}.		axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.R1086H(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TACACATTGGCGCTGTGACAC	0.562																																					p.R1086H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3257A	1	GRCh37	CM970210	CACNA1S	M	rs1800559	.						211.0	204.0	206.0					1																	201029943		2203	4300	6503	199296566	SO:0001630	splice_region_variant	779	exon26			L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.3256-1G>A	1.37:g.201029943C>T		Somatic		Capture	Illumina HiSeq	Phase_I	199296566	NM_000069	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	ENST00000362061.3	37	CCDS1407.1	.	.	.	.	.	.	.	.	.	.	C	16.16	3.044776	0.55110	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.96885	-4.16;-4.08	5.17	4.26	0.50523	.	0.152379	0.64402	D	0.000015	D	0.98460	0.9487	M	0.93638	3.44	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	D	0.99342	1.0912	10	0.87932	D	0	.	13.6178	0.62120	0.0:0.9234:0.0:0.0766	rs1800559;rs28931587	1086	Q13698	CAC1S_HUMAN	H	1086	ENSP00000355192:R1086H;ENSP00000356307:R1086H	ENSP00000355192:R1086H	R	-	2	0	CACNA1S	199296566	1.000000	0.71417	1.000000	0.80357	0.031000	0.12232	7.774000	0.85478	1.297000	0.44761	-0.136000	0.14681	CGC		CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069	Missense_Mutation
SLC30A1	7779	broad.mit.edu	37	1	211749320	211749320	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr1:211749320A>T	ENST00000367001.4	-	2	1063	c.934T>A	c.(934-936)Tgg>Agg	p.W312R		NM_021194.2	NP_067017.2	Q9Y6M5	ZNT1_HUMAN	solute carrier family 30 (zinc transporter), member 1	312					cadmium ion transmembrane transport (GO:0070574)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|cellular zinc ion homeostasis (GO:0006882)|detoxification of cadmium ion (GO:0071585)|in utero embryonic development (GO:0001701)|negative regulation of calcium ion import (GO:0090281)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of zinc ion transmembrane import (GO:0071584)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	calcium channel inhibitor activity (GO:0019855)|zinc ion transmembrane transporter activity (GO:0005385)	p.W312R(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(3)|prostate(1)	11				OV - Ovarian serous cystadenocarcinoma(81;0.00535)|GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.0604)|Epithelial(68;0.0978)		TATAGCACCCAGCAAGGACCA	0.373																																					p.W312R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T934A	1						.						139.0	149.0	145.0					1																	211749320		2203	4300	6503	209815943	SO:0001583	missense	7779	exon2			AF323590	CCDS1499.1	1q32.3	2013-05-22			ENSG00000170385	ENSG00000170385		"""Solute carriers"""	11012	protein-coding gene	gene with protein product		609521		ZNT1			Standard	NM_021194		Approved	ZRC1	uc001hio.1	Q9Y6M5	OTTHUMG00000036995	ENST00000367001.4:c.934T>A	1.37:g.211749320A>T	ENSP00000355968:p.Trp312Arg	Somatic		Capture	Illumina HiSeq	Phase_I	209815943	NM_021194	Q0VAK9|Q9BZF6	Missense_Mutation	SNP	ENST00000367001.4	37	CCDS1499.1	.	.	.	.	.	.	.	.	.	.	A	18.56	3.650585	0.67472	.	.	ENSG00000170385	ENST00000367001	T	0.74002	-0.8	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.89529	0.6741	M	0.93978	3.48	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91989	0.5601	10	0.62326	D	0.03	-7.5743	15.4963	0.75653	1.0:0.0:0.0:0.0	.	312	Q9Y6M5	ZNT1_HUMAN	R	312	ENSP00000355968:W312R	ENSP00000355968:W312R	W	-	1	0	SLC30A1	209815943	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.994000	0.93529	2.061000	0.61500	0.460000	0.39030	TGG		SLC30A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104738.2		
USH2A	7399	broad.mit.edu	37	1	216062088	216062088	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr1:216062088C>T	ENST00000307340.3	-	41	8289	c.7903G>A	c.(7903-7905)Gat>Aat	p.D2635N	RP5-1111A8.3_ENST00000414995.1_RNA|USH2A_ENST00000366943.2_Missense_Mutation_p.D2635N	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2635	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.D2635N(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GTTGGAGTATCAGAGAACAGC	0.498										HNSCC(13;0.011)																											p.D2635N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G7903A	1						.						84.0	89.0	88.0					1																	216062088		2203	4300	6503	214128711	SO:0001583	missense	7399	exon41			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.7903G>A	1.37:g.216062088C>T	ENSP00000305941:p.Asp2635Asn	Somatic		Capture	Illumina HiSeq	Phase_I	214128711	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.665357	0.88251	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.56776	0.44;0.44	5.3	4.36	0.52297	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.159730	0.28706	N	0.014401	T	0.63721	0.2535	L	0.56769	1.78	0.41257	D	0.986755	D	0.76494	0.999	D	0.65323	0.934	T	0.60525	-0.7246	10	0.12103	T	0.63	.	14.8673	0.70427	0.1489:0.8511:0.0:0.0	.	2635	O75445	USH2A_HUMAN	N	2635	ENSP00000305941:D2635N;ENSP00000355910:D2635N	ENSP00000305941:D2635N	D	-	1	0	USH2A	214128711	1.000000	0.71417	0.986000	0.45419	0.964000	0.63967	4.378000	0.59568	1.165000	0.42670	0.655000	0.94253	GAT		USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
HMGCL	3155	broad.mit.edu	37	1	24147022	24147022	+	Missense_Mutation	SNP	C	C	T	rs121964997		TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr1:24147022C>T	ENST00000374490.3	-	2	165	c.122G>A	c.(121-123)cGa>cAa	p.R41Q	HMGCL_ENST00000436439.2_Missense_Mutation_p.R41Q|HMGCL_ENST00000374483.4_Missense_Mutation_p.R16Q|HMGCL_ENST00000509389.1_5'UTR	NM_000191.2	NP_000182.2	P35914	HMGCL_HUMAN	3-hydroxymethyl-3-methylglutaryl-CoA lyase	41			R -> Q (in HMGCLD; loss of activity and of proton exchange). {ECO:0000269|PubMed:17173698, ECO:0000269|PubMed:9463337}.		acyl-CoA metabolic process (GO:0006637)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|ketone body biosynthetic process (GO:0046951)|leucine catabolic process (GO:0006552)|liver development (GO:0001889)|mitochondrion organization (GO:0007005)|protein tetramerization (GO:0051262)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	carboxylic acid binding (GO:0031406)|fatty-acyl-CoA binding (GO:0000062)|hydroxymethylglutaryl-CoA lyase activity (GO:0004419)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.R41Q(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	12		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.0044)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.38e-24)|Colorectal(126;5.58e-08)|COAD - Colon adenocarcinoma(152;3.12e-06)|GBM - Glioblastoma multiforme(114;4.9e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000982)|KIRC - Kidney renal clear cell carcinoma(1967;0.0034)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0856)|LUSC - Lung squamous cell carcinoma(448;0.188)		TAGTCCATCTCGGGGACCAAC	0.403																																					p.R41Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G122A	1	GRCh37	CM980987	HMGCL	M	rs121964997	.						161.0	142.0	148.0					1																	24147022		2203	4300	6503	24019609	SO:0001583	missense	3155	exon2			BC010570	CCDS243.1, CCDS53279.1	1p36.1-p35	2010-04-30	2010-04-30		ENSG00000117305	ENSG00000117305	4.1.3.4		5005	protein-coding gene	gene with protein product	"""hydroxymethylglutaricaciduria"""	613898	"""3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase"""			8102917, 8978493	Standard	NM_001166059		Approved	HL	uc001bib.3	P35914	OTTHUMG00000002963	ENST00000374490.3:c.122G>A	1.37:g.24147022C>T	ENSP00000363614:p.Arg41Gln	Somatic		Capture	Illumina HiSeq	Phase_I	24019609	NM_001166059	B4DUP4|B7UCC6|D3Y5K7|Q6IBC0|Q96FP8	Missense_Mutation	SNP	ENST00000374490.3	37	CCDS243.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.275565|5.275565	0.95459|0.95459	.|.	.|.	ENSG00000117305|ENSG00000117305	ENST00000235958|ENST00000374490;ENST00000436439;ENST00000374483;ENST00000543166	.|D;D;D	.|0.99860	.|-7.25;-7.19;-7.25	5.27|5.27	4.36|4.36	0.52297|0.52297	.|Aldolase-type TIM barrel (1);Pyruvate carboxyltransferase (2);	.|0.158981	.|0.53938	.|D	.|0.000045	D|D	0.99919|0.99919	0.9962|0.9962	H|H	0.99391|0.99391	4.545|4.545	0.58432|0.58432	A|A	0.999998|0.999998	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.79108	.|0.99;0.992;0.986;0.992	D|D	0.96097|0.96097	0.9066|0.9066	4|9	.|0.87932	.|D	.|0	-24.786|-24.786	13.0874|13.0874	0.59149|0.59149	0.0:0.9216:0.0:0.0784|0.0:0.9216:0.0:0.0784	.|.	.|41;41;16;41	.|B4DUP4;Q6IBC0;B1AK13;P35914	.|.;.;.;HMGCL_HUMAN	K|Q	37|41;41;16;16	.|ENSP00000363614:R41Q;ENSP00000389281:R41Q;ENSP00000363607:R16Q	.|ENSP00000363607:R16Q	E|R	-|-	1|2	0|0	HMGCL|HMGCL	24019609|24019609	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.070000|7.070000	0.76763|0.76763	1.474000|1.474000	0.48178|0.48178	0.558000|0.558000	0.71614|0.71614	GAG|CGA		HMGCL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008253.2	NM_000191	
GMEB1	10691	broad.mit.edu	37	1	29040687	29040687	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr1:29040687A>T	ENST00000294409.2	+	10	1214	c.1124A>T	c.(1123-1125)aAg>aTg	p.K375M	GMEB1_ENST00000480454.1_3'UTR|GMEB1_ENST00000373816.1_Missense_Mutation_p.K365M|GMEB1_ENST00000361872.4_Missense_Mutation_p.K365M	NM_006582.3	NP_006573.2	Q9Y692	GMEB1_HUMAN	glucocorticoid modulatory element binding protein 1	375					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.K365M(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)	11		Colorectal(325;3.46e-05)|Lung NSC(340;0.000451)|all_lung(284;0.00063)|Breast(348;0.00502)|Renal(390;0.00555)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		AGCACTCCTAAGCCTCCAAAA	0.557																																					p.K375M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1124T	1						.						81.0	84.0	83.0					1																	29040687		2203	4300	6503	28913274	SO:0001583	missense	10691	exon10			AF099013	CCDS327.1, CCDS328.1	1p35	2008-02-05			ENSG00000162419	ENSG00000162419			4370	protein-coding gene	gene with protein product		604409				10386584, 10523663	Standard	NM_006582		Approved	P96PIF, PIF96	uc001bra.3	Q9Y692	OTTHUMG00000003647	ENST00000294409.2:c.1124A>T	1.37:g.29040687A>T	ENSP00000294409:p.Lys375Met	Somatic		Capture	Illumina HiSeq	Phase_I	28913274	NM_006582	B1AT48|Q9NWH1|Q9UKD0	Missense_Mutation	SNP	ENST00000294409.2	37	CCDS327.1	.	.	.	.	.	.	.	.	.	.	A	19.90	3.912999	0.72983	.	.	ENSG00000162419	ENST00000373816;ENST00000456852;ENST00000361872;ENST00000294409	T;T;T	0.57752	0.39;0.39;0.38	5.86	5.86	0.93980	.	0.051827	0.64402	D	0.000001	T	0.66674	0.2813	L	0.47716	1.5	0.34213	D	0.67454	D;D	0.76494	0.999;0.999	D;D	0.77557	0.99;0.99	T	0.76435	-0.2960	10	0.66056	D	0.02	1.1832	15.2494	0.73532	1.0:0.0:0.0:0.0	.	375;365	Q9Y692;B1AT47	GMEB1_HUMAN;.	M	365;341;365;375	ENSP00000362922:K365M;ENSP00000355186:K365M;ENSP00000294409:K375M	ENSP00000294409:K375M	K	+	2	0	GMEB1	28913274	1.000000	0.71417	0.998000	0.56505	0.918000	0.54935	7.514000	0.81750	2.240000	0.73641	0.533000	0.62120	AAG		GMEB1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000010333.1	NM_006582	
RYR2	6262	broad.mit.edu	37	1	237947690	237947690	+	Silent	SNP	G	G	A			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr1:237947690G>A	ENST00000366574.2	+	90	12995	c.12678G>A	c.(12676-12678)ccG>ccA	p.P4226P	RYR2_ENST00000542537.1_Silent_p.P4210P|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Silent_p.P4232P	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4226					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.P4224P(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGGAGAGGCCGGAAGAGCAGG	0.547																																					p.P4226P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G12678A	1						.						59.0	66.0	64.0					1																	237947690		1978	4163	6141	236014313	SO:0001819	synonymous_variant	6262	exon90			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.12678G>A	1.37:g.237947690G>A		Somatic		Capture	Illumina HiSeq	Phase_I	236014313	NM_001035	Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	CCDS55691.1																																																																																				RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
RBCK1	10616	broad.mit.edu	37	20	390535	390535	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr20:390535G>A	ENST00000356286.5	+	2	738	c.33G>A	c.(31-33)atG>atA	p.M11I	RBCK1_ENST00000475269.1_Missense_Mutation_p.M11I|RBCK1_ENST00000353660.3_Intron|RBCK1_ENST00000400245.3_3'UTR|RBCK1_ENST00000382181.2_Intron|RBCK1_ENST00000400247.3_Intron	NM_031229.2	NP_112506.2	Q9BYM8	HOIL1_HUMAN	RanBP-type and C3HC4-type zinc finger containing 1	11	Interaction with IRF3.|Interaction with TAB2.				negative regulation of necroptotic process (GO:0060546)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein linear polyubiquitination (GO:0097039)|protein polyubiquitination (GO:0000209)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	LUBAC complex (GO:0071797)	ligase activity (GO:0016874)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.M11I(1)		kidney(1)|lung(4)	5		all_epithelial(17;0.172)|Lung NSC(37;0.191)|Breast(17;0.231)				CAGAGGAAATGGCCCTGAGCC	0.572																																					p.M11I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G33A	20						.						116.0	126.0	122.0					20																	390535		2203	4300	6503	338535	SO:0001583	missense	10616	exon2			U67322	CCDS12998.1, CCDS13000.2	20p13	2014-09-17	2006-06-28	2006-06-28	ENSG00000125826	ENSG00000125826		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, RAN-binding domain containing"""	15864	protein-coding gene	gene with protein product	"""heme-oxidized IRP2 ubiquitin ligase 1"""	610924	"""chromosome 20 open reading frame 18"""	C20orf18			Standard	NM_031229		Approved	RBCK2, XAP4, RNF54, ZRANB4, UBCE7IP3, HOIL1	uc002wdp.4	Q9BYM8	OTTHUMG00000031634	ENST00000356286.5:c.33G>A	20.37:g.390535G>A	ENSP00000348632:p.Met11Ile	Somatic		Capture	Illumina HiSeq	Phase_I	338535	NM_031229	O95623|Q86SL2|Q96BS3|Q9BYM9	Missense_Mutation	SNP	ENST00000356286.5	37	CCDS13000.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.30|15.30	2.792379|2.792379	0.50102|0.50102	.|.	.|.	ENSG00000125826|ENSG00000125826	ENST00000411647;ENST00000356286;ENST00000475269;ENST00000441733;ENST00000400244;ENST00000400243|ENST00000414880	T;T;T|.	0.40225|.	1.05;2.39;1.04|.	4.68|4.68	4.68|4.68	0.58851|0.58851	.|.	0.360076|.	0.28889|.	N|.	0.013811|.	T|.	0.53932|.	0.1827|.	L|L	0.41236|0.41236	1.265|1.265	0.80722|0.80722	D|D	1|1	B;P|.	0.35383|.	0.0;0.498|.	B;B|.	0.26770|.	0.001;0.073|.	T|.	0.49725|.	-0.8909|.	10|.	0.25751|.	T|.	0.34|.	-8.7986|-8.7986	8.6702|8.6702	0.34145|0.34145	0.1013:0.0:0.8987:0.0|0.1013:0.0:0.8987:0.0	.|.	1;11|.	B4E0F5;Q9BYM8|.	.;HOIL1_HUMAN|.	I|X	11;11;11;10;11;11|3	ENSP00000415080:M11I;ENSP00000348632:M11I;ENSP00000387799:M10I|.	ENSP00000348632:M11I|.	M|W	+|+	3|2	0|0	RBCK1|RBCK1	338535|338535	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.757000|0.757000	0.42996|0.42996	6.944000|6.944000	0.75940|0.75940	2.397000|2.397000	0.81536|0.81536	0.563000|0.563000	0.77884|0.77884	ATG|TGG		RBCK1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077461.3	NM_031229	
TSHZ2	128553	broad.mit.edu	37	20	51871431	51871431	+	Silent	SNP	C	C	T	rs183008464		TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr20:51871431C>T	ENST00000371497.5	+	2	2321	c.1434C>T	c.(1432-1434)gtC>gtT	p.V478V	TSHZ2_ENST00000329613.6_Silent_p.V475V|TSHZ2_ENST00000603338.2_Silent_p.V475V|RP4-678D15.1_ENST00000606932.1_RNA	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	478					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V478V(1)		NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			ATGAGAAAGTCGTGAAAAGCG	0.413													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20958	0.0		0.0	False		,,,				2504	0.0				p.V478V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1434T	20						.						92.0	98.0	96.0					20																	51871431		2203	4300	6503	51304838	SO:0001819	synonymous_variant	128553	exon2			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.1434C>T	20.37:g.51871431C>T		Somatic		Capture	Illumina HiSeq	Phase_I	51304838	NM_173485	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Silent	SNP	ENST00000371497.5	37	CCDS33490.1																																																																																				TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485	
