#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SEPHS1	22929	broad.mit.edu	37	10	13386833	13386833	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr10:13386833T>C	ENST00000327347.5	-	2	493	c.118A>G	c.(118-120)Aaa>Gaa	p.K40E	SEPHS1_ENST00000494329.1_5'UTR|SEPHS1_ENST00000545675.1_Missense_Mutation_p.K40E|SEPHS1_ENST00000378614.4_Missense_Mutation_p.K40E|SEPHS1_ENST00000537130.1_Intron	NM_001195602.1|NM_012247.4	NP_001182531.1|NP_036379.2	P49903	SPS1_HUMAN	selenophosphate synthetase 1	40					cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|selenide, water dikinase activity (GO:0004756)	p.K40E(2)		cervix(1)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|stomach(1)	16						TCCAGCAATTTTTGCAGGACA	0.468																																					p.K40E												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A118G	10						.						120.0	124.0	123.0					10																	13386833		2203	4300	6503	13426839	SO:0001583	missense	22929	exon2			BC000941	CCDS7098.1, CCDS55702.1, CCDS55703.1	10p14	2006-10-06			ENSG00000086475	ENSG00000086475			19685	protein-coding gene	gene with protein product		600902				7665581	Standard	NM_012247		Approved	SPS, SPS1	uc001imk.3	P49903	OTTHUMG00000017696	ENST00000327347.5:c.118A>G	10.37:g.13386833T>C	ENSP00000367893:p.Lys40Glu	Somatic		Capture	Illumina HiSeq	Phase_I	13426839	NM_001195604	B4DWK0|D3DRS9|D6PSQ9|Q5T5U8|Q5T5U9|Q9BVT4	Missense_Mutation	SNP	ENST00000327347.5	37	CCDS7098.1	.	.	.	.	.	.	.	.	.	.	T	16.75	3.208576	0.58343	.	.	ENSG00000086475	ENST00000327347;ENST00000319684;ENST00000378614;ENST00000545675;ENST00000413411	T;T;T	0.44482	0.92;0.93;0.94	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.37489	0.1005	L	0.50333	1.59	0.80722	D	1	B;B;B;B	0.14012	0.003;0.009;0.009;0.009	B;B;B;B	0.17098	0.002;0.017;0.009;0.017	T	0.15838	-1.0423	10	0.23891	T	0.37	-5.4924	13.53	0.61617	0.0:0.0:0.0:1.0	.	40;40;40;40	Q5T5U9;P49903;D6PSQ9;D3DRS9	.;SPS1_HUMAN;.;.	E	40	ENSP00000367893:K40E;ENSP00000367877:K40E;ENSP00000441119:K40E	ENSP00000367887:K40E	K	-	1	0	SEPHS1	13426839	1.000000	0.71417	0.997000	0.53966	0.852000	0.48524	7.985000	0.88162	1.783000	0.52377	0.260000	0.18958	AAA		SEPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046856.1	NM_012247	
PAX2	5076	broad.mit.edu	37	10	102510632	102510632	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr10:102510632G>A	ENST00000428433.1	+	3	944	c.394G>A	c.(394-396)Gtc>Atc	p.V132I	PAX2_ENST00000556085.1_Missense_Mutation_p.V131I|PAX2_ENST00000553492.1_Intron|PAX2_ENST00000355243.3_Missense_Mutation_p.V132I|PAX2_ENST00000370296.2_Missense_Mutation_p.V132I|PAX2_ENST00000361791.3_Missense_Mutation_p.V132I	NM_003987.3|NM_003990.3	NP_003978|NP_003981.2	Q02962	PAX2_HUMAN	paired box 2	132	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				aging (GO:0007568)|axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cell fate determination (GO:0001709)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucose stimulus (GO:0071333)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cochlea development (GO:0090102)|cochlea morphogenesis (GO:0090103)|glial cell differentiation (GO:0010001)|inner ear morphogenesis (GO:0042472)|mesenchymal to epithelial transition (GO:0060231)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesodermal cell fate specification (GO:0007501)|mesonephric duct development (GO:0072177)|mesonephric tubule formation (GO:0072172)|mesonephros development (GO:0001823)|metanephric collecting duct development (GO:0072205)|metanephric distal convoluted tubule development (GO:0072221)|metanephric epithelium development (GO:0072207)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchyme development (GO:0072075)|metanephric nephron tubule formation (GO:0072289)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic process involved in metanephric collecting duct development (GO:1900215)|negative regulation of apoptotic process involved in metanephric nephron tubule development (GO:1900218)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of cytolysis (GO:0045918)|negative regulation of mesenchymal cell apoptotic process involved in metanephric nephron morphogenesis (GO:0072305)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|negative regulation of programmed cell death (GO:0043069)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|neural tube closure (GO:0001843)|optic chiasma development (GO:0061360)|optic cup morphogenesis involved in camera-type eye development (GO:0002072)|optic nerve development (GO:0021554)|optic nerve morphogenesis (GO:0021631)|optic nerve structural organization (GO:0021633)|pancreas development (GO:0031016)|paramesonephric duct development (GO:0061205)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of metanephric DCT cell differentiation (GO:2000594)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of optic nerve formation (GO:2000597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric field specification (GO:0039003)|pronephros development (GO:0048793)|protein kinase B signaling (GO:0043491)|reactive oxygen species metabolic process (GO:0072593)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of metanephros size (GO:0035566)|response to nutrient levels (GO:0031667)|retinal pigment epithelium development (GO:0003406)|stem cell differentiation (GO:0048863)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|ureter development (GO:0072189)|ureter maturation (GO:0035799)|ureter morphogenesis (GO:0072197)|urogenital system development (GO:0001655)|vestibulocochlear nerve formation (GO:0021650)|visual perception (GO:0007601)	centriolar satellite (GO:0034451)|lysosome (GO:0005764)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|protein complex (GO:0043234)|protein-DNA complex (GO:0032993)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|superoxide-generating NADPH oxidase activity (GO:0016175)|transcription regulatory region DNA binding (GO:0044212)	p.V132I(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	18		Colorectal(252;0.234)		Epithelial(162;1.32e-08)|all cancers(201;7.32e-07)		AGTGCCCAGCGTCTCTTCCAT	0.597																																					p.V132I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G394A	10						.						55.0	59.0	58.0					10																	102510632		2203	4299	6502	102500622	SO:0001583	missense	5076	exon3				CCDS7499.1, CCDS41561.1	10q24.31	2011-06-20	2007-07-12		ENSG00000075891	ENSG00000075891		"""Paired boxes"", ""Homeoboxes / PRD class"""	8616	protein-coding gene	gene with protein product		167409	"""paired box gene 2"""			8431641, 7981748	Standard	NM_003990		Approved		uc001krk.4	Q02962	OTTHUMG00000018913	ENST00000428433.1:c.394G>A	10.37:g.102510632G>A	ENSP00000396259:p.Val132Ile	Somatic		Capture	Illumina HiSeq	Phase_I	102500622	NM_003987	Q15105|Q15110|Q15837|Q5SZP2|Q5SZP3	Missense_Mutation	SNP	ENST00000428433.1	37	CCDS53569.1	.	.	.	.	.	.	.	.	.	.	G	32	5.187093	0.94923	.	.	ENSG00000075891	ENST00000370294;ENST00000370296;ENST00000428433;ENST00000361791;ENST00000355243;ENST00000556085;ENST00000427256;ENST00000554172	D;D;D;D;D;D;D	0.99494	-6.01;-6.01;-6.01;-6.01;-6.01;-6.01;-6.01	5.93	5.93	0.95920	Paired box protein, N-terminal (3);Winged helix-turn-helix transcription repressor DNA-binding (1);Homeodomain-like (1);	0.055638	0.64402	D	0.000001	D	0.99396	0.9787	M	0.80332	2.49	0.80722	D	1	P;D;B;P;P;P;P	0.59767	0.736;0.986;0.406;0.948;0.867;0.736;0.935	P;P;B;P;P;P;P	0.55749	0.489;0.783;0.191;0.727;0.623;0.489;0.489	D	0.99517	1.0957	10	0.87932	D	0	.	20.3437	0.98782	0.0:0.0:1.0:0.0	.	131;132;132;136;132;132;136	G3V5U4;Q02962-2;Q02962-3;Q6YFJ8;Q02962;Q02962-4;G3V5S4	.;.;.;.;PAX2_HUMAN;.;.	I	24;132;132;132;132;131;132;136	ENSP00000359319:V132I;ENSP00000396259:V132I;ENSP00000355069:V132I;ENSP00000347385:V132I;ENSP00000452527:V131I;ENSP00000398652:V132I;ENSP00000452489:V136I	ENSP00000347385:V132I	V	+	1	0	PAX2	102500622	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.815000	0.96918	0.561000	0.74099	GTC		PAX2-202	KNOWN	basic|CCDS	protein_coding	protein_coding			
ENKUR	219670	broad.mit.edu	37	10	25273712	25273712	+	Silent	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr10:25273712G>A	ENST00000331161.4	-	5	936	c.717C>T	c.(715-717)caC>caT	p.H239H	ENKUR_ENST00000376363.1_Silent_p.H239H	NM_145010.3	NP_659447.1	Q8TC29	ENKUR_HUMAN	enkurin, TRPC channel interacting protein	239	Enkurin. {ECO:0000255|PROSITE- ProRule:PRU01000}.					motile cilium (GO:0031514)		p.H239H(1)		endometrium(2)|large_intestine(4)|lung(3)|skin(1)	10						TGCCAATGTCGTGTTCTAGTT	0.348																																					p.H239H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C717T	10						.						128.0	120.0	123.0					10																	25273712		2203	4300	6503	25313718	SO:0001819	synonymous_variant	219670	exon5			AK095021	CCDS7146.1, CCDS73075.1	10p12.31	2014-08-13	2009-04-28	2009-04-28	ENSG00000151023	ENSG00000151023			28388	protein-coding gene	gene with protein product		611025	"""chromosome 10 open reading frame 63"""	C10orf63		17217053, 15385169	Standard	NM_145010		Approved	MGC26778, enkurin, CFAP106	uc001isg.2	Q8TC29	OTTHUMG00000017827	ENST00000331161.4:c.717C>T	10.37:g.25273712G>A		Somatic		Capture	Illumina HiSeq	Phase_I	25313718	NM_145010	A8K8Y0|D3DRV2	Silent	SNP	ENST00000331161.4	37	CCDS7146.1																																																																																				ENKUR-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047239.2	NM_145010	
ANKRD30A	91074	broad.mit.edu	37	10	37508552	37508552	+	Silent	SNP	C	C	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr10:37508552C>T	ENST00000602533.1	+	34	3843	c.3744C>T	c.(3742-3744)aaC>aaT	p.N1248N	ANKRD30A_ENST00000361713.1_Silent_p.N1248N|ANKRD30A_ENST00000374660.1_Silent_p.N1367N			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1304					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N1248N(1)		NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						TGTATCAAAACGAACAAGATA	0.368																																					p.N1248N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3744T	10						.						77.0	65.0	69.0					10																	37508552		1915	4122	6037	37548558	SO:0001819	synonymous_variant	91074	exon34			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.3744C>T	10.37:g.37508552C>T		Somatic		Capture	Illumina HiSeq	Phase_I	37548558	NM_052997	Q5W025	Silent	SNP	ENST00000602533.1	37																																																																																					ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997	
PCDH15	65217	broad.mit.edu	37	10	55582288	55582288	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr10:55582288T>C	ENST00000320301.6	-	33	5592	c.5198A>G	c.(5197-5199)aAt>aGt	p.N1733S	PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000395433.1_Missense_Mutation_p.N1710S|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395432.2_Missense_Mutation_p.N1693S|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000395430.1_Missense_Mutation_p.N1730S|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395438.1_Intron|PCDH15_ENST00000437009.1_Missense_Mutation_p.N1664S|PCDH15_ENST00000361849.3_Missense_Mutation_p.N1735S|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395445.1_Intron	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1733					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.N1733S(1)|p.N1740S(1)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				ATGGGCAAAATTTTCAAAAAT	0.453										HNSCC(58;0.16)																											p.N1693S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A5078G	10						.						37.0	39.0	38.0					10																	55582288		2203	4299	6502	55252294	SO:0001583	missense	65217	exon31			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.5198A>G	10.37:g.55582288T>C	ENSP00000322604:p.Asn1733Ser	Somatic		Capture	Illumina HiSeq	Phase_I	55252294	NM_001142767	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	T	0.060	-1.226185	0.01518	.	.	ENSG00000150275	ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009	T;T;T;T;T;T	0.56275	0.5;0.47;0.51;0.48;0.48;0.49	5.0	2.52	0.30459	.	.	.	.	.	T	0.29556	0.0737	N	0.19112	0.55	0.22112	N	0.999355	B;B;B;B;B;B;B;B	0.13145	0.007;0.007;0.007;0.007;0.004;0.007;0.007;0.007	B;B;B;B;B;B;B;B	0.12156	0.007;0.004;0.004;0.004;0.006;0.004;0.007;0.004	T	0.27157	-1.0082	9	0.07644	T	0.81	.	4.6763	0.12713	0.3082:0.0808:0.0:0.611	.	1710;1733;1735;1740;1664;1693;1730;1733	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;Q96QU1	.;.;.;.;.;.;.;PCD15_HUMAN	S	1693;1735;1710;1733;1730;1740;1664	ENSP00000378820:N1693S;ENSP00000354950:N1735S;ENSP00000378821:N1710S;ENSP00000322604:N1733S;ENSP00000378818:N1730S;ENSP00000412628:N1664S	ENSP00000322604:N1733S	N	-	2	0	PCDH15	55252294	0.063000	0.20901	0.518000	0.27811	0.261000	0.26267	0.031000	0.13710	0.201000	0.20466	0.533000	0.62120	AAT		PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
TLL2	7093	broad.mit.edu	37	10	98133419	98133419	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr10:98133419T>A	ENST00000357947.3	-	19	2821	c.2596A>T	c.(2596-2598)Atg>Ttg	p.M866L		NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	866	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.M866L(1)		NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		CTGAGAAACATACTGCTGCCG	0.592																																					p.M866L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2596T	10						.						72.0	73.0	73.0					10																	98133419		2203	4300	6503	98123409	SO:0001583	missense	7093	exon19			AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.2596A>T	10.37:g.98133419T>A	ENSP00000350630:p.Met866Leu	Somatic		Capture	Illumina HiSeq	Phase_I	98123409	NM_012465	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Missense_Mutation	SNP	ENST00000357947.3	37	CCDS7449.1	.	.	.	.	.	.	.	.	.	.	T	9.642	1.139131	0.21205	.	.	ENSG00000095587	ENST00000357947	T	0.15834	2.39	4.85	0.568	0.17333	CUB (5);	0.344834	0.19558	N	0.111394	T	0.07234	0.0183	N	0.16833	0.445	0.41503	D	0.988291	B	0.02656	0.0	B	0.01281	0.0	T	0.29640	-1.0005	10	0.09338	T	0.73	.	5.0535	0.14520	0.1715:0.0:0.3841:0.4444	.	866	Q9Y6L7	TLL2_HUMAN	L	866	ENSP00000350630:M866L	ENSP00000350630:M866L	M	-	1	0	TLL2	98123409	1.000000	0.71417	0.999000	0.59377	0.875000	0.50365	1.674000	0.37544	0.334000	0.23590	-0.302000	0.09304	ATG		TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1		
KNDC1	85442	broad.mit.edu	37	10	135013012	135013012	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr10:135013012G>A	ENST00000304613.3	+	15	2830	c.2809G>A	c.(2809-2811)Gcc>Acc	p.A937T	KNDC1_ENST00000368572.2_Missense_Mutation_p.A939T|KNDC1_ENST00000368571.2_Missense_Mutation_p.A872T			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	937					cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)	p.A937T(1)		NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		TTTCTGTGGCGCCATTTCCGA	0.532																																					p.A937T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2809A	10						.						177.0	150.0	159.0					10																	135013012		2203	4300	6503	134863002	SO:0001583	missense	85442	exon15			AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.2809G>A	10.37:g.135013012G>A	ENSP00000304437:p.Ala937Thr	Somatic		Capture	Illumina HiSeq	Phase_I	134863002	NM_152643	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	ENST00000304613.3	37	CCDS7674.1	.	.	.	.	.	.	.	.	.	.	G	16.88	3.244556	0.59103	.	.	ENSG00000171798	ENST00000304613;ENST00000368572;ENST00000368571	T;T;T	0.12984	2.63;2.63;2.63	3.99	3.99	0.46301	.	0.479232	0.18727	N	0.132851	T	0.34571	0.0902	M	0.66939	2.045	0.41003	D	0.984944	D;D;D	0.89917	0.993;1.0;0.997	D;D;P	0.72338	0.919;0.977;0.74	T	0.18116	-1.0347	10	0.72032	D	0.01	-25.397	13.9012	0.63804	0.0:0.0:1.0:0.0	.	937;872;937	Q76NI1-4;Q76NI1-2;Q76NI1	.;.;VKIND_HUMAN	T	937;939;872	ENSP00000304437:A937T;ENSP00000357561:A939T;ENSP00000357560:A872T	ENSP00000304437:A937T	A	+	1	0	KNDC1	134863002	0.937000	0.31787	0.821000	0.32701	0.124000	0.20399	2.706000	0.47135	1.957000	0.56846	0.313000	0.20887	GCC		KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
OR51A7	119687	broad.mit.edu	37	11	4929276	4929276	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr11:4929276G>A	ENST00000359350.4	+	1	677	c.677G>A	c.(676-678)aGc>aAc	p.S226N	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004749.1	NP_001004749.1	Q8NH64	O51A7_HUMAN	olfactory receptor, family 51, subfamily A, member 7	226						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S226N(1)		breast(1)|endometrium(1)|large_intestine(7)|lung(13)|ovary(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		ACTATACTCAGCATTGCATCT	0.468																																					p.S226N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G677A	11						.						237.0	197.0	211.0					11																	4929276		2201	4298	6499	4885852	SO:0001583	missense	119687	exon1			AB065525	CCDS31364.1	11p15.4	2012-08-09			ENSG00000176895	ENSG00000176895		"""GPCR / Class A : Olfactory receptors"""	15188	protein-coding gene	gene with protein product							Standard	NM_001004749		Approved		uc010qyq.2	Q8NH64	OTTHUMG00000066502	ENST00000359350.4:c.677G>A	11.37:g.4929276G>A	ENSP00000352305:p.Ser226Asn	Somatic		Capture	Illumina HiSeq	Phase_I	4885852	NM_001004749	Q6IFH8	Missense_Mutation	SNP	ENST00000359350.4	37	CCDS31364.1	.	.	.	.	.	.	.	.	.	.	G	7.246	0.602247	0.13939	.	.	ENSG00000176895	ENST00000359350;ENST00000545959;ENST00000544684	T	0.37752	1.18	5.02	3.16	0.36331	GPCR, rhodopsin-like superfamily (1);	0.380742	0.23093	N	0.052002	T	0.25082	0.0609	N	0.25789	0.76	0.09310	N	1	B	0.12013	0.005	B	0.21151	0.033	T	0.17561	-1.0365	10	0.40728	T	0.16	.	9.8726	0.41185	0.1656:0.0:0.8344:0.0	.	226	Q8NH64	O51A7_HUMAN	N	226;226;215	ENSP00000352305:S226N	ENSP00000352305:S226N	S	+	2	0	OR51A7	4885852	0.000000	0.05858	0.954000	0.39281	0.232000	0.25224	-0.421000	0.07053	0.709000	0.31976	0.655000	0.94253	AGC		OR51A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142175.1	NM_001004749	
OR51B2	79345	broad.mit.edu	37	11	5345396	5345396	+	Silent	SNP	G	G	C			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr11:5345396G>C	ENST00000328813.2	-	1	186	c.132C>G	c.(130-132)ctC>ctG	p.L44L	HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron	NM_033180.4	NP_149420.4	Q9Y5P1	O51B2_HUMAN	olfactory receptor, family 51, subfamily B, member 2	44						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L44L(1)		NS(1)|biliary_tract(1)|central_nervous_system(1)|large_intestine(6)|lung(21)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGATGAGGTAGAGGAGCATGC	0.527																																					p.L44L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C132G	11						.						136.0	114.0	121.0					11																	5345396		2201	4297	6498	5301972	SO:0001819	synonymous_variant	79345	exon1			AF399503	CCDS31377.1	11p15.4	2012-08-09			ENSG00000184881	ENSG00000184881		"""GPCR / Class A : Olfactory receptors"""	14703	protein-coding gene	gene with protein product				OR51B1P			Standard	NM_033180		Approved		uc001mao.1	Q9Y5P1	OTTHUMG00000066682	ENST00000328813.2:c.132C>G	11.37:g.5345396G>C		Somatic		Capture	Illumina HiSeq	Phase_I	5301972	NM_033180	Q96RD4	Silent	SNP	ENST00000328813.2	37	CCDS31377.1																																																																																				OR51B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142983.1	NM_033180	
OR5T1	390155	broad.mit.edu	37	11	56043937	56043937	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr11:56043937A>C	ENST00000313033.2	+	1	909	c.823A>C	c.(823-825)Agt>Cgt	p.S275R		NM_001004745.1	NP_001004745.1	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T, member 1	275						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S275R(2)		NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(27)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	43	Esophageal squamous(21;0.00448)					TGTGAGACCAAGTTCCAGCTA	0.423																																					p.S275R												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.A823C	11						.						226.0	194.0	205.0					11																	56043937		2201	4296	6497	55800513	SO:0001583	missense	390155	exon1			AB065962	CCDS31525.1	11q11	2012-08-09		2004-03-10	ENSG00000181698	ENSG00000181698		"""GPCR / Class A : Olfactory receptors"""	14821	protein-coding gene	gene with protein product				OR5T1P			Standard	NM_001004745		Approved		uc001nio.1	Q8NG75	OTTHUMG00000166853	ENST00000313033.2:c.823A>C	11.37:g.56043937A>C	ENSP00000323612:p.Ser275Arg	Somatic		Capture	Illumina HiSeq	Phase_I	55800513	NM_001004745	B2RNM9	Missense_Mutation	SNP	ENST00000313033.2	37	CCDS31525.1	.	.	.	.	.	.	.	.	.	.	A	11.58	1.681141	0.29872	.	.	ENSG00000181698	ENST00000313033	T	0.00137	8.68	3.48	0.87	0.19102	GPCR, rhodopsin-like superfamily (1);	0.112616	0.39274	N	0.001405	T	0.00178	0.0005	M	0.61703	1.905	0.09310	N	1	B	0.24132	0.098	B	0.37387	0.248	T	0.36841	-0.9731	10	0.72032	D	0.01	.	4.2507	0.10693	0.6692:0.1991:0.1316:0.0	.	275	Q8NG75	OR5T1_HUMAN	R	275	ENSP00000323612:S275R	ENSP00000323612:S275R	S	+	1	0	OR5T1	55800513	0.000000	0.05858	0.275000	0.24674	0.923000	0.55619	0.261000	0.18442	0.052000	0.16007	0.381000	0.24937	AGT		OR5T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391600.1	NM_001004745	
DPF2	5977	broad.mit.edu	37	11	65113720	65113720	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr11:65113720C>T	ENST00000528416.1	+	9	1040	c.907C>T	c.(907-909)Cat>Tat	p.H303Y	DPF2_ENST00000415073.2_Intron|DPF2_ENST00000252268.4_Missense_Mutation_p.H317Y	NM_006268.4	NP_006259.1	Q92785	REQU_HUMAN	D4, zinc and double PHD fingers family 2	303					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|zinc ion binding (GO:0008270)	p.H303Y(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)	23						CACTACAGGGCATCCATCTTG	0.547																																					p.H303Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C907T	11						.						140.0	105.0	117.0					11																	65113720		2201	4297	6498	64870296	SO:0001583	missense	5977	exon9			U94585	CCDS8100.1	11q13.1	2014-05-13	2003-10-06	2003-10-08	ENSG00000133884	ENSG00000133884		"""Zinc fingers, PHD-type"""	9964	protein-coding gene	gene with protein product		601671	"""requiem, apoptosis response zinc finger gene"""	REQ		11845289	Standard	NM_006268		Approved	ubi-d4, BAF45d	uc001odm.3	Q92785	OTTHUMG00000165985	ENST00000528416.1:c.907C>T	11.37:g.65113720C>T	ENSP00000436901:p.His303Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	64870296	NM_006268	A8K7C9|B4DT58	Missense_Mutation	SNP	ENST00000528416.1	37	CCDS8100.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.020289	0.75275	.	.	ENSG00000133884	ENST00000528416;ENST00000252268	D;D	0.94046	-3.2;-3.34	5.62	5.62	0.85841	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.38778	N	0.001576	D	0.97870	0.9300	H	0.96142	3.775	0.80722	D	1	D	0.60160	0.987	D	0.79784	0.993	D	0.98886	1.0771	10	0.87932	D	0	-23.2646	17.1512	0.86778	0.0:1.0:0.0:0.0	.	303	Q92785	REQU_HUMAN	Y	303;317	ENSP00000436901:H303Y;ENSP00000252268:H317Y	ENSP00000252268:H317Y	H	+	1	0	DPF2	64870296	1.000000	0.71417	1.000000	0.80357	0.284000	0.27059	7.701000	0.84566	2.667000	0.90743	0.561000	0.74099	CAT		DPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387293.3	NM_006268	
RELA	5970	broad.mit.edu	37	11	65425864	65425864	+	Silent	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr11:65425864G>A	ENST00000406246.3	-	8	1032	c.771C>T	c.(769-771)taC>taT	p.Y257Y	RELA_ENST00000525693.1_Silent_p.Y257Y|RELA_ENST00000308639.9_Silent_p.Y254Y	NM_001243984.1|NM_001243985.1|NM_021975.3	NP_001230913.1|NP_001230914.1|NP_068810.3	Q04206	TF65_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog A	257	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				acetaldehyde metabolic process (GO:0006117)|aging (GO:0007568)|cellular defense response (GO:0006968)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nicotine (GO:0071316)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to tumor necrosis factor (GO:0071356)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|Fc-epsilon receptor signaling pathway (GO:0038095)|hair follicle development (GO:0001942)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|liver development (GO:0001889)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of Schwann cell differentiation (GO:0014040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|regulation of inflammatory response (GO:0050727)|response to amino acid (GO:0043200)|response to cAMP (GO:0051591)|response to cobalamin (GO:0033590)|response to drug (GO:0042493)|response to insulin (GO:0032868)|response to interleukin-1 (GO:0070555)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to muramyl dipeptide (GO:0032495)|response to organic substance (GO:0010033)|response to progesterone (GO:0032570)|response to UV-B (GO:0010224)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|phosphate ion binding (GO:0042301)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)	p.Y257Y(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(11)|ovary(1)|urinary_tract(1)	19						TGGGGTCTGCGTAGGGAGGGG	0.627																																					p.Y257Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C771T	11						.						82.0	75.0	77.0					11																	65425864		2201	4297	6498	65182440	SO:0001819	synonymous_variant	5970	exon8			Z22951	CCDS31609.1, CCDS44651.1, CCDS73322.1	11q13	2013-07-09	2013-07-09		ENSG00000173039	ENSG00000173039			9955	protein-coding gene	gene with protein product		164014	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells 3"""	NFKB3		2001591	Standard	NM_021975		Approved	p65	uc001ofg.3	Q04206	OTTHUMG00000166566	ENST00000406246.3:c.771C>T	11.37:g.65425864G>A		Somatic		Capture	Illumina HiSeq	Phase_I	65182440	NM_021975	Q6GTV1|Q6SLK1	Silent	SNP	ENST00000406246.3	37	CCDS31609.1																																																																																				RELA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390457.2	NM_021975	
RBM14	10432	broad.mit.edu	37	11	66392424	66392424	+	Silent	SNP	T	T	G			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr11:66392424T>G	ENST00000310137.4	+	2	1216	c.1077T>G	c.(1075-1077)cgT>cgG	p.R359R	RBM14-RBM4_ENST00000500635.2_Intron|RBM4_ENST00000514361.3_Intron|RBM4_ENST00000503028.2_Intron|RBM14_ENST00000393979.3_Intron|RBM14_ENST00000409738.4_Intron|RBM14-RBM4_ENST00000412278.2_Intron|RBM14-RBM4_ENST00000511114.1_Intron	NM_006328.3	NP_006319.1	Q96PK6	RBM14_HUMAN	RNA binding motif protein 14	359	Ala-rich.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|glucocorticoid receptor signaling pathway (GO:0042921)|histone deacetylation (GO:0016575)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to hormone (GO:0009725)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)	p.R359R(1)	RBM14/PACS1(2)	breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						ATGGGGTTCGTGCAGCTGCTT	0.612																																					p.R359R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1077G	11						.						72.0	80.0	77.0					11																	66392424		2200	4295	6495	66149000	SO:0001819	synonymous_variant	10432	exon2			AF080561	CCDS8147.1, CCDS55772.1, CCDS55773.1	11q13.2	2013-02-12			ENSG00000239306	ENSG00000239306		"""RNA binding motif (RRM) containing"""	14219	protein-coding gene	gene with protein product	"""coactivator activator"", ""SYT interacting protein"""	612409				9285794	Standard	NM_006328		Approved	SIP, SYTIP1, COAA, DKFZp779J0927	uc001oit.3	Q96PK6	OTTHUMG00000140380	ENST00000310137.4:c.1077T>G	11.37:g.66392424T>G		Somatic		Capture	Illumina HiSeq	Phase_I	66149000	NM_006328	B0LM41|B3KMN4|D6RGD8|O75932|Q2PYN1|Q53GV1|Q68DQ9|Q96PK5	Silent	SNP	ENST00000310137.4	37	CCDS8147.1																																																																																				RBM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277128.1	NM_006328	
FAT3	120114	broad.mit.edu	37	11	92531511	92531511	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr11:92531511C>G	ENST00000298047.6	+	9	5349	c.5332C>G	c.(5332-5334)Cta>Gta	p.L1778V	FAT3_ENST00000409404.2_Missense_Mutation_p.L1778V|FAT3_ENST00000525166.1_Missense_Mutation_p.L1628V			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1778	Cadherin 16. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L1778V(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CTCAGGCAGCCTAAGTGAGGC	0.453										TCGA Ovarian(4;0.039)																											p.L1778V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C5332G	11						.						29.0	29.0	29.0					11																	92531511		1884	4117	6001	92171159	SO:0001583	missense	120114	exon9			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.5332C>G	11.37:g.92531511C>G	ENSP00000298047:p.Leu1778Val	Somatic		Capture	Illumina HiSeq	Phase_I	92171159	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	C	12.43	1.935438	0.34189	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.57752	0.38;0.38;0.38	5.93	5.93	0.95920	.	.	.	.	.	T	0.21881	0.0527	N	0.00670	-1.27	0.80722	D	1	B	0.15930	0.015	B	0.15870	0.014	T	0.29088	-1.0023	9	0.17832	T	0.49	.	13.2493	0.60041	0.261:0.739:0.0:0.0	.	1778	Q8TDW7-3	.	V	1778;1778;1628	ENSP00000298047:L1778V;ENSP00000387040:L1778V;ENSP00000432586:L1628V	ENSP00000298047:L1778V	L	+	1	2	FAT3	92171159	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.690000	0.61731	2.818000	0.97014	0.591000	0.81541	CTA		FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
TMEM132D	121256	broad.mit.edu	37	12	129558551	129558551	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr12:129558551C>T	ENST00000422113.2	-	9	3495	c.3169G>A	c.(3169-3171)Gac>Aac	p.D1057N	TMEM132D_ENST00000389441.4_Missense_Mutation_p.D595N	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	1057					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.D1057N(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GGGTACTCGTCGTCTGAGGAG	0.512																																					p.D1057N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3169A	12						.						153.0	150.0	151.0					12																	129558551		2203	4300	6503	128124504	SO:0001583	missense	121256	exon9			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.3169G>A	12.37:g.129558551C>T	ENSP00000408581:p.Asp1057Asn	Somatic		Capture	Illumina HiSeq	Phase_I	128124504	NM_133448	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	37	CCDS9266.1	.	.	.	.	.	.	.	.	.	.	C	14.36	2.513069	0.44660	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	T;T	0.10192	2.9;3.69	4.16	4.16	0.48862	.	0.175073	0.37577	N	0.002040	T	0.11793	0.0287	M	0.65975	2.015	0.24021	N	0.996143	P;B	0.48230	0.907;0.17	B;B	0.31495	0.131;0.016	T	0.28713	-1.0035	9	.	.	.	-15.9856	16.8313	0.85945	0.0:1.0:0.0:0.0	.	1057;595	Q14C87;Q14C87-2	T132D_HUMAN;.	N	595;1057	ENSP00000374092:D595N;ENSP00000408581:D1057N	.	D	-	1	0	TMEM132D	128124504	0.001000	0.12720	0.002000	0.10522	0.008000	0.06430	1.239000	0.32719	2.018000	0.59344	0.563000	0.77884	GAC		TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448	
KRAS	3845	broad.mit.edu	37	12	25398281	25398281	+	Missense_Mutation	SNP	C	C	T	rs112445441		TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr12:25398281C>T	ENST00000256078.4	-	2	101	c.38G>A	c.(37-39)gGc>gAc	p.G13D	KRAS_ENST00000311936.3_Missense_Mutation_p.G13D|KRAS_ENST00000556131.1_Missense_Mutation_p.G13D|KRAS_ENST00000557334.1_Missense_Mutation_p.G13D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	13			G -> D (in a breast carcinoma cell line and GASC; somatic mutation). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:3627975}.|G -> R (in pylocytic astrocytoma; somatic mutation; increase activation of the Ras pathway). {ECO:0000269|PubMed:16247081}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G13D(3223)|p.G13V(33)|p.G13A(28)|p.G13E(3)|p.G13I(1)|p.G13N(1)|p.G13_V14>DI(1)|p.G13R(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CTTGCCTACGCCACCAGCTCC	0.338	G13D(DLD1_LARGE_INTESTINE)|G13D(DV90_LUNG)|G13D(HCT116_LARGE_INTESTINE)|G13D(HCT15_LARGE_INTESTINE)|G13D(LOVO_LARGE_INTESTINE)|G13D(MDAMB231_BREAST)|G13D(NCIH647_LUNG)|G13D(NCIH747_LARGE_INTESTINE)|G13D(NOMO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G13D(T84_LARGE_INTESTINE)|G13D(TOLEDO_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G13D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,lung,NS,Substitution - Missense,-1 	.	3291	Substitution - Missense(3290)|Complex - compound substitution(1)	large_intestine(2808)|haematopoietic_and_lymphoid_tissue(94)|lung(92)|endometrium(54)|soft_tissue(38)|ovary(38)|stomach(32)|pancreas(30)|thyroid(27)|biliary_tract(21)|prostate(20)|breast(10)|cervix(4)|gastrointestinal_tract_(site_indeterminate)(3)|upper_aerodigestive_tract(3)|urinary_tract(3)|liver(3)|salivary_gland(3)|small_intestine(3)|oesophagus(2)|skin(1)|genital_tract(1)|bone(1)	c.G38A	12						.						88.0	78.0	82.0					12																	25398281		2203	4300	6503	25289548	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.38G>A	12.37:g.25398281C>T	ENSP00000256078:p.Gly13Asp	Somatic		Capture	Illumina HiSeq	Phase_I	25289548	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.867862	0.91587	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	D;T;T;T	0.82803	-1.65;-0.7;-0.7;-0.7	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90079	0.6901	M	0.93062	3.375	0.80722	D	1	B;P	0.43314	0.215;0.803	B;P	0.46172	0.175;0.506	D	0.92106	0.5692	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	13;13	P01116-2;P01116	.;RASK_HUMAN	D	13	ENSP00000308495:G13D;ENSP00000452512:G13D;ENSP00000256078:G13D;ENSP00000451856:G13D	ENSP00000256078:G13D	G	-	2	0	KRAS	25289548	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGC		KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
