#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
LARP4B	23185	broad.mit.edu	37	10	890957	890957	+	Nonsense_Mutation	SNP	G	G	A	rs538826325		TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr10:890957G>A	ENST00000316157.3	-	5	509	c.469C>T	c.(469-471)Cga>Tga	p.R157*		NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	157	HTH La-type RNA-binding. {ECO:0000255|PROSITE-ProRule:PRU00332}.				positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)	p.R157*(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						AGTACTTCTCGGGGGTCTTCC	0.363																																					p.R157X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C469T	10						.						131.0	123.0	126.0					10																	890957		2203	4300	6503	880957	SO:0001587	stop_gained	23185	exon5			D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.469C>T	10.37:g.890957G>A	ENSP00000326128:p.Arg157*	Somatic		Capture	Illumina HiSeq	Phase_I	880957	NM_015155	A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Nonsense_Mutation	SNP	ENST00000316157.3	37	CCDS31131.1	.	.	.	.	.	.	.	.	.	.	G	36	5.822112	0.96989	.	.	ENSG00000107929	ENST00000316157	.	.	.	5.65	4.73	0.59995	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	-10.4542	16.1496	0.81605	0.0:0.0:0.8653:0.1347	.	.	.	.	X	157	.	ENSP00000326128:R157X	R	-	1	2	LARP4B	880957	1.000000	0.71417	0.989000	0.46669	0.937000	0.57800	3.884000	0.56175	1.483000	0.48342	0.563000	0.77884	CGA		LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046395.2	NM_015155	
AKR1C3	8644	broad.mit.edu	37	10	5138762	5138762	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr10:5138762C>A	ENST00000380554.3	+	2	897	c.245C>A	c.(244-246)aCt>aAt	p.T82N	AKR1C3_ENST00000470862.2_3'UTR|AKR1C3_ENST00000605149.1_Missense_Mutation_p.T59N|AKR1C3_ENST00000439082.2_5'UTR	NM_001253908.1|NM_003739.5	NP_001240837.1|NP_003730.4	P42330	AK1C3_HUMAN	aldo-keto reductase family 1, member C3	82					arachidonic acid metabolic process (GO:0019369)|cellular response to cadmium ion (GO:0071276)|cellular response to calcium ion (GO:0071277)|cellular response to corticosteroid stimulus (GO:0071384)|cellular response to jasmonic acid stimulus (GO:0071395)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to reactive oxygen species (GO:0034614)|cellular response to starvation (GO:0009267)|cyclooxygenase pathway (GO:0019371)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)|farnesol catabolic process (GO:0016488)|G-protein coupled receptor signaling pathway (GO:0007186)|keratinocyte differentiation (GO:0030216)|male gonad development (GO:0008584)|multicellular organismal macromolecule metabolic process (GO:0044259)|negative regulation of retinoic acid biosynthetic process (GO:1900053)|oxidation-reduction process (GO:0055114)|phototransduction, visible light (GO:0007603)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|progesterone metabolic process (GO:0042448)|prostaglandin metabolic process (GO:0006693)|protein import into nucleus, translocation (GO:0000060)|regulation of retinoic acid receptor signaling pathway (GO:0048385)|regulation of testosterone biosynthetic process (GO:2000224)|renal absorption (GO:0070293)|response to nutrient (GO:0007584)|response to prostaglandin (GO:0034694)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	15-hydroxyprostaglandin-D dehydrogenase (NADP+) activity (GO:0047020)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase activity (GO:0047023)|delta4-3-oxosteroid 5beta-reductase activity (GO:0047787)|dihydrotestosterone 17-beta-dehydrogenase activity (GO:0035410)|geranylgeranyl reductase activity (GO:0045550)|indanol dehydrogenase activity (GO:0047718)|ketoreductase activity (GO:0045703)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|prostaglandin D2 11-ketoreductase activity (GO:0036131)|prostaglandin F receptor activity (GO:0004958)|prostaglandin-F synthase activity (GO:0047017)|retinal dehydrogenase activity (GO:0001758)|retinol dehydrogenase activity (GO:0004745)|testosterone 17-beta-dehydrogenase (NADP+) activity (GO:0047045)|testosterone dehydrogenase (NAD+) activity (GO:0047035)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)	p.T82N(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|skin(1)	14					Bimatoprost(DB00905)|Doxorubicin(DB00997)	ATATTCTACACTTCAAAGGTA	0.408																																					p.T82N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C245A	10						.						177.0	137.0	151.0					10																	5138762		2203	4300	6503	5128762	SO:0001583	missense	8644	exon2			L43839	CCDS7063.1, CCDS73062.1	10p15-p14	2012-12-04	2012-12-04		ENSG00000196139	ENSG00000196139	1.1.1.213, 1.1.1.188	"""Aldo-keto reductases"""	386	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase X"", ""prostaglandin F synthase"", ""3-alpha hydroxysteroid dehydrogenase, type II"""	603966	"""hydroxysteroid (17-beta) dehydrogenase 5"", ""aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)"""	HSD17B5		7650035, 9792917	Standard	NM_003739		Approved	KIAA0119, DDX, HAKRB, PGFS	uc021pml.1	P42330	OTTHUMG00000017585	ENST00000380554.3:c.245C>A	10.37:g.5138762C>A	ENSP00000369927:p.Thr82Asn	Somatic		Capture	Illumina HiSeq	Phase_I	5128762	NM_003739	A8K2V0|B4DL37|Q5T2L1|Q96DJ1|Q96KI8|Q99530|Q9UCX1|Q9UII3|Q9UKL9	Missense_Mutation	SNP	ENST00000380554.3	37	CCDS7063.1	.	.	.	.	.	.	.	.	.	.	C	17.25	3.341647	0.61073	.	.	ENSG00000196139	ENST00000380554	T	0.55413	0.52	2.0	2.0	0.26442	NADP-dependent oxidoreductase domain (3);	0.000000	0.56097	D	0.000030	T	0.72252	0.3437	M	0.90922	3.16	0.27770	N	0.943527	P;P	0.51537	0.946;0.859	P;P	0.62382	0.901;0.75	T	0.65932	-0.6048	10	0.72032	D	0.01	.	10.0149	0.42008	0.0:1.0:0.0:0.0	.	82;82	B4DKT3;P42330	.;AK1C3_HUMAN	N	82	ENSP00000369927:T82N	ENSP00000369927:T82N	T	+	2	0	AKR1C3	5128762	0.581000	0.26741	0.136000	0.22124	0.769000	0.43574	1.607000	0.36836	1.424000	0.47217	0.313000	0.20887	ACT		AKR1C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046533.2	NM_003739	
