#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
METTL10	399818	broad.mit.edu	37	10	126453968	126453968	+	Silent	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr10:126453968G>A	ENST00000368836.2	-	5	645	c.609C>T	c.(607-609)ttC>ttT	p.F203F	Y_RNA_ENST00000362596.1_RNA|RP11-12J10.3_ENST00000494792.1_Missense_Mutation_p.S168L	NM_212554.2	NP_997719.2	Q5JPI9	MET10_HUMAN	methyltransferase like 10	203							methyltransferase activity (GO:0008168)	p.F203F(1)		endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(1)	5		all_lung(145;0.0186)|Lung NSC(174;0.0295)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.101)|COAD - Colon adenocarcinoma(40;0.111)		TACCTTCACTGAATTCATTTA	0.358																																					p.F203F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C609T	10						.						156.0	151.0	152.0					10																	126453968		2203	4300	6503	126443958	SO:0001819	synonymous_variant	399818	exon5				CCDS31307.1	10q26.13	2010-01-15			ENSG00000203791	ENSG00000203791			33787	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 138"""	C10orf138			Standard	NM_212554		Approved	Em:AC068896.3	uc001lhy.1	Q5JPI9	OTTHUMG00000019217	ENST00000368836.2:c.609C>T	10.37:g.126453968G>A		Somatic		Capture	Illumina HiSeq	Phase_I	126443958	NM_212554	A8MPY7	Silent	SNP	ENST00000368836.2	37	CCDS31307.1																																																																																				METTL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050884.1	NM_212554	
C11orf87	399947	broad.mit.edu	37	11	109294680	109294680	+	Silent	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr11:109294680C>T	ENST00000327419.6	+	2	724	c.321C>T	c.(319-321)agC>agT	p.S107S	RP11-708B6.2_ENST00000532992.1_RNA|RP11-708B6.2_ENST00000532929.1_RNA	NM_207645.3	NP_997528.2	Q6NUJ2	CK087_HUMAN	chromosome 11 open reading frame 87	107						integral component of membrane (GO:0016021)		p.S107S(1)		breast(2)|endometrium(1)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	17						ATCACTGCAGCGGCAGCCGCG	0.642																																					p.S107S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C321T	11						.						80.0	83.0	82.0					11																	109294680		2201	4298	6499	108799890	SO:0001819	synonymous_variant	399947	exon2			AB096240, BC035798	CCDS31672.1	11q22.3	2013-12-13	2013-12-13	2013-12-13	ENSG00000185742	ENSG00000185742			33788	protein-coding gene	gene with protein product	"""neuronal integral membrane protein 1"""					12477932	Standard	NM_207645		Approved	LOH11CR1A, LOC399947, NEURIM1	uc010rwb.2	Q6NUJ2		ENST00000327419.6:c.321C>T	11.37:g.109294680C>T		Somatic		Capture	Illumina HiSeq	Phase_I	108799890	NM_207645	B4E169	Silent	SNP	ENST00000327419.6	37	CCDS31672.1																																																																																				C11orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390403.1	NM_207645	
ATHL1	80162	broad.mit.edu	37	11	294589	294589	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr11:294589G>A	ENST00000409548.2	+	14	2169	c.2054G>A	c.(2053-2055)cGg>cAg	p.R685Q	ATHL1_ENST00000409479.1_Missense_Mutation_p.R712Q|ATHL1_ENST00000409655.1_Missense_Mutation_p.R437Q	NM_025092.4	NP_079368.3	Q32M88	ATHL1_HUMAN	ATH1, acid trehalase-like 1 (yeast)	685					carbohydrate metabolic process (GO:0005975)		hydrolase activity, acting on glycosyl bonds (GO:0016798)	p.R508Q(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(7)|prostate(1)|skin(3)	17		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;5.38e-28)|Epithelial(43;3.25e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		TCGGCTGGCCGGATACAAATG	0.647																																					p.R685Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2054A	11						.						90.0	103.0	99.0					11																	294589		2203	4300	6503	284589	SO:0001583	missense	80162	exon14			AK090428	CCDS31322.2	11p15.5	2005-10-27			ENSG00000142102	ENSG00000142102			26210	protein-coding gene	gene with protein product							Standard	NM_025092		Approved	FLJ22635	uc010qvu.2	Q32M88	OTTHUMG00000153218	ENST00000409548.2:c.2054G>A	11.37:g.294589G>A	ENSP00000387185:p.Arg685Gln	Somatic		Capture	Illumina HiSeq	Phase_I	284589	NM_025092	Q658X8|Q8TEG9|Q9H635	Missense_Mutation	SNP	ENST00000409548.2	37	CCDS31322.2	.	.	.	.	.	.	.	.	.	.	G	3.024	-0.201146	0.06219	.	.	ENSG00000142102	ENST00000409548;ENST00000409655;ENST00000409479	.	.	.	3.54	1.56	0.23342	.	0.636795	0.14851	N	0.294685	T	0.15998	0.0385	N	0.05230	-0.09	0.24200	N	0.995515	B;B	0.18166	0.026;0.004	B;B	0.08055	0.002;0.003	T	0.28364	-1.0046	9	0.14656	T	0.56	.	10.0895	0.42439	0.1957:0.0:0.8043:0.0	.	685;437	Q32M88;B8ZZ60	ATHL1_HUMAN;.	Q	685;437;712	.	ENSP00000387099:R712Q	R	+	2	0	ATHL1	284589	0.970000	0.33590	0.949000	0.38748	0.057000	0.15508	1.866000	0.39489	0.005000	0.14708	-1.598000	0.00824	CGG		ATHL1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330164.3	NM_025092	
CREB3L1	90993	broad.mit.edu	37	11	46321515	46321515	+	Silent	SNP	G	G	A	rs181804070		TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr11:46321515G>A	ENST00000529193.1	+	2	583	c.132G>A	c.(130-132)acG>acA	p.T44T	CREB3L1_ENST00000288400.3_Silent_p.T44T			Q96BA8	CR3L1_HUMAN	cAMP responsive element binding protein 3-like 1	44	Required for transcriptional activation.				regulation of bone mineralization (GO:0030500)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)	p.T44T(1)	FUS/CREB3L1(6)	NS(2)|breast(1)|large_intestine(4)|lung(2)|ovary(3)	12				GBM - Glioblastoma multiforme(35;0.0285)		ACCACTTTACGGAGAACATGG	0.532			T	FUS	myxofibrosarcoma								G|||	1	0.000199681	0.0	0.0014	5008	,	,		23893	0.0		0.0	False		,,,				2504	0.0				p.T44T	Pancreas(3;159 194 19597 26278 47995)		Dom	yes		11	11p11.2	90993	cAMP responsive element binding protein 3-like 1		M	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G132A	11						.						107.0	103.0	105.0					11																	46321515		2043	4195	6238	46278091	SO:0001819	synonymous_variant	90993	exon2				CCDS53620.1	11q11	2013-01-10				ENSG00000157613		"""basic leucine zipper proteins"""	18856	protein-coding gene	gene with protein product	"""BBF-2 homolog (drosophila)"""						Standard	NM_052854		Approved	OASIS	uc021qil.1	Q96BA8		ENST00000529193.1:c.132G>A	11.37:g.46321515G>A		Somatic		Capture	Illumina HiSeq	Phase_I	46278091	NM_052854	Q8N2D5|Q96CP0	Silent	SNP	ENST00000529193.1	37	CCDS53620.1																																																																																				CREB3L1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389702.1	NM_052854	
OR5D18	219438	broad.mit.edu	37	11	55587548	55587548	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr11:55587548G>T	ENST00000333976.4	+	1	463	c.443G>T	c.(442-444)gGa>gTa	p.G148V		NM_001001952.1	NP_001001952.1	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D, member 18	148						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G148V(1)		NS(2)|breast(1)|endometrium(3)|large_intestine(6)|lung(33)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		all_epithelial(135;0.208)				CTGGTTGTGGGATCCTATGCC	0.468																																					p.G148V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G443T	11						.						194.0	182.0	186.0					11																	55587548		2200	4296	6496	55344124	SO:0001583	missense	219438	exon1			AB065781	CCDS31510.1	11q11	2012-08-09			ENSG00000186119	ENSG00000186119		"""GPCR / Class A : Olfactory receptors"""	15285	protein-coding gene	gene with protein product							Standard	NM_001001952		Approved		uc010rin.2	Q8NGL1	OTTHUMG00000166811	ENST00000333976.4:c.443G>T	11.37:g.55587548G>T	ENSP00000335025:p.Gly148Val	Somatic		Capture	Illumina HiSeq	Phase_I	55344124	NM_001001952	Q6IF67|Q6IFD3|Q96RB3	Missense_Mutation	SNP	ENST00000333976.4	37	CCDS31510.1	.	.	.	.	.	.	.	.	.	.	.	3.822	-0.037460	0.07497	.	.	ENSG00000186119	ENST00000333976	T	0.36520	1.25	4.66	0.263	0.15602	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38663	N	0.001619	T	0.26702	0.0653	L	0.48174	1.505	0.19945	N	0.999948	B	0.22003	0.063	B	0.30716	0.119	T	0.18241	-1.0343	10	0.40728	T	0.16	-2.2592	3.0288	0.06099	0.1583:0.3757:0.3341:0.1319	.	148	Q8NGL1	OR5DI_HUMAN	V	148	ENSP00000335025:G148V	ENSP00000335025:G148V	G	+	2	0	OR5D18	55344124	0.000000	0.05858	0.001000	0.08648	0.028000	0.11728	0.021000	0.13489	-0.107000	0.12088	0.567000	0.79289	GGA		OR5D18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391515.1	NM_001001952	
AMOTL1	154810	broad.mit.edu	37	11	94592772	94592772	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr11:94592772G>A	ENST00000433060.2	+	9	2168	c.2027G>A	c.(2026-2028)cGg>cAg	p.R676Q	AMOTL1_ENST00000317837.9_Intron|AMOTL1_ENST00000317829.8_Missense_Mutation_p.R626Q	NM_130847.2	NP_570899.1	Q8IY63	AMOL1_HUMAN	angiomotin like 1	676					establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|hippo signaling (GO:0035329)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|tight junction (GO:0005923)	identical protein binding (GO:0042802)	p.R677Q(2)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	36		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				AAGGAGGAGCGGATCCTGGCC	0.562																																					p.R676Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2027A	11						.						45.0	49.0	48.0					11																	94592772		2201	4298	6499	94232420	SO:0001583	missense	154810	exon9			AF453742	CCDS44712.1, CCDS73368.1	11q21	2008-07-18				ENSG00000166025			17811	protein-coding gene	gene with protein product	"""junction-enriched and associated protein"""	614657				11733531	Standard	XM_005273798		Approved	JEAP	uc001pfb.3	Q8IY63		ENST00000433060.2:c.2027G>A	11.37:g.94592772G>A	ENSP00000387739:p.Arg676Gln	Somatic		Capture	Illumina HiSeq	Phase_I	94232420	NM_130847	Q63HK7|Q8NDN0|Q8TEN8|Q8WXD1|Q96CM5	Missense_Mutation	SNP	ENST00000433060.2	37	CCDS44712.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.326103	0.81580	.	.	ENSG00000166025	ENST00000317829;ENST00000433060	T;T	0.19532	2.15;2.14	6.08	6.08	0.98989	Angiomotin, C-terminal (1);	0.113923	0.42821	D	0.000645	T	0.24392	0.0591	L	0.43152	1.355	0.80722	D	1	P;P	0.44734	0.842;0.659	P;B	0.46049	0.502;0.319	T	0.01033	-1.1474	10	0.15952	T	0.53	-39.5486	16.0688	0.80909	0.0:0.1332:0.8668:0.0	.	626;676	Q8IY63-2;Q8IY63	.;AMOL1_HUMAN	Q	626;676	ENSP00000320968:R626Q;ENSP00000387739:R676Q	ENSP00000320968:R626Q	R	+	2	0	AMOTL1	94232420	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	6.414000	0.73318	2.894000	0.99253	0.655000	0.94253	CGG		AMOTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396474.3	NM_130847	
OR10G4	390264	broad.mit.edu	37	11	123886963	123886963	+	Missense_Mutation	SNP	C	C	T	rs191928020		TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr11:123886963C>T	ENST00000320891.4	+	1	682	c.682C>T	c.(682-684)Cgc>Tgc	p.R228C		NM_001004462.1	NP_001004462.1	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G, member 4	228						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R228C(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)|skin(4)|stomach(6)|upper_aerodigestive_tract(1)	48		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		CCTGCGGATCCGCACCTCAGA	0.527													c|||	1	0.000199681	0.0	0.0	5008	,	,		21452	0.0		0.001	False		,,,				2504	0.0				p.R228C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C682T	11						.						186.0	152.0	164.0					11																	123886963		2201	4299	6500	123392173	SO:0001583	missense	390264	exon1			AB065757	CCDS31702.1	11q24.1	2012-08-09			ENSG00000254737	ENSG00000254737		"""GPCR / Class A : Olfactory receptors"""	14809	protein-coding gene	gene with protein product							Standard	NM_001004462		Approved		uc010sac.2	Q8NGN3	OTTHUMG00000165966	ENST00000320891.4:c.682C>T	11.37:g.123886963C>T	ENSP00000325076:p.Arg228Cys	Somatic		Capture	Illumina HiSeq	Phase_I	123392173	NM_001004462	Q6IEW0	Missense_Mutation	SNP	ENST00000320891.4	37	CCDS31702.1	3	0.0013736263736263737	0	0.0	2	0.0055248618784530384	0	0.0	1	0.0013192612137203166	c	6.344	0.431547	0.12045	.	.	ENSG00000254737	ENST00000320891	T	0.40225	1.04	3.33	3.33	0.38152	GPCR, rhodopsin-like superfamily (1);	0.420315	0.20410	N	0.092861	T	0.33731	0.0873	M	0.74546	2.27	0.21553	N	0.999647	B	0.17465	0.022	B	0.21360	0.034	T	0.39292	-0.9621	10	0.62326	D	0.03	.	8.8892	0.35423	0.0:0.8919:0.0:0.1081	.	228	Q8NGN3	O10G4_HUMAN	C	228	ENSP00000325076:R228C	ENSP00000325076:R228C	R	+	1	0	OR10G4	123392173	0.000000	0.05858	0.604000	0.28916	0.295000	0.27426	-0.074000	0.11450	1.878000	0.54408	0.580000	0.79431	CGC		OR10G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387268.1	NM_001004462	
NELL2	4753	broad.mit.edu	37	12	45269124	45269124	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr12:45269124C>A	ENST00000429094.2	-	2	572	c.68G>T	c.(67-69)gGt>gTt	p.G23V	NELL2_ENST00000549027.1_Missense_Mutation_p.G22V|NELL2_ENST00000551601.1_Missense_Mutation_p.G22V|NELL2_ENST00000452445.2_Missense_Mutation_p.G23V|NELL2_ENST00000333837.4_Missense_Mutation_p.G46V|NELL2_ENST00000395487.2_Missense_Mutation_p.G22V|NELL2_ENST00000437801.2_Missense_Mutation_p.G73V|NELL2_ENST00000548826.1_Missense_Mutation_p.G23V	NM_001145108.1	NP_001138580.1	Q99435	NELL2_HUMAN	NEL-like 2 (chicken)	23						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.G73V(1)|p.G23V(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(16)|lung(30)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	65	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		AGGGTCCACACCAAGCCCCCA	0.537																																					p.G23V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G68T	12						.						47.0	46.0	46.0					12																	45269124		2203	4300	6503	43555391	SO:0001583	missense	4753	exon2			D83018	CCDS8746.1, CCDS44863.1, CCDS44864.1, CCDS53781.1	12q12	2012-01-30	2001-11-28		ENSG00000184613	ENSG00000184613			7751	protein-coding gene	gene with protein product		602320	"""nel (chicken)-like 2"""			19249368	Standard	NM_006159		Approved	NRP2	uc010skz.1	Q99435	OTTHUMG00000169464	ENST00000429094.2:c.68G>T	12.37:g.45269124C>A	ENSP00000390680:p.Gly23Val	Somatic		Capture	Illumina HiSeq	Phase_I	43555391	NM_001145108	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	ENST00000429094.2	37	CCDS8746.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.381114	0.82792	.	.	ENSG00000184613	ENST00000395487;ENST00000429094;ENST00000551601;ENST00000452445;ENST00000549027;ENST00000333837;ENST00000437801;ENST00000543684;ENST00000552993;ENST00000553120;ENST00000548826;ENST00000548531	D;D;T;D;D;D;D;T;T;T;T	0.82893	-1.55;-1.55;-1.24;-1.55;-1.55;-1.54;-1.66;2.52;-0.14;0.17;-0.42	4.74	4.74	0.60224	.	0.000000	0.64402	D	0.000001	D	0.90086	0.6903	M	0.67397	2.05	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.994;1.0;1.0;0.994;0.999;1.0	D	0.91329	0.5088	10	0.87932	D	0	-16.0105	16.8676	0.86033	0.0:1.0:0.0:0.0	.	46;73;22;23;23;22	B7Z2U7;B7Z9U3;F8VVB6;B3KTI3;Q99435;Q96JS2	.;.;.;.;NELL2_HUMAN;.	V	22;23;22;23;22;46;73;22;23;20;23;22	ENSP00000378866:G22V;ENSP00000390680:G23V;ENSP00000449332:G22V;ENSP00000394612:G23V;ENSP00000447927:G22V;ENSP00000327988:G46V;ENSP00000416341:G73V;ENSP00000447085:G23V;ENSP00000447384:G20V;ENSP00000448635:G23V;ENSP00000449068:G22V	ENSP00000327988:G46V	G	-	2	0	NELL2	43555391	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.102000	0.64572	2.337000	0.79520	0.563000	0.77884	GGT		NELL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404180.1	NM_006159	
CLEC4C	170482	broad.mit.edu	37	12	7894041	7894041	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr12:7894041C>T	ENST00000542353.1	-	4	701	c.211G>A	c.(211-213)Gtc>Atc	p.V71I	CLEC4C_ENST00000540085.1_Missense_Mutation_p.V40I|CLEC4C_ENST00000360345.3_Missense_Mutation_p.V71I|CLEC4C_ENST00000354629.5_Missense_Mutation_p.V40I	NM_130441.2	NP_569708.1	Q8WTT0	CLC4C_HUMAN	C-type lectin domain family 4, member C	71					innate immune response (GO:0045087)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.V71I(2)		autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				Kidney(36;0.0915)		CCTTCCATGACGCAGGTCAGG	0.418																																					p.V40I												.	.	2	Substitution - Missense(2)	large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	c.G118A	12						.						193.0	164.0	174.0					12																	7894041		2203	4300	6503	7785308	SO:0001583	missense	170482	exon3			AF325460	CCDS8583.1, CCDS8584.1	12p13.2-p12.3	2008-02-05	2004-02-13	2005-02-11	ENSG00000198178	ENSG00000198178		"""C-type lectin domain containing"", ""CD molecules"""	13258	protein-coding gene	gene with protein product		606677	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 7"""	CLECSF11, CLECSF7		11031109, 11536172	Standard	NM_130441		Approved	HECL, DLEC, BDCA2, CD303	uc001qth.1	Q8WTT0	OTTHUMG00000168441	ENST00000542353.1:c.211G>A	12.37:g.7894041C>T	ENSP00000440428:p.Val71Ile	Somatic		Capture	Illumina HiSeq	Phase_I	7785308	NM_203503	D3DUU3|Q3T1C3|Q6UXS8|Q8WXX8	Missense_Mutation	SNP	ENST00000542353.1	37	CCDS8583.1	.	.	.	.	.	.	.	.	.	.	C	2.509	-0.313476	0.05422	.	.	ENSG00000198178	ENST00000542353;ENST00000354629;ENST00000540085;ENST00000360345	T;T;T;T	0.16743	2.32;2.32;2.32;2.32	1.79	-3.59	0.04583	.	.	.	.	.	T	0.04092	0.0114	N	0.04335	-0.225	0.09310	N	1	P;B	0.45126	0.851;0.342	B;B	0.30179	0.112;0.026	T	0.36696	-0.9737	9	0.22109	T	0.4	.	4.0105	0.09621	0.5588:0.2914:0.0:0.1498	.	40;71	Q8WTT0-2;Q8WTT0	.;CLC4C_HUMAN	I	71;40;40;71	ENSP00000440428:V71I;ENSP00000346648:V40I;ENSP00000445338:V40I;ENSP00000353500:V71I	ENSP00000346648:V40I	V	-	1	0	CLEC4C	7785308	0.000000	0.05858	0.000000	0.03702	0.238000	0.25445	-0.993000	0.03720	-1.359000	0.02174	0.514000	0.50259	GTC		CLEC4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399750.1	NM_203503	
ARID2	196528	broad.mit.edu	37	12	46233130	46233130	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr12:46233130delT	ENST00000334344.6	+	11	1521	c.1349delT	c.(1348-1350)gttfs	p.V450fs	ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000444670.1_Intron|ARID2_ENST00000422737.1_Frame_Shift_Del_p.V301fs	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	450					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S451fs*12(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		GTGTGTCTGGTTTCTATGGAT	0.348			"""N, S, F"""		hepatocellular carcinoma																																p.V450fs			Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1349delT	12						.						100.0	94.0	96.0					12																	46233130		2203	4300	6503	44519397	SO:0001589	frameshift_variant	196528	exon11				CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.1349delT	12.37:g.46233130delT	ENSP00000335044:p.Val450fs	Somatic		Capture	Illumina HiSeq	Phase_I	44519397	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Frame_Shift_Del	DEL	ENST00000334344.6	37	CCDS31783.1																																																																																				ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
CACNB3	784	broad.mit.edu	37	12	49220218	49220218	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr12:49220218G>A	ENST00000301050.2	+	10	1010	c.811G>A	c.(811-813)Gct>Act	p.A271T	CACNB3_ENST00000540990.1_Missense_Mutation_p.A258T|CACNB3_ENST00000547392.1_Missense_Mutation_p.A244T|CACNB3_ENST00000536187.2_Missense_Mutation_p.A270T|CACNB3_ENST00000547230.1_Missense_Mutation_p.A230T	NM_000725.3	NP_000716.2	P54284	CACB3_HUMAN	calcium channel, voltage-dependent, beta 3 subunit	271					axon guidance (GO:0007411)|calcium ion transport (GO:0006816)|membrane depolarization (GO:0051899)|synaptic transmission (GO:0007268)|T cell receptor signaling pathway (GO:0050852)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|membrane (GO:0016020)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.A271T(1)		autonomic_ganglia(1)|breast(1)|large_intestine(5)|lung(4)|prostate(1)	12					Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	AGTGTTGGACGCTGACACCAT	0.567																																					p.A271T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G811A	12						.						98.0	82.0	88.0					12																	49220218		2203	4300	6503	47506485	SO:0001583	missense	784	exon10				CCDS8769.1, CCDS55821.1, CCDS55822.1, CCDS55823.1	12q13	2008-05-02				ENSG00000167535		"""Calcium channel subunits"""	1403	protein-coding gene	gene with protein product		601958		CACNLB3		8119293	Standard	NM_000725		Approved		uc010sly.2	P54284		ENST00000301050.2:c.811G>A	12.37:g.49220218G>A	ENSP00000301050:p.Ala271Thr	Somatic		Capture	Illumina HiSeq	Phase_I	47506485	NM_000725	A8K0Z4|B7Z4Q1|B7Z973|B7ZAK8|F5GZW7|F5H2P6|F8VSG3|Q13913	Missense_Mutation	SNP	ENST00000301050.2	37	CCDS8769.1	.	.	.	.	.	.	.	.	.	.	G	36	5.754271	0.96890	.	.	ENSG00000167535	ENST00000540990;ENST00000536187;ENST00000547818;ENST00000547392;ENST00000301050;ENST00000547230	T;T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93;0.93	5.86	5.86	0.93980	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (1);	0.000000	0.85682	D	0.000000	T	0.66877	0.2834	M	0.74881	2.28	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.81914	0.995;0.966;0.952;0.98	T	0.68164	-0.5481	10	0.72032	D	0.01	-11.7483	18.9438	0.92613	0.0:0.0:1.0:0.0	.	270;258;271;258	F5GZW7;F5H2P6;P54284;B7Z973	.;.;CACB3_HUMAN;.	T	258;270;95;244;271;230	ENSP00000445495:A258T;ENSP00000444160:A270T;ENSP00000448137:A95T;ENSP00000446529:A244T;ENSP00000301050:A271T;ENSP00000448304:A230T	ENSP00000301050:A271T	A	+	1	0	CACNB3	47506485	1.000000	0.71417	0.996000	0.52242	0.958000	0.62258	9.813000	0.99286	2.768000	0.95171	0.655000	0.94253	GCT		CACNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408886.1		
CRYL1	51084	broad.mit.edu	37	13	20978863	20978863	+	Missense_Mutation	SNP	C	C	T	rs145530540		TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr13:20978863C>T	ENST00000298248.7	-	7	819	c.757G>A	c.(757-759)Gac>Aac	p.D253N	CRYL1_ENST00000382812.1_Missense_Mutation_p.D231N	NM_015974.2	NP_057058.2	Q9Y2S2	CRYL1_HUMAN	crystallin, lambda 1	253					fatty acid metabolic process (GO:0006631)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|L-gulonate 3-dehydrogenase activity (GO:0050104)|NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)	p.D253N(1)		NS(1)|kidney(1)|large_intestine(5)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(29;2.27e-23)|all_epithelial(30;1.69e-19)|all_lung(29;8.29e-18)|Lung SC(185;0.0262)|Ovarian(182;0.0827)|Hepatocellular(188;0.244)		all cancers(112;6.6e-05)|Epithelial(112;0.00178)|OV - Ovarian serous cystadenocarcinoma(117;0.0169)|Lung(94;0.0215)|GBM - Glioblastoma multiforme(144;0.0402)|LUSC - Lung squamous cell carcinoma(192;0.061)		CTGTATCTGTCGCAGTAGCTT	0.393													C|||	0	0.0	0.0	0.0	5008	,	,		23800	0.0		0.0	False		,,,				2504	0.0				p.D253N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G757A	13						.	C	ASN/ASP	7,3725		0,7,1859	165.0	166.0	166.0		757	4.7	1.0	13	dbSNP_134	166	0,8224		0,0,4112	yes	missense	CRYL1	NM_015974.2	23	0,7,5971	TT,TC,CC		0.0,0.1876,0.0585	benign	253/320	20978863	7,11949	1866	4112	5978	19876863	SO:0001583	missense	51084	exon7			AF077049	CCDS41871.1	13q11	2008-07-18			ENSG00000165475	ENSG00000165475			18246	protein-coding gene	gene with protein product	"""crystallin, lamda 1"", ""L-gulonate 3-dehydrogenase"", ""lambda-crystallin homolog"""	609877				12527201	Standard	NM_015974		Approved	GDH, lambda-CRY, MGC149525, MGC149526	uc001une.3	Q9Y2S2	OTTHUMG00000016516	ENST00000298248.7:c.757G>A	13.37:g.20978863C>T	ENSP00000298248:p.Asp253Asn	Somatic		Capture	Illumina HiSeq	Phase_I	19876863	NM_015974	A0PJ43|B3KN92|Q0VDI1|Q7Z4Z9|Q9P0G7	Missense_Mutation	SNP	ENST00000298248.7	37	CCDS41871.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	C	7.146	0.582776	0.13749	0.001876	0.0	ENSG00000165475	ENST00000298248;ENST00000382812	D;D	0.89415	-2.51;-2.51	5.56	4.71	0.59529	3-hydroxyacyl-CoA dehydrogenase, C-terminal (1);6-phosphogluconate dehydrogenase, C-terminal-like (1);	0.228632	0.52532	N	0.000074	D	0.84754	0.5542	L	0.46670	1.46	0.36249	D	0.853765	B	0.14438	0.01	B	0.15484	0.013	T	0.82796	-0.0280	10	0.30854	T	0.27	-40.9827	13.0913	0.59167	0.0:0.9216:0.0:0.0784	.	253	Q9Y2S2	CRYL1_HUMAN	N	253;231	ENSP00000298248:D253N;ENSP00000372262:D231N	ENSP00000298248:D253N	D	-	1	0	CRYL1	19876863	1.000000	0.71417	0.999000	0.59377	0.126000	0.20510	2.122000	0.41987	1.346000	0.45694	0.563000	0.77884	GAC		CRYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044071.1	NM_015974	
SACS	26278	broad.mit.edu	37	13	23912013	23912013	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr13:23912013C>A	ENST00000382292.3	-	9	6275	c.6002G>T	c.(6001-6003)aGa>aTa	p.R2001I	SACS_ENST00000402364.1_Missense_Mutation_p.R1251I|SACS_ENST00000382298.3_Missense_Mutation_p.R2001I			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	2001					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)	p.R1854I(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		AACATCTCTTCTTTTAAGTAT	0.388																																					p.R2001I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6002T	13						.						41.0	42.0	42.0					13																	23912013		2202	4298	6500	22810013	SO:0001583	missense	26278	exon10			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.6002G>T	13.37:g.23912013C>A	ENSP00000371729:p.Arg2001Ile	Somatic		Capture	Illumina HiSeq	Phase_I	22810013	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	C	22.9	4.344397	0.82022	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.87491	-2.12;-2.26;-2.12	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	D	0.90417	0.7000	L	0.51422	1.61	0.80722	D	1	D	0.67145	0.996	P	0.56612	0.802	D	0.90018	0.4126	10	0.52906	T	0.07	.	20.0368	0.97565	0.0:1.0:0.0:0.0	.	2001	Q9NZJ4	SACS_HUMAN	I	2001;1251;2001	ENSP00000371729:R2001I;ENSP00000385844:R1251I;ENSP00000371735:R2001I	ENSP00000371729:R2001I	R	-	2	0	SACS	22810013	1.000000	0.71417	0.995000	0.50966	0.955000	0.61496	7.466000	0.80914	2.727000	0.93392	0.591000	0.81541	AGA		SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
SUCLA2	8803	broad.mit.edu	37	13	48523666	48523666	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr13:48523666C>A	ENST00000378654.3	-	9	1236	c.1180G>T	c.(1180-1182)Gca>Tca	p.A394S	SUCLA2_ENST00000544100.1_Missense_Mutation_p.A260S|SUCLA2_ENST00000534875.1_Missense_Mutation_p.A336S|SUCLA2_ENST00000543413.1_Missense_Mutation_p.A336S	NM_003850.2	NP_003841.1	Q9P2R7	SUCB1_HUMAN	succinate-CoA ligase, ADP-forming, beta subunit	394					cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|succinyl-CoA metabolic process (GO:0006104)|succinyl-CoA pathway (GO:0006781)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)	p.A394S(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(3)|skin(4)	15		all_cancers(8;1.13e-24)|all_epithelial(8;1.78e-13)|all_lung(13;2.85e-06)|Breast(56;0.000141)|Lung NSC(96;0.000226)|all_hematologic(8;0.000885)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.0167)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;2.1e-06)	Succinic acid(DB00139)	TCTTTTACTGCCATGACTATA	0.358																																					p.A394S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1180T	13						.						103.0	99.0	101.0					13																	48523666		2203	4300	6503	47421667	SO:0001583	missense	8803	exon9			AF058953	CCDS9406.1	13q12.2-q13.3	2010-04-16			ENSG00000136143	ENSG00000136143	6.2.1.5		11448	protein-coding gene	gene with protein product		603921				9765291	Standard	NM_003850		Approved		uc001vbs.3	Q9P2R7	OTTHUMG00000016889	ENST00000378654.3:c.1180G>T	13.37:g.48523666C>A	ENSP00000367923:p.Ala394Ser	Somatic		Capture	Illumina HiSeq	Phase_I	47421667	NM_003850	B2RDE7|O95194|Q5T9Q4|Q5T9Q6|Q9NV21|Q9NVP7	Missense_Mutation	SNP	ENST00000378654.3	37	CCDS9406.1	.	.	.	.	.	.	.	.	.	.	c	18.84	3.709238	0.68615	.	.	ENSG00000136143	ENST00000378654;ENST00000378645;ENST00000544100;ENST00000534875;ENST00000543413;ENST00000541732	T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05	4.57	4.57	0.56435	Succinyl-CoA synthetase-like (2);ATP-citrate lyase/succinyl-CoA ligase (1);	0.000000	0.85682	D	0.000000	D	0.91492	0.7314	M	0.93678	3.445	0.80722	D	1	P	0.39250	0.665	D	0.65443	0.935	D	0.93048	0.6463	10	0.66056	D	0.02	-15.9032	16.7109	0.85385	0.0:1.0:0.0:0.0	.	394	Q9P2R7	SUCB1_HUMAN	S	394;372;260;336;336;222	ENSP00000367923:A394S;ENSP00000443412:A260S;ENSP00000438182:A336S;ENSP00000441056:A336S	ENSP00000367912:A372S	A	-	1	0	SUCLA2	47421667	1.000000	0.71417	1.000000	0.80357	0.205000	0.24178	7.348000	0.79366	2.228000	0.72767	0.491000	0.48974	GCA		SUCLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044852.1		
FOXA1	3169	broad.mit.edu	37	14	38061632	38061632	+	Silent	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr14:38061632C>T	ENST00000250448.2	-	2	418	c.357G>A	c.(355-357)caG>caA	p.Q119Q	FOXA1_ENST00000545425.2_5'UTR|FOXA1_ENST00000540786.1_Silent_p.Q86Q	NM_004496.3	NP_004487.2	P55317	FOXA1_HUMAN	forkhead box A1	119					anatomical structure formation involved in morphogenesis (GO:0048646)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|epithelial cell maturation involved in prostate gland development (GO:0060743)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|glucose homeostasis (GO:0042593)|hormone metabolic process (GO:0042445)|lung epithelial cell differentiation (GO:0060487)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|prostate gland stromal morphogenesis (GO:0060741)|response to estradiol (GO:0032355)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)	microvillus (GO:0005902)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.Q119Q(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(12)	19	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		AGGCCGCCTGCTGCGCACCCA	0.741																																					p.Q119Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G357A	14						.						10.0	11.0	11.0					14																	38061632		2094	4130	6224	37131383	SO:0001819	synonymous_variant	3169	exon2			U39840	CCDS9665.1	14q12-q13	2008-04-10		2002-09-20	ENSG00000129514	ENSG00000129514		"""Forkhead boxes"""	5021	protein-coding gene	gene with protein product		602294	"""hepatocyte nuclear factor 3, alpha"""	HNF3A		9119385, 8652662	Standard	NM_004496		Approved		uc001wuf.4	P55317	OTTHUMG00000140253	ENST00000250448.2:c.357G>A	14.37:g.38061632C>T		Somatic		Capture	Illumina HiSeq	Phase_I	37131383	NM_004496	B2R9H6|B7ZAP5|Q9H2A0	Silent	SNP	ENST00000250448.2	37	CCDS9665.1																																																																																				FOXA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276735.1		