IPO8	10526	broad.mit.edu	37	12	30818779	30818779	+	Splice_Site	SNP	C	C	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr12:30818779C>A	ENST00000256079.4	-	12	1560	c.1222G>T	c.(1222-1224)Gtg>Ttg	p.V408L	IPO8_ENST00000544829.1_Splice_Site_p.V203L	NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	408					intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)	p.V408L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TTTGGCAACACCTAAAGAAAC	0.358																																					p.V408L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1222T	12						.						85.0	85.0	85.0					12																	30818779		2203	4300	6503	30710046	SO:0001630	splice_region_variant	10526	exon12			U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.1222-1G>T	12.37:g.30818779C>A		Somatic		Capture	Illumina HiSeq	Phase_I	30710046	NM_006390	B7Z7M3	Missense_Mutation	SNP	ENST00000256079.4	37	CCDS8719.1	.	.	.	.	.	.	.	.	.	.	C	30	5.055631	0.93793	.	.	ENSG00000133704	ENST00000256079;ENST00000544829	T;T	0.67865	-0.29;-0.29	4.52	4.52	0.55395	Armadillo-like helical (1);Armadillo-type fold (1);Exportin/Importin, Cse1-like (1);	0.000000	0.85682	D	0.000000	T	0.76593	0.4009	M	0.74881	2.28	0.80722	D	1	P;D	0.56287	0.877;0.975	P;P	0.55391	0.678;0.775	T	0.74456	-0.3659	10	0.23891	T	0.37	-20.8154	17.7744	0.88503	0.0:1.0:0.0:0.0	.	203;408	B7Z7M3;O15397	.;IPO8_HUMAN	L	408;203	ENSP00000256079:V408L;ENSP00000444520:V203L	ENSP00000256079:V408L	V	-	1	0	IPO8	30710046	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.556000	0.67307	2.497000	0.84241	0.585000	0.79938	GTG		IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402700.2	NM_006390	Missense_Mutation
DENND5B	160518	broad.mit.edu	37	12	31540608	31540608	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr12:31540608G>A	ENST00000389082.5	-	21	4018	c.3754C>T	c.(3754-3756)Cga>Tga	p.R1252*	DENND5B_ENST00000536562.1_Nonsense_Mutation_p.R1287*|DENND5B_ENST00000306833.6_Nonsense_Mutation_p.R1287*	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	1252	RUN 2. {ECO:0000255|PROSITE- ProRule:PRU00178}.				positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.R1252*(1)		NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						TGCAGAATTCGGATAAGGGAG	0.488																																					p.R1252X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3754T	12						.						106.0	100.0	102.0					12																	31540608		1990	4156	6146	31431875	SO:0001587	stop_gained	160518	exon21			AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.3754C>T	12.37:g.31540608G>A	ENSP00000373734:p.Arg1252*	Somatic		Capture	Illumina HiSeq	Phase_I	31431875	NM_144973	B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Nonsense_Mutation	SNP	ENST00000389082.5	37	CCDS44857.1	.	.	.	.	.	.	.	.	.	.	G	42	9.640961	0.99227	.	.	ENSG00000170456	ENST00000389082;ENST00000306833;ENST00000536562	.	.	.	4.98	4.98	0.66077	.	0.157591	0.42821	D	0.000642	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.7112	18.4229	0.90597	0.0:0.0:1.0:0.0	.	.	.	.	X	1252;1287;1287	.	ENSP00000306482:R1287X	R	-	1	2	DENND5B	31431875	1.000000	0.71417	0.998000	0.56505	0.973000	0.67179	1.035000	0.30216	2.597000	0.87782	0.591000	0.81541	CGA		DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402040.1	NM_144973	
SOAT2	8435	broad.mit.edu	37	12	53509273	53509273	+	Silent	SNP	G	G	A	rs151267658	byFrequency	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr12:53509273G>A	ENST00000301466.3	+	6	603	c.543G>A	c.(541-543)ccG>ccA	p.P181P		NM_003578.3	NP_003569.1	O75908	SOAT2_HUMAN	sterol O-acyltransferase 2	181					cholesterol efflux (GO:0033344)|cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|intestinal cholesterol absorption (GO:0030299)|macrophage derived foam cell differentiation (GO:0010742)|very-low-density lipoprotein particle assembly (GO:0034379)	brush border (GO:0005903)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	cholesterol binding (GO:0015485)|cholesterol O-acyltransferase activity (GO:0034736)|fatty-acyl-CoA binding (GO:0000062)|transferase activity, transferring acyl groups (GO:0016746)	p.P181P(1)		endometrium(5)|kidney(3)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|skin(1)	18					Hesperetin(DB01094)	TGTTGGCGCCGTACCAGGCCC	0.677													G|||	2	0.000399361	0.0015	0.0	5008	,	,		17361	0.0		0.0	False		,,,				2504	0.0				p.P181P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G543A	12						.	G		3,4403	6.2+/-15.9	0,3,2200	41.0	41.0	41.0		543	2.7	1.0	12	dbSNP_134	41	0,8600		0,0,4300	no	coding-synonymous	SOAT2	NM_003578.3		0,3,6500	AA,AG,GG		0.0,0.0681,0.0231		181/523	53509273	3,13003	2203	4300	6503	51795540	SO:0001819	synonymous_variant	8435	exon6			AF059203	CCDS8847.1	12q13.13	2012-09-20			ENSG00000167780	ENSG00000167780	2.3.1.26		11178	protein-coding gene	gene with protein product		601311				9756920	Standard	NM_003578		Approved	ACAT2	uc001sbv.3	O75908	OTTHUMG00000169774	ENST00000301466.3:c.543G>A	12.37:g.53509273G>A		Somatic		Capture	Illumina HiSeq	Phase_I	51795540	NM_003578	F5H7W4|I6L9H9|Q4VB99|Q4VBA1|Q96TD4|Q9UNR2	Silent	SNP	ENST00000301466.3	37	CCDS8847.1																																																																																				SOAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405817.1		
CALCOCO1	57658	broad.mit.edu	37	12	54117514	54117514	+	Missense_Mutation	SNP	G	G	A	rs377219497		TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr12:54117514G>A	ENST00000550804.1	-	4	373	c.313C>T	c.(313-315)Cgc>Tgc	p.R105C	CALCOCO1_ENST00000547885.1_5'Flank|CALCOCO1_ENST00000262059.4_Missense_Mutation_p.R105C|CALCOCO1_ENST00000548263.1_Missense_Mutation_p.R105C|CALCOCO1_ENST00000430117.2_Intron			Q9P1Z2	CACO1_HUMAN	calcium binding and coiled-coil domain 1	105	N-terminal AD (CTNNB1 binding site). {ECO:0000250}.				intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)	p.R105C(1)		NS(2)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	28						TGGCCCTGGCGGTTCACATAT	0.592																																					p.R105C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C313T	12						.	G	CYS/ARG,	0,4406		0,0,2203	52.0	55.0	54.0		313,	4.8	1.0	12		54	1,8599	1.2+/-3.3	0,1,4299	no	missense,intron	CALCOCO1	NM_020898.2,NM_001143682.1	180,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,	105/692,	54117514	1,13005	2203	4300	6503	52403781	SO:0001583	missense	57658	exon4			AL136895	CCDS8864.1, CCDS44908.1	12q13.13	2014-01-02			ENSG00000012822	ENSG00000012822			29306	protein-coding gene	gene with protein product	"""coiled-coil leucine zipper coactivator 1"", ""inorganic pyrophosphatase activator"""					10819331, 11230166	Standard	NM_020898		Approved	KIAA1536, calphoglin, Cocoa	uc001sef.3	Q9P1Z2	OTTHUMG00000170095	ENST00000550804.1:c.313C>T	12.37:g.54117514G>A	ENSP00000449960:p.Arg105Cys	Somatic		Capture	Illumina HiSeq	Phase_I	52403781	NM_020898	B3KVA8|Q6FI59|Q71RC3|Q86WF8|Q96JU3|Q9H090	Missense_Mutation	SNP	ENST00000550804.1	37	CCDS8864.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.552327	0.86127	0.0	1.16E-4	ENSG00000012822	ENST00000262059;ENST00000548263;ENST00000550804;ENST00000549935;ENST00000551900;ENST00000546619;ENST00000547949;ENST00000553154;ENST00000549784;ENST00000549173;ENST00000548177;ENST00000552623	T;T;T;T;T;T;T;T;T	0.11169	2.8;2.8;2.8;2.8;2.8;2.8;2.8;2.8;2.8	4.79	4.79	0.61399	.	0.000000	0.46442	D	0.000290	T	0.19208	0.0461	L	0.29908	0.895	0.80722	D	1	D;D;D;D	0.69078	0.997;0.996;0.996;0.997	P;P;P;P	0.57846	0.828;0.736;0.736;0.828	T	0.00901	-1.1521	10	0.62326	D	0.03	-10.8076	17.4946	0.87714	0.0:0.0:1.0:0.0	.	98;105;105;105	B4DG60;Q9P1Z2-3;Q9P1Z2-2;Q9P1Z2	.;.;.;CACO1_HUMAN	C	105;105;105;98;105;105;105;105;105;125;105;105	ENSP00000262059:R105C;ENSP00000447647:R105C;ENSP00000449960:R105C;ENSP00000450083:R105C;ENSP00000448621:R105C;ENSP00000447117:R105C;ENSP00000449058:R125C;ENSP00000446820:R105C;ENSP00000448026:R105C	ENSP00000262059:R105C	R	-	1	0	CALCOCO1	52403781	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	1.688000	0.37690	2.586000	0.87340	0.655000	0.94253	CGC		CALCOCO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407233.2	NM_020898	
HNRNPA1	3178	broad.mit.edu	37	12	54675593	54675593	+	Silent	SNP	A	A	C			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr12:54675593A>C	ENST00000340913.6	+	3	200	c.147A>C	c.(145-147)ccA>ccC	p.P49P	HNRNPA1_ENST00000547276.1_Silent_p.P49P|HNRNPA1_ENST00000330752.8_Silent_p.P49P|CBX5_ENST00000209875.4_5'Flank|HNRNPA1_ENST00000546500.1_Silent_p.P49P|RP11-968A15.2_ENST00000547177.1_RNA|RP11-968A15.8_ENST00000553061.1_RNA	NM_002136.2|NM_031157.2	NP_002127.1|NP_112420.1	P09651	ROA1_HUMAN	heterogeneous nuclear ribonucleoprotein A1	49	Globular A domain.|RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell death (GO:0008219)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|nuclear export (GO:0051168)|nuclear import (GO:0051170)|RNA export from nucleus (GO:0006405)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)|single-stranded RNA binding (GO:0003727)	p.P49P(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20						TGAGAGATCCAAACACCAAGC	0.443																																					p.P49P	Colon(83;502 1289 8436 16406 24870)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A147C	12						.						46.0	46.0	46.0					12																	54675593		1976	4197	6173	52961860	SO:0001819	synonymous_variant	3178	exon3			BC009600	CCDS41793.1, CCDS44909.1	12q13.1	2013-10-11		2007-08-16	ENSG00000135486	ENSG00000135486		"""RNA binding motif (RRM) containing"""	5031	protein-coding gene	gene with protein product		164017		HNRPA1		1733858	Standard	XR_245923		Approved	hnRNPA1, hnRNP-A1	uc001sfl.3	P09651		ENST00000340913.6:c.147A>C	12.37:g.54675593A>C		Somatic		Capture	Illumina HiSeq	Phase_I	52961860	NM_031157	A8K4Z8|Q3MIB7|Q6PJZ7	Silent	SNP	ENST00000340913.6	37	CCDS44909.1																																																																																				HNRNPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000405480.1	NM_031157	
ANKS1B	56899	broad.mit.edu	37	12	99192716	99192716	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr12:99192716A>T	ENST00000547776.2	-	21	3262	c.3263T>A	c.(3262-3264)aTg>aAg	p.M1088K	ANKS1B_ENST00000550693.2_Missense_Mutation_p.M278K|ANKS1B_ENST00000332712.7_Missense_Mutation_p.M278K|ANKS1B_ENST00000341752.7_Missense_Mutation_p.M94K|ANKS1B_ENST00000549025.2_Missense_Mutation_p.M186K|ANKS1B_ENST00000549493.2_Missense_Mutation_p.M338K|ANKS1B_ENST00000547446.1_Missense_Mutation_p.M223K|ANKS1B_ENST00000546960.1_Missense_Mutation_p.M314K|ANKS1B_ENST00000546568.1_Missense_Mutation_p.M254K|ANKS1B_ENST00000549558.2_Missense_Mutation_p.M254K|ANKS1B_ENST00000333732.7_Missense_Mutation_p.M118K|ANKS1B_ENST00000329257.7_Missense_Mutation_p.M1088K|ANKS1B_ENST00000547010.1_Missense_Mutation_p.M604K	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	1088	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.					cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)	p.M1088K(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		ACTTACCCGCATTTTTGCACA	0.333																																					p.M338K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1013A	12						.						108.0	103.0	105.0					12																	99192716		1818	4076	5894	97716847	SO:0001583	missense	56899	exon8			AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.3263T>A	12.37:g.99192716A>T	ENSP00000449629:p.Met1088Lys	Somatic		Capture	Illumina HiSeq	Phase_I	97716847	NM_181670	A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Missense_Mutation	SNP	ENST00000547776.2	37	CCDS55872.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	27.5|27.5	4.833239|4.833239	0.91036|0.91036	.|.	.|.	ENSG00000185046|ENSG00000185046	ENST00000550778|ENST00000341752;ENST00000549558;ENST00000547776;ENST00000547010;ENST00000329257;ENST00000538702;ENST00000550693;ENST00000549025;ENST00000549493;ENST00000547446;ENST00000333732;ENST00000546568;ENST00000332712;ENST00000407362;ENST00000546960	.|T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.19669	.|2.13;2.13;2.13;2.13;2.13;2.13;2.13;2.13;2.13;2.13;2.13;2.13;2.13	5.93|5.93	5.93|5.93	0.95920|0.95920	.|Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.45337|0.45337	0.1337|0.1337	M|M	0.61703|0.61703	1.905|1.905	0.58432|0.58432	D|D	0.999993|0.999993	.|P;D;D;P;D;D;P;P;D;D;D;D;P	.|0.64830	.|0.952;0.988;0.99;0.76;0.994;0.98;0.76;0.869;0.988;0.964;0.975;0.987;0.928	.|P;P;P;P;P;P;P;P;P;P;P;D;P	.|0.72982	.|0.647;0.717;0.814;0.66;0.896;0.701;0.66;0.563;0.717;0.681;0.883;0.979;0.775	T|T	0.38308|0.38308	-0.9667|-0.9667	5|10	.|0.87932	.|D	.|0	-15.393|-15.393	16.3797|16.3797	0.83452|0.83452	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|223;118;118;314;278;228;302;254;338;186;604;1088;254	.|F8VPM3;F8VR14;B7Z9I9;Q7Z6G8-4;Q7Z6G8-5;B1VKB5;F8VQW6;Q7Z6G8-2;Q7Z6G8-3;F8VZR9;Q7Z6G8-6;Q7Z6G8;Q7Z6G8-7	.|.;.;.;.;.;.;.;.;.;.;.;ANS1B_HUMAN;.	S|K	360|94;254;1088;604;1088;603;278;186;338;223;118;254;278;179;314	.|ENSP00000345510:M94K;ENSP00000448993:M254K;ENSP00000449629:M1088K;ENSP00000448512:M604K;ENSP00000331381:M1088K;ENSP00000447999:M278K;ENSP00000447312:M186K;ENSP00000448203:M338K;ENSP00000450015:M223K;ENSP00000331256:M118K;ENSP00000448205:M254K;ENSP00000332683:M278K;ENSP00000447839:M314K	.|ENSP00000331381:M1088K	C|M	-|-	1|2	0|0	ANKS1B|ANKS1B	97716847|97716847	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	8.562000|8.562000	0.90719|0.90719	2.271000|2.271000	0.75665|0.75665	0.533000|0.533000	0.62120|0.62120	TGC|ATG		ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000408421.3	NM_020140	
STX2	2054	broad.mit.edu	37	12	131297522	131297522	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr12:131297522T>G	ENST00000392373.2	-	4	354	c.260A>C	c.(259-261)aAa>aCa	p.K87T	RP11-989F5.1_ENST00000546264.1_lincRNA|RP11-989F5.3_ENST00000542821.1_lincRNA|snoU13_ENST00000459050.1_RNA|STX2_ENST00000261653.6_Missense_Mutation_p.K87T	NM_194356.2	NP_919337.1	P32856	STX2_HUMAN	syntaxin 2	87					acrosome reaction (GO:0007340)|cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|intracellular protein transport (GO:0006886)|organ morphogenesis (GO:0009887)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|signal transduction (GO:0007165)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)	calcium-dependent protein binding (GO:0048306)	p.K87T(2)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)	16	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.79e-06)|all cancers(50;5.27e-05)|Epithelial(86;5.29e-05)		GGCTCGAATTTTATTCGCAGT	0.259																																					p.K87T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A260C	12						.						95.0	99.0	98.0					12																	131297522		2202	4296	6498	129863475	SO:0001583	missense	2054	exon4			D14582	CCDS9269.1, CCDS9270.1	12q24	2008-02-05	2006-04-25	2006-04-25	ENSG00000111450	ENSG00000111450			3403	protein-coding gene	gene with protein product		132350	"""epimorphin"""	STX2B, STX2C, STX2A, EPIM		8938452, 15943887	Standard	NM_001980		Approved	EPM	uc001uio.4	P32856	OTTHUMG00000168365	ENST00000392373.2:c.260A>C	12.37:g.131297522T>G	ENSP00000376178:p.Lys87Thr	Somatic		Capture	Illumina HiSeq	Phase_I	129863475	NM_194356	Q86VW8	Missense_Mutation	SNP	ENST00000392373.2	37	CCDS9270.1	.	.	.	.	.	.	.	.	.	.	T	12.35	1.911874	0.33721	.	.	ENSG00000111450	ENST00000261653;ENST00000392373	T;T	0.20200	2.09;2.09	4.38	2.04	0.26737	t-SNARE (1);Syntaxin, N-terminal (2);	0.354250	0.32231	N	0.006387	T	0.21347	0.0514	M	0.70903	2.155	0.27454	N	0.953349	B;B;B	0.17268	0.021;0.008;0.015	B;B;B	0.19946	0.011;0.011;0.027	T	0.16660	-1.0395	10	0.32370	T	0.25	-14.6089	7.8165	0.29263	0.0:0.1566:0.0:0.8434	.	87;87;87	P32856-3;P32856-2;P32856	.;.;STX2_HUMAN	T	87	ENSP00000261653:K87T;ENSP00000376178:K87T	ENSP00000261653:K87T	K	-	2	0	STX2	129863475	0.936000	0.31750	0.480000	0.27341	0.712000	0.41017	1.439000	0.35013	0.333000	0.23563	0.533000	0.62120	AAA		STX2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399455.2	NM_194356	
VWA8	23078	broad.mit.edu	37	13	42465571	42465571	+	Nonsense_Mutation	SNP	G	G	T	rs57255143		TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr13:42465571G>T	ENST00000379310.3	-	5	704	c.636C>A	c.(634-636)taC>taA	p.Y212*	VWA8_ENST00000281496.6_Nonsense_Mutation_p.Y212*	NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	212						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.Y212*(1)									GAAGTTTGTCGTAACGCTCAG	0.438																																					p.Y212X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C636A	13						.						158.0	149.0	152.0					13																	42465571		2203	4300	6503	41363571	SO:0001587	stop_gained	23078	exon5			AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.636C>A	13.37:g.42465571G>T	ENSP00000368612:p.Tyr212*	Somatic		Capture	Illumina HiSeq	Phase_I	41363571	NM_015058	O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Nonsense_Mutation	SNP	ENST00000379310.3	37	CCDS41881.1	.	.	.	.	.	.	.	.	.	.	G	34	5.322326	0.95708	.	.	ENSG00000102763	ENST00000251030;ENST00000379310;ENST00000281496;ENST00000398857	.	.	.	5.71	-9.4	0.00616	.	0.153522	0.43747	D	0.000529	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	21.3045	0.99951	0.8612:0.0:0.1388:0.0	.	.	.	.	X	116;212;212;212	.	ENSP00000251030:Y116X	Y	-	3	2	KIAA0564	41363571	0.001000	0.12720	0.058000	0.19502	0.955000	0.61496	-1.350000	0.02624	-2.368000	0.00604	-0.808000	0.03180	TAC		VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354828.2	NM_015058	
AKAP11	11215	broad.mit.edu	37	13	42875055	42875055	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr13:42875055A>G	ENST00000025301.2	+	8	2348	c.2173A>G	c.(2173-2175)Atc>Gtc	p.I725V		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	725					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)	p.I725V(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		TACGGATAATATCAAGTATGT	0.408																																					p.I725V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2173G	13						.						147.0	137.0	140.0					13																	42875055		2203	4300	6503	41773055	SO:0001583	missense	11215	exon8			AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.2173A>G	13.37:g.42875055A>G	ENSP00000025301:p.Ile725Val	Somatic		Capture	Illumina HiSeq	Phase_I	41773055	NM_016248	O75124|Q9NUK7	Missense_Mutation	SNP	ENST00000025301.2	37	CCDS9383.1	.	.	.	.	.	.	.	.	.	.	A	0.008	-1.896971	0.00517	.	.	ENSG00000023516	ENST00000025301	T	0.15487	2.42	5.98	-2.45	0.06481	.	0.712950	0.13507	N	0.382818	T	0.05777	0.0151	N	0.04880	-0.145	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.41980	-0.9478	10	0.06365	T	0.9	.	8.9651	0.35872	0.3292:0.2141:0.4567:0.0	.	725	Q9UKA4	AKA11_HUMAN	V	725	ENSP00000025301:I725V	ENSP00000025301:I725V	I	+	1	0	AKAP11	41773055	0.293000	0.24371	0.000000	0.03702	0.013000	0.08279	0.573000	0.23699	-0.630000	0.05567	0.482000	0.46254	ATC		AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044700.2	NM_016248	
SERPINE3	647174	broad.mit.edu	37	13	51929218	51929218	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr13:51929218A>C	ENST00000521255.1	+	5	999	c.939A>C	c.(937-939)ttA>ttC	p.L313F	SERPINE3_ENST00000524365.1_Missense_Mutation_p.L313F|SERPINE3_ENST00000400389.4_Missense_Mutation_p.L313F	NM_001101320.1	NP_001094790.1	A8MV23	SERP3_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 3	313					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.L313F(1)		ovary(2)	2						AAAGCATTTTAAATTCTTGGG	0.338																																					p.L313F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A939C	13						.						58.0	52.0	54.0					13																	51929218		1782	4017	5799	50827219	SO:0001583	missense	647174	exon5			AX772926	CCDS53870.1	13q14.3	2014-02-18			ENSG00000253309	ENSG00000253309		"""Serine (or cysteine) peptidase inhibitors"""	24774	protein-coding gene	gene with protein product						24172014	Standard	NM_001101320		Approved		uc001vfh.2	A8MV23	OTTHUMG00000016943	ENST00000521255.1:c.939A>C	13.37:g.51929218A>C	ENSP00000428316:p.Leu313Phe	Somatic		Capture	Illumina HiSeq	Phase_I	50827219	NM_001101320	B1V8P3	Missense_Mutation	SNP	ENST00000521255.1	37	CCDS53870.1	.	.	.	.	.	.	.	.	.	.	A	12.71	2.020547	0.35606	.	.	ENSG00000253309	ENST00000524365;ENST00000521255;ENST00000400389	D;D;D	0.95035	-3.59;-3.59;-3.59	4.69	3.52	0.40303	Serpin domain (3);	0.158172	0.29646	U	0.011569	D	0.95614	0.8574	M	0.80332	2.49	0.54753	D	0.999986	D;P	0.58268	0.982;0.898	P;P	0.58520	0.84;0.567	D	0.94319	0.7552	10	0.87932	D	0	.	5.9336	0.19152	0.7981:0.0:0.2019:0.0	.	313;313	A8MV23-2;A8MV23	.;SERP3_HUMAN	F	313	ENSP00000430755:L313F;ENSP00000428316:L313F;ENSP00000441468:L313F	ENSP00000441468:L313F	L	+	3	2	SERPINE3	50827219	0.671000	0.27521	0.717000	0.30585	0.736000	0.42039	0.770000	0.26618	0.844000	0.35094	0.460000	0.39030	TTA		SERPINE3-001	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045021.2	NM_001101320	
HECTD1	25831	broad.mit.edu	37	14	31617997	31617997	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr14:31617997T>A	ENST00000399332.1	-	15	2914	c.2426A>T	c.(2425-2427)gAa>gTa	p.E809V	HECTD1_ENST00000553700.1_Missense_Mutation_p.E809V	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	809					neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)	p.E809V(1)		breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		AGTCACAAATTCTGAACCTTG	0.323																																					p.E809V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2426T	14						.						81.0	76.0	78.0					14																	31617997		1797	4062	5859	30687748	SO:0001583	missense	25831	exon15			AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.2426A>T	14.37:g.31617997T>A	ENSP00000382269:p.Glu809Val	Somatic		Capture	Illumina HiSeq	Phase_I	30687748	NM_015382	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	ENST00000399332.1	37	CCDS41939.1	.	.	.	.	.	.	.	.	.	.	T	19.43	3.826007	0.71143	.	.	ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332;ENST00000553957;ENST00000556224	T;T;T;T	0.17854	2.25;2.25;2.25;2.25	6.1	6.1	0.99115	Armadillo-type fold (1);	0.069128	0.56097	U	0.000035	T	0.33440	0.0863	L	0.54323	1.7	0.80722	D	1	D;P	0.67145	0.996;0.759	P;B	0.56788	0.806;0.245	T	0.02121	-1.1210	10	0.87932	D	0	-15.2432	16.3594	0.83251	0.0:0.0:0.0:1.0	.	809;809	D3DS86;Q9ULT8	.;HECD1_HUMAN	V	809;809;809;283;809	ENSP00000450697:E809V;ENSP00000382269:E809V;ENSP00000451860:E283V;ENSP00000452015:E809V	ENSP00000261312:E809V	E	-	2	0	HECTD1	30687748	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.021000	0.88750	2.340000	0.79590	0.528000	0.53228	GAA		HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1		
EXOC5	10640	broad.mit.edu	37	14	57676674	57676674	+	Silent	SNP	A	A	C			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr14:57676674A>C	ENST00000413566.2	-	16	2078	c.1719T>G	c.(1717-1719)acT>acG	p.T573T	EXOC5_ENST00000340918.7_Silent_p.T508T	NM_006544.3	NP_006535.1	O00471	EXOC5_HUMAN	exocyst complex component 5	573					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|vesicle docking (GO:0048278)	cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.T575T(1)		breast(3)|endometrium(1)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	22						TACTCACATTAGTATATTGAA	0.284																																					p.T573T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1719G	14						.						59.0	54.0	56.0					14																	57676674		1831	4062	5893	56746427	SO:0001819	synonymous_variant	10640	exon16			U85946	CCDS45111.1	14q22.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000070367	ENSG00000070367			10696	protein-coding gene	gene with protein product		604469	"""SEC10 (S. cerevisiae)-like 1"", ""SEC10-like 1 (S. cerevisiae)"""	SEC10L1		9119050	Standard	XM_005267272		Approved	SEC10, SEC10P	uc001xct.3	O00471	OTTHUMG00000171309	ENST00000413566.2:c.1719T>G	14.37:g.57676674A>C		Somatic		Capture	Illumina HiSeq	Phase_I	56746427	NM_006544	B2R6C5	Silent	SNP	ENST00000413566.2	37	CCDS45111.1																																																																																				EXOC5-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412905.1	NM_006544	
TOMM20L	387990	broad.mit.edu	37	14	58874096	58874096	+	Silent	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr14:58874096G>A	ENST00000360945.2	+	4	357	c.315G>A	c.(313-315)gaG>gaA	p.E105E	RP11-517O13.1_ENST00000556734.1_RNA|TIMM9_ENST00000216463.4_5'Flank	NM_207377.2	NP_997260.1	Q6UXN7	TO20L_HUMAN	translocase of outer mitochondrial membrane 20 homolog (yeast)-like	105					protein targeting (GO:0006605)	integral component of membrane (GO:0016021)|mitochondrial outer membrane translocase complex (GO:0005742)		p.E105E(1)		large_intestine(2)|lung(2)	4						TAGTGTGCGAGCAACCACGGG	0.428																																					p.E105E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G315A	14						.						103.0	98.0	99.0					14																	58874096		2203	4300	6503	57943849	SO:0001819	synonymous_variant	387990	exon4				CCDS9734.1	14q23.1	2009-01-14			ENSG00000196860	ENSG00000196860			33752	protein-coding gene	gene with protein product	"""translocase of outer mitochondrial membrane 20 homolog type I"""					15733919	Standard	NM_207377		Approved	UNQ9438	uc001xdr.1	Q6UXN7	OTTHUMG00000140323	ENST00000360945.2:c.315G>A	14.37:g.58874096G>A		Somatic		Capture	Illumina HiSeq	Phase_I	57943849	NM_207377	B2RPR0	Silent	SNP	ENST00000360945.2	37	CCDS9734.1																																																																																				TOMM20L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276937.1	NM_207377	
GPHN	10243	broad.mit.edu	37	14	67646310	67646310	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr14:67646310A>C	ENST00000315266.5	+	21	3117	c.1996A>C	c.(1996-1998)Aaa>Caa	p.K666Q	GPHN_ENST00000543237.1_Missense_Mutation_p.K712Q|GPHN_ENST00000544752.2_3'UTR|GPHN_ENST00000305960.9_Missense_Mutation_p.K635Q|GPHN_ENST00000478722.1_Missense_Mutation_p.K699Q	NM_001024218.1	NP_001019389.1	Q9NQX3	GEPH_HUMAN	gephyrin	666	MPT adenylyltransferase.				establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycine receptor clustering (GO:0072579)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|molybdopterin adenylyltransferase activity (GO:0061598)|molybdopterin molybdotransferase activity (GO:0061599)|transferase activity (GO:0016740)	p.K699Q(1)		large_intestine(8)|liver(1)|ovary(2)|stomach(1)	12		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		ATGTGATGTAAAACTTGATCC	0.388			T	MLL	AL																																p.K666Q			Dom	yes		14	14q24	10243	gephyrin (GPH)		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1996C	14						.						149.0	118.0	129.0					14																	67646310		2203	4300	6503	66716063	SO:0001583	missense	10243	exon21			AB037806	CCDS9777.1, CCDS32103.1	14q23.3	2008-04-22			ENSG00000171723	ENSG00000171723			15465	protein-coding gene	gene with protein product		603930				1319186, 10325225, 18403029	Standard	XM_005267250		Approved	KIAA1385	uc001xix.3	Q9NQX3	OTTHUMG00000029785	ENST00000315266.5:c.1996A>C	14.37:g.67646310A>C	ENSP00000312771:p.Lys666Gln	Somatic		Capture	Illumina HiSeq	Phase_I	66716063	NM_001024218	Q9H4E9|Q9P2G2	Missense_Mutation	SNP	ENST00000315266.5	37	CCDS32103.1	.	.	.	.	.	.	.	.	.	.	A	17.63	3.437742	0.62955	.	.	ENSG00000171723	ENST00000315266;ENST00000478722;ENST00000543237;ENST00000305960	.	.	.	5.79	5.79	0.91817	MoeA, C-terminal, domain IV (3);	0.000000	0.85682	D	0.000000	T	0.59155	0.2173	L	0.57536	1.79	0.80722	D	1	B;B;B;B	0.33583	0.161;0.418;0.123;0.077	B;B;B;B	0.28385	0.039;0.089;0.066;0.069	T	0.62845	-0.6768	9	0.66056	D	0.02	-10.2587	16.1342	0.81471	1.0:0.0:0.0:0.0	.	635;712;666;699	F8W7D6;F5H039;Q9NQX3;Q9NQX3-2	.;.;GEPH_HUMAN;.	Q	666;699;712;635	.	ENSP00000303019:K635Q	K	+	1	0	GPHN	66716063	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.237000	0.95368	2.209000	0.71365	0.533000	0.62120	AAA		GPHN-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000074299.2	NM_020806	
ZC2HC1C	79696	broad.mit.edu	37	14	75538609	75538609	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr14:75538609G>A	ENST00000524913.1	+	2	1822	c.1333G>A	c.(1333-1335)Gcc>Acc	p.A445T	ACYP1_ENST00000555463.1_5'Flank|ZC2HC1C_ENST00000238686.8_Intron|ZC2HC1C_ENST00000439583.2_Intron|ZC2HC1C_ENST00000526748.1_Intron	NM_024643.2	NP_078919.2	Q53FD0	ZC21C_HUMAN	zinc finger, C2HC-type containing 1C	445							metal ion binding (GO:0046872)	p.A445T(1)									GCCAGCTTCAGCCAAGGTAAC	0.493																																					p.A445T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1333A	14						.						39.0	40.0	40.0					14																	75538609		1968	4145	6113	74608362	SO:0001583	missense	79696	exon2			AK026746	CCDS41972.1, CCDS45138.1	14q24.3	2013-01-10	2012-02-03	2012-02-03	ENSG00000119703	ENSG00000119703		"""Zinc fingers, C2HC-type containing"""	20354	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 140"", ""family with sequence similarity 164, member C"""	C14orf140, FAM164C			Standard	XM_005268062		Approved		uc001xrh.3	Q53FD0	OTTHUMG00000167439	ENST00000524913.1:c.1333G>A	14.37:g.75538609G>A	ENSP00000435550:p.Ala445Thr	Somatic		Capture	Illumina HiSeq	Phase_I	74608362	NM_024643	E9PJQ0|Q9BTA8|Q9H5S9	Missense_Mutation	SNP	ENST00000524913.1	37	CCDS41972.1	.	.	.	.	.	.	.	.	.	.	G	10.64	1.406127	0.25378	.	.	ENSG00000119703	ENST00000524913	T	0.46451	0.87	5.01	3.19	0.36642	.	1.181490	0.06382	N	0.715439	T	0.25158	0.0611	N	0.19112	0.55	0.09310	N	0.999999	B	0.29716	0.255	B	0.24394	0.053	T	0.23119	-1.0197	9	.	.	.	-1.4665	3.8568	0.08979	0.1536:0.1373:0.5831:0.1261	.	445	E9PJQ0	.	T	445	ENSP00000435550:A445T	.	A	+	1	0	FAM164C	74608362	0.000000	0.05858	0.090000	0.20809	0.983000	0.72400	0.737000	0.26144	0.830000	0.34757	0.655000	0.94253	GCC		ZC2HC1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394616.4	NM_001042430	
EML1	2009	broad.mit.edu	37	14	100361034	100361034	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr14:100361034G>C	ENST00000262233.6	+	6	755	c.616G>C	c.(616-618)Gat>Cat	p.D206H	EML1_ENST00000334192.4_Missense_Mutation_p.D225H|EML1_ENST00000327921.9_Missense_Mutation_p.D194H	NM_004434.2	NP_004425.2	O00423	EMAL1_HUMAN	echinoderm microtubule associated protein like 1	206	Tandem atypical propeller in EMLs.				brain development (GO:0007420)|hematopoietic progenitor cell differentiation (GO:0002244)|microtubule cytoskeleton organization (GO:0000226)|mitotic spindle organization (GO:0007052)|neuroblast proliferation (GO:0007405)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	calcium ion binding (GO:0005509)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)	p.D225H(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Melanoma(154;0.0879)|all_epithelial(191;0.216)				AGATCAAGTGGATTCTTACAG	0.383																																					p.D225H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G673C	14						.						124.0	109.0	114.0					14																	100361034		2203	4300	6503	99430787	SO:0001583	missense	2009	exon7			AK023861	CCDS32154.1, CCDS32155.1	14q32	2013-01-10		2002-02-15		ENSG00000066629		"""WD repeat domain containing"""	3330	protein-coding gene	gene with protein product		602033		EMAPL		9226380, 10521658	Standard	XM_005267397		Approved	EMAP, HuEMAP, ELP79	uc001ygr.3	O00423		ENST00000262233.6:c.616G>C	14.37:g.100361034G>C	ENSP00000262233:p.Asp206His	Somatic		Capture	Illumina HiSeq	Phase_I	99430787	NM_001008707	Q86U15|Q8N536|Q8N5C4|Q8WWL6	Missense_Mutation	SNP	ENST00000262233.6	37	CCDS32155.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.829029	0.90955	.	.	ENSG00000066629	ENST00000554479;ENST00000327921;ENST00000262233;ENST00000334192;ENST00000542138;ENST00000556714	T;T;T;T;T	0.34667	1.35;1.35;1.35;1.35;1.35	5.32	5.32	0.75619	HELP (1);	0.190072	0.56097	D	0.000040	T	0.39937	0.1097	L	0.29908	0.895	0.80722	D	1	P;P;B;P;P	0.48162	0.676;0.906;0.011;0.676;0.723	P;P;B;P;P	0.49226	0.603;0.571;0.063;0.603;0.576	T	0.29274	-1.0017	10	0.62326	D	0.03	-15.1866	18.9766	0.92740	0.0:0.0:1.0:0.0	.	194;194;206;225;225	F8W717;B7Z650;O00423;O00423-3;B3KXA3	.;.;EMAL1_HUMAN;.;.	H	193;194;206;225;225;175	ENSP00000451346:D193H;ENSP00000327384:D194H;ENSP00000262233:D206H;ENSP00000334314:D225H;ENSP00000452089:D175H	ENSP00000262233:D206H	D	+	1	0	EML1	99430787	1.000000	0.71417	0.987000	0.45799	0.981000	0.71138	9.869000	0.99810	2.471000	0.83476	0.585000	0.79938	GAT		EML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413943.1	NM_001008707	