OGDHL	55753	broad.mit.edu	37	10	50945842	50945842	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr10:50945842T>A	ENST00000374103.4	-	20	2665	c.2580A>T	c.(2578-2580)caA>caT	p.Q860H	OGDHL_ENST00000490844.1_5'UTR|OGDHL_ENST00000432695.1_Missense_Mutation_p.Q651H|OGDHL_ENST00000419399.1_Missense_Mutation_p.Q803H	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	860					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)	p.Q860H(1)		central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						CGGATACCATTTGGTCAAAGC	0.587																																					p.Q803H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2409T	10						.						61.0	70.0	67.0					10																	50945842		2203	4300	6503	50615848	SO:0001583	missense	55753	exon19			AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.2580A>T	10.37:g.50945842T>A	ENSP00000363216:p.Gln860His	Somatic		Capture	Illumina HiSeq	Phase_I	50615848	NM_001143996	A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Missense_Mutation	SNP	ENST00000374103.4	37	CCDS7234.1	.	.	.	.	.	.	.	.	.	.	T	15.67	2.902311	0.52227	.	.	ENSG00000197444	ENST00000374103;ENST00000419399;ENST00000432695	T;T;T	0.11385	2.78;2.78;2.78	5.19	-10.0	0.00425	.	0.323215	0.31859	N	0.006948	T	0.08846	0.0219	L	0.47016	1.485	0.23221	N	0.998092	B;B;B	0.32031	0.352;0.067;0.128	B;B;B	0.42282	0.382;0.273;0.212	T	0.14839	-1.0458	10	0.87932	D	0	.	5.8303	0.18577	0.0846:0.4806:0.2543:0.1805	.	803;651;860	Q9ULD0-2;Q9ULD0-3;Q9ULD0	.;.;OGDHL_HUMAN	H	860;803;651	ENSP00000363216:Q860H;ENSP00000401356:Q803H;ENSP00000390240:Q651H	ENSP00000363216:Q860H	Q	-	3	2	OGDHL	50615848	0.297000	0.24408	0.845000	0.33349	0.976000	0.68499	-0.820000	0.04457	-1.467000	0.01895	-0.297000	0.09499	CAA		OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048007.1	NM_018245	
PKNOX2	63876	broad.mit.edu	37	11	125267931	125267931	+	Missense_Mutation	SNP	C	C	A	rs377342245		TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr11:125267931C>A	ENST00000298282.9	+	7	832	c.561C>A	c.(559-561)aaC>aaA	p.N187K	PKNOX2_ENST00000530517.1_3'UTR|PKNOX2_ENST00000542175.1_Missense_Mutation_p.N123K	NM_022062.2	NP_071345.2	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2	187					regulation of transcription from RNA polymerase II promoter (GO:0006357)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)	p.N187K(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(14)|ovary(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	29		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		ACTCCCCCAACCAGCCCTCCA	0.557																																					p.N187K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C561A	11						.						74.0	80.0	78.0					11																	125267931		1939	4130	6069	124773141	SO:0001583	missense	63876	exon7			AK023136	CCDS41730.1	11q24.2	2014-09-04			ENSG00000165495	ENSG00000165495		"""Homeoboxes / TALE class"""	16714	protein-coding gene	gene with protein product		613066				11549286	Standard	NM_022062		Approved		uc001qbu.3	Q96KN3	OTTHUMG00000165884	ENST00000298282.9:c.561C>A	11.37:g.125267931C>A	ENSP00000298282:p.Asn187Lys	Somatic		Capture	Illumina HiSeq	Phase_I	124773141	NM_022062	B7Z5I5|F5GZ15|Q63HL6|Q86XD1	Missense_Mutation	SNP	ENST00000298282.9	37	CCDS41730.1	.	.	.	.	.	.	.	.	.	.	C	9.314	1.056244	0.19907	.	.	ENSG00000165495	ENST00000530517;ENST00000531116;ENST00000298282;ENST00000542175;ENST00000535518	D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.8	5.24	5.24	0.73138	.	0.217375	0.47852	D	0.000215	T	0.73590	0.3606	N	0.14661	0.345	0.58432	D	0.999999	B;B	0.28933	0.228;0.118	B;B	0.29862	0.108;0.039	T	0.70510	-0.4852	10	0.05721	T	0.95	-19.7188	19.2389	0.93873	0.0:1.0:0.0:0.0	.	123;187	F5GZ15;Q96KN3	.;PKNX2_HUMAN	K	158;158;187;123;175	ENSP00000434732:N158K;ENSP00000433971:N158K;ENSP00000298282:N187K;ENSP00000441470:N123K	ENSP00000298282:N187K	N	+	3	2	PKNOX2	124773141	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.067000	0.41461	2.604000	0.88044	0.650000	0.86243	AAC		PKNOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386866.3		
CCKBR	887	broad.mit.edu	37	11	6292523	6292523	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr11:6292523G>A	ENST00000334619.2	+	5	1287	c.1094G>A	c.(1093-1095)cGa>cAa	p.R365Q	CCKBR_ENST00000532715.1_Missense_Mutation_p.R281Q|CCKBR_ENST00000525462.1_Missense_Mutation_p.R434Q	NM_176875.3	NP_795344.1	P32239	GASR_HUMAN	cholecystokinin B receptor	365					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|digestive tract development (GO:0048565)|feeding behavior (GO:0007631)|gastric acid secretion (GO:0001696)|gland development (GO:0048732)|metabolic process (GO:0008152)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|cholecystokinin receptor activity (GO:0004951)|gastrin receptor activity (GO:0015054)|phosphatidylinositol phospholipase C activity (GO:0004435)|type B gastrin/cholecystokinin receptor binding (GO:0031741)	p.R365Q(1)		NS(2)|breast(2)|endometrium(4)|kidney(13)|large_intestine(10)|lung(22)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	Pentagastrin(DB00183)	GGTGCACACCGAGCACTCTCG	0.557																																					p.R365Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1094A	11						.						156.0	125.0	135.0					11																	6292523		2201	4296	6497	6249099	SO:0001583	missense	887	exon5			D13305	CCDS7761.1	11p15.4	2012-08-10			ENSG00000110148	ENSG00000110148		"""GPCR / Class A : Cholecystokinin receptors"""	1571	protein-coding gene	gene with protein product		118445				1280419	Standard	NM_176875		Approved		uc001mcp.3	P32239	OTTHUMG00000133380	ENST00000334619.2:c.1094G>A	11.37:g.6292523G>A	ENSP00000335544:p.Arg365Gln	Somatic		Capture	Illumina HiSeq	Phase_I	6249099	NM_176875	A8K7P9|O75824|Q16144|Q92492|Q96LC6|Q9NYK7|Q9UBV1	Missense_Mutation	SNP	ENST00000334619.2	37	CCDS7761.1	.	.	.	.	.	.	.	.	.	.	G	11.91	1.780790	0.31502	.	.	ENSG00000110148	ENST00000334619;ENST00000532715;ENST00000525462	T;T;T	0.37235	1.21;1.21;1.21	5.24	5.24	0.73138	GPCR, rhodopsin-like superfamily (1);	0.367899	0.29159	N	0.012964	T	0.24699	0.0599	N	0.26042	0.785	0.09310	N	1	P;P;P	0.42584	0.588;0.63;0.784	B;B;B	0.36335	0.222;0.119;0.189	T	0.20405	-1.0276	10	0.45353	T	0.12	.	12.4971	0.55933	0.0:0.0:0.8329:0.1671	.	434;299;365	P32239-2;P32239-3;P32239	.;.;GASR_HUMAN	Q	365;281;434	ENSP00000335544:R365Q;ENSP00000432079:R281Q;ENSP00000435534:R434Q	ENSP00000335544:R365Q	R	+	2	0	CCKBR	6249099	0.000000	0.05858	0.320000	0.25306	0.062000	0.15995	0.578000	0.23773	2.425000	0.82216	0.557000	0.71058	CGA		CCKBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257230.2	NM_176875	