CLEC14A	161198	broad.mit.edu	37	14	38724289	38724289	+	Silent	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr14:38724289G>A	ENST00000342213.2	-	1	1285	c.939C>T	c.(937-939)ccC>ccT	p.P313P		NM_175060.2	NP_778230.1	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	313						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.P313P(1)		breast(1)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		TCTGCGGCACGGGGCTGGTTG	0.617																																					p.P313P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C939T	14						.						64.0	66.0	65.0					14																	38724289		2203	4299	6502	37794040	SO:0001819	synonymous_variant	161198	exon1				CCDS9667.1	14q21.1	2010-04-27	2005-02-11	2005-02-11	ENSG00000176435	ENSG00000176435		"""C-type lectin domain containing"""	19832	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 27"""	C14orf27			Standard	NM_175060		Approved		uc001wum.2	Q86T13	OTTHUMG00000140248	ENST00000342213.2:c.939C>T	14.37:g.38724289G>A		Somatic		Capture	Illumina HiSeq	Phase_I	37794040	NM_175060	Q695G9|Q6PWT6|Q8N5V5	Silent	SNP	ENST00000342213.2	37	CCDS9667.1																																																																																				CLEC14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276729.1	NM_175060	
PRKCH	5583	broad.mit.edu	37	14	61995892	61995892	+	Silent	SNP	G	G	T	rs113681621	byFrequency	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr14:61995892G>T	ENST00000332981.5	+	11	1918	c.1533G>T	c.(1531-1533)acG>acT	p.T511T	PRKCH_ENST00000555082.1_Silent_p.T350T|RP11-47I22.4_ENST00000556347.1_Missense_Mutation_p.R16L	NM_006255.3	NP_006246.2	P24723	KPCL_HUMAN	protein kinase C, eta	511	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|negative regulation of glial cell apoptotic process (GO:0034351)|platelet activation (GO:0030168)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein kinase C signaling (GO:0070528)|protein phosphorylation (GO:0006468)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)	p.T511T(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		GTGTCACCACGGCCACATTCT	0.517																																					p.T511T	Melanoma(135;863 1779 8064 14443 26348)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1533T	14						.						121.0	99.0	106.0					14																	61995892		2203	4300	6503	61065645	SO:0001819	synonymous_variant	5583	exon11			M55284	CCDS9752.1	14q23.1	2009-07-10			ENSG00000027075	ENSG00000027075	2.7.11.1		9403	protein-coding gene	gene with protein product		605437		PRKCL		1986216, 1545821	Standard	NM_006255		Approved	PKC-L, PKCL	uc001xfn.3	P24723	OTTHUMG00000152341	ENST00000332981.5:c.1533G>T	14.37:g.61995892G>T		Somatic		Capture	Illumina HiSeq	Phase_I	61065645	NM_006255	B4DJN5|Q16246|Q8NE03	Silent	SNP	ENST00000332981.5	37	CCDS9752.1	.	.	.	.	.	.	.	.	.	.	G	7.233	0.599626	0.13939	.	.	ENSG00000258989	ENST00000556347	.	.	.	5.9	-9.93	0.00452	.	.	.	.	.	T	0.46034	0.1372	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55173	-0.8182	4	.	.	.	.	8.1984	0.31411	0.6366:0.1931:0.0958:0.0745	.	.	.	.	L	16	.	.	R	+	2	0	RP11-47I22.4	61065645	0.000000	0.05858	0.689000	0.30133	0.686000	0.39977	-3.991000	0.00318	-1.562000	0.01682	-0.808000	0.03180	CGG		PRKCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276974.2	NM_006255	
ATP10A	57194	broad.mit.edu	37	15	26026197	26026197	+	Missense_Mutation	SNP	C	C	T	rs539032579		TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr15:26026197C>T	ENST00000356865.6	-	2	734	c.623G>A	c.(622-624)cGg>cAg	p.R208Q		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	208					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.R208Q(1)		NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		CACCTGCCGCCGCTTCAGGTT	0.602													C|||	1	0.000199681	0.0	0.0	5008	,	,		16301	0.0		0.0	False		,,,				2504	0.001				p.R208Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G623A	15						.						72.0	74.0	74.0					15																	26026197		2203	4300	6503	23577290	SO:0001583	missense	57194	exon2			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.623G>A	15.37:g.26026197C>T	ENSP00000349325:p.Arg208Gln	Somatic		Capture	Illumina HiSeq	Phase_I	23577290	NM_024490	Q4G0S9|Q969I4	Missense_Mutation	SNP	ENST00000356865.6	37	CCDS32178.1	.	.	.	.	.	.	.	.	.	.	C	8.388	0.839056	0.16891	.	.	ENSG00000206190	ENST00000356865	D	0.90385	-2.66	4.67	3.67	0.42095	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.121989	0.56097	D	0.000034	T	0.55862	0.1947	N	0.00082	-2.215	0.38704	D	0.953065	B	0.11235	0.004	B	0.09377	0.004	T	0.66803	-0.5831	10	0.02654	T	1	-29.3942	4.2405	0.10645	0.0:0.7173:0.0:0.2827	.	208	O60312	AT10A_HUMAN	Q	208	ENSP00000349325:R208Q	ENSP00000349325:R208Q	R	-	2	0	ATP10A	23577290	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	3.672000	0.54583	2.428000	0.82296	0.561000	0.74099	CGG		ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	
OCA2	4948	broad.mit.edu	37	15	28230313	28230313	+	Missense_Mutation	SNP	G	G	A	rs372899234		TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr15:28230313G>A	ENST00000354638.3	-	13	1416	c.1261C>T	c.(1261-1263)Cgg>Tgg	p.R421W	OCA2_ENST00000353809.5_Missense_Mutation_p.R397W|OCA2_ENST00000382996.2_Missense_Mutation_p.R421W	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	421					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)	p.R421W(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		GCCCACACCCGTCCCCGGGAG	0.572									Oculocutaneous Albinism				G|||	1	0.000199681	0.0	0.0	5008	,	,		19287	0.0		0.0	False		,,,				2504	0.001				p.R421W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1261T	15						.	G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	107.0	79.0	89.0		1261	0.1	0.0	15		89	0,8600		0,0,4300	no	missense	OCA2	NM_000275.2	101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	421/839	28230313	1,13005	2203	4300	6503	25903908	SO:0001583	missense	4948	exon13	Familial Cancer Database			CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.1261C>T	15.37:g.28230313G>A	ENSP00000346659:p.Arg421Trp	Somatic		Capture	Illumina HiSeq	Phase_I	25903908	NM_000275	Q15211|Q15212|Q96EN1|Q9UMI5	Missense_Mutation	SNP	ENST00000354638.3	37	CCDS10020.1	.	.	.	.	.	.	.	.	.	.	G	17.83	3.486431	0.63962	2.27E-4	0.0	ENSG00000104044	ENST00000354638;ENST00000353809;ENST00000382996	D;D;D	0.82344	-1.6;-1.6;-1.6	5.35	0.0772	0.14407	Divalent ion symporter (1);	0.140477	0.64402	D	0.000009	D	0.88463	0.6443	M	0.69358	2.11	0.37669	D	0.923076	D;D	0.89917	1.0;1.0	D;D	0.72625	0.971;0.978	D	0.88999	0.3420	10	0.87932	D	0	-4.0634	14.1846	0.65598	0.0:0.0:0.5266:0.4734	.	397;421	Q04671-2;Q04671	.;P_HUMAN	W	421;397;421	ENSP00000346659:R421W;ENSP00000261276:R397W;ENSP00000372457:R421W	ENSP00000261276:R397W	R	-	1	2	OCA2	25903908	0.951000	0.32395	0.017000	0.16124	0.790000	0.44656	3.001000	0.49488	-0.172000	0.10779	-0.262000	0.10625	CGG		OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250823.1	NM_000275	
CTDSPL2	51496	broad.mit.edu	37	15	44811371	44811371	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr15:44811371C>T	ENST00000260327.4	+	11	1680	c.1117C>T	c.(1117-1119)Cgg>Tgg	p.R373W	CTDSPL2_ENST00000558373.1_Missense_Mutation_p.R301W|CTDSPL2_ENST00000396780.1_Missense_Mutation_p.R301W|CTDSPL2_ENST00000558966.1_Missense_Mutation_p.R373W|CTD-2329K10.1_ENST00000561324.1_RNA	NM_016396.2	NP_057480.2	Q05D32	CTSL2_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2	373	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.						phosphoprotein phosphatase activity (GO:0004721)	p.R373W(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(2)	13		all_cancers(109;4.36e-14)|all_epithelial(112;9.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;1.02e-20)|GBM - Glioblastoma multiforme(94;1.49e-06)|COAD - Colon adenocarcinoma(120;0.0857)|Colorectal(105;0.0905)		GTTTAGGCACCGGCTTTTCCG	0.269																																					p.R373W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1117T	15						.						21.0	22.0	22.0					15																	44811371		2179	4288	6467	42598663	SO:0001583	missense	51496	exon11			AF161478	CCDS10110.1	15q15.3-q21.1	2010-06-21			ENSG00000137770	ENSG00000137770		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	26936	protein-coding gene	gene with protein product							Standard	NM_016396		Approved	HSPC129, FLJ10523	uc001ztr.3	Q05D32	OTTHUMG00000131159	ENST00000260327.4:c.1117C>T	15.37:g.44811371C>T	ENSP00000260327:p.Arg373Trp	Somatic		Capture	Illumina HiSeq	Phase_I	42598663	NM_016396	Q3ZTU1|Q6AI06|Q8IYI9|Q9NVT2|Q9NZX8|Q9P030	Missense_Mutation	SNP	ENST00000260327.4	37	CCDS10110.1	.	.	.	.	.	.	.	.	.	.	C	17.22	3.333335	0.60853	.	.	ENSG00000137770	ENST00000260327;ENST00000396780	T;T	0.21031	2.03;2.03	5.66	4.74	0.60224	NLI interacting factor (3);Dullard phosphatase domain, eukaryotic (1);HAD-like domain (2);	0.000000	0.85682	D	0.000000	T	0.61825	0.2378	H	0.98802	4.335	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.73421	-0.3988	10	0.87932	D	0	-4.6394	9.62	0.39716	0.1404:0.7883:0.0:0.0713	.	301;373	Q05D32-2;Q05D32	.;CTSL2_HUMAN	W	373;301	ENSP00000260327:R373W;ENSP00000380000:R301W	ENSP00000260327:R373W	R	+	1	2	CTDSPL2	42598663	1.000000	0.71417	0.997000	0.53966	0.974000	0.67602	1.794000	0.38774	1.394000	0.46624	0.557000	0.71058	CGG		CTDSPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253851.1	NM_016396	
FBN1	2200	broad.mit.edu	37	15	48787710	48787710	+	Missense_Mutation	SNP	C	C	G	rs397515775		TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr15:48787710C>G	ENST00000316623.5	-	21	2950	c.2495G>C	c.(2494-2496)tGt>tCt	p.C832S		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	832	EGF-like 13; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.		C -> Y (in MFS). {ECO:0000269|PubMed:16222657}.		extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.C832S(1)		NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		TTCAGAAGAACATTCACAAAT	0.333																																					p.C832S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2495C	15	GRCh37	CM972801	FBN1	M		.						186.0	199.0	194.0					15																	48787710		2197	4296	6493	46575002	SO:0001583	missense	2200	exon21			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.2495G>C	15.37:g.48787710C>G	ENSP00000325527:p.Cys832Ser	Somatic		Capture	Illumina HiSeq	Phase_I	46575002	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	37	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.832381	0.91036	.	.	ENSG00000166147	ENST00000316623	D	0.96619	-4.07	5.87	5.87	0.94306	EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.98833	0.9606	H	0.97783	4.075	0.80722	D	1	D	0.55172	0.97	P	0.60886	0.88	D	0.99379	1.0922	10	0.87932	D	0	.	18.7582	0.91839	0.0:1.0:0.0:0.0	.	832	P35555	FBN1_HUMAN	S	832	ENSP00000325527:C832S	ENSP00000325527:C832S	C	-	2	0	FBN1	46575002	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.042000	0.70996	2.777000	0.95525	0.555000	0.69702	TGT		FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
DENND4A	10260	broad.mit.edu	37	15	65964191	65964191	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr15:65964191G>C	ENST00000431932.2	-	24	4479	c.4271C>G	c.(4270-4272)tCa>tGa	p.S1424*	DENND4A_ENST00000443035.3_Nonsense_Mutation_p.S1467*	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	1424					positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.S1426*(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						TGTCACTTCTGATTTCCCAGG	0.348																																					p.S1467X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C4400G	15						.						142.0	137.0	138.0					15																	65964191		1835	4095	5930	63751245	SO:0001587	stop_gained	10260	exon25			AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.4271C>G	15.37:g.65964191G>C	ENSP00000396830:p.Ser1424*	Somatic		Capture	Illumina HiSeq	Phase_I	63751245	NM_001144823	E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Nonsense_Mutation	SNP	ENST00000431932.2	37	CCDS45285.1	.	.	.	.	.	.	.	.	.	.	G	44	10.739269	0.99460	.	.	ENSG00000174485	ENST00000443035;ENST00000431932	.	.	.	5.92	5.92	0.95590	.	1.047830	0.07441	N	0.897387	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	20.3151	0.98650	0.0:0.0:1.0:0.0	.	.	.	.	X	1467;1424	.	ENSP00000396830:S1424X	S	-	2	0	DENND4A	63751245	1.000000	0.71417	0.998000	0.56505	0.639000	0.38242	7.832000	0.86757	2.809000	0.96659	0.467000	0.42956	TCA		DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419611.1	NM_005848	
SNX33	257364	broad.mit.edu	37	15	75949483	75949483	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr15:75949483G>A	ENST00000308527.5	+	2	2849	c.1652G>A	c.(1651-1653)cGc>cAc	p.R551H		NM_153271.1	NP_695003.1	Q8WV41	SNX33_HUMAN	sorting nexin 33	551	BAR.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|macropinocytosis (GO:0044351)|membrane tubulation (GO:0097320)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|negative regulation of endocytosis (GO:0045806)|negative regulation of protein localization to cell surface (GO:2000009)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein localization to cell surface (GO:2000010)|protein import (GO:0017038)	cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)	p.R551H(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)|soft_tissue(1)|urinary_tract(2)	19						AACTACTTGCGCCAGCAGATC	0.627																																					p.R551H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1652A	15						.						123.0	109.0	114.0					15																	75949483		2197	4294	6491	73736538	SO:0001583	missense	257364	exon2			AK091291	CCDS10283.1	15q23	2008-04-18	2008-03-25	2008-03-25	ENSG00000173548	ENSG00000173548			28468	protein-coding gene	gene with protein product			"""SH3 and PX domain containing 3"""	SH3PX3		16374509, 16782399, 18353773	Standard	NM_153271		Approved	MGC32065, SH3PXD3C, SNX30	uc002bau.3	Q8WV41	OTTHUMG00000142835	ENST00000308527.5:c.1652G>A	15.37:g.75949483G>A	ENSP00000311427:p.Arg551His	Somatic		Capture	Illumina HiSeq	Phase_I	73736538	NM_153271	B1NM17	Missense_Mutation	SNP	ENST00000308527.5	37	CCDS10283.1	.	.	.	.	.	.	.	.	.	.	G	15.57	2.873255	0.51695	.	.	ENSG00000173548	ENST00000308527	T	0.41065	1.01	5.41	2.48	0.30137	Sorting nexin protein, WASP-binding domain (1);	0.258092	0.37530	N	0.002050	T	0.22936	0.0554	N	0.19112	0.55	0.49582	D	0.999806	B;B	0.28584	0.216;0.216	B;B	0.25987	0.065;0.065	T	0.04495	-1.0947	10	0.37606	T	0.19	-1.6655	5.3192	0.15872	0.2896:0.146:0.5644:0.0	.	551;551	B1NM17;Q8WV41	.;SNX33_HUMAN	H	551	ENSP00000311427:R551H	ENSP00000311427:R551H	R	+	2	0	SNX33	73736538	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.751000	0.38339	0.635000	0.30488	0.591000	0.81541	CGC		SNX33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286471.1	NM_153271	
SH3GL3	6457	broad.mit.edu	37	15	84237406	84237406	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr15:84237406G>T	ENST00000427482.2	+	4	619	c.313G>T	c.(313-315)Ggg>Tgg	p.G105W	SH3GL3_ENST00000535412.1_Missense_Mutation_p.G105W|SH3GL3_ENST00000434347.1_Missense_Mutation_p.G113W|SH3GL3_ENST00000324537.5_Missense_Mutation_p.G113W	NM_003027.3	NP_003018.3	Q99963	SH3G3_HUMAN	SH3-domain GRB2-like 3	105	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				central nervous system development (GO:0007417)|endocytosis (GO:0006897)|signal transduction (GO:0007165)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)	p.G113W(1)		central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	30						GAAGGAGCTCGGGGAAGACTC	0.522																																					p.G105W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G313T	15						.						74.0	78.0	77.0					15																	84237406		2203	4300	6503	82028410	SO:0001583	missense	6457	exon4			AF036271	CCDS10325.2, CCDS73772.1	15q24	2006-11-24			ENSG00000140600	ENSG00000140600			10832	protein-coding gene	gene with protein product		603362				9169142	Standard	NR_026799		Approved	SH3D2C, SH3P13, CNSA3, EEN-B2, HsT19371	uc002bjw.3	Q99963	OTTHUMG00000147361	ENST00000427482.2:c.313G>T	15.37:g.84237406G>T	ENSP00000391372:p.Gly105Trp	Somatic		Capture	Illumina HiSeq	Phase_I	82028410	NM_003027	O43553|O43554	Missense_Mutation	SNP	ENST00000427482.2	37	CCDS10325.2	.	.	.	.	.	.	.	.	.	.	G	18.50	3.637043	0.67130	.	.	ENSG00000140600	ENST00000427482;ENST00000535412;ENST00000324537;ENST00000434347	T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24	4.86	4.86	0.63082	BAR (3);	0.000000	0.85682	D	0.000000	D	0.85177	0.5637	M	0.90483	3.12	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.88637	0.3173	10	0.87932	D	0	-5.9604	17.3782	0.87398	0.0:0.0:1.0:0.0	.	105;105;113	Q8IVP1;Q99963;Q99963-3	.;SH3G3_HUMAN;.	W	105;105;113;113	ENSP00000391372:G105W;ENSP00000439239:G105W;ENSP00000320092:G113W;ENSP00000397871:G113W	ENSP00000320092:G113W	G	+	1	0	SH3GL3	82028410	1.000000	0.71417	0.832000	0.32986	0.534000	0.34807	9.384000	0.97219	2.402000	0.81655	0.544000	0.68410	GGG		SH3GL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347797.1	NM_003027	
SPATA8	145946	broad.mit.edu	37	15	97327411	97327411	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr15:97327411A>T	ENST00000328504.3	+	2	385	c.118A>T	c.(118-120)Atg>Ttg	p.M40L	SPATA8-AS1_ENST00000558722.1_RNA|SPATA8_ENST00000558553.1_De_novo_Start_OutOfFrame|SPATA8-AS1_ENST00000560888.1_RNA	NM_173499.3	NP_775770.1	Q6RVD6	SPAT8_HUMAN	spermatogenesis associated 8	40								p.M40L(1)		large_intestine(4)|lung(8)|ovary(1)|skin(3)	16	Melanoma(26;0.0142)|Lung NSC(78;0.041)|all_lung(78;0.0468)		OV - Ovarian serous cystadenocarcinoma(32;0.0718)			CTCAGAAGCCATGACATGTCC	0.592																																					p.M40L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A118T	15						.						79.0	76.0	77.0					15																	97327411		2197	4298	6495	95128415	SO:0001583	missense	145946	exon2			AY489187	CCDS10376.1	15q26	2008-02-05			ENSG00000185594	ENSG00000185594			28676	protein-coding gene	gene with protein product		613948					Standard	NM_173499		Approved	MGC44294	uc002bue.3	Q6RVD6	OTTHUMG00000149847	ENST00000328504.3:c.118A>T	15.37:g.97327411A>T	ENSP00000328149:p.Met40Leu	Somatic		Capture	Illumina HiSeq	Phase_I	95128415	NM_173499	Q2KJ07	Missense_Mutation	SNP	ENST00000328504.3	37	CCDS10376.1	.	.	.	.	.	.	.	.	.	.	A	14.25	2.478010	0.44044	.	.	ENSG00000185594	ENST00000328504	.	.	.	3.84	1.54	0.23209	.	.	.	.	.	T	0.28532	0.0706	N	0.08118	0	0.80722	D	1	P	0.37573	0.6	B	0.42555	0.391	T	0.09100	-1.0690	8	0.87932	D	0	.	5.3629	0.16098	0.7665:0.0:0.2335:0.0	.	40	Q6RVD6	SPAT8_HUMAN	L	40	.	ENSP00000328149:M40L	M	+	1	0	SPATA8	95128415	0.002000	0.14202	0.916000	0.36221	0.834000	0.47266	0.854000	0.27791	0.327000	0.23409	0.533000	0.62120	ATG		SPATA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313533.1	NM_173499	
PRR14	78994	broad.mit.edu	37	16	30664362	30664363	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr16:30664362_30664363insC	ENST00000542965.2	+	4	898_899	c.442_443insC	c.(442-444)gccfs	p.A148fs	PRR14_ENST00000300835.4_Frame_Shift_Ins_p.A148fs			Q9BWN1	PRR14_HUMAN	proline rich 14	148	Pro-rich.							p.Q150fs*15(1)|p.A148P(1)		breast(3)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|skin(1)	18			Colorectal(24;0.103)			GGTGGACCGGGCCCCCCAGCCC	0.644																																					p.A148fs												.	.	2	Substitution - Missense(1)|Insertion - Frameshift(1)	large_intestine(1)|endometrium(1)	c.442_443insC	16						.																																			30571864	SO:0001589	frameshift_variant	78994	exon5			AK074783	CCDS10687.1	16p11.2	2008-02-05			ENSG00000156858	ENSG00000156858			28458	protein-coding gene	gene with protein product						12477932	Standard	NM_024031		Approved	MGC3121	uc002dyy.3	Q9BWN1	OTTHUMG00000132414	ENST00000542965.2:c.448dupC	16.37:g.30664368_30664368dupC	ENSP00000441641:p.Ala148fs	Somatic		Capture	Illumina HiSeq	Phase_I	30571863	NM_024031	Q8WTX2	Frame_Shift_Ins	INS	ENST00000542965.2	37	CCDS10687.1																																																																																				PRR14-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434433.1	NM_024031	
SRRM2	23524	broad.mit.edu	37	16	2816324	2816324	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr16:2816324G>A	ENST00000301740.8	+	11	6344	c.5795G>A	c.(5794-5796)cGc>cAc	p.R1932H		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1932	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)	p.R1932H(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						CCAGTAACCCGCCGTCGTTCA	0.582																																					p.R1932H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5795A	16						.						76.0	79.0	78.0					16																	2816324		2198	4300	6498	2756325	SO:0001583	missense	23524	exon11			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.5795G>A	16.37:g.2816324G>A	ENSP00000301740:p.Arg1932His	Somatic		Capture	Illumina HiSeq	Phase_I	2756325	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	37	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	G	12.02	1.811263	0.32053	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.31769	1.48	5.24	5.24	0.73138	.	0.000000	0.64402	D	0.000008	T	0.33702	0.0872	N	0.08118	0	0.35689	D	0.814703	D	0.76494	0.999	D	0.69654	0.965	T	0.44817	-0.9303	10	0.27082	T	0.32	-8.0496	16.3084	0.82859	0.0:0.0:1.0:0.0	.	1932	Q9UQ35	SRRM2_HUMAN	H	1932;1932;1184	ENSP00000301740:R1932H	ENSP00000301740:R1932H	R	+	2	0	SRRM2	2756325	0.990000	0.36364	1.000000	0.80357	0.985000	0.73830	3.362000	0.52314	2.454000	0.82982	0.650000	0.86243	CGC		SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
MYH11	4629	broad.mit.edu	37	16	15932005	15932005	+	Silent	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr16:15932005G>A	ENST00000300036.5	-	2	214	c.105C>T	c.(103-105)ctC>ctT	p.L35L	MYH11_ENST00000452625.2_Silent_p.L35L|MYH11_ENST00000396324.3_Silent_p.L35L|MYH11_ENST00000576790.2_Silent_p.L35L	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	35					axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)	p.L35L(2)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						GGACCCAGACGAGTCTCTTGG	0.577			T	CBFB	AML																																p.L35L			Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C105T	16						.						101.0	103.0	102.0					16																	15932005		2197	4300	6497	15839506	SO:0001819	synonymous_variant	4629	exon2			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.105C>T	16.37:g.15932005G>A		Somatic		Capture	Illumina HiSeq	Phase_I	15839506	NM_001040114	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Silent	SNP	ENST00000300036.5	37	CCDS10565.1																																																																																				MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113	
MMP2	4313	broad.mit.edu	37	16	55519308	55519308	+	Silent	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr16:55519308C>T	ENST00000219070.4	+	4	1136	c.627C>T	c.(625-627)gaC>gaT	p.D209D	MMP2_ENST00000437642.2_Silent_p.D159D|MMP2_ENST00000570308.1_Silent_p.D133D|MMP2_ENST00000543485.1_Silent_p.D133D	NM_004530.4	NP_004521.1	P08253	MMP2_HUMAN	matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)	209	Collagenase-like 1.				angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|bone trabecula formation (GO:0060346)|cellular protein metabolic process (GO:0044267)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|positive regulation of innate immune response (GO:0045089)|proteolysis (GO:0006508)|response to hypoxia (GO:0001666)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|sarcomere (GO:0030017)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)	p.D209D(2)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|liver(2)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	58		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Captopril(DB01197)|Marimastat(DB00786)	ATTTTGATGACGATGAGCTAT	0.577																																					p.D209D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C627T	16						.						111.0	98.0	102.0					16																	55519308		2198	4300	6498	54076809	SO:0001819	synonymous_variant	4313	exon4				CCDS10752.1, CCDS45487.1	16q13-q21	2008-02-05	2005-08-08		ENSG00000087245	ENSG00000087245	3.4.24.24		7166	protein-coding gene	gene with protein product		120360	"""matrix metalloproteinase 2 (gelatinase A, 72kD gelatinase, 72kD type IV collagenase)"", ""matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)"""	CLG4, CLG4A			Standard	NM_004530		Approved	TBE-1	uc002ehz.4	P08253	OTTHUMG00000133202	ENST00000219070.4:c.627C>T	16.37:g.55519308C>T		Somatic		Capture	Illumina HiSeq	Phase_I	54076809	NM_004530	B2R6U1|B4DWH3|E9PE45|Q9UCJ8	Silent	SNP	ENST00000219070.4	37	CCDS10752.1																																																																																				MMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256913.3		
GRIN2A	2903	broad.mit.edu	37	16	10031860	10031860	+	Silent	SNP	G	G	A	rs368200727		TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr16:10031860G>A	ENST00000396573.2	-	4	1272	c.963C>T	c.(961-963)taC>taT	p.Y321Y	GRIN2A_ENST00000396575.2_Silent_p.Y321Y|GRIN2A_ENST00000330684.3_Silent_p.Y321Y|GRIN2A_ENST00000562109.1_Silent_p.Y321Y|GRIN2A_ENST00000535259.1_Silent_p.Y164Y|GRIN2A_ENST00000566670.1_5'Flank|GRIN2A_ENST00000404927.2_Silent_p.Y321Y	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	321					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.Y321Y(2)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CCATCTGCCCGTAGCAGCTGG	0.562																																					p.Y321Y												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.C963T	16						.	G	,,	3,4391	6.2+/-15.9	0,3,2194	67.0	58.0	61.0		963,963,963	-3.6	1.0	16		61	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	GRIN2A	NM_000833.3,NM_001134407.1,NM_001134408.1	,,	0,4,6493	AA,AG,GG		0.0116,0.0683,0.0308	,,	321/1465,321/1465,321/1282	10031860	4,12990	2197	4300	6497	9939361	SO:0001819	synonymous_variant	2903	exon3				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.963C>T	16.37:g.10031860G>A		Somatic		Capture	Illumina HiSeq	Phase_I	9939361	NM_001134408	O00669|Q17RZ6	Silent	SNP	ENST00000396573.2	37	CCDS10539.1																																																																																				GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
CNGB1	1258	broad.mit.edu	37	16	57953079	57953079	+	Silent	SNP	G	G	A	rs369525244		TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr16:57953079G>A	ENST00000251102.8	-	20	1941	c.1881C>T	c.(1879-1881)tgC>tgT	p.C627C	CNGB1_ENST00000564448.1_Silent_p.C621C	NM_001297.4	NP_001288.3	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1	627					cation transport (GO:0006812)|cytosolic calcium ion homeostasis (GO:0051480)|detection of light stimulus involved in visual perception (GO:0050908)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|protein heterotetramerization (GO:0051290)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina homeostasis (GO:0001895)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of smell (GO:0007608)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|intracellular cyclic nucleotide activated cation channel complex (GO:0017071)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)|transmembrane transporter complex (GO:1902495)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)	p.C627C(1)		breast(7)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(11)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	54						AGAGCATGTCGCAATAGTGCT	0.577																																					p.C627C	Colon(156;1293 1853 16336 28962 38659)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1881T	16						.						103.0	108.0	107.0					16																	57953079		2001	4178	6179	56510580	SO:0001819	synonymous_variant	1258	exon20			AF042498	CCDS42169.1, CCDS45495.1, CCDS67042.1	16q13	2013-02-14			ENSG00000070729	ENSG00000070729		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2151	protein-coding gene	gene with protein product	"""glutamic acid-rich protein"""	600724		CNCG2, CNCG3L		8766832, 7590744, 16382102	Standard	NM_001297		Approved	RCNC2, RCNCb, GARP, GAR1, CNGB1B, RP45	uc002emt.2	Q14028	OTTHUMG00000154810	ENST00000251102.8:c.1881C>T	16.37:g.57953079G>A		Somatic		Capture	Illumina HiSeq	Phase_I	56510580	NM_001297	H3BN09|O43636|Q13059|Q14029|Q9UMG2	Silent	SNP	ENST00000251102.8	37	CCDS42169.1																																																																																				CNGB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337167.2	NM_001297	
NCOR1	9611	broad.mit.edu	37	17	16004937	16004937	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr17:16004937T>A	ENST00000268712.3	-	20	2574	c.2317A>T	c.(2317-2319)Aaa>Taa	p.K773*	NCOR1_ENST00000395851.1_Nonsense_Mutation_p.K789*|NCOR1_ENST00000583226.1_5'Flank|RNU6-314P_ENST00000516574.1_RNA|NCOR1_ENST00000395848.1_Nonsense_Mutation_p.K680*	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	773					CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.K773*(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		TCAGCTGGTTTTGTACTTGGA	0.507																																					p.K789X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A2365T	17						.						183.0	165.0	171.0					17																	16004937		2203	4300	6503	15945662	SO:0001587	stop_gained	9611	exon19			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.2317A>T	17.37:g.16004937T>A	ENSP00000268712:p.Lys773*	Somatic		Capture	Illumina HiSeq	Phase_I	15945662	NM_001190440	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Nonsense_Mutation	SNP	ENST00000268712.3	37	CCDS11175.1	.	.	.	.	.	.	.	.	.	.	T	33	5.250174	0.95305	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000395848	.	.	.	5.55	3.28	0.37604	.	0.341207	0.33092	N	0.005283	.	.	.	.	.	.	0.21147	N	0.999771	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.1724	4.3196	0.11011	0.1226:0.0694:0.1278:0.6802	.	.	.	.	X	773;789;680;680	.	ENSP00000268712:K773X	K	-	1	0	NCOR1	15945662	1.000000	0.71417	0.002000	0.10522	0.937000	0.57800	0.694000	0.25512	0.369000	0.24510	0.533000	0.62120	AAA		NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	