KCNQ2	3785	broad.mit.edu	37	20	62070997	62070997	+	Missense_Mutation	SNP	G	G	A	rs118192211		TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr20:62070997G>A	ENST00000359125.2	-	6	1055	c.881C>T	c.(880-882)gCg>gTg	p.A294V	KCNQ2_ENST00000344462.4_Missense_Mutation_p.A294V|KCNQ2_ENST00000360480.3_Missense_Mutation_p.A294V|KCNQ2_ENST00000370224.1_Missense_Mutation_p.A294V|KCNQ2_ENST00000344425.5_Missense_Mutation_p.A294V|KCNQ2_ENST00000354587.3_Missense_Mutation_p.A294V|KCNQ2_ENST00000359689.1_Missense_Mutation_p.A294V|KCNQ2_ENST00000357249.2_Missense_Mutation_p.A294V	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	294					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.A294V(1)		biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	GAAGGTTGCCGCAAGGAGCCT	0.627																																					p.A294V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C881T	20	GRCh37	CM073161	KCNQ2	M	rs118192211	.						216.0	159.0	178.0					20																	62070997		2203	4300	6503	61541441	SO:0001583	missense	3785	exon6			AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.881C>T	20.37:g.62070997G>A	ENSP00000352035:p.Ala294Val	Somatic		Capture	Illumina HiSeq	Phase_I	61541441	NM_172107	O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Missense_Mutation	SNP	ENST00000359125.2	37	CCDS13520.1	.	.	.	.	.	.	.	.	.	.	G	16.90	3.248795	0.59103	.	.	ENSG00000075043	ENST00000357249;ENST00000359125;ENST00000370226;ENST00000354587;ENST00000359689;ENST00000430658;ENST00000360480;ENST00000344462;ENST00000370224;ENST00000370222;ENST00000370221;ENST00000344425	D;D;D;D;D;D;D;D;D;D;D;D	0.98474	-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95	4.01	4.01	0.46588	Ion transport (1);	0.142257	0.46145	D	0.000306	D	0.98532	0.9510	M	0.64630	1.985	0.58432	D	0.999998	D;P;D;D;D;D	0.76494	0.999;0.782;0.995;0.991;0.991;0.993	D;B;P;P;P;P	0.72338	0.977;0.426;0.726;0.726;0.726;0.821	D	0.99852	1.1073	10	0.87932	D	0	-13.0776	16.4798	0.84155	0.0:0.0:1.0:0.0	.	294;294;294;294;294;294	B4DEP4;Q53Y30;O43526-3;O43526-2;O43526-4;O43526	.;.;.;.;.;KCNQ2_HUMAN	V	294	ENSP00000349789:A294V;ENSP00000352035:A294V;ENSP00000359246:A294V;ENSP00000346601:A294V;ENSP00000352718:A294V;ENSP00000399612:A294V;ENSP00000353668:A294V;ENSP00000339611:A294V;ENSP00000359244:A294V;ENSP00000359242:A294V;ENSP00000359241:A294V;ENSP00000345523:A294V	ENSP00000345523:A294V	A	-	2	0	KCNQ2	61541441	1.000000	0.71417	0.569000	0.28460	0.117000	0.20001	5.273000	0.65564	1.908000	0.55244	0.561000	0.74099	GCG		KCNQ2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080353.1	NM_172109	
GMEB2	26205	broad.mit.edu	37	20	62229213	62229213	+	Splice_Site	SNP	A	A	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr20:62229213A>T	ENST00000266068.1	-	4	836	c.358T>A	c.(358-360)Tac>Aac	p.Y120N	GMEB2_ENST00000370077.1_Splice_Site_p.Y120N|GMEB2_ENST00000370069.1_Splice_Site_p.Y69N			Q9UKD1	GMEB2_HUMAN	glucocorticoid modulatory element binding protein 2	120	SAND. {ECO:0000255|PROSITE- ProRule:PRU00185}.				regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)	p.Y120N(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	18	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)			TGCTCGTCGTACTGTGGGGGA	0.587																																					p.Y120N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T358A	20						.						107.0	81.0	90.0					20																	62229213		2203	4300	6503	61699657	SO:0001630	splice_region_variant	26205	exon5			AF173867	CCDS13528.1	20q13.33	2008-07-02			ENSG00000101216	ENSG00000101216			4371	protein-coding gene	gene with protein product		607451				10523663, 11743720	Standard	NM_012384		Approved	P79PIF, KIAA1269, PIF79	uc002yfq.1	Q9UKD1	OTTHUMG00000032988	ENST00000266068.1:c.358-1T>A	20.37:g.62229213A>T		Somatic		Capture	Illumina HiSeq	Phase_I	61699657	NM_012384	E1P5J3|Q5TDS0|Q9H431|Q9H4X7|Q9H4X8|Q9UF78|Q9ULF1	Missense_Mutation	SNP	ENST00000266068.1	37	CCDS13528.1	.	.	.	.	.	.	.	.	.	.	A	15.07	2.723358	0.48728	.	.	ENSG00000101216	ENST00000370069;ENST00000370077;ENST00000266068	T;T;T	0.71698	-0.59;-0.59;-0.59	5.02	5.02	0.67125	SAND domain-like (2);SAND domain (3);	0.188387	0.47093	D	0.000244	T	0.75170	0.3813	L	0.36672	1.1	0.54753	D	0.999982	D	0.60160	0.987	P	0.62649	0.905	T	0.74853	-0.3523	10	0.38643	T	0.18	0.1356	14.7287	0.69365	1.0:0.0:0.0:0.0	.	120	Q9UKD1	GMEB2_HUMAN	N	69;120;120	ENSP00000359086:Y69N;ENSP00000359094:Y120N;ENSP00000266068:Y120N	ENSP00000266068:Y120N	Y	-	1	0	GMEB2	61699657	1.000000	0.71417	0.991000	0.47740	0.163000	0.22366	6.911000	0.75746	1.894000	0.54839	0.459000	0.35465	TAC		GMEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080166.1	NM_012384	Missense_Mutation
KRTAP10-9	386676	broad.mit.edu	37	21	46047906	46047906	+	Missense_Mutation	SNP	G	G	A	rs587668632		TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr21:46047906G>A	ENST00000397911.3	+	1	867	c.818G>A	c.(817-819)cGc>cAc	p.R273H	KRTAP10-9_ENST00000484861.1_Intron|TSPEAR_ENST00000323084.4_Intron	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9	273						keratin filament (GO:0045095)		p.R273H(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						CTTCTCTGCCGCCCTGTGTGC	0.706													G|||	1	0.000199681	0.0	0.0	5008	,	,		18503	0.0		0.0	False		,,,				2504	0.001				p.R273H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G818A	21						.						64.0	79.0	74.0					21																	46047906		2196	4293	6489	44872334	SO:0001583	missense	386676	exon1			AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.818G>A	21.37:g.46047906G>A	ENSP00000381009:p.Arg273His	Somatic		Capture	Illumina HiSeq	Phase_I	44872334	NM_198690	A2RRG1|A6NIR9|Q70LJ1	Missense_Mutation	SNP	ENST00000397911.3	37	CCDS42961.1	.	.	.	.	.	.	.	.	.	.	g	4.155	0.027215	0.08054	.	.	ENSG00000221837	ENST00000397911	T	0.01015	5.44	3.5	0.186	0.15105	.	.	.	.	.	T	0.01254	0.0041	M	0.84326	2.69	0.09310	N	1	P	0.39250	0.665	B	0.29862	0.108	T	0.43245	-0.9403	8	.	.	.	.	1.4446	0.02361	0.2259:0.162:0.4478:0.1643	.	273	P60411	KR109_HUMAN	H	273	ENSP00000381009:R273H	.	R	+	2	0	KRTAP10-9	44872334	0.000000	0.05858	0.034000	0.17996	0.002000	0.02628	-0.499000	0.06413	0.127000	0.18452	-0.251000	0.11542	CGC		KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128040.1		
PI4KA	5297	broad.mit.edu	37	22	21157556	21157556	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr22:21157556G>A	ENST00000572273.1	-	13	1570	c.1340C>T	c.(1339-1341)cCg>cTg	p.P447L	PI4KA_ENST00000255882.6_Missense_Mutation_p.P505L			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	447					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)	p.P447L(2)		breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			TCGCAAGGACGGTGTCACAGA	0.557																																					p.P447L	GBM(136;1332 1831 3115 23601 50806)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1340T	22						.						179.0	129.0	146.0					22																	21157556		2203	4300	6503	19487556	SO:0001583	missense	5297	exon13			L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.1340C>T	22.37:g.21157556G>A	ENSP00000458238:p.Pro447Leu	Somatic		Capture	Illumina HiSeq	Phase_I	19487556	NM_058004	Q7Z625|Q9UPG2	Missense_Mutation	SNP	ENST00000572273.1	37		.	.	.	.	.	.	.	.	.	.	G	10.97	1.500200	0.26861	.	.	ENSG00000241973	ENST00000255882	.	.	.	4.89	4.89	0.63831	.	0.205291	0.45867	D	0.000323	T	0.25269	0.0614	N	0.01352	-0.895	0.80722	D	1	B;B	0.12013	0.005;0.002	B;B	0.06405	0.002;0.001	T	0.19257	-1.0311	9	0.11182	T	0.66	-26.4369	18.2178	0.89892	0.0:0.0:1.0:0.0	.	505;447	D3DX33;P42356	.;PI4KA_HUMAN	L	447	.	ENSP00000255882:P447L	P	-	2	0	PI4KA	19487556	0.999000	0.42202	0.788000	0.31933	0.974000	0.67602	4.457000	0.60088	2.533000	0.85409	0.491000	0.48974	CCG		PI4KA-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_058004	
MGAT3	4248	broad.mit.edu	37	22	39883628	39883628	+	Silent	SNP	G	G	A	rs527409773		TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr22:39883628G>A	ENST00000341184.6	+	2	491	c.276G>A	c.(274-276)gaG>gaA	p.E92E		NM_001098270.1|NM_002409.4	NP_001091740.1|NP_002400.3	Q09327	MGAT3_HUMAN	mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase	92					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,4-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0003830)	p.E92E(1)		endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|prostate(1)|skin(1)	24	Melanoma(58;0.04)					CGGCCGAGGAGCTCCACCGGG	0.692																																					p.E92E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G276A	22						.						19.0	23.0	22.0					22																	39883628		2196	4280	6476	38213574	SO:0001819	synonymous_variant	4248	exon1			D13789	CCDS13994.2	22q13.1	2013-02-25			ENSG00000128268	ENSG00000128268	2.4.1.144	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7046	protein-coding gene	gene with protein product		604621				8370666	Standard	NM_002409		Approved	GNT-III	uc010gxy.3	Q09327	OTTHUMG00000030185	ENST00000341184.6:c.276G>A	22.37:g.39883628G>A		Somatic		Capture	Illumina HiSeq	Phase_I	38213574	NM_001098270	A6NGD0|Q14CK5|Q6IC49|Q9UH32	Silent	SNP	ENST00000341184.6	37	CCDS13994.2																																																																																				MGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075039.2	NM_002409	
RAPGEF4	11069	broad.mit.edu	37	2	173882219	173882219	+	Silent	SNP	C	C	T	rs34965602	byFrequency	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr2:173882219C>T	ENST00000397081.3	+	21	2138	c.1995C>T	c.(1993-1995)cgC>cgT	p.R665R	RAPGEF4_ENST00000409036.1_Silent_p.R665R|RAPGEF4_ENST00000538974.1_Silent_p.R494R|RAPGEF4_ENST00000397087.3_Silent_p.R521R|RAPGEF4_ENST00000264111.6_Silent_p.R664R|RAPGEF4_ENST00000539331.1_Silent_p.R512R|RAPGEF4_ENST00000535187.1_Silent_p.R445R|RAPGEF4_ENST00000540783.1_Silent_p.R512R	NM_007023.3	NP_008954.2	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4	665					blood coagulation (GO:0007596)|calcium ion-dependent exocytosis (GO:0017156)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|insulin secretion (GO:0030073)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of exocytosis (GO:0017157)|regulation of insulin secretion (GO:0050796)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)	p.R665R(1)		breast(1)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(14)|lung(13)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47			OV - Ovarian serous cystadenocarcinoma(117;0.194)			AGCCTATCCGCGGCTCTGATG	0.473													C|||	4	0.000798722	0.0	0.0014	5008	,	,		19508	0.0		0.0	False		,,,				2504	0.0031				p.R665R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1995T	2						.	C	,	1,3809		0,1,1904	56.0	58.0	57.0		1563,1995	-9.7	0.3	2	dbSNP_126	57	7,8261		0,7,4127	no	coding-synonymous,coding-synonymous	RAPGEF4	NM_001100397.1,NM_007023.3	,	0,8,6031	TT,TC,CC		0.0847,0.0262,0.0662	,	521/868,665/1012	173882219	8,12070	1905	4134	6039	173590465	SO:0001819	synonymous_variant	11069	exon21			U78516	CCDS42775.1, CCDS42776.1, CCDS63060.1, CCDS63061.1, CCDS74604.1	2q31-q32	2008-02-05	2004-03-26		ENSG00000091428	ENSG00000091428			16626	protein-coding gene	gene with protein product	"""cAMP-regulated guanine nucleotide exchange factor II"", "" exchange protein directly activated by cAMP 2"""	606058	"""RAP guanine-nucleotide-exchange factor (GEF) 4"""			10777494, 9856955	Standard	NM_007023		Approved	cAMP-GEFII, CGEF2	uc002uhv.4	Q8WZA2	OTTHUMG00000133677	ENST00000397081.3:c.1995C>T	2.37:g.173882219C>T		Somatic		Capture	Illumina HiSeq	Phase_I	173590465	NM_007023	B2R7R3|B7Z283|B7Z3T6|B7Z912|O95636|Q8IXK6|Q8TAA4	Silent	SNP	ENST00000397081.3	37	CCDS42775.1																																																																																				RAPGEF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257864.2	NM_007023	
TMEM214	54867	broad.mit.edu	37	2	27259422	27259422	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr2:27259422G>A	ENST00000238788.9	+	6	850	c.788G>A	c.(787-789)gGt>gAt	p.G263D	TMEM214_ENST00000404032.3_Missense_Mutation_p.G218D	NM_017727.4	NP_060197.4	Q6NUQ4	TM214_HUMAN	transmembrane protein 214	263					apoptotic process (GO:0006915)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.G263D(1)		kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						TGGGCCCTGGGTCAAGCAGGT	0.557																																					p.G218D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G653A	2						.						110.0	109.0	109.0					2																	27259422		1934	4142	6076	27112926	SO:0001583	missense	54867	exon5				CCDS42664.1, CCDS46242.1	2p23.3	2013-06-19			ENSG00000119777	ENSG00000119777			25983	protein-coding gene	gene with protein product						23661706	Standard	NM_001083590		Approved	FLJ20254	uc002ria.4	Q6NUQ4	OTTHUMG00000151999	ENST00000238788.9:c.788G>A	2.37:g.27259422G>A	ENSP00000238788:p.Gly263Asp	Somatic		Capture	Illumina HiSeq	Phase_I	27112926	NM_001083590	A6NNF2|B3KUI9|B5MCD8|D6W547|Q53SW1|Q69YH4|Q8NC45|Q8WZ37|Q9NXH2	Missense_Mutation	SNP	ENST00000238788.9	37	CCDS42664.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.188699|5.188699	0.94923|0.94923	.|.	.|.	ENSG00000119777|ENSG00000119777	ENST00000238788;ENST00000404032;ENST00000537397|ENST00000425720	T;T|.	0.69561|.	-0.41;-0.41|.	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77096|0.77096	0.4080|0.4080	M|M	0.73962|0.73962	2.25|2.25	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.996;0.999|.	T|T	0.76041|0.76041	-0.3104|-0.3104	10|5	0.48119|.	T|.	0.1|.	-11.1876|-11.1876	19.0913|19.0913	0.93228|0.93228	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	218;263|.	Q6NUQ4-2;Q6NUQ4|.	.;TM214_HUMAN|.	D|I	263;218;5|22	ENSP00000238788:G263D;ENSP00000384417:G218D|.	ENSP00000238788:G263D|.	G|V	+|+	2|1	0|0	TMEM214|TMEM214	27112926|27112926	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.976000|0.976000	0.68499|0.68499	9.234000|9.234000	0.95347|0.95347	2.634000|2.634000	0.89283|0.89283	0.561000|0.561000	0.74099|0.74099	GGT|GTC		TMEM214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324748.1	NM_017727	
RASGRP3	25780	broad.mit.edu	37	2	33783344	33783344	+	Missense_Mutation	SNP	G	G	A	rs375130686		TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr2:33783344G>A	ENST00000403687.3	+	16	2386	c.1646G>A	c.(1645-1647)cGg>cAg	p.R549Q	AC020594.5_ENST00000437680.1_RNA|RASGRP3_ENST00000407811.1_Missense_Mutation_p.R548Q|RASGRP3_ENST00000402538.3_Missense_Mutation_p.R549Q	NM_001139488.1	NP_001132960.1	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and DAG-regulated)	549					MAPK cascade (GO:0000165)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)	guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap GTPase activator activity (GO:0046582)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)	p.R549Q(2)		large_intestine(3)|lung(3)|ovary(2)|pancreas(1)|stomach(2)	11	all_hematologic(175;0.115)					AGATTTGCCCGGGCGCCCTCC	0.552																																					p.R549Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G1646A	2						.	G	GLN/ARG,GLN/ARG,GLN/ARG	0,3830		0,0,1915	52.0	54.0	53.0		1646,1643,1646	5.1	1.0	2		53	2,8212		0,2,4105	no	missense,missense,missense	RASGRP3	NM_001139488.1,NM_015376.2,NM_170672.2	43,43,43	0,2,6020	AA,AG,GG		0.0243,0.0,0.0166	possibly-damaging,possibly-damaging,possibly-damaging	549/691,548/690,549/691	33783344	2,12042	1915	4107	6022	33636848	SO:0001583	missense	25780	exon17			AB020653	CCDS46256.1, CCDS54346.1	2p25.1-p24.1	2013-01-10			ENSG00000152689	ENSG00000152689		"""EF-hand domain containing"""	14545	protein-coding gene	gene with protein product		609531				10048485, 10934204	Standard	NM_170672		Approved	KIAA0846, GRP3	uc002roy.3	Q8IV61	OTTHUMG00000152124	ENST00000403687.3:c.1646G>A	2.37:g.33783344G>A	ENSP00000384192:p.Arg549Gln	Somatic		Capture	Illumina HiSeq	Phase_I	33636848	NM_170672	D6W583|O94931|Q53SD7	Missense_Mutation	SNP	ENST00000403687.3	37	CCDS46256.1	.	.	.	.	.	.	.	.	.	.	G	11.25	1.584040	0.28268	0.0	2.43E-4	ENSG00000152689	ENST00000402538;ENST00000403687;ENST00000407811	T;T;T	0.77358	-1.08;-1.08;-1.09	5.14	5.14	0.70334	.	0.625289	0.15897	N	0.239273	T	0.68348	0.2991	L	0.28608	0.87	0.35828	D	0.825086	B;B	0.21821	0.061;0.061	B;B	0.17722	0.019;0.019	T	0.65944	-0.6045	10	0.11794	T	0.64	-15.3144	18.9666	0.92698	0.0:0.0:1.0:0.0	.	548;549	D6W583;Q8IV61	.;GRP3_HUMAN	Q	549;549;548	ENSP00000385886:R549Q;ENSP00000384192:R549Q;ENSP00000383917:R548Q	ENSP00000385886:R549Q	R	+	2	0	RASGRP3	33636848	1.000000	0.71417	0.996000	0.52242	0.697000	0.40408	3.043000	0.49823	2.537000	0.85549	0.650000	0.86243	CGG		RASGRP3-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325462.2	NM_015376	