NLRP10	338322	broad.mit.edu	37	11	7981697	7981697	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr11:7981697C>T	ENST00000328600.2	-	2	1623	c.1462G>A	c.(1462-1464)Ggg>Agg	p.G488R		NM_176821.3	NP_789791.1	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	488					defense response to fungus (GO:0050832)|defense response to Gram-negative bacterium (GO:0050829)|dendritic cell migration (GO:0036336)|helper T cell enhancement of adaptive immune response (GO:0035397)|innate immune response (GO:0045087)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 type immune response (GO:2000318)	cytoplasm (GO:0005737)|extrinsic component of plasma membrane (GO:0019897)	ATP binding (GO:0005524)	p.G488R(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GACTCCTTCCCCAGCCGGCTT	0.512																																					p.G488R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1462A	11						.						89.0	93.0	92.0					11																	7981697		2201	4296	6497	7938273	SO:0001583	missense	338322	exon2			AY154465	CCDS7784.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000182261		"""Nucleotide-binding domain and leucine rich repeat containing"""	21464	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 10"""	609662	"""NACHT, leucine rich repeat and PYD containing 10"""	NALP10		12563287	Standard	NM_176821		Approved	NOD8, PAN5, Pynod, CLR11.1	uc001mfv.1	Q86W26		ENST00000328600.2:c.1462G>A	11.37:g.7981697C>T	ENSP00000327763:p.Gly488Arg	Somatic		Capture	Illumina HiSeq	Phase_I	7938273	NM_176821	Q2M3C4|Q6JGT0	Missense_Mutation	SNP	ENST00000328600.2	37	CCDS7784.1	.	.	.	.	.	.	.	.	.	.	C	5.876	0.345695	0.11126	.	.	ENSG00000182261	ENST00000328600	D	0.87729	-2.29	3.57	2.65	0.31530	.	0.000000	0.37761	N	0.001946	D	0.84079	0.5393	L	0.48362	1.52	0.09310	N	1	P	0.46395	0.877	P	0.51453	0.67	T	0.72211	-0.4359	10	0.15952	T	0.53	.	6.9612	0.24597	0.0:0.8748:0.0:0.1252	.	488	Q86W26	NAL10_HUMAN	R	488	ENSP00000327763:G488R	ENSP00000327763:G488R	G	-	1	0	NLRP10	7938273	0.000000	0.05858	0.083000	0.20561	0.098000	0.18820	-0.213000	0.09305	1.091000	0.41335	-0.251000	0.11542	GGG		NLRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385705.1	NM_176821	
CSTF3	1479	broad.mit.edu	37	11	33127570	33127570	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	SOLID			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr11:33127570T>A	ENST00000323959.4	-	6	536	c.397A>T	c.(397-399)Att>Ttt	p.I133F	CSTF3_ENST00000524827.1_Missense_Mutation_p.I165F	NM_001326.2	NP_001317.1	Q12996	CSTF3_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa	133					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.I133F(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(1)|stomach(1)	19						TCCATTCCAATTTTATCCAGT	0.259																																					p.I133F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A397T	11						.						77.0	83.0	81.0					11																	33127570		2202	4297	6499	33084146	SO:0001583	missense	1479	exon6			U15782	CCDS7883.1, CCDS44563.1, CCDS44564.1	11p13	2007-01-05	2002-08-29		ENSG00000176102	ENSG00000176102			2485	protein-coding gene	gene with protein product		600367	"""cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kD"""			7984242	Standard	XM_006718154		Approved	CstF-77	uc001muh.3	Q12996	OTTHUMG00000166268	ENST00000323959.4:c.397A>T	11.37:g.33127570T>A	ENSP00000315791:p.Ile133Phe	Somatic		Capture	Illumina HiSeq	Phase_I	33084146	NM_001326	A8K471|D3DR04|E9PB40|Q32P22|Q96FQ8|Q96QD6|Q96QK4	Missense_Mutation	SNP	ENST00000323959.4	37	CCDS7883.1	.	.	.	.	.	.	.	.	.	.	T	31	5.083805	0.94050	.	.	ENSG00000176102	ENST00000323959;ENST00000537832;ENST00000524827	T;T	0.35605	1.3;1.3	5.57	5.57	0.84162	.	0.049210	0.85682	D	0.000000	T	0.54806	0.1881	M	0.75150	2.29	0.80722	D	1	D	0.63880	0.993	P	0.55615	0.78	T	0.60677	-0.7216	10	0.72032	D	0.01	.	15.732	0.77814	0.0:0.0:0.0:1.0	.	133	Q12996	CSTF3_HUMAN	F	133;66;165	ENSP00000315791:I133F;ENSP00000431355:I165F	ENSP00000315791:I133F	I	-	1	0	CSTF3	33084146	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.035000	0.88872	2.123000	0.65237	0.477000	0.44152	ATT		CSTF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388801.1	NM_001326	
OR8I2	120586	broad.mit.edu	37	11	55861213	55861213	+	Silent	SNP	C	C	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr11:55861213C>T	ENST00000302124.2	+	1	461	c.430C>T	c.(430-432)Ctg>Ttg	p.L144L		NM_001003750.1	NP_001003750.1	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I, member 2	144						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L144L(1)		NS(1)|breast(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(24)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	53	Esophageal squamous(21;0.00693)					GTCCAACTGGCTGGGAGTAAT	0.438																																					p.L144L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C430T	11						.						147.0	135.0	139.0					11																	55861213		2201	4296	6497	55617789	SO:0001819	synonymous_variant	120586	exon1			AB065656	CCDS31517.1	11q11	2012-08-09			ENSG00000172154	ENSG00000172154		"""GPCR / Class A : Olfactory receptors"""	15310	protein-coding gene	gene with protein product							Standard	NM_001003750		Approved		uc010rix.2	Q8N0Y5	OTTHUMG00000166831	ENST00000302124.2:c.430C>T	11.37:g.55861213C>T		Somatic		Capture	Illumina HiSeq	Phase_I	55617789	NM_001003750	B2RNN4|Q6IFC0|Q96RC5	Silent	SNP	ENST00000302124.2	37	CCDS31517.1																																																																																				OR8I2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001003750	