DPH6	89978	broad.mit.edu	37	15	35664092	35664093	+	3'UTR	INS	-	-	A	rs551151049	byFrequency	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr15:35664092_35664093insA	ENST00000256538.4	-	0	1088_1089				DPH6_ENST00000560386.1_Intron|MIR3942_ENST00000585264.1_RNA	NM_080650.3	NP_542381.1	Q7L8W6	DPH6_HUMAN	diphthamine biosynthesis 6						peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)		ATP binding (GO:0005524)|diphthine-ammonia ligase activity (GO:0017178)										TGAAATAAAAGAAAAAAAAGGT	0.347													AAAAAAAA|AAAAAAAA|AAAAAAAAA|insertion	3	0.000599042	0.0	0.0	5008	,	,		15851	0.0		0.0	False		,,,				2504	0.0031				.												.	.	0			.	15						.																																			33451385	SO:0001624	3_prime_UTR_variant	89978	.				CCDS10043.1, CCDS45213.1	15q14	2013-06-19	2013-06-19	2013-05-02	ENSG00000134146	ENSG00000134146	6.3.1.14		30543	protein-coding gene	gene with protein product	"""diphthine--ammonia ligase"""		"""ATP binding domain 4"", ""DPH6 homolog (S. cerevisiae)"""	ATPBD4		23169644, 23468660	Standard	NM_080650		Approved	MGC14798		Q7L8W6	OTTHUMG00000129759	ENST00000256538.4:c.*259->T	15.37:g.35664100_35664100dupA		Somatic		Capture	Illumina HiSeq	Phase_I	33451384	.	B3KWG1|Q96HJ6	Splice_Site	INS	ENST00000256538.4	37	CCDS10043.1																																																																																				DPH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251973.1	NM_080650	
RYR3	6263	broad.mit.edu	37	15	33927942	33927942	+	Silent	SNP	C	C	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr15:33927942C>T	ENST00000389232.4	+	26	3373	c.3303C>T	c.(3301-3303)gtC>gtT	p.V1101V	RYR3_ENST00000415757.3_Silent_p.V1101V	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1101	4 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.V1101V(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		ACATGCGAGTCGGCTGGGCGA	0.502																																					p.V1101V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3303T	15						.						62.0	65.0	64.0					15																	33927942		2027	4198	6225	31715234	SO:0001819	synonymous_variant	6263	exon26				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.3303C>T	15.37:g.33927942C>T		Somatic		Capture	Illumina HiSeq	Phase_I	31715234	NM_001036	O15175|Q15412	Silent	SNP	ENST00000389232.4	37	CCDS45210.1																																																																																				RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
LEO1	123169	broad.mit.edu	37	15	52258693	52258693	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr15:52258693A>T	ENST00000299601.5	-	2	127	c.67T>A	c.(67-69)Tct>Act	p.S23T	LEO1_ENST00000315141.5_Missense_Mutation_p.S23T	NM_138792.2	NP_620147.1	Q8WVC0	LEO1_HUMAN	Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)	23	Asp-rich.				endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of myeloid cell differentiation (GO:0045638)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)		p.S23T(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|skin(1)	14				all cancers(107;0.00264)		TCAGATCCAGAATCAGAATCT	0.418																																					p.S23T	Esophageal Squamous(40;229 896 18505 32465 43844)|Ovarian(53;886 1123 14462 18432 23189)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T67A	15						.						78.0	76.0	77.0					15																	52258693		2190	4292	6482	50045985	SO:0001583	missense	123169	exon2			AY302186	CCDS10146.1, CCDS66767.1	15q21.2	2008-02-05			ENSG00000166477	ENSG00000166477			30401	protein-coding gene	gene with protein product		610507				15632063	Standard	NM_001286430		Approved		uc002abo.3	Q8WVC0	OTTHUMG00000131843	ENST00000299601.5:c.67T>A	15.37:g.52258693A>T	ENSP00000299601:p.Ser23Thr	Somatic		Capture	Illumina HiSeq	Phase_I	50045985	NM_138792	Q96N99	Missense_Mutation	SNP	ENST00000299601.5	37	CCDS10146.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.131372	0.77549	.	.	ENSG00000166477	ENST00000299601;ENST00000538386;ENST00000315141	.	.	.	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.65954	0.2741	L	0.34521	1.04	0.80722	D	1	D;D	0.58268	0.974;0.982	D;D	0.70487	0.969;0.952	T	0.65372	-0.6184	9	0.39692	T	0.17	.	15.5373	0.76013	1.0:0.0:0.0:0.0	.	23;23	Q8WVC0-2;Q8WVC0	.;LEO1_HUMAN	T	23	.	ENSP00000299601:S23T	S	-	1	0	LEO1	50045985	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.153000	0.89640	2.068000	0.61886	0.460000	0.39030	TCT		LEO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254791.2	NM_138792	
CCPG1	9236	broad.mit.edu	37	15	55664032	55664032	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr15:55664032G>T	ENST00000310958.6	-	6	963	c.665C>A	c.(664-666)gCt>gAt	p.A222D	CCPG1_ENST00000442196.3_Missense_Mutation_p.A222D|MIR628_ENST00000385229.1_RNA|DYX1C1-CCPG1_ENST00000565113.1_RNA|CCPG1_ENST00000569205.1_Missense_Mutation_p.A222D|CCPG1_ENST00000425574.3_Missense_Mutation_p.A222D	NM_001204450.1|NM_001204451.1|NM_004748.4|NM_020739.3	NP_001191379.1|NP_001191380.1|NP_004739.3|NP_065790.2	Q9ULG6	CCPG1_HUMAN	cell cycle progression 1	222	Interaction with MCF2L and SRC. {ECO:0000250}.				cell cycle (GO:0007049)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001106)	integral component of membrane (GO:0016021)		p.A222D(1)		autonomic_ganglia(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|stomach(3)	30				all cancers(107;0.0354)		AATCACCAAAGCAAGTATAAC	0.393																																					p.A222D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C665A	15						.						120.0	107.0	111.0					15																	55664032		1899	4119	6018	53451324	SO:0001583	missense	9236	exon6			AF212228	CCDS42039.1, CCDS55966.1, CCDS55967.1	15q21.1	2011-04-20				ENSG00000260916			24227	protein-coding gene	gene with protein product		611326				9383053, 10574462	Standard	NM_004748		Approved	KIAA1254, CPR8	uc010bfk.2	Q9ULG6		ENST00000310958.6:c.665C>A	15.37:g.55664032G>T	ENSP00000311656:p.Ala222Asp	Somatic		Capture	Illumina HiSeq	Phase_I	53451324	NM_004748	A0PJH3|A8K9T0|O14712|Q05DG4|Q5U5S7|Q8IYV8|Q9BY53|Q9HA17	Missense_Mutation	SNP	ENST00000310958.6	37	CCDS42039.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.394725	0.83011	.	.	ENSG00000256061	ENST00000310958;ENST00000442196;ENST00000425574	T;T;T	0.51817	3.03;3.03;0.69	5.74	4.82	0.62117	.	0.049620	0.85682	D	0.000000	T	0.69566	0.3125	M	0.78916	2.43	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.74765	-0.3554	10	0.87932	D	0	.	15.3284	0.74186	0.0:0.0:0.8594:0.1406	.	222;222;222;78	A8K9T0;Q9ULG6-3;Q9ULG6;Q9ULG6-2	.;.;CCPG1_HUMAN;.	D	222	ENSP00000311656:A222D;ENSP00000403400:A222D;ENSP00000415128:A222D	ENSP00000311656:A222D	A	-	2	0	DYX1C1	53451324	1.000000	0.71417	0.995000	0.50966	0.992000	0.81027	7.778000	0.85637	1.416000	0.47057	0.655000	0.94253	GCT		CCPG1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419850.1	NM_004748	
TLN2	83660	broad.mit.edu	37	15	63063276	63063276	+	Silent	SNP	C	C	T	rs200255870	byFrequency	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr15:63063276C>T	ENST00000561311.1	+	41	5540	c.5310C>T	c.(5308-5310)ctC>ctT	p.L1770L	TLN2_ENST00000306829.6_Silent_p.L1770L|TLN2_ENST00000472902.1_Silent_p.L163L			Q9Y4G6	TLN2_HUMAN	talin 2	1770					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.L1770L(1)		NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						CCAAGACTCTCGCAGAGTCTG	0.517																																					p.L1770L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5310T	15						.	C		1,4405	2.1+/-5.4	0,1,2202	119.0	108.0	112.0		5310	-10.8	0.0	15		112	0,8600		0,0,4300	no	coding-synonymous	TLN2	NM_015059.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		1770/2543	63063276	1,13005	2203	4300	6503	60850568	SO:0001819	synonymous_variant	83660	exon39			AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.5310C>T	15.37:g.63063276C>T		Somatic		Capture	Illumina HiSeq	Phase_I	60850568	NM_015059	A6NLB8	Silent	SNP	ENST00000561311.1	37	CCDS32261.1																																																																																				TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2		
ALPK3	57538	broad.mit.edu	37	15	85402523	85402523	+	Silent	SNP	C	C	A	rs188837127	byFrequency	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr15:85402523C>A	ENST00000258888.5	+	7	4640	c.4473C>A	c.(4471-4473)tcC>tcA	p.S1491S		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1491	Ig-like 2.				heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.S1491S(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CTGATGCCTCCGGTAGCCTGA	0.582																																					p.S1491S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4473A	15						.						91.0	77.0	82.0					15																	85402523		2203	4299	6502	83203527	SO:0001819	synonymous_variant	57538	exon7			AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.4473C>A	15.37:g.85402523C>A		Somatic		Capture	Illumina HiSeq	Phase_I	83203527	NM_020778	Q9P2L6	Silent	SNP	ENST00000258888.5	37	CCDS10333.1																																																																																				ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308997.1	NM_020778	
CCDC144A	9720	broad.mit.edu	37	17	16593740	16593740	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr17:16593740G>A	ENST00000360524.8	+	1	102	c.26G>A	c.(25-27)cGg>cAg	p.R9Q	CCDC144A_ENST00000443444.2_Missense_Mutation_p.R9Q|CCDC144A_ENST00000456009.1_Missense_Mutation_p.R9Q|CCDC144A_ENST00000399273.1_Missense_Mutation_p.R9Q|CCDC144A_ENST00000436374.1_3'UTR|RNU6-405P_ENST00000516637.1_RNA|CCDC144A_ENST00000340621.5_Missense_Mutation_p.R9Q|RP11-219A15.1_ENST00000448331.3_Missense_Mutation_p.R9Q	NM_014695.1	NP_055510.1	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	9								p.R9Q(1)									GGAGAAAAGCGGGGAGGGGCT	0.657																																					p.R9Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G26A	17						.						13.0	16.0	15.0					17																	16593740		2197	4293	6490	16534465	SO:0001583	missense	9720	exon1			BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000360524.8:c.26G>A	17.37:g.16593740G>A	ENSP00000353717:p.Arg9Gln	Somatic		Capture	Illumina HiSeq	Phase_I	16534465	NM_014695	O60311|Q6ZU57	Missense_Mutation	SNP	ENST00000360524.8	37	CCDS45621.1	.	.	.	.	.	.	.	.	.	.	.	10.09	1.254907	0.22965	.	.	ENSG00000170160	ENST00000420937;ENST00000340621;ENST00000399273;ENST00000436374;ENST00000399264;ENST00000443444;ENST00000448331;ENST00000360524;ENST00000456009;ENST00000360495	T;T;T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47;1.47;1.47	0.407	0.407	0.16371	.	.	.	.	.	T	0.14485	0.0350	N	0.22421	0.69	0.09310	N	1	P	0.36065	0.535	B	0.14023	0.01	T	0.12734	-1.0536	8	0.52906	T	0.07	.	.	.	.	.	9	A2RUR9	C144A_HUMAN	Q	9	ENSP00000344740:R9Q;ENSP00000382215:R9Q;ENSP00000439262:R9Q;ENSP00000440655:R9Q;ENSP00000353717:R9Q;ENSP00000394201:R9Q;ENSP00000353685:R9Q	ENSP00000344740:R9Q	R	+	2	0	CCDC144A	16534465	0.323000	0.24643	0.001000	0.08648	0.022000	0.10575	0.199000	0.17237	0.443000	0.26582	0.184000	0.17185	CGG		CCDC144A-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000444093.1		
TP53	7157	broad.mit.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	C	T	rs28934576		TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr17:7577120C>T	ENST00000269305.4	-	8	1007	c.818G>A	c.(817-819)cGt>cAt	p.R273H	TP53_ENST00000420246.2_Missense_Mutation_p.R273H|TP53_ENST00000455263.2_Missense_Mutation_p.R273H|TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.R273H|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.R273H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273H(521)|p.R273L(93)|p.R273P(32)|p.0?(8)|p.?(2)|p.R273fs*32(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273S(1)|p.E258fs*71(1)|p.R273fs*72(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.R273fs*33(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACAAACACGCACCTCAAA	0.542	R273H(EN_ENDOMETRIUM)|R273H(HEC59_ENDOMETRIUM)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(MDAMB468_BREAST)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(NCIH1155_LUNG)|R273H(NCIH1793_LUNG)|R273H(NCIH1975_LUNG)|R273H(NCIH2405_LUNG)|R273H(NCIH508_LARGE_INTESTINE)|R273H(OC314_OVARY)|R273H(PANC1_PANCREAS)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SKMEL30_SKIN)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SUIT2_PANCREAS)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(SW480_LARGE_INTESTINE)|R273H(SW620_LARGE_INTESTINE)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18620	0.0		0.001	False		,,,				2504	0.0				p.R273H	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,-1 	.	669	Substitution - Missense(647)|Whole gene deletion(8)|Deletion - Frameshift(6)|Deletion - In frame(5)|Unknown(2)|Insertion - Frameshift(1)	large_intestine(136)|lung(99)|breast(74)|ovary(59)|upper_aerodigestive_tract(55)|central_nervous_system(46)|oesophagus(35)|haematopoietic_and_lymphoid_tissue(30)|stomach(26)|urinary_tract(25)|pancreas(15)|endometrium(13)|liver(12)|skin(11)|bone(9)|biliary_tract(7)|penis(4)|cervix(2)|genital_tract(2)|NS(2)|soft_tissue(2)|vulva(1)|thyroid(1)|fallopian_tube(1)|prostate(1)|thymus(1)	c.G818A	17	GRCh37	CM004342|CM010472|CM920677	TP53	M	rs28934576	.						67.0	58.0	61.0					17																	7577120		2203	4300	6503	7517845	SO:0001583	missense	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.818G>A	17.37:g.7577120C>T	ENSP00000269305:p.Arg273His	Somatic		Capture	Illumina HiSeq	Phase_I	7517845	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	18.03	3.532510	0.64972	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.79475	2.455	0.80722	A	1	P;D;P;P	0.89917	0.631;1.0;0.831;0.48	B;D;P;B	0.77004	0.274;0.989;0.516;0.242	D	0.96531	0.9393	9	0.72032	D	0.01	-11.9995	15.662	0.77193	0.0:1.0:0.0:0.0	rs28934576	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	H	273;273;273;273;273;262;141	ENSP00000352610:R273H;ENSP00000269305:R273H;ENSP00000398846:R273H;ENSP00000391127:R273H;ENSP00000391478:R273H;ENSP00000425104:R141H	ENSP00000269305:R273H	R	-	2	0	TP53	7517845	1.000000	0.71417	0.068000	0.19968	0.665000	0.39181	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	CGT		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
ERBB2	2064	broad.mit.edu	37	17	37881332	37881332	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr17:37881332G>A	ENST00000269571.5	+	21	2683	c.2524G>A	c.(2524-2526)Gta>Ata	p.V842I	ERBB2_ENST00000584450.1_Missense_Mutation_p.V842I|ERBB2_ENST00000445658.2_Missense_Mutation_p.V566I|ERBB2_ENST00000584601.1_Missense_Mutation_p.V812I|ERBB2_ENST00000406381.2_Missense_Mutation_p.V812I|MIR4728_ENST00000580969.1_RNA|ERBB2_ENST00000541774.1_Missense_Mutation_p.V827I|ERBB2_ENST00000540147.1_Missense_Mutation_p.V812I			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	842	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)	p.V842I(6)		NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	TGTGCGGCTCGTACACAGGGA	0.597		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																											p.V812I			Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	ERBB2,stomach,NS,Substitution - Missense,0 	.	6	Substitution - Missense(6)	large_intestine(5)|stomach(1)	c.G2434A	17						.						70.0	61.0	64.0					17																	37881332		2203	4300	6503	35134858	SO:0001583	missense	2064	exon24			X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.2524G>A	17.37:g.37881332G>A	ENSP00000269571:p.Val842Ile	Somatic		Capture	Illumina HiSeq	Phase_I	35134858	NM_001005862	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	SNP	ENST00000269571.5	37	CCDS32642.1	.	.	.	.	.	.	.	.	.	.	G	16.87	3.241303	0.58995	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000445658;ENST00000269571;ENST00000540147	D;D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.69;-1.69	5.09	5.09	0.68999	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.85106	0.5621	N	0.21142	0.635	0.80722	D	1	D;D;D	0.76494	0.997;0.979;0.999	D;P;D	0.64506	0.92;0.559;0.926	D	0.87344	0.2333	9	0.87932	D	0	.	18.2846	0.90110	0.0:0.0:1.0:0.0	.	566;827;842	B4DTR1;P04626-4;P04626	.;.;ERBB2_HUMAN	I	812;827;566;842;812	ENSP00000385185:V812I;ENSP00000446466:V827I;ENSP00000404047:V566I;ENSP00000269571:V842I;ENSP00000443562:V812I	ENSP00000269571:V842I	V	+	1	0	ERBB2	35134858	1.000000	0.71417	0.919000	0.36401	0.900000	0.52787	9.657000	0.98554	2.651000	0.90000	0.563000	0.77884	GTA		ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2		
NFIC	4782	broad.mit.edu	37	19	3434304	3434304	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr19:3434304T>G	ENST00000443272.2	+	5	790	c.739T>G	c.(739-741)Ttc>Gtc	p.F247V	NFIC_ENST00000346156.5_Missense_Mutation_p.F214V|NFIC_ENST00000395111.3_Missense_Mutation_p.F238V|NFIC_ENST00000590282.1_Missense_Mutation_p.F247V|NFIC_ENST00000341919.3_Missense_Mutation_p.F247V|NFIC_ENST00000586919.1_Missense_Mutation_p.F214V|NFIC_ENST00000589123.1_Missense_Mutation_p.F238V	NM_001245002.1	NP_001231931.1	P08651	NFIC_HUMAN	nuclear factor I/C (CCAAT-binding transcription factor)	247					DNA replication (GO:0006260)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)|nucleus (GO:0005634)	core promoter proximal region DNA binding (GO:0001159)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F238V(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.8e-05)|Epithelial(107;2.94e-108)|BRCA - Breast invasive adenocarcinoma(158;0.00154)|STAD - Stomach adenocarcinoma(1328;0.191)		AGGACCCAACTTCTCCCTGGG	0.612																																					p.F247V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T739G	19						.						101.0	95.0	97.0					19																	3434304		2203	4300	6503	3385304	SO:0001583	missense	4782	exon5			X12492	CCDS12107.1, CCDS45914.1, CCDS58640.1, CCDS59330.1, CCDS59331.1	19p13.3	2008-02-05				ENSG00000141905			7786	protein-coding gene	gene with protein product		600729		NFI		3398920, 7590749	Standard	NM_205843		Approved	CTF, NF-I, CTF5	uc010xhi.2	P08651		ENST00000443272.2:c.739T>G	19.37:g.3434304T>G	ENSP00000396843:p.Phe247Val	Somatic		Capture	Illumina HiSeq	Phase_I	3385304	NM_005597	A8K1H0|B7Z4U5|B7Z9C3|K7EMU1|P08652|Q14932|Q9UPJ3|Q9UPJ9|Q9UPK0|Q9UPK1	Missense_Mutation	SNP	ENST00000443272.2	37	CCDS59330.1	.	.	.	.	.	.	.	.	.	.	T	18.66	3.672397	0.67928	.	.	ENSG00000141905	ENST00000443272;ENST00000395111;ENST00000346156;ENST00000341919;ENST00000343825;ENST00000269778	T;T;T	0.59364	0.27;0.27;0.27	3.48	3.48	0.39840	.	0.142329	0.50627	D	0.000102	T	0.70789	0.3264	M	0.76838	2.35	0.47862	D	0.999537	P;D;P;D;D	0.61697	0.891;0.99;0.867;0.988;0.976	P;P;B;P;P	0.61722	0.596;0.893;0.269;0.829;0.743	T	0.73461	-0.3975	10	0.52906	T	0.07	.	10.9743	0.47456	0.0:0.0:0.0:1.0	.	247;247;238;247;238	B7Z4U5;P08651;P08651-3;P08651-5;P08651-2	.;NFIC_HUMAN;.;.;.	V	238;238;214;247;247;247	ENSP00000378543:F238V;ENSP00000301935:F214V;ENSP00000342194:F247V	ENSP00000269778:F247V	F	+	1	0	NFIC	3385304	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.752000	0.74898	1.459000	0.47892	0.379000	0.24179	TTC		NFIC-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452834.1	NM_005597	
PDCD2L	84306	broad.mit.edu	37	19	34916980	34916980	+	Silent	SNP	A	A	G			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr19:34916980A>G	ENST00000246535.3	+	7	1079	c.1032A>G	c.(1030-1032)gaA>gaG	p.E344E	CTD-2588C8.8_ENST00000592220.1_RNA|UBA2_ENST00000246548.4_5'Flank|UBA2_ENST00000439527.2_5'Flank|PDCD2L_ENST00000587065.2_Silent_p.E42E	NM_032346.1	NP_115722.1	Q9BRP1	PDD2L_HUMAN	programmed cell death 2-like	344					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.E344E(1)		breast(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			CCATGGAAGAATTTTGTATTA	0.318																																					p.E344E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1032G	19						.						70.0	73.0	72.0					19																	34916980		2203	4300	6503	39608820	SO:0001819	synonymous_variant	84306	exon7			BC006146	CCDS12438.1	19q13.11	2008-02-05				ENSG00000126249			28194	protein-coding gene	gene with protein product		615661				16311922	Standard	NM_032346		Approved	MGC13096	uc002nvj.3	Q9BRP1		ENST00000246535.3:c.1032A>G	19.37:g.34916980A>G		Somatic		Capture	Illumina HiSeq	Phase_I	39608820	NM_032346		Silent	SNP	ENST00000246535.3	37	CCDS12438.1																																																																																				PDCD2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459251.3	NM_032346	
CADM4	199731	broad.mit.edu	37	19	44131040	44131040	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr19:44131040C>T	ENST00000222374.2	-	4	443	c.395G>A	c.(394-396)cGg>cAg	p.R132Q	CADM4_ENST00000593506.1_5'Flank	NM_145296.1	NP_660339.1	Q8NFZ8	CADM4_HUMAN	cell adhesion molecule 4	132	Ig-like C2-type 1.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.R132Q(1)		endometrium(2)|large_intestine(3)|lung(4)|prostate(1)|skin(2)	12		Prostate(69;0.0199)				CGCCTGCTCCCGGACCTCCAC	0.667																																					p.R132Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G395A	19						.						28.0	31.0	30.0					19																	44131040		2203	4300	6503	48822880	SO:0001583	missense	199731	exon4			AF363368	CCDS12627.1	19q13.32	2013-01-29	2007-02-07	2007-02-07		ENSG00000105767		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30825	protein-coding gene	gene with protein product	"""nectin-like 4"""	609744	"""immunoglobulin superfamily, member 4C"""	IGSF4C		11536053	Standard	NM_145296		Approved	TSLL2, Necl-4, SynCAM4	uc002oxc.1	Q8NFZ8		ENST00000222374.2:c.395G>A	19.37:g.44131040C>T	ENSP00000222374:p.Arg132Gln	Somatic		Capture	Illumina HiSeq	Phase_I	48822880	NM_145296	B2R7L5|Q9Y4A4	Missense_Mutation	SNP	ENST00000222374.2	37	CCDS12627.1	.	.	.	.	.	.	.	.	.	.	C	15.89	2.966960	0.53507	.	.	ENSG00000105767	ENST00000222374	T	0.75704	-0.96	5.62	3.52	0.40303	Immunoglobulin subtype (1);CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.209202	0.38548	N	0.001645	T	0.52289	0.1725	N	0.17474	0.49	0.31161	N	0.704355	B	0.16396	0.017	B	0.16722	0.016	T	0.47005	-0.9150	10	0.14252	T	0.57	.	6.7186	0.23318	0.0:0.7344:0.0:0.2656	.	132	Q8NFZ8	CADM4_HUMAN	Q	132	ENSP00000222374:R132Q	ENSP00000222374:R132Q	R	-	2	0	CADM4	48822880	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.973000	0.40550	1.381000	0.46364	0.591000	0.81541	CGG		CADM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463352.1	NM_145296	
RAB11B	9230	broad.mit.edu	37	19	8467073	8467073	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr19:8467073G>T	ENST00000328024.6	+	3	558	c.340G>T	c.(340-342)Gac>Tac	p.D114Y	RAB11B_ENST00000601897.1_5'UTR|RAB11B_ENST00000594216.1_Missense_Mutation_p.D114Y	NM_004218.3	NP_004209.2	Q15907	RB11B_HUMAN	RAB11B, member RAS oncogene family	114					cellular response to acidic pH (GO:0071468)|constitutive secretory pathway (GO:0045054)|establishment of protein localization to membrane (GO:0090150)|GTP catabolic process (GO:0006184)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|melanosome transport (GO:0032402)|receptor recycling (GO:0001881)|regulated secretory pathway (GO:0045055)|regulation of anion transport (GO:0044070)|regulation of endocytic recycling (GO:2001135)|regulation of protein localization to cell surface (GO:2000008)|retrograde transport, endosome to plasma membrane (GO:1990126)|small GTPase mediated signal transduction (GO:0007264)|transferrin transport (GO:0033572)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|phagocytic vesicle (GO:0045335)|recycling endosome (GO:0055037)|recycling endosome membrane (GO:0055038)|synaptic vesicle (GO:0008021)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)	p.D114Y(1)		large_intestine(2)|lung(1)|ovary(1)	4						GGACCACGCAGACAGCAACAT	0.642																																					p.D114Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G340T	19						.						72.0	41.0	52.0					19																	8467073		2201	4299	6500	8373073	SO:0001583	missense	9230	exon3			X79780	CCDS12201.1	19p13.2	2012-07-02			ENSG00000185236	ENSG00000185236		"""RAB, member RAS oncogene"""	9761	protein-coding gene	gene with protein product		604198				7811277	Standard	NM_004218		Approved	H-YPT3	uc002mju.4	Q15907		ENST00000328024.6:c.340G>T	19.37:g.8467073G>T	ENSP00000333547:p.Asp114Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	8373073	NM_004218	A5YM50|B2R7I4|B4DMK0|D6W671|Q2YDT2|Q5U0I1|Q6FHR0|Q6FI42|Q8NI07	Missense_Mutation	SNP	ENST00000328024.6	37	CCDS12201.1	.	.	.	.	.	.	.	.	.	.	G	16.09	3.024112	0.54683	.	.	ENSG00000185236	ENST00000328024	T	0.77750	-1.12	4.65	3.59	0.41128	Small GTP-binding protein domain (1);	0.095427	0.64402	D	0.000001	T	0.81809	0.4901	L	0.40543	1.245	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.68621	0.959;0.955	D	0.83628	0.0143	10	0.87932	D	0	.	13.1333	0.59395	0.0:0.0:0.8384:0.1616	.	114;114	B4DMK0;Q15907	.;RB11B_HUMAN	Y	114	ENSP00000333547:D114Y	ENSP00000333547:D114Y	D	+	1	0	RAB11B	8373073	1.000000	0.71417	0.855000	0.33649	0.252000	0.25951	9.657000	0.98554	1.290000	0.44636	0.561000	0.74099	GAC		RAB11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460343.2	NM_004218	
EXOC3L2	90332	broad.mit.edu	37	19	45716583	45716583	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr19:45716583C>T	ENST00000252482.3	-	9	1001	c.974G>A	c.(973-975)cGt>cAt	p.R325H	EXOC3L2_ENST00000413988.1_Missense_Mutation_p.R325H|AC006126.3_ENST00000591569.1_Intron			Q2M3D2	EX3L2_HUMAN	exocyst complex component 3-like 2	325					exocytosis (GO:0006887)	exocyst (GO:0000145)		p.R325H(1)		endometrium(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00883)		GCGCAGGCCACGGATGTCGAG	0.672																																					p.R325H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G974A	19						.						39.0	42.0	41.0					19																	45716583		2203	4300	6503	50408423	SO:0001583	missense	90332	exon10			AK093466	CCDS12657.1	19q13.32	2011-07-07			ENSG00000130201	ENSG00000130201			30162	protein-coding gene	gene with protein product						21566143	Standard	NM_138568		Approved	FLJ36147, XTP7	uc002pay.1	Q2M3D2	OTTHUMG00000155018	ENST00000252482.3:c.974G>A	19.37:g.45716583C>T	ENSP00000252482:p.Arg325His	Somatic		Capture	Illumina HiSeq	Phase_I	50408423	NM_138568	Q8N9W2|Q96GV2	Missense_Mutation	SNP	ENST00000252482.3	37	CCDS12657.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.064226	0.76187	.	.	ENSG00000130201	ENST00000252482;ENST00000413988	T;T	0.29142	1.58;1.58	4.39	4.39	0.52855	.	0.136296	0.48286	D	0.000196	T	0.54029	0.1833	M	0.75777	2.31	0.37754	D	0.926064	D	0.89917	1.0	D	0.97110	1.0	T	0.63743	-0.6568	10	0.87932	D	0	.	12.4574	0.55712	0.0:1.0:0.0:0.0	.	325	Q2M3D2	EX3L2_HUMAN	H	325	ENSP00000252482:R325H;ENSP00000400713:R325H	ENSP00000252482:R325H	R	-	2	0	EXOC3L2	50408423	0.999000	0.42202	0.842000	0.33263	0.617000	0.37484	5.375000	0.66173	1.983000	0.57843	0.455000	0.32223	CGT		EXOC3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338073.1	NM_138568	
WNT2B	7482	broad.mit.edu	37	1	113057699	113057699	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr1:113057699G>C	ENST00000369684.4	+	2	871	c.386G>C	c.(385-387)gGc>gCc	p.G129A	WNT2B_ENST00000369686.5_Missense_Mutation_p.G110A|RP4-671G15.2_ENST00000608357.1_RNA|WNT2B_ENST00000478360.1_3'UTR|WNT2B_ENST00000256640.5_Missense_Mutation_p.G37A	NM_024494.2	NP_078613.1	Q93097	WNT2B_HUMAN	wingless-type MMTV integration site family, member 2B	129					canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to starvation (GO:0009267)|chondrocyte differentiation (GO:0002062)|cornea development in camera-type eye (GO:0061303)|forebrain regionalization (GO:0021871)|hematopoietic stem cell proliferation (GO:0071425)|iris morphogenesis (GO:0061072)|lens development in camera-type eye (GO:0002088)|lung induction (GO:0060492)|male gonad development (GO:0008584)|mesenchymal-epithelial cell signaling (GO:0060638)|neuron differentiation (GO:0030182)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)	p.G129A(1)		breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(2)|skin(1)|stomach(1)	18	Lung SC(450;0.246)	all_cancers(81;7.31e-07)|all_epithelial(167;4.59e-06)|all_lung(203;2.56e-05)|Lung NSC(69;4.38e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACCGTCTTTGGCCGTGTCATG	0.597																																					p.G110A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G329C	1						.						71.0	50.0	57.0					1																	113057699		2203	4300	6503	112859222	SO:0001583	missense	7482	exon3			AB045116	CCDS847.1, CCDS846.1	1p13	2008-07-18			ENSG00000134245	ENSG00000134245		"""Wingless-type MMTV integration sites"""	12781	protein-coding gene	gene with protein product	"""XWNT2, Xenopus, homolog of"", ""wingless-type MMTV integration site family, member 13"""	601968		WNT13		8761309, 10944466	Standard	NM_024494		Approved	XWNT2	uc001ecb.3	Q93097	OTTHUMG00000011157	ENST00000369684.4:c.386G>C	1.37:g.113057699G>C	ENSP00000358698:p.Gly129Ala	Somatic		Capture	Illumina HiSeq	Phase_I	112859222	NM_004185	O14903|Q5TEH9|Q5TEI2|Q9HDC1|Q9HDC2	Missense_Mutation	SNP	ENST00000369684.4	37	CCDS847.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.751041	0.89753	.	.	ENSG00000134245	ENST00000256640;ENST00000369686;ENST00000369684	T;T;T	0.75938	-0.98;-0.98;-0.98	4.96	4.96	0.65561	.	0.092424	0.85682	D	0.000000	D	0.85758	0.5771	M	0.83118	2.625	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.994	D	0.87833	0.2646	10	0.87932	D	0	.	18.238	0.89956	0.0:0.0:1.0:0.0	.	129;110	Q93097;Q93097-2	WNT2B_HUMAN;.	A	37;110;129	ENSP00000256640:G37A;ENSP00000358700:G110A;ENSP00000358698:G129A	ENSP00000256640:G37A	G	+	2	0	WNT2B	112859222	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.813000	0.99286	2.469000	0.83416	0.555000	0.69702	GGC		WNT2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030692.1	NM_004185	
HAO2	51179	broad.mit.edu	37	1	119923775	119923775	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr1:119923775G>T	ENST00000325945.3	+	2	140	c.67G>T	c.(67-69)Gat>Tat	p.D23Y	HAO2_ENST00000361035.4_Missense_Mutation_p.D36Y	NM_001005783.1|NM_016527.2	NP_001005783.1|NP_057611.1	Q9NYQ3	HAOX2_HUMAN	hydroxyacid oxidase 2 (long chain)	23	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				fatty acid oxidation (GO:0019395)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)	p.D23Y(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	30	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.0155)|LUSC - Lung squamous cell carcinoma(189;0.0856)		GTCAACTCGGGATTTTATTGA	0.458																																					p.D23Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G67T	1						.						198.0	187.0	190.0					1																	119923775		2203	4300	6503	119725298	SO:0001583	missense	51179	exon2			AF231917	CCDS901.1	1p13.3-p13.1	2008-07-18			ENSG00000116882	ENSG00000116882	1.1.3.15		4810	protein-coding gene	gene with protein product	"""(S)-2-hydroxy-acid oxidase"", ""glycolate oxidase"", ""long-chain L-2-hydroxy acid oxidase"", ""growth-inhibiting protein 16"""	605176				10777549	Standard	XM_005270913		Approved	HAOX2, GIG16	uc001ehr.1	Q9NYQ3	OTTHUMG00000012410	ENST00000325945.3:c.67G>T	1.37:g.119923775G>T	ENSP00000316339:p.Asp23Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	119725298	NM_016527	Q2TU86|Q5QP00|Q9UJS6	Missense_Mutation	SNP	ENST00000325945.3	37	CCDS901.1	.	.	.	.	.	.	.	.	.	.	G	16.76	3.211186	0.58343	.	.	ENSG00000116882	ENST00000457318;ENST00000361035;ENST00000325945	T;T;T	0.34667	1.35;1.35;1.35	5.4	5.4	0.78164	Aldolase-type TIM barrel (1);FMN-dependent dehydrogenase (1);	0.091701	0.64402	D	0.000001	T	0.59169	0.2174	M	0.82433	2.59	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.61936	-0.6960	9	.	.	.	-25.1974	19.1748	0.93600	0.0:0.0:1.0:0.0	.	23	Q9NYQ3	HAOX2_HUMAN	Y	23;36;23	ENSP00000393955:D23Y;ENSP00000354314:D36Y;ENSP00000316339:D23Y	.	D	+	1	0	HAO2	119725298	1.000000	0.71417	0.996000	0.52242	0.067000	0.16453	9.139000	0.94554	2.542000	0.85734	0.655000	0.94253	GAT		HAO2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034984.1	NM_001005783	
ELF3	1999	broad.mit.edu	37	1	201982405	201982405	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr1:201982405G>T	ENST00000359651.3	+	6	3976	c.784G>T	c.(784-786)Gag>Tag	p.E262*	RP11-510N19.5_ENST00000504773.1_RNA|ELF3_ENST00000367284.5_Nonsense_Mutation_p.E262*|ELF3_ENST00000367283.3_Nonsense_Mutation_p.E262*|RP11-465N4.4_ENST00000419190.1_RNA					E74-like factor 3 (ets domain transcription factor, epithelial-specific )									p.E262*(1)		breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	20						GGACTGTCTCGAGGGCAAGAA	0.632																																					p.E262X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G784T	1						.						71.0	77.0	75.0					1																	201982405		2203	4300	6503	200249028	SO:0001587	stop_gained	1999	exon7			AF016295	CCDS1419.1	1q32.2	2008-02-05			ENSG00000163435	ENSG00000163435			3318	protein-coding gene	gene with protein product		602191		ESX		9395241, 9129154	Standard	NM_001114309		Approved	EPR-1, ESE-1, ERT	uc001gxh.4	P78545	OTTHUMG00000035867	ENST00000359651.3:c.784G>T	1.37:g.201982405G>T	ENSP00000352673:p.Glu262*	Somatic		Capture	Illumina HiSeq	Phase_I	200249028	NM_001114309		Nonsense_Mutation	SNP	ENST00000359651.3	37	CCDS1419.1	.	.	.	.	.	.	.	.	.	.	G	37	6.256485	0.97417	.	.	ENSG00000163435	ENST00000359651;ENST00000367284;ENST00000367283;ENST00000310044	.	.	.	5.6	5.6	0.85130	.	1.419500	0.03867	N	0.275079	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	.	17.4077	0.87477	0.0:0.0:1.0:0.0	.	.	.	.	X	262;262;262;239	.	ENSP00000311348:E239X	E	+	1	0	ELF3	200249028	0.468000	0.25839	0.994000	0.49952	0.974000	0.67602	1.618000	0.36954	2.633000	0.89246	0.561000	0.74099	GAG		ELF3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087360.1	NM_004433	