VRK2	7444	broad.mit.edu	37	2	58386817	58386817	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr2:58386817T>G	ENST00000435505.2	+	16	2261	c.1516T>G	c.(1516-1518)Ttt>Gtt	p.F506V	VRK2_ENST00000440705.2_Missense_Mutation_p.F483V|VRK2_ENST00000417641.2_3'UTR|VRK2_ENST00000340157.4_Missense_Mutation_p.F506V|FANCL_ENST00000403295.3_3'UTR|FANCL_ENST00000233741.4_3'UTR|FANCL_ENST00000402135.3_3'UTR|VRK2_ENST00000412104.2_3'UTR			Q86Y07	VRK2_HUMAN	vaccinia related kinase 2	506	Interaction with MAP3K7.				cellular response to oxidative stress (GO:0034599)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interleukin-1-mediated signaling pathway (GO:2000659)|regulation of MAPK cascade (GO:0043408)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.F506V(1)		endometrium(4)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)	24						TCTTGCTTTATTTTTTCTCTG	0.318																																					p.F483V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1447G	2						.						141.0	143.0	142.0					2																	58386817		2203	4300	6503	58240321	SO:0001583	missense	7444	exon13			AK058199	CCDS1859.1, CCDS46291.1, CCDS46292.1	2p16.1	2008-05-15			ENSG00000028116	ENSG00000028116			12719	protein-coding gene	gene with protein product		602169					Standard	NM_001130480		Approved		uc002rzv.3	Q86Y07	OTTHUMG00000129348	ENST00000435505.2:c.1516T>G	2.37:g.58386817T>G	ENSP00000408002:p.Phe506Val	Somatic		Capture	Illumina HiSeq	Phase_I	58240321	NM_001130482	B4DKL0|D6W5D4|D6W5D6|Q49AK9|Q53EU9|Q53S39|Q53S77|Q53TU1|Q86Y08|Q86Y09|Q86Y10|Q86Y11|Q86Y12|Q8IXI5|Q99987	Missense_Mutation	SNP	ENST00000435505.2	37	CCDS1859.1	.	.	.	.	.	.	.	.	.	.	T	15.67	2.902599	0.52227	.	.	ENSG00000028116	ENST00000435505;ENST00000340157;ENST00000440705	T;T;T	0.04917	3.53;3.53;3.53	6.16	4.95	0.65309	.	0.681687	0.14169	N	0.336844	T	0.04497	0.0123	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42172	-0.9467	10	0.87932	D	0	-2.9189	12.1733	0.54172	0.128:0.0:0.0:0.872	.	506	Q86Y07	VRK2_HUMAN	V	506;506;483	ENSP00000408002:F506V;ENSP00000342381:F506V;ENSP00000398323:F483V	ENSP00000342381:F506V	F	+	1	0	VRK2	58240321	0.983000	0.35010	0.980000	0.43619	0.739000	0.42172	3.491000	0.53252	2.367000	0.80283	0.528000	0.53228	TTT		VRK2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325304.2	NM_006296	
MOGS	7841	broad.mit.edu	37	2	74688817	74688817	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr2:74688817C>T	ENST00000233616.4	-	4	2261	c.2099G>A	c.(2098-2100)cGa>cAa	p.R700Q	MOGS_ENST00000462443.1_5'Flank|MOGS_ENST00000409065.1_3'UTR|MOGS_ENST00000452063.2_Missense_Mutation_p.R594Q	NM_006302.2	NP_006293.2	Q13724	MOGS_HUMAN	mannosyl-oligosaccharide glucosidase	700					cellular protein metabolic process (GO:0044267)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucosidase activity (GO:0015926)|mannosyl-oligosaccharide glucosidase activity (GO:0004573)	p.R700Q(1)		cervix(1)|endometrium(6)|large_intestine(3)|lung(10)|prostate(1)|urinary_tract(2)	23						GTCCAGCAGTCGCAGCAGCAA	0.617																																					p.R594Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1781A	2						.						65.0	77.0	73.0					2																	74688817		2026	4181	6207	74542325	SO:0001583	missense	7841	exon5			X87237	CCDS42700.1, CCDS54370.1	2p13.1	2012-01-31			ENSG00000115275	ENSG00000115275	3.2.1.106		24862	protein-coding gene	gene with protein product	"""glucosidase I"", ""processing A-glucosidase I"""	601336				7635146, 8786151	Standard	NM_006302		Approved	GCS1, CWH41, DER7	uc010ffj.3	Q13724	OTTHUMG00000152886	ENST00000233616.4:c.2099G>A	2.37:g.74688817C>T	ENSP00000233616:p.Arg700Gln	Somatic		Capture	Illumina HiSeq	Phase_I	74542325	NM_001146158	A8K938|F5H6D0|Q17RN9|Q8TCT5	Missense_Mutation	SNP	ENST00000233616.4	37	CCDS42700.1	.	.	.	.	.	.	.	.	.	.	C	0.085	-1.177173	0.01633	.	.	ENSG00000115275	ENST00000233616;ENST00000452063	T;T	0.41758	0.99;0.99	5.01	3.2	0.36748	Six-hairpin glycosidase-like (1);	0.250170	0.40222	N	0.001153	T	0.15609	0.0376	N	0.03967	-0.31	0.29795	N	0.83294	B	0.16396	0.017	B	0.12837	0.008	T	0.22836	-1.0205	10	0.08837	T	0.75	-10.4167	6.558	0.22471	0.0:0.7041:0.0:0.2959	.	700	Q13724	MOGS_HUMAN	Q	700;594	ENSP00000233616:R700Q;ENSP00000388201:R594Q	ENSP00000233616:R700Q	R	-	2	0	MOGS	74542325	1.000000	0.71417	0.492000	0.27490	0.829000	0.46940	3.367000	0.52350	0.696000	0.31696	-0.448000	0.05591	CGA		MOGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328382.1	NM_006302	
TSGA10	80705	broad.mit.edu	37	2	99636911	99636911	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr2:99636911A>G	ENST00000393483.3	-	18	2493	c.1649T>C	c.(1648-1650)aTt>aCt	p.I550T	TSGA10_ENST00000410001.1_Missense_Mutation_p.I550T|TSGA10_ENST00000355053.4_Missense_Mutation_p.I550T|TSGA10_ENST00000539964.1_Missense_Mutation_p.I550T	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10	550					cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)		p.I550T(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						CAGGAGTTCAATTTCAGAATG	0.373																																					p.I550T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1649C	2						.						52.0	51.0	51.0					2																	99636911		2203	4300	6503	99003343	SO:0001583	missense	80705	exon18			AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.1649T>C	2.37:g.99636911A>G	ENSP00000377123:p.Ile550Thr	Somatic		Capture	Illumina HiSeq	Phase_I	99003343	NM_025244	B7Z925|D3DVH7|Q8NEP0|Q9BWX0	Missense_Mutation	SNP	ENST00000393483.3	37	CCDS2037.1	.	.	.	.	.	.	.	.	.	.	A	16.11	3.029073	0.54790	.	.	ENSG00000135951	ENST00000393483;ENST00000410001;ENST00000355053;ENST00000539964;ENST00000409564;ENST00000393482	T;T;T;T;T;T	0.77877	2.56;2.56;2.56;2.56;-1.13;2.56	5.49	4.33	0.51752	.	0.000000	0.85682	D	0.000000	T	0.74215	0.3687	L	0.43152	1.355	0.39652	D	0.970478	P	0.51351	0.944	P	0.49999	0.628	T	0.71337	-0.4623	10	0.27082	T	0.32	-19.6474	9.5464	0.39284	0.8538:0.0:0.1462:0.0	.	550	Q9BZW7	TSG10_HUMAN	T	550;550;550;550;480;550	ENSP00000377123:I550T;ENSP00000386956:I550T;ENSP00000347161:I550T;ENSP00000444419:I550T;ENSP00000386508:I480T;ENSP00000377122:I550T	ENSP00000347161:I550T	I	-	2	0	TSGA10	99003343	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.892000	0.48625	1.089000	0.41292	0.528000	0.53228	ATT		TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253125.1	NM_182911	
GIGYF2	26058	broad.mit.edu	37	2	233681635	233681635	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr2:233681635C>T	ENST00000409547.1	+	22	2574	c.2263C>T	c.(2263-2265)Cga>Tga	p.R755*	GIGYF2_ENST00000409196.3_Nonsense_Mutation_p.R749*|GIGYF2_ENST00000409480.1_Nonsense_Mutation_p.R777*|GIGYF2_ENST00000452341.2_Nonsense_Mutation_p.R586*|GIGYF2_ENST00000409451.3_Nonsense_Mutation_p.R776*|GIGYF2_ENST00000373566.3_Nonsense_Mutation_p.R777*|GIGYF2_ENST00000373563.4_Nonsense_Mutation_p.R755*	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	755	Gln-rich.|Glu-rich.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.R755*(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		AGAGGAAGAGCGAAAGAGGCA	0.478																																					p.R749X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2245T	2						.						155.0	140.0	145.0					2																	233681635		2203	4300	6503	233389879	SO:0001587	stop_gained	26058	exon19			U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.2263C>T	2.37:g.233681635C>T	ENSP00000386537:p.Arg755*	Somatic		Capture	Illumina HiSeq	Phase_I	233389879	NM_001103148	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Nonsense_Mutation	SNP	ENST00000409547.1	37	CCDS33401.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.945982	0.73672	.	.	ENSG00000204120	ENST00000373566;ENST00000414511;ENST00000373563;ENST00000409480;ENST00000409547;ENST00000535418;ENST00000423659;ENST00000409196;ENST00000409451;ENST00000440945;ENST00000452341	.	.	.	3.89	1.91	0.25777	.	0.060381	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.7047	8.2865	0.31932	0.2045:0.7033:0.0:0.0922	.	.	.	.	X	777;698;755;777;755;755;698;749;776;749;586	.	ENSP00000362664:R755X	R	+	1	2	GIGYF2	233389879	1.000000	0.71417	0.992000	0.48379	0.112000	0.19704	2.279000	0.43435	0.986000	0.38683	-0.258000	0.10820	CGA		GIGYF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330316.2	NM_001103146	
DCLK3	85443	broad.mit.edu	37	3	36779763	36779763	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr3:36779763C>A	ENST00000416516.2	-	2	878	c.388G>T	c.(388-390)Gaa>Taa	p.E130*		NM_033403.1	NP_208382.1	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	130						cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.E130*(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	48						GAGGTCTTTTCAATCTCCACC	0.572																																					p.E130X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G388T	3						.						145.0	146.0	146.0					3																	36779763		1890	4115	6005	36754767	SO:0001587	stop_gained	85443	exon2			AB051552	CCDS43064.1	3p22.3	2007-04-02	2007-04-02	2007-04-02	ENSG00000163673	ENSG00000163673			19005	protein-coding gene	gene with protein product		613167	"""doublecortin and CaM kinase-like 3"""	DCAMKL3		11214970, 16869982	Standard	NM_033403		Approved	KIAA1765, DCDC3C	uc003cgi.2	Q9C098	OTTHUMG00000155805	ENST00000416516.2:c.388G>T	3.37:g.36779763C>A	ENSP00000394484:p.Glu130*	Somatic		Capture	Illumina HiSeq	Phase_I	36754767	NM_033403		Nonsense_Mutation	SNP	ENST00000416516.2	37	CCDS43064.1	.	.	.	.	.	.	.	.	.	.	C	39	7.776827	0.98483	.	.	ENSG00000163673	ENST00000416516	.	.	.	4.7	2.83	0.33086	.	0.254751	0.20568	N	0.089791	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	6.1919	0.20528	0.0:0.6776:0.1591:0.1633	.	.	.	.	X	130	.	ENSP00000394484:E130X	E	-	1	0	DCLK3	36754767	0.802000	0.28943	0.705000	0.30386	0.885000	0.51271	2.105000	0.41825	1.078000	0.41014	0.655000	0.94253	GAA		DCLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341727.1	XM_047355	
SCN5A	6331	broad.mit.edu	37	3	38597231	38597231	+	Silent	SNP	G	G	A			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr3:38597231G>A	ENST00000333535.4	-	26	4607	c.4458C>T	c.(4456-4458)ttC>ttT	p.F1486F	SCN5A_ENST00000449557.2_Silent_p.F1432F|SCN5A_ENST00000414099.2_Silent_p.F1468F|SCN5A_ENST00000443581.1_Silent_p.F1485F|SCN5A_ENST00000464652.1_5'Flank|SCN5A_ENST00000425664.1_Silent_p.F1468F|SCN5A_ENST00000450102.2_Silent_p.F1432F|SCN5A_ENST00000451551.2_Silent_p.F1432F|SCN5A_ENST00000413689.1_Silent_p.F1486F|SCN5A_ENST00000423572.2_Silent_p.F1485F|SCN5A_ENST00000455624.2_Silent_p.F1485F			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1486			F -> L (in LQT3).		AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)	p.F1486F(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	CCTCTGTCATGAAGATGTCCT	0.572																																					p.F1468F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4404T	3						.						99.0	106.0	104.0					3																	38597231		2203	4300	6503	38572235	SO:0001819	synonymous_variant	6331	exon25			AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.4458C>T	3.37:g.38597231G>A		Somatic		Capture	Illumina HiSeq	Phase_I	38572235	NM_001099405	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Silent	SNP	ENST00000333535.4	37	CCDS46796.1																																																																																				SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056	
MITF	4286	broad.mit.edu	37	3	69988260	69988260	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr3:69988260G>C	ENST00000448226.2	+	4	721	c.594G>C	c.(592-594)aaG>aaC	p.K198N	MITF_ENST00000328528.6_Missense_Mutation_p.K197N|MITF_ENST00000314589.5_Missense_Mutation_p.K182N|MITF_ENST00000352241.4_Missense_Mutation_p.K198N|MITF_ENST00000314557.6_Missense_Mutation_p.K91N|MITF_ENST00000472437.1_Missense_Mutation_p.K146N|MITF_ENST00000531774.1_Missense_Mutation_p.K35N|MITF_ENST00000394351.3_Missense_Mutation_p.K91N|MITF_ENST00000394355.2_Missense_Mutation_p.K173N			O75030	MITF_HUMAN	microphthalmia-associated transcription factor	198					bone remodeling (GO:0046849)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|melanocyte differentiation (GO:0030318)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)	p.K91N(1)		NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(6)|stomach(1)|urinary_tract(2)	30		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		GATTTTATAAGTTTGAAGAGC	0.438			A		melanoma		"""Waardenburg syndrome type 2, Tietz syndrome"""																														p.K91N	Melanoma(29;269 969 31479 41502 42961)		Dom	yes		3	3p14.1	4286	microphthalmia-associated transcription factor	yes	E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G273C	3						.						96.0	93.0	94.0					3																	69988260		2203	4300	6503	70070950	SO:0001583	missense	4286	exon3				CCDS2913.1, CCDS43106.1, CCDS43107.1, CCDS46865.1, CCDS46866.1, CCDS46866.2, CCDS54607.1, CCDS74962.1	3p14.1-p12.3	2014-09-17			ENSG00000187098	ENSG00000187098		"""Basic helix-loop-helix proteins"""	7105	protein-coding gene	gene with protein product	"""homolog of mouse microphthalmia"""	156845	"""Waardenburg syndrome, type 2A"""	WS2A, WS2		8069297, 7874167, 7951321	Standard	NM_198159		Approved	MI, bHLHe32	uc003dnz.3	O75030	OTTHUMG00000149921	ENST00000448226.2:c.594G>C	3.37:g.69988260G>C	ENSP00000391803:p.Lys198Asn	Somatic		Capture	Illumina HiSeq	Phase_I	70070950	NM_198158	B4DJL2|D3K197|E9PFN0|Q14841|Q9P2V0|Q9P2V1|Q9P2V2|Q9P2Y8	Missense_Mutation	SNP	ENST00000448226.2	37		.	.	.	.	.	.	.	.	.	.	G	12.23	1.874745	0.33069	.	.	ENSG00000187098	ENST00000352241;ENST00000448226;ENST00000433517;ENST00000472437;ENST00000328528;ENST00000451708;ENST00000314589;ENST00000394355;ENST00000314557;ENST00000394351;ENST00000531774	T;T;T;T;T;T;T;T;T;T	0.24538	2.67;2.19;2.45;2.67;1.85;2.66;2.67;2.44;1.86;2.42	5.99	0.153	0.14897	.	0.187157	0.36932	N	0.002336	T	0.16214	0.0390	N	0.08118	0	0.36938	D	0.892242	P;P;P;P;D;P;P	0.56035	0.808;0.589;0.589;0.936;0.974;0.936;0.893	B;B;B;P;P;P;B	0.50659	0.225;0.211;0.288;0.634;0.647;0.634;0.394	T	0.11690	-1.0577	9	.	.	.	.	10.2273	0.43233	0.5817:0.0:0.4183:0.0	.	146;91;91;173;182;197;198	E9PFN0;O75030-9;O75030-10;O75030-4;O75030-8;O75030-6;O75030-2	.;.;.;.;.;.;.	N	198;198;90;146;197;182;182;173;91;91;35	ENSP00000295600:K198N;ENSP00000391803:K198N;ENSP00000418845:K146N;ENSP00000327867:K197N;ENSP00000398639:K182N;ENSP00000324443:K182N;ENSP00000377884:K173N;ENSP00000324246:K91N;ENSP00000377880:K91N;ENSP00000435909:K35N	.	K	+	3	2	MITF	70070950	0.997000	0.39634	0.988000	0.46212	0.990000	0.78478	0.253000	0.18296	-0.265000	0.09352	-0.140000	0.14226	AAG		MITF-007	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000313947.1	NM_198159	