OR4D11	219986	broad.mit.edu	37	11	59271156	59271156	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr11:59271156G>C	ENST00000313253.1	+	1	108	c.108G>C	c.(106-108)atG>atC	p.M36I		NM_001004706.1	NP_001004706.1	Q8NGI4	OR4DB_HUMAN	olfactory receptor, family 4, subfamily D, member 11	36						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M36I(1)		endometrium(2)|large_intestine(3)|liver(2)|lung(17)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29						TTGTGTACATGACGACTCTGC	0.458																																					p.M36I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G108C	11						.						147.0	138.0	141.0					11																	59271156		2201	4295	6496	59027732	SO:0001583	missense	219986	exon1			AB065810	CCDS31563.1	11q12.1	2012-08-09		2004-03-10	ENSG00000176200	ENSG00000176200		"""GPCR / Class A : Olfactory receptors"""	15174	protein-coding gene	gene with protein product				OR4D11P			Standard	NM_001004706		Approved		uc001noa.1	Q8NGI4	OTTHUMG00000167342	ENST00000313253.1:c.108G>C	11.37:g.59271156G>C	ENSP00000320077:p.Met36Ile	Somatic		Capture	Illumina HiSeq	Phase_I	59027732	NM_001004706		Missense_Mutation	SNP	ENST00000313253.1	37	CCDS31563.1	.	.	.	.	.	.	.	.	.	.	G	0.017	-1.505978	0.00992	.	.	ENSG00000176200	ENST00000313253	T	0.02863	4.13	5.45	-2.59	0.06209	.	1.094760	0.06977	N	0.819116	T	0.01124	0.0037	N	0.05259	-0.085	0.09310	N	0.999998	B	0.02656	0.0	B	0.04013	0.001	T	0.46665	-0.9175	10	0.02654	T	1	0.5716	2.1716	0.03851	0.3459:0.1881:0.3615:0.1044	.	36	Q8NGI4	OR4DB_HUMAN	I	36	ENSP00000320077:M36I	ENSP00000320077:M36I	M	+	3	0	OR4D11	59027732	0.000000	0.05858	0.104000	0.21259	0.191000	0.23601	-3.239000	0.00544	0.031000	0.15407	0.563000	0.77884	ATG		OR4D11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394236.1	NM_001004706	
ADAMTS15	170689	broad.mit.edu	37	11	130332087	130332087	+	Missense_Mutation	SNP	G	G	A	rs200077954		TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr11:130332087G>A	ENST00000299164.2	+	3	1196	c.1196G>A	c.(1195-1197)cGt>cAt	p.R399H		NM_139055.2	NP_620686.1	Q8TE58	ATS15_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 15	399	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R399H(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(8)|urinary_tract(1)	36	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		CAGATCGACCGTGCCAACCCC	0.607													G|||	1	0.000199681	0.0	0.0	5008	,	,		18020	0.001		0.0	False		,,,				2504	0.0				p.R399H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1196A	11						.						119.0	97.0	105.0					11																	130332087		2201	4297	6498	129837297	SO:0001583	missense	170689	exon3			AJ315733	CCDS8488.1	11q25	2008-02-01	2005-08-19		ENSG00000166106	ENSG00000166106		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	16305	protein-coding gene	gene with protein product		607509	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 15"""			11867212	Standard	NM_139055		Approved		uc010scd.2	Q8TE58	OTTHUMG00000165657	ENST00000299164.2:c.1196G>A	11.37:g.130332087G>A	ENSP00000299164:p.Arg399His	Somatic		Capture	Illumina HiSeq	Phase_I	129837297	NM_139055	Q32MI6	Missense_Mutation	SNP	ENST00000299164.2	37	CCDS8488.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	15.85	2.954456	0.53293	.	.	ENSG00000166106	ENST00000299164	D	0.86164	-2.08	5.58	5.58	0.84498	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	.	.	.	.	T	0.77928	0.4204	N	0.13140	0.3	0.58432	D	0.999999	P	0.44627	0.839	B	0.40477	0.33	T	0.77707	-0.2487	9	0.25751	T	0.34	.	15.9302	0.79654	0.0:0.0:0.8646:0.1354	.	399	Q8TE58	ATS15_HUMAN	H	399	ENSP00000299164:R399H	ENSP00000299164:R399H	R	+	2	0	ADAMTS15	129837297	1.000000	0.71417	0.963000	0.40424	0.876000	0.50452	6.585000	0.74062	2.621000	0.88768	0.650000	0.86243	CGT		ADAMTS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385638.1	NM_139055	
A2M	2	broad.mit.edu	37	12	9265980	9265980	+	Silent	SNP	G	G	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr12:9265980G>A	ENST00000318602.7	-	2	553	c.246C>T	c.(244-246)gaC>gaT	p.D82D		NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	82				D -> V (in Ref. 3; AAT02228). {ECO:0000305}.	blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)	p.D82D(1)		breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	AGTGGAGTACGTCATTCTCCG	0.483													G|||	2	0.000399361	0.0	0.0	5008	,	,		-128	0.0		0.0	False		,,,				2504	0.002				p.D82D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C246T	12						.						121.0	121.0	121.0					12																	9265980		2203	4300	6503	9157247	SO:0001819	synonymous_variant	2	exon2			BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.246C>T	12.37:g.9265980G>A		Somatic		Capture	Illumina HiSeq	Phase_I	9157247	NM_000014	Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	De_novo_Start_OutOfFrame	SNP	ENST00000318602.7	37	CCDS44827.1																																																																																				A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317233.2	NM_000014	