SOX13	9580	broad.mit.edu	37	1	204092051	204092051	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr1:204092051G>A	ENST00000367204.1	+	10	1203	c.1094G>A	c.(1093-1095)aGt>aAt	p.S365N		NM_005686.2	NP_005677.2	Q9UN79	SOX13_HUMAN	SRY (sex determining region Y)-box 13	365					anatomical structure morphogenesis (GO:0009653)|regulation of gamma-delta T cell differentiation (GO:0045586)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S365N(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)	13	all_cancers(21;0.0754)|Breast(84;0.116)|all_epithelial(62;0.189)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			CACAGCCACAGTGGGGCCTTG	0.617																																					p.S365N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1094A	1						.						27.0	31.0	30.0					1																	204092051		2037	4189	6226	202358674	SO:0001583	missense	9580	exon10				CCDS44299.1	1q32	2008-07-18			ENSG00000143842	ENSG00000143842		"""SRY (sex determining region Y)-boxes"""	11192	protein-coding gene	gene with protein product	"""islet cell antibody 12"", ""SRY-related HMG-box gene 13"", ""type 1 diabetes autoantigen"", ""SRY-box 13"""	604748				10198172	Standard	NM_005686		Approved	Sox-13, ICA12, MGC117216	uc001ham.3	Q9UN79	OTTHUMG00000036050	ENST00000367204.1:c.1094G>A	1.37:g.204092051G>A	ENSP00000356172:p.Ser365Asn	Somatic		Capture	Illumina HiSeq	Phase_I	202358674	NM_005686	B4E2B0|O95275|O95826|Q3KQV7|Q5SXX1|Q9UHW7	Missense_Mutation	SNP	ENST00000367204.1	37	CCDS44299.1	.	.	.	.	.	.	.	.	.	.	G	14.60	2.584932	0.46110	.	.	ENSG00000143842	ENST00000367204	D	0.97994	-4.65	5.31	4.38	0.52667	.	0.407005	0.31392	N	0.007738	D	0.94496	0.8228	L	0.43152	1.355	0.25250	N	0.989689	B;B;B	0.24963	0.002;0.115;0.002	B;B;B	0.22880	0.002;0.042;0.004	D	0.86902	0.2055	10	0.26408	T	0.33	.	9.12	0.36782	0.0777:0.1486:0.7737:0.0	.	232;232;365	B4DX26;B4E3N9;Q9UN79	.;.;SOX13_HUMAN	N	365	ENSP00000356172:S365N	ENSP00000356172:S365N	S	+	2	0	SOX13	202358674	0.999000	0.42202	0.525000	0.27900	0.976000	0.68499	4.303000	0.59098	1.195000	0.43115	0.655000	0.94253	AGT		SOX13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087881.2	NM_005686	
CENPF	1063	broad.mit.edu	37	1	214818039	214818039	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr1:214818039T>C	ENST00000366955.3	+	13	5294	c.5126T>C	c.(5125-5127)aTa>aCa	p.I1709T		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	1805					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.I1709T(1)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		ATTGAGAAAATAACTGAGACT	0.448																																					p.I1709T	Colon(80;575 1284 11000 14801 43496)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T5126C	1						.						65.0	64.0	64.0					1																	214818039		2203	4300	6503	212884662	SO:0001583	missense	1063	exon13			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.5126T>C	1.37:g.214818039T>C	ENSP00000355922:p.Ile1709Thr	Somatic		Capture	Illumina HiSeq	Phase_I	212884662	NM_016343	Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	37	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	T	3.675	-0.066641	0.07273	.	.	ENSG00000117724	ENST00000366955	T	0.03242	4.0	5.04	1.48	0.22813	.	0.759033	0.10916	N	0.620050	T	0.03095	0.0091	L	0.51422	1.61	0.09310	N	1	B	0.15473	0.013	B	0.09377	0.004	T	0.50092	-0.8868	10	0.10636	T	0.68	.	0.4042	0.00430	0.209:0.2497:0.156:0.3853	.	1805	P49454	CENPF_HUMAN	T	1709	ENSP00000355922:I1709T	ENSP00000355922:I1709T	I	+	2	0	CENPF	212884662	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.045000	0.12003	0.083000	0.17047	0.496000	0.49642	ATA		CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
ACTN2	88	broad.mit.edu	37	1	236923041	236923041	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr1:236923041G>A	ENST00000366578.4	+	19	2485	c.2319G>A	c.(2317-2319)atG>atA	p.M773I	ACTN2_ENST00000542672.1_Missense_Mutation_p.M773I|ACTN2_ENST00000546208.1_Missense_Mutation_p.M267I	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	773	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)	p.M773I(1)		endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			ATGGCCTGATGGATCATGAGG	0.418																																					p.M773I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2319A	1						.						149.0	133.0	139.0					1																	236923041		2203	4300	6503	234989664	SO:0001583	missense	88	exon19			BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.2319G>A	1.37:g.236923041G>A	ENSP00000355537:p.Met773Ile	Somatic		Capture	Illumina HiSeq	Phase_I	234989664	NM_001103	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	ENST00000366578.4	37	CCDS1613.1	.	.	.	.	.	.	.	.	.	.	G	19.52	3.842906	0.71488	.	.	ENSG00000077522	ENST00000542672;ENST00000366578;ENST00000546208;ENST00000545611	T;T;T	0.63096	-0.02;-0.02;-0.02	5.41	5.41	0.78517	EF-hand-like domain (1);	0.036669	0.85682	D	0.000000	T	0.43344	0.1243	N	0.01817	-0.705	0.80722	D	1	B;B;B;B	0.19073	0.033;0.002;0.015;0.007	B;B;B;B	0.28784	0.094;0.025;0.094;0.013	T	0.48468	-0.9033	10	0.87932	D	0	.	19.1936	0.93677	0.0:0.0:1.0:0.0	.	558;773;543;773	B7Z4K1;B2RCS5;Q59FD9;P35609	.;.;.;ACTN2_HUMAN	I	773;773;267;542	ENSP00000443495:M773I;ENSP00000355537:M773I;ENSP00000438384:M267I	ENSP00000355537:M773I	M	+	3	0	ACTN2	234989664	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.427000	0.97472	2.540000	0.85666	0.655000	0.94253	ATG		ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103	
LZIC	84328	broad.mit.edu	37	1	9996591	9996591	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr1:9996591A>T	ENST00000377223.1	-	3	334	c.87T>A	c.(85-87)gaT>gaA	p.D29E	LZIC_ENST00000400903.2_Missense_Mutation_p.D29E|LZIC_ENST00000377213.1_Missense_Mutation_p.D29E|LZIC_ENST00000541052.1_Missense_Mutation_p.D50E	NM_032368.3	NP_115744.2	Q8WZA0	LZIC_HUMAN	leucine zipper and CTNNBIP1 domain containing	29					response to ionizing radiation (GO:0010212)			p.D29E(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(1)|skin(1)	7		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.29e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;0.000242)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|STAD - Stomach adenocarcinoma(132;0.00842)|READ - Rectum adenocarcinoma(331;0.0419)		ATTCCTCCAGATCTTGTAATT	0.403																																					p.D29E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T87A	1						.						251.0	223.0	232.0					1																	9996591		2203	4300	6503	9919178	SO:0001583	missense	84328	exon2			AB060688	CCDS107.1	1p36.22	2008-02-05			ENSG00000162441	ENSG00000162441			17497	protein-coding gene	gene with protein product		610458				11712074	Standard	NM_032368		Approved	MGC15436	uc001aqm.3	Q8WZA0	OTTHUMG00000001804	ENST00000377223.1:c.87T>A	1.37:g.9996591A>T	ENSP00000366430:p.Asp29Glu	Somatic		Capture	Illumina HiSeq	Phase_I	9919178	NM_032368	B2R6F0|B4E2N0|Q96IU1	Missense_Mutation	SNP	ENST00000377223.1	37	CCDS107.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.980217	0.74474	.	.	ENSG00000162441	ENST00000377223;ENST00000400903;ENST00000541052;ENST00000377213	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	5.67	0.438	0.16560	.	0.000000	0.85682	D	0.000000	T	0.42944	0.1225	M	0.67397	2.05	0.50313	D	0.999865	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.997	T	0.10543	-1.0625	9	.	.	.	-5.9897	9.5843	0.39506	0.637:0.0:0.363:0.0	.	50;29	B4E2N0;Q8WZA0	.;LZIC_HUMAN	E	29;29;50;29	ENSP00000366430:D29E;ENSP00000383695:D29E;ENSP00000437432:D50E;ENSP00000366418:D29E	.	D	-	3	2	LZIC	9919178	0.982000	0.34865	0.996000	0.52242	0.997000	0.91878	0.245000	0.18142	-0.171000	0.10797	0.459000	0.35465	GAT		LZIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005037.1	NM_032368	
ZSCAN20	7579	broad.mit.edu	37	1	33960677	33960677	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr1:33960677C>G	ENST00000361328.3	+	8	2886	c.2733C>G	c.(2731-2733)agC>agG	p.S911R		NM_145238.3	NP_660281	P17040	ZSC20_HUMAN	zinc finger and SCAN domain containing 20	911					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S911R(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(2)|pancreas(1)|stomach(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				GTGGGAAAAGCTTCAGTAAGA	0.507																																					p.S911R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2733G	1						.						79.0	90.0	87.0					1																	33960677		2128	4258	6386	33733264	SO:0001583	missense	7579	exon8			X52360	CCDS41300.1	1p34.3	2013-01-08	2007-02-20	2007-02-20	ENSG00000121903	ENSG00000121903		"""-"", ""Zinc fingers, C2H2-type"""	13093	protein-coding gene	gene with protein product		611315	"""zinc finger protein 31 (KOX 29)"", ""zinc finger protein 31"""	ZNF360, ZNF31		2288909	Standard	NM_145238		Approved	KOX29	uc001bxj.4	P17040	OTTHUMG00000004173	ENST00000361328.3:c.2733C>G	1.37:g.33960677C>G	ENSP00000355053:p.Ser911Arg	Somatic		Capture	Illumina HiSeq	Phase_I	33733264	NM_145238	A8K2D0|B1ALI4|B1ALI5|B1ALI6|Q6ZN23|Q96FA9|Q96H84	Missense_Mutation	SNP	ENST00000361328.3	37	CCDS41300.1	.	.	.	.	.	.	.	.	.	.	C	15.76	2.928704	0.52759	.	.	ENSG00000121903	ENST00000326544;ENST00000361328;ENST00000401072	.	.	.	5.76	1.75	0.24633	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.153488	0.46758	D	0.000270	T	0.43986	0.1272	N	0.25094	0.71	0.31142	N	0.706457	P;D	0.76494	0.638;0.999	B;D	0.75020	0.218;0.985	T	0.46105	-0.9215	9	0.72032	D	0.01	-8.3849	7.8342	0.29360	0.0:0.6159:0.0:0.3841	.	910;911	P17040-3;P17040	.;ZSC20_HUMAN	R	911;845;845	.	ENSP00000324450:S911R	S	+	3	2	ZSCAN20	33733264	0.851000	0.29673	1.000000	0.80357	0.994000	0.84299	0.863000	0.27913	0.752000	0.32923	0.655000	0.94253	AGC		ZSCAN20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277003.2	NM_145238	
AGO4	192670	broad.mit.edu	37	1	36316529	36316529	+	Silent	SNP	G	G	C	rs150907205		TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr1:36316529G>C	ENST00000373210.3	+	17	2597	c.2352G>C	c.(2350-2352)ctG>ctC	p.L784L	AGO4_ENST00000488778.1_3'UTR	NM_017629.3	NP_060099.2	Q9HCK5	AGO4_HUMAN	argonaute RISC catalytic component 4	784	Piwi. {ECO:0000255|HAMAP-Rule:MF_03033}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)	p.L784L(1)									TCCAGCTACTGACTTACCAGC	0.498																																					p.L784L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2352C	1						.						124.0	108.0	113.0					1																	36316529		2203	4300	6503	36089116	SO:0001819	synonymous_variant	192670	exon17			AB046787	CCDS397.1	1p34	2013-02-15	2013-02-15	2013-02-15	ENSG00000134698	ENSG00000134698		"""Argonaute/PIWI family"""	18424	protein-coding gene	gene with protein product	"""argonaute 4"""	607356	"""eukaryotic translation initiation factor 2C, 4"""	EIF2C4		12906857	Standard	NM_017629		Approved	hAGO4, KIAA1567, FLJ20033	uc001bzj.2	Q9HCK5	OTTHUMG00000004243	ENST00000373210.3:c.2352G>C	1.37:g.36316529G>C		Somatic		Capture	Illumina HiSeq	Phase_I	36089116	NM_017629	A7MD27	Silent	SNP	ENST00000373210.3	37	CCDS397.1																																																																																				AGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012213.3	NM_017629	
GRIK3	2899	broad.mit.edu	37	1	37324825	37324825	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr1:37324825C>T	ENST00000373091.3	-	7	1004	c.988G>A	c.(988-990)Gtc>Atc	p.V330I	GRIK3_ENST00000462621.1_5'Flank|GRIK3_ENST00000373093.4_Missense_Mutation_p.V330I	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	330					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)	p.V330I(1)		breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				ACGATATGGACGGCGTCGTAC	0.647																																					p.V330I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G988A	1						.						138.0	118.0	125.0					1																	37324825		2203	4300	6503	37097412	SO:0001583	missense	2899	exon7			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.988G>A	1.37:g.37324825C>T	ENSP00000362183:p.Val330Ile	Somatic		Capture	Illumina HiSeq	Phase_I	37097412	NM_000831	A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	ENST00000373091.3	37	CCDS416.1	.	.	.	.	.	.	.	.	.	.	C	33	5.211136	0.95069	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	D;D	0.90069	-2.61;-2.61	5.68	5.68	0.88126	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.92251	0.7542	M	0.77103	2.36	0.58432	D	0.999999	B;B	0.32753	0.176;0.383	B;B	0.43301	0.415;0.324	D	0.91112	0.4923	10	0.51188	T	0.08	.	19.7849	0.96432	0.0:1.0:0.0:0.0	.	330;330	A9Z1Z8;Q13003	.;GRIK3_HUMAN	I	330	ENSP00000362183:V330I;ENSP00000362185:V330I	ENSP00000362183:V330I	V	-	1	0	GRIK3	37097412	1.000000	0.71417	0.970000	0.41538	0.683000	0.39861	7.482000	0.81143	2.671000	0.90904	0.650000	0.86243	GTC		GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1	NM_000831	
NRD1	4898	broad.mit.edu	37	1	52275053	52275053	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr1:52275053C>A	ENST00000354831.7	-	19	2317	c.2128G>T	c.(2128-2130)Gaa>Taa	p.E710*	NRD1_ENST00000485608.1_5'UTR|NRD1_ENST00000352171.7_Nonsense_Mutation_p.E642*|NRD1_ENST00000544028.1_Nonsense_Mutation_p.E510*|NRD1_ENST00000539524.1_Nonsense_Mutation_p.E578*	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)	641					cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.E710*(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						TTCCACAGTTCAGCCCAAGAG	0.303																																					p.E710X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G2128T	1						.						151.0	162.0	158.0					1																	52275053		2203	4300	6503	52047641	SO:0001587	stop_gained	4898	exon19			X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.2128G>T	1.37:g.52275053C>A	ENSP00000346890:p.Glu710*	Somatic		Capture	Illumina HiSeq	Phase_I	52047641	NM_002525	A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Nonsense_Mutation	SNP	ENST00000354831.7	37	CCDS559.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.06|14.06	2.424089|2.424089	0.43020|0.43020	.|.	.|.	ENSG00000078618|ENSG00000078618	ENST00000352171;ENST00000354831;ENST00000539524;ENST00000371665;ENST00000546169;ENST00000544028|ENST00000440943	.|.	.|.	.|.	5.55|5.55	4.64|4.64	0.57946|0.57946	.|.	0.222920|.	0.45867|.	D|.	0.000324|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.27785|.	T|.	0.31|.	-9.2672|-9.2672	14.3582|14.3582	0.66752|0.66752	0.0:0.9288:0.0:0.0712|0.0:0.9288:0.0:0.0712	.|.	.|.	.|.	.|.	X|L	642;710;578;112;642;510|96	.|.	ENSP00000262679:E642X|.	E|X	-|-	1|2	0|2	NRD1|NRD1	52047641|52047641	0.982000|0.982000	0.34865|0.34865	1.000000|1.000000	0.80357|0.80357	0.252000|0.252000	0.25951|0.25951	2.718000|2.718000	0.47236|0.47236	1.353000|1.353000	0.45828|0.45828	-0.136000|-0.136000	0.14681|0.14681	GAA|TGA		NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023045.1	NM_002525	
DAB1	1600	broad.mit.edu	37	1	57537209	57537209	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr1:57537209G>C	ENST00000371231.1	-	5	578	c.544C>G	c.(544-546)Caa>Gaa	p.Q182E	DAB1_ENST00000371230.1_Missense_Mutation_p.Q182E|DAB1_ENST00000414851.2_Missense_Mutation_p.Q182E|DAB1_ENST00000371236.2_Missense_Mutation_p.Q182E|DAB1_ENST00000420954.2_Missense_Mutation_p.Q182E|DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000439789.2_Intron|DAB1_ENST00000371234.4_Missense_Mutation_p.Q182E			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	182	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)		p.Q182E(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						TACACAGCTTGTTCACACTGC	0.398																																					p.Q182E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C544G	1						.						250.0	218.0	229.0					1																	57537209		2203	4300	6503	57309797	SO:0001583	missense	1600	exon8			BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.544C>G	1.37:g.57537209G>C	ENSP00000360275:p.Gln182Glu	Somatic		Capture	Illumina HiSeq	Phase_I	57309797	NM_021080	A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Missense_Mutation	SNP	ENST00000371231.1	37		.	.	.	.	.	.	.	.	.	.	G	17.61	3.432422	0.62844	.	.	ENSG00000173406	ENST00000371236;ENST00000371233;ENST00000371234;ENST00000420954;ENST00000414851;ENST00000371231;ENST00000332102;ENST00000371230	T;T;T;T;T;T;T	0.64260	0.86;0.86;1.13;1.19;0.84;0.11;-0.09	6.16	6.16	0.99307	.	0.052644	0.85682	D	0.000000	T	0.48314	0.1493	N	0.19112	0.55	0.80722	D	1	P;B;B;B	0.39480	0.675;0.136;0.087;0.087	B;B;B;B	0.39258	0.295;0.037;0.063;0.063	T	0.47315	-0.9127	10	0.02654	T	1	-19.2076	20.8598	0.99761	0.0:0.0:1.0:0.0	.	182;182;182;182	O75553-4;O75553;O75553-6;O75553-5	.;DAB1_HUMAN;.;.	E	182	ENSP00000360280:Q182E;ENSP00000360278:Q182E;ENSP00000395296:Q182E;ENSP00000387581:Q182E;ENSP00000360275:Q182E;ENSP00000329120:Q182E;ENSP00000360274:Q182E	ENSP00000329120:Q182E	Q	-	1	0	DAB1	57309797	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.937000	0.99478	0.650000	0.86243	CAA		DAB1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000027962.1	NM_021080	
ROR1	4919	broad.mit.edu	37	1	64624706	64624706	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr1:64624706A>G	ENST00000371079.1	+	8	1592	c.1217A>G	c.(1216-1218)tAc>tGc	p.Y406C	ROR1_ENST00000545203.1_5'UTR|RP11-24J23.2_ENST00000424995.1_RNA	NM_005012.3	NP_005003.2	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1	406					peptidyl-tyrosine phosphorylation (GO:0018108)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)	p.Y406C(1)		breast(7)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(10)|ovary(6)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	51						GAAATCCTGTACATACTAGTG	0.408																																					p.Y406C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1217G	1						.						110.0	105.0	106.0					1																	64624706		2203	4300	6503	64397294	SO:0001583	missense	4919	exon8			M97675	CCDS626.1, CCDS41344.1	1p32-p31	2013-01-11			ENSG00000185483	ENSG00000185483		"""Immunoglobulin superfamily / I-set domain containing"""	10256	protein-coding gene	gene with protein product		602336		NTRKR1		1334494, 8875995	Standard	NM_001083592		Approved		uc001dbj.3	Q01973	OTTHUMG00000009022	ENST00000371079.1:c.1217A>G	1.37:g.64624706A>G	ENSP00000360120:p.Tyr406Cys	Somatic		Capture	Illumina HiSeq	Phase_I	64397294	NM_005012	Q5VVX6|Q66K77|Q92776	Missense_Mutation	SNP	ENST00000371079.1	37	CCDS626.1	.	.	.	.	.	.	.	.	.	.	A	19.57	3.852525	0.71719	.	.	ENSG00000185483	ENST00000371079;ENST00000544776	T	0.76448	-1.02	5.77	5.77	0.91146	Kringle-like fold (1);	0.000000	0.39210	N	0.001430	T	0.74658	0.3745	L	0.32530	0.975	0.80722	D	1	D	0.67145	0.996	P	0.58077	0.832	T	0.79598	-0.1737	10	0.87932	D	0	.	14.9523	0.71083	1.0:0.0:0.0:0.0	.	406	Q01973	ROR1_HUMAN	C	406;409	ENSP00000360120:Y406C	ENSP00000360120:Y406C	Y	+	2	0	ROR1	64397294	1.000000	0.71417	1.000000	0.80357	0.666000	0.39218	9.255000	0.95524	2.330000	0.79161	0.528000	0.53228	TAC		ROR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025002.1	NM_005012	
GBP7	388646	broad.mit.edu	37	1	89616102	89616102	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr1:89616102A>T	ENST00000294671.2	-	6	920	c.782T>A	c.(781-783)tTc>tAc	p.F261Y		NM_207398.2	NP_997281.2	Q8N8V2	GBP7_HUMAN	guanylate binding protein 7	261	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.F261Y(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Lung NSC(277;0.0908)		all cancers(265;0.00835)|Epithelial(280;0.0322)		TTGCATCTGGAAATTACTATC	0.398																																					p.F261Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T782A	1						.						126.0	121.0	123.0					1																	89616102		2203	4300	6503	89388690	SO:0001583	missense	388646	exon6			AK096141	CCDS720.1	1p22.2	2008-02-05			ENSG00000213512	ENSG00000213512			29606	protein-coding gene	gene with protein product		612468					Standard	NM_207398		Approved	FLJ38822, GBP4L	uc001dna.2	Q8N8V2	OTTHUMG00000010659	ENST00000294671.2:c.782T>A	1.37:g.89616102A>T	ENSP00000294671:p.Phe261Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	89388690	NM_207398		Missense_Mutation	SNP	ENST00000294671.2	37	CCDS720.1	.	.	.	.	.	.	.	.	.	.	A	16.02	3.004258	0.54254	.	.	ENSG00000213512	ENST00000294671	D	0.83837	-1.77	3.4	3.4	0.38934	Guanylate-binding protein, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.88444	0.6438	M	0.84773	2.715	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.89531	0.3785	10	0.87932	D	0	.	9.8308	0.40941	1.0:0.0:0.0:0.0	.	261	Q8N8V2	GBP7_HUMAN	Y	261	ENSP00000294671:F261Y	ENSP00000294671:F261Y	F	-	2	0	GBP7	89388690	0.998000	0.40836	0.011000	0.14972	0.005000	0.04900	5.981000	0.70524	1.424000	0.47217	0.338000	0.21704	TTC		GBP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029401.1	NM_207398	
LRRC8C	84230	broad.mit.edu	37	1	90178694	90178694	+	Silent	SNP	A	A	C			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr1:90178694A>C	ENST00000370454.4	+	3	820	c.565A>C	c.(565-567)Agg>Cgg	p.R189R	LRRC8C_ENST00000479252.1_Intron|RP11-302M6.4_ENST00000370453.5_Intron	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	189					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.R189R(1)		breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		AAAGGACAACAGGAAGAACAA	0.458																																					p.R189R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A565C	1						.						63.0	64.0	64.0					1																	90178694		2203	4300	6503	89951282	SO:0001819	synonymous_variant	84230	exon3				CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.565A>C	1.37:g.90178694A>C		Somatic		Capture	Illumina HiSeq	Phase_I	89951282	NM_032270	B3KXS9|Q29RV6|Q9H075	Silent	SNP	ENST00000370454.4	37	CCDS725.1																																																																																				LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028435.2	NM_032270	
AHCTF1	25909	broad.mit.edu	37	1	247067334	247067334	+	Splice_Site	SNP	C	C	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr1:247067334C>T	ENST00000391829.2	-	7	1006	c.883G>A	c.(883-885)Gaa>Aaa	p.E295K	AHCTF1_ENST00000326225.3_Splice_Site_p.E304K|AHCTF1_ENST00000366508.1_Splice_Site_p.E330K			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	295	Necessary for cytoplasmic localization. {ECO:0000250}.|Seven-bladed beta propeller repeats. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E295K(1)		NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			ACATCCCCTTCACTGAAACAG	0.373																																					p.E304K	Colon(145;197 1800 4745 15099 26333)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G910A	1						.						70.0	67.0	68.0					1																	247067334		2203	4300	6503	245133957	SO:0001630	splice_region_variant	25909	exon7				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.882-1G>A	1.37:g.247067334C>T		Somatic		Capture	Illumina HiSeq	Phase_I	245133957	NM_015446	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	ENST00000391829.2	37		.	.	.	.	.	.	.	.	.	.	C	30	5.052023	0.93793	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.21191	2.02;2.02;2.02	5.37	5.37	0.77165	.	0.051464	0.85682	D	0.000000	T	0.36608	0.0973	L	0.32530	0.975	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.68765	0.96;0.936	T	0.03630	-1.1018	10	0.40728	T	0.16	-24.8108	19.1058	0.93294	0.0:1.0:0.0:0.0	.	330;295	Q8WYP5-2;Q8WYP5	.;ELYS_HUMAN	K	330;304;295	ENSP00000355464:E330K;ENSP00000355465:E304K;ENSP00000375705:E295K	ENSP00000355465:E304K	E	-	1	0	AHCTF1	245133957	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.298000	0.78815	2.506000	0.84524	0.557000	0.71058	GAA		AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015446	Missense_Mutation
DEFB126	81623	broad.mit.edu	37	20	126092	126092	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr20:126092G>A	ENST00000382398.3	+	2	355	c.95G>A	c.(94-96)gGa>gAa	p.G32E	DEFB126_ENST00000542572.1_3'UTR	NM_030931.3	NP_112193.1	Q9BYW3	DB126_HUMAN	defensin, beta 126	32					defense response to bacterium (GO:0042742)	cell surface (GO:0009986)|extracellular region (GO:0005576)|glycocalyx (GO:0030112)		p.G32E(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(1)	4		all_cancers(10;7.65e-05)|Lung NSC(37;0.0417)|all_epithelial(17;0.0676)|all_lung(30;0.0713)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.122)			AACGACGTTGGAATTTGCAAG	0.383																																					p.G32E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G95A	20						.						140.0	132.0	135.0					20																	126092		2203	4300	6503	74092	SO:0001583	missense	81623	exon2				CCDS12990.1	20p13	2010-03-30	2002-05-09	2002-05-10	ENSG00000125788	ENSG00000125788		"""Defensins, beta"""	15900	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 8"""	C20orf8		11854508	Standard	NM_030931		Approved	bA530N10.1, DEFB-26	uc002wcx.3	Q9BYW3	OTTHUMG00000031616	ENST00000382398.3:c.95G>A	20.37:g.126092G>A	ENSP00000371835:p.Gly32Glu	Somatic		Capture	Illumina HiSeq	Phase_I	74092	NM_030931	Q562G3|Q9H1M5	Missense_Mutation	SNP	ENST00000382398.3	37	CCDS12990.1	.	.	.	.	.	.	.	.	.	.	G	15.22	2.770367	0.49680	.	.	ENSG00000125788	ENST00000382398	T	0.63417	-0.04	3.74	3.74	0.42951	.	0.000000	0.46145	D	0.000316	T	0.64216	0.2578	N	0.19112	0.55	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.55829	-0.8079	10	0.87932	D	0	-31.0193	11.3542	0.49607	0.0:0.0:1.0:0.0	.	32	Q9BYW3	DB126_HUMAN	E	32	ENSP00000371835:G32E	ENSP00000371835:G32E	G	+	2	0	DEFB126	74092	0.457000	0.25752	0.037000	0.18230	0.005000	0.04900	3.056000	0.49923	2.371000	0.80710	0.561000	0.74099	GGA		DEFB126-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077428.2	NM_030931	
CENPB	1059	broad.mit.edu	37	20	3765546	3765546	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr20:3765546C>T	ENST00000379751.4	-	1	1791	c.1585G>A	c.(1585-1587)Gac>Aac	p.D529N	CDC25B_ENST00000344256.6_5'Flank|CDC25B_ENST00000379598.5_5'Flank	NM_001810.5	NP_001801.1	P07199	CENPB_HUMAN	centromere protein B, 80kDa	529	Asp/Glu-rich (acidic).				regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)	centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|satellite DNA binding (GO:0003696)|sequence-specific DNA binding (GO:0043565)	p.D529N(1)		kidney(1)|large_intestine(2)|lung(4)|skin(1)	8						tcatcatcgtcgtcttcatct	0.537																																					p.D529N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1585A	20						.						233.0	173.0	193.0					20																	3765546		2203	4300	6503	3713546	SO:0001583	missense	1059	exon1			X05299	CCDS13064.1	20p13	2013-11-05	2002-08-29		ENSG00000125817	ENSG00000125817			1852	protein-coding gene	gene with protein product		117140	"""centromere protein B (80kD)"""			8406460, 11884609	Standard	NM_001810		Approved		uc002wjk.3	P07199	OTTHUMG00000031761	ENST00000379751.4:c.1585G>A	20.37:g.3765546C>T	ENSP00000369075:p.Asp529Asn	Somatic		Capture	Illumina HiSeq	Phase_I	3713546	NM_001810	Q96EI4	Missense_Mutation	SNP	ENST00000379751.4	37	CCDS13064.1	.	.	.	.	.	.	.	.	.	.	C	5.735	0.320134	0.10845	.	.	ENSG00000125817	ENST00000379751;ENST00000536335	T	0.26223	1.75	4.32	4.32	0.51571	Centromere protein Cenp-B, dimerisation domain (1);	.	.	.	.	T	0.23611	0.0571	L	0.27053	0.805	0.21325	N	0.999724	D	0.55385	0.971	P	0.48189	0.57	T	0.06338	-1.0832	9	0.26408	T	0.33	.	12.2756	0.54733	0.0:1.0:0.0:0.0	.	529	P07199	CENPB_HUMAN	N	529;68	ENSP00000369075:D529N	ENSP00000369075:D529N	D	-	1	0	CENPB	3713546	0.255000	0.24002	0.133000	0.22050	0.021000	0.10359	3.285000	0.51716	1.952000	0.56665	0.655000	0.94253	GAC		CENPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077772.2	NM_001810	
DSCAM	1826	broad.mit.edu	37	21	41450657	41450657	+	Silent	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr21:41450657G>A	ENST00000400454.1	-	26	5145	c.4668C>T	c.(4666-4668)tgC>tgT	p.C1556C		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1556	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.C1556C(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GCTTCTCCGCGCAGCCCGCAC	0.587																																					p.C1556C	Melanoma(134;970 1778 1785 21664 32388)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4668T	21						.						75.0	79.0	78.0					21																	41450657		2190	4290	6480	40372527	SO:0001819	synonymous_variant	1826	exon26			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.4668C>T	21.37:g.41450657G>A		Somatic		Capture	Illumina HiSeq	Phase_I	40372527	NM_001389	O60468	Silent	SNP	ENST00000400454.1	37	CCDS42929.1																																																																																				DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
ITGB2	3689	broad.mit.edu	37	21	46306689	46306689	+	Missense_Mutation	SNP	G	G	A	rs568682818	byFrequency	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr21:46306689G>A	ENST00000397850.2	-	16	2661	c.2209C>T	c.(2209-2211)Cgc>Tgc	p.R737C	ITGB2_ENST00000397857.1_Missense_Mutation_p.R737C|ITGB2_ENST00000397854.3_Missense_Mutation_p.R680C|ITGB2_ENST00000355153.4_Missense_Mutation_p.R737C|ITGB2_ENST00000397852.1_Missense_Mutation_p.R737C|ITGB2_ENST00000302347.5_Missense_Mutation_p.R737C			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	737					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)	p.R737C(1)		breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	TTCTCAAAGCGCCTGTACTCC	0.612													G|||	2	0.000399361	0.0	0.0	5008	,	,		17604	0.0		0.001	False		,,,				2504	0.001				p.R737C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2209T	21						.						100.0	83.0	89.0					21																	46306689		2203	4300	6503	45131117	SO:0001583	missense	3689	exon15			AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.2209C>T	21.37:g.46306689G>A	ENSP00000380948:p.Arg737Cys	Somatic		Capture	Illumina HiSeq	Phase_I	45131117	NM_001127491	B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Missense_Mutation	SNP	ENST00000397850.2	37	CCDS13716.1	.	.	.	.	.	.	.	.	.	.	G	13.62	2.292327	0.40594	.	.	ENSG00000160255	ENST00000397852;ENST00000397857;ENST00000397854;ENST00000355153;ENST00000397850;ENST00000302347	D;D;D;D;D;D	0.90324	-2.65;-2.65;-2.65;-2.65;-2.65;-2.65	4.51	3.55	0.40652	Integrin beta subunit, cytoplasmic (2);	.	.	.	.	D	0.93644	0.7970	M	0.72894	2.215	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.93363	0.6728	9	0.87932	D	0	.	9.0891	0.36598	0.0:0.0:0.6439:0.3561	.	680;737	A8MYE6;P05107	.;ITB2_HUMAN	C	737;737;680;737;737;737	ENSP00000380950:R737C;ENSP00000380955:R737C;ENSP00000380952:R680C;ENSP00000347279:R737C;ENSP00000380948:R737C;ENSP00000303242:R737C	ENSP00000303242:R737C	R	-	1	0	ITGB2	45131117	1.000000	0.71417	0.976000	0.42696	0.091000	0.18340	2.861000	0.48380	2.055000	0.61198	0.655000	0.94253	CGC		ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206566.2	NM_000211	
SLC25A18	83733	broad.mit.edu	37	22	18070018	18070018	+	Missense_Mutation	SNP	A	A	C	rs201336926		TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr22:18070018A>C	ENST00000327451.6	+	8	1064	c.526A>C	c.(526-528)Act>Cct	p.T176P	SLC25A18_ENST00000399813.1_Missense_Mutation_p.T176P|AC004019.13_ENST00000443935.1_RNA	NM_031481.1	NP_113669.1	Q9H1K4	GHC2_HUMAN	solute carrier family 25 (glutamate carrier), member 18	176						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	symporter activity (GO:0015293)	p.T176P(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)	18				Lung(27;0.124)		GCTGCTCCGCACTCAGGGCCT	0.662													A|||	1	0.000199681	0.0	0.0	5008	,	,		16786	0.0		0.001	False		,,,				2504	0.0				p.T176P	Colon(118;1560 1625 18964 29606 50093)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A526C	22						.						72.0	71.0	72.0					22																	18070018		2203	4300	6503	16450018	SO:0001583	missense	83733	exon8			AY008285	CCDS13744.1	22q11.2	2013-05-22	2012-03-29		ENSG00000182902	ENSG00000182902		"""Solute carriers"""	10988	protein-coding gene	gene with protein product		609303	"""solute carrier family 25 (mitochondrial carrier), member 18"""			11381032, 11897791	Standard	NM_031481		Approved		uc002zmp.1	Q9H1K4	OTTHUMG00000150089	ENST00000327451.6:c.526A>C	22.37:g.18070018A>C	ENSP00000329033:p.Thr176Pro	Somatic		Capture	Illumina HiSeq	Phase_I	16450018	NM_031481		Missense_Mutation	SNP	ENST00000327451.6	37	CCDS13744.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	A	15.67	2.901129	0.52227	.	.	ENSG00000182902	ENST00000327451;ENST00000399813	T;T	0.79454	-1.27;-1.27	4.95	3.9	0.45041	Mitochondrial carrier domain (2);	0.150965	0.64402	D	0.000016	D	0.87916	0.6298	M	0.92507	3.315	0.30223	N	0.796678	P	0.52463	0.953	P	0.59825	0.864	D	0.85943	0.1459	10	0.62326	D	0.03	.	10.3833	0.44125	0.9153:0.0:0.0847:0.0	.	176	Q9H1K4	GHC2_HUMAN	P	176	ENSP00000329033:T176P;ENSP00000382710:T176P	ENSP00000329033:T176P	T	+	1	0	SLC25A18	16450018	0.065000	0.20965	0.173000	0.22940	0.767000	0.43475	2.592000	0.46171	2.002000	0.58637	0.397000	0.26171	ACT		SLC25A18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316214.3	NM_031481	