BCAS3	54828	broad.mit.edu	37	17	59024609	59024609	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr17:59024609G>C	ENST00000390652.5	+	14	1148	c.1117G>C	c.(1117-1119)Ggc>Cgc	p.G373R	BCAS3_ENST00000589222.1_Missense_Mutation_p.G373R|BCAS3_ENST00000408905.3_Missense_Mutation_p.G373R|BCAS3_ENST00000585744.1_Missense_Mutation_p.G144R|BCAS3_ENST00000407086.3_Missense_Mutation_p.G373R|BCAS3_ENST00000588462.1_Missense_Mutation_p.G373R|BCAS3_ENST00000588874.1_Missense_Mutation_p.G144R	NM_001099432.1	NP_001092902.1			breast carcinoma amplified sequence 3									p.G373R(1)		NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(24)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			AGACACCCTTGGCCATGACTT	0.388																																					p.G373R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1117C	17						.						203.0	186.0	191.0					17																	59024609		1903	4133	6036	56379391	SO:0001583	missense	54828	exon14			AF361219	CCDS11626.1, CCDS45749.1	17q23.2	2013-06-25			ENSG00000141376	ENSG00000141376		"""WD repeat domain containing"""	14347	protein-coding gene	gene with protein product		607470				12378525	Standard	NM_017679		Approved	FLJ20128	uc002iyv.4	Q9H6U6	OTTHUMG00000180064	ENST00000390652.5:c.1117G>C	17.37:g.59024609G>C	ENSP00000375067:p.Gly373Arg	Somatic		Capture	Illumina HiSeq	Phase_I	56379391	NM_001099432		Missense_Mutation	SNP	ENST00000390652.5	37	CCDS45749.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.848929	0.91277	.	.	ENSG00000141376	ENST00000390652;ENST00000407086;ENST00000405070;ENST00000408905;ENST00000360207;ENST00000405217	T;T;T	0.62498	0.02;0.02;0.02	5.59	5.59	0.84812	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.81597	0.4856	M	0.80847	2.515	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.985;0.988;0.999;0.997;1.0	T	0.83058	-0.0149	10	0.87932	D	0	.	19.9542	0.97213	0.0:0.0:1.0:0.0	.	164;178;373;373;373	B4E3M9;Q70WD9;Q9H6U6-7;Q9H6U6;Q9H6U6-2	.;.;.;BCAS3_HUMAN;.	R	373;373;373;373;165;178	ENSP00000375067:G373R;ENSP00000385323:G373R;ENSP00000386173:G373R	ENSP00000353336:G165R	G	+	1	0	BCAS3	56379391	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.467000	0.97671	2.788000	0.95919	0.585000	0.79938	GGC		BCAS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449578.1	NM_017679	
TP53	7157	broad.mit.edu	37	17	7579321	7579322	+	Frame_Shift_Del	DEL	CA	CA	-	rs587780067		TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	CA	CA	CA	-	CA	CA	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr17:7579321_7579322delCA	ENST00000269305.4	-	4	554_555	c.365_366delTG	c.(364-366)gtgfs	p.V122fs	TP53_ENST00000420246.2_Frame_Shift_Del_p.V122fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.V122fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.V122fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Frame_Shift_Del_p.V122fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.V122fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	122	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> L (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.V122fs*26(5)|p.G59fs*23(3)|p.V73fs*9(1)|p.G105_T125del21(1)|p.G112_V122delGFLHSGTAKSV(1)|p.V122fs*46(1)|p.Y107fs*44(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCGTGCAAGTCACAGACTTGGC	0.554		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.122_122del	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	.	23	Deletion - Frameshift(13)|Whole gene deletion(8)|Deletion - In frame(2)	upper_aerodigestive_tract(4)|large_intestine(4)|bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|lung(2)|breast(2)|stomach(1)|liver(1)|ovary(1)	c.365_366del	17	GRCh37	CM065494	TP53	M		.																																			7520047	SO:0001589	frameshift_variant	7157	exon4	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.365_366delTG	17.37:g.7579323_7579324delCA	ENSP00000269305:p.Val122fs	Somatic		Capture	Illumina HiSeq	Phase_I	7520046	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1																																																																																				TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
CACNG5	27091	broad.mit.edu	37	17	64880889	64880889	+	Intron	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr17:64880889G>A	ENST00000533854.1	+	5	807				CACNG5_ENST00000169565.3_Silent_p.P227P|CACNG5_ENST00000307139.3_Intron			Q9UF02	CCG5_HUMAN	calcium channel, voltage-dependent, gamma subunit 5						regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ion transmembrane transporter activity (GO:0015075)|voltage-gated calcium channel activity (GO:0005245)	p.P227P(1)		NS(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	24			BRCA - Breast invasive adenocarcinoma(6;1.61e-08)			TTTGGACCCCGGACCACCCAC	0.597																																					p.P227P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G681A	17						.						108.0	93.0	98.0					17																	64880889		2203	4300	6503	62311351	SO:0001627	intron_variant	27091	exon4			AF148220	CCDS11665.1	17q24	2004-02-16				ENSG00000075429		"""Calcium channel subunits"""	1409	protein-coding gene	gene with protein product		606405				10613843	Standard	NM_145811		Approved		uc010wqj.2	Q9UF02		ENST00000533854.1:c.570+111G>A	17.37:g.64880889G>A		Somatic		Capture	Illumina HiSeq	Phase_I	62311351	NM_014404	A8K2A6|Q547R3|Q8WXS7|Q9UHM3	Silent	SNP	ENST00000533854.1	37	CCDS11665.1																																																																																				CACNG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389882.1	NM_014404, NM_145811	
SLC1A6	6511	broad.mit.edu	37	19	15063790	15063790	+	Silent	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr19:15063790G>A	ENST00000221742.3	-	8	1456	c.1449C>T	c.(1447-1449)gtC>gtT	p.V483V	SLC1A6_ENST00000430939.2_Silent_p.V419V|SLC1A6_ENST00000600144.1_Silent_p.V405V	NM_005071.1	NP_005062.1	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6	483					aspartate transport (GO:0015810)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)	p.V483V(1)		breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(8)|liver(1)|lung(12)|ovary(3)|pancreas(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42						TGGGCAAGCCGACCGACGTAA	0.617																																					p.V483V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1449T	19						.						189.0	147.0	161.0					19																	15063790		2203	4300	6503	14924790	SO:0001819	synonymous_variant	6511	exon8				CCDS12321.1, CCDS62578.1	19p13.12	2013-07-15			ENSG00000105143	ENSG00000105143		"""Solute carriers"""	10944	protein-coding gene	gene with protein product		600637				7791878	Standard	NM_005071		Approved	EAAT4	uc002naa.2	P48664	OTTHUMG00000183351	ENST00000221742.3:c.1449C>T	19.37:g.15063790G>A		Somatic		Capture	Illumina HiSeq	Phase_I	14924790	NM_005071	Q8N753	Silent	SNP	ENST00000221742.3	37	CCDS12321.1																																																																																				SLC1A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466283.1	NM_005071	
ZNF507	22847	broad.mit.edu	37	19	32851435	32851435	+	Silent	SNP	A	A	G			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr19:32851435A>G	ENST00000311921.4	+	4	2463	c.2271A>G	c.(2269-2271)caA>caG	p.Q757Q	ZNF507_ENST00000355898.5_Silent_p.Q757Q|ZNF507_ENST00000544431.1_Silent_p.Q757Q	NM_001136156.1|NM_014910.4	NP_001129628.1|NP_055725.2	Q8TCN5	ZN507_HUMAN	zinc finger protein 507	757					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q757Q(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	31	Esophageal squamous(110;0.162)					TCCAGAAACAATATAGATGTG	0.368																																					p.Q757Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2271G	19						.						147.0	140.0	142.0					19																	32851435		2203	4300	6503	37543275	SO:0001819	synonymous_variant	22847	exon5			AB029007	CCDS32985.1	19q13.12	2008-02-05				ENSG00000168813		"""Zinc fingers, C2H2-type"""	23783	protein-coding gene	gene with protein product							Standard	NM_014910		Approved	KIAA1084	uc002ntd.3	Q8TCN5		ENST00000311921.4:c.2271A>G	19.37:g.32851435A>G		Somatic		Capture	Illumina HiSeq	Phase_I	37543275	NM_001136156	A8K911|Q2TBF1|Q6MZU0|Q9UPR8	Silent	SNP	ENST00000311921.4	37	CCDS32985.1																																																																																				ZNF507-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450301.3	NM_014910	
ZNF382	84911	broad.mit.edu	37	19	37117799	37117799	+	Missense_Mutation	SNP	C	C	T	rs374650096		TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr19:37117799C>T	ENST00000292928.2	+	5	1113	c.1000C>T	c.(1000-1002)Cgt>Tgt	p.R334C	ZNF382_ENST00000439428.1_Missense_Mutation_p.R333C|ZNF382_ENST00000435416.1_Missense_Mutation_p.R333C|CTD-3234P18.2_ENST00000585467.1_lincRNA|ZNF382_ENST00000423582.1_Missense_Mutation_p.R285C	NM_001256838.1|NM_032825.4	NP_001243767.1|NP_116214.2	Q96SR6	ZN382_HUMAN	zinc finger protein 382	334	Required for transcriptional repression activity; probably mediates sequence- specific DNA-binding. {ECO:0000250}.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R334C(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	34	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			AAAGGCCTTCCGTCAGAAGAC	0.448																																					p.R334C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1000T	19						.	C	CYS/ARG	0,4406		0,0,2203	76.0	75.0	75.0		1000	3.3	1.0	19		75	1,8599	1.2+/-3.3	0,1,4299	no	missense	ZNF382	NM_032825.3	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	334/551	37117799	1,13005	2203	4300	6503	41809639	SO:0001583	missense	84911	exon5			AF513816	CCDS33004.1, CCDS58659.1	19q13.13	2013-01-08			ENSG00000161298	ENSG00000161298		"""Zinc fingers, C2H2-type"", ""-"""	17409	protein-coding gene	gene with protein product		609516					Standard	NM_032825		Approved	FLJ14686, KS1	uc010efb.4	Q96SR6	OTTHUMG00000048153	ENST00000292928.2:c.1000C>T	19.37:g.37117799C>T	ENSP00000292928:p.Arg334Cys	Somatic		Capture	Illumina HiSeq	Phase_I	41809639	NM_032825	A3KMP6|A8MT55|C9K0V5|Q53ZY8|Q5JPJ2	Missense_Mutation	SNP	ENST00000292928.2	37	CCDS33004.1	.	.	.	.	.	.	.	.	.	.	C	13.15	2.150089	0.37923	0.0	1.16E-4	ENSG00000161298	ENST00000423582;ENST00000292928;ENST00000439428;ENST00000435416	T;T;T;T	0.07444	3.19;3.19;3.19;3.19	4.47	3.34	0.38264	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.42821	D	0.000651	T	0.16685	0.0401	M	0.64630	1.985	0.41073	D	0.985467	D;D;D	0.76494	0.998;0.998;0.999	P;P;P	0.60886	0.809;0.809;0.88	T	0.00460	-1.1726	10	0.42905	T	0.14	.	5.0872	0.14689	0.2061:0.6881:0.0:0.1058	.	333;333;334	Q96SR6-2;Q96SR6-3;Q96SR6	.;.;ZN382_HUMAN	C	285;334;333;333	ENSP00000389722:R285C;ENSP00000292928:R334C;ENSP00000407593:R333C;ENSP00000410113:R333C	ENSP00000292928:R334C	R	+	1	0	ZNF382	41809639	0.001000	0.12720	1.000000	0.80357	0.998000	0.95712	0.882000	0.28186	2.481000	0.83766	0.591000	0.81541	CGT		ZNF382-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109562.2	NM_032825	
PSG2	5670	broad.mit.edu	37	19	43579536	43579536	+	Missense_Mutation	SNP	G	G	A	rs529547477		TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr19:43579536G>A	ENST00000406487.1	-	3	777	c.679C>T	c.(679-681)Cgc>Tgc	p.R227C		NM_031246.3	NP_112536.2	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2	227	Ig-like C2-type 1.				cell migration (GO:0016477)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.R227C(1)		central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(24)|ovary(1)|pancreas(2)|prostate(6)|stomach(2)|urinary_tract(2)	49		Prostate(69;0.00682)				GGGTCACTGCGGCTGGCACTC	0.527																																					p.R227C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C679T	19						.						221.0	233.0	229.0					19																	43579536		2202	4299	6501	48271376	SO:0001583	missense	5670	exon3				CCDS12616.1	19q13.1-q13.2	2013-01-29			ENSG00000242221	ENSG00000242221		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9519	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta-1-glycoprotein 7"", ""carcinoembryonic antigen SG8"""	176391		PSBG2		2377620	Standard	NM_031246		Approved	PSGGB, PSG1, CEA	uc002ovr.3	P11465	OTTHUMG00000151547	ENST00000406487.1:c.679C>T	19.37:g.43579536G>A	ENSP00000385706:p.Arg227Cys	Somatic		Capture	Illumina HiSeq	Phase_I	48271376	NM_031246	Q8TCD9|Q9UEA4|Q9UQ78	Missense_Mutation	SNP	ENST00000406487.1	37	CCDS12616.1	.	.	.	.	.	.	.	.	.	.	N	11.11	1.543254	0.27563	.	.	ENSG00000242221	ENST00000406487;ENST00000329509;ENST00000401942;ENST00000406917	T	0.12774	2.65	1.33	-0.184	0.13280	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.31544	0.0800	M	0.80616	2.505	0.09310	N	1	P;D	0.89917	0.934;1.0	P;D	0.75484	0.712;0.986	T	0.08973	-1.0696	9	0.87932	D	0	.	3.9393	0.09319	0.0:0.0:0.5847:0.4153	.	227;227	B5MCM8;P11465	.;PSG2_HUMAN	C	227	ENSP00000385706:R227C	ENSP00000332984:R227C	R	-	1	0	PSG2	48271376	0.000000	0.05858	0.007000	0.13788	0.074000	0.17049	-0.263000	0.08670	0.703000	0.31848	0.454000	0.30748	CGC		PSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323083.1	NM_031246	
PSG4	5672	broad.mit.edu	37	19	43698574	43698574	+	Silent	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr19:43698574C>T	ENST00000405312.3	-	5	1398	c.1161G>A	c.(1159-1161)aaG>aaA	p.K387K	PSG4_ENST00000244295.9_Silent_p.K294K|PSG4_ENST00000433626.2_Silent_p.K294K	NM_002780.3	NP_002771.2	Q00888	PSG4_HUMAN	pregnancy specific beta-1-glycoprotein 4	387	Ig-like C2-type 3.				female pregnancy (GO:0007565)	extracellular vesicular exosome (GO:0070062)		p.K387K(1)|p.K294K(1)		central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	24		Prostate(69;0.00682)				GCCCACTATGCTTTGTAGTTA	0.468																																					p.K387K												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1161A	19						.						210.0	210.0	210.0					19																	43698574		2202	4295	6497	48390414	SO:0001819	synonymous_variant	5672	exon5				CCDS33039.1, CCDS46093.1, CCDS62695.1	19q13.2	2013-01-29			ENSG00000243137	ENSG00000243137		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9521	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1-glycoprotein 4"""	176393				2783133	Standard	NM_002780		Approved		uc002ovy.4	Q00888	OTTHUMG00000151544	ENST00000405312.3:c.1161G>A	19.37:g.43698574C>T		Somatic		Capture	Illumina HiSeq	Phase_I	48390414	NM_002780	E7EX79|Q13047|Q13048|Q15234|Q15240|Q9UQ76	Silent	SNP	ENST00000405312.3	37	CCDS46093.1																																																																																				PSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323073.1	NM_213633	
NLRP4	147945	broad.mit.edu	37	19	56369444	56369444	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr19:56369444G>A	ENST00000301295.6	+	3	1107	c.685G>A	c.(685-687)Gtc>Atc	p.V229I	NLRP4_ENST00000587891.1_Missense_Mutation_p.V154I|NLRP4_ENST00000346986.5_Missense_Mutation_p.V229I	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	229	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.V229I(3)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		ACTCTTGTTCGTCATCGACAG	0.557																																					p.V229I												.	.	3	Substitution - Missense(3)	large_intestine(2)|ovary(1)	c.G685A	19						.						81.0	80.0	81.0					19																	56369444		2203	4300	6503	61061256	SO:0001583	missense	147945	exon3			AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.685G>A	19.37:g.56369444G>A	ENSP00000301295:p.Val229Ile	Somatic		Capture	Illumina HiSeq	Phase_I	61061256	NM_134444	Q86W87|Q96AY6	Missense_Mutation	SNP	ENST00000301295.6	37	CCDS12936.1	.	.	.	.	.	.	.	.	.	.	G	0.017	-1.491014	0.01009	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	D;D	0.83992	-1.79;-1.79	4.1	-2.63	0.06133	NACHT nucleoside triphosphatase (1);	.	.	.	.	T	0.51568	0.1682	N	0.02854	-0.475	0.23876	N	0.996597	B;B;B	0.27997	0.0;0.0;0.197	B;B;B	0.24006	0.0;0.001;0.05	T	0.50947	-0.8767	9	0.02654	T	1	.	4.8964	0.13753	0.448:0.2809:0.271:0.0	.	229;154;229	Q96MN2-2;Q96MN2-3;Q96MN2	.;.;NALP4_HUMAN	I	229	ENSP00000301295:V229I;ENSP00000344787:V229I	ENSP00000301295:V229I	V	+	1	0	NLRP4	61061256	0.159000	0.22864	0.009000	0.14445	0.166000	0.22503	-0.124000	0.10595	-0.811000	0.04369	-0.302000	0.09304	GTC		NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444	
ZNF560	147741	broad.mit.edu	37	19	9580372	9580372	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr19:9580372T>G	ENST00000301480.4	-	8	676	c.463A>C	c.(463-465)Aaa>Caa	p.K155Q		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	155	KRAB 2. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K155Q(1)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						AGACTGGGTTTGAAGAGCTGG	0.463																																					p.K155Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A463C	19						.						108.0	94.0	99.0					19																	9580372		2203	4300	6503	9441372	SO:0001583	missense	147741	exon8			AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.463A>C	19.37:g.9580372T>G	ENSP00000301480:p.Lys155Gln	Somatic		Capture	Illumina HiSeq	Phase_I	9441372	NM_152476	Q495S9|Q495T1	Missense_Mutation	SNP	ENST00000301480.4	37	CCDS12214.1	.	.	.	.	.	.	.	.	.	.	T	13.61	2.288461	0.40494	.	.	ENSG00000198028	ENST00000301480	T	0.00932	5.53	2.43	2.43	0.29744	Krueppel-associated box (3);	.	.	.	.	T	0.02610	0.0079	M	0.73372	2.23	0.21184	N	0.999765	D	0.60160	0.987	P	0.56278	0.795	T	0.45659	-0.9246	9	0.18710	T	0.47	.	8.3437	0.32258	0.0:0.0:0.0:1.0	.	155	Q96MR9	ZN560_HUMAN	Q	155	ENSP00000301480:K155Q	ENSP00000301480:K155Q	K	-	1	0	ZNF560	9441372	0.347000	0.24853	0.053000	0.19242	0.907000	0.53573	1.425000	0.34859	1.098000	0.41479	0.379000	0.24179	AAA		ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449901.1	NM_152476	
ZNF586	54807	broad.mit.edu	37	19	58290302	58290302	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr19:58290302G>A	ENST00000396154.2	+	3	520	c.347G>A	c.(346-348)cGc>cAc	p.R116H	ZNF586_ENST00000396150.4_Missense_Mutation_p.A74T|ZNF586_ENST00000599802.1_Intron|ZNF586_ENST00000598885.1_Intron|ZNF586_ENST00000598183.1_Intron|ZNF586_ENST00000391702.3_Missense_Mutation_p.R73H	NM_017652.3	NP_060122.2	Q9NXT0	ZN586_HUMAN	zinc finger protein 586	116					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R116H(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)	15		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AGGAATGTTCGCACTGGAGAA	0.418																																					p.R116H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G347A	19						.						80.0	81.0	81.0					19																	58290302		2061	4250	6311	62982114	SO:0001583	missense	54807	exon3			AK095993	CCDS42640.1, CCDS56107.1, CCDS56108.1	19q13.43	2013-01-08				ENSG00000083828		"""Zinc fingers, C2H2-type"", ""-"""	25949	protein-coding gene	gene with protein product						12477932	Standard	NM_017652		Approved	FLJ20070	uc002qqd.3	Q9NXT0		ENST00000396154.2:c.347G>A	19.37:g.58290302G>A	ENSP00000379458:p.Arg116His	Somatic		Capture	Illumina HiSeq	Phase_I	62982114	NM_017652	A0JLV8|A8MY63|B3KTS9|E7ERT1|G3XAH3	Missense_Mutation	SNP	ENST00000396154.2	37	CCDS42640.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.017|0.017	-1.503189|-1.503189	0.00992|0.00992	.|.	.|.	ENSG00000083828|ENSG00000083828	ENST00000396150|ENST00000449441;ENST00000391702;ENST00000396154	T|T;T	0.06142|0.09911	3.34|2.93;3.08	1.66|1.66	0.513|0.513	0.17000|0.17000	.|Zinc finger, C2H2-type/integrase, DNA-binding (1);	.|.	.|.	.|.	.|.	T|T	0.01254|0.01254	0.0041|0.0041	N|N	0.00025|0.00025	-2.68|-2.68	0.23126|0.23126	N|N	0.998259|0.998259	B|B	0.22146|0.17465	0.065|0.022	B|B	0.06405|0.08055	0.002|0.003	T|T	0.43310|0.43310	-0.9399|-0.9399	9|9	0.09084|0.02654	T|T	0.74|1	.|.	5.2282|5.2282	0.15406|0.15406	0.8141:0.0:0.1859:0.0|0.8141:0.0:0.1859:0.0	.|.	74|116	A0JLV8|Q9NXT0	.|ZN586_HUMAN	T|H	74|116;73;116	ENSP00000379454:A74T|ENSP00000375583:R73H;ENSP00000379458:R116H	ENSP00000379454:A74T|ENSP00000375583:R73H	A|R	+|+	1|2	0|0	ZNF586|ZNF586	62982114|62982114	0.133000|0.133000	0.22466|0.22466	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	4.205000|4.205000	0.58466|0.58466	-0.081000|-0.081000	0.12662|0.12662	-0.339000|-0.339000	0.08088|0.08088	GCA|CGC		ZNF586-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466825.2	NM_017652	
AMPD2	271	broad.mit.edu	37	1	110163651	110163652	+	Missense_Mutation	DNP	CA	CA	TG			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	CA	CA					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr1:110163651_110163652CA>TG	ENST00000256578.3	+	1	376_377	c.16_17CA>TG	c.(16-18)CAg>TGg	p.Q6W	AMPD2_ENST00000528454.1_5'Flank|AMPD2_ENST00000528667.1_Missense_Mutation_p.Q6W|AMPD2_ENST00000526301.1_Intron|AMPD2_ENST00000342115.4_Intron|AMPD2_ENST00000358729.4_5'Flank	NM_004037.7	NP_004028.3	Q01433	AMPD2_HUMAN	adenosine monophosphate deaminase 2	6					cell death (GO:0008219)|cyclic purine nucleotide metabolic process (GO:0052652)|energy homeostasis (GO:0097009)|IMP biosynthetic process (GO:0006188)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)	p.Q6>?(1)		breast(1)|large_intestine(3)|ovary(2)|skin(1)	7		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)		AAATCGTGGCCAGGGCCTCTTC	0.663																																					.												.	.	1	Complex(1)	large_intestine(1)	c.16_17TG	1						.																																			109965175	SO:0001583	missense	271	exon1			S47833	CCDS804.1, CCDS805.1, CCDS30796.1, CCDS58016.1	1p13.3	2014-03-03	2010-02-10		ENSG00000116337	ENSG00000116337	3.5.4.6		469	protein-coding gene	gene with protein product	"""AMPD isoform L"""	102771	"""adenosine monophosphate deaminase 2 (isoform L)"""			1400401, 24482476	Standard	NM_004037		Approved	SPG63	uc009wfh.2	Q01433	OTTHUMG00000011649	Exception_encountered	1.37:g.110163651_110163652delinsTG	ENSP00000256578:p.Gln6Trp	Somatic		Capture	Illumina HiSeq	Phase_I	109965174	NM_004037	B4DK50|B4DZI5|E9PNG0|Q14856|Q14857|Q16686|Q16687|Q16688|Q16729|Q5T693|Q5T695|Q96IA1|Q9UDX8|Q9UDX9|Q9UMU4	Missense_Mutation	DNP	ENST00000256578.3	37	CCDS805.1																																																																																				AMPD2-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390615.1		
BCL9	607	broad.mit.edu	37	1	147091237	147091237	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr1:147091237G>A	ENST00000234739.3	+	8	2016	c.1276G>A	c.(1276-1278)Gtg>Atg	p.V426M		NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	426	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)		p.V426M(1)		breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					CCGGACAGACGTGGGAGCTCC	0.532			T	"""IGH@, IGL@"""	B-ALL																																p.V426M			Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1276A	1						.						55.0	62.0	60.0					1																	147091237		2203	4300	6503	145557861	SO:0001583	missense	607	exon8			Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.1276G>A	1.37:g.147091237G>A	ENSP00000234739:p.Val426Met	Somatic		Capture	Illumina HiSeq	Phase_I	145557861	NM_004326	Q5T489	Missense_Mutation	SNP	ENST00000234739.3	37	CCDS30833.1	.	.	.	.	.	.	.	.	.	.	G	9.076	0.998055	0.19043	.	.	ENSG00000116128	ENST00000234739	T	0.76316	-1.01	5.61	3.74	0.42951	.	0.308735	0.34460	N	0.003958	T	0.41119	0.1145	N	0.08118	0	0.30715	N	0.748912	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.29640	-1.0005	10	0.49607	T	0.09	-10.853	12.3874	0.55340	0.1354:0.0:0.8646:0.0	.	426;426	Q1JQ81;O00512	.;BCL9_HUMAN	M	426	ENSP00000234739:V426M	ENSP00000234739:V426M	V	+	1	0	BCL9	145557861	1.000000	0.71417	0.988000	0.46212	0.806000	0.45545	3.156000	0.50708	0.937000	0.37394	-0.156000	0.13503	GTG		BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039468.1	NM_004326	
OR10K2	391107	broad.mit.edu	37	1	158390379	158390379	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr1:158390379G>T	ENST00000314902.2	-	1	277	c.278C>A	c.(277-279)tCt>tAt	p.S93Y		NM_001004476.1	NP_001004476.1	Q6IF99	O10K2_HUMAN	olfactory receptor, family 10, subfamily K, member 2	93						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S93Y(1)		NS(1)|breast(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(19)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_hematologic(112;0.0378)					GCCCAGGAAAGAAATGGTCTT	0.478																																					p.S93Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C278A	1						.						178.0	174.0	175.0					1																	158390379		2203	4300	6503	156657003	SO:0001583	missense	391107	exon1			AB065642	CCDS30896.1	1q23.1	2012-08-09			ENSG00000180708	ENSG00000180708		"""GPCR / Class A : Olfactory receptors"""	14826	protein-coding gene	gene with protein product							Standard	NM_001004476		Approved		uc010pii.2	Q6IF99	OTTHUMG00000019638	ENST00000314902.2:c.278C>A	1.37:g.158390379G>T	ENSP00000324251:p.Ser93Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	156657003	NM_001004476		Missense_Mutation	SNP	ENST00000314902.2	37	CCDS30896.1	.	.	.	.	.	.	.	.	.	.	G	13.04	2.117726	0.37339	.	.	ENSG00000180708	ENST00000314902	T	0.00745	5.75	4.1	4.1	0.47936	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46758	D	0.000280	T	0.04318	0.0119	H	0.96996	3.92	0.35657	D	0.812211	D	0.71674	0.998	P	0.62813	0.907	T	0.02728	-1.1118	10	0.87932	D	0	.	15.5895	0.76517	0.0:0.0:1.0:0.0	.	93	Q6IF99	O10K2_HUMAN	Y	93	ENSP00000324251:S93Y	ENSP00000324251:S93Y	S	-	2	0	OR10K2	156657003	1.000000	0.71417	0.978000	0.43139	0.315000	0.28087	7.168000	0.77570	2.265000	0.75225	0.467000	0.42956	TCT		OR10K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051854.1	NM_001004476	
SPTA1	6708	broad.mit.edu	37	1	158626363	158626363	+	Silent	SNP	G	G	A	rs371639635	byFrequency	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr1:158626363G>A	ENST00000368147.4	-	20	3069	c.2889C>T	c.(2887-2889)aaC>aaT	p.N963N		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	963					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.N963N(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CCTGGCAGGCGTTTGCCTGAT	0.398													G|||	4	0.000798722	0.003	0.0	5008	,	,		16668	0.0		0.0	False		,,,				2504	0.0				p.N963N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2889T	1						.	G		2,3722		0,2,1860	168.0	171.0	170.0		2889	-5.2	1.0	1		170	1,8185		0,1,4092	no	coding-synonymous	SPTA1	NM_003126.2		0,3,5952	AA,AG,GG		0.0122,0.0537,0.0252		963/2420	158626363	3,11907	1862	4093	5955	156892987	SO:0001819	synonymous_variant	6708	exon20			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.2889C>T	1.37:g.158626363G>A		Somatic		Capture	Illumina HiSeq	Phase_I	156892987	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	ENST00000368147.4	37	CCDS41423.1																																																																																				SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
PIK3C2B	5287	broad.mit.edu	37	1	204412619	204412619	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr1:204412619G>A	ENST00000367187.3	-	20	3530	c.2974C>T	c.(2974-2976)Cgc>Tgc	p.R992C	PIK3C2B_ENST00000424712.2_Missense_Mutation_p.R964C	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	992					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)	p.R992C(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			CAGCACTGGCGGTTAAACTCT	0.607																																					p.R992C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2974T	1						.						89.0	90.0	90.0					1																	204412619		2203	4300	6503	202679242	SO:0001583	missense	5287	exon20			Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.2974C>T	1.37:g.204412619G>A	ENSP00000356155:p.Arg992Cys	Somatic		Capture	Illumina HiSeq	Phase_I	202679242	NM_002646	O95666|Q5SW99	Missense_Mutation	SNP	ENST00000367187.3	37	CCDS1446.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.033178	0.75504	.	.	ENSG00000133056	ENST00000367187;ENST00000424712	D;D	0.81579	-1.51;-1.51	5.79	4.8	0.61643	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.87811	0.6271	M	0.74467	2.265	0.44155	D	0.99695	P;D	0.89917	0.753;1.0	P;P	0.62184	0.571;0.899	D	0.88611	0.3156	10	0.62326	D	0.03	.	15.4174	0.74980	0.0:0.0:0.7758:0.2242	.	964;992	F5GWN5;O00750	.;P3C2B_HUMAN	C	992;964	ENSP00000356155:R992C;ENSP00000400561:R964C	ENSP00000356155:R992C	R	-	1	0	PIK3C2B	202679242	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.039000	0.49791	2.742000	0.94016	0.591000	0.81541	CGC		PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087965.1	NM_002646	