TMTC1	83857	broad.mit.edu	37	12	29709923	29709923	+	Missense_Mutation	SNP	G	G	A	rs141215209		TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr12:29709923G>A	ENST00000539277.1	-	10	1601	c.1543C>T	c.(1543-1545)Cgc>Tgc	p.R515C	TMTC1_ENST00000552618.1_Missense_Mutation_p.R539C|TMTC1_ENST00000319685.8_5'UTR|TMTC1_ENST00000256062.5_Missense_Mutation_p.R407C|TMTC1_ENST00000381224.2_Missense_Mutation_p.R469C|TMTC1_ENST00000551659.1_Missense_Mutation_p.R577C	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	515						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.R407C(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					CTTGCATGGCGTGGATACAAC	0.448													G|||	1	0.000199681	0.0	0.0	5008	,	,		18748	0.001		0.0	False		,,,				2504	0.0				p.R515C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1543T	12						.	G	CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	146.0	130.0	135.0		1543,1219	5.5	1.0	12	dbSNP_134	135	0,8600		0,0,4300	yes	missense,missense	TMTC1	NM_001193451.1,NM_175861.3	180,180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	515/883,407/775	29709923	1,13005	2203	4300	6503	29601190	SO:0001583	missense	83857	exon10				CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.1543C>T	12.37:g.29709923G>A	ENSP00000442046:p.Arg515Cys	Somatic		Capture	Illumina HiSeq	Phase_I	29601190	NM_001193451	D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Missense_Mutation	SNP	ENST00000539277.1	37	CCDS53772.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	20.9	4.071779	0.76301	2.27E-4	0.0	ENSG00000133687	ENST00000540901;ENST00000256062;ENST00000551659;ENST00000552618;ENST00000539277;ENST00000381224	T;T;T;T;T	0.59772	0.24;0.24;0.6;0.24;0.24	5.48	5.48	0.80851	Tetratricopeptide-like helical (1);PIK-related kinase, FAT (1);Tetratricopeptide repeat-containing (1);	0.120205	0.64402	D	0.000018	T	0.70185	0.3195	M	0.66439	2.03	0.58432	D	0.999991	D;D;D	0.89917	0.999;1.0;0.999	P;P;P	0.62184	0.854;0.873;0.899	T	0.70310	-0.4907	9	.	.	.	-16.3665	12.9681	0.58497	0.0:0.0:0.8384:0.1616	.	469;515;577	Q8IUR5-3;Q8IUR5;F8VTQ9	.;TMTC1_HUMAN;.	C	278;407;577;539;515;469	ENSP00000256062:R407C;ENSP00000448112:R577C;ENSP00000449043:R539C;ENSP00000442046:R515C;ENSP00000370622:R469C	.	R	-	1	0	TMTC1	29601190	1.000000	0.71417	0.959000	0.39883	0.959000	0.62525	6.994000	0.76251	2.576000	0.86940	0.655000	0.94253	CGC		TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403509.1	NM_031920	
ARID2	196528	broad.mit.edu	37	12	46230605	46230605	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr12:46230605G>A	ENST00000334344.6	+	8	1026	c.854G>A	c.(853-855)cGg>cAg	p.R285Q	ARID2_ENST00000444670.1_5'Flank|ARID2_ENST00000422737.1_Missense_Mutation_p.R136Q|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	285					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R285Q(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		GAAGGACAGCGGGTACTTCAG	0.403			"""N, S, F"""		hepatocellular carcinoma																																p.R285Q			Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G854A	12						.						157.0	153.0	155.0					12																	46230605		2203	4300	6503	44516872	SO:0001583	missense	196528	exon8				CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.854G>A	12.37:g.46230605G>A	ENSP00000335044:p.Arg285Gln	Somatic		Capture	Illumina HiSeq	Phase_I	44516872	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	ENST00000334344.6	37	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	G	35	5.482817	0.96307	.	.	ENSG00000189079	ENST00000334344;ENST00000422737	T;T	0.48522	0.81;0.81	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.71195	0.3311	M	0.73598	2.24	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.72616	-0.4239	10	0.87932	D	0	-12.5418	20.2009	0.98259	0.0:0.0:1.0:0.0	.	285	Q68CP9	ARID2_HUMAN	Q	285;136	ENSP00000335044:R285Q;ENSP00000415650:R136Q	ENSP00000335044:R285Q	R	+	2	0	ARID2	44516872	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.822000	0.99363	2.767000	0.95098	0.591000	0.81541	CGG		ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
GLI1	2735	broad.mit.edu	37	12	57865076	57865076	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr12:57865076C>A	ENST00000228682.2	+	12	2644	c.2553C>A	c.(2551-2553)taC>taA	p.Y851*	GLI1_ENST00000543426.1_Nonsense_Mutation_p.Y723*|GLI1_ENST00000546141.1_Nonsense_Mutation_p.Y810*	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	851					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)	p.Y851*(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			TTTCCCATTACCCCCAGCCCT	0.602																																					p.Y723X	Pancreas(157;841 1936 10503 41495 50368)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2169A	12						.						75.0	85.0	82.0					12																	57865076		2203	4300	6503	56151343	SO:0001587	stop_gained	2735	exon10				CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.2553C>A	12.37:g.57865076C>A	ENSP00000228682:p.Tyr851*	Somatic		Capture	Illumina HiSeq	Phase_I	56151343	NM_001160045	D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Nonsense_Mutation	SNP	ENST00000228682.2	37	CCDS8940.1	.	.	.	.	.	.	.	.	.	.	C	19.02	3.745964	0.69418	.	.	ENSG00000111087	ENST00000543426;ENST00000228682;ENST00000546141;ENST00000528467;ENST00000443131	.	.	.	4.44	-2.92	0.05615	.	0.196194	0.25456	N	0.030541	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.2153	0.25957	0.1296:0.2434:0.0:0.627	.	.	.	.	X	723;851;810;810;319	.	ENSP00000228682:Y851X	Y	+	3	2	GLI1	56151343	0.000000	0.05858	0.759000	0.31340	0.515000	0.34225	-1.397000	0.02511	-0.495000	0.06659	-0.439000	0.05793	TAC		GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394197.1	NM_005269	
MON2	23041	broad.mit.edu	37	12	62938714	62938714	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr12:62938714G>T	ENST00000393632.2	+	21	2894	c.2503G>T	c.(2503-2505)Gga>Tga	p.G835*	MON2_ENST00000546600.1_Nonsense_Mutation_p.G835*|RNU6-399P_ENST00000365164.1_RNA|MON2_ENST00000280379.6_Nonsense_Mutation_p.G836*|MON2_ENST00000552738.1_Nonsense_Mutation_p.G812*|MON2_ENST00000393630.3_Nonsense_Mutation_p.G836*|MON2_ENST00000552115.1_Nonsense_Mutation_p.G835*|MON2_ENST00000393629.2_Nonsense_Mutation_p.G835*	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	835					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.G835*(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		GAGAGAATGGGGAGCAGAAGC	0.328																																					p.G835X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G2503T	12						.						65.0	65.0	65.0					12																	62938714		2203	4300	6503	61224981	SO:0001587	stop_gained	23041	exon21				CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.2503G>T	12.37:g.62938714G>T	ENSP00000377252:p.Gly835*	Somatic		Capture	Illumina HiSeq	Phase_I	61224981	NM_015026	A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Nonsense_Mutation	SNP	ENST00000393632.2	37	CCDS31849.1	.	.	.	.	.	.	.	.	.	.	G	44	11.251642	0.99537	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000552738;ENST00000393629;ENST00000552115	.	.	.	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-19.4591	19.9855	0.97347	0.0:0.0:1.0:0.0	.	.	.	.	X	835;836;836;835;812;835;835	.	.	G	+	1	0	MON2	61224981	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.715000	0.92844	0.655000	0.94253	GGA		MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406767.3	NM_015026	