WDR49	151790	broad.mit.edu	37	3	167293922	167293922	+	Silent	SNP	A	A	G			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr3:167293922A>G	ENST00000308378.3	-	4	575	c.270T>C	c.(268-270)gaT>gaC	p.D90D	WDR49_ENST00000453925.2_Silent_p.D143D|WDR49_ENST00000479765.1_Silent_p.D431D|WDR49_ENST00000476376.1_5'Flank	NM_178824.3	NP_849146.1	Q8IV35	WDR49_HUMAN	WD repeat domain 49	90								p.D90D(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	50						GGTGTTGAATATCCCAGAGTC	0.388																																					p.D90D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T270C	3						.						67.0	64.0	65.0					3																	167293922		2203	4300	6503	168776616	SO:0001819	synonymous_variant	151790	exon4			AK097556	CCDS3201.1	3q26.1	2013-01-11			ENSG00000174776	ENSG00000174776		"""WD repeat domain containing"""	26587	protein-coding gene	gene with protein product						12477932	Standard	NM_178824		Approved	FLJ33620	uc003fev.1	Q8IV35	OTTHUMG00000158290	ENST00000308378.3:c.270T>C	3.37:g.167293922A>G		Somatic		Capture	Illumina HiSeq	Phase_I	168776616	NM_178824	Q8N297	Silent	SNP	ENST00000308378.3	37	CCDS3201.1	.	.	.	.	.	.	.	.	.	.	A	7.148	0.583281	0.13749	.	.	ENSG00000174776	ENST00000472600	.	.	.	5.76	3.09	0.35607	.	.	.	.	.	T	0.55049	0.1896	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49925	-0.8887	4	.	.	.	.	6.2961	0.21087	0.7212:0.0:0.2788:0.0	.	.	.	.	T	155	.	.	I	-	2	0	WDR49	168776616	1.000000	0.71417	0.999000	0.59377	0.845000	0.48019	0.900000	0.28431	1.041000	0.40125	0.529000	0.55759	ATA		WDR49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350592.3	NM_178824	
CORIN	10699	broad.mit.edu	37	4	47597796	47597796	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr4:47597796G>A	ENST00000273857.4	-	22	3070	c.3071C>T	c.(3070-3072)tCa>tTa	p.S1024L	CORIN_ENST00000502252.1_Missense_Mutation_p.S957L|CORIN_ENST00000508498.1_Missense_Mutation_p.S885L|CORIN_ENST00000505909.1_Missense_Mutation_p.S987L	NM_006587.2	NP_006578.2	Q9Y5Q5	CORIN_HUMAN	corin, serine peptidase	1024	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				female pregnancy (GO:0007565)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)	p.S1024L(1)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(18)|lung(39)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	79						GACGAAATATGACACATTACT	0.418																																					p.S1024L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3071T	4						.						80.0	84.0	83.0					4																	47597796		2203	4300	6503	47292553	SO:0001583	missense	10699	exon22			AF133845	CCDS3477.1, CCDS63958.1, CCDS75122.1	4p13-p12	2011-08-31	2005-08-17		ENSG00000145244	ENSG00000145244		"""Serine peptidases / Transmembrane"""	19012	protein-coding gene	gene with protein product		605236	"""corin, serine protease"""			10329693	Standard	NM_006587		Approved	PRSC, CRN, ATC2, Lrp4, TMPRSS10	uc003gxm.3	Q9Y5Q5	OTTHUMG00000099441	ENST00000273857.4:c.3071C>T	4.37:g.47597796G>A	ENSP00000273857:p.Ser1024Leu	Somatic		Capture	Illumina HiSeq	Phase_I	47292553	NM_006587	B0ZBE3|Q2TBD2|Q4W5E5|Q4W5G6|Q9UHY2	Missense_Mutation	SNP	ENST00000273857.4	37	CCDS3477.1	.	.	.	.	.	.	.	.	.	.	G	10.97	1.502076	0.26949	.	.	ENSG00000145244	ENST00000273857;ENST00000508498;ENST00000502252;ENST00000505909	D;D;D;D	0.89415	-2.51;-2.51;-2.51;-2.51	5.46	5.46	0.80206	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.161023	0.42682	D	0.000661	D	0.88254	0.6387	L	0.41415	1.275	0.80722	D	1	P;P	0.36909	0.573;0.488	B;B	0.44315	0.345;0.446	D	0.87089	0.2171	10	0.39692	T	0.17	.	17.4819	0.87674	0.0:0.0:1.0:0.0	.	957;1024	B4E1Y7;Q9Y5Q5	.;CORIN_HUMAN	L	1024;885;957;987	ENSP00000273857:S1024L;ENSP00000425597:S885L;ENSP00000424212:S957L;ENSP00000425401:S987L	ENSP00000273857:S1024L	S	-	2	0	CORIN	47292553	1.000000	0.71417	0.953000	0.39169	0.011000	0.07611	9.727000	0.98787	2.574000	0.86865	0.462000	0.41574	TCA		CORIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216906.2		
SGCB	6443	broad.mit.edu	37	4	52899746	52899746	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr4:52899746C>T	ENST00000381431.5	-	2	316	c.94G>A	c.(94-96)Gtc>Atc	p.V32I	SGCB_ENST00000535450.1_Intron	NM_000232.4	NP_000223.1	Q16585	SGCB_HUMAN	sarcoglycan, beta (43kDa dystrophin-associated glycoprotein)	32					cardiac muscle cell development (GO:0055013)|muscle fiber development (GO:0048747)|muscle organ development (GO:0007517)|vascular smooth muscle cell development (GO:0097084)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of plasma membrane (GO:0005887)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)		p.V32I(1)		breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(6)|prostate(1)	17			GBM - Glioblastoma multiforme(4;7.63e-12)|LUSC - Lung squamous cell carcinoma(32;0.00204)			TCTTTATTGACACTCCTTCTC	0.408																																					p.V32I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G94A	4						.						226.0	197.0	207.0					4																	52899746		2203	4300	6503	52594503	SO:0001583	missense	6443	exon2			U29586	CCDS3488.1	4q12	2014-09-17	2002-08-29		ENSG00000163069	ENSG00000163069			10806	protein-coding gene	gene with protein product		600900	"""sarcoglycan, beta (43kD dystrophin-associated glycoprotein)"""	LGMD2E		8968749	Standard	NM_000232		Approved	SGC, A3b	uc003gzj.2	Q16585	OTTHUMG00000128697	ENST00000381431.5:c.94G>A	4.37:g.52899746C>T	ENSP00000370839:p.Val32Ile	Somatic		Capture	Illumina HiSeq	Phase_I	52594503	NM_000232	B7Z635|O00661	Missense_Mutation	SNP	ENST00000381431.5	37	CCDS3488.1	.	.	.	.	.	.	.	.	.	.	C	8.513	0.866886	0.17250	.	.	ENSG00000163069	ENST00000381431	D	0.88818	-2.43	5.29	5.29	0.74685	.	0.174926	0.51477	D	0.000090	T	0.76456	0.3990	N	0.08118	0	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.71017	-0.4714	10	0.23302	T	0.38	-5.7478	11.4019	0.49875	0.0:0.9176:0.0:0.0824	.	32	Q16585	SGCB_HUMAN	I	32	ENSP00000370839:V32I	ENSP00000370839:V32I	V	-	1	0	SGCB	52594503	0.132000	0.22450	0.401000	0.26359	0.020000	0.10135	0.684000	0.25364	2.476000	0.83614	0.650000	0.86243	GTC		SGCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250596.2		
FAT4	79633	broad.mit.edu	37	4	126372252	126372252	+	Missense_Mutation	SNP	C	C	G	rs61163957		TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr4:126372252C>G	ENST00000394329.3	+	9	10094	c.10081C>G	c.(10081-10083)Ctt>Gtt	p.L3361V	FAT4_ENST00000335110.5_Missense_Mutation_p.L1659V	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3361	Cadherin 32. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L3361V(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TTCTGGAATTCTTGATCGAGA	0.403																																					p.L3361V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C10081G	4						.						117.0	120.0	119.0					4																	126372252		2203	4300	6503	126591702	SO:0001583	missense	79633	exon9			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.10081C>G	4.37:g.126372252C>G	ENSP00000377862:p.Leu3361Val	Somatic		Capture	Illumina HiSeq	Phase_I	126591702	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	C	12.15	1.852109	0.32699	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.73152	-0.72;-0.72	5.27	5.27	0.74061	Cadherin (4);Cadherin-like (1);	0.000000	0.31450	U	0.007623	D	0.83995	0.5375	M	0.71871	2.18	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.999	D;D;D	0.91635	0.996;0.999;0.994	D	0.85076	0.0943	10	0.59425	D	0.04	.	18.9292	0.92558	0.0:1.0:0.0:0.0	.	1659;3361;3361	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	V	3361;1659	ENSP00000377862:L3361V;ENSP00000335169:L1659V	ENSP00000335169:L1659V	L	+	1	0	FAT4	126591702	1.000000	0.71417	0.993000	0.49108	0.052000	0.14988	5.919000	0.70005	2.461000	0.83175	0.655000	0.94253	CTT		FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
APC	324	broad.mit.edu	37	5	112173917	112173917	+	Nonsense_Mutation	SNP	C	C	T	rs121913333		TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr5:112173917C>T	ENST00000457016.1	+	16	3006	c.2626C>T	c.(2626-2628)Cga>Tga	p.R876*	APC_ENST00000508376.2_Nonsense_Mutation_p.R876*|APC_ENST00000257430.4_Nonsense_Mutation_p.R876*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	876	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R876*(38)|p.S874_R876>*(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TTCTTCAAAGCGAGGTTTGCA	0.463		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R858X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Nonsense,0 	.	40	Substitution - Nonsense(38)|Unknown(1)|Complex - deletion inframe(1)	large_intestine(37)|lung(1)|breast(1)|skin(1)	c.C2572T	5	GRCh37	CM942020	APC	M	rs121913333	.						70.0	72.0	71.0					5																	112173917		2202	4300	6502	112201816	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2626C>T	5.37:g.112173917C>T	ENSP00000413133:p.Arg876*	Somatic		Capture	Illumina HiSeq	Phase_I	112201816	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	37	6.588996	0.97688	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.92	4.09	0.47781	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.2738	14.8639	0.70401	0.3912:0.6088:0.0:0.0	.	.	.	.	X	876;858;876;876;876	.	ENSP00000257430:R876X	R	+	1	2	APC	112201816	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.385000	0.34408	0.785000	0.33685	0.557000	0.71058	CGA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PCDHA1	56147	broad.mit.edu	37	5	140167397	140167397	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr5:140167397G>A	ENST00000504120.2	+	1	1522	c.1522G>A	c.(1522-1524)Gtg>Atg	p.V508M	PCDHA1_ENST00000394633.3_Missense_Mutation_p.V508M|PCDHA1_ENST00000378133.3_Missense_Mutation_p.V508M	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	508	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V508M(2)		breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTCGAACTACGTGTCAGTGCA	0.687																																					p.V508M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1522A	5						.						66.0	67.0	67.0					5																	140167397		2203	4300	6503	140147581	SO:0001583	missense	56147	exon1			AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.1522G>A	5.37:g.140167397G>A	ENSP00000420840:p.Val508Met	Somatic		Capture	Illumina HiSeq	Phase_I	140147581	NM_031410	O75288|Q9NRT7	Missense_Mutation	SNP	ENST00000504120.2	37	CCDS54913.1	.	.	.	.	.	.	.	.	.	.	g	15.95	2.983011	0.53827	.	.	ENSG00000204970	ENST00000504120;ENST00000394633;ENST00000378133	T;T;T	0.61392	0.11;0.11;0.11	3.63	3.63	0.41609	Cadherin (4);Cadherin-like (1);	0.000000	0.37304	U	0.002143	T	0.72187	0.3429	M	0.79926	2.475	0.23886	N	0.99657	D;D;D	0.89917	1.0;0.999;1.0	D;P;D	0.72338	0.977;0.889;0.964	T	0.62464	-0.6849	10	0.87932	D	0	.	7.469	0.27338	0.1995:0.0:0.8005:0.0	.	508;508;508	Q9Y5I3;Q9Y5I3-2;Q9Y5I3-3	PCDA1_HUMAN;.;.	M	508	ENSP00000420840:V508M;ENSP00000378129:V508M;ENSP00000367373:V508M	ENSP00000367373:V508M	V	+	1	0	PCDHA1	140147581	1.000000	0.71417	0.999000	0.59377	0.711000	0.40976	1.173000	0.31920	1.768000	0.52137	0.549000	0.68633	GTG		PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389127.1	NM_018900	
PCDH12	51294	broad.mit.edu	37	5	141325081	141325081	+	Silent	SNP	C	C	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr5:141325081C>T	ENST00000231484.3	-	4	4630	c.3420G>A	c.(3418-3420)tcG>tcA	p.S1140S		NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	1140					calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S1140S(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCCGCAGACCGAGAGCCGCC	0.637																																					p.S1140S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3420A	5						.						21.0	21.0	21.0					5																	141325081		2203	4300	6503	141305265	SO:0001819	synonymous_variant	51294	exon4			AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.3420G>A	5.37:g.141325081C>T		Somatic		Capture	Illumina HiSeq	Phase_I	141305265	NM_016580	Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Silent	SNP	ENST00000231484.3	37	CCDS4269.1																																																																																				PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251858.1	NM_016580	
RGS7BP	401190	broad.mit.edu	37	5	63871616	63871616	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr5:63871616G>T	ENST00000334025.2	+	3	674	c.348G>T	c.(346-348)gaG>gaT	p.E116D	RNU6-294P_ENST00000364999.1_RNA|RGS7BP_ENST00000508162.1_3'UTR	NM_001029875.1|NM_001271890.1|NM_001271891.1	NP_001025046.1|NP_001258819.1|NP_001258820.1	Q6MZT1	R7BP_HUMAN	regulator of G-protein signaling 7 binding protein	116					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of signal transduction (GO:0009968)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.E116D(1)		breast(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|stomach(1)	11		Lung NSC(810;0.000518)|Prostate(74;0.0435)|Ovarian(174;0.186)		Lung(70;0.147)		AAGATGGTGAGATCCATCCAG	0.448																																					p.E116D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G348T	5						.						90.0	87.0	88.0					5																	63871616		2203	4300	6503	63907372	SO:0001583	missense	401190	exon3			BX640900	CCDS34170.1	5q12.3	2008-02-05	2007-08-14		ENSG00000186479	ENSG00000186479			23271	protein-coding gene	gene with protein product		610890	"""regulator of G-protein signalling 7 binding protein"""			15632198	Standard	NM_001271890		Approved	R7BP	uc003jtj.4	Q6MZT1	OTTHUMG00000162293	ENST00000334025.2:c.348G>T	5.37:g.63871616G>T	ENSP00000334851:p.Glu116Asp	Somatic		Capture	Illumina HiSeq	Phase_I	63907372	NM_001029875	B7Z3X1	Missense_Mutation	SNP	ENST00000334025.2	37	CCDS34170.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.996745	0.74818	.	.	ENSG00000186479	ENST00000334025	T	0.36878	1.23	5.91	3.18	0.36537	.	0.000000	0.85682	D	0.000000	T	0.43964	0.1271	L	0.34521	1.04	0.47949	D	0.999551	D	0.61697	0.99	D	0.73380	0.98	T	0.19160	-1.0314	10	0.39692	T	0.17	-2.286	9.6994	0.40178	0.3234:0.0:0.6766:0.0	.	116	Q6MZT1	R7BP_HUMAN	D	116	ENSP00000334851:E116D	ENSP00000334851:E116D	E	+	3	2	RGS7BP	63907372	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.398000	0.34554	0.842000	0.35045	0.655000	0.94253	GAG		RGS7BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368464.1	NM_001029875	
RAD17	5884	broad.mit.edu	37	5	68680652	68680652	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr5:68680652G>T	ENST00000509734.1	+	7	1248	c.570G>T	c.(568-570)caG>caT	p.Q190H	RAD17_ENST00000282891.6_Missense_Mutation_p.Q93H|RAD17_ENST00000358030.2_Missense_Mutation_p.Q14H|RAD17_ENST00000345306.6_Missense_Mutation_p.Q179H|RAD17_ENST00000380774.3_Missense_Mutation_p.Q190H|RAD17_ENST00000354312.3_Missense_Mutation_p.Q179H|RAD17_ENST00000504177.1_Intron|RAD17_ENST00000361732.2_Missense_Mutation_p.Q179H|RAD17_ENST00000305138.4_Missense_Mutation_p.Q179H|RAD17_ENST00000521422.1_Missense_Mutation_p.Q14H|RAD17_ENST00000354868.5_Missense_Mutation_p.Q179H			O75943	RAD17_HUMAN	RAD17 homolog (S. pombe)	190					cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of DNA replication (GO:0008156)|regulation of phosphorylation (GO:0042325)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)	p.Q179H(1)					Lung NSC(167;5.19e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;9.36e-57)|Epithelial(20;1.21e-52)|all cancers(19;3.34e-48)|Lung(70;0.0183)		TTCCCTATCAGTCTCAGATAG	0.313								Other conserved DNA damage response genes																													p.Q93H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G279T	5						.						75.0	75.0	75.0					5																	68680652		2203	4300	6503	68716408	SO:0001583	missense	5884	exon5			AF085736	CCDS4003.1, CCDS4004.1, CCDS4005.1, CCDS47226.1	5q13	2010-09-24	2001-11-28		ENSG00000152942	ENSG00000152942			9807	protein-coding gene	gene with protein product		603139	"""RAD1 (S. pombe) homolog"""			9869296, 9660800	Standard	NM_133343		Approved	Rad24, RAD17Sp, CCYC	uc003jwo.3	O75943	OTTHUMG00000099357	ENST00000509734.1:c.570G>T	5.37:g.68680652G>T	ENSP00000426191:p.Gln190His	Somatic		Capture	Illumina HiSeq	Phase_I	68716408	NM_133341	A8K8X2|D3DWA5|O75714|Q7Z3S4|Q9UNK7|Q9UNR7|Q9UNR8|Q9UPF5	Missense_Mutation	SNP	ENST00000509734.1	37	CCDS4003.1	.	.	.	.	.	.	.	.	.	.	G	17.92	3.506714	0.64410	.	.	ENSG00000152942	ENST00000361732;ENST00000509734;ENST00000354868;ENST00000521422;ENST00000354312;ENST00000345306;ENST00000512785;ENST00000305138;ENST00000282891;ENST00000358030;ENST00000380774	T;T;T;T;T;T;T;T;T;T;T	0.23754	1.89;1.89;1.89;1.89;1.89;1.89;1.89;1.89;1.89;1.89;1.89	5.05	-1.09	0.09904	ATPase, AAA+ type, core (1);	0.178511	0.51477	D	0.000083	T	0.40619	0.1124	M	0.78637	2.42	0.34823	D	0.738928	P;D;P	0.54397	0.536;0.966;0.941	B;P;P	0.58970	0.396;0.849;0.849	T	0.51560	-0.8690	10	0.42905	T	0.14	-6.611	9.8064	0.40795	0.4258:0.0:0.5742:0.0	.	190;93;179	O75943;O75943-4;O75943-2	RAD17_HUMAN;.;.	H	179;190;179;14;179;179;14;179;93;14;190	ENSP00000355226:Q179H;ENSP00000426191:Q190H;ENSP00000346938:Q179H;ENSP00000427743:Q14H;ENSP00000346271:Q179H;ENSP00000311227:Q179H;ENSP00000427673:Q14H;ENSP00000303134:Q179H;ENSP00000282891:Q93H;ENSP00000350725:Q14H;ENSP00000370151:Q190H	ENSP00000282891:Q93H	Q	+	3	2	RAD17	68716408	1.000000	0.71417	0.985000	0.45067	0.970000	0.65996	1.034000	0.30204	-0.186000	0.10533	0.305000	0.20034	CAG		RAD17-008	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369171.1	NM_133344	