PPP2R5A	5525	broad.mit.edu	37	1	212502526	212502526	+	Silent	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr1:212502526G>A	ENST00000261461.2	+	2	805	c.231G>A	c.(229-231)caG>caA	p.Q77Q	PPP2R5A_ENST00000537030.3_Silent_p.Q20Q|PPP2R5A_ENST00000498129.2_3'UTR|RP11-384C4.7_ENST00000442146.1_RNA	NM_006243.3	NP_006234.1	Q15172	2A5A_HUMAN	protein phosphatase 2, regulatory subunit B', alpha	77					negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of lipid kinase activity (GO:0090219)|positive regulation of protein dephosphorylation (GO:0035307)|signal transduction (GO:0007165)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|M band (GO:0031430)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)|Z disc (GO:0030018)	kinase binding (GO:0019900)|protein phosphatase type 2A regulator activity (GO:0008601)	p.Q77Q(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)	16				OV - Ovarian serous cystadenocarcinoma(81;0.0125)|all cancers(67;0.029)|Epithelial(68;0.154)|GBM - Glioblastoma multiforme(131;0.155)		AGTTGCAGCAGTGTTGTATAC	0.328																																					p.Q20Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G60A	1						.						104.0	102.0	103.0					1																	212502526		2203	4300	6503	210569149	SO:0001819	synonymous_variant	5525	exon2			BC022474	CCDS1503.1, CCDS55686.1	1q32.2-q32.3	2010-06-18	2010-04-14		ENSG00000066027	ENSG00000066027		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9309	protein-coding gene	gene with protein product		601643	"""protein phosphatase 2, regulatory subunit B (B56), alpha isoform"", ""protein phosphatase 2, regulatory subunit B', alpha isoform"""			7592815	Standard	NM_006243		Approved	PR61A, B56A	uc001hjb.3	Q15172	OTTHUMG00000036750	ENST00000261461.2:c.231G>A	1.37:g.212502526G>A		Somatic		Capture	Illumina HiSeq	Phase_I	210569149	NM_001199756	B2R6D2|B7Z7L2|D3DT99|Q2NL72|Q5VVB2|Q8TBI9	Silent	SNP	ENST00000261461.2	37	CCDS1503.1																																																																																				PPP2R5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089302.1	NM_006243	
CLIC4	25932	broad.mit.edu	37	1	25167305	25167305	+	Silent	SNP	A	A	G			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr1:25167305A>G	ENST00000374379.4	+	6	836	c.639A>G	c.(637-639)gaA>gaG	p.E213E		NM_013943.2	NP_039234.1	Q9Y696	CLIC4_HUMAN	chloride intracellular channel 4	213	GST C-terminal.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cell differentiation (GO:0030154)|cellular response to calcium ion (GO:0071277)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|endothelial cell morphogenesis (GO:0001886)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|fertilization (GO:0009566)|keratinocyte differentiation (GO:0030216)|multicellular organism growth (GO:0035264)|negative regulation of cell migration (GO:0030336)|regulation of cytoskeleton organization (GO:0051493)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|vacuolar acidification (GO:0007035)	actin cytoskeleton (GO:0015629)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|microvillus (GO:0005902)|midbody (GO:0030496)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.E213E(1)		large_intestine(3)|lung(2)|skin(1)	6		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000778)|all_lung(284;0.00106)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0479)|OV - Ovarian serous cystadenocarcinoma(117;1.06e-24)|Colorectal(126;1.03e-07)|COAD - Colon adenocarcinoma(152;4.93e-06)|STAD - Stomach adenocarcinoma(196;0.000418)|GBM - Glioblastoma multiforme(114;0.000451)|BRCA - Breast invasive adenocarcinoma(304;0.00215)|KIRC - Kidney renal clear cell carcinoma(1967;0.00216)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.18)		TTCCAAAAGAAATGACTGGCA	0.383																																					p.E213E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A639G	1						.						122.0	117.0	119.0					1																	25167305		2203	4300	6503	25039892	SO:0001819	synonymous_variant	25932	exon6			AF097330	CCDS256.1	1p	2012-09-26			ENSG00000169504	ENSG00000169504		"""Ion channels / Chloride channels : Intracellular"""	13518	protein-coding gene	gene with protein product		606536				9139710, 10070163	Standard	NM_013943		Approved	DKFZP566G223, CLIC4L, P64H1, H1, huH1, p64H1	uc001bjo.2	Q9Y696	OTTHUMG00000003327	ENST00000374379.4:c.639A>G	1.37:g.25167305A>G		Somatic		Capture	Illumina HiSeq	Phase_I	25039892	NM_013943	Q9UFW9|Q9UQJ6	Silent	SNP	ENST00000374379.4	37	CCDS256.1																																																																																				CLIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009332.1	NM_013943	
SLC44A5	204962	broad.mit.edu	37	1	75708605	75708605	+	Missense_Mutation	SNP	C	C	T	rs373084017		TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr1:75708605C>T	ENST00000370855.5	-	8	550	c.437G>A	c.(436-438)cGt>cAt	p.R146H	SLC44A5_ENST00000370859.3_Missense_Mutation_p.R146H|SLC44A5_ENST00000469525.1_5'UTR|SLC44A5_ENST00000535611.1_Missense_Mutation_p.R16H	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	146					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R146H(2)		kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						ACAGAACTGACGGTAGTCTTC	0.378																																					p.R146H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G437A	1						.	C	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	163.0	166.0	165.0		437,437	2.1	0.4	1		165	0,8600		0,0,4300	no	missense,missense	SLC44A5	NM_001130058.1,NM_152697.4	29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	146/718,146/720	75708605	1,13005	2203	4300	6503	75481193	SO:0001583	missense	204962	exon8			BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.437G>A	1.37:g.75708605C>T	ENSP00000359892:p.Arg146His	Somatic		Capture	Illumina HiSeq	Phase_I	75481193	NM_152697	B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Missense_Mutation	SNP	ENST00000370855.5	37	CCDS667.1	.	.	.	.	.	.	.	.	.	.	C	13.55	2.270806	0.40194	2.27E-4	0.0	ENSG00000137968	ENST00000370859;ENST00000536707;ENST00000370855;ENST00000535611;ENST00000535790	T;T;T	0.27104	1.69;1.69;2.36	5.07	2.14	0.27477	.	0.631700	0.16943	N	0.193215	T	0.08626	0.0214	L	0.52573	1.65	0.24652	N	0.993511	B;B;B;P;B	0.36599	0.425;0.425;0.284;0.56;0.427	B;B;B;B;B	0.32090	0.046;0.066;0.046;0.14;0.058	T	0.10753	-1.0616	10	0.44086	T	0.13	0.009	8.7123	0.34391	0.0:0.6837:0.0:0.3163	.	140;185;146;146;185	B7Z5Y4;B7Z470;Q8NCS7;Q8NCS7-2;F5GYS0	.;.;CTL5_HUMAN;.;.	H	146;185;146;16;139	ENSP00000359896:R146H;ENSP00000359892:R146H;ENSP00000443090:R16H	ENSP00000359892:R146H	R	-	2	0	SLC44A5	75481193	0.049000	0.20398	0.442000	0.26870	0.644000	0.38419	0.193000	0.17116	0.649000	0.30751	0.655000	0.94253	CGT		SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026921.1	NM_152697	
OR2G6	391211	broad.mit.edu	37	1	248685161	248685161	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr1:248685161T>C	ENST00000343414.4	+	1	246	c.214T>C	c.(214-216)Tgc>Cgc	p.C72R		NM_001013355.1	NP_001013373.1	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G, member 6	72						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C72R(1)		NS(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(40)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGTGGACATCTGCTTTACCAC	0.507																																					p.C72R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T214C	1						.						125.0	108.0	114.0					1																	248685161		2203	4300	6503	246751784	SO:0001583	missense	391211	exon1				CCDS31119.1	1q44	2012-08-09			ENSG00000188558	ENSG00000188558		"""GPCR / Class A : Olfactory receptors"""	27019	protein-coding gene	gene with protein product							Standard	NM_001013355		Approved		uc001ien.1	Q5TZ20	OTTHUMG00000040462	ENST00000343414.4:c.214T>C	1.37:g.248685161T>C	ENSP00000341291:p.Cys72Arg	Somatic		Capture	Illumina HiSeq	Phase_I	246751784	NM_001013355	B2RP33	Missense_Mutation	SNP	ENST00000343414.4	37	CCDS31119.1	.	.	.	.	.	.	.	.	.	.	-	12.24	1.879932	0.33162	.	.	ENSG00000188558	ENST00000343414	T	0.01106	5.33	3.68	3.68	0.42216	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48767	U	0.000166	T	0.11537	0.0281	H	0.97540	4.025	0.09310	N	0.999997	D	0.89917	1.0	D	0.87578	0.998	T	0.14755	-1.0461	10	0.87932	D	0	.	11.4534	0.50167	0.0:0.0:0.0:1.0	.	72	Q5TZ20	OR2G6_HUMAN	R	72	ENSP00000341291:C72R	ENSP00000341291:C72R	C	+	1	0	OR2G6	246751784	0.000000	0.05858	0.577000	0.28562	0.762000	0.43233	0.192000	0.17096	1.523000	0.49018	0.329000	0.21502	TGC		OR2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097358.1	XM_372842	
MYL9	10398	broad.mit.edu	37	20	35177494	35177494	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr20:35177494G>A	ENST00000279022.2	+	4	465	c.361G>A	c.(361-363)Gac>Aac	p.D121N	RP5-977B1.7_ENST00000439595.1_RNA|RP5-977B1.11_ENST00000561134.1_RNA|RP5-977B1.7_ENST00000425233.1_RNA|MYL9_ENST00000346786.2_Missense_Mutation_p.D67N	NM_006097.4	NP_006088.2	P24844	MYL9_HUMAN	myosin, light chain 9, regulatory	121	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				axon guidance (GO:0007411)|muscle contraction (GO:0006936)|platelet aggregation (GO:0070527)|regulation of muscle contraction (GO:0006937)	cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|stress fiber (GO:0001725)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|structural constituent of muscle (GO:0008307)	p.D121N(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(2)	8	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				CATCCATGAGGACCACCTCCG	0.597																																					p.D121N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G361A	20						.						73.0	66.0	69.0					20																	35177494		2203	4300	6503	34610908	SO:0001583	missense	10398	exon4			J02854	CCDS13276.1, CCDS13277.1	20q11.23	2013-01-10	2006-09-29		ENSG00000101335	ENSG00000101335		"""Myosins / Light chain"", ""EF-hand domain containing"""	15754	protein-coding gene	gene with protein product	"""myosin regulatory light chain 2, smooth muscle isoform"", ""myosin regulatory light chain 1"""	609905	"""myosin, light polypeptide 9, regulatory"""			2526655	Standard	NM_006097		Approved	MYRL2, MLC2, LC20, MRLC1	uc002xfl.2	P24844	OTTHUMG00000032387	ENST00000279022.2:c.361G>A	20.37:g.35177494G>A	ENSP00000279022:p.Asp121Asn	Somatic		Capture	Illumina HiSeq	Phase_I	34610908	NM_006097	E1P5T6|Q9BQL9|Q9BUF9|Q9H136	Missense_Mutation	SNP	ENST00000279022.2	37	CCDS13276.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.028316	0.93518	.	.	ENSG00000101335	ENST00000279022;ENST00000346786	T;T	0.80566	-1.28;-1.39	4.7	4.7	0.59300	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.87533	0.6201	L	0.58510	1.815	0.80722	D	1	D;B	0.69078	0.997;0.173	D;B	0.73380	0.98;0.14	D	0.88741	0.3243	10	0.66056	D	0.02	.	16.5838	0.84722	0.0:0.0:1.0:0.0	.	67;121	Q9BUF9;P24844	.;MYL9_HUMAN	N	121;67	ENSP00000279022:D121N;ENSP00000217313:D67N	ENSP00000279022:D121N	D	+	1	0	MYL9	34610908	1.000000	0.71417	1.000000	0.80357	0.749000	0.42624	9.759000	0.98931	2.317000	0.78254	0.655000	0.94253	GAC		MYL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079015.2	NM_006097	
TSHZ2	128553	broad.mit.edu	37	20	51870841	51870841	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr20:51870841G>A	ENST00000371497.5	+	2	1731	c.844G>A	c.(844-846)Gac>Aac	p.D282N	TSHZ2_ENST00000603338.2_Missense_Mutation_p.D279N|RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_Missense_Mutation_p.D279N	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	282					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D282N(1)		NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			GTTTTGTGGCGACTCCTTTGA	0.443																																					p.D282N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G844A	20						.						75.0	60.0	65.0					20																	51870841		2203	4300	6503	51304248	SO:0001583	missense	128553	exon2			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.844G>A	20.37:g.51870841G>A	ENSP00000360552:p.Asp282Asn	Somatic		Capture	Illumina HiSeq	Phase_I	51304248	NM_173485	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	ENST00000371497.5	37	CCDS33490.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.396175	0.83011	.	.	ENSG00000182463	ENST00000371497;ENST00000329613	T;T	0.27557	1.66;1.66	5.5	5.5	0.81552	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.047161	0.85682	D	0.000000	T	0.30916	0.0780	N	0.03608	-0.345	0.54753	D	0.999989	D	0.67145	0.996	P	0.58391	0.838	T	0.46952	-0.9154	10	0.52906	T	0.07	-0.7384	19.7465	0.96253	0.0:0.0:1.0:0.0	.	282	Q9NRE2	TSH2_HUMAN	N	282;279	ENSP00000360552:D282N;ENSP00000333114:D279N	ENSP00000333114:D279N	D	+	1	0	TSHZ2	51304248	1.000000	0.71417	0.992000	0.48379	0.993000	0.82548	6.934000	0.75880	2.732000	0.93576	0.643000	0.83706	GAC		TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485	
CABIN1	23523	broad.mit.edu	37	22	24466813	24466813	+	Silent	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr22:24466813C>T	ENST00000398319.2	+	17	2680	c.2295C>T	c.(2293-2295)aaC>aaT	p.N765N	CABIN1_ENST00000263119.5_Silent_p.N765N|CABIN1_ENST00000405822.2_Silent_p.N715N	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	765					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)	p.N765N(1)		breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						TGGCTCTGAACGAGGCTGTCC	0.587																																					p.N765N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2295T	22						.						127.0	116.0	119.0					22																	24466813		2203	4300	6503	22796813	SO:0001819	synonymous_variant	23523	exon17			AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.2295C>T	22.37:g.24466813C>T		Somatic		Capture	Illumina HiSeq	Phase_I	22796813	NM_001199281	G5E9F3|Q6PHY0|Q9Y460	Silent	SNP	ENST00000398319.2	37	CCDS13823.1																																																																																				CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2	NM_012295	
CFAP221	200373	broad.mit.edu	37	2	120397422	120397422	+	Silent	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr2:120397422C>T	ENST00000413369.3	+	21	2286	c.2199C>T	c.(2197-2199)gaC>gaT	p.D733D	PCDP1_ENST00000602047.1_Silent_p.D447D	NM_001271049.1	NP_001257978												p.D447D(1)				Colorectal(110;0.196)					CCCTGCCGGACCCCTCCAAGA	0.493																																					p.D447D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1341T	2						.						93.0	91.0	92.0					2																	120397422		2203	4300	6503	120113892	SO:0001819	synonymous_variant	200373	exon22																														ENST00000413369.3:c.2199C>T	2.37:g.120397422C>T		Somatic		Capture	Illumina HiSeq	Phase_I	120113892	NM_001029996		Silent	SNP	ENST00000413369.3	37	CCDS33282.2	.	.	.	.	.	.	.	.	.	.	C	3.201	-0.163689	0.06502	.	.	ENSG00000163075	ENST00000443972;ENST00000434869	.	.	.	5.07	-1.49	0.08718	.	.	.	.	.	T	0.18509	0.0444	.	.	.	0.19945	N	0.999945	.	.	.	.	.	.	T	0.23655	-1.0182	4	.	.	.	-9.8575	0.9151	0.01303	0.2991:0.295:0.2345:0.1714	.	.	.	.	I	292;41	.	.	T	+	2	0	AC069154.2	120113892	0.001000	0.12720	0.001000	0.08648	0.011000	0.07611	-0.280000	0.08468	-0.217000	0.10033	0.655000	0.94253	ACC		PCDP1-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464236.1		
LRP1B	53353	broad.mit.edu	37	2	141812827	141812827	+	Splice_Site	SNP	G	G	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr2:141812827G>T	ENST00000389484.3	-	10	2381	c.1410C>A	c.(1408-1410)gtC>gtA	p.V470V		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	470					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.V470V(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CATGGCTTCTGACTACAACAA	0.403										TSP Lung(27;0.18)																											p.V470V	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1410A	2						.						75.0	68.0	71.0					2																	141812827		2203	4300	6503	141529297	SO:0001630	splice_region_variant	53353	exon10			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.1409-1C>A	2.37:g.141812827G>T		Somatic		Capture	Illumina HiSeq	Phase_I	141529297	NM_018557	Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	37	CCDS2182.1																																																																																				LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	Silent
XIRP2	129446	broad.mit.edu	37	2	168100236	168100236	+	Silent	SNP	G	G	A	rs191792139		TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr2:168100236G>A	ENST00000409195.1	+	9	2423	c.2334G>A	c.(2332-2334)ccG>ccA	p.P778P	XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409273.1_Silent_p.P556P|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000295237.9_Silent_p.P778P|XIRP2_ENST00000409043.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	603					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.P778P(2)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AAACACAGCCGTTGGACACAA	0.413													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19011	0.0		0.0	False		,,,				2504	0.0				p.P556P												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.G1668A	2						.	G	,,,,	2,3718		0,2,1858	69.0	65.0	66.0		,,1668,,2334	-4.1	0.2	2		66	0,8194		0,0,4097	no	intron,intron,coding-synonymous,intron,coding-synonymous	XIRP2	NM_001079810.3,NM_001199143.1,NM_001199144.1,NM_001199145.1,NM_152381.5	,,,,	0,2,5955	AA,AG,GG		0.0,0.0538,0.0168	,,,,	,,556/3328,,778/3550	168100236	2,11912	1860	4097	5957	167808482	SO:0001819	synonymous_variant	129446	exon7			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.2334G>A	2.37:g.168100236G>A		Somatic		Capture	Illumina HiSeq	Phase_I	167808482	NM_001199144	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	ENST00000409195.1	37	CCDS42769.1																																																																																				XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
ABCB11	8647	broad.mit.edu	37	2	169851948	169851948	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr2:169851948C>T	ENST00000263817.6	-	7	646	c.522G>A	c.(520-522)atG>atA	p.M174I		NM_003742.2	NP_003733.2	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 11	174	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|canalicular bile acid transport (GO:0015722)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|bile acid-exporting ATPase activity (GO:0015432)|canalicular bile acid transmembrane transporter activity (GO:0015126)|sodium-exporting ATPase activity, phosphorylative mechanism (GO:0008554)|transporter activity (GO:0005215)	p.M174I(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(16)|lung(26)|ovary(3)|stomach(1)	57					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Chlorpromazine(DB00477)|Cimetidine(DB00501)|Clofazimine(DB00845)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Digoxin(DB00390)|Doxorubicin(DB00997)|Ethinyl Estradiol(DB00977)|Fluorescein(DB00693)|Fusidic Acid(DB02703)|Glyburide(DB01016)|Ketoconazole(DB01026)|Novobiocin(DB01051)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Ponatinib(DB08901)|Pravastatin(DB00175)|Progesterone(DB00396)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Tamoxifen(DB00675)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	AAAATTTTCTCATTTTCTGTA	0.368																																					p.M174I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G522A	2						.						86.0	80.0	82.0					2																	169851948		1836	4089	5925	169560194	SO:0001583	missense	8647	exon7			AF091582	CCDS46444.1	2q24	2012-03-14			ENSG00000073734	ENSG00000073734		"""ATP binding cassette transporters / subfamily B"""	42	protein-coding gene	gene with protein product	"""ABC member 16, MDR/TAP subfamily"""	603201	"""progressive familial intrahepatic cholestasis 2"", ""bile salt export pump"""	BSEP, PFIC2		9806540	Standard	NM_003742		Approved	ABC16, SPGP, PFIC-2, PGY4	uc002ueo.1	O95342	OTTHUMG00000154039	ENST00000263817.6:c.522G>A	2.37:g.169851948C>T	ENSP00000263817:p.Met174Ile	Somatic		Capture	Illumina HiSeq	Phase_I	169560194	NM_003742	Q53TL2|Q9UNB2	Missense_Mutation	SNP	ENST00000263817.6	37	CCDS46444.1	.	.	.	.	.	.	.	.	.	.	C	2.252	-0.371380	0.05034	.	.	ENSG00000073734	ENST00000263817	D	0.86627	-2.15	4.94	2.85	0.33270	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.089051	0.85682	N	0.000000	T	0.52500	0.1738	N	0.00453	-1.485	0.35297	D	0.782683	B	0.02656	0.0	B	0.04013	0.001	T	0.57934	-0.7725	10	0.02654	T	1	-13.7667	3.825	0.08851	0.0:0.3706:0.2856:0.3437	.	174	O95342	ABCBB_HUMAN	I	174	ENSP00000263817:M174I	ENSP00000263817:M174I	M	-	3	0	ABCB11	169560194	0.876000	0.30132	1.000000	0.80357	0.933000	0.57130	-0.133000	0.10451	1.066000	0.40716	0.655000	0.94253	ATG		ABCB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333616.2	NM_003742	
TTN	7273	broad.mit.edu	37	2	179396278	179396278	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr2:179396278C>T	ENST00000591111.1	-	308	100365	c.100141G>A	c.(100141-100143)Gaa>Aaa	p.E33381K	TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E32454K|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E35022K|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E26149K|TTN-AS1_ENST00000585625.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E26082K|TTN_ENST00000460472.2_Missense_Mutation_p.E25957K|TTN-AS1_ENST00000589355.1_RNA			Q8WZ42	TITIN_HUMAN	titin	33381	Ig-like 146.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.E32452K(1)|p.E26082K(1)|p.E25957K(1)|p.E26149K(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCAGAAGCTTCGCCCTTGTAG	0.507																																					p.A25956A												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.G77868A	2						.						117.0	117.0	117.0					2																	179396278		2017	4188	6205	179104524	SO:0001583	missense	7273	exon186			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.100141G>A	2.37:g.179396278C>T	ENSP00000465570:p.Glu33381Lys	Somatic		Capture	Illumina HiSeq	Phase_I	179104524	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	23.5	4.427921	0.83667	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2	5.56	5.56	0.83823	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.78604	0.4309	M	0.61703	1.905	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	T	0.79841	-0.1633	9	0.87932	D	0	.	19.5233	0.95194	0.0:1.0:0.0:0.0	.	25957;26082;26149;33381	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	32454;25957;26149;26082;25954	ENSP00000343764:E32454K;ENSP00000434586:E25957K;ENSP00000340554:E26149K;ENSP00000352154:E26082K	ENSP00000340554:E26149K	E	-	1	0	TTN	179104524	1.000000	0.71417	0.936000	0.37596	0.607000	0.37147	7.810000	0.86072	2.615000	0.88500	0.650000	0.86243	GAA		TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ZNF804A	91752	broad.mit.edu	37	2	185800807	185800807	+	Silent	SNP	C	C	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr2:185800807C>A	ENST00000302277.6	+	4	1278	c.684C>A	c.(682-684)tcC>tcA	p.S228S		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	228							metal ion binding (GO:0046872)	p.S228S(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						AGCTAGAGTCCTCAGCTGCAG	0.438																																					p.S228S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C684A	2						.						74.0	73.0	74.0					2																	185800807		2203	4299	6502	185509052	SO:0001819	synonymous_variant	91752	exon4			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.684C>A	2.37:g.185800807C>A		Somatic		Capture	Illumina HiSeq	Phase_I	185509052	NM_194250	A7E253|Q6ZN26	Silent	SNP	ENST00000302277.6	37	CCDS2291.1																																																																																				ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250	
TRAPPC12	51112	broad.mit.edu	37	2	3405656	3405656	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr2:3405656C>T	ENST00000324266.5	+	3	1351	c.1156C>T	c.(1156-1158)Cag>Tag	p.Q386*	TRAPPC12_ENST00000382110.2_Nonsense_Mutation_p.Q386*	NM_016030.5	NP_057114.5	Q8WVT3	TPC12_HUMAN	trafficking protein particle complex 12	386					vesicle-mediated transport (GO:0016192)			p.Q386*(1)									TGGATTGAAACAGCTAATCGT	0.368																																					p.Q386X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1156T	2						.						244.0	239.0	240.0					2																	3405656		2203	4300	6503	3384663	SO:0001587	stop_gained	51112	exon3			BC017475	CCDS1652.1	2p25.3	2013-01-10	2011-12-12	2011-12-12	ENSG00000171853	ENSG00000171853		"""Trafficking protein particle complex"", ""Tetratricopeptide (TTC) repeat domain containing"""	24284	protein-coding gene	gene with protein product		614139	"""tetratricopeptide repeat domain 15"""	TTC15		10810093, 21525244, 20562859	Standard	NM_016030		Approved	CGI-87, TTC-15	uc002qxm.1	Q8WVT3	OTTHUMG00000090328	ENST00000324266.5:c.1156C>T	2.37:g.3405656C>T	ENSP00000324318:p.Gln386*	Somatic		Capture	Illumina HiSeq	Phase_I	3384663	NM_016030	B3KV01|D6W4Y2|Q8WVW1|Q9Y395	Nonsense_Mutation	SNP	ENST00000324266.5	37	CCDS1652.1	.	.	.	.	.	.	.	.	.	.	C	17.07	3.296062	0.60086	.	.	ENSG00000171853	ENST00000382110;ENST00000304601;ENST00000324266	.	.	.	5.23	5.23	0.72850	.	0.123739	0.56097	D	0.000027	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	.	12.7945	0.57553	0.1637:0.8363:0.0:0.0	.	.	.	.	X	386;369;386	.	ENSP00000303612:Q369X	Q	+	1	0	TTC15	3384663	1.000000	0.71417	0.997000	0.53966	0.398000	0.30690	5.039000	0.64185	2.605000	0.88082	0.655000	0.94253	CAG		TRAPPC12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206693.2	NM_016030	
MEMO1	51072	broad.mit.edu	37	2	32093497	32093497	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr2:32093497G>A	ENST00000295065.5	-	9	1136	c.827C>T	c.(826-828)tCg>tTg	p.S276L	MEMO1_ENST00000426310.2_Missense_Mutation_p.S253L|MEMO1_ENST00000379383.3_Missense_Mutation_p.S279L|MEMO1_ENST00000404530.1_Missense_Mutation_p.S276L|DPY30_ENST00000446765.1_5'UTR|MEMO1_ENST00000490459.1_5'UTR	NM_015955.2	NP_057039.1	Q9Y316	MEMO1_HUMAN	mediator of cell motility 1	276					regulation of microtubule-based process (GO:0032886)	cytosol (GO:0005829)|nucleus (GO:0005634)		p.S276L(1)		NS(1)|breast(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)|skin(2)	17	Acute lymphoblastic leukemia(172;0.155)					ACACTGGCTCGACTGGGCATA	0.443																																					p.S276L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C827T	2						.						20.0	19.0	19.0					2																	32093497		2202	4295	6497	31947001	SO:0001583	missense	51072	exon9			AF132961	CCDS1776.1, CCDS46255.1	2p22-p21	2010-05-24	2007-02-12	2007-02-12	ENSG00000162959	ENSG00000162959			14014	protein-coding gene	gene with protein product		611786	"""chromosome 2 open reading frame 4"""	C2orf4		15156151	Standard	NM_015955		Approved	CGI-27, MEMO	uc002rnx.3	Q9Y316	OTTHUMG00000128453	ENST00000295065.5:c.827C>T	2.37:g.32093497G>A	ENSP00000295065:p.Ser276Leu	Somatic		Capture	Illumina HiSeq	Phase_I	31947001	NM_015955	B4DLS0|D6W575|Q5R2V8|Q5R2V9|Q6NSL5	Missense_Mutation	SNP	ENST00000295065.5	37	CCDS1776.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.273718	0.80580	.	.	ENSG00000162959	ENST00000295065;ENST00000379383;ENST00000404530;ENST00000426310	.	.	.	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	D	0.86522	0.5953	M	0.92649	3.33	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.993;1.0	D	0.89610	0.3841	9	0.87932	D	0	0.0	18.7757	0.91911	0.0:0.0:1.0:0.0	.	253;276	Q9Y316-2;Q9Y316	.;MEMO1_HUMAN	L	276;279;276;253	.	ENSP00000295065:S276L	S	-	2	0	MEMO1	31947001	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.560000	0.98139	2.608000	0.88229	0.650000	0.86243	TCG		MEMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250251.2	NM_015955	
MSH6	2956	broad.mit.edu	37	2	48028057	48028057	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr2:48028057C>G	ENST00000234420.5	+	4	3087	c.2935C>G	c.(2935-2937)Ctg>Gtg	p.L979V	MSH6_ENST00000540021.1_Missense_Mutation_p.L849V|MSH6_ENST00000538136.1_Missense_Mutation_p.L677V|FBXO11_ENST00000405808.1_Intron	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	979					ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)|p.L979V(1)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CCGTTACCAGCTGGAAATTCC	0.438			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.L979V		yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	mutS homolog 6 (E. coli)		E	.	.	3	Whole gene deletion(2)|Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)	c.C2935G	2						.						51.0	51.0	51.0					2																	48028057		2203	4300	6503	47881561	SO:0001583	missense	2956	exon4	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.2935C>G	2.37:g.48028057C>G	ENSP00000234420:p.Leu979Val	Somatic		Capture	Illumina HiSeq	Phase_I	47881561	NM_000179	B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Missense_Mutation	SNP	ENST00000234420.5	37	CCDS1836.1	.	.	.	.	.	.	.	.	.	.	C	13.46	2.243482	0.39697	.	.	ENSG00000116062	ENST00000234420;ENST00000544857;ENST00000540021;ENST00000538136	D;D;D	0.91577	-2.87;-2.87;-2.87	5.61	-0.99	0.10238	DNA mismatch repair protein MutS, clamp (1);DNA mismatch repair protein MutS, core (3);	0.101506	0.64402	D	0.000007	D	0.90683	0.7077	M	0.75884	2.315	0.80722	D	1	P;P;P	0.51537	0.946;0.933;0.73	P;P;B	0.53689	0.732;0.718;0.327	D	0.86944	0.2081	10	0.54805	T	0.06	-9.8504	6.5288	0.22316	0.2119:0.4745:0.0:0.3135	.	849;979;979	B4DF41;P52701;P52701-2	.;MSH6_HUMAN;.	V	979;977;849;677	ENSP00000234420:L979V;ENSP00000446475:L849V;ENSP00000438580:L677V	ENSP00000234420:L979V	L	+	1	2	MSH6	47881561	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	0.902000	0.28459	-0.112000	0.11979	-0.414000	0.06135	CTG		MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251180.4	NM_000179	
CCT4	10575	broad.mit.edu	37	2	62099690	62099690	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr2:62099690T>C	ENST00000394440.3	-	11	1455	c.1159A>G	c.(1159-1161)Aca>Gca	p.T387A	CCT4_ENST00000538252.1_Missense_Mutation_p.T331A|CCT4_ENST00000544079.1_Missense_Mutation_p.T357A|CCT4_ENST00000461540.2_Intron|CCT4_ENST00000544185.1_Missense_Mutation_p.T237A|AC107081.5_ENST00000425779.1_RNA	NM_006430.3	NP_006421.2	P50991	TCPD_HUMAN	chaperonin containing TCP1, subunit 4 (delta)	387					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)	p.T387A(1)		breast(1)|large_intestine(2)|lung(6)|ovary(2)	11	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;6.5e-06)|Epithelial(17;0.0647)|all cancers(80;0.221)			ACAACAATTGTAACTGTTTTT	0.428																																					p.T387A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1159G	2						.						72.0	68.0	69.0					2																	62099690		2203	4300	6503	61953194	SO:0001583	missense	10575	exon11				CCDS33206.1, CCDS58711.1	2p15	2011-09-02			ENSG00000115484	ENSG00000115484		"""Heat Shock Proteins / Chaperonins"""	1617	protein-coding gene	gene with protein product		605142				9819444	Standard	NM_001256721		Approved	Cctd	uc002sbo.4	P50991	OTTHUMG00000152166	ENST00000394440.3:c.1159A>G	2.37:g.62099690T>C	ENSP00000377958:p.Thr387Ala	Somatic		Capture	Illumina HiSeq	Phase_I	61953194	NM_006430	B2R6I3|B7Z8B1|F5H5W3|O14870|Q53QP9|Q96C51	Missense_Mutation	SNP	ENST00000394440.3	37	CCDS33206.1	.	.	.	.	.	.	.	.	.	.	T	19.39	3.818328	0.71028	.	.	ENSG00000115484	ENST00000394440;ENST00000544079;ENST00000544185;ENST00000538252	T;T;T;T	0.81078	-1.45;-1.45;-1.45;-1.45	5.87	5.87	0.94306	.	0.041854	0.85682	D	0.000000	D	0.88680	0.6502	H	0.97291	3.975	0.54753	D	0.999989	B;B	0.18741	0.029;0.03	B;B	0.25759	0.063;0.046	D	0.87864	0.2666	10	0.87932	D	0	-15.0909	16.2496	0.82475	0.0:0.0:0.0:1.0	.	357;387	F5H5W3;P50991	.;TCPD_HUMAN	A	387;357;237;331	ENSP00000377958:T387A;ENSP00000443061:T357A;ENSP00000443451:T237A;ENSP00000442174:T331A	ENSP00000377958:T387A	T	-	1	0	CCT4	61953194	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.881000	0.87252	2.371000	0.80710	0.533000	0.62120	ACA		CCT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325548.2		