ZNF74	7625	broad.mit.edu	37	22	20761176	20761176	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr22:20761176C>T	ENST00000400451.2	+	5	2367	c.1853C>T	c.(1852-1854)gCg>gTg	p.A618V	ZNF74_ENST00000356671.5_Missense_Mutation_p.A618V|ZNF74_ENST00000357502.5_3'UTR|ZNF74_ENST00000403682.3_3'UTR|ZNF74_ENST00000405993.1_Missense_Mutation_p.A586V	NM_003426.3	NP_003417.2	Q16587	ZNF74_HUMAN	zinc finger protein 74	618					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A618V(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	19	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			CCCATCGACGCGCTGGATGTG	0.572																																					p.A618V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1853T	22						.						54.0	59.0	58.0					22																	20761176		2133	4240	6373	19091176	SO:0001583	missense	7625	exon5			X71623	CCDS42982.1, CCDS58794.1	22q11.2	2013-01-08	2006-05-12		ENSG00000185252	ENSG00000185252		"""Zinc fingers, C2H2-type"", ""-"""	13144	protein-coding gene	gene with protein product		194548	"""zinc finger protein 74 (Cos52)"""			1639391, 10591208	Standard	NM_003426		Approved	Cos52, Zfp520, ZNF520	uc010gsm.4	Q16587	OTTHUMG00000150687	ENST00000400451.2:c.1853C>T	22.37:g.20761176C>T	ENSP00000383301:p.Ala618Val	Somatic		Capture	Illumina HiSeq	Phase_I	19091176	NM_003426	B5MCE3|B7Z5Y2|Q6IBV2|Q6PJP1|Q9UC04|Q9UF05|Q9UF06|Q9UF07	Missense_Mutation	SNP	ENST00000400451.2	37	CCDS42982.1	.	.	.	.	.	.	.	.	.	.	C	15.12	2.737747	0.49045	.	.	ENSG00000185252	ENST00000400451;ENST00000356671;ENST00000405993	T;T;T	0.07021	3.33;3.33;3.23	4.04	4.04	0.47022	.	0.457832	0.16223	N	0.223973	T	0.07999	0.0200	L	0.34521	1.04	0.09310	N	1	B	0.30146	0.27	B	0.24394	0.053	T	0.20338	-1.0278	10	0.59425	D	0.04	.	14.5044	0.67743	0.0:1.0:0.0:0.0	.	618	Q16587	ZNF74_HUMAN	V	618;618;586	ENSP00000383301:A618V;ENSP00000349098:A618V;ENSP00000385855:A586V	ENSP00000349098:A618V	A	+	2	0	ZNF74	19091176	0.003000	0.15002	0.014000	0.15608	0.007000	0.05969	1.835000	0.39181	2.535000	0.85469	0.563000	0.77884	GCG		ZNF74-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319648.2	NM_003426	
NPTXR	23467	broad.mit.edu	37	22	39222678	39222678	+	Missense_Mutation	SNP	C	C	T	rs368736692		TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr22:39222678C>T	ENST00000333039.2	-	3	1048	c.925G>A	c.(925-927)Gtg>Atg	p.V309M		NM_014293.3	NP_055108	O95502	NPTXR_HUMAN	neuronal pentraxin receptor	309	Pentaxin.					integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)	p.V309M(1)		central_nervous_system(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	Melanoma(58;0.04)					GCCTTCCGCACGCGGGCGTAC	0.622																																					p.V309M	Pancreas(139;2521 3281 36965)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G925A	22						.	C	MET/VAL	0,4406		0,0,2203	91.0	81.0	84.0		925	2.2	1.0	22		84	1,8599	1.2+/-3.3	0,1,4299	no	missense	NPTXR	NM_014293.3	21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	309/501	39222678	1,13005	2203	4300	6503	37552624	SO:0001583	missense	23467	exon3			AF052163	CCDS33647.1	22q13.1	2007-01-25			ENSG00000221890	ENSG00000221890			7954	protein-coding gene	gene with protein product		609474				16497176	Standard	NM_014293		Approved		uc003awk.3	O95502	OTTHUMG00000150458	ENST00000333039.2:c.925G>A	22.37:g.39222678C>T	ENSP00000327545:p.Val309Met	Somatic		Capture	Illumina HiSeq	Phase_I	37552624	NM_014293		Missense_Mutation	SNP	ENST00000333039.2	37	CCDS33647.1	.	.	.	.	.	.	.	.	.	.	C	18.48	3.633610	0.67015	0.0	1.16E-4	ENSG00000221890	ENST00000333039	T	0.61980	0.06	4.64	2.24	0.28232	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.270890	0.35903	N	0.002909	T	0.56062	0.1960	L	0.43701	1.375	0.42244	D	0.991943	P	0.50272	0.933	P	0.45946	0.498	T	0.68550	-0.5379	9	0.59425	D	0.04	-47.7375	10.8239	0.46620	0.0:0.7442:0.0:0.2558	.	309	O95502	NPTXR_HUMAN	M	309	ENSP00000327545:V309M	ENSP00000327545:V309M	V	-	1	0	NPTXR	37552624	0.245000	0.23899	1.000000	0.80357	0.930000	0.56654	0.260000	0.18424	0.740000	0.32651	0.655000	0.94253	GTG		NPTXR-001	KNOWN	non_ATG_start|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318194.2	NM_014293	
GCC2	9648	broad.mit.edu	37	2	109087283	109087283	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr2:109087283A>G	ENST00000309863.6	+	6	2212	c.1498A>G	c.(1498-1500)Aaa>Gaa	p.K500E		NM_181453.3	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain containing 2	500					Golgi ribbon formation (GO:0090161)|late endosome to Golgi transport (GO:0034499)|microtubule anchoring (GO:0034453)|microtubule organizing center organization (GO:0031023)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|recycling endosome to Golgi transport (GO:0071955)|regulation of protein exit from endoplasmic reticulum (GO:0070861)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)	p.K500E(1)		breast(8)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	54						ATCTGCTGGAAAAATAAGTCA	0.373																																					p.K500E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1498G	2						.						60.0	62.0	61.0					2																	109087283		2202	4297	6499	108453715	SO:0001583	missense	9648	exon6			BC020645	CCDS33268.1	2q12.3	2008-02-05	2004-03-05		ENSG00000135968	ENSG00000135968			23218	protein-coding gene	gene with protein product		612711	"""GRIP and coiled-coil domain-containing 2"""			12446665	Standard	NM_181453		Approved	GCC185, KIAA0336	uc002tec.3	Q8IWJ2	OTTHUMG00000153214	ENST00000309863.6:c.1498A>G	2.37:g.109087283A>G	ENSP00000307939:p.Lys500Glu	Somatic		Capture	Illumina HiSeq	Phase_I	108453715	NM_181453	A6H8X8|O15045|Q4ZG46|Q8TDH3|Q9H2G8	Missense_Mutation	SNP	ENST00000309863.6	37	CCDS33268.1	.	.	.	.	.	.	.	.	.	.	A	17.12	3.307123	0.60305	.	.	ENSG00000135968	ENST00000309863;ENST00000409896;ENST00000393318	T	0.36699	1.24	5.4	4.24	0.50183	.	0.179384	0.49305	D	0.000153	T	0.34571	0.0902	M	0.69823	2.125	0.38980	D	0.958924	B	0.21606	0.058	B	0.20184	0.028	T	0.17745	-1.0359	10	0.12103	T	0.63	.	11.2765	0.49170	0.9281:0.0:0.0719:0.0	.	500	Q8IWJ2	GCC2_HUMAN	E	500;463;245	ENSP00000307939:K500E	ENSP00000307939:K500E	K	+	1	0	GCC2	108453715	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.624000	0.67764	0.990000	0.38787	0.528000	0.53228	AAA		GCC2-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358516.3	NM_014635	
THSD7B	80731	broad.mit.edu	37	2	137814212	137814212	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr2:137814212G>A	ENST00000409968.1	+	3	540	c.362G>A	c.(361-363)cGc>cAc	p.R121H	THSD7B_ENST00000272643.3_Missense_Mutation_p.R121H|THSD7B_ENST00000413152.2_Missense_Mutation_p.R90H|THSD7B_ENST00000543459.1_5'Flank			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	121	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)		p.R121H(2)		NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		CCTTACGCTCGCGGTGAAGTC	0.542																																					p.R90H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G269A	2						.						75.0	82.0	79.0					2																	137814212		2061	4206	6267	137530682	SO:0001583	missense	80731	exon2					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.362G>A	2.37:g.137814212G>A	ENSP00000387145:p.Arg121His	Somatic		Capture	Illumina HiSeq	Phase_I	137530682	NM_001080427		Missense_Mutation	SNP	ENST00000409968.1	37		.	.	.	.	.	.	.	.	.	.	g	5.876	0.345696	0.11126	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.23754	2.43;2.29;1.89	6.07	1.07	0.20283	.	0.972227	0.08512	N	0.934707	T	0.07818	0.0196	N	0.01705	-0.755	0.09310	N	0.999997	B	0.02656	0.0	B	0.01281	0.0	T	0.36286	-0.9754	9	.	.	.	.	1.4505	0.02374	0.5177:0.1143:0.2233:0.1447	.	90	C9JKN6	.	H	121;121;90	ENSP00000387145:R121H;ENSP00000272643:R121H;ENSP00000413841:R90H	.	R	+	2	0	THSD7B	137530682	0.000000	0.05858	0.002000	0.10522	0.135000	0.20990	0.037000	0.13840	-0.046000	0.13446	-0.385000	0.06624	CGC		THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9	
KCNS3	3790	broad.mit.edu	37	2	18112879	18112879	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr2:18112879A>T	ENST00000403915.1	+	3	1055	c.604A>T	c.(604-606)Atg>Ttg	p.M202L	KCNS3_ENST00000304101.4_Missense_Mutation_p.M202L|KCNS3_ENST00000465292.1_Intron	NM_001282428.1	NP_001269357.1	Q9BQ31	KCNS3_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3	202					energy reserve metabolic process (GO:0006112)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel regulator activity (GO:0015459)	p.M202L(1)		endometrium(5)|kidney(1)|large_intestine(7)|lung(11)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					CATCGTGGCCATGTGCGTTCA	0.542																																					p.M202L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A604T	2						.						64.0	63.0	63.0					2																	18112879		2203	4300	6503	17976360	SO:0001583	missense	3790	exon3			AF043472	CCDS1692.1	2p24	2011-07-05			ENSG00000170745	ENSG00000170745		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6302	protein-coding gene	gene with protein product		603888				10484328, 16382104	Standard	NM_002252		Approved	Kv9.3	uc002rcw.3	Q9BQ31	OTTHUMG00000044150	ENST00000403915.1:c.604A>T	2.37:g.18112879A>T	ENSP00000385968:p.Met202Leu	Somatic		Capture	Illumina HiSeq	Phase_I	17976360	NM_002252	D6W520|O43651|Q4ZFY1|Q96B56	Missense_Mutation	SNP	ENST00000403915.1	37	CCDS1692.1	.	.	.	.	.	.	.	.	.	.	A	17.07	3.295917	0.60086	.	.	ENSG00000170745	ENST00000403915;ENST00000304101	D;D	0.97041	-4.22;-4.22	6.07	6.07	0.98685	.	0.035762	0.85682	D	0.000000	D	0.93654	0.7973	L	0.36672	1.1	0.58432	D	0.999997	B	0.19706	0.038	B	0.21546	0.035	D	0.89850	0.4009	10	0.02654	T	1	.	16.6288	0.85011	1.0:0.0:0.0:0.0	.	202	Q9BQ31	KCNS3_HUMAN	L	202	ENSP00000385968:M202L;ENSP00000305824:M202L	ENSP00000305824:M202L	M	+	1	0	KCNS3	17976360	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	9.339000	0.96797	2.326000	0.78906	0.533000	0.62120	ATG		KCNS3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323808.1	NM_002252	
OSBPL6	114880	broad.mit.edu	37	2	179259117	179259117	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr2:179259117G>T	ENST00000190611.4	+	24	3027	c.2651G>T	c.(2650-2652)cGa>cTa	p.R884L	OSBPL6_ENST00000315022.2_Missense_Mutation_p.R888L|OSBPL6_ENST00000409045.3_Missense_Mutation_p.R853L|OSBPL6_ENST00000409631.1_Missense_Mutation_p.R848L|OSBPL6_ENST00000392505.2_Missense_Mutation_p.R909L|OSBPL6_ENST00000359685.3_Missense_Mutation_p.R848L	NM_032523.3	NP_115912.1	Q9BZF3	OSBL6_HUMAN	oxysterol binding protein-like 6	884					lipid transport (GO:0006869)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)	p.R884L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(18)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			TCTCGGAGACGATATATGGAA	0.373																																					p.R884L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2651T	2						.						106.0	119.0	115.0					2																	179259117		2203	4300	6503	178967363	SO:0001583	missense	114880	exon24			AF392448	CCDS2277.1, CCDS2278.1, CCDS56150.1, CCDS56151.1, CCDS56152.1	2q32.1	2008-05-27			ENSG00000079156	ENSG00000079156		"""Oxysterol binding proteins"""	16388	protein-coding gene	gene with protein product	"""OSBP-related protein 6"""	606734				11483621	Standard	NM_001201480		Approved	ORP6	uc002uly.3	Q9BZF3	OTTHUMG00000132579	ENST00000190611.4:c.2651G>T	2.37:g.179259117G>T	ENSP00000190611:p.Arg884Leu	Somatic		Capture	Illumina HiSeq	Phase_I	178967363	NM_032523	B4DTW1|C4AMC0|C4AME4|D3DPF6|D3DPF7|Q4ZG68|Q53T68|Q59H61|Q7Z4Q1|Q86V84|Q8N9T0|Q96SR1	Missense_Mutation	SNP	ENST00000190611.4	37	CCDS2277.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.585811	0.86748	.	.	ENSG00000079156	ENST00000392505;ENST00000359685;ENST00000409045;ENST00000190611;ENST00000409631;ENST00000315022	T;T;T;T;T;T	0.34667	1.35;1.35;1.35;1.35;1.35;1.35	6.07	6.07	0.98685	.	0.128204	0.56097	D	0.000027	T	0.67126	0.2860	M	0.92169	3.28	0.58432	D	0.999998	P;P;D;D;D	0.71674	0.758;0.875;0.998;0.98;0.965	P;P;D;P;P	0.68039	0.628;0.774;0.955;0.774;0.83	T	0.74210	-0.3739	10	0.87932	D	0	-9.5297	13.7999	0.63192	0.0696:0.0:0.9304:0.0	.	853;888;848;909;884	Q9BZF3-4;Q9BZF3-3;Q9BZF3-2;Q9BZF3-5;Q9BZF3	.;.;.;.;OSBL6_HUMAN	L	909;848;853;884;848;888	ENSP00000376293:R909L;ENSP00000352713:R848L;ENSP00000387248:R853L;ENSP00000190611:R884L;ENSP00000386885:R848L;ENSP00000318723:R888L	ENSP00000190611:R884L	R	+	2	0	OSBPL6	178967363	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.145000	0.58065	2.890000	0.99128	0.585000	0.79938	CGA		OSBPL6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334393.2	NM_032523	
COL5A2	1290	broad.mit.edu	37	2	189910538	189910538	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr2:189910538T>G	ENST00000374866.3	-	46	3571	c.3297A>C	c.(3295-3297)caA>caC	p.Q1099H		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	1099					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.Q1099H(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			GATCTCCTCTTTGTCCTGCAT	0.537																																					p.Q1099H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3297C	2						.						88.0	82.0	84.0					2																	189910538		2203	4300	6503	189618783	SO:0001583	missense	1290	exon46			Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.3297A>C	2.37:g.189910538T>G	ENSP00000364000:p.Gln1099His	Somatic		Capture	Illumina HiSeq	Phase_I	189618783	NM_000393	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	ENST00000374866.3	37	CCDS33350.1	.	.	.	.	.	.	.	.	.	.	T	16.19	3.051939	0.55218	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.93189	-3.18	5.21	-1.54	0.08584	.	0.138683	0.32703	N	0.005742	D	0.85336	0.5673	L	0.41079	1.255	0.36453	D	0.866232	B;P	0.38677	0.187;0.642	B;B	0.34452	0.037;0.183	T	0.78871	-0.2033	10	0.13470	T	0.59	.	9.9567	0.41671	0.0:0.3939:0.0:0.6061	.	739;1099	Q5PR22;P05997	.;CO5A2_HUMAN	H	1099;739	ENSP00000364000:Q1099H	ENSP00000364000:Q1099H	Q	-	3	2	COL5A2	189618783	0.999000	0.42202	0.989000	0.46669	0.996000	0.88848	0.635000	0.24629	-0.405000	0.07599	0.528000	0.53228	CAA		COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393	
ALS2CR12	130540	broad.mit.edu	37	2	202163982	202163982	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr2:202163982T>A	ENST00000286190.5	-	11	967	c.921A>T	c.(919-921)gaA>gaT	p.E307D	ALS2CR12_ENST00000405148.2_Missense_Mutation_p.E307D|ALS2CR12_ENST00000392257.3_Missense_Mutation_p.E307D|ALS2CR12_ENST00000439709.1_Missense_Mutation_p.E307D			Q96Q35	AL2SB_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12	307					regulation of GTPase activity (GO:0043087)	outer dense fiber (GO:0001520)|sperm fibrous sheath (GO:0035686)|sperm flagellum (GO:0036126)		p.E307D(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)	21						TTCTCAGCTCTTCTAATTGCA	0.368																																					p.E307D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A921T	2						.						214.0	209.0	211.0					2																	202163982		2203	4300	6503	201872227	SO:0001583	missense	130540	exon12			AB053314	CCDS2346.1, CCDS46488.1	2q33.1	2009-10-06			ENSG00000155749	ENSG00000155749			14439	protein-coding gene	gene with protein product							Standard	XM_006712272		Approved		uc002uya.4	Q96Q35	OTTHUMG00000132824	ENST00000286190.5:c.921A>T	2.37:g.202163982T>A	ENSP00000286190:p.Glu307Asp	Somatic		Capture	Illumina HiSeq	Phase_I	201872227	NM_001127391	G5E9S3|Q53TT6|Q8N1B6	Missense_Mutation	SNP	ENST00000286190.5	37	CCDS2346.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.35|12.35	1.910910|1.910910	0.33721|0.33721	.|.	.|.	ENSG00000155749|ENSG00000155749	ENST00000286190;ENST00000405148;ENST00000392257;ENST00000439709|ENST00000415745	T;T;T;T|.	0.43688|.	0.94;0.94;0.94;0.94|.	4.52|4.52	-0.9|-0.9	0.10544|0.10544	.|.	0.262894|.	0.26891|.	N|.	0.021979|.	T|T	0.30166|0.30166	0.0756|0.0756	L|L	0.29908|0.29908	0.895|0.895	0.21822|0.21822	N|N	0.999521|0.999521	P;P|.	0.50156|.	0.932;0.827|.	P;B|.	0.46543|.	0.52;0.442|.	T|T	0.31696|0.31696	-0.9934|-0.9934	10|5	0.29301|.	T|.	0.29|.	-6.2128|-6.2128	7.7233|7.7233	0.28744|0.28744	0.0:0.3791:0.0:0.6209|0.0:0.3791:0.0:0.6209	.|.	307;307|.	Q96Q35;G5E9S3|.	AL2SB_HUMAN;.|.	D|M	307|82	ENSP00000286190:E307D;ENSP00000385098:E307D;ENSP00000376086:E307D;ENSP00000412073:E307D|.	ENSP00000286190:E307D|.	E|K	-|-	3|2	2|0	ALS2CR12|ALS2CR12	201872227|201872227	0.951000|0.951000	0.32395|0.32395	0.988000|0.988000	0.46212|0.46212	0.512000|0.512000	0.34134|0.34134	0.131000|0.131000	0.15870|0.15870	-0.069000|-0.069000	0.12931|0.12931	-0.468000|-0.468000	0.05107|0.05107	GAA|AAG		ALS2CR12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256286.1	NM_139163	
NCL	4691	broad.mit.edu	37	2	232326411	232326411	+	Silent	SNP	A	A	G			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr2:232326411A>G	ENST00000322723.4	-	3	693	c.453T>C	c.(451-453)gaT>gaC	p.D151D	SNORD82_ENST00000365530.1_RNA	NM_005381.2	NP_005372.2	P19338	NUCL_HUMAN	nucleolin	151	Asp/Glu-rich (acidic).				angiogenesis (GO:0001525)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)	cell cortex (GO:0005938)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)	p.D151D(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(3)	35		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		cctcactgtcatcatcctcct	0.532																																					p.D151D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T453C	2						.						474.0	283.0	348.0					2																	232326411		2203	4300	6503	232034655	SO:0001819	synonymous_variant	4691	exon3				CCDS33397.1	2q37.1	2013-09-19			ENSG00000115053	ENSG00000115053		"""RNA binding motif (RRM) containing"""	7667	protein-coding gene	gene with protein product		164035				2394707, 3409881	Standard	NM_005381		Approved	C23	uc002vru.3	P19338	OTTHUMG00000153866	ENST00000322723.4:c.453T>C	2.37:g.232326411A>G		Somatic		Capture	Illumina HiSeq	Phase_I	232034655	NM_005381	Q53SK1|Q8NB06|Q9UCF0|Q9UDG1	Silent	SNP	ENST00000322723.4	37	CCDS33397.1																																																																																				NCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332731.1	NM_005381	
ATP2B2	491	broad.mit.edu	37	3	10442664	10442664	+	Missense_Mutation	SNP	C	C	T	rs375973812		TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr3:10442664C>T	ENST00000352432.4	-	4	823	c.754G>A	c.(754-756)Gtg>Atg	p.V252M	ATP2B2_ENST00000397077.1_Missense_Mutation_p.V252M|ATP2B2_ENST00000383800.4_Missense_Mutation_p.V252M|ATP2B2_ENST00000360273.2_Missense_Mutation_p.V252M|ATP2B2_ENST00000343816.4_Missense_Mutation_p.V252M			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	252					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)	p.V252M(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						TCCTTGTCCACGGACTTGCGC	0.587																																					p.V252M	Ovarian(125;1619 1709 15675 19819 38835)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G754A	3						.	C	MET/VAL,MET/VAL	0,4406		0,0,2203	146.0	117.0	127.0		754,754	5.6	1.0	3		127	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ATP2B2	NM_001001331.2,NM_001683.3	21,21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	252/1244,252/1199	10442664	1,13005	2203	4300	6503	10417664	SO:0001583	missense	491	exon5			X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.754G>A	3.37:g.10442664C>T	ENSP00000324172:p.Val252Met	Somatic		Capture	Illumina HiSeq	Phase_I	10417664	NM_001683	O00766|Q12994|Q16818	Missense_Mutation	SNP	ENST00000352432.4	37	CCDS33701.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.729415	0.89390	0.0	1.16E-4	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000452124;ENST00000342354	D;D;D;D;D;D	0.90563	-2.69;-2.69;-2.69;-2.69;-2.69;-2.69	5.61	5.61	0.85477	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.122884	0.53938	D	0.000046	D	0.92315	0.7562	M	0.75615	2.305	0.48185	D	0.999609	P;P;P	0.48230	0.906;0.907;0.616	P;P;B	0.46339	0.511;0.513;0.19	D	0.92413	0.5939	10	0.51188	T	0.08	-25.5035	19.6383	0.95746	0.0:1.0:0.0:0.0	.	252;264;252	Q01814-7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	M	252;252;252;252;252;218;139;252	ENSP00000324172:V252M;ENSP00000373311:V252M;ENSP00000380267:V252M;ENSP00000353414:V252M;ENSP00000344677:V252M;ENSP00000414854:V139M	ENSP00000342954:V252M	V	-	1	0	ATP2B2	10417664	0.789000	0.28775	0.996000	0.52242	0.999000	0.98932	1.646000	0.37249	2.631000	0.89168	0.655000	0.94253	GTG		ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683	
CLSTN2	64084	broad.mit.edu	37	3	140285015	140285015	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr3:140285015G>C	ENST00000458420.3	+	17	2978	c.2788G>C	c.(2788-2790)Ggg>Cgg	p.G930R		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	930					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)	p.G930R(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						GGAGGAGGAAGGGATGGGCAG	0.602										HNSCC(16;0.037)																											p.G930R	GBM(45;858 913 3709 36904 37282)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2788C	3						.						97.0	87.0	91.0					3																	140285015		2203	4300	6503	141767705	SO:0001583	missense	64084	exon17			AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.2788G>C	3.37:g.140285015G>C	ENSP00000402460:p.Gly930Arg	Somatic		Capture	Illumina HiSeq	Phase_I	141767705	NM_022131	B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	ENST00000458420.3	37	CCDS3112.1	.	.	.	.	.	.	.	.	.	.	G	7.575	0.667574	0.14710	.	.	ENSG00000158258	ENST00000458420	T	0.39229	1.09	5.59	3.76	0.43208	.	0.796683	0.10880	N	0.623905	T	0.29524	0.0736	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24048	-1.0171	9	.	.	.	-17.509	7.8831	0.29633	0.0834:0.3095:0.6071:0.0	.	930	Q9H4D0	CSTN2_HUMAN	R	930	ENSP00000402460:G930R	.	G	+	1	0	CLSTN2	141767705	0.999000	0.42202	0.006000	0.13384	0.439000	0.31926	3.492000	0.53259	0.681000	0.31386	0.655000	0.94253	GGG		CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3	NM_022131	
SLITRK3	22865	broad.mit.edu	37	3	164905727	164905727	+	Silent	SNP	C	C	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr3:164905727C>T	ENST00000475390.1	-	2	3335	c.2892G>A	c.(2890-2892)ccG>ccA	p.P964P	SLITRK3_ENST00000241274.3_Silent_p.P964P			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	964					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.P964P(2)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						CGAGGTAATCCGGCTTGGTTT	0.393										HNSCC(40;0.11)																											p.P964P												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.G2892A	3						.						150.0	148.0	149.0					3																	164905727		2203	4300	6503	166388421	SO:0001819	synonymous_variant	22865	exon2			AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.2892G>A	3.37:g.164905727C>T		Somatic		Capture	Illumina HiSeq	Phase_I	166388421	NM_014926	Q1RMY6	Silent	SNP	ENST00000475390.1	37	CCDS3197.1																																																																																				SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926	
ROBO1	6091	broad.mit.edu	37	3	78666887	78666887	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr3:78666887C>G	ENST00000464233.1	-	27	4293	c.4180G>C	c.(4180-4182)Gac>Cac	p.D1394H	ROBO1_ENST00000436010.2_Missense_Mutation_p.D1355H|ROBO1_ENST00000495273.1_Missense_Mutation_p.D1349H|ROBO1_ENST00000467549.1_Missense_Mutation_p.D1294H	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1394					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)	p.D1394H(1)|p.D1349H(1)|p.D1371H(1)		breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		AAGGAGCCGTCCGAAGAACTA	0.577																																					p.D1394H												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.G4180C	3						.						56.0	61.0	59.0					3																	78666887		1971	4137	6108	78749577	SO:0001583	missense	6091	exon27			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.4180G>C	3.37:g.78666887C>G	ENSP00000420321:p.Asp1394His	Somatic		Capture	Illumina HiSeq	Phase_I	78749577	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	37	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	C	16.45	3.126909	0.56721	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.79653	-1.24;-1.29;-1.12;-1.23	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	D	0.86377	0.5918	L	0.39245	1.2	0.80722	D	1	D;D;D;D;B	0.89917	1.0;0.981;1.0;0.982;0.052	D;P;D;P;B	0.87578	0.998;0.662;0.956;0.856;0.014	D	0.83779	0.0224	9	.	.	.	.	20.1554	0.98111	0.0:1.0:0.0:0.0	.	1358;1394;1349;1294;1355	Q9Y6N7-3;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;ROBO1_HUMAN;.;.;.	H	1355;1349;1394;1349;1294;1398	ENSP00000406043:D1355H;ENSP00000420321:D1394H;ENSP00000420637:D1349H;ENSP00000417992:D1294H	.	D	-	1	0	ROBO1	78749577	1.000000	0.71417	0.123000	0.21794	0.048000	0.14542	7.445000	0.80570	2.838000	0.97847	0.591000	0.81541	GAC		ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
GNB4	59345	broad.mit.edu	37	3	179134313	179134313	+	Silent	SNP	A	A	G			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr3:179134313A>G	ENST00000232564.3	-	5	521	c.235T>C	c.(235-237)Tta>Cta	p.L79L	GNB4_ENST00000465153.1_5'Flank|GNB4_ENST00000468623.1_Silent_p.L79L	NM_021629.3	NP_067642.1	Q9HAV0	GBB4_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 4	79					cell death (GO:0008219)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	protein complex binding (GO:0032403)|signal transducer activity (GO:0004871)	p.L79L(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	16	all_cancers(143;2.01e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.237)			CAAATAATTAATTTTCCATCT	0.308																																					p.L79L	Melanoma(105;1405 1491 7265 20440 33721)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T235C	3						.						47.0	51.0	50.0					3																	179134313		2202	4282	6484	180617007	SO:0001819	synonymous_variant	59345	exon5			AF300648	CCDS3230.1	3q27.1	2013-01-10			ENSG00000114450	ENSG00000114450		"""WD repeat domain containing"""	20731	protein-coding gene	gene with protein product		610863				10644457, 11842130	Standard	NM_021629		Approved		uc003fjv.4	Q9HAV0	OTTHUMG00000157440	ENST00000232564.3:c.235T>C	3.37:g.179134313A>G		Somatic		Capture	Illumina HiSeq	Phase_I	180617007	NM_021629	B3KMH5|D3DNR8	Silent	SNP	ENST00000232564.3	37	CCDS3230.1	.	.	.	.	.	.	.	.	.	.	A	10.20	1.285442	0.23478	.	.	ENSG00000114450	ENST00000466899	.	.	.	5.45	4.32	0.51571	.	.	.	.	.	T	0.60418	0.2267	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58713	-0.7588	4	.	.	.	-45.0162	9.9401	0.41576	0.8895:0.0:0.1105:0.0	.	.	.	.	T	1	.	.	I	-	2	0	GNB4	180617007	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.215000	0.32431	2.061000	0.61500	0.533000	0.62120	ATT		GNB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258218.1	NM_021629	
SLC25A31	83447	broad.mit.edu	37	4	128651781	128651781	+	Silent	SNP	C	C	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr4:128651781C>T	ENST00000281154.4	+	1	249	c.81C>T	c.(79-81)ggC>ggT	p.G27G		NM_031291.2	NP_112581.1	Q9H0C2	ADT4_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31	27					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|motile cilium (GO:0031514)|nucleus (GO:0005634)	transporter activity (GO:0005215)	p.G27G(1)		NS(1)|breast(1)|large_intestine(10)|lung(8)|skin(2)	22						TTCTGGCCGGCGGAGTCGCGG	0.597																																					p.G27G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C81T	4						.						53.0	50.0	51.0					4																	128651781		2203	4300	6503	128871231	SO:0001819	synonymous_variant	83447	exon1			AL136857	CCDS3733.1	4q28	2013-05-22			ENSG00000151475	ENSG00000151475		"""Solute carriers"""	25319	protein-coding gene	gene with protein product		610796				15670820	Standard	NM_031291		Approved	DKFZP434N1235, ANT4	uc003ifl.3	Q9H0C2	OTTHUMG00000133300	ENST00000281154.4:c.81C>T	4.37:g.128651781C>T		Somatic		Capture	Illumina HiSeq	Phase_I	128871231	NM_031291		Silent	SNP	ENST00000281154.4	37	CCDS3733.1																																																																																				SLC25A31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257094.2	NM_031291	
TTC29	83894	broad.mit.edu	37	4	147724726	147724726	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr4:147724726C>G	ENST00000325106.4	-	11	1439	c.1213G>C	c.(1213-1215)Gct>Cct	p.A405P	TTC29_ENST00000513335.1_Missense_Mutation_p.A431P|TTC29_ENST00000506019.1_5'UTR|TTC29_ENST00000398886.4_Missense_Mutation_p.A431P	NM_031956.2	NP_114162.2	Q8NA56	TTC29_HUMAN	tetratricopeptide repeat domain 29	405								p.A405P(1)		breast(2)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					ATCTGATGAGCTTTTGCTATT	0.428																																					p.A405P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1213C	4						.						98.0	97.0	97.0					4																	147724726		1920	4148	6068	147944176	SO:0001583	missense	83894	exon11			AF345910	CCDS47141.1, CCDS75200.1	4q31.23	2013-01-11				ENSG00000137473		"""Tetratricopeptide (TTC) repeat domain containing"""	29936	protein-coding gene	gene with protein product						12477932	Standard	NM_031956		Approved	NYD-SP14	uc003ikw.4	Q8NA56		ENST00000325106.4:c.1213G>C	4.37:g.147724726C>G	ENSP00000316740:p.Ala405Pro	Somatic		Capture	Illumina HiSeq	Phase_I	147944176	NM_031956	A4GU95|Q9BXB6	Missense_Mutation	SNP	ENST00000325106.4	37	CCDS47141.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.602002	0.87055	.	.	ENSG00000137473	ENST00000513335;ENST00000398886;ENST00000325106;ENST00000504425	T;T;T;T	0.30448	1.53;1.53;1.56;1.55	5.84	5.84	0.93424	.	0.118165	0.56097	D	0.000031	T	0.56455	0.1986	M	0.65498	2.005	0.47778	D	0.999512	D;D;D	0.76494	0.998;0.999;0.998	D;D;D	0.69142	0.924;0.962;0.924	T	0.55792	-0.8085	10	0.72032	D	0.01	-5.9448	20.1551	0.98106	0.0:1.0:0.0:0.0	.	405;431;405	E7EQ14;G5E9Z5;Q8NA56	.;.;TTC29_HUMAN	P	431;431;405;405	ENSP00000423505:A431P;ENSP00000381861:A431P;ENSP00000316740:A405P;ENSP00000425778:A405P	ENSP00000316740:A405P	A	-	1	0	TTC29	147944176	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	3.070000	0.50033	2.760000	0.94817	0.655000	0.94253	GCT		TTC29-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_031956	
AASDH	132949	broad.mit.edu	37	4	57244559	57244559	+	Silent	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr4:57244559G>A	ENST00000205214.6	-	4	603	c.423C>T	c.(421-423)ctC>ctT	p.L141L	AASDH_ENST00000513376.1_Silent_p.L41L|AASDH_ENST00000434343.2_Intron|AASDH_ENST00000602986.1_5'UTR|AASDH_ENST00000451613.1_Silent_p.L141L|AASDH_ENST00000502617.1_Silent_p.L141L|AASDH_ENST00000510762.1_5'UTR	NM_181806.2	NP_861522.2	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	141					fatty acid metabolic process (GO:0006631)		acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)	p.L141L(1)		endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	40	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				GAAGTCTGAAGAGCACTAGGT	0.318																																					p.L141L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C423T	4						.						80.0	79.0	79.0					4																	57244559		2203	4299	6502	56939316	SO:0001819	synonymous_variant	132949	exon4			AF516672	CCDS3504.1, CCDS68705.1, CCDS68706.1, CCDS75126.1, CCDS75127.1	4q12	2010-12-14			ENSG00000157426	ENSG00000157426	1.2.1.31	"""Acyl-CoA synthetase family"""	23993	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 4"""	614365				15865210, 12712191, 17762044	Standard	XM_005265721		Approved	NRPS998, LYS2, ACSF4	uc003hbn.3	Q4L235	OTTHUMG00000128841	ENST00000205214.6:c.423C>T	4.37:g.57244559G>A		Somatic		Capture	Illumina HiSeq	Phase_I	56939316	NM_181806	A5D8V3|A5PL22|Q63HK2|Q63HR7|Q6IPP8|Q6TFZ6|Q7Z5Y3|Q96BW4|Q9P064	Silent	SNP	ENST00000205214.6	37	CCDS3504.1																																																																																				AASDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250780.1	NM_181806	
UGT2B4	7363	broad.mit.edu	37	4	70361243	70361243	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr4:70361243G>A	ENST00000305107.6	-	1	383	c.337C>T	c.(337-339)Caa>Taa	p.Q113*	UGT2B4_ENST00000512583.1_Nonsense_Mutation_p.Q113*|UGT2B4_ENST00000381096.3_Intron|UGT2B4_ENST00000506580.1_5'UTR	NM_021139.2	NP_066962.2	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B4	113					cellular glucuronidation (GO:0052695)|estrogen catabolic process (GO:0006711)|metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.Q113*(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(29)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	47					Canagliflozin(DB08907)|Codeine(DB00318)|Dapagliflozin(DB06292)|Flurbiprofen(DB00712)|Ibuprofen(DB01050)|Morphine(DB00295)	ATGATTTCTTGTACTTGTGAA	0.318																																					p.Q113X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C337T	4						.						48.0	44.0	45.0					4																	70361243		1964	4209	6173	70395832	SO:0001587	stop_gained	7363	exon1			BC026264	CCDS43234.1, CCDS75137.1	4q13	2008-02-05	2005-07-20			ENSG00000156096		"""UDP glucuronosyltransferases"""	12553	protein-coding gene	gene with protein product		600067	"""UDP glycosyltransferase 2 family, polypeptide B4"""			3109396, 7835904	Standard	NM_021139		Approved	UGT2B11	uc003hek.4	P06133		ENST00000305107.6:c.337C>T	4.37:g.70361243G>A	ENSP00000305221:p.Gln113*	Somatic		Capture	Illumina HiSeq	Phase_I	70395832	NM_021139	A6NCP7|B4DT75|G5E9X8|O60731|O60867|O75614|P36538|Q1HBF9|Q6QQX7	Nonsense_Mutation	SNP	ENST00000305107.6	37	CCDS43234.1	.	.	.	.	.	.	.	.	.	.	G	10.94	1.491596	0.26774	.	.	ENSG00000156096	ENST00000512583;ENST00000305107	.	.	.	2.41	-3.99	0.04069	.	0.285346	0.26428	U	0.024426	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	5.5245	0.16951	0.0:0.312:0.2196:0.4684	.	.	.	.	X	113	.	ENSP00000305221:Q113X	Q	-	1	0	UGT2B4	70395832	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-1.415000	0.02469	-0.580000	0.05944	0.306000	0.20318	CAA		UGT2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365526.1	NM_021139	