POU4F3	5459	broad.mit.edu	37	5	145719863	145719863	+	Silent	SNP	C	C	G			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr5:145719863C>G	ENST00000230732.4	+	2	962	c.873C>G	c.(871-873)gcC>gcG	p.A291A	CTC-359M8.1_ENST00000515598.1_RNA	NM_002700.2	NP_002691.1	Q15319	PO4F3_HUMAN	POU class 4 homeobox 3	291					auditory receptor cell differentiation (GO:0042491)|axon extension (GO:0048675)|inner ear morphogenesis (GO:0042472)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A291A(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CACTCGAGGCCTATTTCGCTA	0.562																																					p.A291A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C873G	5						.						51.0	50.0	50.0					5																	145719863		2203	4300	6503	145700056	SO:0001819	synonymous_variant	5459	exon2			U10060	CCDS4281.1	5q32	2011-06-20	2007-07-13		ENSG00000091010	ENSG00000091010		"""Homeoboxes / POU class"""	9220	protein-coding gene	gene with protein product		602460	"""POU domain class 4, transcription factor 3"""	DFNA15		9506947	Standard	NM_002700		Approved	BRN3C	uc003loa.2	Q15319	OTTHUMG00000129684	ENST00000230732.4:c.873C>G	5.37:g.145719863C>G		Somatic		Capture	Illumina HiSeq	Phase_I	145700056	NM_002700	O60557|Q2M3F8	Silent	SNP	ENST00000230732.4	37	CCDS4281.1																																																																																				POU4F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251887.2	NM_002700	
GPR126	57211	broad.mit.edu	37	6	142688889	142688889	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr6:142688889A>C	ENST00000230173.6	+	3	763	c.287A>C	c.(286-288)tAt>tCt	p.Y96S	GPR126_ENST00000545477.1_3'UTR|GPR126_ENST00000367608.2_Missense_Mutation_p.Y96S|GPR126_ENST00000296932.8_Missense_Mutation_p.Y96S|GPR126_ENST00000367609.3_Missense_Mutation_p.Y96S	NM_020455.5	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126	96	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.Y95S(1)|p.Y96S(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(12)|lung(10)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		AATTGCATTTATGACTCATTA	0.438																																					p.Y96S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A287C	6						.						79.0	79.0	79.0					6																	142688889		1862	4103	5965	142730582	SO:0001583	missense	57211	exon3			AK027843	CCDS47489.1, CCDS47490.1, CCDS47491.1, CCDS55064.1	6q23.1-q24.3	2014-08-08			ENSG00000112414	ENSG00000112414		"""-"", ""GPCR / Class B : Orphans"""	13841	protein-coding gene	gene with protein product		612243				12565841	Standard	NM_001032395		Approved	FLJ14937	uc010khe.3	Q86SQ4	OTTHUMG00000015709	ENST00000230173.6:c.287A>C	6.37:g.142688889A>C	ENSP00000230173:p.Tyr96Ser	Somatic		Capture	Illumina HiSeq	Phase_I	142730582	NM_001032394	Q5TGN7|Q6DHZ4|Q6F3F5|Q6F3F6|Q6F3F7|Q6F3F8|Q6MZU7|Q8IXA4|Q8NC14|Q96JW0	Missense_Mutation	SNP	ENST00000230173.6	37	CCDS47490.1	.	.	.	.	.	.	.	.	.	.	A	26.5	4.743865	0.89663	.	.	ENSG00000112414	ENST00000230173;ENST00000367608;ENST00000296932;ENST00000367609;ENST00000541199;ENST00000435011	T;T;T;T;T;T	0.20069	2.1;2.1;2.1;2.1;2.1;2.1	6.06	6.06	0.98353	CUB (5);	0.000000	0.64402	D	0.000011	T	0.37183	0.0994	M	0.64630	1.985	0.54753	D	0.999985	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;0.999;1.0;0.999	T	0.18650	-1.0330	10	0.87932	D	0	.	16.6245	0.84952	1.0:0.0:0.0:0.0	.	96;96;96;96;95	Q86SQ4-4;Q86SQ4-3;Q86SQ4-2;Q86SQ4;F5H2L1	.;.;.;GP126_HUMAN;.	S	96;96;96;96;95;96	ENSP00000230173:Y96S;ENSP00000356580:Y96S;ENSP00000296932:Y96S;ENSP00000356581:Y96S;ENSP00000446287:Y95S;ENSP00000438366:Y96S	ENSP00000230173:Y96S	Y	+	2	0	GPR126	142730582	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.962000	0.93254	2.323000	0.78572	0.528000	0.53228	TAT		GPR126-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042487.2		
TAGAP	117289	broad.mit.edu	37	6	159456927	159456927	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr6:159456927C>T	ENST00000367066.3	-	10	2459	c.2128G>A	c.(2128-2130)Gtg>Atg	p.V710M	TAGAP_ENST00000326965.6_Missense_Mutation_p.V532M|RP1-111C20.4_ENST00000607391.1_RNA|RP1-111C20.4_ENST00000606466.1_RNA|RP1-111C20.4_ENST00000606470.1_RNA|RP1-111C20.4_ENST00000607796.1_RNA	NM_001278733.1|NM_054114.3	NP_001265662.1|NP_473455.2	Q8N103	TAGAP_HUMAN	T-cell activation RhoGTPase activating protein	710					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.V710M(1)		NS(1)|autonomic_ganglia(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(2)|skin(1)	23		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-16)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		CATCGTCGCACGAGACAGTCC	0.577																																					p.V710M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2128A	6						.						70.0	64.0	66.0					6																	159456927		2203	4300	6503	159376915	SO:0001583	missense	117289	exon10			AF385429	CCDS5261.1, CCDS5262.1, CCDS5263.1	6q25.3	2011-09-07	2008-03-25		ENSG00000164691	ENSG00000164691		"""Rho GTPase activating proteins"""	15669	protein-coding gene	gene with protein product		609667	"""T-cell activation GTPase activating protein"""			16375659, 18311140, 18356936	Standard	NM_152133		Approved	FLJ32631, IDDM21, ARHGAP47	uc003qrz.3	Q8N103	OTTHUMG00000015923	ENST00000367066.3:c.2128G>A	6.37:g.159456927C>T	ENSP00000356033:p.Val710Met	Somatic		Capture	Illumina HiSeq	Phase_I	159376915	NM_054114	Q2NKM8|Q8NI40|Q96KZ2|Q96QA2	Missense_Mutation	SNP	ENST00000367066.3	37	CCDS5261.1	.	.	.	.	.	.	.	.	.	.	C	9.424	1.083896	0.20309	.	.	ENSG00000164691	ENST00000367066;ENST00000326965	T;T	0.17370	2.28;2.54	5.82	-7.41	0.01392	.	1.853500	0.02343	N	0.075080	T	0.04137	0.0115	L	0.44542	1.39	0.09310	N	1	B	0.30851	0.297	B	0.14023	0.01	T	0.07328	-1.0778	10	0.46703	T	0.11	-0.4464	10.7124	0.45990	0.0:0.5576:0.2347:0.2077	.	710	Q8N103	TAGAP_HUMAN	M	710;532	ENSP00000356033:V710M;ENSP00000322650:V532M	ENSP00000322650:V532M	V	-	1	0	TAGAP	159376915	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.278000	0.08490	-1.905000	0.01090	-2.611000	0.00159	GTG		TAGAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042890.1	NM_054114	
HIST1H1B	3009	broad.mit.edu	37	6	27835017	27835017	+	Silent	SNP	C	C	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr6:27835017C>T	ENST00000331442.3	-	1	342	c.291G>A	c.(289-291)gtG>gtA	p.V97V		NM_005322.2	NP_005313.1	P16401	H15_HUMAN	histone cluster 1, H1b	97	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				chromatin organization (GO:0006325)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|positive regulation of cell growth (GO:0030307)|positive regulation of histone H3-K9 methylation (GO:0051574)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)	p.V97V(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(12)|prostate(2)|upper_aerodigestive_tract(2)	24						CCTTGGTCTGCACCAGGGTGC	0.587																																					p.V97V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G291A	6						.						126.0	137.0	133.0					6																	27835017		2203	4300	6503	27942996	SO:0001819	synonymous_variant	3009	exon1			AF531304	CCDS4635.1	6p22.1	2012-05-04	2006-10-11	2003-02-14	ENSG00000184357	ENSG00000184357		"""Histones / Replication-dependent"""	4719	protein-coding gene	gene with protein product		142711	"""H1 histone family, member 5"", ""histone 1, H1b"""	H1F5		9031620, 9119399, 12408966	Standard	NM_005322		Approved	H1.5, H1b, H1s-3	uc003njx.3	P16401	OTTHUMG00000016139	ENST00000331442.3:c.291G>A	6.37:g.27835017C>T		Somatic		Capture	Illumina HiSeq	Phase_I	27942996	NM_005322	Q14529|Q3MJ42	Silent	SNP	ENST00000331442.3	37	CCDS4635.1																																																																																				HIST1H1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043371.1	NM_005322	
NOTCH4	4855	broad.mit.edu	37	6	32187428	32187428	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr6:32187428C>T	ENST00000375023.3	-	8	1589	c.1451G>A	c.(1450-1452)tGc>tAc	p.C484Y		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	484	EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)	p.C484Y(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						TCCTGGGTGGCAGGGCTGGGA	0.607																																					p.Q484Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1451A	6						.						93.0	65.0	75.0					6																	32187428		1510	2709	4219	32295406	SO:0001583	missense	4855	exon8				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.1451G>A	6.37:g.32187428C>T	ENSP00000364163:p.Cys484Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	32295406	NM_004557	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	ENST00000375023.3	37	CCDS34420.1	.	.	.	.	.	.	.	.	.	.	C	18.34	3.602829	0.66445	.	.	ENSG00000204301	ENST00000375023	D	0.94828	-3.53	4.0	4.0	0.46444	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.45606	D	0.000356	D	0.98535	0.9511	H	0.99740	4.74	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98824	1.0748	10	0.87932	D	0	.	13.6604	0.62363	0.0:1.0:0.0:0.0	.	484;484	Q6P3V5;Q99466	.;NOTC4_HUMAN	Y	484	ENSP00000364163:C484Y	ENSP00000364163:C484Y	C	-	2	0	NOTCH4	32295406	1.000000	0.71417	1.000000	0.80357	0.683000	0.39861	7.140000	0.77322	2.069000	0.61940	0.455000	0.32223	TGC		NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2		
NFYA	4800	broad.mit.edu	37	6	41059354	41059354	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr6:41059354C>G	ENST00000341376.6	+	7	836	c.635C>G	c.(634-636)aCa>aGa	p.T212R	NFYA_ENST00000353205.5_Missense_Mutation_p.T183R|OARD1_ENST00000480585.1_Intron	NM_002505.4	NP_002496.1	P23511	NFYA_HUMAN	nuclear transcription factor Y, alpha	212					cellular lipid metabolic process (GO:0044255)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription from RNA polymerase II promoter (GO:0006366)	CCAAT-binding factor complex (GO:0016602)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T212R(1)		cervix(1)|endometrium(1)|large_intestine(4)|lung(2)|urinary_tract(1)	9	Ovarian(28;0.0418)|Colorectal(47;0.196)					AATACCAACACAACCAGCAGT	0.468																																					p.T212R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C635G	6						.						213.0	177.0	189.0					6																	41059354		2203	4300	6503	41167332	SO:0001583	missense	4800	exon7				CCDS4849.1, CCDS4850.1	6p21.3	2008-11-11			ENSG00000001167	ENSG00000001167			7804	protein-coding gene	gene with protein product		189903				1774067, 9612081	Standard	NM_002505		Approved	HAP2, CBF-B, NF-YA	uc003opo.3	P23511	OTTHUMG00000014669	ENST00000341376.6:c.635C>G	6.37:g.41059354C>G	ENSP00000345702:p.Thr212Arg	Somatic		Capture	Illumina HiSeq	Phase_I	41167332	NM_002505	Q8IXU0	Missense_Mutation	SNP	ENST00000341376.6	37	CCDS4849.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.901261	0.92035	.	.	ENSG00000001167	ENST00000341376;ENST00000353205	.	.	.	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.70605	0.3243	L	0.51422	1.61	0.80722	D	1	D;D	0.69078	0.997;0.995	D;D	0.78314	0.991;0.979	T	0.67067	-0.5764	9	0.41790	T	0.15	-15.4413	19.1684	0.93567	0.0:1.0:0.0:0.0	.	183;212	P23511-2;P23511	.;NFYA_HUMAN	R	212;183	.	ENSP00000345702:T212R	T	+	2	0	NFYA	41167332	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.734000	0.84928	2.777000	0.95525	0.655000	0.94253	ACA		NFYA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040496.1		
TCTE1	202500	broad.mit.edu	37	6	44250254	44250254	+	Missense_Mutation	SNP	G	G	A	rs112092930		TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr6:44250254G>A	ENST00000371505.4	-	4	1011	c.889C>T	c.(889-891)Cgc>Tgc	p.R297C	TMEM151B_ENST00000438774.2_Intron|TCTE1_ENST00000371503.3_Intron|RP11-444E17.6_ENST00000505802.1_Intron|TCTE1_ENST00000371504.1_Intron	NM_182539.3	NP_872345.2	Q5JU00	TCTE1_HUMAN	t-complex-associated-testis-expressed 1	297								p.R297C(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			ATTATGATGCGTGCCTTGTCA	0.562																																					p.R297C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C889T	6						.						113.0	100.0	105.0					6																	44250254		2203	4300	6503	44358232	SO:0001583	missense	202500	exon4			BC035022	CCDS4910.1	6q21.1	2014-07-18			ENSG00000146221	ENSG00000146221			11693	protein-coding gene	gene with protein product		186975				2568335, 8646886	Standard	NM_182539		Approved	D6S46, MGC33600, FAP155	uc003oxi.2	Q5JU00	OTTHUMG00000014763	ENST00000371505.4:c.889C>T	6.37:g.44250254G>A	ENSP00000360560:p.Arg297Cys	Somatic		Capture	Illumina HiSeq	Phase_I	44358232	NM_182539	B4DX59|Q8IYS6	Missense_Mutation	SNP	ENST00000371505.4	37	CCDS4910.1	.	.	.	.	.	.	.	.	.	.	G	8.982	0.975525	0.18736	.	.	ENSG00000146221	ENST00000371505	T	0.53857	0.6	5.37	5.37	0.77165	.	0.169046	0.51477	D	0.000093	T	0.29684	0.0741	L	0.58354	1.805	0.80722	D	1	P	0.35107	0.484	B	0.25291	0.059	T	0.34825	-0.9813	10	0.49607	T	0.09	-53.6838	8.815	0.34989	0.0774:0.0:0.7625:0.1601	.	297	Q5JU00	TCTE1_HUMAN	C	297	ENSP00000360560:R297C	ENSP00000360560:R297C	R	-	1	0	TCTE1	44358232	1.000000	0.71417	0.989000	0.46669	0.108000	0.19459	4.388000	0.59633	2.695000	0.91970	0.455000	0.32223	CGC		TCTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040736.1	NM_182539	
BAI3	577	broad.mit.edu	37	6	70071001	70071001	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr6:70071001G>T	ENST00000370598.1	+	29	4657	c.3836G>T	c.(3835-3837)aGa>aTa	p.R1279I	BAI3_ENST00000546190.1_Missense_Mutation_p.R243I|BAI3_ENST00000238918.8_Missense_Mutation_p.R485I	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1279					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R1279I(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				GAATTGCGGAGAACTGTGTAC	0.413																																					p.R1279I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3836T	6						.						89.0	85.0	86.0					6																	70071001		2203	4298	6501	70127722	SO:0001583	missense	577	exon29			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.3836G>T	6.37:g.70071001G>T	ENSP00000359630:p.Arg1279Ile	Somatic		Capture	Illumina HiSeq	Phase_I	70127722	NM_001704	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.184372	0.78677	.	.	ENSG00000135298	ENST00000370598;ENST00000238918;ENST00000546190	T;T;T	0.10763	2.84;2.84;2.84	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.21307	0.0513	L	0.47716	1.5	0.80722	D	1	D;D	0.65815	0.995;0.972	D;P	0.75484	0.986;0.549	T	0.00724	-1.1593	10	0.66056	D	0.02	.	19.3944	0.94601	0.0:0.0:1.0:0.0	.	485;1279	B7Z356;O60242	.;BAI3_HUMAN	I	1279;485;243	ENSP00000359630:R1279I;ENSP00000238918:R485I;ENSP00000441821:R243I	ENSP00000238918:R485I	R	+	2	0	BAI3	70127722	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	9.174000	0.94824	2.665000	0.90641	0.591000	0.81541	AGA		BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1		
FILIP1	27145	broad.mit.edu	37	6	76023352	76023352	+	Silent	SNP	G	G	A			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr6:76023352G>A	ENST00000237172.7	-	5	2526	c.2196C>T	c.(2194-2196)caC>caT	p.H732H	FILIP1_ENST00000393004.2_Silent_p.H732H|FILIP1_ENST00000498523.1_5'UTR|FILIP1_ENST00000370020.1_Silent_p.H633H	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	732								p.H732H(1)		breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						TCATTAATTCGTGAATCTTCT	0.373																																					p.H732H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2196T	6						.						112.0	118.0	116.0					6																	76023352		2203	4300	6503	76080072	SO:0001819	synonymous_variant	27145	exon5			AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.2196C>T	6.37:g.76023352G>A		Somatic		Capture	Illumina HiSeq	Phase_I	76080072	NM_015687	B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Silent	SNP	ENST00000237172.7	37	CCDS4984.1																																																																																				FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041263.1	XM_029179	