DYSF	8291	broad.mit.edu	37	2	71795413	71795413	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr2:71795413C>T	ENST00000258104.3	+	26	3032	c.2755C>T	c.(2755-2757)Cgc>Tgc	p.R919C	DYSF_ENST00000409366.1_Missense_Mutation_p.R920C|DYSF_ENST00000410020.3_Missense_Mutation_p.R937C|DYSF_ENST00000409744.1_Missense_Mutation_p.R906C|DYSF_ENST00000409582.3_Missense_Mutation_p.R936C|DYSF_ENST00000413539.2_Missense_Mutation_p.R950C|DYSF_ENST00000429174.2_Missense_Mutation_p.R919C|DYSF_ENST00000394120.2_Missense_Mutation_p.R920C|DYSF_ENST00000409651.1_Missense_Mutation_p.R951C|DYSF_ENST00000410041.1_Missense_Mutation_p.R937C|DYSF_ENST00000409762.1_Missense_Mutation_p.R936C	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	919					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)	p.R919C(1)		autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						GGACAGCTTCCGCCCCTCGGC	0.632																																					p.R951C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2851T	2						.						211.0	222.0	218.0					2																	71795413		2203	4300	6503	71648921	SO:0001583	missense	8291	exon27			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.2755C>T	2.37:g.71795413C>T	ENSP00000258104:p.Arg919Cys	Somatic		Capture	Illumina HiSeq	Phase_I	71648921	NM_001130982	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	ENST00000258104.3	37	CCDS1918.1	.	.	.	.	.	.	.	.	.	.	C	16.67	3.186634	0.57909	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	D;D;D;D;D;D;D;D;D;D;D	0.83419	-1.71;-1.72;-1.72;-1.71;-1.71;-1.71;-1.71;-1.71;-1.71;-1.72;-1.72	4.95	4.95	0.65309	Ferlin/Peroxisome membrane (1);	0.059627	0.64402	D	0.000002	D	0.85071	0.5613	L	0.38175	1.15	0.49582	D	0.999803	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.993;0.987;0.993;0.998;1.0;0.998;0.999;1.0;1.0;1.0	D;D;D;D;P;P;P;P;D;P;D;D;D;D	0.68943	0.961;0.961;0.961;0.961;0.827;0.781;0.827;0.827;0.961;0.862;0.921;0.947;0.961;0.915	D	0.85222	0.1027	10	0.52906	T	0.07	-21.8454	10.8993	0.47043	0.1877:0.8123:0.0:0.0	.	951;937;920;906;937;906;936;905;950;936;919;905;920;919	O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	C	950;936;936;919;919;951;920;906;920;937;937	ENSP00000407046:R950C;ENSP00000387137:R936C;ENSP00000386547:R936C;ENSP00000398305:R919C;ENSP00000258104:R919C;ENSP00000386683:R951C;ENSP00000377678:R920C;ENSP00000386285:R906C;ENSP00000386512:R920C;ENSP00000386881:R937C;ENSP00000386617:R937C	ENSP00000258104:R919C	R	+	1	0	DYSF	71648921	1.000000	0.71417	1.000000	0.80357	0.679000	0.39708	2.998000	0.49465	2.298000	0.77334	0.462000	0.41574	CGC		DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494	
SNRNP200	23020	broad.mit.edu	37	2	96944355	96944355	+	Silent	SNP	G	G	A	rs72937669	byFrequency	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr2:96944355G>A	ENST00000323853.5	-	38	5495	c.5418C>T	c.(5416-5418)gaC>gaT	p.D1806D	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	1806					ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.D1806D(1)		breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						CGTCCATCTCGTCCTCGATGC	0.577													G|||	18	0.00359425	0.0129	0.0014	5008	,	,		21332	0.0		0.0	False		,,,				2504	0.0				p.D1806D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5418T	2						.	G		44,4362	46.7+/-81.2	0,44,2159	107.0	97.0	101.0		5418	-9.4	0.5	2	dbSNP_130	101	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous	SNRNP200	NM_014014.4		0,47,6456	AA,AG,GG		0.0349,0.9986,0.3614		1806/2137	96944355	47,12959	2203	4300	6503	96308082	SO:0001819	synonymous_variant	23020	exon38			AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.5418C>T	2.37:g.96944355G>A		Somatic		Capture	Illumina HiSeq	Phase_I	96308082	NM_014014	O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Silent	SNP	ENST00000323853.5	37	CCDS2020.1																																																																																				SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2	NM_014014	
AFF3	3899	broad.mit.edu	37	2	100210168	100210168	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr2:100210168G>A	ENST00000409236.2	-	13	2067	c.1955C>T	c.(1954-1956)aCg>aTg	p.T652M	AFF3_ENST00000356421.2_Missense_Mutation_p.T677M|AFF3_ENST00000317233.4_Missense_Mutation_p.T652M|AFF3_ENST00000409579.1_Missense_Mutation_p.T677M			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	652					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)	p.T677M(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						TAGCCCCCGCGTGCGGCGCTT	0.632																																					p.T677M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2030T	2						.						59.0	64.0	63.0					2																	100210168		2203	4299	6502	99576600	SO:0001583	missense	3899	exon14			U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.1955C>T	2.37:g.100210168G>A	ENSP00000387207:p.Thr652Met	Somatic		Capture	Illumina HiSeq	Phase_I	99576600	NM_001025108	B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	ENST00000409236.2	37	CCDS42723.1	.	.	.	.	.	.	.	.	.	.	G	16.40	3.113561	0.56398	.	.	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236;ENST00000433370;ENST00000444786;ENST00000432288	T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1	5.17	4.28	0.50868	.	0.362216	0.26507	N	0.023987	T	0.71986	0.3405	L	0.59436	1.845	0.33979	D	0.647759	D;D;D	0.76494	0.999;0.999;0.988	D;D;P	0.65987	0.94;0.921;0.599	T	0.76987	-0.2755	10	0.33940	T	0.23	.	13.0792	0.59102	0.0775:0.0:0.9225:0.0	.	805;652;677	B7Z4I6;P51826;P51826-2	.;AFF3_HUMAN;.	M	652;677;677;652;652;805;677	ENSP00000317421:T652M;ENSP00000348793:T677M;ENSP00000386834:T677M;ENSP00000387207:T652M	ENSP00000317421:T652M	T	-	2	0	AFF3	99576600	0.000000	0.05858	0.947000	0.38551	0.757000	0.42996	0.240000	0.18042	2.426000	0.82243	0.561000	0.74099	ACG		AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328982.3	NM_002285	
SP110	3431	broad.mit.edu	37	2	231050789	231050789	+	Silent	SNP	G	G	A	rs115361843	byFrequency	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr2:231050789G>A	ENST00000358662.4	-	11	1278	c.1200C>T	c.(1198-1200)gaC>gaT	p.D400D	SP110_ENST00000540870.1_Silent_p.D406D|SP110_ENST00000392048.3_Silent_p.D398D|SP110_ENST00000258381.6_Silent_p.D400D|SP110_ENST00000258382.5_Silent_p.D400D|SP110_ENST00000338556.3_Silent_p.D102D	NM_004509.3	NP_004500	Q9HB58	SP110_HUMAN	SP110 nuclear body protein	400					regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)	p.D400D(1)		breast(4)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Renal(207;0.0112)|all_lung(227;0.0223)|Lung NSC(271;0.0983)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.169)		Epithelial(121;2.61e-12)|all cancers(144;6.39e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.0097)		AGGTTGAGTCGTCTTTCCTTT	0.473																																					p.D400D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1200T	2						.	G	,,,	0,4406		0,0,2203	197.0	168.0	178.0		1218,1200,1200,1200	-5.5	0.0	2	dbSNP_132	178	7,8593	5.7+/-21.5	0,7,4293	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SP110	NM_001185015.1,NM_004509.3,NM_004510.3,NM_080424.2	,,,	0,7,6496	AA,AG,GG		0.0814,0.0,0.0538	,,,	406/556,400/690,400/550,400/714	231050789	7,12999	2203	4300	6503	230759033	SO:0001819	synonymous_variant	3431	exon11			L22343	CCDS2474.1, CCDS2475.1, CCDS2476.1, CCDS54435.1	2q37.1	2014-09-17	2001-12-19	2001-12-20	ENSG00000135899	ENSG00000135899			5401	protein-coding gene	gene with protein product		604457	"""interferon-induced protein 41, 30kD"""	IFI41, IFI75		7693701, 10388521	Standard	NM_080424		Approved		uc002vqg.3	Q9HB58	OTTHUMG00000133204	ENST00000358662.4:c.1200C>T	2.37:g.231050789G>A		Somatic		Capture	Illumina HiSeq	Phase_I	230759033	NM_004510	B4DVI4|F5H1M1|Q14976|Q14977|Q53TG2|Q8WUZ6|Q9HCT8	Silent	SNP	ENST00000358662.4	37	CCDS2474.1																																																																																				SP110-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000332414.1	NM_080424	
MYH15	22989	broad.mit.edu	37	3	108248110	108248110	+	Splice_Site	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr3:108248110C>T	ENST00000273353.3	-	1	59	c.3G>A	c.(1-3)atG>atA	p.M1I		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.M1I(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						GTCCACTCACCATGATCTTTT	0.358																																					p.M1I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3A	3						.						84.0	80.0	81.0					3																	108248110		1856	4088	5944	109730800	SO:0001630	splice_region_variant	22989	exon1			AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.3+1G>A	3.37:g.108248110C>T		Somatic		Capture	Illumina HiSeq	Phase_I	109730800	NM_014981		Missense_Mutation	SNP	ENST00000273353.3	37	CCDS43127.1	.	.	.	.	.	.	.	.	.	.	C	14.04	2.416108	0.42918	.	.	ENSG00000144821	ENST00000273353	D	0.84873	-1.91	2.91	-3.98	0.04082	.	.	.	.	.	T	0.67664	0.2917	.	.	.	0.19575	N	0.999966	B	0.02656	0.0	B	0.01281	0.0	T	0.50792	-0.8786	7	.	.	.	.	4.4316	0.11531	0.0:0.4011:0.1876:0.4113	.	1	Q9Y2K3	MYH15_HUMAN	I	1	ENSP00000273353:M1I	.	M	-	3	0	MYH15	109730800	0.000000	0.05858	0.000000	0.03702	0.913000	0.54294	-0.238000	0.08977	-0.715000	0.04968	-0.369000	0.07265	ATG		MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988	Missense_Mutation
IQCB1	9657	broad.mit.edu	37	3	121489301	121489301	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr3:121489301G>A	ENST00000310864.6	-	15	1902	c.1688C>T	c.(1687-1689)cCc>cTc	p.P563L	IQCB1_ENST00000349820.6_Missense_Mutation_p.P430L	NM_001023570.2	NP_001018864.2	Q15051	IQCB1_HUMAN	IQ motif containing B1	563					cilium assembly (GO:0042384)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)	calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)	p.P563L(1)		NS(1)|biliary_tract(1)|breast(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|prostate(1)|skin(1)	30				GBM - Glioblastoma multiforme(114;0.0983)		CTTCCACCAGGGTGCTTGTAT	0.463																																					p.P563L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1688T	3						.						172.0	166.0	168.0					3																	121489301		2203	4300	6503	122971991	SO:0001583	missense	9657	exon15			D25278	CCDS33836.1, CCDS33837.1	3q21.1	2014-01-28	2004-09-02		ENSG00000173226	ENSG00000173226			28949	protein-coding gene	gene with protein product	"""nephrocystin-5"""	609237	"""IQ calmodulin-binding motif containing 1"""			15723066	Standard	NM_001023571		Approved	KIAA0036, NPHP5, SLSN5	uc010hre.1	Q15051	OTTHUMG00000128677	ENST00000310864.6:c.1688C>T	3.37:g.121489301G>A	ENSP00000311505:p.Pro563Leu	Somatic		Capture	Illumina HiSeq	Phase_I	122971991	NM_001023570	Q3KS08|Q3KS09|Q5DKQ7|Q8NI79|Q9BS08	Missense_Mutation	SNP	ENST00000310864.6	37	CCDS33837.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.253250	0.80135	.	.	ENSG00000173226	ENST00000310864;ENST00000349820	T;T	0.80653	-1.4;-1.4	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	D	0.88288	0.6396	M	0.65498	2.005	0.80722	D	1	D;D	0.89917	1.0;0.986	D;P	0.83275	0.996;0.73	D	0.88696	0.3212	10	0.87932	D	0	-8.322	14.7509	0.69525	0.0:0.0:1.0:0.0	.	563;430	Q15051;Q15051-2	IQCB1_HUMAN;.	L	563;430	ENSP00000311505:P563L;ENSP00000323756:P430L	ENSP00000311505:P563L	P	-	2	0	IQCB1	122971991	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.523000	0.60545	2.857000	0.98124	0.650000	0.86243	CCC		IQCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250573.1	NM_014642	
ALDH1L1	10840	broad.mit.edu	37	3	125872377	125872377	+	Silent	SNP	G	G	A	rs149145858		TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr3:125872377G>A	ENST00000393434.2	-	7	1117	c.768C>T	c.(766-768)ccC>ccT	p.P256P	ALDH1L1_ENST00000452905.2_Silent_p.P155P|ALDH1L1_ENST00000393431.2_Silent_p.P256P|ALDH1L1_ENST00000273450.3_Silent_p.P266P|ALDH1L1_ENST00000472186.1_Silent_p.P256P|ALDH1L1_ENST00000455064.2_Silent_p.P81P|ALDH1L1_ENST00000413612.1_5'UTR	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	256					10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)	p.P256P(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	CGTCTCCCTCGGGCACCAGGC	0.537																																					p.P256P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C768T	3						.	G		0,4406		0,0,2203	97.0	96.0	97.0		768	-8.5	0.6	3	dbSNP_134	97	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ALDH1L1	NM_012190.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		256/903	125872377	1,13005	2203	4300	6503	127355067	SO:0001819	synonymous_variant	10840	exon7			AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.768C>T	3.37:g.125872377G>A		Somatic		Capture	Illumina HiSeq	Phase_I	127355067	NM_012190	B4DG36|E9PBX3|Q68CS1	Silent	SNP	ENST00000393434.2	37	CCDS3034.1																																																																																				ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354391.1	NM_012190	
MLF1	4291	broad.mit.edu	37	3	158317840	158317840	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr3:158317840G>A	ENST00000355893.5	+	5	584	c.446G>A	c.(445-447)aGt>aAt	p.S149N	MLF1_ENST00000478894.2_Missense_Mutation_p.S139N|MLF1_ENST00000484955.1_Missense_Mutation_p.S124N|MLF1_ENST00000392822.3_Missense_Mutation_p.S180N|MLF1_ENST00000497004.1_3'UTR|MLF1_ENST00000471745.1_Missense_Mutation_p.S139N|MLF1_ENST00000469452.1_Missense_Mutation_p.S81N|MLF1_ENST00000359117.5_Missense_Mutation_p.S124N|MLF1_ENST00000482628.1_Missense_Mutation_p.S124N	NM_022443.4	NP_071888.1	P58340	MLF1_HUMAN	myeloid leukemia factor 1	149					cell cycle arrest (GO:0007050)|myeloid progenitor cell differentiation (GO:0002318)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)	p.S180N(1)		large_intestine(3)	3		Melanoma(1037;0.000458)|Prostate(884;0.0235)|all_neural(597;0.0299)	Lung(72;0.00199)|LUSC - Lung squamous cell carcinoma(72;0.00256)			GATTCTGACAGTGGACTAGAA	0.338			T	NPM1	AML																																p.S139N			Dom	yes		3	3q25.1	4291	myeloid leukemia factor 1		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G416A	3						.						82.0	89.0	87.0					3																	158317840		2203	4300	6503	159800534	SO:0001583	missense	4291	exon7			L49054	CCDS3182.1, CCDS46945.1, CCDS56286.1, CCDS56287.1, CCDS56288.1	3q25	2008-07-18			ENSG00000178053	ENSG00000178053			7125	protein-coding gene	gene with protein product	"""myeloid leukemia factor 1 variant 1"", ""myeloid leukemia factor 1 variant 2"", ""myeloid leukemia factor 1 variant 3"""	601402				8570204	Standard	NM_022443		Approved		uc003fcb.3	P58340	OTTHUMG00000158775	ENST00000355893.5:c.446G>A	3.37:g.158317840G>A	ENSP00000348157:p.Ser149Asn	Somatic		Capture	Illumina HiSeq	Phase_I	159800534	NM_001195434	E9PEU9|Q2TLE3|Q2TLE5|Q8N8F8|Q96MH1	Missense_Mutation	SNP	ENST00000355893.5	37	CCDS3182.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.576760	0.86645	.	.	ENSG00000178053	ENST00000491767;ENST00000355893;ENST00000484955;ENST00000359117;ENST00000498592;ENST00000477042;ENST00000471745;ENST00000469452;ENST00000482628;ENST00000478894;ENST00000392822;ENST00000466246	T;T;T;T;T;T;T;T;T;T	0.52057	0.79;0.68;0.71;0.71;0.75;0.77;0.76;0.71;0.77;0.74	6.06	5.2	0.72013	.	0.126819	0.64402	D	0.000001	T	0.65831	0.2729	L	0.61036	1.89	0.46241	D	0.998948	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.981;0.993;0.99	T	0.67515	-0.5651	10	0.51188	T	0.08	-11.0103	15.3434	0.74314	0.0665:0.0:0.9335:0.0	.	81;180;149	Q2TLE5;Q8N8F8;P58340	.;.;MLF1_HUMAN	N	75;149;124;124;104;139;139;81;124;139;180;164	ENSP00000420410:S75N;ENSP00000348157:S149N;ENSP00000417835:S124N;ENSP00000352025:S124N;ENSP00000419636:S104N;ENSP00000420134:S139N;ENSP00000418595:S81N;ENSP00000417141:S124N;ENSP00000417777:S139N;ENSP00000376568:S180N	ENSP00000348157:S149N	S	+	2	0	MLF1	159800534	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.303000	0.65738	1.582000	0.49881	0.650000	0.86243	AGT		MLF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352164.3	NM_022443	
ZCWPW2	152098	broad.mit.edu	37	3	28454693	28454693	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr3:28454693C>T	ENST00000383768.2	+	3	322	c.134C>T	c.(133-135)tCa>tTa	p.S45L	ZCWPW2_ENST00000421010.1_Missense_Mutation_p.S45L			Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2	45							zinc ion binding (GO:0008270)	p.S45L(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(6)|ovary(2)	17						AGATTGTTATCAAGTGAGGAT	0.353																																					p.S45L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C134T	3						.						137.0	131.0	133.0					3																	28454693		2203	4300	6503	28429697	SO:0001583	missense	152098	exon2			BC065764	CCDS33723.1	3p23	2005-08-22			ENSG00000206559	ENSG00000206559			23574	protein-coding gene	gene with protein product						14607086	Standard	XM_005264892		Approved	ZCW2	uc003cei.3	Q504Y3	OTTHUMG00000155705	ENST00000383768.2:c.134C>T	3.37:g.28454693C>T	ENSP00000373278:p.Ser45Leu	Somatic		Capture	Illumina HiSeq	Phase_I	28429697	NM_001040432		Missense_Mutation	SNP	ENST00000383768.2	37	CCDS33723.1	.	.	.	.	.	.	.	.	.	.	C	19.05	3.751436	0.69533	.	.	ENSG00000206559	ENST00000420223;ENST00000383768;ENST00000421010	T;T	0.32023	1.47;1.47	5.46	4.58	0.56647	Zinc finger, CW-type (2);	0.327135	0.22381	N	0.060811	T	0.27313	0.0670	L	0.45285	1.41	0.29178	N	0.876667	B	0.20052	0.041	B	0.23419	0.046	T	0.18871	-1.0323	10	0.52906	T	0.07	-3.1557	10.1793	0.42957	0.0:0.9074:0.0:0.0926	.	45	Q504Y3	ZCPW2_HUMAN	L	45	ENSP00000373278:S45L;ENSP00000412386:S45L	ENSP00000373278:S45L	S	+	2	0	ZCWPW2	28429697	1.000000	0.71417	0.997000	0.53966	0.924000	0.55760	1.931000	0.40134	1.304000	0.44892	0.591000	0.81541	TCA		ZCWPW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341318.1	XM_087384	
CLASP2	23122	broad.mit.edu	37	3	33725930	33725930	+	Silent	SNP	A	A	G			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr3:33725930A>G	ENST00000468888.2	-	6	611	c.565T>C	c.(565-567)Ttg>Ctg	p.L189L	CLASP2_ENST00000359576.5_Silent_p.L189L|CLASP2_ENST00000307312.7_5'UTR|CLASP2_ENST00000399362.4_Silent_p.L189L			O75122	CLAP2_HUMAN	cytoplasmic linker associated protein 2	1242					axon guidance (GO:0007411)|establishment or maintenance of cell polarity (GO:0007163)|fucosylation (GO:0036065)|microtubule anchoring (GO:0034453)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of microtubule-based process (GO:0032886)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)|microtubule plus-end binding (GO:0051010)	p.L189L(1)		breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	48						ACTATAGCCAATATTGCAGCA	0.338																																					p.L189L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T565C	3						.						136.0	134.0	134.0					3																	33725930		1814	4082	5896	33700934	SO:0001819	synonymous_variant	23122	exon6			AB014527		3p24.3	2013-01-18			ENSG00000163539	ENSG00000163539			17078	protein-coding gene	gene with protein product		605853				9734811, 10899121	Standard	NM_015097		Approved	KIAA0627	uc021wvc.1	O75122	OTTHUMG00000156489	ENST00000468888.2:c.565T>C	3.37:g.33725930A>G		Somatic		Capture	Illumina HiSeq	Phase_I	33700934	NM_015097	Q7L8F6|Q8N6R6|Q9BQT3|Q9BQT4|Q9H7A3|Q9NSZ2	Silent	SNP	ENST00000468888.2	37																																																																																					CLASP2-001	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000344320.4	NM_001207044	
KIF9	64147	broad.mit.edu	37	3	47282501	47282501	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr3:47282501C>T	ENST00000265529.3	-	18	2394	c.1714G>A	c.(1714-1716)Gac>Aac	p.D572N	KIF9_ENST00000352910.4_Missense_Mutation_p.D414N|KIF9_ENST00000487440.1_5'UTR|KIF9-AS1_ENST00000429315.3_RNA|KIF9_ENST00000452770.2_Missense_Mutation_p.D572N|KIF9_ENST00000444589.2_Missense_Mutation_p.D507N|KIF9_ENST00000335044.2_Missense_Mutation_p.D572N			Q9HAQ2	KIF9_HUMAN	kinesin family member 9	572					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|extracellular matrix disassembly (GO:0022617)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle disassembly (GO:1903008)|regulation of podosome assembly (GO:0071801)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|podosome (GO:0002102)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|protein dimerization activity (GO:0046983)	p.D572N(1)		central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(15)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)	34		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000284)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		GGTGGGGTGTCGGGCCTTGAG	0.478																																					p.D572N	Colon(44;962 1147 15977 24541)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1714A	3						.						72.0	75.0	74.0					3																	47282501		2203	4300	6503	47257505	SO:0001583	missense	64147	exon17			AF311212	CCDS2751.1, CCDS2752.1	3p21.31	2008-03-03			ENSG00000088727	ENSG00000088727		"""Kinesins"""	16666	protein-coding gene	gene with protein product		607910				11483511	Standard	NM_022342		Approved	MGC104186	uc003cqx.3	Q9HAQ2	OTTHUMG00000133512	ENST00000265529.3:c.1714G>A	3.37:g.47282501C>T	ENSP00000265529:p.Asp572Asn	Somatic		Capture	Illumina HiSeq	Phase_I	47257505	NM_182902	Q86Z28|Q9H8A4	Missense_Mutation	SNP	ENST00000265529.3	37	CCDS2752.1	.	.	.	.	.	.	.	.	.	.	C	12.00	1.806488	0.31961	.	.	ENSG00000088727	ENST00000335044;ENST00000265529;ENST00000444589;ENST00000452770;ENST00000352910	T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9	5.84	2.15	0.27550	.	0.192471	0.56097	D	0.000033	T	0.22666	0.0547	N	0.14661	0.345	0.29044	N	0.884899	B;B	0.13145	0.001;0.007	B;B	0.04013	0.001;0.001	T	0.12243	-1.0555	10	0.32370	T	0.25	.	8.536	0.33364	0.0:0.2412:0.0:0.7588	.	507;572	Q9HAQ2-2;Q9HAQ2	.;KIF9_HUMAN	N	572;572;507;572;414	ENSP00000333942:D572N;ENSP00000265529:D572N;ENSP00000414987:D507N;ENSP00000391100:D572N;ENSP00000292334:D414N	ENSP00000265529:D572N	D	-	1	0	KIF9	47257505	1.000000	0.71417	0.983000	0.44433	0.360000	0.29518	1.348000	0.33987	0.487000	0.27698	-0.302000	0.09304	GAC		KIF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257475.2		
CNTN3	5067	broad.mit.edu	37	3	74474046	74474046	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr3:74474046C>T	ENST00000263665.6	-	4	431	c.404G>A	c.(403-405)cGt>cAt	p.R135H		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	135	Ig-like C2-type 2.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.R135H(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		CTGGCCTTCACGCACAGACAC	0.398																																					p.R135H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G404A	3						.						85.0	76.0	79.0					3																	74474046		2203	4300	6503	74556736	SO:0001583	missense	5067	exon4			AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.404G>A	3.37:g.74474046C>T	ENSP00000263665:p.Arg135His	Somatic		Capture	Illumina HiSeq	Phase_I	74556736	NM_020872	B9EK50|Q9H039	Missense_Mutation	SNP	ENST00000263665.6	37	CCDS33790.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.384232	0.82792	.	.	ENSG00000113805	ENST00000263665	T	0.13307	2.6	5.18	5.18	0.71444	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.21387	0.0515	M	0.77103	2.36	0.80722	D	1	P	0.37525	0.598	B	0.36534	0.227	T	0.02214	-1.1194	10	0.39692	T	0.17	.	16.5611	0.84566	0.0:1.0:0.0:0.0	.	135	Q9P232	CNTN3_HUMAN	H	135	ENSP00000263665:R135H	ENSP00000263665:R135H	R	-	2	0	CNTN3	74556736	1.000000	0.71417	0.990000	0.47175	0.959000	0.62525	6.814000	0.75236	2.574000	0.86865	0.549000	0.68633	CGT		CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352306.1	NM_020872	
IFT80	57560	broad.mit.edu	37	3	159996992	159996992	+	Missense_Mutation	SNP	G	G	A	rs186192085	byFrequency	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr3:159996992G>A	ENST00000326448.7	-	16	2257	c.1825C>T	c.(1825-1827)Cgc>Tgc	p.R609C	RP11-432B6.3_ENST00000483754.1_Missense_Mutation_p.R780C|IFT80_ENST00000496589.1_Missense_Mutation_p.R472C|IFT80_ENST00000483465.1_Missense_Mutation_p.R472C	NM_020800.2	NP_065851.1	Q9P2H3	IFT80_HUMAN	intraflagellar transport 80	609					bone morphogenesis (GO:0060349)|chondrocyte differentiation (GO:0002062)|cilium assembly (GO:0042384)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|osteoblast differentiation (GO:0001649)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)		p.R609C(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(12)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			TTAACAAAGCGACAAAGTCTC	0.353													G|||	2	0.000399361	0.0	0.0014	5008	,	,		17885	0.0		0.0	False		,,,				2504	0.001				p.R472C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1414T	3						.						81.0	78.0	79.0					3																	159996992		2203	4300	6503	161479686	SO:0001583	missense	57560	exon15			AB037795	CCDS3188.1, CCDS54668.1	3q25.33	2014-07-03	2014-07-03	2005-11-02	ENSG00000068885	ENSG00000068885		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29262	protein-coding gene	gene with protein product		611177	"""WD repeat domain 56"", ""intraflagellar transport 80 homolog (Chlamydomonas)"""	WDR56		10718198	Standard	NM_020800		Approved	KIAA1374	uc021xgq.1	Q9P2H3	OTTHUMG00000158953	ENST00000326448.7:c.1825C>T	3.37:g.159996992G>A	ENSP00000312778:p.Arg609Cys	Somatic		Capture	Illumina HiSeq	Phase_I	161479686	NM_001190242	B4E0K1|C9J8I0|Q3MJC4|Q86YF4|Q9UIX1	Missense_Mutation	SNP	ENST00000326448.7	37	CCDS3188.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	21.5	4.162685	0.78226	.	.	ENSG00000068885	ENST00000326448;ENST00000483465;ENST00000496589	D;D;D	0.82984	-1.67;-1.67;-1.67	6.16	6.16	0.99307	.	0.000000	0.64402	U	0.000013	D	0.84977	0.5592	M	0.88906	2.99	0.80722	D	1	B	0.29955	0.263	B	0.20767	0.031	D	0.84303	0.0506	10	0.87932	D	0	-14.0768	14.6998	0.69147	0.0:0.0:0.7448:0.2551	.	609	Q9P2H3	IFT80_HUMAN	C	609;472;472	ENSP00000312778:R609C;ENSP00000418196:R472C;ENSP00000420646:R472C	ENSP00000312778:R609C	R	-	1	0	IFT80	161479686	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.225000	0.58600	2.937000	0.99478	0.650000	0.86243	CGC		IFT80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352651.2	NM_020800	
FAT4	79633	broad.mit.edu	37	4	126373648	126373648	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr4:126373648T>A	ENST00000394329.3	+	9	11490	c.11477T>A	c.(11476-11478)gTa>gAa	p.V3826E	FAT4_ENST00000335110.5_Missense_Mutation_p.V2124E	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3826	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V3826E(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GTGAGCTCCGTATTAAAAAGC	0.502																																					p.V3826E												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T11477A	4						.						86.0	86.0	86.0					4																	126373648		2203	4300	6503	126593098	SO:0001583	missense	79633	exon9			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.11477T>A	4.37:g.126373648T>A	ENSP00000377862:p.Val3826Glu	Somatic		Capture	Illumina HiSeq	Phase_I	126593098	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	T	0.012	-1.659225	0.00772	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.74526	-0.71;-0.85	5.47	-10.9	0.00192	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	2.042920	0.04412	N	0.366239	T	0.35740	0.0942	N	0.01874	-0.695	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.29640	-1.0005	10	0.02654	T	1	.	6.558	0.22471	0.164:0.526:0.0772:0.2329	.	2124;3826;3826	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	E	3826;2124	ENSP00000377862:V3826E;ENSP00000335169:V2124E	ENSP00000335169:V2124E	V	+	2	0	FAT4	126593098	0.000000	0.05858	0.000000	0.03702	0.198000	0.23893	-0.079000	0.11357	-2.310000	0.00650	-0.379000	0.06801	GTA		FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
NR3C2	4306	broad.mit.edu	37	4	149357481	149357481	+	Missense_Mutation	SNP	G	G	A	rs375487193		TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr4:149357481G>A	ENST00000358102.3	-	2	894	c.532C>T	c.(532-534)Cgc>Tgc	p.R178C	NR3C2_ENST00000512865.1_Missense_Mutation_p.R178C|NR3C2_ENST00000511528.1_Missense_Mutation_p.R178C|NR3C2_ENST00000355292.3_Missense_Mutation_p.R178C|NR3C2_ENST00000344721.4_Missense_Mutation_p.R178C	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	178	Modulating.				gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.R178C(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	ACAACGGCGCGCATGACGCCA	0.502																																					p.R178C	Melanoma(27;428 957 40335 51025 51111)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C532T	4						.	G	CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	106.0	106.0	106.0		532,532	4.5	1.0	4		106	0,8600		0,0,4300	no	missense,missense	NR3C2	NM_000901.4,NM_001166104.1	180,180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	178/985,178/868	149357481	1,13005	2203	4300	6503	149576931	SO:0001583	missense	4306	exon2			M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.532C>T	4.37:g.149357481G>A	ENSP00000350815:p.Arg178Cys	Somatic		Capture	Illumina HiSeq	Phase_I	149576931	NM_001166104	B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Missense_Mutation	SNP	ENST00000358102.3	37	CCDS3772.1	.	.	.	.	.	.	.	.	.	.	G	9.405	1.078946	0.20227	2.27E-4	0.0	ENSG00000151623	ENST00000344721;ENST00000355292;ENST00000358102;ENST00000512865;ENST00000544252;ENST00000342437;ENST00000511528	D;D;D;D;D;D	0.90133	-2.62;-2.62;-2.62;-2.2;-2.21;-2.62	5.38	4.54	0.55810	.	0.688531	0.14729	N	0.301876	D	0.85737	0.5766	L	0.36672	1.1	0.42829	D	0.994014	B;D	0.61080	0.003;0.989	B;B	0.44163	0.001;0.443	T	0.82165	-0.0592	9	.	.	.	.	9.1999	0.37251	0.0738:0.0:0.7821:0.1441	.	178;178	B0ZBF5;B0ZBF6	.;.	C	178	ENSP00000341390:R178C;ENSP00000347441:R178C;ENSP00000350815:R178C;ENSP00000423510:R178C;ENSP00000343907:R178C;ENSP00000421481:R178C	.	R	-	1	0	NR3C2	149576931	1.000000	0.71417	0.964000	0.40570	0.154000	0.21943	4.934000	0.63491	1.265000	0.44215	0.467000	0.42956	CGC		NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364986.1		