KRR1	11103	broad.mit.edu	37	12	75900604	75900604	+	Silent	SNP	T	T	C			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	SOLID			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr12:75900604T>C	ENST00000229214.4	-	3	374	c.351A>G	c.(349-351)agA>agG	p.R117R	KRR1_ENST00000438169.2_Silent_p.R117R	NM_007043.6	NP_008974.5	Q13601	KRR1_HUMAN	KRR1, small subunit (SSU) processome component, homolog (yeast)	117					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)	p.R117R(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(1)|pancreas(1)|urinary_tract(1)	11						TTATCAGATCTCTGGCCCTAA	0.378																																					p.R117R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A351G	12						.						130.0	122.0	125.0					12																	75900604		2203	4300	6503	74186871	SO:0001819	synonymous_variant	11103	exon3			U55766	CCDS9012.1	12q	2011-03-15	2006-05-18	2006-05-18	ENSG00000111615	ENSG00000111615			5176	protein-coding gene	gene with protein product		612817	"""HIV-1 rev binding protein 2"", ""HIV-1 Rev binding protein 2"""	HRB2		7505766, 11027267, 11359931, 8675026	Standard	NM_007043		Approved	RIP-1	uc001sxt.3	Q13601	OTTHUMG00000169759	ENST00000229214.4:c.351A>G	12.37:g.75900604T>C		Somatic		Capture	Illumina HiSeq	Phase_I	74186871	NM_007043	A0FIK6|A0JLP0|B2R989|E7EUQ0|Q8NEA8|Q8TC37|Q96AT5	Silent	SNP	ENST00000229214.4	37	CCDS9012.1																																																																																				KRR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405727.1	NM_007043	
CCER1	196477	broad.mit.edu	37	12	91348043	91348043	+	Silent	SNP	C	C	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr12:91348043C>T	ENST00000358859.2	-	1	910	c.477G>A	c.(475-477)ccG>ccA	p.P159P	CCER1_ENST00000548187.1_Intron	NM_152638.2	NP_689851.1	Q8TC90	CCER1_HUMAN	coiled-coil glutamate-rich protein 1	159								p.P159P(3)									GCGGGCTCCGCGGGTAGGAGT	0.706																																					p.P159P												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.G477A	12						.						21.0	24.0	23.0					12																	91348043		2198	4295	6493	89872174	SO:0001819	synonymous_variant	196477	exon1			BC024183	CCDS9036.1	12q21.33	2012-05-30	2012-05-30	2012-05-30	ENSG00000197651	ENSG00000197651			28373	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 12"""	C12orf12		17967063	Standard	NM_152638		Approved	MGC26598	uc001tbj.3	Q8TC90	OTTHUMG00000170070	ENST00000358859.2:c.477G>A	12.37:g.91348043C>T		Somatic		Capture	Illumina HiSeq	Phase_I	89872174	NM_152638	Q8TC47	Silent	SNP	ENST00000358859.2	37	CCDS9036.1																																																																																				CCER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407142.2	NM_152638	
MPHOSPH9	10198	broad.mit.edu	37	12	123649915	123649915	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr12:123649915C>A	ENST00000606320.1	-	18	2907	c.2701G>T	c.(2701-2703)Gaa>Taa	p.E901*	MPHOSPH9_ENST00000392425.3_Nonsense_Mutation_p.E749*|MPHOSPH9_ENST00000302349.5_Nonsense_Mutation_p.E749*|MPHOSPH9_ENST00000541076.2_Nonsense_Mutation_p.E871*			Q99550	MPP9_HUMAN	M-phase phosphoprotein 9	901						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.E749*(1)		NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(18)|prostate(2)|skin(1)	33	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)		TCATCAAGTTCTTTTAAAGCT	0.378																																					p.E749X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G2245T	12						.						116.0	116.0	116.0					12																	123649915		2203	4300	6503	122215868	SO:0001587	stop_gained	10198	exon14			X98258	CCDS9243.1, CCDS9243.2	12q24	2008-03-03			ENSG00000051825	ENSG00000051825			7215	protein-coding gene	gene with protein product		605501				8885239	Standard	NM_022782		Approved	MPP9	uc001uel.3	Q99550	OTTHUMG00000168849	ENST00000606320.1:c.2701G>T	12.37:g.123649915C>A	ENSP00000475489:p.Glu901*	Somatic		Capture	Illumina HiSeq	Phase_I	122215868	NM_022782	A1L486|A6NEE2|B3KR87|Q9H976|U3KQ28	Nonsense_Mutation	SNP	ENST00000606320.1	37		.	.	.	.	.	.	.	.	.	.	C	36	5.725359	0.96847	.	.	ENSG00000051825	ENST00000302349;ENST00000541076	.	.	.	5.95	3.74	0.42951	.	0.283922	0.33290	N	0.005078	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-20.0928	10.934	0.47235	0.0:0.7885:0.1334:0.0781	.	.	.	.	X	749	.	ENSP00000303597:E749X	E	-	1	0	MPHOSPH9	122215868	1.000000	0.71417	0.940000	0.37924	0.095000	0.18619	2.550000	0.45811	1.458000	0.47871	0.655000	0.94253	GAA		MPHOSPH9-030	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000471390.2		