PDE10A	10846	broad.mit.edu	37	6	165848819	165848819	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr6:165848819C>T	ENST00000366882.1	-	7	567	c.413G>A	c.(412-414)cGc>cAc	p.R138H	PDE10A_ENST00000354448.4_Missense_Mutation_p.R138H|PDE10A_ENST00000539869.2_Missense_Mutation_p.R148H			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	138	GAF 1.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)	p.R138H(1)		breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	AGGGATGAGGCGGGGTTTTCC	0.488																																					p.R138H	Esophageal Squamous(22;308 615 5753 12038 40624)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G413A	6						.						146.0	125.0	132.0					6																	165848819		2203	4300	6503	165768809	SO:0001583	missense	10846	exon7			AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.413G>A	6.37:g.165848819C>T	ENSP00000355847:p.Arg138His	Somatic		Capture	Illumina HiSeq	Phase_I	165768809	NM_006661	Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	ENST00000366882.1	37		.	.	.	.	.	.	.	.	.	.	C	16.42	3.118205	0.56505	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	T;T	0.69306	-0.39;-0.39	5.32	2.57	0.30868	GAF (1);	0.473990	0.25535	N	0.030018	T	0.36441	0.0967	L	0.38175	1.15	0.21527	N	0.999651	P;P	0.52842	0.66;0.956	B;P	0.47102	0.149;0.537	T	0.28713	-1.0035	10	0.45353	T	0.12	.	2.4185	0.04442	0.1336:0.5251:0.1293:0.212	.	148;138	Q9ULW9;Q9Y233	.;PDE10_HUMAN	H	138;166;148;138;137	ENSP00000355847:R138H;ENSP00000346435:R138H	ENSP00000341187:R148H	R	-	2	0	PDE10A	165768809	0.001000	0.12720	0.070000	0.20053	0.702000	0.40608	0.827000	0.27421	0.321000	0.23259	0.460000	0.39030	CGC		PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1		
PUS7	54517	broad.mit.edu	37	7	105135670	105135670	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr7:105135670C>T	ENST00000356362.2	-	6	975	c.761G>A	c.(760-762)aGg>aAg	p.R254K	PUS7_ENST00000469408.1_Missense_Mutation_p.R254K	NM_019042.3	NP_061915.2	Q96PZ0	PUS7_HUMAN	pseudouridylate synthase 7 (putative)	254					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)	p.R254K(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(8)|pancreas(1)|skin(1)	23						GTAACTTCCCCTAGATTTTGG	0.328																																					p.R254K	Colon(138;2387 3051 17860)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G761A	7						.						201.0	204.0	203.0					7																	105135670		2203	4300	6503	104922906	SO:0001583	missense	54517	exon6			AK128629	CCDS34725.1	7q22.3	2014-02-14	2014-02-14		ENSG00000091127	ENSG00000091127			26033	protein-coding gene	gene with protein product			"""pseudouridylate synthase 7 homolog (S. cerevisiae)"""			11572484	Standard	NM_019042		Approved	FLJ20485	uc003vcx.3	Q96PZ0	OTTHUMG00000157399	ENST00000356362.2:c.761G>A	7.37:g.105135670C>T	ENSP00000348722:p.Arg254Lys	Somatic		Capture	Illumina HiSeq	Phase_I	104922906	NM_019042	Q75MG4|Q9NX19	Missense_Mutation	SNP	ENST00000356362.2	37	CCDS34725.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.018237	0.93404	.	.	ENSG00000091127	ENST00000356362;ENST00000544995;ENST00000469408	T;T	0.41065	1.01;1.01	5.35	5.35	0.76521	Pseudouridine synthase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.42200	0.1192	L	0.43701	1.375	0.58432	D	0.999999	D;P	0.58970	0.984;0.843	P;B	0.49561	0.615;0.336	T	0.21552	-1.0242	10	0.06494	T	0.89	-11.54	18.0541	0.89358	0.0:1.0:0.0:0.0	.	254;254	B3KY42;Q96PZ0	.;PUS7_HUMAN	K	254	ENSP00000348722:R254K;ENSP00000417402:R254K	ENSP00000348722:R254K	R	-	2	0	PUS7	104922906	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.280000	0.78610	2.505000	0.84491	0.650000	0.86243	AGG		PUS7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348681.1	NM_019042	
PTPRZ1	5803	broad.mit.edu	37	7	121651200	121651200	+	Silent	SNP	A	A	C			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr7:121651200A>C	ENST00000393386.2	+	12	2511	c.2100A>C	c.(2098-2100)tcA>tcC	p.S700S	PTPRZ1_ENST00000449182.1_Silent_p.S700S	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	700					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.S700S(2)		NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						CAGTGATGTCACAGGGTCCCT	0.468																																					p.S700S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A2100C	7						.						111.0	94.0	100.0					7																	121651200		2203	4300	6503	121438436	SO:0001819	synonymous_variant	5803	exon12			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.2100A>C	7.37:g.121651200A>C		Somatic		Capture	Illumina HiSeq	Phase_I	121438436	NM_002851	A4D0W5|C9JFM0|O76043|Q9UDR6	Silent	SNP	ENST00000393386.2	37	CCDS34740.1																																																																																				PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851	
RNF148	378925	broad.mit.edu	37	7	122342770	122342770	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr7:122342770C>T	ENST00000434824.1	-	1	251	c.35G>A	c.(34-36)aGt>aAt	p.S12N	CADPS2_ENST00000313070.7_Intron|CADPS2_ENST00000412584.2_Intron|RNF148_ENST00000447240.1_Missense_Mutation_p.S12N|CADPS2_ENST00000334010.7_Intron|CADPS2_ENST00000449022.2_Intron	NM_198085.1	NP_932351.1	Q8N7C7	RN148_HUMAN	ring finger protein 148	12						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)	p.S12N(1)		endometrium(2)|kidney(1)|large_intestine(6)|lung(7)	16						TGAAACAGAACTATGCGTCGA	0.383																																					p.S12N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G35A	7						.						36.0	31.0	33.0					7																	122342770		1863	4094	5957	122130006	SO:0001583	missense	378925	exon1			BC029264	CCDS47692.1	7q31.33	2013-01-09			ENSG00000235631	ENSG00000235631		"""RING-type (C3HC4) zinc fingers"""	22411	protein-coding gene	gene with protein product						8744354	Standard	NM_198085		Approved	MGC35222	uc003vkk.1	Q8N7C7	OTTHUMG00000157099	ENST00000434824.1:c.35G>A	7.37:g.122342770C>T	ENSP00000388207:p.Ser12Asn	Somatic		Capture	Illumina HiSeq	Phase_I	122130006	NM_198085	A4D0X4|Q8N308	Missense_Mutation	SNP	ENST00000434824.1	37	CCDS47692.1	.	.	.	.	.	.	.	.	.	.	C	0.432	-0.902940	0.02453	.	.	ENSG00000235631	ENST00000434824;ENST00000447240	T	0.04360	3.64	5.4	1.18	0.20946	.	.	.	.	.	T	0.03011	0.0089	L	0.27053	0.805	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.001	T	0.48948	-0.8989	9	0.12766	T	0.61	.	4.1241	0.10119	0.3168:0.4975:0.0:0.1857	.	12;12	C9JVJ0;Q8N7C7	.;RN148_HUMAN	N	12	ENSP00000388207:S12N	ENSP00000388207:S12N	S	-	2	0	RNF148	122130006	0.000000	0.05858	0.001000	0.08648	0.046000	0.14306	-0.083000	0.11286	0.216000	0.20781	0.555000	0.69702	AGT		RNF148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347424.1	NM_198085	
MACC1	346389	broad.mit.edu	37	7	20198970	20198970	+	Silent	SNP	G	G	A	rs535443647		TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr7:20198970G>A	ENST00000400331.5	-	5	1322	c.1014C>T	c.(1012-1014)atC>atT	p.I338I	MACC1_ENST00000589011.1_Silent_p.I338I|MACC1_ENST00000332878.4_Silent_p.I338I	NM_182762.3	NP_877439.3	Q6ZN28	MACC1_HUMAN	metastasis associated in colon cancer 1	338					positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.I338I(1)		endometrium(1)|kidney(1)|large_intestine(15)|lung(12)|ovary(2)|prostate(1)|skin(3)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(1)	39						GACTCAAGTCGATTAGCTTGA	0.418													G|||	1	0.000199681	0.0	0.0	5008	,	,		20577	0.0		0.0	False		,,,				2504	0.001				p.I338I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1014T	7						.						62.0	58.0	60.0					7																	20198970		2203	4300	6503	20165495	SO:0001819	synonymous_variant	346389	exon5				CCDS5369.1	7p15.3	2008-10-14			ENSG00000183742	ENSG00000183742			30215	protein-coding gene	gene with protein product		612646					Standard	NM_182762		Approved	7A5, SH3BP4L	uc003sus.4	Q6ZN28	OTTHUMG00000128415	ENST00000400331.5:c.1014C>T	7.37:g.20198970G>A		Somatic		Capture	Illumina HiSeq	Phase_I	20165495	NM_182762	A8MUS5|B2RNR9|Q6ZQN8|Q7Z5A5	Silent	SNP	ENST00000400331.5	37	CCDS5369.1																																																																																				MACC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250202.5	NM_182762	
ZNF117	51351	broad.mit.edu	37	7	64438652	64438652	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr7:64438652T>C	ENST00000282869.6	-	4	2581	c.1297A>G	c.(1297-1299)Att>Gtt	p.I433V		NM_015852.3	NP_056936.2	Q03924	ZN117_HUMAN	zinc finger protein 117	433					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.I433V(1)		breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|prostate(1)|skin(1)	22		Lung NSC(55;0.0295)|all_lung(88;0.0691)				TTATGTCCAATAAGGGTTGAA	0.353																																					p.I433V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1297G	7						.						65.0	68.0	67.0					7																	64438652		2102	4254	6356	64076087	SO:0001583	missense	51351	exon4			M27879	CCDS43593.1	7q11.2	2013-01-08	2006-06-12		ENSG00000152926	ENSG00000152926		"""Zinc fingers, C2H2-type"""	12897	protein-coding gene	gene with protein product		194624	"""zinc finger protein 117 (HPF9)"""			1427907	Standard	NM_015852		Approved	HPF9, H-plk	uc003ttr.2	Q03924	OTTHUMG00000156631	ENST00000282869.6:c.1297A>G	7.37:g.64438652T>C	ENSP00000282869:p.Ile433Val	Somatic		Capture	Illumina HiSeq	Phase_I	64076087	NM_015852	Q02313|Q7Z7Q7	Missense_Mutation	SNP	ENST00000282869.6	37	CCDS43593.1	.	.	.	.	.	.	.	.	.	.	.	4.859	0.159682	0.09287	.	.	ENSG00000152926	ENST00000282869	T	0.07216	3.21	1.1	1.1	0.20463	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03783	0.0107	N	0.04655	-0.195	0.09310	N	1	B	0.14012	0.009	B	0.21151	0.033	T	0.40627	-0.9553	9	0.56958	D	0.05	.	4.2658	0.10763	0.0:0.0:0.0:1.0	.	433	Q03924	ZN117_HUMAN	V	433	ENSP00000282869:I433V	ENSP00000282869:I433V	I	-	1	0	ZNF117	64076087	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-0.053000	0.11846	0.432000	0.26286	0.255000	0.18592	ATT		ZNF117-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344863.3	NM_024498	
ZNF804B	219578	broad.mit.edu	37	7	88964664	88964664	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr7:88964664T>A	ENST00000333190.4	+	4	2977	c.2368T>A	c.(2368-2370)Tca>Aca	p.S790T		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	790							metal ion binding (GO:0046872)	p.S790T(1)		NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			ATTGTGGGAATCATTTAAAAA	0.358										HNSCC(36;0.09)																											p.S790T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2368A	7						.						44.0	42.0	43.0					7																	88964664		2203	4300	6503	88802600	SO:0001583	missense	219578	exon4			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.2368T>A	7.37:g.88964664T>A	ENSP00000329638:p.Ser790Thr	Somatic		Capture	Illumina HiSeq	Phase_I	88802600	NM_181646	B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	37	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	T	8.991	0.977646	0.18812	.	.	ENSG00000182348	ENST00000333190	T	0.05258	3.47	5.4	4.24	0.50183	.	0.365590	0.23420	N	0.048362	T	0.03871	0.0109	N	0.20986	0.625	0.09310	N	1	B	0.31077	0.307	B	0.25759	0.063	T	0.36625	-0.9740	10	0.36615	T	0.2	-7.7891	5.3711	0.16140	0.2103:0.0:0.1577:0.632	.	790	A4D1E1	Z804B_HUMAN	T	790	ENSP00000329638:S790T	ENSP00000329638:S790T	S	+	1	0	ZNF804B	88802600	0.458000	0.25760	0.067000	0.19924	0.844000	0.47949	2.404000	0.44539	2.274000	0.75844	0.533000	0.62120	TCA		ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646	
C7orf55-LUC7L2	100996928	broad.mit.edu	37	7	139102364	139102364	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr7:139102364G>A	ENST00000354926.4	+	9	1244	c.890G>A	c.(889-891)cGg>cAg	p.R297Q	C7orf55-LUC7L2_ENST00000482860.1_3'UTR|LUC7L2_ENST00000541515.3_Missense_Mutation_p.R363Q|C7orf55-LUC7L2_ENST00000263545.6_Missense_Mutation_p.R296Q|C7orf55-LUC7L2_ENST00000541170.3_Missense_Mutation_p.R294Q	NM_001270643.1|NM_016019.4	NP_001257572.1|NP_057103.2			C7orf55-LUC7L2 readthrough									p.R297Q(1)									TCCAAATCTCGGGAGAAACGC	0.552																																					p.R297Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G890A	7						.						71.0	81.0	78.0					7																	139102364		2128	4235	6363	138752904	SO:0001583	missense	51631	exon9				CCDS59084.1	7q34	2013-02-14			ENSG00000146963	ENSG00000146963			44671	other	readthrough							Standard	NM_001244584		Approved		uc011kqt.3		OTTHUMG00000151717	ENST00000354926.4:c.890G>A	7.37:g.139102364G>A	ENSP00000347005:p.Arg297Gln	Somatic		Capture	Illumina HiSeq	Phase_I	138752904	NM_016019		Missense_Mutation	SNP	ENST00000354926.4	37	CCDS43656.1	.	.	.	.	.	.	.	.	.	.	G	18.82	3.704223	0.68615	.	.	ENSG00000146963	ENST00000541170;ENST00000541515;ENST00000545899;ENST00000354926;ENST00000263545	T;T;T;T	0.28895	3.36;1.59;3.36;3.36	5.69	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.24774	0.0601	L	0.48642	1.525	0.51012	D	0.999907	P;P;P;P	0.43352	0.553;0.804;0.681;0.553	B;B;B;B	0.31337	0.06;0.06;0.128;0.06	T	0.47071	-0.9145	9	0.54805	T	0.06	-1.6322	15.0572	0.71925	0.0692:0.0:0.9308:0.0	.	363;294;296;297	B7Z4Q3;B7Z500;Q9Y383-2;Q9Y383	.;.;.;LC7L2_HUMAN	Q	294;363;297;297;296	ENSP00000441604:R294Q;ENSP00000440222:R363Q;ENSP00000347005:R297Q;ENSP00000263545:R296Q	ENSP00000263545:R296Q	R	+	2	0	LUC7L2	138752904	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	5.902000	0.69869	2.698000	0.92095	0.563000	0.77884	CGG		C7orf55-LUC7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323618.2		
RSPO2	340419	broad.mit.edu	37	8	108970375	108970375	+	Missense_Mutation	SNP	G	G	T	rs151165897	byFrequency	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr8:108970375G>T	ENST00000276659.5	-	5	1169	c.549C>A	c.(547-549)gaC>gaA	p.D183E	RSPO2_ENST00000378439.2_Missense_Mutation_p.D119E|RSPO2_ENST00000517781.1_Missense_Mutation_p.D119E|RSPO2_ENST00000517939.1_Missense_Mutation_p.D116E	NM_178565.4	NP_848660.3	Q6UXX9	RSPO2_HUMAN	R-spondin 2	183	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				bone mineralization (GO:0030282)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|lung growth (GO:0060437)|osteoblast differentiation (GO:0001649)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|extracellular region (GO:0005576)	heparin binding (GO:0008201)|receptor binding (GO:0005102)	p.D183E(1)	EIF3E/RSPO2(6)	haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	28			OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)			ACAGTATTGTGTCTTTCACTG	0.443																																					p.D183E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C549A	8						.						321.0	277.0	292.0					8																	108970375		2203	4300	6503	109039551	SO:0001583	missense	340419	exon5			AK123023	CCDS6307.1, CCDS64953.1	8q23.1	2014-01-30	2011-06-29		ENSG00000147655	ENSG00000147655		"""Endogenous ligands"""	28583	protein-coding gene	gene with protein product		610575	"""R-spondin 2 homolog (Xenopus laevis)"""			15469841	Standard	NM_178565		Approved	MGC35555	uc003yms.3	Q6UXX9	OTTHUMG00000164893	ENST00000276659.5:c.549C>A	8.37:g.108970375G>T	ENSP00000276659:p.Asp183Glu	Somatic		Capture	Illumina HiSeq	Phase_I	109039551	NM_178565	B3KVP0|Q4G0U4|Q8N6X6	Missense_Mutation	SNP	ENST00000276659.5	37	CCDS6307.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.451651	0.84209	.	.	ENSG00000147655	ENST00000517939;ENST00000517781;ENST00000378439;ENST00000276659;ENST00000521502	T;T;T;T;T	0.75938	-0.98;-0.98;-0.98;-0.98;-0.98	5.9	4.11	0.48088	.	0.000000	0.85682	D	0.000000	T	0.71813	0.3384	N	0.16066	0.365	0.51012	D	0.999905	D;B	0.61697	0.99;0.22	D;B	0.75484	0.986;0.101	T	0.65545	-0.6142	10	0.12430	T	0.62	-7.7256	12.515	0.56028	0.1347:0.0:0.8653:0.0	.	183;119	Q6UXX9;Q6UXX9-3	RSPO2_HUMAN;.	E	116;119;119;183;116	ENSP00000428940:D116E;ENSP00000427937:D119E;ENSP00000367698:D119E;ENSP00000276659:D183E;ENSP00000428614:D116E	ENSP00000276659:D183E	D	-	3	2	RSPO2	109039551	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	1.794000	0.38774	0.829000	0.34733	0.563000	0.77884	GAC		RSPO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380830.1	NM_178565	