TENM3	55714	broad.mit.edu	37	4	183713656	183713656	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr4:183713656G>A	ENST00000511685.1	+	26	5954	c.5831G>A	c.(5830-5832)cGg>cAg	p.R1944Q	TENM3_ENST00000406950.2_Missense_Mutation_p.R1944Q			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	1944					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.R1944Q(1)									GGTACAAGTCGGAGGGTCTTA	0.453																																					p.R1944Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5831A	4						.						60.0	60.0	60.0					4																	183713656		1882	4101	5983	183950650	SO:0001583	missense	55714	exon25			AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.5831G>A	4.37:g.183713656G>A	ENSP00000424226:p.Arg1944Gln	Somatic		Capture	Illumina HiSeq	Phase_I	183950650	NM_001080477	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	ENST00000511685.1	37	CCDS47165.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.358002	0.82243	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	D;D	0.87179	-2.22;-2.22	4.74	4.74	0.60224	.	.	.	.	.	D	0.91405	0.7288	L	0.58428	1.81	0.80722	D	1	D	0.69078	0.997	D	0.67725	0.953	D	0.89411	0.3703	9	0.29301	T	0.29	.	18.268	0.90057	0.0:0.0:1.0:0.0	.	1944	Q9P273	TEN3_HUMAN	Q	1944	ENSP00000424226:R1944Q;ENSP00000385276:R1944Q	ENSP00000385276:R1944Q	R	+	2	0	ODZ3	183950650	1.000000	0.71417	0.992000	0.48379	0.917000	0.54804	9.321000	0.96353	2.608000	0.88229	0.591000	0.81541	CGG		TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
APC	324	broad.mit.edu	37	5	112175153	112175153	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr5:112175153G>T	ENST00000457016.1	+	16	4242	c.3862G>T	c.(3862-3864)Gga>Tga	p.G1288*	APC_ENST00000508376.2_Nonsense_Mutation_p.G1288*|APC_ENST00000257430.4_Nonsense_Mutation_p.G1288*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1288	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.G1288*(2)|p.K1192fs*3(1)|p.?(1)|p.I1287fs*3(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AGATGAAATAGGATGTAATCA	0.358		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.G1270X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Nonsense,0 	.	5	Substitution - Nonsense(2)|Deletion - Frameshift(2)|Unknown(1)	large_intestine(3)|soft_tissue(1)|skin(1)	c.G3808T	5						.						56.0	58.0	57.0					5																	112175153		2202	4300	6502	112203052	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3862G>T	5.37:g.112175153G>T	ENSP00000413133:p.Gly1288*	Somatic		Capture	Illumina HiSeq	Phase_I	112203052	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	G	39	7.661470	0.98419	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.73	5.73	0.89815	.	0.058979	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-20.3238	19.8705	0.96849	0.0:0.0:1.0:0.0	.	.	.	.	X	1288	.	.	G	+	1	0	APC	112203052	1.000000	0.71417	0.999000	0.59377	0.902000	0.53008	5.057000	0.64294	2.861000	0.98227	0.655000	0.94253	GGA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
SLC27A6	28965	broad.mit.edu	37	5	128302276	128302276	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr5:128302276G>A	ENST00000262462.4	+	1	1456	c.446G>A	c.(445-447)cGc>cAc	p.R149H	SLC27A6_ENST00000506176.1_Missense_Mutation_p.R149H|SLC27A6_ENST00000395266.1_Missense_Mutation_p.R149H			Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid transporter), member 6	149					long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty acid transport (GO:0015909)|transmembrane transport (GO:0055085)|very long-chain fatty acid metabolic process (GO:0000038)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	long-chain fatty acid-CoA ligase activity (GO:0004467)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)	p.R149H(1)		NS(2)|endometrium(1)|kidney(3)|large_intestine(11)|liver(1)|lung(20)|prostate(1)|skin(4)|stomach(1)	44		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)		AATTGCATCCGCGCCTGTGGG	0.582																																					p.R149H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G446A	5						.						41.0	30.0	34.0					5																	128302276		2203	4300	6503	128330175	SO:0001583	missense	28965	exon1			AF064254	CCDS4145.1	5q23.3	2013-05-22			ENSG00000113396	ENSG00000113396		"""Acyl-CoA synthetase family"", ""Solute carriers"""	11000	protein-coding gene	gene with protein product	"""fatty-acid-Coenzyme A ligase, very long-chain 2"""	604196				12556534, 10479480	Standard	XM_005271967		Approved	FATP6, VLCS-H1, FACVL2, ACSVL2	uc003kuy.3	Q9Y2P4	OTTHUMG00000128991	ENST00000262462.4:c.446G>A	5.37:g.128302276G>A	ENSP00000262462:p.Arg149His	Somatic		Capture	Illumina HiSeq	Phase_I	128330175	NM_001017372	Q6IAM5|Q7Z6E6|Q86YF6	Missense_Mutation	SNP	ENST00000262462.4	37	CCDS4145.1	.	.	.	.	.	.	.	.	.	.	G	7.373	0.627191	0.14257	.	.	ENSG00000113396	ENST00000262462;ENST00000395266;ENST00000506176	T;T;T	0.42900	0.96;0.96;0.96	4.18	-0.984	0.10259	AMP-dependent synthetase/ligase (1);	0.969547	0.08601	N	0.921544	T	0.28400	0.0702	L	0.42245	1.32	0.09310	N	1	B	0.16396	0.017	B	0.18561	0.022	T	0.29882	-0.9997	10	0.34782	T	0.22	-4.4793	0.9223	0.01318	0.3473:0.1122:0.3121:0.2284	.	149	Q9Y2P4	S27A6_HUMAN	H	149	ENSP00000262462:R149H;ENSP00000378684:R149H;ENSP00000421024:R149H	ENSP00000262462:R149H	R	+	2	0	SLC27A6	128330175	0.000000	0.05858	0.477000	0.27303	0.557000	0.35523	0.285000	0.18883	-0.202000	0.10268	0.561000	0.74099	CGC		SLC27A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250980.1	NM_014031	
RAPGEF6	51735	broad.mit.edu	37	5	130928157	130928157	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr5:130928157G>C	ENST00000509018.1	-	4	405	c.200C>G	c.(199-201)tCa>tGa	p.S67*	RAPGEF6_ENST00000510071.1_Nonsense_Mutation_p.S67*|CTC-432M15.3_ENST00000514667.1_Nonsense_Mutation_p.S117*|RAPGEF6_ENST00000296859.6_Nonsense_Mutation_p.S67*|RAPGEF6_ENST00000503398.2_5'Flank|RAPGEF6_ENST00000307984.5_Nonsense_Mutation_p.S67*|RAPGEF6_ENST00000308008.6_Nonsense_Mutation_p.S67*|RAPGEF6_ENST00000507093.1_Nonsense_Mutation_p.S67*	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6	67					positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)	p.S67*(2)|p.S117*(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		AATCGTTTCTGAACTGTTTAA	0.323																																					p.S67X	Melanoma(168;435 1955 13113 13877 23213)											.	.	3	Substitution - Nonsense(3)	large_intestine(3)	c.C200G	5						.						67.0	56.0	60.0					5																	130928157		2203	4300	6503	130956056	SO:0001587	stop_gained	51735	exon4			AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.200C>G	5.37:g.130928157G>C	ENSP00000421684:p.Ser67*	Somatic		Capture	Illumina HiSeq	Phase_I	130956056	NM_001164387	A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Nonsense_Mutation	SNP	ENST00000509018.1	37	CCDS34225.1	.	.	.	.	.	.	.	.	.	.	G	38	7.052717	0.98029	.	.	ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000217128	ENST00000509018;ENST00000307984;ENST00000507093;ENST00000296859;ENST00000358714;ENST00000308008;ENST00000510071;ENST00000514667	.	.	.	4.73	4.73	0.59995	.	0.232089	0.28671	N	0.014523	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	16.8241	0.85926	0.0:0.0:1.0:0.0	.	.	.	.	X	67;67;67;67;67;67;67;117	.	ENSP00000426948:S117X	S	-	2	0	RAPGEF6;FNIP1	130956056	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	5.920000	0.70017	2.317000	0.78254	0.563000	0.77884	TCA		RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370059.1	NM_016340	
C5orf15	56951	broad.mit.edu	37	5	133292560	133292560	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr5:133292560T>A	ENST00000231512.3	-	3	990	c.788A>T	c.(787-789)tAt>tTt	p.Y263F	C5orf15_ENST00000507191.1_5'Flank	NM_020199.2	NP_064584.1	Q8NC54	KCT2_HUMAN	chromosome 5 open reading frame 15	263						integral component of membrane (GO:0016021)		p.Y263F(1)		endometrium(2)|large_intestine(1)|lung(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00806)|Kidney(363;0.02)			TTAAAAAATATAATCATTGGT	0.338																																					p.Y263F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A788T	5						.						67.0	66.0	66.0					5																	133292560		2203	4300	6503	133320459	SO:0001583	missense	56951	exon3			AF226055	CCDS4167.1	5q31.1	2012-02-22			ENSG00000113583	ENSG00000113583			20656	protein-coding gene	gene with protein product	"""keratinocytes associated transmembrane protein 2"""						Standard	NM_020199		Approved	KCT2, HTGN29	uc003kyo.3	Q8NC54	OTTHUMG00000129125	ENST00000231512.3:c.788A>T	5.37:g.133292560T>A	ENSP00000231512:p.Tyr263Phe	Somatic		Capture	Illumina HiSeq	Phase_I	133320459	NM_020199	B2RD10|D3DQ92|Q9NRG2	Missense_Mutation	SNP	ENST00000231512.3	37	CCDS4167.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.474523	0.84640	.	.	ENSG00000113583	ENST00000231512;ENST00000451255	.	.	.	5.8	5.8	0.92144	.	0.000000	0.64402	D	0.000010	T	0.77725	0.4173	M	0.66939	2.045	0.53688	D	0.999971	D	0.89917	1.0	D	0.85130	0.997	T	0.79869	-0.1621	9	0.72032	D	0.01	-17.0445	15.327	0.74172	0.0:0.0:0.0:1.0	.	263	Q8NC54	KCT2_HUMAN	F	263;163	.	ENSP00000231512:Y263F	Y	-	2	0	C5orf15	133320459	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.476000	0.81055	2.221000	0.72209	0.528000	0.53228	TAT		C5orf15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251175.1	NM_020199	
PCDHA9	9752	broad.mit.edu	37	5	140228226	140228226	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr5:140228226C>T	ENST00000532602.1	+	1	1179	c.146C>T	c.(145-147)gCg>gTg	p.A49V	PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA9_ENST00000378122.3_Missense_Mutation_p.A49V|PCDHA8_ENST00000531613.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	49	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A49V(2)		breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCCGCATCGCGCAGGACCTG	0.652																																					p.A49V	Melanoma(55;1800 1972 14909)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C146T	5						.						51.0	57.0	55.0					5																	140228226		2196	4266	6462	140208410	SO:0001583	missense	9752	exon1			AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.146C>T	5.37:g.140228226C>T	ENSP00000436042:p.Ala49Val	Somatic		Capture	Illumina HiSeq	Phase_I	140208410	NM_014005	O15053|Q2M3S5	Missense_Mutation	SNP	ENST00000532602.1	37	CCDS54920.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.744705	0.89663	.	.	ENSG00000204961	ENST00000532602;ENST00000378122	T;T	0.53423	0.62;0.62	3.69	3.69	0.42338	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.72455	0.3462	M	0.86805	2.84	0.34935	D	0.749779	D;D	0.89917	1.0;1.0	D;D	0.87578	0.932;0.998	D	0.84215	0.0458	9	0.87932	D	0	.	16.0581	0.80820	0.0:1.0:0.0:0.0	.	49;49	Q9Y5H5;Q9Y5H5-2	PCDA9_HUMAN;.	V	49	ENSP00000436042:A49V;ENSP00000367362:A49V	ENSP00000367362:A49V	A	+	2	0	PCDHA9	140208410	0.711000	0.27906	1.000000	0.80357	0.918000	0.54935	1.450000	0.35134	2.047000	0.60756	0.586000	0.80456	GCG		PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	NM_031857	
PCDHA13	56136	broad.mit.edu	37	5	140263460	140263460	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr5:140263460G>A	ENST00000289272.2	+	1	1607	c.1607G>A	c.(1606-1608)aGc>aAc	p.S536N	PCDHA6_ENST00000529310.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA13_ENST00000409494.1_Missense_Mutation_p.S536N|PCDHA11_ENST00000398640.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA8_ENST00000531613.1_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	536	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S536N(1)		NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCCAGGTGAGCGCGCGCGAC	0.682																																					p.S536N	Melanoma(147;1739 1852 5500 27947 37288)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1607A	5						.						73.0	79.0	77.0					5																	140263460		2203	4299	6502	140243644	SO:0001583	missense	56136	exon1			AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.1607G>A	5.37:g.140263460G>A	ENSP00000289272:p.Ser536Asn	Somatic		Capture	Illumina HiSeq	Phase_I	140243644	NM_031865	O75277	Missense_Mutation	SNP	ENST00000289272.2	37	CCDS4240.1	.	.	.	.	.	.	.	.	.	.	G	10.85	1.466932	0.26335	.	.	ENSG00000239389	ENST00000409494;ENST00000289272	T;T	0.61510	0.1;0.1	4.54	1.58	0.23477	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.36166	0.0957	N	0.11756	0.17	0.19775	N	0.999956	B;B;B	0.20261	0.013;0.03;0.043	B;B;B	0.24848	0.033;0.044;0.056	T	0.27434	-1.0074	9	0.49607	T	0.09	.	5.3606	0.16085	0.1989:0.3303:0.4708:0.0	.	536;536;536	Q9Y5I0;C9JA99;Q9Y5I0-2	PCDAD_HUMAN;.;.	N	536	ENSP00000386821:S536N;ENSP00000289272:S536N	ENSP00000289272:S536N	S	+	2	0	PCDHA13	140243644	0.000000	0.05858	1.000000	0.80357	0.912000	0.54170	-1.319000	0.02702	1.079000	0.41038	0.561000	0.74099	AGC		PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335000.1	NM_018904	
PCDHB15	56121	broad.mit.edu	37	5	140626409	140626409	+	Silent	SNP	C	C	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr5:140626409C>A	ENST00000231173.3	+	1	1263	c.1263C>A	c.(1261-1263)atC>atA	p.I421I		NM_018935.2	NP_061758.1	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15	421	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.I421I(1)		NS(1)|breast(3)|endometrium(8)|kidney(3)|large_intestine(14)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	61			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACATCACCATCACCATCACAG	0.517																																					p.I421I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1263A	5						.						103.0	95.0	98.0					5																	140626409		2203	4300	6503	140606593	SO:0001819	synonymous_variant	56121	exon1			AF152494	CCDS4257.1	5q31	2011-06-07			ENSG00000113248	ENSG00000113248		"""Cadherins / Protocadherins : Clustered"""	8686	other	protocadherin		606341				10380929	Standard	NM_018935		Approved	PCDH-BETA15	uc003lje.3	Q9Y5E8	OTTHUMG00000129609	ENST00000231173.3:c.1263C>A	5.37:g.140626409C>A		Somatic		Capture	Illumina HiSeq	Phase_I	140606593	NM_018935	Q8IUX5	Silent	SNP	ENST00000231173.3	37	CCDS4257.1																																																																																				PCDHB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251804.2	NM_018935	
PRLR	5618	broad.mit.edu	37	5	35068332	35068332	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr5:35068332C>G	ENST00000382002.5	-	9	1267	c.841G>C	c.(841-843)Gct>Cct	p.A281P	PRLR_ENST00000342362.5_Missense_Mutation_p.A180P|PRLR_ENST00000542609.1_Missense_Mutation_p.A281P|PRLR_ENST00000397391.3_Intron|PRLR_ENST00000513753.1_Missense_Mutation_p.A281P|PRLR_ENST00000511486.1_Missense_Mutation_p.A180P|PRLR_ENST00000231423.3_Missense_Mutation_p.A281P|PRLR_ENST00000310101.5_Missense_Mutation_p.A281P|PRLR_ENST00000348262.3_Intron|PRLR_ENST00000509934.1_5'UTR	NM_000949.5	NP_000940.1	P16471	PRLR_HUMAN	prolactin receptor	281					activation of JAK2 kinase activity (GO:0042977)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cell surface receptor signaling pathway (GO:0007166)|embryo implantation (GO:0007566)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|prolactin signaling pathway (GO:0038161)|steroid biosynthetic process (GO:0006694)|T cell activation (GO:0042110)	cell surface (GO:0009986)|endosome lumen (GO:0031904)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|ornithine decarboxylase activator activity (GO:0042978)|peptide hormone binding (GO:0017046)|prolactin receptor activity (GO:0004925)|protein homodimerization activity (GO:0042803)	p.A281P(1)		central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Fluoxymesterone(DB01185)|Somatropin recombinant(DB00052)	AACAGATGAGCATCAAATCCT	0.418																																					p.A281P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G841C	5						.						173.0	156.0	161.0					5																	35068332		2203	4300	6503	35104089	SO:0001583	missense	5618	exon9				CCDS3909.1, CCDS56358.1, CCDS56359.1, CCDS56360.1, CCDS56361.1, CCDS56362.1	5p14-p13	2013-02-27			ENSG00000113494	ENSG00000113494			9446	protein-coding gene	gene with protein product		176761					Standard	NM_001204315		Approved		uc003jjm.3	P16471	OTTHUMG00000090789	ENST00000382002.5:c.841G>C	5.37:g.35068332C>G	ENSP00000371432:p.Ala281Pro	Somatic		Capture	Illumina HiSeq	Phase_I	35104089	NM_000949	B2R882|D1MDP1|Q16354|Q8TD75|Q8TD78|Q96P35|Q96P36|Q9BX87|Q9UHJ5	Missense_Mutation	SNP	ENST00000382002.5	37	CCDS3909.1	.	.	.	.	.	.	.	.	.	.	C	15.21	2.764450	0.49574	.	.	ENSG00000113494	ENST00000231423;ENST00000513753;ENST00000542609;ENST00000342362;ENST00000382002;ENST00000511486;ENST00000310101	T;T;T;D;T;D;T	0.86497	-0.85;-0.83;-0.83;-2.13;-1.22;-2.13;-0.82	5.54	1.77	0.24775	.	0.416111	0.29908	N	0.010900	T	0.64983	0.2648	N	0.01631	-0.79	0.21802	N	0.999533	P;P;P;P	0.43885	0.725;0.82;0.731;0.731	B;B;B;B	0.42692	0.177;0.331;0.306;0.395	T	0.62310	-0.6881	10	0.24483	T	0.36	-3.4131	4.9522	0.14021	0.1256:0.2144:0.0:0.6599	.	281;180;281;281	P16471;P16471-2;P16471-6;P16471-4	PRLR_HUMAN;.;.;.	P	281;281;281;180;281;180;281	ENSP00000231423:A281P;ENSP00000424841:A281P;ENSP00000441813:A281P;ENSP00000339213:A180P;ENSP00000371432:A281P;ENSP00000422556:A180P;ENSP00000309008:A281P	ENSP00000231423:A281P	A	-	1	0	PRLR	35104089	0.995000	0.38212	0.999000	0.59377	0.922000	0.55478	0.310000	0.19356	0.120000	0.18254	-0.302000	0.09304	GCT		PRLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207575.2		
ARHGEF28	64283	broad.mit.edu	37	5	73166009	73166009	+	Silent	SNP	C	C	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr5:73166009C>T	ENST00000426542.2	+	20	2561	c.2541C>T	c.(2539-2541)gtC>gtT	p.V847V	ARHGEF28_ENST00000296799.4_Silent_p.V534V|ARHGEF28_ENST00000513042.2_Silent_p.V847V|ARHGEF28_ENST00000545377.1_Silent_p.V847V|ARHGEF28_ENST00000296794.6_Silent_p.V847V|ARHGEF28_ENST00000287898.5_Silent_p.V847V|ARHGEF28_ENST00000437974.1_Silent_p.V847V			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	847					central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)	p.V847V(2)									AGAAGGATGTCATCAAAAGAC	0.448																																					p.V847V												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C2541T	5						.						129.0	119.0	122.0					5																	73166009		1899	4126	6025	73201765	SO:0001819	synonymous_variant	64283	exon21				CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.2541C>T	5.37:g.73166009C>T		Somatic		Capture	Illumina HiSeq	Phase_I	73201765	NM_001177693	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Silent	SNP	ENST00000426542.2	37	CCDS54870.1																																																																																				ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368975.1		
POU5F2	134187	broad.mit.edu	37	5	93076993	93076993	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr5:93076993G>A	ENST00000510627.4	-	1	350	c.277C>T	c.(277-279)Cga>Tga	p.R93*	RP11-185E12.2_ENST00000606528.1_RNA|FAM172A_ENST00000395965.3_Intron|FAM172A_ENST00000509163.1_Intron|FAM172A_ENST00000509739.1_Intron|FAM172A_ENST00000505869.1_Intron|POU5F2_ENST00000606183.1_5'Flank	NM_153216.1	NP_694948.1	Q8N7G0	PO5F2_HUMAN	POU domain class 5, transcription factor 2	93					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)						all_cancers(142;3.87e-05)|all_epithelial(76;4.59e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0415)|all cancers(79;2.03e-19)		GAGGGGCGTCGCAACCAGTCC	0.652																																					p.R93X												.	.	0			c.C277T	5						.						22.0	24.0	24.0					5																	93076993		1882	4108	5990	93102749	SO:0001587	stop_gained	134187	exon1				CCDS59489.1	5q15	2011-06-20				ENSG00000248483		"""Homeoboxes / POU class"""	26367	protein-coding gene	gene with protein product						7908264	Standard	NM_153216		Approved	SPRM-1, FLJ25680	uc003kkl.1	Q8N7G0		ENST00000510627.4:c.277C>T	5.37:g.93076993G>A	ENSP00000464890:p.Arg93*	Somatic		Capture	Illumina HiSeq	Phase_I	93102749	NM_153216	Q15169|Q6MZL7|Q8N748	Nonsense_Mutation	SNP	ENST00000510627.4	37	CCDS59489.1																																																																																				POU5F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369873.5	NM_153216	
GABRB2	2561	broad.mit.edu	37	5	160757952	160757952	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr5:160757952T>A	ENST00000393959.1	-	8	1014	c.1015A>T	c.(1015-1017)Aag>Tag	p.K339*	GABRB2_ENST00000517901.1_Nonsense_Mutation_p.K276*|GABRB2_ENST00000517547.1_Nonsense_Mutation_p.K179*|GABRB2_ENST00000520240.1_Nonsense_Mutation_p.K339*|GABRB2_ENST00000274547.2_Nonsense_Mutation_p.K339*|GABRB2_ENST00000353437.6_Nonsense_Mutation_p.K339*			P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 2	339					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|GABA-A receptor activity (GO:0004890)|inhibitory extracellular ligand-gated ion channel activity (GO:0005237)	p.K339*(2)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(9)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	26	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GCTGCTTTCTTTTGGCGTTGG	0.498																																					p.K339X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.A1015T	5						.						97.0	101.0	100.0					5																	160757952		2203	4300	6503	160690530	SO:0001587	stop_gained	2561	exon9				CCDS4354.1, CCDS4355.1	5q34	2012-06-22			ENSG00000145864	ENSG00000145864		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4082	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 2"""	600232				7851879	Standard	NM_000813		Approved		uc003lys.1	P47870	OTTHUMG00000130349	ENST00000393959.1:c.1015A>T	5.37:g.160757952T>A	ENSP00000377531:p.Lys339*	Somatic		Capture	Illumina HiSeq	Phase_I	160690530	NM_000813	A8K115|A8K1A0|D1LYT0|D1LYT1|Q16323|Q4FZB2	Nonsense_Mutation	SNP	ENST00000393959.1	37	CCDS4355.1	.	.	.	.	.	.	.	.	.	.	T	39	7.872728	0.98537	.	.	ENSG00000145864	ENST00000393959;ENST00000274547;ENST00000353437;ENST00000520240;ENST00000517901;ENST00000517547	.	.	.	5.26	5.26	0.73747	.	0.556823	0.19671	N	0.108749	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.1774	0.72924	0.0:0.0:0.0:1.0	.	.	.	.	X	339;339;339;339;276;179	.	ENSP00000274547:K339X	K	-	1	0	GABRB2	160690530	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.946000	0.87746	1.984000	0.57885	0.460000	0.39030	AAG		GABRB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252704.1		
HIVEP1	3096	broad.mit.edu	37	6	12089420	12089420	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr6:12089420A>G	ENST00000379388.2	+	3	376	c.44A>G	c.(43-45)aAa>aGa	p.K15R		NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	15					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K15R(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				TTCTTAGACAAAATTGAAGAA	0.274																																					p.K15R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A44G	6						.						46.0	42.0	43.0					6																	12089420		1780	4037	5817	12197406	SO:0001583	missense	3096	exon3			J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.44A>G	6.37:g.12089420A>G	ENSP00000368698:p.Lys15Arg	Somatic		Capture	Illumina HiSeq	Phase_I	12197406	NM_002114	B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	ENST00000379388.2	37	CCDS43426.1	.	.	.	.	.	.	.	.	.	.	A	15.95	2.984154	0.53827	.	.	ENSG00000095951	ENST00000491710;ENST00000487103;ENST00000379388;ENST00000442081;ENST00000478545	T	0.16073	2.37	5.95	5.95	0.96441	.	0.000000	0.34268	U	0.004105	T	0.25005	0.0607	L	0.46157	1.445	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.01863	-1.1258	10	0.87932	D	0	-21.038	12.8206	0.57690	1.0:0.0:0.0:0.0	.	15	P15822	ZEP1_HUMAN	R	15;15;15;24;15	ENSP00000368698:K15R	ENSP00000368698:K15R	K	+	2	0	HIVEP1	12197406	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.836000	0.62789	2.282000	0.76494	0.533000	0.62120	AAA		HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039870.2	NM_002114	
RANBP9	10048	broad.mit.edu	37	6	13697041	13697041	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr6:13697041T>G	ENST00000011619.3	-	2	717	c.659A>C	c.(658-660)aAa>aCa	p.K220T		NM_005493.2	NP_005484.2	Q96S59	RANB9_HUMAN	RAN binding protein 9	220	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				axon guidance (GO:0007411)|microtubule nucleation (GO:0007020)|protein complex assembly (GO:0006461)	cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|Ran GTPase binding (GO:0008536)	p.K220T(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|skin(1)	16	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.117)	Epithelial(50;0.223)			ACTGACAATTTTTACTTCAAA	0.378																																					p.K220T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A659C	6						.						91.0	96.0	94.0					6																	13697041		2203	4300	6503	13805020	SO:0001583	missense	10048	exon2			AB008515	CCDS4529.1	6p23	2010-05-25			ENSG00000010017	ENSG00000010017			13727	protein-coding gene	gene with protein product	"""Ran Binding Protein in the Microtubule organizing center"""	603854				9817760	Standard	NM_005493		Approved	RanBPM	uc003nbb.3	Q96S59	OTTHUMG00000015642	ENST00000011619.3:c.659A>C	6.37:g.13697041T>G	ENSP00000011619:p.Lys220Thr	Somatic		Capture	Illumina HiSeq	Phase_I	13805020	NM_005493	A0PJA2|B2R8E1|O94764|Q6P3T7|Q7LBR2|Q7Z7F9	Missense_Mutation	SNP	ENST00000011619.3	37	CCDS4529.1	.	.	.	.	.	.	.	.	.	.	T	13.85	2.358840	0.41801	.	.	ENSG00000010017	ENST00000011619;ENST00000283152	T	0.70749	-0.51	5.64	5.64	0.86602	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	T	0.61261	0.2333	N	0.11364	0.135	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.66019	-0.6027	10	0.25106	T	0.35	-23.7751	15.5275	0.75923	0.0:0.0:0.0:1.0	.	220	Q96S59	RANB9_HUMAN	T	220	ENSP00000011619:K220T	ENSP00000011619:K220T	K	-	2	0	RANBP9	13805020	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.677000	0.84024	2.142000	0.66516	0.528000	0.53228	AAA		RANBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042373.1		
NMBR	4829	broad.mit.edu	37	6	142396914	142396914	+	Silent	SNP	C	C	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr6:142396914C>T	ENST00000258042.1	-	3	1184	c.1044G>A	c.(1042-1044)gaG>gaA	p.E348E	NMBR_ENST00000480652.1_5'UTR	NM_002511.2	NP_002502.2	P28336	NMBR_HUMAN	neuromedin B receptor	348					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)	p.E348E(1)		breast(2)|central_nervous_system(3)|endometrium(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;9.93e-06)|GBM - Glioblastoma multiforme(68;0.0013)		TGGTTCCTCTCTCTTGATAGG	0.458																																					p.E348E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1044A	6						.						126.0	117.0	120.0					6																	142396914		2203	4300	6503	142438607	SO:0001819	synonymous_variant	4829	exon3				CCDS5196.1	6q24.1	2014-02-21			ENSG00000135577	ENSG00000135577		"""GPCR / Class A : Bombesin receptors"""	7843	protein-coding gene	gene with protein product	"""bombesin receptor 1"""	162341					Standard	NM_002511		Approved	BB1	uc003qiu.3	P28336	OTTHUMG00000015704	ENST00000258042.1:c.1044G>A	6.37:g.142396914C>T		Somatic		Capture	Illumina HiSeq	Phase_I	142438607	NM_002511	E9KL38|Q5VUK8	Silent	SNP	ENST00000258042.1	37	CCDS5196.1																																																																																				NMBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042479.1		
PRL	5617	broad.mit.edu	37	6	22290562	22290562	+	Silent	SNP	C	C	G			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr6:22290562C>G	ENST00000306482.1	-	4	851	c.333G>C	c.(331-333)ctG>ctC	p.L111L	RP3-404K8.2_ENST00000561912.1_RNA	NM_000948.5|NM_001163558.2	NP_000939.1|NP_001157030.1	P01236	PRL_HUMAN	prolactin	111				SL -> VS (in Ref. 7; AA sequence). {ECO:0000305}.	cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|circadian rhythm (GO:0007623)|female pregnancy (GO:0007565)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|multicellular organismal response to stress (GO:0033555)|ovulation cycle (GO:0042698)|parturition (GO:0007567)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of JAK-STAT cascade (GO:0046427)|regulation of multicellular organism growth (GO:0040014)|regulation of ossification (GO:0030278)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|secretory granule (GO:0030141)	prolactin receptor binding (GO:0005148)	p.L111L(1)		NS(1)|endometrium(2)|large_intestine(6)|lung(6)|prostate(1)	16	Ovarian(93;0.163)					TGCTGACTATCAGGCTCAGAA	0.418																																					p.L111L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G333C	6						.						107.0	101.0	103.0					6																	22290562		2203	4300	6503	22398541	SO:0001819	synonymous_variant	5617	exon4			D00411	CCDS4548.1	6p22.3	2013-09-16			ENSG00000172179	ENSG00000172179			9445	protein-coding gene	gene with protein product		176760					Standard	NM_000948		Approved		uc003ndq.3	P01236	OTTHUMG00000016111	ENST00000306482.1:c.333G>C	6.37:g.22290562C>G		Somatic		Capture	Illumina HiSeq	Phase_I	22398541	NM_000948	Q15199|Q92996	Silent	SNP	ENST00000306482.1	37	CCDS4548.1																																																																																				PRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043327.1	NM_000948	
CMTR1	23070	broad.mit.edu	37	6	37421042	37421042	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr6:37421042A>G	ENST00000373451.4	+	8	895	c.731A>G	c.(730-732)gAt>gGt	p.D244G		NM_015050.2	NP_055865.1	Q8N1G2	CMTR1_HUMAN	cap methyltransferase 1	244	RrmJ-type SAM-dependent 2'-O-MTase. {ECO:0000255|PROSITE-ProRule:PRU00945}.				7-methylguanosine mRNA capping (GO:0006370)|cap1 mRNA methylation (GO:0097309)|mRNA methylation (GO:0080009)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA (nucleoside-2'-O-)-methyltransferase activity (GO:0004483)|nucleic acid binding (GO:0003676)	p.D244G(1)									GCTAACATGGATTTTGTATTT	0.433																																					p.D244G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A731G	6						.						204.0	186.0	192.0					6																	37421042		2203	4300	6503	37529020	SO:0001583	missense	23070	exon8			BC031890	CCDS4835.1	6p21.2	2013-07-23	2013-07-23	2013-07-23	ENSG00000137200	ENSG00000137200	2.1.1.57	"""G patch domain containing"""	21077	protein-coding gene	gene with protein product			"""KIAA0082"", ""FtsJ methyltransferase domain containing 2"""	KIAA0082, FTSJD2		20713356	Standard	NM_015050		Approved	MTr1, ISG95	uc003ons.3	Q8N1G2	OTTHUMG00000014624	ENST00000373451.4:c.731A>G	6.37:g.37421042A>G	ENSP00000362550:p.Asp244Gly	Somatic		Capture	Illumina HiSeq	Phase_I	37529020	NM_015050	A8K949|Q14670|Q96FJ9	Missense_Mutation	SNP	ENST00000373451.4	37	CCDS4835.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.505672	0.85282	.	.	ENSG00000137200	ENST00000373451	T	0.36157	1.27	5.92	5.92	0.95590	Ribosomal RNA methyltransferase RrmJ/FtsJ (1);	0.000000	0.85682	D	0.000000	T	0.65739	0.2720	H	0.94264	3.515	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76675	-0.2872	10	0.72032	D	0.01	-20.7239	15.5593	0.76229	1.0:0.0:0.0:0.0	.	244	Q8N1G2	MTR1_HUMAN	G	244	ENSP00000362550:D244G	ENSP00000362550:D244G	D	+	2	0	FTSJD2	37529020	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.277000	0.76020	0.528000	0.53228	GAT		CMTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040408.1	NM_015050	
DNAH8	1769	broad.mit.edu	37	6	38939412	38939412	+	Nonsense_Mutation	SNP	C	C	T	rs150428096		TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr6:38939412C>T	ENST00000359357.3	+	81	12099	c.11845C>T	c.(11845-11847)Cga>Tga	p.R3949*	DNAH8_ENST00000441566.1_Nonsense_Mutation_p.R3913*|DNAH8_ENST00000449981.2_Nonsense_Mutation_p.R4166*			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	3949	AAA 6. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R3949*(2)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						AGTACATGCTCGAAAGCTGAT	0.418													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20158	0.0		0.0	False		,,,				2504	0.0				p.R3949X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C11845T	6						.	C	stop/ARG	1,4405	2.1+/-5.4	0,1,2202	160.0	131.0	141.0		12496	3.2	1.0	6	dbSNP_134	141	2,8598	2.2+/-6.3	0,2,4298	yes	stop-gained	DNAH8	NM_001206927.1		0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231		4166/4708	38939412	3,13003	2203	4300	6503	39047390	SO:0001587	stop_gained	1769	exon81			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.11845C>T	6.37:g.38939412C>T	ENSP00000352312:p.Arg3949*	Somatic		Capture	Illumina HiSeq	Phase_I	39047390	NM_001371	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Nonsense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	C	53	21.383550	0.99940	2.27E-4	2.33E-4	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	.	.	.	5.04	3.19	0.36642	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.7075	0.62648	0.2814:0.7186:0.0:0.0	.	.	.	.	X	4154;4154;3949;3913	.	ENSP00000333363:R4154X	R	+	1	2	DNAH8	39047390	0.833000	0.29383	0.992000	0.48379	0.924000	0.55760	1.464000	0.35288	0.480000	0.27534	-0.324000	0.08512	CGA		DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