GLRB	2743	broad.mit.edu	37	4	158091817	158091817	+	Silent	SNP	A	A	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr4:158091817A>T	ENST00000264428.4	+	10	1701	c.1431A>T	c.(1429-1431)gcA>gcT	p.A477A	GLRB_ENST00000512619.1_3'UTR|GLRB_ENST00000541722.1_3'UTR|GLRB_ENST00000509282.1_Silent_p.A477A	NM_000824.4	NP_000815.1	P48167	GLRB_HUMAN	glycine receptor, beta	477					acrosome reaction (GO:0007340)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|extracellular-glycine-gated ion channel activity (GO:0016933)|glycine binding (GO:0016594)	p.A477A(1)		central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(6)|skin(5)|upper_aerodigestive_tract(1)	27	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0564)|COAD - Colon adenocarcinoma(41;0.0642)|Kidney(143;0.0707)	Enflurane(DB00228)|Glycine(DB00145)|Lindane(DB00431)	ATCTTTATGCAAGAGCATTGT	0.348																																					p.A477A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1431T	4						.						116.0	117.0	117.0					4																	158091817		2203	4300	6503	158311267	SO:0001819	synonymous_variant	2743	exon10			U33267	CCDS3796.1, CCDS54813.1	4q31.3	2008-02-05			ENSG00000109738	ENSG00000109738			4329	protein-coding gene	gene with protein product		138492				9676428, 8717357	Standard	NM_000824		Approved		uc003ipj.2	P48167	OTTHUMG00000161954	ENST00000264428.4:c.1431A>T	4.37:g.158091817A>T		Somatic		Capture	Illumina HiSeq	Phase_I	158311267	NM_001166060	A8K3K2|D3DP23|F5GWE1	Silent	SNP	ENST00000264428.4	37	CCDS3796.1																																																																																				GLRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366507.1	NM_000824	
FSTL5	56884	broad.mit.edu	37	4	162376202	162376202	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr4:162376202C>T	ENST00000306100.5	-	15	2231	c.1795G>A	c.(1795-1797)Gat>Aat	p.D599N	FSTL5_ENST00000427802.2_Missense_Mutation_p.D589N|FSTL5_ENST00000536695.1_Missense_Mutation_p.D598N|FSTL5_ENST00000379164.4_Missense_Mutation_p.D598N	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	599						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.D599fs*14(1)|p.D599N(1)		central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		AAAAAATCATCCACTCTGTCA	0.413																																					p.D599N												.	.	2	Substitution - Missense(1)|Deletion - Frameshift(1)	large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	c.G1795A	4						.						171.0	127.0	142.0					4																	162376202		2203	4300	6503	162595652	SO:0001583	missense	56884	exon15			BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.1795G>A	4.37:g.162376202C>T	ENSP00000305334:p.Asp599Asn	Somatic		Capture	Illumina HiSeq	Phase_I	162595652	NM_020116	E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	ENST00000306100.5	37	CCDS3802.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.870929	0.91587	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	T;T;T;T	0.29397	1.57;1.57;1.57;1.57	5.24	5.24	0.73138	WD40/YVTN repeat-like-containing domain (1);	0.094002	0.64402	D	0.000001	T	0.43033	0.1229	M	0.72118	2.19	0.80722	D	1	P;P;P	0.46395	0.877;0.799;0.799	P;B;B	0.45829	0.494;0.275;0.343	T	0.47497	-0.9113	10	0.72032	D	0.01	.	18.1706	0.89744	0.0:1.0:0.0:0.0	.	589;598;599	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	N	599;598;589;598	ENSP00000305334:D599N;ENSP00000368462:D598N;ENSP00000389270:D589N;ENSP00000440409:D598N	ENSP00000305334:D599N	D	-	1	0	FSTL5	162595652	1.000000	0.71417	0.997000	0.53966	0.972000	0.66771	7.231000	0.78106	2.606000	0.88127	0.655000	0.94253	GAT		FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	NM_020116	
TMPRSS11F	389208	broad.mit.edu	37	4	68934470	68934470	+	Silent	SNP	G	G	C			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr4:68934470G>C	ENST00000356291.2	-	7	680	c.621C>G	c.(619-621)gtC>gtG	p.V207V	UBA6-AS1_ENST00000499180.2_RNA|UBA6-AS1_ENST00000511571.1_RNA|UBA6-AS1_ENST00000500538.2_RNA	NM_207407.2	NP_997290.2	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F	207	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)	p.V207V(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(4)	39						CCCTTCCTTGGACAATTCTTT	0.478																																					p.V207V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C621G	4						.						117.0	105.0	109.0					4																	68934470		2203	4300	6503	68617065	SO:0001819	synonymous_variant	389208	exon7			AK122625	CCDS3520.1	4q13.2	2010-04-13			ENSG00000198092	ENSG00000198092		"""Serine peptidases / Transmembrane"""	29994	protein-coding gene	gene with protein product							Standard	NM_207407		Approved	FLJ16046	uc003hdt.1	Q6ZWK6	OTTHUMG00000129307	ENST00000356291.2:c.621C>G	4.37:g.68934470G>C		Somatic		Capture	Illumina HiSeq	Phase_I	68617065	NM_207407	A8MXX2	Silent	SNP	ENST00000356291.2	37	CCDS3520.1																																																																																				TMPRSS11F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251439.1	NM_207407	
AFM	173	broad.mit.edu	37	4	74357723	74357723	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr4:74357723A>C	ENST00000226355.3	+	8	1071	c.978A>C	c.(976-978)ttA>ttC	p.L326F		NM_001133.2	NP_001124.1	P43652	AFAM_HUMAN	afamin	326	Albumin 2. {ECO:0000255|PROSITE- ProRule:PRU00769}.				vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	vitamin E binding (GO:0008431)	p.L326F(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CAAAGGATTTATCTCTAAGAG	0.373																																					p.L326F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A978C	4						.						81.0	84.0	83.0					4																	74357723		2203	4300	6503	74576587	SO:0001583	missense	173	exon8			L32140	CCDS3557.1	4q13.3	2008-06-11			ENSG00000079557	ENSG00000079557			316	protein-coding gene	gene with protein product		104145				7517938	Standard	NM_001133		Approved	ALB2, ALBA	uc003hhb.3	P43652	OTTHUMG00000130004	ENST00000226355.3:c.978A>C	4.37:g.74357723A>C	ENSP00000226355:p.Leu326Phe	Somatic		Capture	Illumina HiSeq	Phase_I	74576587	NM_001133	A8K3E1|Q32MR3|Q4W5C5	Missense_Mutation	SNP	ENST00000226355.3	37	CCDS3557.1	.	.	.	.	.	.	.	.	.	.	A	15.35	2.808253	0.50421	.	.	ENSG00000079557	ENST00000226355	T	0.75589	-0.95	4.54	1.94	0.25998	Serum albumin-like (1);Serum albumin, N-terminal (3);	0.333399	0.24456	N	0.038379	D	0.82879	0.5133	M	0.87827	2.91	0.09310	N	1	D	0.69078	0.997	D	0.65874	0.939	T	0.71892	-0.4455	10	0.87932	D	0	.	3.8629	0.09004	0.7108:0.0:0.1047:0.1845	.	326	P43652	AFAM_HUMAN	F	326	ENSP00000226355:L326F	ENSP00000226355:L326F	L	+	3	2	AFM	74576587	0.172000	0.23043	0.205000	0.23548	0.954000	0.61252	0.645000	0.24782	0.626000	0.30322	0.248000	0.18094	TTA		AFM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252275.2		
SPATA4	132851	broad.mit.edu	37	4	177109270	177109270	+	Splice_Site	SNP	G	G	A	rs142260014		TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr4:177109270G>A	ENST00000280191.2	-	5	913	c.805C>T	c.(805-807)Cca>Tca	p.P269S	SPATA4_ENST00000515234.1_Splice_Site_p.P96S	NM_144644.2	NP_653245.2	Q8NEY3	SPAT4_HUMAN	spermatogenesis associated 4	269						cytoplasm (GO:0005737)		p.P269S(1)		NS(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)	22		Breast(14;0.0011)|Prostate(90;0.0129)|Melanoma(52;0.0133)|Renal(120;0.0376)|all_hematologic(60;0.124)		all cancers(43;2.9e-20)|Epithelial(43;1.99e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.58e-09)|GBM - Glioblastoma multiforme(59;0.000162)|STAD - Stomach adenocarcinoma(60;0.000543)|LUSC - Lung squamous cell carcinoma(193;0.096)		TAAAACTTACGTAAAACAGGG	0.328																																					p.P269S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C805T	4						.	G	SER/PRO	1,4405	2.1+/-5.4	0,1,2202	58.0	63.0	61.0		805	-8.8	0.0	4	dbSNP_134	61	1,8599	1.2+/-3.3	0,1,4299	yes	missense-near-splice	SPATA4	NM_144644.2	74	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign	269/306	177109270	2,13004	2203	4300	6503	177346264	SO:0001630	splice_region_variant	132851	exon5			AY040204	CCDS3826.1	4q34.2	2008-02-05			ENSG00000150628	ENSG00000150628			17333	protein-coding gene	gene with protein product		609879					Standard	NM_144644		Approved	TSARG2, SPEF1B	uc003iuo.1	Q8NEY3	OTTHUMG00000160788	ENST00000280191.2:c.805+1C>T	4.37:g.177109270G>A		Somatic		Capture	Illumina HiSeq	Phase_I	177346264	NM_144644	Q8NCS5|Q8WW15	Missense_Mutation	SNP	ENST00000280191.2	37	CCDS3826.1	.	.	.	.	.	.	.	.	.	.	G	3.674	-0.066955	0.07273	2.27E-4	1.16E-4	ENSG00000150628	ENST00000280191;ENST00000515234	T	0.41400	1.0	4.42	-8.84	0.00803	.	4.529290	0.00597	N	0.000365	T	0.19685	0.0473	N	0.14661	0.345	0.09310	N	0.999997	B	0.10296	0.003	B	0.04013	0.001	T	0.16660	-1.0395	9	.	.	.	.	2.5489	0.04743	0.1083:0.3732:0.1981:0.3204	.	269	Q8NEY3	SPAT4_HUMAN	S	269;96	ENSP00000280191:P269S	.	P	-	1	0	SPATA4	177346264	0.000000	0.05858	0.000000	0.03702	0.186000	0.23388	-4.293000	0.00258	-4.385000	0.00052	-0.479000	0.04858	CCA		SPATA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362326.1	NM_144644	Missense_Mutation
APC	324	broad.mit.edu	37	5	112173917	112173917	+	Nonsense_Mutation	SNP	C	C	T	rs121913333		TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr5:112173917C>T	ENST00000457016.1	+	16	3006	c.2626C>T	c.(2626-2628)Cga>Tga	p.R876*	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Nonsense_Mutation_p.R876*|APC_ENST00000257430.4_Nonsense_Mutation_p.R876*			P25054	APC_HUMAN	adenomatous polyposis coli	876	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R876*(38)|p.S874_R876>*(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TTCTTCAAAGCGAGGTTTGCA	0.463		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R858X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Nonsense,0 	.	40	Substitution - Nonsense(38)|Unknown(1)|Complex - deletion inframe(1)	large_intestine(37)|lung(1)|breast(1)|skin(1)	c.C2572T	5	GRCh37	CM942020	APC	M	rs121913333	.						70.0	72.0	71.0					5																	112173917		2202	4300	6502	112201816	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2626C>T	5.37:g.112173917C>T	ENSP00000413133:p.Arg876*	Somatic		Capture	Illumina HiSeq	Phase_I	112201816	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	37	6.588996	0.97688	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.92	4.09	0.47781	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.2738	14.8639	0.70401	0.3912:0.6088:0.0:0.0	.	.	.	.	X	876;858;876;876;876	.	ENSP00000257430:R876X	R	+	1	2	APC	112201816	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.385000	0.34408	0.785000	0.33685	0.557000	0.71058	CGA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PCDHA13	56136	broad.mit.edu	37	5	140264030	140264030	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr5:140264030C>T	ENST00000289272.2	+	1	2177	c.2177C>T	c.(2176-2178)cCg>cTg	p.P726L	PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA13_ENST00000409494.1_Missense_Mutation_p.P726L|PCDHA4_ENST00000530339.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	726					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P726L(1)		NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCTCGGCACCGCCCACCGAG	0.647																																					p.P726L	Melanoma(147;1739 1852 5500 27947 37288)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2177T	5						.						55.0	56.0	56.0					5																	140264030		2203	4299	6502	140244214	SO:0001583	missense	56136	exon1			AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.2177C>T	5.37:g.140264030C>T	ENSP00000289272:p.Pro726Leu	Somatic		Capture	Illumina HiSeq	Phase_I	140244214	NM_031865	O75277	Missense_Mutation	SNP	ENST00000289272.2	37	CCDS4240.1	.	.	.	.	.	.	.	.	.	.	C	0.027	-1.361579	0.01235	.	.	ENSG00000239389	ENST00000409494;ENST00000289272	T;T	0.11385	2.78;2.78	4.08	2.16	0.27623	.	.	.	.	.	T	0.07908	0.0198	L	0.55990	1.75	0.09310	N	1	B;B;B	0.16802	0.007;0.019;0.012	B;B;B	0.12837	0.001;0.006;0.008	T	0.45011	-0.9290	9	0.09590	T	0.72	.	0.6424	0.00813	0.302:0.3218:0.1831:0.1931	.	726;726;726	Q9Y5I0;C9JA99;Q9Y5I0-2	PCDAD_HUMAN;.;.	L	726	ENSP00000386821:P726L;ENSP00000289272:P726L	ENSP00000289272:P726L	P	+	2	0	PCDHA13	140244214	0.000000	0.05858	0.007000	0.13788	0.012000	0.07955	-0.893000	0.04127	0.261000	0.21753	0.655000	0.94253	CCG		PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335000.1	NM_018904	
SPEF2	79925	broad.mit.edu	37	5	35641565	35641565	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr5:35641565G>A	ENST00000356031.3	+	3	348	c.194G>A	c.(193-195)cGc>cAc	p.R65H	SPEF2_ENST00000282469.6_Missense_Mutation_p.R65H|SPEF2_ENST00000440995.2_Missense_Mutation_p.R65H|SPEF2_ENST00000509059.1_Missense_Mutation_p.R65H	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	65	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)		p.R65H(2)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AATTTTTCTCGCTTGGAGCCA	0.373																																					p.R65H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G194A	5						.						83.0	86.0	85.0					5																	35641565		2203	4300	6503	35677322	SO:0001583	missense	79925	exon3			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.194G>A	5.37:g.35641565G>A	ENSP00000348314:p.Arg65His	Somatic		Capture	Illumina HiSeq	Phase_I	35677322	NM_024867	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	ENST00000356031.3	37	CCDS43309.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.761602	0.89932	.	.	ENSG00000152582	ENST00000282469;ENST00000356031;ENST00000509059;ENST00000510777;ENST00000440995	T;T;T;T;T	0.23950	1.88;1.88;1.88;1.88;1.88	5.93	5.93	0.95920	Calponin homology domain (1);	0.000000	0.85682	D	0.000000	T	0.52789	0.1756	M	0.75777	2.31	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.987	T	0.50947	-0.8767	10	0.59425	D	0.04	.	16.6094	0.84858	0.0:0.0:0.8694:0.1306	.	65;65;65	D6REZ4;Q9C093;Q9C093-3	.;SPEF2_HUMAN;.	H	65	ENSP00000282469:R65H;ENSP00000348314:R65H;ENSP00000421593:R65H;ENSP00000426259:R65H;ENSP00000412125:R65H	ENSP00000282469:R65H	R	+	2	0	SPEF2	35677322	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.416000	0.66417	2.814000	0.96858	0.655000	0.94253	CGC		SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722	
PCDHB6	56130	broad.mit.edu	37	5	140531943	140531943	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr5:140531943C>T	ENST00000231136.1	+	1	2105	c.2105C>T	c.(2104-2106)tCg>tTg	p.S702L	PCDHB6_ENST00000543635.1_Missense_Mutation_p.S566L	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	702					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.S702L(1)		cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTCCTCTTTTCGGTGCTCCTG	0.687																																					p.S702L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2105T	5						.						83.0	93.0	89.0					5																	140531943		2201	4288	6489	140512127	SO:0001583	missense	56130	exon1			AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.2105C>T	5.37:g.140531943C>T	ENSP00000231136:p.Ser702Leu	Somatic		Capture	Illumina HiSeq	Phase_I	140512127	NM_018939	B2R8R9	Missense_Mutation	SNP	ENST00000231136.1	37	CCDS4248.1	.	.	.	.	.	.	.	.	.	.	C	17.17	3.320921	0.60634	.	.	ENSG00000113211	ENST00000543635;ENST00000231136	T;T	0.20463	2.07;2.07	4.55	2.65	0.31530	.	.	.	.	.	T	0.55705	0.1937	M	0.92649	3.33	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.55573	-0.8120	9	0.87932	D	0	.	14.5088	0.67769	0.0:0.5788:0.4212:0.0	.	702	Q9Y5E3	PCDB6_HUMAN	L	566;702	ENSP00000438466:S566L;ENSP00000231136:S702L	ENSP00000231136:S702L	S	+	2	0	PCDHB6	140512127	0.001000	0.12720	0.003000	0.11579	0.751000	0.42716	0.519000	0.22862	0.410000	0.25675	0.556000	0.70494	TCG		PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939	
SLC35B3	51000	broad.mit.edu	37	6	8430341	8430341	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr6:8430341G>T	ENST00000379660.4	-	3	502	c.53C>A	c.(52-54)aCc>aAc	p.T18N	SLC35B3_ENST00000339306.5_Missense_Mutation_p.T18N|SLC35B3_ENST00000426876.1_Missense_Mutation_p.T84N	NM_001142540.1|NM_001142541.1|NM_015948.3	NP_001136012.1|NP_001136013.1|NP_057032.2	Q9H1N7	S35B3_HUMAN	solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B3	18					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.T18N(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(1)|prostate(1)	15	Ovarian(93;0.0569)					ATTTTTGTTGGTTTCCTGGAC	0.333																																					p.T18N	Melanoma(83;700 1353 9357 11478 30548)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C53A	6						.						153.0	147.0	149.0					6																	8430341		2203	4300	6503	8375340	SO:0001583	missense	51000	exon3			AF132953	CCDS4508.1	6p24.3	2013-07-17	2013-07-17	2003-09-10	ENSG00000124786	ENSG00000124786		"""Solute carriers"""	21601	protein-coding gene	gene with protein product	"""3' phosphoadenosine 5' phosphosulfate transporter 2"""	610845	"""chromosome 6 open reading frame 196"", ""solute carrier family 35, member B3"""	C6orf196		10810093	Standard	XM_005249156		Approved	CGI-19, dJ453H5.1, PAPST2	uc010joe.3	Q9H1N7	OTTHUMG00000014224	ENST00000379660.4:c.53C>A	6.37:g.8430341G>T	ENSP00000368981:p.Thr18Asn	Somatic		Capture	Illumina HiSeq	Phase_I	8375340	NM_001142541	A6NKX9|Q1XH11|Q6MZJ0|Q7Z662|Q9Y308	Missense_Mutation	SNP	ENST00000379660.4	37	CCDS4508.1	.	.	.	.	.	.	.	.	.	.	G	6.659	0.490067	0.12702	.	.	ENSG00000124786	ENST00000379660;ENST00000339306;ENST00000426876	T;T	0.45668	1.5;0.89	5.59	-0.932	0.10435	.	1.160410	0.06280	N	0.697214	T	0.05640	0.0148	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.002;0.0	B;B	0.06405	0.002;0.0	T	0.26883	-1.0090	9	.	.	.	1.4672	1.166	0.01815	0.1661:0.1935:0.2238:0.4166	.	18;18	B4E2F5;Q9H1N7	.;S35B3_HUMAN	N	18;18;84	ENSP00000368981:T18N;ENSP00000345902:T18N	.	T	-	2	0	SLC35B3	8375340	0.891000	0.30450	0.000000	0.03702	0.070000	0.16714	0.574000	0.23714	0.026000	0.15269	-0.296000	0.09543	ACC		SLC35B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039802.1	NM_015948	
HIST1H2BH	8345	broad.mit.edu	37	6	26252218	26252218	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr6:26252218G>A	ENST00000356350.2	+	1	340	c.340G>A	c.(340-342)Gag>Aag	p.E114K	HIST1H3F_ENST00000446824.2_5'Flank	NM_003524.2	NP_003515.1	Q93079	H2B1H_HUMAN	histone cluster 1, H2bh	114					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E114K(2)|p.E114Q(1)		NS(3)|breast(2)|large_intestine(1)|lung(3)|ovary(3)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	17						CGCCGTGTCCGAGGGCACTAA	0.537																																					p.E114K												.	.	3	Substitution - Missense(3)	large_intestine(1)|NS(1)|lung(1)	c.G340A	6						.						63.0	68.0	66.0					6																	26252218		2203	4300	6503	26360197	SO:0001583	missense	8345	exon1			Z80781	CCDS4601.1	6p21.3	2011-01-27	2006-10-11	2003-02-14	ENSG00000197459	ENSG00000275713		"""Histones / Replication-dependent"""	4755	protein-coding gene	gene with protein product		602806	"""H2B histone family, member J"", ""histone 1, H2bh"""	H2BFJ		9119399, 12408966	Standard	NM_003524		Approved	H2B/j	uc003nhh.3	Q93079	OTTHUMG00000014447	ENST00000356350.2:c.340G>A	6.37:g.26252218G>A	ENSP00000348706:p.Glu114Lys	Somatic		Capture	Illumina HiSeq	Phase_I	26360197	NM_003524	B2R541|Q4VB74	Missense_Mutation	SNP	ENST00000356350.2	37	CCDS4601.1	.	.	.	.	.	.	.	.	.	.	.	16.28	3.079141	0.55753	.	.	ENSG00000197459	ENST00000356350	T	0.48201	0.82	4.65	3.78	0.43462	Histone-fold (2);	0.000000	0.40222	U	0.001155	T	0.30696	0.0773	M	0.78801	2.425	0.35286	D	0.781761	B	0.33299	0.407	B	0.23018	0.043	T	0.38908	-0.9639	10	0.52906	T	0.07	.	12.6473	0.56742	0.0824:0.0:0.9176:0.0	.	114	Q93079	H2B1H_HUMAN	K	114	ENSP00000348706:E114K	ENSP00000348706:E114K	E	+	1	0	HIST1H2BH	26360197	1.000000	0.71417	0.962000	0.40283	0.380000	0.30137	7.726000	0.84824	1.271000	0.44313	0.591000	0.81541	GAG		HIST1H2BH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040110.1	NM_003524	
PRRC2A	7916	broad.mit.edu	37	6	31600024	31600024	+	Silent	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr6:31600024C>T	ENST00000376033.2	+	16	3808	c.3574C>T	c.(3574-3576)Ctg>Ttg	p.L1192L	PRRC2A_ENST00000376007.4_Silent_p.L1192L	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	1192	4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.L1192L(1)		breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						AGCCAAGTCTCTGGCTCCCAA	0.642																																					p.L1192L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3574T	6						.						24.0	31.0	28.0					6																	31600024		1508	2705	4213	31708003	SO:0001819	synonymous_variant	7916	exon16			M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.3574C>T	6.37:g.31600024C>T		Somatic		Capture	Illumina HiSeq	Phase_I	31708003	NM_004638	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Silent	SNP	ENST00000376033.2	37	CCDS4708.1																																																																																				PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259319.1	NM_080686	
DAAM2	23500	broad.mit.edu	37	6	39869628	39869628	+	Missense_Mutation	SNP	C	C	T	rs573237647		TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr6:39869628C>T	ENST00000398904.2	+	25	3204	c.3022C>T	c.(3022-3024)Cgg>Tgg	p.R1008W	DAAM2_ENST00000274867.4_Missense_Mutation_p.R1008W|DAAM2_ENST00000538976.1_Missense_Mutation_p.R1007W|RP11-61I13.3_ENST00000437947.1_RNA			Q86T65	DAAM2_HUMAN	dishevelled associated activator of morphogenesis 2	1008					actin cytoskeleton organization (GO:0030036)|determination of left/right symmetry (GO:0007368)			p.R1007W(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(18)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)	49	Ovarian(28;0.0355)|Colorectal(47;0.196)					GCAGCGGCAGCGGAAGGTCCT	0.662													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15990	0.0		0.0	False		,,,				2504	0.0				p.R1007W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3019T	6						.						21.0	29.0	26.0					6																	39869628		2092	4211	6303	39977606	SO:0001583	missense	23500	exon25			AB002379	CCDS54999.1, CCDS56426.1	6p21.1	2008-07-30			ENSG00000146122	ENSG00000146122			18143	protein-coding gene	gene with protein product		606627				11779461, 12632087	Standard	NM_015345		Approved	KIAA0381	uc003oow.3	Q86T65	OTTHUMG00000014653	ENST00000398904.2:c.3022C>T	6.37:g.39869628C>T	ENSP00000381876:p.Arg1008Trp	Somatic		Capture	Illumina HiSeq	Phase_I	39977606	NM_015345	G5EA45|Q5T4T8|Q5T4U0|Q9NQI5|Q9Y4G0	Missense_Mutation	SNP	ENST00000398904.2	37	CCDS56426.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.997134	0.74818	.	.	ENSG00000146122	ENST00000274867;ENST00000398904;ENST00000538976	T;T;T	0.80214	-1.34;-1.34;-1.35	5.51	1.33	0.21861	Actin-binding FH2/DRF autoregulatory (1);	0.400623	0.24755	N	0.035864	T	0.79143	0.4396	L	0.47190	1.495	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74023	0.982;0.96	T	0.79497	-0.1779	10	0.72032	D	0.01	.	10.5247	0.44941	0.6084:0.2832:0.1083:0.0	.	1007;1008	G5EA45;Q86T65	.;DAAM2_HUMAN	W	1008;1008;1007	ENSP00000274867:R1008W;ENSP00000381876:R1008W;ENSP00000437808:R1007W	ENSP00000274867:R1008W	R	+	1	2	DAAM2	39977606	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.162000	0.31786	0.236000	0.21180	-0.314000	0.08810	CGG		DAAM2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280648.1		
PKHD1	5314	broad.mit.edu	37	6	51768525	51768525	+	Splice_Site	SNP	T	T	C			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr6:51768525T>C	ENST00000371117.3	-	43	7141	c.6866A>G	c.(6865-6867)gAc>gGc	p.D2289G	PKHD1_ENST00000340994.4_Splice_Site_p.D2289G	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	2289					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.D2289G(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TCCTGACCAGTCTAATGTTTC	0.403																																					p.D2289G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A6866G	6						.						126.0	119.0	121.0					6																	51768525		2203	4300	6503	51876484	SO:0001630	splice_region_variant	5314	exon43			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.6866-1A>G	6.37:g.51768525T>C		Somatic		Capture	Illumina HiSeq	Phase_I	51876484	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	T	7.242	0.601388	0.13939	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	T;T	0.80566	-1.39;-1.39	5.73	0.704	0.18121	Pectin lyase fold/virulence factor (1);Pectin lyase fold (1);	0.296460	0.27060	N	0.021127	T	0.49474	0.1559	L	0.53671	1.685	0.09310	N	1	B;B;B	0.10296	0.003;0.002;0.0	B;B;B	0.12156	0.007;0.004;0.001	T	0.41592	-0.9500	10	0.15952	T	0.53	.	5.5774	0.17231	0.0:0.2947:0.1371:0.5682	.	2289;2289;2289	A8MVM9;P08F94-2;P08F94	.;.;PKHD1_HUMAN	G	2289	ENSP00000360158:D2289G;ENSP00000341097:D2289G	ENSP00000341097:D2289G	D	-	2	0	PKHD1	51876484	0.861000	0.29849	0.006000	0.13384	0.421000	0.31385	0.184000	0.16939	-0.102000	0.12197	0.528000	0.53228	GAC		PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	Missense_Mutation
IBTK	25998	broad.mit.edu	37	6	82891706	82891706	+	Silent	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr6:82891706C>T	ENST00000306270.7	-	26	4164	c.3615G>A	c.(3613-3615)cgG>cgA	p.R1205R	IBTK_ENST00000510291.1_Silent_p.R1190R|IBTK_ENST00000503631.1_Silent_p.R1004R	NM_015525.2	NP_056340.2	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton agammaglobulinemia tyrosine kinase	1205					negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein tyrosine kinase activity (GO:0061099)|release of sequestered calcium ion into cytosol (GO:0051209)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine kinase inhibitor activity (GO:0030292)	p.R1205R(1)		central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(10)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	54		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		GTAAGAAATCCCGGAATGACT	0.368																																					p.R1205R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3615A	6						.						57.0	60.0	59.0					6																	82891706		2203	4300	6503	82948425	SO:0001819	synonymous_variant	25998	exon26			AF235049	CCDS34490.1, CCDS75486.1	6q14.3	2013-01-10	2003-10-06	2003-10-08	ENSG00000005700	ENSG00000005700		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	17853	protein-coding gene	gene with protein product		606457	"""Bruton agammaglobulinemia tyrosine kinase inhibitor"""	BTKI		11577348	Standard	XM_006715453		Approved	DKFZP564B116, BTBD26	uc003pjl.1	Q9P2D0	OTTHUMG00000015102	ENST00000306270.7:c.3615G>A	6.37:g.82891706C>T		Somatic		Capture	Illumina HiSeq	Phase_I	82948425	NM_015525	Q2QKU2|Q2QKU3|Q2QKU4|Q5TFD7|Q5TFD9|Q8IUQ9|Q8IUY7|Q8TAI4|Q9HBI8|Q9Y3T8	Silent	SNP	ENST00000306270.7	37	CCDS34490.1																																																																																				IBTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041337.2	NM_015525	
MAP3K4	4216	broad.mit.edu	37	6	161455406	161455406	+	Nonsense_Mutation	SNP	C	C	T	rs370191115		TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr6:161455406C>T	ENST00000392142.4	+	2	416	c.268C>T	c.(268-270)Cga>Tga	p.R90*	MAP3K4_ENST00000366919.2_Nonsense_Mutation_p.R90*|MAP3K4_ENST00000366920.2_Nonsense_Mutation_p.R90*|MAP3K4_ENST00000348824.7_Nonsense_Mutation_p.R90*|MAP3K4_ENST00000446500.1_3'UTR	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	90					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)	p.R90*(2)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		CAGCACACCTCGACAGATGAA	0.458																																					p.R90X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C268T	6						.						84.0	84.0	84.0					6																	161455406		2203	4300	6503	161375396	SO:0001587	stop_gained	4216	exon2			AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.268C>T	6.37:g.161455406C>T	ENSP00000375986:p.Arg90*	Somatic		Capture	Illumina HiSeq	Phase_I	161375396	NM_006724	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Nonsense_Mutation	SNP	ENST00000392142.4	37	CCDS34565.1	.	.	.	.	.	.	.	.	.	.	C	38	6.755629	0.97813	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824;ENST00000544209	.	.	.	5.49	4.61	0.57282	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-21.2332	15.9703	0.80008	0.136:0.864:0.0:0.0	.	.	.	.	X	90;90;90;90;90;69	.	ENSP00000297332:R90X	R	+	1	2	MAP3K4	161375396	1.000000	0.71417	0.867000	0.34043	0.992000	0.81027	5.733000	0.68571	1.440000	0.47531	0.558000	0.71614	CGA		MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3		