CSMD3	114788	broad.mit.edu	37	8	113569062	113569062	+	Silent	SNP	G	G	A	rs140111920		TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr8:113569062G>A	ENST00000297405.5	-	25	4408	c.4164C>T	c.(4162-4164)caC>caT	p.H1388H	CSMD3_ENST00000455883.2_Silent_p.H1284H|CSMD3_ENST00000343508.3_Silent_p.H1348H|CSMD3_ENST00000352409.3_Silent_p.H1388H	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1388	Sushi 7. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.H1388H(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GGCTACTTCCGTGGAGAGTGT	0.463										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.H1388H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4164T	8						.	G	,,	0,4406		0,0,2203	110.0	97.0	101.0		3852,4164,4044	1.3	1.0	8	dbSNP_134	101	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous,coding-synonymous,coding-synonymous	CSMD3	NM_052900.2,NM_198123.1,NM_198124.1	,,	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	,,	1284/3539,1388/3708,1348/3668	113569062	1,13003	2203	4299	6502	113638238	SO:0001819	synonymous_variant	114788	exon25			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.4164C>T	8.37:g.113569062G>A		Somatic		Capture	Illumina HiSeq	Phase_I	113638238	NM_198123	Q96PZ3	Silent	SNP	ENST00000297405.5	37	CCDS6315.1																																																																																				CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
RAD21	5885	broad.mit.edu	37	8	117864329	117864329	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr8:117864329G>A	ENST00000297338.2	-	11	1615	c.1328C>T	c.(1327-1329)cCc>cTc	p.P443L	RAD21_ENST00000518055.1_5'UTR|RAD21_ENST00000523986.1_5'UTR|RAD21_ENST00000517749.1_5'Flank	NM_006265.2	NP_006256.1	O60216	RAD21_HUMAN	RAD21 homolog (S. pombe)	443					apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|protein localization to chromatin (GO:0071168)|reciprocal meiotic recombination (GO:0007131)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.P443L(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|stomach(1)	32	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)					TTCAATAATGGGCTCATCTGC	0.418																																					p.P443L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1328T	8						.						58.0	53.0	55.0					8																	117864329		2203	4300	6503	117933510	SO:0001583	missense	5885	exon11			BC050381	CCDS6321.1	8q24.11	2014-09-17	2001-11-28		ENSG00000164754	ENSG00000164754			9811	protein-coding gene	gene with protein product	"""sister chromatid cohesion 1"""	606462	"""RAD21 (S. pombe) homolog"""			8812457	Standard	NM_006265		Approved	KIAA0078, hHR21, SCC1	uc003yod.3	O60216	OTTHUMG00000164959	ENST00000297338.2:c.1328C>T	8.37:g.117864329G>A	ENSP00000297338:p.Pro443Leu	Somatic		Capture	Illumina HiSeq	Phase_I	117933510	NM_006265	A8K0E0|Q15001|Q99568	Missense_Mutation	SNP	ENST00000297338.2	37	CCDS6321.1	.	.	.	.	.	.	.	.	.	.	G	17.71	3.457875	0.63401	.	.	ENSG00000164754	ENST00000297338	T	0.51071	0.72	5.71	5.71	0.89125	.	0.046947	0.85682	D	0.000000	T	0.42337	0.1198	L	0.38531	1.155	0.80722	D	1	B	0.23377	0.084	B	0.20767	0.031	T	0.15093	-1.0449	10	0.28530	T	0.3	-21.5991	19.8625	0.96789	0.0:0.0:1.0:0.0	.	443	O60216	RAD21_HUMAN	L	443	ENSP00000297338:P443L	ENSP00000297338:P443L	P	-	2	0	RAD21	117933510	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.611000	0.82962	2.689000	0.91719	0.655000	0.94253	CCC		RAD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381184.1	NM_006265	
PTP4A3	11156	broad.mit.edu	37	8	142432393	142432393	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr8:142432393G>T	ENST00000521578.1	+	2	998	c.53G>T	c.(52-54)cGc>cTc	p.R18L	PTP4A3_ENST00000520105.1_Missense_Mutation_p.R18L|PTP4A3_ENST00000329397.1_Missense_Mutation_p.R18L|PTP4A3_ENST00000524028.1_Missense_Mutation_p.R18L|PTP4A3_ENST00000349124.1_Missense_Mutation_p.R18L			O75365	TP4A3_HUMAN	protein tyrosine phosphatase type IVA, member 3	18					peptidyl-tyrosine dephosphorylation (GO:0035335)	endosome (GO:0005768)|plasma membrane (GO:0005886)	prenylated protein tyrosine phosphatase activity (GO:0004727)	p.R18L(1)		endometrium(2)|large_intestine(1)|lung(3)	6	all_cancers(97;2.55e-15)|all_epithelial(106;1.39e-13)|Lung NSC(106;2.07e-05)|all_lung(105;2.89e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0474)			AAACACATGCGCTTCCTCATC	0.657																																					p.R18L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G53T	8						.						125.0	115.0	118.0					8																	142432393		2203	4300	6503	142501575	SO:0001583	missense	11156	exon1			AF041434	CCDS6382.1, CCDS6383.1	8q24.3	2011-06-09				ENSG00000184489		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PRLs"""	9636	protein-coding gene	gene with protein product		606449					Standard	NM_032611		Approved	PRL-3, PRL-R, PRL3	uc003ywg.1	O75365		ENST00000521578.1:c.53G>T	8.37:g.142432393G>T	ENSP00000428976:p.Arg18Leu	Somatic		Capture	Illumina HiSeq	Phase_I	142501575	NM_032611	Q8IVN5|Q99849|Q9BTW5	Missense_Mutation	SNP	ENST00000521578.1	37	CCDS6383.1	.	.	.	.	.	.	.	.	.	.	G	33	5.287413	0.95517	.	.	ENSG00000184489	ENST00000521578;ENST00000520105;ENST00000523147;ENST00000329397;ENST00000349124;ENST00000524028	D;T;D;T	0.95949	-3.86;0.7;-3.86;0.7	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	D	0.97864	0.9298	M	0.87456	2.885	0.80722	D	1	D;B	0.71674	0.998;0.294	D;B	0.80764	0.994;0.29	D	0.98715	1.0706	10	0.66056	D	0.02	-14.7022	16.6165	0.84917	0.0:0.0:1.0:0.0	.	18;18	O75365-2;O75365	.;TP4A3_HUMAN	L	18	ENSP00000428976:R18L;ENSP00000428758:R18L;ENSP00000332274:R18L;ENSP00000331730:R18L	ENSP00000332274:R18L	R	+	2	0	PTP4A3	142501575	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.644000	0.98468	2.268000	0.75426	0.491000	0.48974	CGC		PTP4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378977.1	NM_032611	
PNMA2	10687	broad.mit.edu	37	8	26365513	26365513	+	Silent	SNP	C	C	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr8:26365513C>T	ENST00000522362.2	-	3	1653	c.759G>A	c.(757-759)agG>agA	p.R253R	PNMA2_ENST00000522764.1_5'Flank	NM_007257.5	NP_009188.1	Q9UL42	PNMA2_HUMAN	paraneoplastic Ma antigen 2	253					positive regulation of apoptotic process (GO:0043065)	nucleus (GO:0005634)		p.R253R(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)	11		all_cancers(63;0.109)|Ovarian(32;2.61e-05)|all_epithelial(46;0.105)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0196)|Epithelial(17;3.13e-11)|Colorectal(74;0.123)		tcttcagatacctcacctggg	0.552																																					p.R253R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G759A	8						.						62.0	61.0	61.0					8																	26365513		2203	4300	6503	26421430	SO:0001819	synonymous_variant	10687	exon3				CCDS34868.1	8p21.1	2012-02-09	2012-02-09		ENSG00000240694	ENSG00000240694		"""Paraneoplastic Ma antigens"""	9159	protein-coding gene	gene with protein product		603970	"""paraneoplastic antigen MA2"""			10362822	Standard	NM_007257		Approved	MA2, RGAG2	uc003xez.2	Q9UL42	OTTHUMG00000163816	ENST00000522362.2:c.759G>A	8.37:g.26365513C>T		Somatic		Capture	Illumina HiSeq	Phase_I	26421430	NM_007257	B3KNY9|O94959|O95145|Q49A18|Q9UL43	Silent	SNP	ENST00000522362.2	37	CCDS34868.1																																																																																				PNMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375709.2	NM_007257	
ST18	9705	broad.mit.edu	37	8	53071513	53071513	+	Missense_Mutation	SNP	C	C	T	rs200417136	byFrequency	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr8:53071513C>T	ENST00000276480.7	-	15	2434	c.1751G>A	c.(1750-1752)cGc>cAc	p.R584H		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	584					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R584H(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TTCCCTGCAGCGGGTGGAAAG	0.592													C|||	2	0.000399361	0.0	0.0	5008	,	,		14818	0.002		0.0	False		,,,				2504	0.0				p.R584H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1751A	8						.						107.0	113.0	111.0					8																	53071513		2203	4300	6503	53234066	SO:0001583	missense	9705	exon15			AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.1751G>A	8.37:g.53071513C>T	ENSP00000276480:p.Arg584His	Somatic		Capture	Illumina HiSeq	Phase_I	53234066	NM_014682	Q17RY1	Missense_Mutation	SNP	ENST00000276480.7	37	CCDS6149.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	19.46	3.831179	0.71258	.	.	ENSG00000147488	ENST00000276480;ENST00000517580	T;T	0.60920	0.15;0.15	6.08	6.08	0.98989	Myelin transcription factor 1 (1);	0.000000	0.85682	D	0.000000	T	0.61986	0.2391	M	0.83223	2.63	0.80722	D	1	P;P	0.38767	0.641;0.646	B;B	0.36244	0.165;0.22	T	0.67925	-0.5544	10	0.66056	D	0.02	-20.4449	14.7703	0.69671	0.0:0.9316:0.0:0.0684	.	584;584	E5RHS3;O60284	.;ST18_HUMAN	H	584	ENSP00000276480:R584H;ENSP00000428521:R584H	ENSP00000276480:R584H	R	-	2	0	ST18	53234066	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	5.774000	0.68906	2.894000	0.99253	0.655000	0.94253	CGC		ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1		
NSMAF	8439	broad.mit.edu	37	8	59518550	59518550	+	Silent	SNP	G	G	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr8:59518550G>T	ENST00000038176.3	-	12	1016	c.804C>A	c.(802-804)atC>atA	p.I268I	NSMAF_ENST00000427130.2_Silent_p.I299I|NSMAF_ENST00000519858.1_5'UTR	NM_003580.3	NP_003571.2	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation associated factor	268					ceramide metabolic process (GO:0006672)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)|sphingomyelin phosphodiesterase activator activity (GO:0016230)	p.I268I(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	38		all_lung(136;0.174)|Lung NSC(129;0.2)				ACTTTAGGTAGATGTCGGAAC	0.333																																					p.I268I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C804A	8						.						89.0	83.0	85.0					8																	59518550		2203	4300	6503	59681104	SO:0001819	synonymous_variant	8439	exon12			X96586	CCDS6173.1, CCDS47864.1	8q12-q13	2013-01-10			ENSG00000035681	ENSG00000035681		"""WD repeat domain containing"""	8017	protein-coding gene	gene with protein product		603043				8808629, 10640829	Standard	NM_003580		Approved	FAN	uc011lee.2	Q92636	OTTHUMG00000164352	ENST00000038176.3:c.804C>A	8.37:g.59518550G>T		Somatic		Capture	Illumina HiSeq	Phase_I	59681104	NM_003580	B4DFB0|E9PCH0|Q8IW26	Silent	SNP	ENST00000038176.3	37	CCDS6173.1																																																																																				NSMAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378384.1	NM_003580	
ZFHX4	79776	broad.mit.edu	37	8	77765849	77765849	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr8:77765849C>T	ENST00000521891.2	+	10	7140	c.6692C>T	c.(6691-6693)aCg>aTg	p.T2231M	ZFHX4_ENST00000455469.2_Missense_Mutation_p.T2186M|ZFHX4_ENST00000050961.6_Missense_Mutation_p.T2186M|ZFHX4_ENST00000518282.1_Missense_Mutation_p.T2205M	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2186					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.T2215M(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TCTTCTAGAACGAGATTTACT	0.383										HNSCC(33;0.089)																											p.T2231M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6692T	8						.						71.0	68.0	69.0					8																	77765849		1891	4097	5988	77928404	SO:0001583	missense	79776	exon10				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.6692C>T	8.37:g.77765849C>T	ENSP00000430497:p.Thr2231Met	Somatic		Capture	Illumina HiSeq	Phase_I	77928404	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	15.11	2.735213	0.48939	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	D;D;D;D	0.97352	-4.35;-4.35;-4.35;-4.35	4.05	4.05	0.47172	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.45867	U	0.000338	D	0.98576	0.9524	M	0.88241	2.94	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.998	D	0.99655	1.0992	10	0.87932	D	0	.	16.7528	0.85490	0.0:1.0:0.0:0.0	.	2186;2186;2231	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	M	2231;2215;2186;2186;2205	ENSP00000430497:T2231M;ENSP00000399605:T2186M;ENSP00000050961:T2186M;ENSP00000430848:T2205M	ENSP00000050961:T2186M	T	+	2	0	ZFHX4	77928404	1.000000	0.71417	0.047000	0.18901	0.893000	0.52053	7.548000	0.82154	2.270000	0.75569	0.555000	0.69702	ACG		ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
KCNS2	3788	broad.mit.edu	37	8	99441154	99441154	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr8:99441154G>A	ENST00000287042.4	+	2	1297	c.947G>A	c.(946-948)cGc>cAc	p.R316H	KCNS2_ENST00000521839.1_Missense_Mutation_p.R316H	NM_020697.2	NP_065748.1	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2	316					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.R316H(1)		autonomic_ganglia(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	31	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)			ACTGGCCTCCGCTCCCTGGGG	0.577																																					p.R316H	Pancreas(138;844 2489 9202 24627)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G947A	8						.						83.0	75.0	78.0					8																	99441154		2203	4300	6503	99510330	SO:0001583	missense	3788	exon2			AB032970	CCDS6279.1	8q22	2011-07-05			ENSG00000156486	ENSG00000156486		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6301	protein-coding gene	gene with protein product		602906				9305895, 16382104	Standard	NM_020697		Approved	Kv9.2	uc003yin.3	Q9ULS6	OTTHUMG00000044337	ENST00000287042.4:c.947G>A	8.37:g.99441154G>A	ENSP00000287042:p.Arg316His	Somatic		Capture	Illumina HiSeq	Phase_I	99510330	NM_020697	A8KAN1	Missense_Mutation	SNP	ENST00000287042.4	37	CCDS6279.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.358219	0.82243	.	.	ENSG00000156486	ENST00000287042;ENST00000521839	D;D	0.97959	-4.63;-4.63	5.83	5.83	0.93111	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98979	0.9652	M	0.89478	3.035	0.58432	D	0.999997	D	0.89917	1.0	D	0.87578	0.998	D	0.99544	1.0964	10	0.87932	D	0	.	20.1184	0.97949	0.0:0.0:1.0:0.0	.	316	Q9ULS6	KCNS2_HUMAN	H	316	ENSP00000287042:R316H;ENSP00000430712:R316H	ENSP00000287042:R316H	R	+	2	0	KCNS2	99510330	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.869000	0.99810	2.769000	0.95229	0.655000	0.94253	CGC		KCNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103134.1	NM_020697	
CYP11B1	1584	broad.mit.edu	37	8	143960554	143960554	+	Missense_Mutation	SNP	C	C	T	rs200867786		TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr8:143960554C>T	ENST00000292427.4	-	2	321	c.289G>A	c.(289-291)Gtg>Atg	p.V97M	CYP11B1_ENST00000377675.3_Missense_Mutation_p.V142M|CYP11B1_ENST00000517471.1_Missense_Mutation_p.V97M	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	97					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)	p.V97L(1)|p.V97M(1)		central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	AGCTTCTCCACGTCCTCCGGC	0.622									Familial Hyperaldosteronism type I																												p.V97M												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G289A	8						.						205.0	150.0	169.0					8																	143960554		2203	4300	6503	143957556	SO:0001583	missense	1584	exon2	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.289G>A	8.37:g.143960554C>T	ENSP00000292427:p.Val97Met	Somatic		Capture	Illumina HiSeq	Phase_I	143957556	NM_001026213	Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	ENST00000292427.4	37	CCDS6392.1	.	.	.	.	.	.	.	.	.	.	C	12.31	1.900515	0.33535	.	.	ENSG00000160882	ENST00000292427;ENST00000517471;ENST00000377675	T;T;T	0.76968	-0.62;-0.62;-1.06	3.55	3.55	0.40652	.	0.766622	0.10813	N	0.631407	T	0.75384	0.3842	L	0.54323	1.7	0.19575	N	0.999968	P;P;P	0.46578	0.841;0.8;0.88	B;B;B	0.43386	0.241;0.418;0.329	T	0.66551	-0.5895	10	0.66056	D	0.02	.	10.9711	0.47441	0.0:1.0:0.0:0.0	.	142;97;97	Q4VAR0;Q4VAQ9;P15538	.;.;C11B1_HUMAN	M	97;97;142	ENSP00000292427:V97M;ENSP00000428043:V97M;ENSP00000366903:V142M	ENSP00000292427:V97M	V	-	1	0	CYP11B1	143957556	0.024000	0.19004	0.033000	0.17914	0.457000	0.32468	2.857000	0.48349	1.677000	0.50941	0.484000	0.47621	GTG		CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2		