TREM1	54210	broad.mit.edu	37	6	41250471	41250471	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr6:41250471T>G	ENST00000244709.4	-	2	131	c.68A>C	c.(67-69)aAa>aCa	p.K23T	TREM1_ENST00000589614.1_Missense_Mutation_p.K23T|TREM1_ENST00000334475.6_Missense_Mutation_p.K23T|TREM1_ENST00000591620.1_Missense_Mutation_p.K23T	NM_018643.3	NP_061113.1	Q9NP99	TREM1_HUMAN	triggering receptor expressed on myeloid cells 1	23					blood coagulation (GO:0007596)|chemokine metabolic process (GO:0050755)|cytokine secretion involved in immune response (GO:0002374)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|neutrophil mediated killing of gram-negative bacterium (GO:0070945)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)	p.K23T(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(5)|lung(5)|skin(1)	16	Ovarian(28;0.0327)|Colorectal(47;0.196)					CTCAGTTAATTTAGTTGCAGC	0.468																																					p.K23T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A68C	6						.						93.0	100.0	98.0					6																	41250471		2203	4300	6503	41358449	SO:0001583	missense	54210	exon2			AF196329	CCDS4854.1, CCDS56427.1, CCDS59499.1	6p21.1	2013-01-11			ENSG00000124731	ENSG00000124731		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	17760	protein-coding gene	gene with protein product		605085				11922939, 10799849	Standard	NM_018643		Approved	TREM-1, CD354	uc003oqf.2	Q9NP99	OTTHUMG00000014674	ENST00000244709.4:c.68A>C	6.37:g.41250471T>G	ENSP00000244709:p.Lys23Thr	Somatic		Capture	Illumina HiSeq	Phase_I	41358449	NM_018643	B4DWG2|K7EJW1|Q53FL8|Q5T2C9|Q86YU1	Missense_Mutation	SNP	ENST00000244709.4	37	CCDS4854.1	.	.	.	.	.	.	.	.	.	.	T	8.281	0.815641	0.16607	.	.	ENSG00000124731	ENST00000244709;ENST00000334475	T;T	0.12255	3.08;2.7	3.65	-3.76	0.04359	.	2.028980	0.02444	N	0.084868	T	0.01976	0.0062	N	0.22421	0.69	0.09310	N	1	B;B	0.15719	0.014;0.008	B;B	0.25140	0.035;0.058	T	0.39623	-0.9605	10	0.20519	T	0.43	1.8266	0.0987	0.00046	0.3367:0.21:0.1609:0.2924	.	23;23	Q9NP99-2;Q9NP99	.;TREM1_HUMAN	T	23	ENSP00000244709:K23T;ENSP00000334284:K23T	ENSP00000244709:K23T	K	-	2	0	TREM1	41358449	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.946000	0.01536	-0.703000	0.05049	0.482000	0.46254	AAA		TREM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040505.2	NM_018643	
OGFRL1	79627	broad.mit.edu	37	6	72011438	72011438	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr6:72011438G>A	ENST00000370435.4	+	7	1176	c.1042G>A	c.(1042-1044)Gac>Aac	p.D348N	RP11-154D6.1_ENST00000587253.1_RNA|RP11-154D6.1_ENST00000432050.1_RNA|RP11-154D6.1_ENST00000585882.1_RNA|RP11-154D6.1_ENST00000591156.1_RNA|RP11-154D6.1_ENST00000588612.1_RNA|RP11-154D6.1_ENST00000450998.1_RNA|RP11-154D6.1_ENST00000587397.1_RNA|RP11-154D6.1_ENST00000586030.1_RNA|RP11-154D6.1_ENST00000412751.1_RNA|RP11-154D6.1_ENST00000587036.1_RNA|RP3-331H24.5_ENST00000602823.1_lincRNA|RP11-154D6.1_ENST00000423255.1_RNA|RP11-154D6.1_ENST00000586232.1_RNA	NM_024576.3	NP_078852.3	Q5TC84	OGRL1_HUMAN	opioid growth factor receptor-like 1	348						membrane (GO:0016020)	receptor activity (GO:0004872)	p.D348N(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|upper_aerodigestive_tract(1)	13						AAAAGCCAAGGACTCCAAAAA	0.463																																					p.D348N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1042A	6						.						43.0	49.0	47.0					6																	72011438		2203	4300	6503	72068159	SO:0001583	missense	79627	exon7				CCDS34482.1	6q13	2008-02-05			ENSG00000119900	ENSG00000119900			21378	protein-coding gene	gene with protein product							Standard	NM_024576		Approved	dJ331H24.1	uc003pfx.1	Q5TC84	OTTHUMG00000015000	ENST00000370435.4:c.1042G>A	6.37:g.72011438G>A	ENSP00000359464:p.Asp348Asn	Somatic		Capture	Illumina HiSeq	Phase_I	72068159	NM_024576	Q2TAC1|Q8NEQ4|Q9H7B5	Missense_Mutation	SNP	ENST00000370435.4	37	CCDS34482.1	.	.	.	.	.	.	.	.	.	.	G	18.02	3.530338	0.64860	.	.	ENSG00000119900	ENST00000370435	T	0.51817	0.69	6.04	6.04	0.98038	.	0.373147	0.28006	N	0.016974	T	0.41627	0.1167	L	0.56769	1.78	0.33385	D	0.575402	P	0.46395	0.877	P	0.45829	0.494	T	0.50866	-0.8777	10	0.62326	D	0.03	-24.4858	16.0072	0.80372	0.0:0.1336:0.8664:0.0	.	348	Q5TC84	OGRL1_HUMAN	N	348	ENSP00000359464:D348N	ENSP00000359464:D348N	D	+	1	0	OGFRL1	72068159	1.000000	0.71417	1.000000	0.80357	0.343000	0.28985	5.393000	0.66279	2.873000	0.98535	0.563000	0.77884	GAC		OGFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041153.2	NM_024576	
MAP3K4	4216	broad.mit.edu	37	6	161470018	161470018	+	Silent	SNP	C	C	G			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr6:161470018C>G	ENST00000392142.4	+	3	862	c.714C>G	c.(712-714)gtC>gtG	p.V238V	MAP3K4_ENST00000348824.7_Silent_p.V238V|MAP3K4_ENST00000366920.2_Silent_p.V238V|MAP3K4_ENST00000366919.2_Silent_p.V238V	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	238					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)	p.V238V(2)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		TTACCTCAGTCTCAAAGAAAA	0.438																																					p.V238V												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C714G	6						.						41.0	41.0	41.0					6																	161470018		2203	4300	6503	161390008	SO:0001819	synonymous_variant	4216	exon3			AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.714C>G	6.37:g.161470018C>G		Somatic		Capture	Illumina HiSeq	Phase_I	161390008	NM_006724	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Silent	SNP	ENST00000392142.4	37	CCDS34565.1																																																																																				MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3		
ZAN	7455	broad.mit.edu	37	7	100334192	100334192	+	RNA	SNP	C	C	T	rs200760090		TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr7:100334192C>T	ENST00000348028.3	+	0	358				ZAN_ENST00000421100.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000538115.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R65*(1)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			AGACTGGGTTCGAGCCAGTGG	0.622																																					p.R65X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C193T	7						.	C	stop/ARG,stop/ARG	0,3648		0,0,1824	82.0	80.0	80.0		193,193	4.7	0.5	7		80	2,7762		0,2,3880	yes	stop-gained,stop-gained	ZAN	NM_003386.1,NM_173059.1	,	0,2,5704	TT,TC,CC		0.0258,0.0,0.0175	,	65/2813,65/2722	100334192	2,11410	1824	3882	5706	100172128			7455	exon4			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100334192C>T		Somatic		Capture	Illumina HiSeq	Phase_I	100172128	NM_173059	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Nonsense_Mutation	SNP	ENST00000348028.3	37		.	.	.	.	.	.	.	.	.	.	C	27.9	4.869836	0.91587	0.0	2.58E-4	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	.	.	.	4.7	4.7	0.59300	.	0.000000	0.29009	N	0.013438	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.8686	0.63603	0.0:1.0:0.0:0.0	.	.	.	.	X	65	.	ENSP00000423579:R65X	R	+	1	2	ZAN	100172128	0.062000	0.20869	0.490000	0.27465	0.318000	0.28184	2.025000	0.41059	2.551000	0.86045	0.561000	0.74099	CGA		ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386	
PHF14	9678	broad.mit.edu	37	7	11022332	11022332	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr7:11022332C>G	ENST00000403050.3	+	3	898	c.446C>G	c.(445-447)gCt>gGt	p.A149G	PHF14_ENST00000445996.2_Intron	NM_014660.3	NP_055475.2	O94880	PHF14_HUMAN	PHD finger protein 14	149					lung alveolus development (GO:0048286)|negative regulation of mesenchymal cell proliferation involved in lung development (GO:2000791)|negative regulation of platelet-derived growth factor receptor-alpha signaling pathway (GO:2000584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.A149G(1)		NS(2)|breast(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	35				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		GCTTCTGCTGCTGCCACCACA	0.458																																					p.A149G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C446G	7						.						27.0	34.0	31.0					7																	11022332		1999	4169	6168	10988857	SO:0001583	missense	9678	exon3			AB018326	CCDS47542.1	7p21.3	2013-01-28			ENSG00000106443	ENSG00000106443		"""Zinc fingers, PHD-type"""	22203	protein-coding gene	gene with protein product						9872452	Standard	NM_014660		Approved	KIAA0783	uc003sry.2	O94880	OTTHUMG00000150463	ENST00000403050.3:c.446C>G	7.37:g.11022332C>G	ENSP00000385795:p.Ala149Gly	Somatic		Capture	Illumina HiSeq	Phase_I	10988857	NM_014660	A7MCZ3|B4DI82	Missense_Mutation	SNP	ENST00000403050.3	37	CCDS47542.1	.	.	.	.	.	.	.	.	.	.	C	9.274	1.046527	0.19748	.	.	ENSG00000106443	ENST00000403050	T	0.63744	-0.06	4.25	2.45	0.29901	.	.	.	.	.	T	0.35856	0.0946	N	0.08118	0	0.80722	D	1	B;B	0.27498	0.18;0.079	B;B	0.23018	0.043;0.043	T	0.09662	-1.0664	9	0.33940	T	0.23	.	6.752	0.23491	0.0:0.7887:0.0:0.2113	.	149;149	A8MSQ1;O94880	.;PHF14_HUMAN	G	149	ENSP00000385795:A149G	ENSP00000385795:A149G	A	+	2	0	PHF14	10988857	0.002000	0.14202	0.962000	0.40283	0.794000	0.44872	1.506000	0.35747	0.739000	0.32628	0.585000	0.79938	GCT		PHF14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318212.1	NM_014660	
ANKMY2	57037	broad.mit.edu	37	7	16666720	16666720	+	Silent	SNP	T	T	G			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr7:16666720T>G	ENST00000306999.2	-	3	459	c.216A>C	c.(214-216)gtA>gtC	p.V72V	ANKMY2_ENST00000421746.1_5'UTR	NM_020319.2	NP_064715.1	Q8IV38	ANKY2_HUMAN	ankyrin repeat and MYND domain containing 2	72						cilium (GO:0005929)	metal ion binding (GO:0046872)	p.V72V(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|urinary_tract(1)	23	Lung NSC(10;0.103)|all_lung(11;0.204)			UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		GATGACAATTTACATCGGCTC	0.363																																					p.V72V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A216C	7						.						96.0	83.0	87.0					7																	16666720		2203	4300	6503	16633245	SO:0001819	synonymous_variant	57037	exon3			AK001740	CCDS5361.1	7p21	2013-01-10			ENSG00000106524	ENSG00000106524		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	25370	protein-coding gene	gene with protein product						12477932	Standard	NM_020319		Approved	DKFZP564O043, ZMYND20	uc003sti.3	Q8IV38	OTTHUMG00000090806	ENST00000306999.2:c.216A>C	7.37:g.16666720T>G		Somatic		Capture	Illumina HiSeq	Phase_I	16633245	NM_020319	A4D124|Q659G1|Q96BL3	Silent	SNP	ENST00000306999.2	37	CCDS5361.1																																																																																				ANKMY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207600.2	NM_020319	
HDAC9	9734	broad.mit.edu	37	7	18687500	18687500	+	Silent	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr7:18687500G>A	ENST00000432645.2	+	9	1119	c.1119G>A	c.(1117-1119)ccG>ccA	p.P373P	HDAC9_ENST00000456174.2_Silent_p.P345P|HDAC9_ENST00000417496.2_Silent_p.P371P|HDAC9_ENST00000406072.1_Silent_p.P360P|HDAC9_ENST00000441542.2_Silent_p.P376P|HDAC9_ENST00000428307.2_Silent_p.P329P|HDAC9_ENST00000405010.3_Silent_p.P373P|HDAC9_ENST00000401921.1_Silent_p.P332P|HDAC9_ENST00000524023.1_Silent_p.P296P|HDAC9_ENST00000406451.4_Silent_p.P373P	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	373					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.P376P(2)|p.P373P(1)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	GCAGCATCCCGGCATCTTCCA	0.512																																					p.P373P												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.G1119A	7						.						38.0	41.0	40.0					7																	18687500		2071	4220	6291	18654025	SO:0001819	synonymous_variant	9734	exon10			AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.1119G>A	7.37:g.18687500G>A		Somatic		Capture	Illumina HiSeq	Phase_I	18654025	NM_178423	A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Silent	SNP	ENST00000432645.2	37	CCDS47555.1																																																																																				HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1		
LANCL2	55915	broad.mit.edu	37	7	55493099	55493099	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr7:55493099G>T	ENST00000254770.2	+	7	1739	c.1161G>T	c.(1159-1161)aaG>aaT	p.K387N		NM_018697.3	NP_061167.1	Q9NS86	LANC2_HUMAN	LanC lantibiotic synthetase component C-like 2 (bacterial)	387					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of abscisic acid-activated signaling pathway (GO:0009789)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|GTP binding (GO:0005525)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)	p.K387N(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	25	Breast(14;0.0379)		Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00128)|Epithelial(13;0.0706)			CGCAGGATAAGAAGTACCTCT	0.542																																					p.K387N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1161T	7						.						161.0	143.0	149.0					7																	55493099		2203	4300	6503	55460593	SO:0001583	missense	55915	exon7			AJ278245	CCDS5517.1	7q31.1-q31.33	2008-07-18	2001-12-04		ENSG00000132434	ENSG00000132434			6509	protein-coding gene	gene with protein product	"""testis-specific adriamycin sensitivity protein"", ""G protein-coupled receptor 69B"""	612919	"""LanC (bacterial lantibiotic synthetase component C)-like 2"""	GPR69B		11762191	Standard	NM_018697		Approved	TASP	uc003tqp.3	Q9NS86	OTTHUMG00000023779	ENST00000254770.2:c.1161G>T	7.37:g.55493099G>T	ENSP00000254770:p.Lys387Asn	Somatic		Capture	Illumina HiSeq	Phase_I	55460593	NM_018697	B2R8D4|Q6NSL4|Q8TCQ3|Q9BSR1	Missense_Mutation	SNP	ENST00000254770.2	37	CCDS5517.1	.	.	.	.	.	.	.	.	.	.	G	13.96	2.394290	0.42410	.	.	ENSG00000132434	ENST00000254770	T	0.42513	0.97	5.27	-7.42	0.01388	Six-hairpin glycosidase (1);Six-hairpin glycosidase-like (1);	0.131990	0.64402	D	0.000002	T	0.41213	0.1149	M	0.80746	2.51	0.27131	N	0.961893	P	0.38335	0.627	B	0.41412	0.356	T	0.45877	-0.9231	10	0.17832	T	0.49	.	15.7739	0.78193	0.7442:0.0:0.2558:0.0	.	387	Q9NS86	LANC2_HUMAN	N	387	ENSP00000254770:K387N	ENSP00000254770:K387N	K	+	3	2	LANCL2	55460593	0.005000	0.15991	0.013000	0.15412	0.976000	0.68499	-0.187000	0.09656	-1.513000	0.01789	0.557000	0.71058	AAG		LANCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251459.1	NM_018697	
ASNS	440	broad.mit.edu	37	7	97482429	97482429	+	Silent	SNP	T	T	C			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr7:97482429T>C	ENST00000394309.3	-	12	1890	c.1419A>G	c.(1417-1419)ggA>ggG	p.G473G	ASNS_ENST00000455086.1_Silent_p.G390G|ASNS_ENST00000175506.4_Silent_p.G473G|ASNS_ENST00000444334.1_Silent_p.G452G|ASNS_ENST00000394308.3_Silent_p.G473G|ASNS_ENST00000422745.1_Silent_p.G452G|ASNS_ENST00000437628.1_Silent_p.G390G	NM_133436.3	NP_597680.2	P08243	ASNS_HUMAN	asparagine synthetase (glutamine-hydrolyzing)	473	Asparagine synthetase.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|asparagine biosynthetic process (GO:0006529)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular protein metabolic process (GO:0044267)|cellular response to glucose starvation (GO:0042149)|cellular response to hormone stimulus (GO:0032870)|endoplasmic reticulum unfolded protein response (GO:0030968)|glutamine metabolic process (GO:0006541)|L-asparagine biosynthetic process (GO:0070981)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|positive regulation of mitotic cell cycle (GO:0045931)|response to amino acid (GO:0043200)|response to follicle-stimulating hormone (GO:0032354)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)|ATP binding (GO:0005524)|cofactor binding (GO:0048037)	p.G473G(1)		ovary(1)	1	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)				Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	CTGAAGTTATTCCATCACTGA	0.368																																					p.G473G	Melanoma(70;6 1280 3108 3799 51123)|GBM(6;275 291 425 9929 27738)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1419G	7						.						43.0	41.0	42.0					7																	97482429		2203	4300	6503	97320365	SO:0001819	synonymous_variant	440	exon13			M27396	CCDS5652.1, CCDS55131.1, CCDS55132.1	7q21.3	2012-10-02	2010-05-07		ENSG00000070669	ENSG00000070669	6.3.5.4		753	protein-coding gene	gene with protein product		108370	"""asparagine synthetase"""				Standard	NM_001673		Approved		uc003uov.4	P08243	OTTHUMG00000022892	ENST00000394309.3:c.1419A>G	7.37:g.97482429T>C		Somatic		Capture	Illumina HiSeq	Phase_I	97320365	NM_183356	A4D1I8|B4DXZ1|B7ZAA9|D6W5R3|E9PCI3|E9PCX6|P08184|Q15666|Q549T9|Q96HD0	Silent	SNP	ENST00000394309.3	37	CCDS5652.1																																																																																				ASNS-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333645.1	NM_001673, NM_183356	
TAF6	6878	broad.mit.edu	37	7	99706133	99706133	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr7:99706133G>A	ENST00000344095.4	-	13	1840	c.1315C>T	c.(1315-1317)Cgc>Tgc	p.R439C	TAF6_ENST00000452041.1_Missense_Mutation_p.R439C|AP4M1_ENST00000421755.1_Intron|TAF6_ENST00000437822.2_Missense_Mutation_p.R476C|TAF6_ENST00000453269.2_Missense_Mutation_p.R439C|TAF6_ENST00000418432.2_Missense_Mutation_p.R363C|TAF6_ENST00000472509.1_Missense_Mutation_p.R496C	NM_005641.3	NP_005632.1	P49848	TAF6_HUMAN	TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa	439					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R439C(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(2)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GGCGGTGGGCGCAGCTTTGCC	0.607																																					p.R439C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1315T	7						.						60.0	67.0	65.0					7																	99706133		2203	4300	6503	99544069	SO:0001583	missense	6878	exon13				CCDS5686.1, CCDS55135.1	7q	2010-02-26	2002-08-29	2001-12-07	ENSG00000106290	ENSG00000106290			11540	protein-coding gene	gene with protein product	"""TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80 kD"", ""transcription initiation factor TFIID 70 kD subunit"""	602955	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, E, 70/85kD"""	TAF2E		826207	Standard	NM_139315		Approved	TAFII70, TAFII80, MGC:8964, TAFII85	uc011kji.2	P49848	OTTHUMG00000154771	ENST00000344095.4:c.1315C>T	7.37:g.99706133G>A	ENSP00000344537:p.Arg439Cys	Somatic		Capture	Illumina HiSeq	Phase_I	99544069	NM_005641	A4D2B2|A4D2B3|B4DT11|D6W5U2|Q6AI29	Missense_Mutation	SNP	ENST00000344095.4	37	CCDS5686.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.382507	0.82792	.	.	ENSG00000106290	ENST00000453269;ENST00000472509;ENST00000452041;ENST00000344095;ENST00000418432;ENST00000437822	T;T;T;T;T	0.60797	0.23;0.16;0.23;0.23;0.17	5.69	3.77	0.43336	.	0.000000	0.85682	D	0.000000	T	0.71525	0.3350	M	0.74647	2.275	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.79784	0.983;0.993;0.983;0.983;0.983	T	0.73439	-0.3982	10	0.87932	D	0	-11.6419	8.261	0.31786	0.0867:0.0:0.7611:0.1522	.	476;439;429;439;363	B4DT11;P49848-2;A4D299;P49848;B3KUR4	.;.;.;TAF6_HUMAN;.	C	439;496;439;439;363;476	ENSP00000389575:R439C;ENSP00000419760:R496C;ENSP00000416396:R439C;ENSP00000344537:R439C;ENSP00000399982:R476C	ENSP00000344537:R439C	R	-	1	0	TAF6	99544069	1.000000	0.71417	0.998000	0.56505	0.937000	0.57800	5.509000	0.67012	1.344000	0.45657	0.491000	0.48974	CGC		TAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337024.2	NM_005641	
MUC17	140453	broad.mit.edu	37	7	100682302	100682303	+	Missense_Mutation	DNP	TT	TT	AC			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	TT	TT					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr7:100682302_100682303TT>AC	ENST00000306151.4	+	3	7669_7670	c.7605_7606TT>AC	c.(7603-7608)ctTTca>ctACca	p.S2536P		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2536	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.L2535>?(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CTAGCACCCTTTCAACAACTCC	0.480																																					.												.	.	1	Complex(1)	large_intestine(1)	c.7605_7606AC	7						.																																			100469023	SO:0001583	missense	140453	exon3			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	Exception_encountered	7.37:g.100682302_100682303delinsAC	ENSP00000302716:p.Ser2536Pro	Somatic		Capture	Illumina HiSeq	Phase_I	100469022	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	DNP	ENST00000306151.4	37	CCDS34711.1																																																																																				MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
FZD6	8323	broad.mit.edu	37	8	104337008	104337008	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr8:104337008G>A	ENST00000358755.4	+	4	991	c.674G>A	c.(673-675)aGa>aAa	p.R225K	FZD6_ENST00000540287.1_Intron|FZD6_ENST00000522566.1_Missense_Mutation_p.R225K|FZD6_ENST00000523739.1_Missense_Mutation_p.R193K	NM_001164616.1|NM_003506.3	NP_001158088.1|NP_003497.2	O60353	FZD6_HUMAN	frizzled class receptor 6	225					angiogenesis (GO:0001525)|axonogenesis (GO:0007409)|cell proliferation in midbrain (GO:0033278)|embryonic nail plate morphogenesis (GO:0035880)|establishment of planar polarity (GO:0001736)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hair follicle development (GO:0001942)|inner ear morphogenesis (GO:0042472)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|neural tube closure (GO:0001843)|non-canonical Wnt signaling pathway (GO:0035567)|platelet activation (GO:0030168)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	apical part of cell (GO:0045177)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.R225K(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	24			OV - Ovarian serous cystadenocarcinoma(57;2.86e-05)|STAD - Stomach adenocarcinoma(118;0.197)			ATTGATGTTAGAAGATTCAGA	0.333																																					p.R225K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G674A	8						.						50.0	51.0	50.0					8																	104337008		2203	4300	6503	104406184	SO:0001583	missense	8323	exon4			AB012911	CCDS6298.1, CCDS55268.1	8q22.3-q23.1	2014-01-29	2014-01-29		ENSG00000164930	ENSG00000164930		"""GPCR / Class F : Frizzled receptors"""	4044	protein-coding gene	gene with protein product		603409	"""frizzled (Drosophila) homolog 6"", ""frizzled homolog 6 (Drosophila)"", ""frizzled 6, seven transmembrane spanning receptor"", ""frizzled family receptor 6"""			9480858, 14747478	Standard	NM_003506		Approved	Hfz6	uc003ylh.3	O60353	OTTHUMG00000164840	ENST00000358755.4:c.674G>A	8.37:g.104337008G>A	ENSP00000351605:p.Arg225Lys	Somatic		Capture	Illumina HiSeq	Phase_I	104406184	NM_001164615	B4DRN0|Q6N0A5|Q6P9C3|Q8WXR9	Missense_Mutation	SNP	ENST00000358755.4	37	CCDS6298.1	.	.	.	.	.	.	.	.	.	.	G	2.158	-0.392939	0.04899	.	.	ENSG00000164930	ENST00000522566;ENST00000358755;ENST00000523739;ENST00000539487	T;T;T	0.81163	-1.46;-1.46;-1.46	5.6	-0.0437	0.13858	GPCR, family 2-like (1);	0.246549	0.46758	N	0.000263	T	0.54175	0.1842	N	0.11154	0.105	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.19549	-1.0302	10	0.11485	T	0.65	.	4.9812	0.14166	0.5649:0.146:0.2891:0.0	.	170;225;225	B4E236;B2R9H9;O60353	.;.;FZD6_HUMAN	K	225;225;193;170	ENSP00000429055:R225K;ENSP00000351605:R225K;ENSP00000429528:R193K	ENSP00000351605:R225K	R	+	2	0	FZD6	104406184	1.000000	0.71417	0.862000	0.33874	0.980000	0.70556	2.628000	0.46477	-0.162000	0.10964	-0.658000	0.03865	AGA		FZD6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380560.1	NM_003506	
ZFPM2	23414	broad.mit.edu	37	8	106815014	106815014	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr8:106815014C>T	ENST00000407775.2	+	8	2954	c.2704C>T	c.(2704-2706)Cga>Tga	p.R902*	RP11-152P17.2_ENST00000509144.2_RNA|ZFPM2_ENST00000378472.4_Nonsense_Mutation_p.R633*|RP11-152P17.2_ENST00000520433.1_RNA|RP11-152P17.2_ENST00000521622.1_RNA|ZFPM2_ENST00000522296.1_3'UTR|RP11-152P17.2_ENST00000524045.2_RNA|ZFPM2_ENST00000520492.1_Nonsense_Mutation_p.R770*|ZFPM2_ENST00000517361.1_Nonsense_Mutation_p.R770*|RP11-152P17.2_ENST00000518932.1_RNA|RP11-152P17.2_ENST00000520594.1_RNA	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	902					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.R902*(1)		NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			AGAAAGCGAACGAAACAGCCC	0.458																																					p.R902X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2704T	8						.						46.0	45.0	45.0					8																	106815014		1930	4141	6071	106884190	SO:0001587	stop_gained	23414	exon8			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.2704C>T	8.37:g.106815014C>T	ENSP00000384179:p.Arg902*	Somatic		Capture	Illumina HiSeq	Phase_I	106884190	NM_012082	Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Nonsense_Mutation	SNP	ENST00000407775.2	37	CCDS47908.1	.	.	.	.	.	.	.	.	.	.	C	37	5.984063	0.97173	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	.	.	.	5.57	3.73	0.42828	.	0.176149	0.51477	D	0.000099	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	.	14.4956	0.67685	0.5405:0.4595:0.0:0.0	.	.	.	.	X	902;770;770;633	.	ENSP00000367733:R633X	R	+	1	2	ZFPM2	106884190	1.000000	0.71417	0.973000	0.42090	0.869000	0.49853	1.600000	0.36762	0.663000	0.31027	-0.284000	0.09977	CGA		ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380614.1		
PKHD1L1	93035	broad.mit.edu	37	8	110504156	110504156	+	Missense_Mutation	SNP	C	C	T	rs541350761	byFrequency	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr8:110504156C>T	ENST00000378402.5	+	62	10273	c.10169C>T	c.(10168-10170)tCg>tTg	p.S3390L		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3390					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.S3392L(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ATTGCACTTTCGGTTTGGCCA	0.353										HNSCC(38;0.096)			C|||	2	0.000399361	0.0015	0.0	5008	,	,		14555	0.0		0.0	False		,,,				2504	0.0				p.S3390L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C10169T	8						.						42.0	44.0	43.0					8																	110504156		1817	4075	5892	110573332	SO:0001583	missense	93035	exon62			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.10169C>T	8.37:g.110504156C>T	ENSP00000367655:p.Ser3390Leu	Somatic		Capture	Illumina HiSeq	Phase_I	110573332	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	C	19.12	3.764903	0.69878	.	.	ENSG00000205038	ENST00000378402;ENST00000526472	D;D	0.85773	-2.03;-1.84	5.61	5.61	0.85477	Pectin lyase fold/virulence factor (1);	0.262894	0.32175	N	0.006466	T	0.79930	0.4531	L	0.34521	1.04	0.30014	N	0.814901	B	0.30021	0.265	B	0.29267	0.1	T	0.77191	-0.2678	10	0.45353	T	0.12	.	17.1443	0.86762	0.0:1.0:0.0:0.0	.	3390	Q86WI1	PKHL1_HUMAN	L	3390;318	ENSP00000367655:S3390L;ENSP00000437376:S318L	ENSP00000367655:S3390L	S	+	2	0	PKHD1L1	110573332	1.000000	0.71417	0.976000	0.42696	0.955000	0.61496	6.015000	0.70791	2.635000	0.89317	0.563000	0.77884	TCG		PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
KIAA0196	9897	broad.mit.edu	37	8	126049483	126049483	+	Silent	SNP	A	A	G			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr8:126049483A>G	ENST00000318410.7	-	26	3526	c.3177T>C	c.(3175-3177)aaT>aaC	p.N1059N	KIAA0196_ENST00000517845.1_Silent_p.N911N	NM_014846.3	NP_055661.3	Q12768	STRUM_HUMAN	KIAA0196	1059					cell death (GO:0008219)|endosomal transport (GO:0016197)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|WASH complex (GO:0071203)		p.N1059N(1)		NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	42	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			ACGTACCCAGATTTTTGTTGT	0.308																																					p.N1059N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T3177C	8						.						110.0	113.0	112.0					8																	126049483		2203	4300	6503	126118665	SO:0001819	synonymous_variant	9897	exon26				CCDS6355.1	8q24.13	2014-05-09			ENSG00000164961	ENSG00000164961			28984	protein-coding gene	gene with protein product	"""strumpellin"""	610657	"""spastic paraplegia 8 (autosomal dominant)"""	SPG8		9973294, 17160902, 23085491	Standard	NM_014846		Approved		uc003yrt.3	Q12768	OTTHUMG00000164991	ENST00000318410.7:c.3177T>C	8.37:g.126049483A>G		Somatic		Capture	Illumina HiSeq	Phase_I	126118665	NM_014846	A8K4R7|Q3KQX5|Q8TBQ2	Silent	SNP	ENST00000318410.7	37	CCDS6355.1	.	.	.	.	.	.	.	.	.	.	A	8.292	0.817861	0.16607	.	.	ENSG00000164961	ENST00000523273	.	.	.	6.04	3.07	0.35406	.	.	.	.	.	T	0.57858	0.2082	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50242	-0.8851	4	.	.	.	-29.3312	8.5922	0.33695	0.373:0.0:0.627:0.0	.	.	.	.	T	676	.	.	I	-	2	0	KIAA0196	126118665	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	2.472000	0.45136	0.335000	0.23614	0.459000	0.35465	ATC		KIAA0196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381369.1	NM_014846	
MCPH1	79648	broad.mit.edu	37	8	6302622	6302622	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr8:6302622A>T	ENST00000344683.5	+	8	1455	c.1379A>T	c.(1378-1380)gAt>gTt	p.D460V	MCPH1_ENST00000522905.1_Missense_Mutation_p.D412V|MCPH1_ENST00000519480.1_Missense_Mutation_p.D460V	NM_024596.3	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin 1	460					cerebral cortex development (GO:0021987)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)	p.D460V(1)	AGPAT5/MCPH1(2)	central_nervous_system(1)|large_intestine(4)|skin(1)	6		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		GAAATGTCTGATTTTTCCTGC	0.438																																					p.D460V	Colon(95;1448 1467 8277 34473 35819)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1379T	8						.						85.0	84.0	84.0					8																	6302622		1865	4114	5979	6290030	SO:0001583	missense	79648	exon8			AK022909	CCDS43689.1, CCDS55190.1, CCDS55191.1	8p23.1	2012-11-26	2007-11-26		ENSG00000147316	ENSG00000147316			6954	protein-coding gene	gene with protein product	"""BRCT-repeat inhibitor of TERT expression 1"""	607117	"""microcephaly, primary autosomal recessive 1"""			9683597, 17925396	Standard	NM_024596		Approved	FLJ12847, BRIT1	uc003wqi.3	Q8NEM0	OTTHUMG00000163618	ENST00000344683.5:c.1379A>T	8.37:g.6302622A>T	ENSP00000342924:p.Asp460Val	Somatic		Capture	Illumina HiSeq	Phase_I	6290030	NM_024596	B4DWW2|E9PGU5|E9PH63|Q66GU1|Q9H9C7	Missense_Mutation	SNP	ENST00000344683.5	37	CCDS43689.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.096918	0.76870	.	.	ENSG00000147316	ENST00000344683;ENST00000519480;ENST00000522905	T;T;T	0.26373	1.74;1.74;1.74	5.76	4.57	0.56435	.	0.592362	0.17984	N	0.155449	T	0.49626	0.1568	M	0.77486	2.375	0.22342	N	0.999186	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	T	0.42155	-0.9468	10	0.87932	D	0	-23.2935	9.2142	0.37337	0.8386:0.0:0.0:0.1614	.	412;460;460	E9PH63;Q8NEM0;E9PGU5	.;MCPH1_HUMAN;.	V	460;460;412	ENSP00000342924:D460V;ENSP00000430962:D460V;ENSP00000430768:D412V	ENSP00000342924:D460V	D	+	2	0	MCPH1	6290030	0.011000	0.17503	0.014000	0.15608	0.707000	0.40811	2.001000	0.40825	1.076000	0.40961	0.533000	0.62120	GAT		MCPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374532.2	NM_024596	
DUSP26	78986	broad.mit.edu	37	8	33451178	33451178	+	Silent	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr8:33451178G>A	ENST00000256261.4	-	3	826	c.309C>T	c.(307-309)ccC>ccT	p.P103P	DUSP26_ENST00000523956.1_Silent_p.P103P	NM_024025.1	NP_076930.1	Q9BV47	DUS26_HUMAN	dual specificity phosphatase 26 (putative)	103	Tyrosine-protein phosphatase.				negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of cell adhesion (GO:0045785)|positive regulation of peptidyl-serine dephosphorylation (GO:1902310)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	p53 binding (GO:0002039)|phosphoprotein phosphatase activity (GO:0004721)|phosphoserine phosphatase activity (GO:0004647)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA polymerase II activating transcription factor binding (GO:0001102)	p.P103P(1)		NS(1)|breast(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)	15				KIRC - Kidney renal clear cell carcinoma(67;0.0918)|Kidney(114;0.111)		CATAGGCCTCGGGCGTGCCTC	0.637																																					p.P103P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C309T	8						.						54.0	47.0	49.0					8																	33451178		2203	4300	6503	33570720	SO:0001819	synonymous_variant	78986	exon3			AY902194	CCDS6092.1	8p12	2014-09-09			ENSG00000133878	ENSG00000133878		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	28161	protein-coding gene	gene with protein product							Standard	NM_024025		Approved	MGC1136, DUSP24	uc003xjp.3	Q9BV47	OTTHUMG00000163961	ENST00000256261.4:c.309C>T	8.37:g.33451178G>A		Somatic		Capture	Illumina HiSeq	Phase_I	33570720	NM_024025	D3DSV8|Q9BTW0	Silent	SNP	ENST00000256261.4	37	CCDS6092.1																																																																																				DUSP26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376564.1	NM_024025	
RB1CC1	9821	broad.mit.edu	37	8	53569095	53569095	+	Silent	SNP	T	T	C			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr8:53569095T>C	ENST00000025008.5	-	15	3817	c.3294A>G	c.(3292-3294)gaA>gaG	p.E1098E	RB1CC1_ENST00000521611.1_Intron|RB1CC1_ENST00000539297.1_Silent_p.E1098E|RB1CC1_ENST00000435644.2_Silent_p.E1098E	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	1098					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)		p.E1098E(1)		NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				TTCTCAAATTTTCTGTCTCTT	0.358																																					p.E1098E	GBM(180;1701 2102 13475 42023 52570)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A3294G	8						.						58.0	60.0	59.0					8																	53569095		2202	4298	6500	53731648	SO:0001819	synonymous_variant	9821	exon15			AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.3294A>G	8.37:g.53569095T>C		Somatic		Capture	Illumina HiSeq	Phase_I	53731648	NM_001083617	Q86YR4|Q8WVU9|Q92601	Silent	SNP	ENST00000025008.5	37	CCDS34892.1																																																																																				RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	NM_014781	