FBXL18	80028	broad.mit.edu	37	7	5540135	5540135	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr7:5540135G>A	ENST00000382368.3	-	3	1888	c.1765C>T	c.(1765-1767)Cgg>Tgg	p.R589W	FBXL18_ENST00000453700.3_Missense_Mutation_p.R589W	NM_024963.4	NP_079239.3	Q96ME1	FXL18_HUMAN	F-box and leucine-rich repeat protein 18	589								p.R589W(1)	FBXL18/RNF216(2)	central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)	21		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.181)|OV - Ovarian serous cystadenocarcinoma(56;3.64e-13)		TCCCTCAGCCGCTTGCAGTGC	0.667																																					p.R589W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1765T	7						.						39.0	44.0	42.0					7																	5540135		2019	4159	6178	5506661	SO:0001583	missense	80028	exon3			AK057042	CCDS43546.1	7p22.2	2011-06-09			ENSG00000155034	ENSG00000155034		"""F-boxes / Leucine-rich repeats"""	21874	protein-coding gene	gene with protein product		609084					Standard	NM_024963		Approved	FLJ11467, Fbl18	uc003son.4	Q96ME1	OTTHUMG00000151832	ENST00000382368.3:c.1765C>T	7.37:g.5540135G>A	ENSP00000371805:p.Arg589Trp	Somatic		Capture	Illumina HiSeq	Phase_I	5506661	NM_024963	Q9BR90|Q9BTC7|Q9HAK7	Missense_Mutation	SNP	ENST00000382368.3	37	CCDS43546.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.59|18.59	3.656834|3.656834	0.67586|0.67586	.|.	.|.	ENSG00000155034|ENSG00000155034	ENST00000297035|ENST00000382368;ENST00000312577;ENST00000453700	.|T;T	.|0.55234	.|0.53;0.53	5.35|5.35	5.35|5.35	0.76521|0.76521	.|.	.|0.341140	.|0.33938	.|N	.|0.004410	T|T	0.47002|0.47002	0.1422|0.1422	N|N	0.14661|0.14661	0.345|0.345	0.36710|0.36710	D|D	0.880617|0.880617	.|D;D	.|0.69078	.|0.997;0.987	.|P;P	.|0.53861	.|0.736;0.528	T|T	0.58781|0.58781	-0.7576|-0.7576	6|10	0.87932|0.72032	D|D	0|0.01	.|.	11.4554|11.4554	0.50179|0.50179	0.0919:0.0:0.9081:0.0|0.0919:0.0:0.9081:0.0	.|.	.|589;589	.|F5H4Z4;Q96ME1-4	.|.;.	V|W	148|589	.|ENSP00000371805:R589W;ENSP00000444797:R589W	ENSP00000297035:A148V|ENSP00000311990:R589W	A|R	-|-	2|1	0|2	FBXL18|FBXL18	5506661|5506661	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	4.467000|4.467000	0.60155|0.60155	2.533000|2.533000	0.85409|0.85409	0.585000|0.585000	0.79938|0.79938	GCG|CGG		FBXL18-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324093.1	NM_024963	
ADCY1	107	broad.mit.edu	37	7	45753429	45753429	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr7:45753429C>G	ENST00000297323.7	+	20	3217	c.3195C>G	c.(3193-3195)atC>atG	p.I1065M		NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	1065					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.I1065M(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GCTCCCAAATCAGGTCCCTGG	0.567																																					p.I1065M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3195G	7						.						117.0	108.0	111.0					7																	45753429		2203	4300	6503	45719954	SO:0001583	missense	107	exon20			L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.3195C>G	7.37:g.45753429C>G	ENSP00000297323:p.Ile1065Met	Somatic		Capture	Illumina HiSeq	Phase_I	45719954	NM_021116	A4D2L8|Q75MI1	Missense_Mutation	SNP	ENST00000297323.7	37	CCDS34631.1	.	.	.	.	.	.	.	.	.	.	C	9.244	1.039004	0.19669	.	.	ENSG00000164742	ENST00000297323	T	0.79653	-1.29	5.77	4.89	0.63831	.	0.631499	0.17732	N	0.163866	T	0.64371	0.2592	N	0.08118	0	0.20307	N	0.999915	B	0.09022	0.002	B	0.12156	0.007	T	0.54132	-0.8339	10	0.34782	T	0.22	.	12.6393	0.56700	0.0:0.9199:0.0:0.0801	.	1065	Q08828	ADCY1_HUMAN	M	1065	ENSP00000297323:I1065M	ENSP00000297323:I1065M	I	+	3	3	ADCY1	45719954	0.014000	0.17966	0.035000	0.18076	0.396000	0.30629	0.728000	0.26013	1.447000	0.47661	-0.140000	0.14226	ATC		ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340055.2	NM_021116	
C7orf57	136288	broad.mit.edu	37	7	48089541	48089541	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr7:48089541A>G	ENST00000348904.3	+	6	784	c.572A>G	c.(571-573)aAt>aGt	p.N191S	C7orf57_ENST00000420324.1_Missense_Mutation_p.N236S|C7orf57_ENST00000435376.1_Missense_Mutation_p.N69S|C7orf57_ENST00000430738.1_Missense_Mutation_p.N236S|C7orf57_ENST00000539619.1_Missense_Mutation_p.N191S	NM_001100159.2	NP_001093629.1	Q8NEG2	CG057_HUMAN	chromosome 7 open reading frame 57	191								p.N191S(2)		breast(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	9						GGCCCTAAGAATCCTGCAGGA	0.537																																					p.N191S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A572G	7						.						61.0	57.0	59.0					7																	48089541		1987	4165	6152	48056066	SO:0001583	missense	136288	exon6			BC031107	CCDS47583.1, CCDS59054.1, CCDS75594.1	7p12.3	2011-11-25			ENSG00000164746	ENSG00000164746			22247	protein-coding gene	gene with protein product							Standard	NM_001100159		Approved		uc003toh.5	Q8NEG2	OTTHUMG00000155808	ENST00000348904.3:c.572A>G	7.37:g.48089541A>G	ENSP00000335500:p.Asn191Ser	Somatic		Capture	Illumina HiSeq	Phase_I	48056066	NM_001100159	C9JBJ8	Missense_Mutation	SNP	ENST00000348904.3	37	CCDS47583.1	.	.	.	.	.	.	.	.	.	.	A	6.914	0.538213	0.13188	.	.	ENSG00000164746	ENST00000420324;ENST00000435376;ENST00000430738;ENST00000348904;ENST00000539619	T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94	5.57	4.41	0.53225	.	0.582317	0.18412	N	0.142022	T	0.29976	0.0750	L	0.29908	0.895	0.09310	N	1	B;B	0.14438	0.001;0.01	B;B	0.15484	0.004;0.013	T	0.18555	-1.0333	10	0.44086	T	0.13	-10.347	8.3405	0.32241	0.9108:0.0:0.0892:0.0	.	69;191	C9JBJ8;Q8NEG2	.;CG057_HUMAN	S	236;69;236;191;191	ENSP00000394648:N236S;ENSP00000391652:N69S;ENSP00000410944:N236S;ENSP00000335500:N191S;ENSP00000442474:N191S	ENSP00000335500:N191S	N	+	2	0	C7orf57	48056066	0.571000	0.26659	0.008000	0.14137	0.014000	0.08584	2.932000	0.48940	0.954000	0.37851	0.454000	0.30748	AAT		C7orf57-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341745.1	NM_001100159	
KRIT1	889	broad.mit.edu	37	7	91851319	91851319	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr7:91851319C>T	ENST00000340022.2	-	14	2478	c.1460G>A	c.(1459-1461)tGg>tAg	p.W487*	KRIT1_ENST00000412043.2_Nonsense_Mutation_p.W487*|KRIT1_ENST00000394507.1_Nonsense_Mutation_p.W487*|KRIT1_ENST00000394503.2_Nonsense_Mutation_p.W439*|KRIT1_ENST00000394505.2_Nonsense_Mutation_p.W487*	NM_004912.3|NM_194455.1	NP_004903.2|NP_919437.1	O00522	KRIT1_HUMAN	KRIT1, ankyrin repeat containing	487	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				angiogenesis (GO:0001525)|cell redox homeostasis (GO:0045454)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|positive regulation of protein binding (GO:0032092)|regulation of catalytic activity (GO:0050790)|regulation of establishment of cell polarity (GO:2000114)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)|small GTPase regulator activity (GO:0005083)	p.W487*(1)		autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(2)|stomach(1)	22	all_cancers(62;1.04e-09)|all_epithelial(64;5.75e-09)|Breast(17;0.00206)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TATTTCTGGCCAGTCACGAAC	0.358																																					p.W487X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1460A	7						.						110.0	109.0	109.0					7																	91851319		2203	4300	6503	91689255	SO:0001587	stop_gained	889	exon14			AJ294850	CCDS5624.1, CCDS34679.1	7q21.2	2014-09-17	2005-03-15	2005-03-17	ENSG00000001631	ENSG00000001631		"""Ankyrin repeat domain containing"""	1573	protein-coding gene	gene with protein product		604214	"""cerebral cavernous malformations 1"""	CCM1		7604043, 11342228	Standard	NM_194455		Approved	CAM	uc003ulu.1	O00522	OTTHUMG00000131187	ENST00000340022.2:c.1460G>A	7.37:g.91851319C>T	ENSP00000344668:p.Trp487*	Somatic		Capture	Illumina HiSeq	Phase_I	91689255	NM_194455	A6NNU0|O43894|Q506L6|Q6U276|Q75N19|Q9H180|Q9H264|Q9HAX5	Nonsense_Mutation	SNP	ENST00000340022.2	37	CCDS5624.1	.	.	.	.	.	.	.	.	.	.	C	41	8.867462	0.98984	.	.	ENSG00000001631	ENST00000394507;ENST00000340022;ENST00000412043;ENST00000394505;ENST00000394503;ENST00000415227	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.0998	19.6508	0.95805	0.0:1.0:0.0:0.0	.	.	.	.	X	487;487;487;487;439;487	.	ENSP00000344668:W487X	W	-	2	0	KRIT1	91689255	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.287000	0.78681	2.650000	0.89964	0.471000	0.43371	TGG		KRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253910.1		
DGKI	9162	broad.mit.edu	37	7	137374734	137374734	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr7:137374734C>T	ENST00000288490.5	-	2	416	c.416G>A	c.(415-417)cGg>cAg	p.R139Q	DGKI_ENST00000446122.1_Missense_Mutation_p.R139Q|DGKI_ENST00000453654.2_Intron|DGKI_ENST00000424189.2_Missense_Mutation_p.R139Q	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	139					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)	p.R139Q(1)		breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						GAGGCCTGCCCGGGAGATTGC	0.498																																					p.R139Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G416A	7						.						59.0	61.0	60.0					7																	137374734		2203	4300	6503	137025274	SO:0001583	missense	9162	exon2			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.416G>A	7.37:g.137374734C>T	ENSP00000288490:p.Arg139Gln	Somatic		Capture	Illumina HiSeq	Phase_I	137025274	NM_004717	A4D1Q9|Q9NZ49	Missense_Mutation	SNP	ENST00000288490.5	37	CCDS5845.1	.	.	.	.	.	.	.	.	.	.	C	34	5.398092	0.96030	.	.	ENSG00000157680	ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T	0.36878	1.23;1.42	5.83	5.83	0.93111	.	0.175120	0.51477	D	0.000099	T	0.44498	0.1296	L	0.42245	1.32	0.58432	D	0.999999	D	0.61697	0.99	P	0.50270	0.636	T	0.30090	-0.9990	10	0.59425	D	0.04	.	18.9089	0.92474	0.0:1.0:0.0:0.0	.	139	O75912	DGKI_HUMAN	Q	87;139;139;139	ENSP00000288490:R139Q;ENSP00000399131:R139Q	ENSP00000288490:R139Q	R	-	2	0	DGKI	137025274	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.377000	0.66184	2.763000	0.94921	0.563000	0.77884	CGG		DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341286.3	NM_004717	
SYBU	55638	broad.mit.edu	37	8	110588198	110588198	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr8:110588198C>T	ENST00000422135.1	-	8	1444	c.929G>A	c.(928-930)cGa>cAa	p.R310Q	SYBU_ENST00000424158.2_Missense_Mutation_p.R315Q|SYBU_ENST00000276646.9_Missense_Mutation_p.R310Q|SYBU_ENST00000399066.3_Missense_Mutation_p.R307Q|SYBU_ENST00000532779.1_Missense_Mutation_p.R242Q|SYBU_ENST00000419099.1_Missense_Mutation_p.R309Q|SYBU_ENST00000408889.3_Missense_Mutation_p.R191Q|SYBU_ENST00000440310.1_Missense_Mutation_p.R310Q|SYBU_ENST00000529690.1_Missense_Mutation_p.R180Q|SYBU_ENST00000527707.1_5'Flank|SYBU_ENST00000408908.2_Missense_Mutation_p.R310Q|SYBU_ENST00000433638.1_Missense_Mutation_p.R310Q|SYBU_ENST00000528331.1_Missense_Mutation_p.R191Q|SYBU_ENST00000529175.1_Missense_Mutation_p.R104Q|SYBU_ENST00000533171.1_Missense_Mutation_p.R310Q|SYBU_ENST00000533065.1_Missense_Mutation_p.R191Q|SYBU_ENST00000533895.1_Missense_Mutation_p.R309Q|SYBU_ENST00000446070.2_Missense_Mutation_p.R309Q|SYBU_ENST00000528647.1_Missense_Mutation_p.R309Q	NM_001099744.1	NP_001093214.1	Q9NX95	SYBU_HUMAN	syntabulin (syntaxin-interacting)	310	Sufficient for interaction with KIF5B.|Sufficient for interaction with STX1A.				regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|dense body (GO:0097433)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.R307Q(1)|p.R307L(1)		NS(1)|breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	30						CCAGTCCTCTCGCATGCGGGC	0.443																																					p.R191Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G572A	8						.						53.0	54.0	54.0					8																	110588198		1988	4214	6202	110657374	SO:0001583	missense	55638	exon6			AB040905	CCDS43763.1, CCDS43764.1, CCDS47912.1, CCDS55271.1	8q23.2	2010-08-27				ENSG00000147642			26011	protein-coding gene	gene with protein product	"""syntaphilin-like"""	611568				17611281, 16750881, 16157705, 15656992, 15459722	Standard	NM_001099743		Approved	FLJ20366, GOLSYN, KIAA1472, OCSYN, SNPHL	uc003ynj.4	Q9NX95		ENST00000422135.1:c.929G>A	8.37:g.110588198C>T	ENSP00000407118:p.Arg310Gln	Somatic		Capture	Illumina HiSeq	Phase_I	110657374	NM_001099746	A8K354|B3KQX3|B3KU61|Q5R1T1|Q5R1T2|Q5R1T3|Q5Y2M6|Q8ND49|Q8TCR6|Q96D80|Q9P256	Missense_Mutation	SNP	ENST00000422135.1	37	CCDS47912.1	.	.	.	.	.	.	.	.	.	.	C	17.76	3.468357	0.63625	.	.	ENSG00000147642	ENST00000533895;ENST00000424158;ENST00000532779;ENST00000399066;ENST00000446070;ENST00000528331;ENST00000529175;ENST00000276646;ENST00000528647;ENST00000422135;ENST00000419099;ENST00000433638;ENST00000408908;ENST00000440310;ENST00000408889;ENST00000533065;ENST00000529690;ENST00000533171	.	.	.	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.72095	0.3418	L	0.44542	1.39	0.54753	D	0.999986	D;D;P;D;D	0.89917	1.0;1.0;0.93;1.0;1.0	D;D;P;D;D	0.85130	0.997;0.996;0.66;0.997;0.997	T	0.63466	-0.6631	9	0.12103	T	0.63	-23.7344	19.0385	0.92989	0.0:1.0:0.0:0.0	.	180;242;309;310;307	B7Z4D2;Q9NX95-2;Q9NX95-3;Q9NX95;Q9NX95-4	.;.;.;SYBU_HUMAN;.	Q	309;315;242;307;309;191;104;310;309;310;309;310;310;310;191;191;180;310	.	ENSP00000276646:R310Q	R	-	2	0	SYBU	110657374	0.997000	0.39634	0.930000	0.37139	0.983000	0.72400	6.019000	0.70818	2.736000	0.93811	0.591000	0.81541	CGA		SYBU-204	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000385501.1	NM_017786	
TRPS1	7227	broad.mit.edu	37	8	116426341	116426341	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr8:116426341G>T	ENST00000220888.5	-	6	3915	c.3756C>A	c.(3754-3756)tgC>tgA	p.C1252*	TRPS1_ENST00000519076.1_Nonsense_Mutation_p.C1006*|TRPS1_ENST00000395715.3_Nonsense_Mutation_p.C1265*|TRPS1_ENST00000520276.1_Nonsense_Mutation_p.C1256*			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	1252	Transcriptional repressor domain. {ECO:0000250}.				chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.C1252*(1)		autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			ATTTGTCCGTGCAAAGATGCT	0.433									Langer-Giedion syndrome																												p.C1265X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3795A	8						.						179.0	168.0	172.0					8																	116426341		1967	4155	6122	116495517	SO:0001587	stop_gained	7227	exon7	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.3756C>A	8.37:g.116426341G>T	ENSP00000220888:p.Cys1252*	Somatic		Capture	Illumina HiSeq	Phase_I	116495517	NM_014112	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Nonsense_Mutation	SNP	ENST00000220888.5	37		.	.	.	.	.	.	.	.	.	.	G	39	7.584813	0.98374	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276	.	.	.	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.2461	0.93902	0.0:0.0:1.0:0.0	.	.	.	.	X	1265;1252;1006;1256	.	ENSP00000220888:C1252X	C	-	3	2	TRPS1	116495517	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.158000	0.58150	2.525000	0.85131	0.655000	0.94253	TGC		TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	
ADAM32	203102	broad.mit.edu	37	8	39079179	39079179	+	Silent	SNP	C	C	T	rs189440658		TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr8:39079179C>T	ENST00000379907.4	+	13	1411	c.1284C>T	c.(1282-1284)gaC>gaT	p.D428D	ADAM32_ENST00000437682.2_Silent_p.D329D|ADAM32_ENST00000519315.1_Silent_p.D322D	NM_145004.5	NP_659441	Q8TC27	ADA32_HUMAN	ADAM metallopeptidase domain 32	428	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.					integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.D427D(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	31		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			TACTGAAAGACGGAGCAAAAT	0.338													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19067	0.0		0.0	False		,,,				2504	0.0				p.D428D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1284T	8						.						132.0	123.0	126.0					8																	39079179		1879	4109	5988	39198336	SO:0001819	synonymous_variant	203102	exon13			BC026085	CCDS47846.1	8p11.22	2005-08-18	2005-08-18		ENSG00000197140	ENSG00000197140		"""ADAM metallopeptidase domain containing"""	15479	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 32"""			12568724	Standard	NM_145004		Approved		uc003xmt.4	Q8TC27	OTTHUMG00000164071	ENST00000379907.4:c.1284C>T	8.37:g.39079179C>T		Somatic		Capture	Illumina HiSeq	Phase_I	39198336	NM_145004	Q8TC42	De_novo_Start_InFrame	SNP	ENST00000379907.4	37	CCDS47846.1																																																																																				ADAM32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377089.1	NM_145004	
ZFHX4	79776	broad.mit.edu	37	8	77620095	77620095	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr8:77620095C>G	ENST00000521891.2	+	3	3353	c.2905C>G	c.(2905-2907)Cag>Gag	p.Q969E	ZFHX4_ENST00000455469.2_Missense_Mutation_p.Q943E|ZFHX4_ENST00000050961.6_Missense_Mutation_p.Q943E|ZFHX4_ENST00000518282.1_Missense_Mutation_p.Q943E|ZFHX4_ENST00000517683.1_Intron	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	943					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.Q969E(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TAAACATATGCAGAAATATCA	0.438										HNSCC(33;0.089)																											p.Q969E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2905G	8						.						99.0	100.0	100.0					8																	77620095		2199	4297	6496	77782650	SO:0001583	missense	79776	exon3				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.2905C>G	8.37:g.77620095C>G	ENSP00000430497:p.Gln969Glu	Somatic		Capture	Illumina HiSeq	Phase_I	77782650	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	9.568	1.120218	0.20877	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.55413	0.52;0.52;0.52;0.52	5.43	5.43	0.79202	Zinc finger, U1-type (1);	0.000000	0.41097	U	0.000946	T	0.76863	0.4047	M	0.87547	2.89	0.80722	D	1	D;D;D;D	0.69078	0.965;0.979;0.979;0.997	P;P;P;D	0.70227	0.542;0.73;0.73;0.968	T	0.78518	-0.2173	10	0.51188	T	0.08	.	19.4288	0.94756	0.0:1.0:0.0:0.0	.	943;943;969;943	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	E	969;969;943;943;943	ENSP00000430497:Q969E;ENSP00000399605:Q943E;ENSP00000050961:Q943E;ENSP00000430848:Q943E	ENSP00000050961:Q943E	Q	+	1	0	ZFHX4	77782650	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.320000	0.79064	2.830000	0.97506	0.585000	0.79938	CAG		ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
NDUFB9	4715	broad.mit.edu	37	8	125562099	125562099	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr8:125562099A>G	ENST00000276689.3	+	4	590	c.506A>G	c.(505-507)tAt>tGt	p.Y169C	NDUFB9_ENST00000522532.1_Intron|NDUFB9_ENST00000517830.1_Intron|NDUFB9_ENST00000517367.1_Missense_Mutation_p.Y158C	NM_001278646.1|NM_005005.2	NP_001265575.1|NP_004996.1	Q9Y6M9	NDUB9_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa	169					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.Y169C(1)		kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	8	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			CTGTGGTGGTATATTGTGACC	0.512																																					p.Y169C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A506G	8						.						61.0	57.0	58.0					8																	125562099		2203	4300	6503	125631280	SO:0001583	missense	4715	exon4			AF044956	CCDS6352.1	8q24.13	2011-07-04	2002-08-29		ENSG00000147684	ENSG00000147684		"""LYR motif containing"", ""Mitochondrial respiratory chain complex / Complex I"""	7704	protein-coding gene	gene with protein product	"""complex I B22 subunit"""	601445	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9 (22kD, B22)"""			8661098	Standard	NM_005005		Approved	B22, UQOR22, LYRM3	uc003yrg.4	Q9Y6M9	OTTHUMG00000165054	ENST00000276689.3:c.506A>G	8.37:g.125562099A>G	ENSP00000276689:p.Tyr169Cys	Somatic		Capture	Illumina HiSeq	Phase_I	125631280	NM_005005	B2R8M6|Q9UQE8	Missense_Mutation	SNP	ENST00000276689.3	37	CCDS6352.1	.	.	.	.	.	.	.	.	.	.	A	16.24	3.066685	0.55539	.	.	ENSG00000147684	ENST00000276689;ENST00000517367	T;T	0.71934	-0.61;-0.61	5.01	5.01	0.66863	.	0.115612	0.64402	D	0.000011	T	0.53286	0.1787	N	0.08118	0	0.32788	N	0.501492	B	0.29805	0.257	B	0.30179	0.112	T	0.66814	-0.5828	10	0.87932	D	0	-13.8005	15.004	0.71498	1.0:0.0:0.0:0.0	.	169	Q9Y6M9	NDUB9_HUMAN	C	169;158	ENSP00000276689:Y169C;ENSP00000430322:Y158C	ENSP00000276689:Y169C	Y	+	2	0	NDUFB9	125631280	1.000000	0.71417	0.998000	0.56505	0.891000	0.51852	6.766000	0.74970	2.018000	0.59344	0.260000	0.18958	TAT		NDUFB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381606.1	NM_005005	
NFIB	4781	broad.mit.edu	37	9	14120603	14120603	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr9:14120603G>C	ENST00000380959.3	-	8	1554	c.1081C>G	c.(1081-1083)Cct>Gct	p.P361A	NFIB_ENST00000380953.1_Missense_Mutation_p.P361A|NFIB_ENST00000397575.3_Missense_Mutation_p.P361A|NFIB_ENST00000397581.2_Missense_Mutation_p.P361A|NFIB_ENST00000543693.1_Missense_Mutation_p.P109A|NFIB_ENST00000397579.2_Missense_Mutation_p.P361A|NFIB_ENST00000380924.1_Missense_Mutation_p.P109A|NFIB_ENST00000380934.4_Missense_Mutation_p.P387A	NM_005596.3	NP_005587.2	O00712	NFIB_HUMAN	nuclear factor I/B	361					anterior commissure morphogenesis (GO:0021960)|chondrocyte differentiation (GO:0002062)|Clara cell differentiation (GO:0060486)|commissural neuron axon guidance (GO:0071679)|DNA replication (GO:0006260)|glial cell differentiation (GO:0010001)|hindbrain development (GO:0030902)|lung ciliated cell differentiation (GO:0061141)|negative regulation of DNA binding (GO:0043392)|negative regulation of epithelial cell proliferation involved in lung morphogenesis (GO:2000795)|negative regulation of mesenchymal cell proliferation involved in lung development (GO:2000791)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|principal sensory nucleus of trigeminal nerve development (GO:0021740)|transcription from RNA polymerase II promoter (GO:0006366)|Type I pneumocyte differentiation (GO:0060509)|Type II pneumocyte differentiation (GO:0060510)	cerebellar mossy fiber (GO:0044300)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.P361A(2)		central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(50;4.4e-08)|LUAD - Lung adenocarcinoma(58;0.119)|Lung(218;0.164)		GAAGGTGGAGGTGGAGTTCGA	0.468			T	"""MYB, HGMA2"""	"""adenoid cystic carcinoma, lipoma"""																																p.P387A	Esophageal Squamous(132;921 1730 14828 40753 46471)		Dom	yes		9	9p24.1	4781	nuclear factor I/B		E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1159G	9						.						159.0	116.0	131.0					9																	14120603		2203	4300	6503	14110603	SO:0001583	missense	4781	exon8			U07810	CCDS6474.1, CCDS55291.1, CCDS55292.1, CCDS65007.1	9p24.1	2008-02-05			ENSG00000147862	ENSG00000147862			7785	protein-coding gene	gene with protein product		600728				7590749	Standard	NM_001190737		Approved	NFI-RED, NFIB2, NFIB3	uc003zlf.3	O00712	OTTHUMG00000021027	ENST00000380959.3:c.1081C>G	9.37:g.14120603G>C	ENSP00000370346:p.Pro361Ala	Somatic		Capture	Illumina HiSeq	Phase_I	14110603	NM_001190738	G3V1P1|H7BYE8|O00166|Q12858|Q5VW29|Q63HM5|Q6ZNF9|Q96J45	Missense_Mutation	SNP	ENST00000380959.3	37	CCDS6474.1	.	.	.	.	.	.	.	.	.	.	G	9.591	1.126031	0.20959	.	.	ENSG00000147862	ENST00000380934;ENST00000380959;ENST00000380953;ENST00000397575;ENST00000397581;ENST00000397579;ENST00000543693;ENST00000380924	T;T;T;T;T;T;T;T	0.39229	1.09;1.09;1.09;1.09;1.09;1.09;1.09;1.09	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.40398	0.1115	N	0.05199	-0.095	0.58432	D	0.999998	D;P;D;D	0.69078	0.997;0.942;0.997;0.988	D;P;D;D	0.77004	0.989;0.711;0.989;0.981	T	0.19582	-1.0301	10	0.02654	T	1	.	18.9927	0.92800	0.0:0.0:1.0:0.0	.	361;361;361;109	Q5VW27;Q5VW29;O00712;G3V1P1	.;.;NFIB_HUMAN;.	A	387;361;361;361;361;361;109;109	ENSP00000370321:P387A;ENSP00000370346:P361A;ENSP00000370340:P361A;ENSP00000380705:P361A;ENSP00000380711:P361A;ENSP00000380709:P361A;ENSP00000442888:P109A;ENSP00000370311:P109A	ENSP00000370311:P109A	P	-	1	0	NFIB	14110603	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.011000	0.93618	2.487000	0.83934	0.655000	0.94253	CCT		NFIB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055468.1	NM_005596	
FAM74A7	100996582	broad.mit.edu	37	9	40716047	40716047	+	lincRNA	SNP	G	G	A	rs529135402	byFrequency	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr9:40716047G>A	ENST00000432614.1	-	0	0				FAM74A3_ENST00000604146.1_lincRNA														p.V67M(1)									CGGAGAAGACGTGGAAAGAGC	0.547													G|||	2	0.000399361	0.0	0.0	5008	,	,		24081	0.001		0.0	False		,,,				2504	0.001				.												.	.	1	Substitution - Missense(1)	large_intestine(1)	.	9						.																																			40706047			728495	.																															9.37:g.40716047G>A		Somatic		Capture	Illumina HiSeq	Phase_I	40706047	.		Missense_Mutation	SNP	ENST00000432614.1	37																																																																																					RP11-395E19.5-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000143688.1		
TRPM3	80036	broad.mit.edu	37	9	73152149	73152149	+	Missense_Mutation	SNP	G	G	A	rs148061413		TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr9:73152149G>A	ENST00000377111.2	-	25	4087	c.3844C>T	c.(3844-3846)Cgc>Tgc	p.R1282C	TRPM3_ENST00000423814.3_Missense_Mutation_p.R1309C|TRPM3_ENST00000360823.2_Missense_Mutation_p.R1144C|TRPM3_ENST00000396292.4_Missense_Mutation_p.R1154C|TRPM3_ENST00000408909.2_Missense_Mutation_p.R1141C|TRPM3_ENST00000396280.5_Missense_Mutation_p.R1131C|TRPM3_ENST00000377105.1_Missense_Mutation_p.R1141C|TRPM3_ENST00000377106.1_Missense_Mutation_p.R1154C|TRPM3_ENST00000377110.3_Missense_Mutation_p.R1282C|TRPM3_ENST00000357533.2_Missense_Mutation_p.R1286C|TRPM3_ENST00000358082.3_Missense_Mutation_p.R1144C|TRPM3_ENST00000396285.1_Missense_Mutation_p.R1141C	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	1307					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)	p.R1154C(1)|p.R1286C(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						GTCCTCGAGCGGATTTTGTTG	0.617													G|||	1	0.000199681	0.0	0.0	5008	,	,		16489	0.0		0.0	False		,,,				2504	0.001				p.R1282C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C3844T	9						.	G	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	86.0	83.0	84.0		3844,3385,3421,3355,3391,3460,3430	6.1	1.0	9	dbSNP_134	84	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TRPM3	NM_001007471.2,NM_020952.4,NM_024971.5,NM_206944.3,NM_206945.3,NM_206946.3,NM_206947.3	180,180,180,180,180,180,180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	1282/1708,1129/1555,1141/1567,1119/1545,1131/1557,1154/1580,1144/1570	73152149	1,13005	2203	4300	6503	72341969	SO:0001583	missense	80036	exon25			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.3844C>T	9.37:g.73152149G>A	ENSP00000366315:p.Arg1282Cys	Somatic		Capture	Illumina HiSeq	Phase_I	72341969	NM_001007471	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	ENST00000377111.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.95|18.95	3.732722|3.732722	0.69189|0.69189	0.0|0.0	1.16E-4|1.16E-4	ENSG00000083067|ENSG00000083067	ENST00000396280|ENST00000377111;ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814	.|T;T;T;T;T;T;T;T;T;T;T	.|0.55413	.|0.52;0.52;0.52;0.52;0.52;0.52;0.52;0.52;0.52;0.52;0.52	6.08|6.08	6.08|6.08	0.98989|0.98989	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.74291|0.74291	0.3697|0.3697	M|M	0.75447|0.75447	2.3|2.3	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D;D;D;D;D;D;D	.|0.89917	.|1.0;0.998;1.0;0.999;0.999;0.999;1.0;0.999	.|D;P;D;P;P;P;D;P	.|0.70487	.|0.954;0.886;0.969;0.899;0.836;0.899;0.962;0.732	T|T	0.73646|0.73646	-0.3917|-0.3917	5|10	.|0.59425	.|D	.|0.04	-14.6718|-14.6718	20.6721|20.6721	0.99693|0.99693	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1282;1282;1272;1286;1144;1141;1254;1141	.|Q9HCF6-2;Q9HCF6-10;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;Q9HCF6-8;A2A3F3	.|.;.;.;.;.;.;.;.	L|C	1130|1282;1282;1154;1144;1141;1286;1141;1141;1154;1144;1309	.|ENSP00000366315:R1282C;ENSP00000366314:R1282C;ENSP00000366310:R1154C;ENSP00000354066:R1144C;ENSP00000366309:R1141C;ENSP00000350140:R1286C;ENSP00000386127:R1141C;ENSP00000379581:R1141C;ENSP00000379587:R1154C;ENSP00000350791:R1144C;ENSP00000389542:R1309C	.|ENSP00000350140:R1286C	P|R	-|-	2|1	0|0	TRPM3|TRPM3	72341969|72341969	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	6.185000|6.185000	0.72013|0.72013	2.894000|2.894000	0.99253|0.99253	0.591000|0.591000	0.81541|0.81541	CCG|CGC		TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945	
ANXA1	301	broad.mit.edu	37	9	75775279	75775279	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr9:75775279G>A	ENST00000376911.1	+	4	1253	c.371G>A	c.(370-372)cGt>cAt	p.R124H	ANXA1_ENST00000257497.6_Missense_Mutation_p.R124H			P04083	ANXA1_HUMAN	annexin A1	124					alpha-beta T cell differentiation (GO:0046632)|arachidonic acid secretion (GO:0050482)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to hydrogen peroxide (GO:0070301)|endocrine pancreas development (GO:0031018)|estrous cycle phase (GO:0060206)|gliogenesis (GO:0042063)|hepatocyte differentiation (GO:0070365)|inflammatory response (GO:0006954)|insulin secretion (GO:0030073)|keratinocyte differentiation (GO:0030216)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of interleukin-8 secretion (GO:2000483)|neutrophil clearance (GO:0097350)|neutrophil homeostasis (GO:0001780)|peptide cross-linking (GO:0018149)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of neutrophil apoptotic process (GO:0033031)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of vesicle fusion (GO:0031340)|regulation of cell proliferation (GO:0042127)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to interleukin-1 (GO:0070555)|response to peptide hormone (GO:0043434)|response to X-ray (GO:0010165)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cilium (GO:0005929)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phospholipase A2 inhibitor activity (GO:0019834)|phospholipid binding (GO:0005543)|protein binding, bridging (GO:0030674)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)	p.R124H(1)		breast(1)|central_nervous_system(1)|large_intestine(1)|lung(5)	8		all_epithelial(88;2.54e-11)		OV - Ovarian serous cystadenocarcinoma(323;2.82e-06)|GBM - Glioblastoma multiforme(74;0.0325)	Amcinonide(DB00288)|Dexamethasone(DB01234)|Hydrocortisone(DB00741)	GATGAACTTCGTGCTGCCATG	0.428																																					p.R124H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G371A	9						.						96.0	93.0	94.0					9																	75775279		2203	4300	6503	74965099	SO:0001583	missense	301	exon5			X05908	CCDS6645.1	9q21.13	2013-02-25			ENSG00000135046	ENSG00000135046		"""Annexins"", ""Endogenous ligands"""	533	protein-coding gene	gene with protein product		151690		ANX1, LPC1		2936963	Standard	NM_000700		Approved		uc004ajf.1	P04083	OTTHUMG00000020016	ENST00000376911.1:c.371G>A	9.37:g.75775279G>A	ENSP00000366109:p.Arg124His	Somatic		Capture	Illumina HiSeq	Phase_I	74965099	NM_000700		Missense_Mutation	SNP	ENST00000376911.1	37	CCDS6645.1	.	.	.	.	.	.	.	.	.	.	G	19.65	3.868205	0.72065	.	.	ENSG00000135046	ENST00000257497;ENST00000456643;ENST00000376911	T;T;T	0.03468	3.92;3.92;3.92	5.92	4.9	0.64082	.	0.139109	0.64402	D	0.000006	T	0.10809	0.0264	L	0.48642	1.525	0.09310	N	0.999995	D	0.89917	1.0	D	0.75484	0.986	T	0.21861	-1.0233	10	0.15499	T	0.54	.	12.4182	0.55506	0.0992:0.0:0.9008:0.0	.	124	P04083	ANXA1_HUMAN	H	124;135;124	ENSP00000257497:R124H;ENSP00000412489:R135H;ENSP00000366109:R124H	ENSP00000257497:R124H	R	+	2	0	ANXA1	74965099	0.969000	0.33509	0.682000	0.30024	0.941000	0.58515	3.640000	0.54350	1.249000	0.43950	0.650000	0.86243	CGT		ANXA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052665.1	NM_000700	