RFX3	5991	broad.mit.edu	37	9	3228886	3228886	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr9:3228886C>T	ENST00000382004.3	-	17	2283	c.1972G>A	c.(1972-1974)Ggt>Agt	p.G658S		NM_001282116.1|NM_134428.1	NP_001269045.1|NP_602304.1	P48380	RFX3_HUMAN	regulatory factor X, 3 (influences HLA class II expression)	658					cell maturation (GO:0048469)|cilium assembly (GO:0042384)|cilium-dependent cell motility (GO:0060285)|endocrine pancreas development (GO:0031018)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell maturation (GO:0072560)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.G658S(1)		central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(11)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		TTTAAATCACCAAACTGCAAA	0.294																																					p.G658S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1972A	9						.						52.0	52.0	52.0					9																	3228886		2202	4291	6493	3218886	SO:0001583	missense	5991	exon17			AI811824	CCDS6449.1, CCDS6450.1, CCDS75809.1	9p24.2	2008-02-05			ENSG00000080298	ENSG00000080298			9984	protein-coding gene	gene with protein product		601337				8289803	Standard	XM_005251534		Approved		uc003zhr.3	P48380	OTTHUMG00000019456	ENST00000382004.3:c.1972G>A	9.37:g.3228886C>T	ENSP00000371434:p.Gly658Ser	Somatic		Capture	Illumina HiSeq	Phase_I	3218886	NM_134428	A8K0H5|D3DRH8|D3DRH9|Q5JTL7|Q5JTL8|Q6NW13|Q8WTU4|Q95HL5|Q95HL6	Missense_Mutation	SNP	ENST00000382004.3	37	CCDS6449.1	.	.	.	.	.	.	.	.	.	.	C	15.94	2.981858	0.53827	.	.	ENSG00000080298	ENST00000382004	T	0.40476	1.03	5.77	5.77	0.91146	.	0.402843	0.30383	N	0.009747	T	0.30823	0.0777	N	0.16790	0.44	0.80722	D	1	B	0.11235	0.004	B	0.16722	0.016	T	0.10941	-1.0608	10	0.14252	T	0.57	-12.1489	19.9928	0.97374	0.0:1.0:0.0:0.0	.	658	P48380	RFX3_HUMAN	S	658	ENSP00000371434:G658S	ENSP00000371434:G658S	G	-	1	0	RFX3	3218886	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.480000	0.73604	2.745000	0.94114	0.650000	0.86243	GGT		RFX3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051545.1	NM_002919	
BNC2	54796	broad.mit.edu	37	9	16419344	16419344	+	Silent	SNP	G	G	A	rs374901966		TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr9:16419344G>A	ENST00000380672.4	-	7	3000	c.2943C>T	c.(2941-2943)gaC>gaT	p.D981D	BNC2_ENST00000545497.1_Silent_p.D886D|BNC2_ENST00000380667.2_Silent_p.D914D	NM_017637.5	NP_060107.3			basonuclin 2									p.D981D(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		CGCTGCCTGCGTCGGATTCTC	0.612																																					p.D981D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2943T	9						.	G		0,4406		0,0,2203	91.0	87.0	88.0		2943	-0.1	1.0	9		88	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	BNC2	NM_017637.5		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		981/1100	16419344	1,13005	2203	4300	6503	16409344	SO:0001819	synonymous_variant	54796	exon7			AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.2943C>T	9.37:g.16419344G>A		Somatic		Capture	Illumina HiSeq	Phase_I	16409344	NM_017637		Silent	SNP	ENST00000380672.4	37	CCDS6482.2																																																																																				BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216901.5	NM_017637	
SMC5	23137	broad.mit.edu	37	9	72967217	72967217	+	Silent	SNP	G	G	A			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr9:72967217G>A	ENST00000361138.5	+	25	3334	c.3276G>A	c.(3274-3276)cgG>cgA	p.R1092R		NM_015110.3	NP_055925.2	Q8IY18	SMC5_HUMAN	structural maintenance of chromosomes 5	1092					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|telomere maintenance via recombination (GO:0000722)	cell junction (GO:0030054)|chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)	p.R1092R(1)		breast(1)|central_nervous_system(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(4)	35						AAAGGCGGCGGCGCCGTATTA	0.368																																					p.R1092R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3276A	9						.						82.0	89.0	87.0					9																	72967217		2203	4300	6503	72157037	SO:0001819	synonymous_variant	23137	exon25			AB011166	CCDS6632.1	9q21.11	2008-02-05	2006-07-06	2006-07-06	ENSG00000198887	ENSG00000198887		"""Structural maintenance of chromosomes proteins"""	20465	protein-coding gene	gene with protein product		609386	"""SMC5 structural maintenance of chromosomes 5-like 1 (yeast)"""	SMC5L1		9628581	Standard	NM_015110		Approved	KIAA0594	uc004ahr.2	Q8IY18	OTTHUMG00000019992	ENST00000361138.5:c.3276G>A	9.37:g.72967217G>A		Somatic		Capture	Illumina HiSeq	Phase_I	72157037	NM_015110	A6NM81|O60335|Q05D92|Q5VZ60|Q96SB9	Silent	SNP	ENST00000361138.5	37	CCDS6632.1																																																																																				SMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052603.1	NM_015110	
KIAA1958	158405	broad.mit.edu	37	9	115422112	115422112	+	Silent	SNP	C	C	T			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chr9:115422112C>T	ENST00000337530.6	+	4	2210	c.1914C>T	c.(1912-1914)taC>taT	p.Y638Y	KIAA1958_ENST00000536272.1_Silent_p.Y666Y	NM_133465.2	NP_597722.1	Q8N8K9	K1958_HUMAN	KIAA1958	638								p.Y638Y(1)		endometrium(1)|large_intestine(9)|lung(10)|prostate(2)|skin(3)	25						AGTACATGTACATCCACCGGC	0.587																																					p.Y638Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1914T	9						.						56.0	49.0	51.0					9																	115422112		2203	4300	6503	114461933	SO:0001819	synonymous_variant	158405	exon4			AB075838	CCDS35108.1, CCDS69642.1	9q33.1	2009-09-22			ENSG00000165185	ENSG00000165185			23427	protein-coding gene	gene with protein product							Standard	NM_001287038		Approved	FLJ39294	uc004bgf.1	Q8N8K9	OTTHUMG00000020508	ENST00000337530.6:c.1914C>T	9.37:g.115422112C>T		Somatic		Capture	Illumina HiSeq	Phase_I	114461933	NM_133465	B7ZKW6|Q2M336|Q5T252|Q8TF43|Q96N02	Silent	SNP	ENST00000337530.6	37	CCDS35108.1																																																																																				KIAA1958-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053690.1	NM_133465	
FAM47A	158724	broad.mit.edu	37	X	34149087	34149087	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chrX:34149087T>C	ENST00000346193.3	-	1	1360	c.1309A>G	c.(1309-1311)Acg>Gcg	p.T437A		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	437								p.T437A(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						TCCTTCAGCGTCCTCCCAGAA	0.552																																					p.T437A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1309G	X						.						44.0	45.0	44.0					X																	34149087		2117	4243	6360	34059008	SO:0001583	missense	158724	exon1			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1309A>G	X.37:g.34149087T>C	ENSP00000345029:p.Thr437Ala	Somatic		Capture	Illumina HiSeq	Phase_I	34059008	NM_203408	A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	37	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	t	3.300	-0.143110	0.06669	.	.	ENSG00000185448	ENST00000346193	T	0.13307	2.6	0.866	-1.73	0.08081	.	.	.	.	.	T	0.06005	0.0156	N	0.22421	0.69	0.09310	N	1	P	0.40834	0.73	B	0.37387	0.248	T	0.29397	-1.0013	8	0.10111	T	0.7	.	.	.	.	.	437	Q5JRC9	FA47A_HUMAN	A	437	ENSP00000345029:T437A	ENSP00000345029:T437A	T	-	1	0	FAM47A	34059008	0.072000	0.21174	0.010000	0.14722	0.151000	0.21798	-0.314000	0.08092	-1.023000	0.03342	0.237000	0.17872	ACG		FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
ITIH6	347365	broad.mit.edu	37	X	54785075	54785075	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chrX:54785075G>A	ENST00000218436.6	-	8	1461	c.1432C>T	c.(1432-1434)Cgt>Tgt	p.R478C		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	478					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R478C(1)									TAGTTCAGACGCACATCTGCC	0.597																																					p.R478C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1432T	X						.						45.0	40.0	42.0					X																	54785075		2203	4300	6503	54801800	SO:0001583	missense	347365	exon8			AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.1432C>T	X.37:g.54785075G>A	ENSP00000218436:p.Arg478Cys	Somatic		Capture	Illumina HiSeq	Phase_I	54801800	NM_198510	A6NN03	Missense_Mutation	SNP	ENST00000218436.6	37	CCDS14361.1	.	.	.	.	.	.	.	.	.	.	G	6.725	0.502448	0.12822	.	.	ENSG00000102313	ENST00000218436	T	0.11821	2.74	3.66	0.383	0.16239	.	0.849036	0.10374	N	0.682431	T	0.08582	0.0213	N	0.24115	0.695	0.24611	N	0.993722	B	0.06786	0.001	B	0.01281	0.0	T	0.32693	-0.9897	10	0.66056	D	0.02	.	4.9584	0.14054	0.2486:0.3734:0.378:0.0	.	478	Q6UXX5	ITH5L_HUMAN	C	478	ENSP00000218436:R478C	ENSP00000218436:R478C	R	-	1	0	ITIH5L	54801800	0.001000	0.12720	0.489000	0.27452	0.417000	0.31264	0.222000	0.17699	0.386000	0.24997	-0.196000	0.12772	CGT		ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056814.2	NM_198510	
AMER1	139285	broad.mit.edu	37	X	63411291	63411291	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chrX:63411291G>A	ENST00000330258.3	-	2	2148	c.1876C>T	c.(1876-1878)Cga>Tga	p.R626*	AMER1_ENST00000374869.3_Nonsense_Mutation_p.R626*|AMER1_ENST00000403336.1_Nonsense_Mutation_p.R626*	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	626					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)|p.R626*(2)									TGGGCTTCTCGGGTTCTGGCC	0.617																																					p.R626X												.	.	69	Whole gene deletion(67)|Substitution - Nonsense(2)	kidney(65)|large_intestine(3)|ovary(1)	c.C1876T	X						.						27.0	23.0	24.0					X																	63411291		2203	4300	6503	63328016	SO:0001587	stop_gained	139285	exon2			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.1876C>T	X.37:g.63411291G>A	ENSP00000329117:p.Arg626*	Somatic		Capture	Illumina HiSeq	Phase_I	63328016	NM_152424	A2IB86|Q8N885	Nonsense_Mutation	SNP	ENST00000330258.3	37	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	G	27.0	4.788975	0.90367	.	.	ENSG00000184675	ENST00000374869;ENST00000330258;ENST00000403336	.	.	.	4.24	3.35	0.38373	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.8451	4.4728	0.11720	0.1079:0.0:0.4881:0.404	.	.	.	.	X	626	.	ENSP00000329117:R626X	R	-	1	2	FAM123B	63328016	0.002000	0.14202	0.008000	0.14137	0.053000	0.15095	0.259000	0.18405	1.098000	0.41479	0.600000	0.82982	CGA		AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424	
AR	367	broad.mit.edu	37	X	66942701	66942701	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chrX:66942701T>C	ENST00000374690.3	+	7	3006	c.2482T>C	c.(2482-2484)Ttt>Ctt	p.F828L	AR_ENST00000396044.3_Intron|AR_ENST00000396043.2_Missense_Mutation_p.F296L	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	827	Interaction with KAT7.|Interaction with LPXN.|Ligand-binding.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.F646L(1)|p.F828L(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	TCAAAAATTCTTTGATGAACT	0.448									Androgen Insensitivity Syndrome																												p.F296L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T886C	X	GRCh37	CM014507	AR	M		.						75.0	65.0	68.0					X																	66942701		2203	4300	6503	66859426	SO:0001583	missense	367	exon7	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.2482T>C	X.37:g.66942701T>C	ENSP00000363822:p.Phe828Leu	Somatic		Capture	Illumina HiSeq	Phase_I	66859426	NM_001011645	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	37	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	-	18.85	3.711175	0.68730	.	.	ENSG00000169083	ENST00000544984;ENST00000374690;ENST00000396043	D;D	0.96200	-3.94;-3.94	5.19	5.19	0.71726	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.97377	0.9142	M	0.80982	2.52	0.80722	D	1	P;D	0.89917	0.65;1.0	B;D	0.83275	0.398;0.996	D	0.97868	1.0284	10	0.87932	D	0	.	11.864	0.52482	0.0:0.0:0.0:1.0	.	296;827	F1D8N5;P10275	.;ANDR_HUMAN	L	646;828;296	ENSP00000363822:F828L;ENSP00000379358:F296L	ENSP00000363822:F828L	F	+	1	0	AR	66859426	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.862000	0.87013	1.930000	0.55929	0.478000	0.44815	TTT		AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
PCDH11X	27328	broad.mit.edu	37	X	91873897	91873897	+	Silent	SNP	G	G	A	rs80336085	byFrequency	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chrX:91873897G>A	ENST00000373094.1	+	7	4847	c.4002G>A	c.(4000-4002)ccG>ccA	p.P1334P	PCDH11X_ENST00000373097.1_Silent_p.P1324P|PCDH11X_ENST00000504220.2_3'UTR|PCDH11X_ENST00000298274.8_Silent_p.P1297P|PCDH11X_ENST00000406881.1_Silent_p.P1326P|PCDH11X_ENST00000361655.2_Silent_p.P1316P|PCDH11X_ENST00000373088.1_Silent_p.P1297P	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	1334					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P1334P(1)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						AGGCCAGACCGTCCAGAGGTG	0.378													G|||	7	0.0018543	0.0053	0.0	3775	,	,		15380	0.0		0.0	False		,,,				2504	0.0				p.P1334P	NSCLC(38;925 1092 2571 38200 45895)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4002A	X						.	A	,,,,,	42,3793		0,33,9,1599,562	116.0	112.0	113.0		3978,,3891,3948,4002,3972	-1.1	0.0	X	dbSNP_131	113	0,6728		0,0,0,2428,1872	no	coding-synonymous,utr-3,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PCDH11X	NM_001168360.1,NM_001168361.1,NM_001168362.1,NM_001168363.1,NM_032968.3,NM_032969.3	,,,,,	0,33,9,4027,2434	AA,AG,A,GG,G		0.0,1.0952,0.3976	,,,,,	1326/1340,,1297/1311,1316/1330,1334/1348,1324/1338	91873897	42,10521	2203	4300	6503	91760553	SO:0001819	synonymous_variant	27328	exon7			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.4002G>A	X.37:g.91873897G>A		Somatic		Capture	Illumina HiSeq	Phase_I	91760553	NM_032968	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Silent	SNP	ENST00000373094.1	37	CCDS14461.1																																																																																				PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969	
COL4A5	1287	broad.mit.edu	37	X	107936015	107936015	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3896-01A-01W-1073-09	TCGA-AG-3896-10A-01W-1073-09	g.chrX:107936015G>C	ENST00000361603.2	+	48	4792	c.4548G>C	c.(4546-4548)atG>atC	p.M1516I	COL4A5_ENST00000328300.6_Missense_Mutation_p.M1522I	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1516	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)	p.M1516I(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						TTAGTACCATGCCTTTCATGT	0.438									Alport syndrome with Diffuse Leiomyomatosis																												p.M1516I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4548C	X						.						129.0	99.0	109.0					X																	107936015		2203	4300	6503	107822671	SO:0001583	missense	1287	exon48	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.4548G>C	X.37:g.107936015G>C	ENSP00000354505:p.Met1516Ile	Somatic		Capture	Illumina HiSeq	Phase_I	107822671	NM_000495	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	37	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.992232	0.93167	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.94330	-3.4;-3.4	5.82	5.82	0.92795	C-type lectin fold (1);	0.000000	0.85682	D	0.000000	D	0.97009	0.9023	M	0.84219	2.685	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.91635	0.999;0.999	D	0.97086	0.9787	10	0.59425	D	0.04	.	19.0941	0.93242	0.0:0.0:1.0:0.0	.	1519;1516	E7EVY4;P29400	.;CO4A5_HUMAN	I	1522;1516;1522	ENSP00000331902:M1522I;ENSP00000354505:M1516I	ENSP00000331902:M1522I	M	+	3	0	COL4A5	107822671	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.459000	0.83118	0.594000	0.82650	ATG		COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2		