SGK3	23678	broad.mit.edu	37	8	67771662	67771662	+	Missense_Mutation	SNP	T	T	C	rs150440508		TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr8:67771662T>C	ENST00000396596.1	+	17	1551	c.1337T>C	c.(1336-1338)aTc>aCc	p.I446T	C8orf44-SGK3_ENST00000519289.1_Missense_Mutation_p.I446T|SGK3_ENST00000521198.2_Missense_Mutation_p.I446T|SGK3_ENST00000520976.1_Missense_Mutation_p.I414T|SGK3_ENST00000522398.1_Missense_Mutation_p.I446T|SGK3_ENST00000345714.4_Missense_Mutation_p.I446T	NM_013257.4	NP_037389.4	Q96BR1	SGK3_HUMAN	serum/glucocorticoid regulated kinase family, member 3	446	AGC-kinase C-terminal.				ion transmembrane transport (GO:0034220)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to stress (GO:0006950)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|phosphatidylinositol binding (GO:0035091)|potassium channel regulator activity (GO:0015459)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|sodium channel regulator activity (GO:0017080)	p.I379T(1)|p.I446T(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	18	Breast(64;0.186)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0046)|OV - Ovarian serous cystadenocarcinoma(28;0.0112)|all cancers(69;0.0141)|BRCA - Breast invasive adenocarcinoma(89;0.206)			CCAGATGATATCAGAAACTTT	0.328																																					p.I446T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T1337C	8						.						179.0	157.0	164.0					8																	67771662		2203	4300	6503	67934216	SO:0001583	missense	23678	exon17				CCDS6195.1, CCDS6196.1	8q12	2008-07-28	2005-09-13	2005-09-13		ENSG00000104205			10812	protein-coding gene	gene with protein product		607591	"""serum/glucocorticoid regulated kinase-like"""	SGK2, SGKL		10585774, 10548550	Standard	NM_013257		Approved		uc003xwr.3	Q96BR1		ENST00000396596.1:c.1337T>C	8.37:g.67771662T>C	ENSP00000379842:p.Ile446Thr	Somatic		Capture	Illumina HiSeq	Phase_I	67934216	NM_001033578	A8K5W3|B3KQC2|Q9P1Q7|Q9UKG5	Missense_Mutation	SNP	ENST00000396596.1	37	CCDS6195.1	.	.	.	.	.	.	.	.	.	.	T	18.53	3.643713	0.67244	.	.	ENSG00000104205	ENST00000519289;ENST00000521198;ENST00000262211;ENST00000522398;ENST00000520976;ENST00000396596;ENST00000345714	T;T;T;T;T;T	0.38240	1.15;1.15;1.15;1.15;1.15;1.15	5.51	5.51	0.81932	Protein kinase, C-terminal (1);AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.24547	0.0595	N	0.12887	0.27	0.45205	D	0.998213	B;B	0.25719	0.109;0.132	B;B	0.29353	0.061;0.101	T	0.27536	-1.0071	9	0.26408	T	0.33	.	15.6124	0.76737	0.0:0.0:0.0:1.0	.	414;446	Q96BR1-2;Q96BR1	.;SGK3_HUMAN	T	446;446;446;446;414;446;446	ENSP00000429022:I446T;ENSP00000430463:I446T;ENSP00000430256:I446T;ENSP00000430691:I414T;ENSP00000379842:I446T;ENSP00000331816:I446T	ENSP00000262211:I446T	I	+	2	0	SGK3	67934216	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.690000	0.84178	2.096000	0.63516	0.528000	0.53228	ATC		SGK3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379232.3		
COPS5	10987	broad.mit.edu	37	8	67958095	67958095	+	Missense_Mutation	SNP	G	G	A	rs143525514		TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr8:67958095G>A	ENST00000357849.4	-	7	1192	c.872C>T	c.(871-873)aCg>aTg	p.T291M	PPP1R42_ENST00000517834.1_Intron|COPS5_ENST00000517736.1_3'UTR	NM_006837.2	NP_006828.2	Q92905	CSN5_HUMAN	COP9 signalosome subunit 5	291					cullin deneddylation (GO:0010388)|exosomal secretion (GO:1990182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein deneddylation (GO:0000338)|protein deubiquitination (GO:0016579)|regulation of cell cycle (GO:0051726)|regulation of JNK cascade (GO:0046328)|transcription from RNA polymerase II promoter (GO:0006366)|translation (GO:0006412)|translational initiation (GO:0006413)	cell junction (GO:0030054)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|eukaryotic translation initiation factor 3 complex (GO:0005852)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|transcription coactivator activity (GO:0003713)|translation initiation factor activity (GO:0003743)|ubiquitin-specific protease activity (GO:0004843)	p.T291M(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|skin(3)	14	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00389)|OV - Ovarian serous cystadenocarcinoma(28;0.00691)|all cancers(69;0.0205)|BRCA - Breast invasive adenocarcinoma(89;0.153)			TCGGTCATGCGTTTCTAAACC	0.418																																					p.T291M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C872T	8						.	G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	163.0	155.0	158.0		872	5.7	1.0	8	dbSNP_134	158	1,8599	1.2+/-3.3	0,1,4299	no	missense	COPS5	NM_006837.2	81	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign	291/335	67958095	2,13004	2203	4300	6503	68120649	SO:0001583	missense	10987	exon7			U65928	CCDS6198.1	8q13.1	2013-03-14	2013-03-14		ENSG00000121022	ENSG00000121022			2240	protein-coding gene	gene with protein product		604850	"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 5"", ""COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis)"""			8837781, 9341143	Standard	NM_006837		Approved	JAB1, SGN5, MOV-34, CSN5	uc003xxe.3	Q92905	OTTHUMG00000164563	ENST00000357849.4:c.872C>T	8.37:g.67958095G>A	ENSP00000350512:p.Thr291Met	Somatic		Capture	Illumina HiSeq	Phase_I	68120649	NM_006837	O15386|Q6AW95|Q86WQ4|Q9BQ17	Missense_Mutation	SNP	ENST00000357849.4	37	CCDS6198.1	.	.	.	.	.	.	.	.	.	.	G	15.93	2.978093	0.53720	2.27E-4	1.16E-4	ENSG00000121022	ENST00000357849	.	.	.	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.53367	0.1792	L	0.46157	1.445	0.80722	D	1	P	0.36110	0.537	B	0.32677	0.15	T	0.54892	-0.8225	9	0.48119	T	0.1	-2.3839	19.4585	0.94906	0.0:0.0:1.0:0.0	.	291	Q92905	CSN5_HUMAN	M	291	.	ENSP00000350512:T291M	T	-	2	0	COPS5	68120649	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	7.856000	0.86956	2.705000	0.92388	0.650000	0.86243	ACG		COPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379245.2		
PREX2	80243	broad.mit.edu	37	8	68939513	68939513	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr8:68939513A>T	ENST00000288368.4	+	5	775	c.498A>T	c.(496-498)ttA>ttT	p.L166F	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	166	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.L166F(2)		NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						AAGGATATTTAGTAACACCAA	0.348																																					p.L166F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A498T	8						.						140.0	132.0	135.0					8																	68939513		2203	4300	6503	69102067	SO:0001583	missense	80243	exon5			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.498A>T	8.37:g.68939513A>T	ENSP00000288368:p.Leu166Phe	Somatic		Capture	Illumina HiSeq	Phase_I	69102067	NM_025170	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	37	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.965443	0.74131	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	D	0.83914	-1.78	5.66	-2.1	0.07210	Guanine-nucleotide dissociation stimulator, CDC24, conserved site (1);Dbl homology (DH) domain (5);	0.000000	0.64402	D	0.000003	D	0.90310	0.6969	M	0.92077	3.27	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.87509	0.2438	10	0.87932	D	0	.	7.2562	0.26177	0.5405:0.0:0.3566:0.103	.	166;166;166	Q70Z35-2;Q70Z35;Q70Z35-3	.;PREX2_HUMAN;.	F	166	ENSP00000288368:L166F	ENSP00000288368:L166F	L	+	3	2	PREX2	69102067	1.000000	0.71417	0.984000	0.44739	0.989000	0.77384	1.112000	0.31172	-0.279000	0.09167	-0.290000	0.09829	TTA		PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
TG	7038	broad.mit.edu	37	8	133899528	133899528	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr8:133899528G>A	ENST00000220616.4	+	9	1951	c.1911G>A	c.(1909-1911)tgG>tgA	p.W637*	TG_ENST00000377869.1_Nonsense_Mutation_p.W637*	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	637	Thyroglobulin type-1 5. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.W637*(1)		NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GAGAGTGCTGGTGTGTGAATT	0.532																																					p.W637X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1911A	8						.						119.0	98.0	105.0					8																	133899528		2203	4300	6503	133968710	SO:0001587	stop_gained	7038	exon9			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.1911G>A	8.37:g.133899528G>A	ENSP00000220616:p.Trp637*	Somatic		Capture	Illumina HiSeq	Phase_I	133968710	NM_003235	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Nonsense_Mutation	SNP	ENST00000220616.4	37	CCDS34944.1	.	.	.	.	.	.	.	.	.	.	G	39	7.358002	0.98235	.	.	ENSG00000042832	ENST00000377869;ENST00000220616;ENST00000535932	.	.	.	5.03	5.03	0.67393	.	0.000000	0.56097	D	0.000033	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.5379	0.87839	0.0:0.0:1.0:0.0	.	.	.	.	X	637	.	ENSP00000220616:W637X	W	+	3	0	TG	133968710	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	8.793000	0.91862	2.613000	0.88420	0.655000	0.94253	TGG		TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
C5	727	broad.mit.edu	37	9	123751902	123751902	+	Missense_Mutation	SNP	A	A	T	rs41311881	byFrequency	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr9:123751902A>T	ENST00000223642.1	-	24	3127	c.3098T>A	c.(3097-3099)aTt>aAt	p.I1033N		NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	1033			I -> T (in dbSNP:rs41311881). {ECO:0000269|Ref.2}.		activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)	p.I1033N(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	AGAATGAAAAATGTTCCAATG	0.363																																					p.I1033N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3098A	9						.						52.0	54.0	53.0					9																	123751902		2203	4300	6503	122791723	SO:0001583	missense	727	exon24			M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.3098T>A	9.37:g.123751902A>T	ENSP00000223642:p.Ile1033Asn	Somatic		Capture	Illumina HiSeq	Phase_I	122791723	NM_001735	Q14CJ0|Q27I61	Missense_Mutation	SNP	ENST00000223642.1	37	CCDS6826.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.45|16.45	3.126388|3.126388	0.56721|0.56721	.|.	.|.	ENSG00000106804|ENSG00000106804	ENST00000430906|ENST00000223642	.|T	.|0.38722	.|1.12	5.73|5.73	4.6|4.6	0.57074|0.57074	.|Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);	.|0.331184	.|0.33650	.|N	.|0.004689	T|T	0.59266|0.59266	0.2181|0.2181	M|M	0.74881|0.74881	2.28|2.28	0.42608|0.42608	D|D	0.993304|0.993304	.|D	.|0.71674	.|0.998	.|D	.|0.65573	.|0.936	T|T	0.60840|0.60840	-0.7183|-0.7183	6|10	0.33940|0.52906	T|T	0.23|0.07	.|.	9.127|9.127	0.36821|0.36821	0.917:0.0:0.0829:0.0|0.917:0.0:0.0829:0.0	.|.	.|1033	.|P01031	.|CO5_HUMAN	Q|N	1102|1033	.|ENSP00000223642:I1033N	ENSP00000394199:H1102Q|ENSP00000223642:I1033N	H|I	-|-	3|2	2|0	C5|C5	122791723|122791723	0.532000|0.532000	0.26346|0.26346	0.967000|0.967000	0.41034|0.41034	0.615000|0.615000	0.37417|0.37417	2.188000|2.188000	0.42612|0.42612	1.013000|1.013000	0.39391|0.39391	0.460000|0.460000	0.39030|0.39030	CAT|ATT		C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053844.1	NM_001735	
PTGS1	5742	broad.mit.edu	37	9	125154645	125154645	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr9:125154645C>T	ENST00000362012.2	+	11	1627	c.1622C>T	c.(1621-1623)cCg>cTg	p.P541L	PTGS1_ENST00000223423.4_Missense_Mutation_p.P504L|PTGS1_ENST00000373698.5_Missense_Mutation_p.P432L|PTGS1_ENST00000540753.1_Missense_Mutation_p.P479L	NM_000962.3|NM_001271164.1|NM_001271367.1|NM_080591.2	NP_000953.2|NP_001258093.1|NP_001258296.1|NP_542158.1	P23219	PGH1_HUMAN	prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)	541					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|prostaglandin biosynthetic process (GO:0001516)|regulation of blood pressure (GO:0008217)|regulation of cell proliferation (GO:0042127)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)	dioxygenase activity (GO:0051213)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)	p.P541L(1)		large_intestine(3)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	8					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bortezomib(DB00188)|Bromfenac(DB00963)|Candesartan(DB00796)|Carprofen(DB00821)|Carvedilol(DB01136)|Chlorpropamide(DB00672)|Dapsone(DB00250)|Desmopressin(DB00035)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Diphenhydramine(DB01075)|Dronabinol(DB00470)|Eletriptan(DB00216)|Eszopiclone(DB00402)|Etodolac(DB00749)|Etoposide(DB00773)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Hexobarbital(DB01355)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Icosapent(DB00159)|Ifosfamide(DB01181)|Imatinib(DB00619)|Indomethacin(DB00328)|Irbesartan(DB01029)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Minoxidil(DB00350)|Montelukast(DB00471)|Nabumetone(DB00461)|Naproxen(DB00788)|Nateglinide(DB00731)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nortriptyline(DB00540)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Rosiglitazone(DB00412)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfamethoxazole(DB01015)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Terbinafine(DB00857)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Torasemide(DB00214)|Trabectedin(DB05109)|Triflusal(DB08814)|Trisalicylate-choline(DB01401)|Valproic Acid(DB00313)|Voriconazole(DB00582)|Zafirlukast(DB00549)|Zileuton(DB00744)|Zolpidem(DB00425)|Zopiclone(DB01198)	ATCTGTTCTCCGGAGTACTGG	0.517																																					p.P541L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1622T	9						.						108.0	110.0	110.0					9																	125154645		2203	4300	6503	124194466	SO:0001583	missense	5742	exon11			M59979	CCDS6842.1, CCDS6843.1, CCDS59520.1, CCDS59521.1, CCDS75895.1	9q32-q33.3	2008-02-05			ENSG00000095303	ENSG00000095303	1.14.99.1		9604	protein-coding gene	gene with protein product		176805				2512924, 1907252	Standard	NM_000962		Approved	COX1, PGHS-1, PTGHS	uc004bmg.2	P23219	OTTHUMG00000020605	ENST00000362012.2:c.1622C>T	9.37:g.125154645C>T	ENSP00000354612:p.Pro541Leu	Somatic		Capture	Illumina HiSeq	Phase_I	124194466	NM_000962	A8K1V7|B4DHQ2|B4E2S5|Q15122|Q3HY28|Q3HY29|Q5T7T6|Q5T7T7|Q5T7T8	Missense_Mutation	SNP	ENST00000362012.2	37	CCDS6842.1	.	.	.	.	.	.	.	.	.	.	C	34	5.303898	0.95601	.	.	ENSG00000095303	ENST00000540753;ENST00000362012;ENST00000223423;ENST00000373698	T;T;T;T	0.09911	2.93;2.93;2.93;2.93	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.44074	0.1276	M	0.92026	3.265	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;0.999	T	0.55055	-0.8200	10	0.87932	D	0	-10.2139	18.2032	0.89846	0.0:1.0:0.0:0.0	.	479;541;504	B4DHQ2;P23219;P23219-2	.;PGH1_HUMAN;.	L	479;541;504;432	ENSP00000437709:P479L;ENSP00000354612:P541L;ENSP00000223423:P504L;ENSP00000362802:P432L	ENSP00000223423:P504L	P	+	2	0	PTGS1	124194466	1.000000	0.71417	0.992000	0.48379	0.991000	0.79684	7.814000	0.86154	2.539000	0.85634	0.655000	0.94253	CCG		PTGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053933.1		
RABGAP1	23637	broad.mit.edu	37	9	125751741	125751741	+	Silent	SNP	A	A	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr9:125751741A>T	ENST00000373647.4	+	5	890	c.756A>T	c.(754-756)atA>atT	p.I252I		NM_012197.3	NP_036329.3	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1	252	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				cell cycle (GO:0007049)|positive regulation of GTPase activity (GO:0043547)|regulation of GTP catabolic process (GO:0033124)	centrosome (GO:0005813)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)	DNA binding (GO:0003677)|GTPase activator activity (GO:0005096)|Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)|tubulin binding (GO:0015631)	p.I252I(1)|p.I180I(1)		breast(3)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|prostate(4)|stomach(3)|upper_aerodigestive_tract(1)	41						GGTGTGAAATACAAGAAGCTG	0.408																																					p.I252I												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A756T	9						.						62.0	60.0	60.0					9																	125751741		2203	4300	6503	124791562	SO:0001819	synonymous_variant	23637	exon5			AJ011679	CCDS6848.2	9q34.11	2013-07-09			ENSG00000011454	ENSG00000011454			17155	protein-coding gene	gene with protein product	"""rab6 GTPase activating protein (GAP and centrosome-associated)"", ""TBC1 domain family, member 11"""	615882				10202141	Standard	NM_012197		Approved	GAPCenA, TBC1D11	uc011lzh.2	Q9Y3P9	OTTHUMG00000020633	ENST00000373647.4:c.756A>T	9.37:g.125751741A>T		Somatic		Capture	Illumina HiSeq	Phase_I	124791562	NM_012197	B9A6L2|Q05CW2|Q6ZMY1|Q9HA28|Q9P0E2|Q9UG67	Silent	SNP	ENST00000373647.4	37	CCDS6848.2																																																																																				RABGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053976.3	NM_012197	
DENND1A	57706	broad.mit.edu	37	9	126202686	126202686	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr9:126202686G>A	ENST00000373624.2	-	19	1642	c.1441C>T	c.(1441-1443)Ccc>Tcc	p.P481S	DENND1A_ENST00000373620.3_Missense_Mutation_p.P481S|DENND1A_ENST00000542603.1_Missense_Mutation_p.P223S|DENND1A_ENST00000473039.1_5'UTR|DENND1A_ENST00000394219.3_Missense_Mutation_p.P449S|DENND1A_ENST00000373618.1_Missense_Mutation_p.P449S|DENND1A_ENST00000394215.2_Missense_Mutation_p.P451S	NM_020946.1	NP_065997.1	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A	481					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|regulation of Rab protein signal transduction (GO:0032483)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.P481S(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|liver(2)|lung(18)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43						CGGAGCTTGGGGTCCTTGGCC	0.552																																					p.P481S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1441T	9						.						59.0	51.0	54.0					9																	126202686		2203	4300	6503	125242507	SO:0001583	missense	57706	exon19			AB046828	CCDS35133.1, CCDS35134.1	9q34.11	2012-10-03	2005-08-17	2005-08-17	ENSG00000119522	ENSG00000119522		"""DENN/MADD domain containing"""	29324	protein-coding gene	gene with protein product		613633	"""KIAA1608"""	KIAA1608		10997877	Standard	XM_005252109		Approved	FLJ21129, FAM31A	uc004bnz.1	Q8TEH3	OTTHUMG00000020643	ENST00000373624.2:c.1441C>T	9.37:g.126202686G>A	ENSP00000362727:p.Pro481Ser	Somatic		Capture	Illumina HiSeq	Phase_I	125242507	NM_024820	A8MZA3|B1AM80|B7Z3C8|B7Z669|D3PFD3|Q05C88|Q5VWF0|Q6PJZ5|Q8IVD6|Q9H796	Missense_Mutation	SNP	ENST00000373624.2	37	CCDS35133.1	.	.	.	.	.	.	.	.	.	.	G	10.95	1.494914	0.26774	.	.	ENSG00000119522	ENST00000373624;ENST00000542603;ENST00000394219;ENST00000373620;ENST00000394215;ENST00000373618	T;T;T;T;T;T	0.20332	3.51;2.08;3.41;3.53;3.39;3.37	5.31	3.04	0.35103	.	0.763124	0.12802	N	0.437906	T	0.08846	0.0219	N	0.10837	0.055	0.30122	N	0.805566	B;B;B;B;B;B;B	0.21071	0.008;0.008;0.0;0.006;0.001;0.001;0.051	B;B;B;B;B;B;B	0.16722	0.006;0.006;0.002;0.007;0.003;0.002;0.016	T	0.32161	-0.9917	10	0.07030	T	0.85	-14.0218	6.4754	0.22033	0.082:0.1303:0.6542:0.1334	.	449;439;449;451;481;481;301	Q8TEH3-6;Q8TEH3-7;Q8TEH3-4;Q8TEH3-5;Q8TEH3-2;Q8TEH3;Q9HCG4	.;.;.;.;.;DEN1A_HUMAN;.	S	481;223;449;481;451;449	ENSP00000362727:P481S;ENSP00000437457:P223S;ENSP00000377766:P449S;ENSP00000362722:P481S;ENSP00000377763:P451S;ENSP00000362720:P449S	ENSP00000362720:P449S	P	-	1	0	DENND1A	125242507	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.710000	0.37920	1.189000	0.43028	0.655000	0.94253	CCC		DENND1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053997.1	NM_024820	
ELAVL2	1993	broad.mit.edu	37	9	23701471	23701471	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr9:23701471T>G	ENST00000397312.2	-	5	893	c.619A>C	c.(619-621)Agc>Cgc	p.S207R	ELAVL2_ENST00000380117.1_Missense_Mutation_p.S207R|ELAVL2_ENST00000544538.1_Missense_Mutation_p.S207R|ELAVL2_ENST00000380110.4_Missense_Mutation_p.S236R|ELAVL2_ENST00000223951.6_Missense_Mutation_p.S207R	NM_004432.3	NP_004423.2	Q12926	ELAV2_HUMAN	ELAV like neuron-specific RNA binding protein 2	207					regulation of transcription, DNA-templated (GO:0006355)		mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S207R(1)		breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(1;2.18e-156)|Lung(42;2.15e-28)|LUSC - Lung squamous cell carcinoma(38;1.02e-19)		GTTTTTTGGCTTGGGTTATTA	0.493																																					p.S207R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A619C	9						.						303.0	304.0	303.0					9																	23701471		2203	4300	6503	23691471	SO:0001583	missense	1993	exon5			BC030692	CCDS6515.1, CCDS55298.1	9p21	2013-10-03	2013-10-03		ENSG00000107105	ENSG00000107105		"""RNA binding motif (RRM) containing"""	3313	protein-coding gene	gene with protein product	"""Hu antigen B"""	601673	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)"""			8812435	Standard	NM_004432		Approved	HuB, HEL-N1	uc003zpu.3	Q12926	OTTHUMG00000019700	ENST00000397312.2:c.619A>C	9.37:g.23701471T>G	ENSP00000380479:p.Ser207Arg	Somatic		Capture	Illumina HiSeq	Phase_I	23691471	NM_001171197	D3DRK3|Q13235|Q59G15|Q8NEM4|Q9H1Q8	Missense_Mutation	SNP	ENST00000397312.2	37	CCDS6515.1	.	.	.	.	.	.	.	.	.	.	T	18.97	3.736129	0.69189	.	.	ENSG00000107105	ENST00000223951;ENST00000397312;ENST00000544538;ENST00000380110;ENST00000380117;ENST00000359598;ENST00000423281	T;T;T;T;T	0.35605	1.3;3.39;3.39;3.39;1.3	5.92	5.92	0.95590	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	T	0.42223	0.1193	M	0.72353	2.195	0.80722	D	1	B;P	0.34412	0.248;0.453	B;B	0.33620	0.015;0.167	T	0.42068	-0.9473	10	0.66056	D	0.02	.	16.3663	0.83325	0.0:0.0:0.0:1.0	.	207;207	Q12926;Q12926-2	ELAV2_HUMAN;.	R	207;207;207;207;207;235;72	ENSP00000223951:S207R;ENSP00000380479:S207R;ENSP00000440998:S207R;ENSP00000369460:S207R;ENSP00000391757:S72R	ENSP00000223951:S207R	S	-	1	0	ELAVL2	23691471	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.678000	0.84035	2.269000	0.75478	0.460000	0.39030	AGC		ELAVL2-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051943.2	NM_004432	
DAPK1	1612	broad.mit.edu	37	9	90262278	90262278	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr9:90262278T>A	ENST00000408954.3	+	14	1624	c.1289T>A	c.(1288-1290)tTt>tAt	p.F430Y	DAPK1_ENST00000472284.1_Missense_Mutation_p.F430Y|DAPK1_ENST00000491893.1_Missense_Mutation_p.F430Y|DAPK1_ENST00000358077.5_Missense_Mutation_p.F430Y|DAPK1_ENST00000469640.2_Missense_Mutation_p.F430Y	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	430					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.F430Y(2)		breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						ACCTTGAAATTTCTCAGTGAG	0.502									Chronic Lymphocytic Leukemia, Familial Clustering of																												p.F430Y												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T1289A	9						.						114.0	118.0	117.0					9																	90262278		2025	4179	6204	89452098	SO:0001583	missense	1612	exon14	Familial Cancer Database	Familial CLL	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.1289T>A	9.37:g.90262278T>A	ENSP00000386135:p.Phe430Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	89452098	NM_004938	B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Missense_Mutation	SNP	ENST00000408954.3	37	CCDS43842.1	.	.	.	.	.	.	.	.	.	.	T	14.39	2.522040	0.44866	.	.	ENSG00000196730	ENST00000358077;ENST00000472284;ENST00000469640;ENST00000408954;ENST00000491893	T;T;T;T;T	0.64260	-0.02;-0.02;-0.09;-0.02;-0.09	4.74	4.74	0.60224	Ankyrin repeat-containing domain (4);	0.000000	0.52532	D	0.000069	T	0.75199	0.3817	M	0.74881	2.28	0.80722	D	1	B;D;D	0.62365	0.059;0.991;0.981	B;D;D	0.74023	0.043;0.982;0.931	T	0.72286	-0.4338	10	0.11485	T	0.65	.	14.6995	0.69147	0.0:0.0:0.0:1.0	.	430;430;430	B7ZLE7;B7Z454;P53355	.;.;DAPK1_HUMAN	Y	430	ENSP00000350785:F430Y;ENSP00000417076:F430Y;ENSP00000418885:F430Y;ENSP00000386135:F430Y;ENSP00000419026:F430Y	ENSP00000350785:F430Y	F	+	2	0	DAPK1	89452098	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.885000	0.69736	2.125000	0.65367	0.533000	0.62120	TTT		DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356843.1	NM_004938	
SPATA31E1	286234	broad.mit.edu	37	9	90501795	90501795	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr9:90501795A>G	ENST00000325643.5	+	4	2459	c.2393A>G	c.(2392-2394)aAg>aGg	p.K798R		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	798					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.K798R(1)									GCTGTTCCCAAGTCTGACACC	0.592																																					p.K798R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2393G	9						.						80.0	85.0	83.0					9																	90501795		2203	4300	6503	89691615	SO:0001583	missense	286234	exon4			AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.2393A>G	9.37:g.90501795A>G	ENSP00000322640:p.Lys798Arg	Somatic		Capture	Illumina HiSeq	Phase_I	89691615	NM_178828	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	ENST00000325643.5	37	CCDS6676.1	.	.	.	.	.	.	.	.	.	.	a	8.515	0.867384	0.17250	.	.	ENSG00000177992	ENST00000325643;ENST00000539327	T	0.03982	3.74	2.43	0.031	0.14169	.	2.533380	0.01756	N	0.030228	T	0.06280	0.0162	L	0.34521	1.04	0.09310	N	1	P;P	0.49185	0.92;0.666	P;B	0.48030	0.564;0.362	T	0.31806	-0.9930	10	0.19590	T	0.45	.	4.3425	0.11117	0.6557:0.0:0.3443:0.0	.	798;450	Q6ZUB1;Q8NA33	CI079_HUMAN;.	R	798;450	ENSP00000322640:K798R	ENSP00000322640:K798R	K	+	2	0	C9orf79	89691615	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.033000	0.13754	-0.003000	0.14444	0.455000	0.32223	AAG		SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052954.2	NM_178828	
SETX	23064	broad.mit.edu	37	9	135202893	135202893	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chr9:135202893T>G	ENST00000224140.5	-	10	4274	c.4092A>C	c.(4090-4092)agA>agC	p.R1364S	SETX_ENST00000372169.2_Missense_Mutation_p.R1364S|SETX_ENST00000393220.1_Missense_Mutation_p.R1364S	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	1364					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.R1364S(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		AATCAGAAAGTCTTCGTCTAT	0.363																																					p.R1364S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4092C	9						.						102.0	102.0	102.0					9																	135202893		2203	4300	6503	134192714	SO:0001583	missense	23064	exon10			AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.4092A>C	9.37:g.135202893T>G	ENSP00000224140:p.Arg1364Ser	Somatic		Capture	Illumina HiSeq	Phase_I	134192714	NM_015046	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	ENST00000224140.5	37	CCDS6947.1	.	.	.	.	.	.	.	.	.	.	T	4.249	0.045246	0.08196	.	.	ENSG00000107290	ENST00000224140;ENST00000372169;ENST00000393220	D;D;D	0.86956	-2.09;-2.19;-1.81	5.63	-1.41	0.08941	.	2.192920	0.01617	N	0.022834	T	0.80949	0.4722	L	0.36672	1.1	0.09310	N	1	B;B;B	0.20368	0.034;0.044;0.034	B;B;B	0.24394	0.053;0.024;0.053	T	0.62358	-0.6871	10	0.15066	T	0.55	.	8.1432	0.31095	0.0:0.5044:0.1355:0.3602	.	1364;1364;1364	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	S	1364	ENSP00000224140:R1364S;ENSP00000361242:R1364S;ENSP00000376913:R1364S	ENSP00000224140:R1364S	R	-	3	2	SETX	134192714	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.045000	0.14013	-0.508000	0.06540	-0.417000	0.06048	AGA		SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3	NM_015046	
CNKSR2	22866	broad.mit.edu	37	X	21627703	21627703	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chrX:21627703G>T	ENST00000379510.3	+	20	2696	c.2660G>T	c.(2659-2661)gGg>gTg	p.G887V	CNKSR2_ENST00000543067.1_Missense_Mutation_p.G838V|CNKSR2_ENST00000279451.4_Missense_Mutation_p.G887V|CNKSR2_ENST00000425654.2_Missense_Mutation_p.G857V	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	887	Poly-Glu.				regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)		p.G887V(1)		breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						gaggaggaaggggaggCAGCA	0.488																																					p.G838V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2513T	X						.						31.0	23.0	26.0					X																	21627703		2199	4292	6491	21537624	SO:0001583	missense	22866	exon19			AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.2660G>T	X.37:g.21627703G>T	ENSP00000368824:p.Gly887Val	Somatic		Capture	Illumina HiSeq	Phase_I	21537624	NM_001168649	B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Missense_Mutation	SNP	ENST00000379510.3	37	CCDS14198.1	.	.	.	.	.	.	.	.	.	.	G	7.202	0.593591	0.13875	.	.	ENSG00000149970	ENST00000425654;ENST00000543067;ENST00000279451;ENST00000379510	T;T;T;T	0.19938	2.47;2.11;2.14;2.5	5.38	3.56	0.40772	.	0.301293	0.33235	N	0.005127	T	0.12433	0.0302	L	0.29908	0.895	0.39018	D	0.959683	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.12708	-1.0537	10	0.32370	T	0.25	.	3.9224	0.09250	0.2424:0.0:0.4682:0.2894	.	857;838;479;887	B7ZLJ1;B4DGR4;B3KPN2;Q8WXI2	.;.;.;CNKR2_HUMAN	V	857;838;887;887	ENSP00000397906:G857V;ENSP00000444633:G838V;ENSP00000279451:G887V;ENSP00000368824:G887V	ENSP00000279451:G887V	G	+	2	0	CNKSR2	21537624	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.862000	0.39448	1.120000	0.41904	0.513000	0.50165	GGG		CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056019.1	NM_014927	
RBM10	8241	broad.mit.edu	37	X	47028790	47028790	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chrX:47028790C>T	ENST00000377604.3	+	3	836	c.94C>T	c.(94-96)Cga>Tga	p.R32*	RBM10_ENST00000345781.6_Nonsense_Mutation_p.R32*|RBM10_ENST00000329236.7_Nonsense_Mutation_p.R32*	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	32					3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)	p.R32*(2)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						GAACCGCAGCCGAGACCACGA	0.592																																					p.R32X	Melanoma(171;120 2705 19495 39241)											.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C94T	X						.						98.0	67.0	78.0					X																	47028790		2203	4300	6503	46913734	SO:0001587	stop_gained	8241	exon3			U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.94C>T	X.37:g.47028790C>T	ENSP00000366829:p.Arg32*	Somatic		Capture	Illumina HiSeq	Phase_I	46913734	NM_005676	C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Nonsense_Mutation	SNP	ENST00000377604.3	37	CCDS14274.1	.	.	.	.	.	.	.	.	.	.	C	39	7.573321	0.98368	.	.	ENSG00000182872	ENST00000377604;ENST00000329236;ENST00000345781	.	.	.	4.62	2.79	0.32731	.	0.000000	0.41938	D	0.000797	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.8986	9.4105	0.38489	0.3851:0.6149:0.0:0.0	.	.	.	.	X	32	.	ENSP00000328848:R32X	R	+	1	2	RBM10	46913734	1.000000	0.71417	0.983000	0.44433	0.991000	0.79684	1.426000	0.34870	0.324000	0.23333	0.436000	0.28706	CGA		RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	NM_005676	
PABPC5	140886	broad.mit.edu	37	X	90690912	90690912	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3902-01A-01W-1073-09	TCGA-AG-3902-10A-01W-1073-09	g.chrX:90690912C>A	ENST00000312600.3	+	2	550	c.336C>A	c.(334-336)aaC>aaA	p.N112K	PABPC5-AS1_ENST00000456187.1_RNA|PABPC5_ENST00000373105.1_Intron	NM_080832.2	NP_543022.1	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	112	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.					mitochondrion (GO:0005739)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.N112K(1)		central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(1)|pancreas(1)	42						TCATCAAAAACCTGGACAAAT	0.408																																					p.N112K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C336A	X						.						73.0	68.0	70.0					X																	90690912		2203	4300	6503	90577568	SO:0001583	missense	140886	exon2			AJ278963	CCDS14460.1	Xq21.3	2013-02-12	2001-11-28		ENSG00000174740	ENSG00000174740		"""RNA binding motif (RRM) containing"""	13629	protein-coding gene	gene with protein product		300407	"""poly(A)-binding protein, cytoplasmic 5"""			11374897	Standard	NM_080832		Approved	PABP5	uc004efg.3	Q96DU9	OTTHUMG00000021959	ENST00000312600.3:c.336C>A	X.37:g.90690912C>A	ENSP00000308012:p.Asn112Lys	Somatic		Capture	Illumina HiSeq	Phase_I	90577568	NM_080832	A8K240|Q5JQF4|Q6P529|Q9UFE5	Missense_Mutation	SNP	ENST00000312600.3	37	CCDS14460.1	.	.	.	.	.	.	.	.	.	.	C	12.82	2.052021	0.36181	.	.	ENSG00000174740	ENST00000312600;ENST00000402906	T	0.27720	1.65	4.43	1.74	0.24563	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.043066	0.85682	D	0.000000	T	0.32071	0.0817	M	0.78916	2.43	0.45502	D	0.998463	P	0.35575	0.51	B	0.35353	0.201	T	0.11842	-1.0571	10	0.87932	D	0	.	7.7233	0.28744	0.0:0.702:0.0:0.298	.	112	Q96DU9	PABP5_HUMAN	K	112;80	ENSP00000308012:N112K	ENSP00000308012:N112K	N	+	3	2	PABPC5	90577568	0.965000	0.33210	0.999000	0.59377	0.954000	0.61252	0.169000	0.16641	0.239000	0.21243	-0.208000	0.12717	AAC		PABPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057429.1	NM_080832	