SETX	23064	broad.mit.edu	37	9	135203335	135203335	+	Missense_Mutation	SNP	G	G	A	rs140892948		TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chr9:135203335G>A	ENST00000224140.5	-	10	3832	c.3650C>T	c.(3649-3651)aCg>aTg	p.T1217M	SETX_ENST00000393220.1_Missense_Mutation_p.T1217M|SETX_ENST00000372169.2_Missense_Mutation_p.T1217M	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	1217					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.T1217M(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		TTGTGAAACCGTAGTGGCTCT	0.388													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19350	0.0		0.0	False		,,,				2504	0.0				p.T1217M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3650T	9						.	G	MET/THR	3,4403	6.2+/-15.9	0,3,2200	111.0	109.0	109.0		3650	-2.4	0.0	9	dbSNP_134	109	0,8600		0,0,4300	yes	missense	SETX	NM_015046.5	81	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	possibly-damaging	1217/2678	135203335	3,13003	2203	4300	6503	134193156	SO:0001583	missense	23064	exon10			AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.3650C>T	9.37:g.135203335G>A	ENSP00000224140:p.Thr1217Met	Somatic		Capture	Illumina HiSeq	Phase_I	134193156	NM_015046	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	ENST00000224140.5	37	CCDS6947.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	13.15	2.152651	0.38021	6.81E-4	0.0	ENSG00000107290	ENST00000224140;ENST00000372169;ENST00000393220	D;D;D	0.87029	-2.11;-2.2;-1.82	5.69	-2.39	0.06602	.	3.645620	0.00639	N	0.000520	T	0.77644	0.4161	L	0.27053	0.805	0.09310	N	1	D;P;D	0.54397	0.966;0.898;0.966	B;B;B	0.42214	0.38;0.117;0.38	T	0.69595	-0.5103	10	0.48119	T	0.1	.	2.3999	0.04399	0.3201:0.0882:0.3997:0.192	.	1217;1217;1217	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	M	1217	ENSP00000224140:T1217M;ENSP00000361242:T1217M;ENSP00000376913:T1217M	ENSP00000224140:T1217M	T	-	2	0	SETX	134193156	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-0.578000	0.05841	-0.137000	0.11455	0.650000	0.86243	ACG		SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3	NM_015046	
THOC2	57187	broad.mit.edu	37	X	122765683	122765683	+	Silent	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chrX:122765683C>T	ENST00000245838.8	-	22	2368	c.2337G>A	c.(2335-2337)caG>caA	p.Q779Q	THOC2_ENST00000491737.1_Silent_p.Q664Q|THOC2_ENST00000355725.4_Silent_p.Q779Q	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	779					mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)	p.Q779Q(1)|p.Q700Q(1)		breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						ACCCACCAAACTGCACCAGGG	0.313																																					p.Q779Q												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G2337A	X						.						138.0	129.0	132.0					X																	122765683		1829	4082	5911	122593364	SO:0001819	synonymous_variant	57187	exon22			AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.2337G>A	X.37:g.122765683C>T		Somatic		Capture	Illumina HiSeq	Phase_I	122593364	NM_001081550	A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Silent	SNP	ENST00000245838.8	37	CCDS43988.1																																																																																				THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058153.3		
STAG2	10735	broad.mit.edu	37	X	123179201	123179201	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chrX:123179201A>G	ENST00000371160.1	+	8	940	c.650A>G	c.(649-651)cAt>cGt	p.H217R	STAG2_ENST00000371144.3_Missense_Mutation_p.H217R|STAG2_ENST00000371145.3_Missense_Mutation_p.H217R|STAG2_ENST00000218089.9_Missense_Mutation_p.H217R|STAG2_ENST00000354548.5_Missense_Mutation_p.H148R|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000371157.3_Missense_Mutation_p.H217R	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	217					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)	p.H217R(1)		breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						GCATTTCGACATACAAGCACC	0.348																																					p.H217R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A650G	X						.						128.0	121.0	123.0					X																	123179201		2203	4300	6503	123006882	SO:0001583	missense	10735	exon8			Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.650A>G	X.37:g.123179201A>G	ENSP00000360202:p.His217Arg	Somatic		Capture	Illumina HiSeq	Phase_I	123006882	NM_001042750	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Missense_Mutation	SNP	ENST00000371160.1	37	CCDS14607.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.242660	0.79912	.	.	ENSG00000101972	ENST00000218089;ENST00000455404;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144	T;T;T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.62;0.62;0.62	4.95	4.95	0.65309	STAG (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.74344	0.3704	H	0.94658	3.565	0.80722	D	1	D;D	0.56035	0.974;0.963	P;P	0.61328	0.887;0.857	T	0.82504	-0.0424	10	0.87932	D	0	-17.2085	13.9391	0.64043	1.0:0.0:0.0:0.0	.	217;217	Q8N3U4-2;Q8N3U4	.;STAG2_HUMAN	R	217;217;148;217;217;217;217	ENSP00000218089:H217R;ENSP00000397265:H217R;ENSP00000346555:H148R;ENSP00000360202:H217R;ENSP00000360199:H217R;ENSP00000360187:H217R;ENSP00000360186:H217R	ENSP00000218089:H217R	H	+	2	0	STAG2	123006882	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.272000	0.95707	1.736000	0.51660	0.345000	0.21793	CAT		STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603	
ZNF280C	55609	broad.mit.edu	37	X	129394415	129394415	+	Silent	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chrX:129394415G>A	ENST00000370978.4	-	2	162	c.9C>T	c.(7-9)gaC>gaT	p.D3D		NM_017666.4	NP_060136.1	Q8ND82	Z280C_HUMAN	zinc finger protein 280C	3					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D3D(1)		endometrium(3)|kidney(4)|large_intestine(9)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	26						AAGGTTTGTCGTCATCCATGA	0.348													G|||	1	0.000264901	0.0	0.0	3775	,	,		11610	0.0		0.0	False		,,,				2504	0.001				p.D3D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C9T	X						.						127.0	106.0	113.0					X																	129394415		2203	4300	6503	129222096	SO:0001819	synonymous_variant	55609	exon2			AL834333	CCDS14622.1	Xq25	2008-05-02	2007-09-20	2007-09-20	ENSG00000056277	ENSG00000056277			25955	protein-coding gene	gene with protein product			"""suppressor of hairy wing homolog 3 (Drosophila)"""	SUHW3		12477932	Standard	NM_017666		Approved	FLJ20095, ZNF633	uc004evm.3	Q8ND82	OTTHUMG00000022393	ENST00000370978.4:c.9C>T	X.37:g.129394415G>A		Somatic		Capture	Illumina HiSeq	Phase_I	129222096	NM_017666	A8K2V8|Q9NXR3	Silent	SNP	ENST00000370978.4	37	CCDS14622.1																																																																																				ZNF280C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058251.1	NM_017666	
FHL1	2273	broad.mit.edu	37	X	135288597	135288597	+	Silent	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chrX:135288597G>A	ENST00000345434.3	+	2	87	c.6G>A	c.(4-6)gcG>gcA	p.A2A	FHL1_ENST00000370676.3_Silent_p.A18A|FHL1_ENST00000394153.2_Silent_p.A2A|FHL1_ENST00000543669.1_Silent_p.A2A|FHL1_ENST00000539015.1_Silent_p.A31A|FHL1_ENST00000394155.2_Silent_p.A2A|FHL1_ENST00000477080.1_3'UTR|FHL1_ENST00000535737.1_Silent_p.A2A|FHL1_ENST00000370690.3_Silent_p.A2A|FHL1_ENST00000370683.1_Silent_p.A18A			Q13642	FHL1_HUMAN	four and a half LIM domains 1	2					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|organ morphogenesis (GO:0009887)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane depolarization (GO:0003254)|regulation of potassium ion transmembrane transporter activity (GO:1901016)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ion channel binding (GO:0044325)|zinc ion binding (GO:0008270)	p.A2A(2)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(192;0.000127)					GCACCATGGCGGAGAAGTTTG	0.567																																					p.A2A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G6A	X						.						134.0	120.0	125.0					X																	135288597		2203	4300	6503	135116263	SO:0001819	synonymous_variant	2273	exon3			U60115	CCDS14655.1, CCDS55505.1, CCDS55506.1, CCDS55507.1, CCDS76036.1	Xq26.3	2014-09-17			ENSG00000022267	ENSG00000022267			3702	protein-coding gene	gene with protein product	"""Four-and-a-half LIM domains 1"", ""LIM protein SLIMMER"""	300163				8753811, 9714789	Standard	NM_001449		Approved	SLIM1, KYO-T, bA535K18.1, FHL1B, XMPMA, FLH1A, MGC111107	uc004ezo.3	Q13642	OTTHUMG00000022504	ENST00000345434.3:c.6G>A	X.37:g.135288597G>A		Somatic		Capture	Illumina HiSeq	Phase_I	135116263	NM_001159702	B7Z5T4|B7Z793|O95212|Q13230|Q13645|Q5JXI7|Q5M7Y6|Q6IB30|Q9NZ40|Q9UKZ8|Q9Y630	Silent	SNP	ENST00000345434.3	37	CCDS55507.1																																																																																				FHL1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058461.1	NM_001449	
MAOB	4129	broad.mit.edu	37	X	43626760	43626760	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chrX:43626760C>T	ENST00000378069.4	-	15	1663	c.1516G>A	c.(1516-1518)Gct>Act	p.A506T	MAOB_ENST00000536181.1_Missense_Mutation_p.A490T|MAOB_ENST00000538942.1_3'UTR	NM_000898.4	NP_000889.3	P27338	AOFB_HUMAN	monoamine oxidase B	506					negative regulation of serotonin secretion (GO:0014063)|positive regulation of dopamine metabolic process (GO:0045964)|response to aluminum ion (GO:0010044)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|primary amine oxidase activity (GO:0008131)	p.A506T(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(2)|skin(5)	21					Amantadine(DB00915)|Amphetamine(DB00182)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Procaine(DB00721)|Rasagiline(DB01367)|Selegiline(DB01037)|Sertraline(DB01104)|Tranylcypromine(DB00752)|Zonisamide(DB00909)	AAGCCAAGAGCCGTTGCTGAA	0.517																																					p.A506T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1516A	X						.						84.0	71.0	75.0					X																	43626760		2203	4300	6503	43511704	SO:0001583	missense	4129	exon15				CCDS14261.1	Xp11.4-p11.3	2008-02-05			ENSG00000069535	ENSG00000069535	1.4.3.4		6834	protein-coding gene	gene with protein product		309860					Standard	NM_000898		Approved		uc004dfz.4	P27338	OTTHUMG00000021388	ENST00000378069.4:c.1516G>A	X.37:g.43626760C>T	ENSP00000367309:p.Ala506Thr	Somatic		Capture	Illumina HiSeq	Phase_I	43511704	NM_000898	B2R6R3|B7Z5H3|D3DWC3|Q7Z6S2	Missense_Mutation	SNP	ENST00000378069.4	37	CCDS14261.1	.	.	.	.	.	.	.	.	.	.	C	16.91	3.251481	0.59212	.	.	ENSG00000069535	ENST00000378069;ENST00000536181	T;T	0.18657	2.2;2.23	5.76	5.76	0.90799	.	0.050617	0.85682	D	0.000000	T	0.29524	0.0736	M	0.72479	2.2	0.80722	D	1	B	0.24043	0.096	B	0.23419	0.046	T	0.03863	-1.0997	10	0.54805	T	0.06	-5.748	17.6248	0.88091	0.0:1.0:0.0:0.0	.	506	P27338	AOFB_HUMAN	T	506;490	ENSP00000367309:A506T;ENSP00000441613:A490T	ENSP00000367309:A506T	A	-	1	0	MAOB	43511704	1.000000	0.71417	0.476000	0.27291	0.438000	0.31896	6.803000	0.75180	2.434000	0.82447	0.597000	0.82753	GCT		MAOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056303.1	NM_000898	
SYN1	6853	broad.mit.edu	37	X	47436858	47436858	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chrX:47436858C>T	ENST00000295987.7	-	6	941	c.817G>A	c.(817-819)Gca>Aca	p.A273T	SYN1_ENST00000340666.4_Missense_Mutation_p.A273T	NM_006950.3	NP_008881.2	P17600	SYN1_HUMAN	synapsin I	273	C; actin-binding and synaptic-vesicle binding.				neurotransmitter secretion (GO:0007269)|regulation of neurotransmitter secretion (GO:0046928)|regulation of synaptic vesicle exocytosis (GO:2000300)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|protein kinase binding (GO:0019901)|transporter activity (GO:0005215)	p.A273T(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(6)|lung(6)|ovary(1)	21						CCAGAGTGTGCGTGCCCCATC	0.562																																					p.A273T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G817A	X						.						222.0	101.0	142.0					X																	47436858		2203	4300	6503	47321802	SO:0001583	missense	6853	exon6				CCDS14280.1, CCDS35233.1	Xp11.2	2012-10-02			ENSG00000008056	ENSG00000008056			11494	protein-coding gene	gene with protein product		313440					Standard	NM_133499		Approved		uc004die.3	P17600	OTTHUMG00000021454	ENST00000295987.7:c.817G>A	X.37:g.47436858C>T	ENSP00000295987:p.Ala273Thr	Somatic		Capture	Illumina HiSeq	Phase_I	47321802	NM_133499	B1AJQ1|O75825|Q5H9A9	Missense_Mutation	SNP	ENST00000295987.7	37	CCDS14280.1	.	.	.	.	.	.	.	.	.	.	C	19.77	3.888742	0.72524	.	.	ENSG00000008056	ENST00000295987;ENST00000340666	T;T	0.38240	1.63;1.15	4.39	4.39	0.52855	Synapsin, conserved site (1);ATP-grasp fold, subdomain 1 (1);Synapsin, ATP-binding domain (1);	0.000000	0.64402	D	0.000008	T	0.65015	0.2651	M	0.88704	2.975	0.80722	D	1	D;D	0.89917	0.969;1.0	P;D	0.87578	0.64;0.998	T	0.73251	-0.4042	10	0.87932	D	0	-8.2626	13.5758	0.61873	0.0:1.0:0.0:0.0	.	273;273	P17600;P17600-2	SYN1_HUMAN;.	T	273	ENSP00000295987:A273T;ENSP00000343206:A273T	ENSP00000295987:A273T	A	-	1	0	SYN1	47321802	1.000000	0.71417	0.431000	0.26735	0.184000	0.23303	7.094000	0.76944	1.764000	0.52075	0.583000	0.79449	GCA		SYN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056445.1	NM_006950	
WDR13	64743	broad.mit.edu	37	X	48457786	48457786	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chrX:48457786C>T	ENST00000218056.5	+	3	833	c.328C>T	c.(328-330)Cgt>Tgt	p.R110C	WDR13_ENST00000376729.5_Missense_Mutation_p.R110C|WDR13_ENST00000492715.1_3'UTR	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13	110						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R110C(2)		endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						TGGGCACCGTCGTTCTGTCAG	0.617																																					p.R18C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C52T	X						.						28.0	25.0	26.0					X																	48457786		2203	4300	6503	48342730	SO:0001583	missense	64743	exon2			AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.328C>T	X.37:g.48457786C>T	ENSP00000218056:p.Arg110Cys	Somatic		Capture	Illumina HiSeq	Phase_I	48342730	NM_001166426	Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	Missense_Mutation	SNP	ENST00000218056.5	37	CCDS14302.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.447005	0.84101	.	.	ENSG00000101940	ENST00000376729;ENST00000218056	T;T	0.72835	-0.69;-0.69	5.14	5.14	0.70334	.	0.057310	0.64402	D	0.000001	T	0.79287	0.4420	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	P	0.59221	0.854	T	0.80953	-0.1152	10	0.54805	T	0.06	-28.2534	14.9887	0.71368	0.0:1.0:0.0:0.0	.	110	Q9H1Z4	WDR13_HUMAN	C	110	ENSP00000365919:R110C;ENSP00000218056:R110C	ENSP00000218056:R110C	R	+	1	0	WDR13	48342730	1.000000	0.71417	0.990000	0.47175	0.964000	0.63967	3.053000	0.49901	2.124000	0.65301	0.529000	0.55759	CGT		WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060743.2		
HSD17B10	3028	broad.mit.edu	37	X	53460776	53460776	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chrX:53460776G>A	ENST00000168216.6	-	2	112	c.85C>T	c.(85-87)Cga>Tga	p.R29*	HSD17B10_ENST00000375304.5_Nonsense_Mutation_p.R29*|HSD17B10_ENST00000375298.4_Nonsense_Mutation_p.R29*|HSD17B10_ENST00000495986.1_5'UTR|RP3-339A18.6_ENST00000418049.1_RNA	NM_001037811.2|NM_004493.2	NP_001032900.1|NP_004484.1	Q99714	HCD2_HUMAN	hydroxysteroid (17-beta) dehydrogenase 10	29					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxy-2-methylbutyryl-CoA dehydrogenase activity (GO:0047015)|3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|cholate 7-alpha-dehydrogenase activity (GO:0008709)|poly(A) RNA binding (GO:0044822)|testosterone dehydrogenase [NAD(P)] activity (GO:0030283)	p.R29*(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|skin(1)	8						CCCACAAGTCGCTCCGCCGTG	0.627																																					p.R29X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C85T	X						.						33.0	25.0	28.0					X																	53460776		2203	4299	6502	53477501	SO:0001587	stop_gained	3028	exon2			U96132	CCDS14354.1, CCDS35300.1	Xp11.2	2014-09-17	2006-11-22	2006-11-22	ENSG00000072506	ENSG00000072506	1.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	4800	protein-coding gene	gene with protein product	"""type 10 17b-HSD"", ""type 10 17beta-hydroxysteroid dehydrogenase"", ""AB-binding alcohol dehydrogenase"", ""short chain dehydrogenase/reductase family 5C, member 1"", ""mitochondrial RNase P subunit 2"""	300256	"""hydroxyacyl-Coenzyme A dehydrogenase, type II, hydroxyacyl-Coenzyme A dehydrogenase, type II"", ""mental retardation, X-linked, syndromic 10"""	HADH2, MRXS10		9338779, 16899120, 19027726, 18984158, 17236142	Standard	NM_004493		Approved	ERAB, MHBD, 17b-HSD10, ABAD, SDR5C1, MRPP2, CAMR	uc004dsl.1	Q99714	OTTHUMG00000021612	ENST00000168216.6:c.85C>T	X.37:g.53460776G>A	ENSP00000168216:p.Arg29*	Somatic		Capture	Illumina HiSeq	Phase_I	53477501	NM_001037811	Q5H927|Q6IBS9|Q8TCV9|Q96HD5	Nonsense_Mutation	SNP	ENST00000168216.6	37	CCDS14354.1	.	.	.	.	.	.	.	.	.	.	G	18.81	3.703299	0.68501	.	.	ENSG00000072506	ENST00000168216;ENST00000375304;ENST00000375298	.	.	.	5.55	3.53	0.40419	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.17	0.59593	0.0:0.0:0.6684:0.3316	.	.	.	.	X	29	.	ENSP00000168216:R29X	R	-	1	2	HSD17B10	53477501	1.000000	0.71417	0.827000	0.32855	0.140000	0.21249	3.327000	0.52045	1.065000	0.40693	0.513000	0.50165	CGA		HSD17B10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056750.1	NM_004493	
ZC4H2	55906	broad.mit.edu	37	X	64138962	64138962	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chrX:64138962C>T	ENST00000374839.3	-	4	627	c.521G>A	c.(520-522)cGg>cAg	p.R174Q	ZC4H2_ENST00000337990.2_Missense_Mutation_p.R151Q|ZC4H2_ENST00000545618.1_Missense_Mutation_p.R169Q|ZC4H2_ENST00000447788.2_Intron|ZC4H2_ENST00000488608.1_5'UTR	NM_018684.3	NP_061154.1	Q9NQZ6	ZC4H2_HUMAN	zinc finger, C4H2 domain containing	174					nervous system development (GO:0007399)|neuromuscular junction development (GO:0007528)|spinal cord motor neuron differentiation (GO:0021522)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	metal ion binding (GO:0046872)	p.R174Q(1)		endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						GGCCGTCTGCCGAGTATCCTG	0.612																																					p.R151Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G452A	X						.						54.0	50.0	51.0					X																	64138962		2203	4300	6503	64055687	SO:0001583	missense	55906	exon4			AF270491	CCDS14380.1, CCDS55431.1, CCDS55432.1	Xq11.1	2013-07-23	2008-10-01	2008-10-01	ENSG00000126970	ENSG00000126970		"""Zinc fingers"""	24931	protein-coding gene	gene with protein product		300897	"""KIAA1166"", ""Wieacker-Wolff syndrome"""	KIAA1166, WWS		10574461, 12097419, 23623388	Standard	NM_018684		Approved	HCA127	uc004dvu.3	Q9NQZ6	OTTHUMG00000021712	ENST00000374839.3:c.521G>A	X.37:g.64138962C>T	ENSP00000363972:p.Arg174Gln	Somatic		Capture	Illumina HiSeq	Phase_I	64055687	NM_001178032	B2RDC2|B3KVZ5|B4DED0|E7EM74|G3V1L3|Q53H73|Q5JTF9|Q9H9C3|Q9H9H7|Q9ULQ4	Missense_Mutation	SNP	ENST00000374839.3	37	CCDS14380.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.003970	0.74932	.	.	ENSG00000126970	ENST00000545618;ENST00000374839;ENST00000337990	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.60547	0.2277	L	0.36672	1.1	0.80722	D	1	D	0.65815	0.995	P	0.57283	0.817	T	0.53229	-0.8468	9	0.13853	T	0.58	.	16.0648	0.80863	0.0:1.0:0.0:0.0	.	174	Q9NQZ6	ZC4H2_HUMAN	Q	169;174;151	.	ENSP00000338650:R151Q	R	-	2	0	ZC4H2	64055687	1.000000	0.71417	0.990000	0.47175	0.995000	0.86356	7.555000	0.82223	2.482000	0.83794	0.600000	0.82982	CGG		ZC4H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056958.1	NM_018684	
MED12	9968	broad.mit.edu	37	X	70342603	70342603	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chrX:70342603G>A	ENST00000374080.3	+	10	1396	c.1364G>A	c.(1363-1365)cGg>cAg	p.R455Q	MED12_ENST00000333646.6_Missense_Mutation_p.R455Q|MED12_ENST00000374102.1_Missense_Mutation_p.R455Q			Q93074	MED12_HUMAN	mediator complex subunit 12	455					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.R455Q(2)		breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					ACCATTGGACGGGTACTTCAT	0.478			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome						.|||	1	0.000264901	0.0	0.0014	3775	,	,		13699	0.0		0.0	False		,,,				2504	0.0				p.R455Q			Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1364A	X						.						99.0	85.0	89.0					X																	70342603		1931	4133	6064	70259328	SO:0001583	missense	9968	exon10			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.1364G>A	X.37:g.70342603G>A	ENSP00000363193:p.Arg455Gln	Somatic		Capture	Illumina HiSeq	Phase_I	70259328	NM_005120	O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	ENST00000374080.3	37	CCDS43970.1	.	.	.	.	.	.	.	.	.	.	.	17.86	3.493322	0.64186	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072	T;T;T;T	0.37235	1.21;1.21;1.21;1.21	4.85	4.85	0.62838	Mediator complex, subunit Med12, LCEWAV-domain (1);	0.000000	0.85682	D	0.000000	T	0.48150	0.1484	M	0.73962	2.25	0.58432	D	0.999999	B;P;B;B	0.48016	0.032;0.904;0.267;0.275	B;P;B;B	0.46479	0.018;0.518;0.083;0.093	T	0.55945	-0.8060	10	0.56958	D	0.05	-22.8441	17.2392	0.87008	0.0:0.0:1.0:0.0	.	455;302;455;455	F5H3Y1;Q7Z3Z5;Q93074-3;Q93074	.;.;.;MED12_HUMAN	Q	455;455;455;455;423	ENSP00000333125:R455Q;ENSP00000363215:R455Q;ENSP00000363193:R455Q;ENSP00000414203:R423Q	ENSP00000333125:R455Q	R	+	2	0	MED12	70259328	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.152000	0.77419	2.251000	0.74343	0.502000	0.49764	CGG		MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1	NM_005120	
TAF1	6872	broad.mit.edu	37	X	70595134	70595134	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chrX:70595134G>A	ENST00000373790.4	+	4	581	c.530G>A	c.(529-531)gGt>gAt	p.G177D	TAF1_ENST00000449580.1_Missense_Mutation_p.G177D|TAF1_ENST00000423759.1_Missense_Mutation_p.G177D|TAF1_ENST00000276072.3_Missense_Mutation_p.G177D	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	177	Protein kinase 1.				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.G177D(1)		breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				TCTATTACTGGTGGTAAGTAG	0.438																																					p.G177D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G530A	X						.						96.0	81.0	86.0					X																	70595134		2203	4300	6503	70511859	SO:0001583	missense	6872	exon4				CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.530G>A	X.37:g.70595134G>A	ENSP00000362895:p.Gly177Asp	Somatic		Capture	Illumina HiSeq	Phase_I	70511859	NM_138923	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	ENST00000373790.4	37	CCDS35325.1	.	.	.	.	.	.	.	.	.	.	.	6.764	0.509787	0.12883	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000276072	T;T;T;T	0.09630	2.96;3.02;3.12;3.07	4.83	2.05	0.26809	.	0.970411	0.08475	N	0.940471	T	0.05823	0.0152	N	0.19112	0.55	0.18873	N	0.999983	B;B	0.19200	0.001;0.034	B;B	0.21708	0.002;0.036	T	0.47005	-0.9150	10	0.12103	T	0.63	.	1.4179	0.02306	0.2715:0.3092:0.292:0.1273	.	177;177	P21675;P21675-2	TAF1_HUMAN;.	D	177	ENSP00000362895:G177D;ENSP00000389000:G177D;ENSP00000406549:G177D;ENSP00000276072:G177D	ENSP00000276072:G177D	G	+	2	0	TAF1	70511859	0.629000	0.27146	0.471000	0.27229	0.155000	0.21991	0.587000	0.23909	0.406000	0.25560	0.429000	0.28392	GGT		TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058995.2	NM_004606	
SLC16A2	6567	broad.mit.edu	37	X	73745670	73745670	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chrX:73745670G>A	ENST00000587091.1	+	4	1289	c.1112G>A	c.(1111-1113)cGt>cAt	p.R371H	SLC16A2_ENST00000276033.5_Missense_Mutation_p.R445H	NM_006517.4	NP_006508.2	P36021	MOT8_HUMAN	solute carrier family 16, member 2 (thyroid hormone transporter)	371					monocarboxylic acid transport (GO:0015718)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)|transporter activity (GO:0005215)	p.R445H(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|skin(2)	21					L-Leucine(DB00149)|L-Tryptophan(DB00150)|L-Tyrosine(DB00135)|Levothyroxine(DB00451)|Liotrix(DB01583)|Pyruvic acid(DB00119)	GGCCTTGGGCGTCTTGTGTCA	0.517																																					p.R445H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1334A	X						.						177.0	150.0	159.0					X																	73745670		2203	4300	6503	73662395	SO:0001583	missense	6567	exon4				CCDS14426.1, CCDS14426.2	Xq13.2	2013-05-22	2012-03-20		ENSG00000147100	ENSG00000147100		"""Solute carriers"""	10923	protein-coding gene	gene with protein product		300095	"""solute carrier family 16 (monocarboxylic acid transporters), member 2 (putative transporter)"", ""Allan-Herndon-Dudley syndrome"", ""solute carrier family 16 (monocarboxylic acid transporters), member 2"", ""mental retardation, X-linked 22"", ""solute carrier family 16, member 2 (monocarboxylic acid transporter 8)"""	DXS128, AHDS, MRX22		7981683, 12871948, 15889350	Standard	NM_006517		Approved	XPCT, MCT8, MCT7	uc031tjy.1	P36021	OTTHUMG00000021857	ENST00000587091.1:c.1112G>A	X.37:g.73745670G>A	ENSP00000465734:p.Arg371His	Somatic		Capture	Illumina HiSeq	Phase_I	73662395	NM_006517	Q7Z797	Missense_Mutation	SNP	ENST00000587091.1	37	CCDS14426.2	.	.	.	.	.	.	.	.	.	.	G	25.5	4.645668	0.87958	.	.	ENSG00000147100	ENST00000276033	T	0.56941	0.43	4.94	4.94	0.65067	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.75265	0.3826	M	0.84082	2.675	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.80493	-0.1358	10	0.87932	D	0	.	17.4803	0.87671	0.0:0.0:1.0:0.0	.	371	P36021	MOT8_HUMAN	H	445	ENSP00000276033:R445H	ENSP00000276033:R445H	R	+	2	0	SLC16A2	73662395	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.472000	0.97709	2.052000	0.61016	0.597000	0.82753	CGT		SLC16A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057266.3		
PCDH19	57526	broad.mit.edu	37	X	99662660	99662660	+	Silent	SNP	G	G	A			TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chrX:99662660G>A	ENST00000373034.4	-	1	2611	c.936C>T	c.(934-936)taC>taT	p.Y312Y	PCDH19_ENST00000420881.2_Silent_p.Y312Y|PCDH19_ENST00000255531.7_Silent_p.Y312Y	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	312	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Y312Y(1)		breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						CGTCCAGTTCGTACACGTGCC	0.602																																					p.Y312Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C936T	X						.						59.0	65.0	63.0					X																	99662660		2169	4254	6423	99549316	SO:0001819	synonymous_variant	57526	exon1			AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.936C>T	X.37:g.99662660G>A		Somatic		Capture	Illumina HiSeq	Phase_I	99549316	NM_001105243	B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Silent	SNP	ENST00000373034.4	37	CCDS55462.1																																																																																				PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057479.2	NM_020766	
OPN1LW	5956	broad.mit.edu	37	X	153420112	153420112	+	Silent	SNP	C	C	T	rs138979991	byFrequency	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4001-01A-02W-1073-09	TCGA-AG-4001-10A-01W-1073-09	g.chrX:153420112C>T	ENST00000369951.4	+	4	702	c.642C>T	c.(640-642)ccC>ccT	p.P214P	OPN1LW_ENST00000463296.1_Intron	NM_020061.4	NP_064445.2	P04000	OPSR_HUMAN	opsin 1 (cone pigments), long-wave-sensitive	214					phototransduction, visible light (GO:0007603)|positive regulation of cytokinesis (GO:0032467)|protein-chromophore linkage (GO:0018298)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)	p.P214P(2)		endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	15	all_cancers(53;1.83e-16)|all_epithelial(53;2.73e-10)|all_lung(58;6.39e-07)|Lung NSC(58;8.37e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCTCGTACCCCGGGGTGCAGT	0.607													C|||	2	0.000529801	0.0015	0.0	3775	,	,		11090	0.0		0.0	False		,,,				2504	0.0				p.P214P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C642T	X						.	C		5,3809		1,1,2,1629,550	135.0	98.0	111.0		642	-8.5	0.4	X	dbSNP_134	111	0,6664		0,0,0,2424,1816	no	coding-synonymous	OPN1LW	NM_020061.4		1,1,2,4053,2366	TT,TC,T,CC,C		0.0,0.1311,0.0477		214/365	153420112	5,10473	2183	4240	6423	153073306	SO:0001819	synonymous_variant	5956	exon4			Z68193	CCDS14742.1	Xq28	2013-01-08	2008-04-16		ENSG00000102076	ENSG00000102076		"""GPCR / Class A : Opsin receptors"""	9936	protein-coding gene	gene with protein product	"""cone dystrophy 5 (X-linked)"""	300822	"""color blindness, protan"", ""red cone photoreceptor pigment"""	CBBM, RCP, CBP			Standard	NM_020061		Approved	COD5	uc004fjz.4	P04000	OTTHUMG00000034295	ENST00000369951.4:c.642C>T	X.37:g.153420112C>T		Somatic		Capture	Illumina HiSeq	Phase_I	153073306	NM_020061		Silent	SNP	ENST00000369951.4	37	CCDS14742.1																																																																																				OPN1LW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082839.2	NM_020061	