TBC1D4	9882	broad.mit.edu	37	13	75900518	75900518	+	Silent	SNP	C	C	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr13:75900518C>T	ENST00000377636.3	-	10	2194	c.1848G>A	c.(1846-1848)gcG>gcA	p.A616A	TBC1D4_ENST00000377625.2_Silent_p.A616A|TBC1D4_ENST00000431480.2_Silent_p.A616A|TBC1D4_ENST00000425511.1_5'UTR	NM_014832.2	NP_055647.2	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	616					cellular response to insulin stimulus (GO:0032869)|membrane organization (GO:0061024)|negative regulation of vesicle fusion (GO:0031339)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)	p.A616A(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(12)|lung(18)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		ACGGTGGGGACGCTGGCGGTG	0.592																																					p.A616A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1848A	13						.						77.0	81.0	80.0					13																	75900518		2024	4182	6206	74798519	SO:0001819	synonymous_variant	9882	exon10			AB011175	CCDS41901.1, CCDS66563.1, CCDS66564.1	13q22.2	2013-07-09			ENSG00000136111	ENSG00000136111			19165	protein-coding gene	gene with protein product	"""Akt substrate of 160 kDa"""	612465				11829485, 11994271, 15304337	Standard	XM_005266603		Approved	KIAA0603, AS160, DKFZp779C0666	uc001vjl.1	O60343	OTTHUMG00000017088	ENST00000377636.3:c.1848G>A	13.37:g.75900518C>T		Somatic		Capture	Illumina HiSeq	Phase_I	74798519	NM_014832	A7E2X8|B4DU25|B4E235|B6ETN8|B6ETN9|Q5W0B9|Q68D14	Silent	SNP	ENST00000377636.3	37	CCDS41901.1																																																																																				TBC1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045283.1	NM_014832	
SLITRK1	114798	broad.mit.edu	37	13	84454333	84454333	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr13:84454333G>A	ENST00000377084.2	-	1	2195	c.1310C>T	c.(1309-1311)aCg>aTg	p.T437M		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	437					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)		p.T437M(1)		NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		CCGGGACAGCGTGTCCAGGTA	0.498																																					p.T437M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1310T	13						.						138.0	131.0	133.0					13																	84454333		2203	4300	6503	83352334	SO:0001583	missense	114798	exon1			AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1310C>T	13.37:g.84454333G>A	ENSP00000366288:p.Thr437Met	Somatic		Capture	Illumina HiSeq	Phase_I	83352334	NM_052910	Q5U5I6|Q96SF9	Missense_Mutation	SNP	ENST00000377084.2	37	CCDS9464.1	.	.	.	.	.	.	.	.	.	.	G	14.27	2.486035	0.44147	.	.	ENSG00000178235	ENST00000377084	T	0.58210	0.35	5.07	5.07	0.68467	.	0.051580	0.85682	D	0.000000	T	0.55940	0.1952	M	0.66939	2.045	0.80722	D	1	P	0.35551	0.509	B	0.37650	0.255	T	0.59606	-0.7423	10	0.48119	T	0.1	-7.3503	17.3701	0.87374	0.0:0.0:1.0:0.0	.	437	Q96PX8	SLIK1_HUMAN	M	437	ENSP00000366288:T437M	ENSP00000366288:T437M	T	-	2	0	SLITRK1	83352334	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.643000	0.74334	2.522000	0.85027	0.655000	0.94253	ACG		SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910	
PCCA	5095	broad.mit.edu	37	13	101020796	101020796	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr13:101020796G>A	ENST00000376285.1	+	19	1752	c.1714G>A	c.(1714-1716)Gta>Ata	p.V572I	PCCA_ENST00000376286.4_Missense_Mutation_p.V546I|PCCA_ENST00000376279.3_Missense_Mutation_p.V572I	NM_000282.3	NP_000273.2	P05165	PCCA_HUMAN	propionyl CoA carboxylase, alpha polypeptide	572					biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|propionyl-CoA carboxylase activity (GO:0004658)	p.V572I(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|prostate(1)|skin(2)	26	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	AGTTCATACCGTAGTAGCATC	0.328																																					p.V572I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1714A	13						.						161.0	148.0	153.0					13																	101020796		2203	4300	6503	99818797	SO:0001583	missense	5095	exon19			X14608	CCDS9496.2, CCDS45065.1, CCDS53878.1	13q32	2011-01-14	2010-04-30		ENSG00000175198	ENSG00000175198	6.4.1.3		8653	protein-coding gene	gene with protein product		232000	"""propionyl Coenzyme A carboxylase, alpha polypeptide"""			1427880	Standard	NM_000282		Approved		uc001voo.3	P05165	OTTHUMG00000017284	ENST00000376285.1:c.1714G>A	13.37:g.101020796G>A	ENSP00000365462:p.Val572Ile	Somatic		Capture	Illumina HiSeq	Phase_I	99818797	NM_001178004	B4DKY8|B4DPF9|C9JPQ8|Q15979|Q8WXQ7	Missense_Mutation	SNP	ENST00000376285.1	37	CCDS9496.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.92|11.92	1.782310|1.782310	0.31502|0.31502	.|.	.|.	ENSG00000175198|ENSG00000175198	ENST00000458283;ENST00000413170|ENST00000376286;ENST00000376279;ENST00000376285;ENST00000424527;ENST00000536640	.|T;T;T;T	.|0.78595	.|-1.19;-1.19;-1.19;-1.19	4.77|4.77	3.9|3.9	0.45041|0.45041	.|.	.|0.063949	.|0.64402	.|D	.|0.000008	T|T	0.62466|0.62466	0.2430|0.2430	L|L	0.31664|0.31664	0.95|0.95	0.09310|0.09310	N|N	0.999997|0.999997	.|B;B;B	.|0.30870	.|0.204;0.298;0.107	.|B;B;B	.|0.27500	.|0.025;0.08;0.014	T|T	0.51204|0.51204	-0.8735|-0.8735	5|10	.|0.25106	.|T	.|0.35	.|.	9.8813|9.8813	0.41236|0.41236	0.0975:0.0:0.9025:0.0|0.0975:0.0:0.9025:0.0	.|.	.|572;546;572	.|C9JPQ8;P05165-2;P05165	.|.;.;PCCA_HUMAN	H|I	24;15|546;572;572;106;68	.|ENSP00000365463:V546I;ENSP00000365456:V572I;ENSP00000365462:V572I;ENSP00000396050:V106I	.|ENSP00000365456:V572I	R|V	+|+	2|1	0|0	PCCA|PCCA	99818797|99818797	0.639000|0.639000	0.27234|0.27234	0.038000|0.038000	0.18304|0.18304	0.057000|0.057000	0.15508|0.15508	1.976000|1.976000	0.40579|0.40579	2.356000|2.356000	0.79943|0.79943	0.563000|0.563000	0.77884|0.77884	CGT|GTA		PCCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045627.2		
C14orf93	60686	broad.mit.edu	37	14	23465438	23465438	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr14:23465438G>A	ENST00000299088.6	-	3	1066	c.637C>T	c.(637-639)Cga>Tga	p.R213*	RP11-298I3.4_ENST00000557615.1_RNA|C14orf93_ENST00000406429.2_Nonsense_Mutation_p.R213*|C14orf93_ENST00000397382.4_Nonsense_Mutation_p.R213*|RP11-298I3.4_ENST00000555294.1_RNA|C14orf93_ENST00000341470.4_Nonsense_Mutation_p.R213*|RP11-298I3.4_ENST00000556503.1_RNA|C14orf93_ENST00000557513.1_5'Flank|C14orf93_ENST00000397379.3_Nonsense_Mutation_p.R213*|C14orf93_ENST00000397377.1_Nonsense_Mutation_p.R33*	NM_001130708.1|NM_021944.2	NP_001124180.1|NP_068763.2	Q9H972	CN093_HUMAN	chromosome 14 open reading frame 93	213						extracellular region (GO:0005576)	poly(A) RNA binding (GO:0044822)	p.R213*(1)		kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(2)|urinary_tract(1)	17	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0127)		ACCAGAACTCGCTGTACTGCA	0.512																																					p.R213X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C637T	14						.						111.0	97.0	102.0					14																	23465438		2203	4300	6503	22535278	SO:0001587	stop_gained	60686	exon3			AK023026	CCDS9583.1, CCDS61399.1, CCDS61400.1	14q11.1	2012-09-25			ENSG00000100802	ENSG00000100802			20162	protein-coding gene	gene with protein product							Standard	XM_005267971		Approved	FLJ12154	uc001wih.3	Q9H972	OTTHUMG00000028712	ENST00000299088.6:c.637C>T	14.37:g.23465438G>A	ENSP00000299088:p.Arg213*	Somatic		Capture	Illumina HiSeq	Phase_I	22535278	NM_001130708	B7WP03|D3DS38|D3DS39|Q86SE6|Q96CF7|Q9HA68	Nonsense_Mutation	SNP	ENST00000299088.6	37	CCDS9583.1	.	.	.	.	.	.	.	.	.	.	G	39	7.302150	0.98196	.	.	ENSG00000100802	ENST00000299088;ENST00000341470;ENST00000397379;ENST00000397382;ENST00000397377;ENST00000406429;ENST00000397376	.	.	.	5.83	5.83	0.93111	.	0.000000	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-27.71	12.5442	0.56190	0.0:0.0:0.8338:0.1662	.	.	.	.	X	213;213;213;213;33;213;33	.	ENSP00000299088:R213X	R	-	1	2	C14orf93	22535278	1.000000	0.71417	0.997000	0.53966	0.778000	0.44026	3.353000	0.52247	2.769000	0.95229	0.655000	0.94253	CGA		C14orf93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071688.5	NM_021944	
FAM179B	23116	broad.mit.edu	37	14	45535820	45535820	+	Silent	SNP	C	C	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr14:45535820C>T	ENST00000361577.3	+	16	4654	c.4440C>T	c.(4438-4440)gtC>gtT	p.V1480V	FAM179B_ENST00000361462.2_Silent_p.V1533V|FAM179B_ENST00000382233.2_3'UTR	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	1480								p.V1480V(1)		endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						GAAAATCAGTCCCTCGTAATT	0.343																																					p.V1480V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4440T	14						.						121.0	121.0	121.0					14																	45535820		2203	4300	6503	44605570	SO:0001819	synonymous_variant	23116	exon16			AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.4440C>T	14.37:g.45535820C>T		Somatic		Capture	Illumina HiSeq	Phase_I	44605570	NM_015091	Q68D66|Q6PG27	Silent	SNP	ENST00000361577.3	37	CCDS9681.1																																																																																				FAM179B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276791.1	XM_113781	
AHNAK2	113146	broad.mit.edu	37	14	105411676	105411676	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr14:105411676T>A	ENST00000333244.5	-	7	10231	c.10112A>T	c.(10111-10113)cAg>cTg	p.Q3371L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3371						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.Q3371L(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CACGTCCACCTGGCCAGCCTG	0.647																																					p.Q3371L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A10112T	14						.						119.0	130.0	126.0					14																	105411676		1961	4135	6096	104482721	SO:0001583	missense	113146	exon7			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.10112A>T	14.37:g.105411676T>A	ENSP00000353114:p.Gln3371Leu	Somatic		Capture	Illumina HiSeq	Phase_I	104482721	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	t	12.46	1.944814	0.34283	.	.	ENSG00000185567	ENST00000333244	T	0.00737	5.76	4.12	-1.37	0.09056	.	.	.	.	.	T	0.01765	0.0056	M	0.82923	2.615	0.09310	N	1	D	0.57899	0.981	P	0.53401	0.725	T	0.40664	-0.9551	9	0.27785	T	0.31	.	0.4756	0.00539	0.2506:0.2259:0.1284:0.3952	.	3371	Q8IVF2	AHNK2_HUMAN	L	3371	ENSP00000353114:Q3371L	ENSP00000353114:Q3371L	Q	-	2	0	AHNAK2	104482721	0.474000	0.25886	0.000000	0.03702	0.020000	0.10135	1.976000	0.40579	-0.118000	0.11851	0.402000	0.26972	CAG		AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
RASGRP1	10125	broad.mit.edu	37	15	38793405	38793405	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr15:38793405G>A	ENST00000310803.5	-	13	1799	c.1622C>T	c.(1621-1623)cCt>cTt	p.P541L	RASGRP1_ENST00000539159.1_Missense_Mutation_p.P493L|RASGRP1_ENST00000558164.1_Missense_Mutation_p.P506L|RP11-102L12.2_ENST00000560231.1_RNA|RASGRP1_ENST00000561180.1_Missense_Mutation_p.P592L|RASGRP1_ENST00000559830.1_Missense_Mutation_p.P506L|RASGRP1_ENST00000450598.2_Missense_Mutation_p.P506L	NM_001128602.1|NM_005739.3	NP_001122074.1|NP_005730.2	O95267	GRP1_HUMAN	RAS guanyl releasing protein 1 (calcium and DAG-regulated)	541					activation of Rho GTPase activity (GO:0032862)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|platelet activation (GO:0030168)|Ras protein signal transduction (GO:0007265)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)|secretory granule localization (GO:0032252)|signal transduction (GO:0007165)|vesicle transport along microtubule (GO:0047496)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)	p.P541L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20		all_cancers(109;6.38e-17)|all_epithelial(112;5.51e-15)|Lung NSC(122;2.12e-11)|all_lung(180;5.63e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;1.97e-07)|BRCA - Breast invasive adenocarcinoma(123;0.00248)		GAAGTTGTGAGGAAAGCCCAG	0.522																																					p.P541L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1622T	15						.						88.0	88.0	88.0					15																	38793405		1934	4148	6082	36580697	SO:0001583	missense	10125	exon13			AF106071	CCDS45221.1, CCDS45222.1	15q15	2013-01-10				ENSG00000172575		"""EF-hand domain containing"""	9878	protein-coding gene	gene with protein product		603962				10087292, 9789079	Standard	NM_005739		Approved	CalDAG-GEFII, RASGRP	uc001zke.4	O95267		ENST00000310803.5:c.1622C>T	15.37:g.38793405G>A	ENSP00000310244:p.Pro541Leu	Somatic		Capture	Illumina HiSeq	Phase_I	36580697	NM_005739	Q56CZ0|Q58G75|Q59HB1|Q5I3A8|Q6GV31|Q6NX39|Q7LDG6|Q9UI94|Q9UNN9	Missense_Mutation	SNP	ENST00000310803.5	37	CCDS45222.1	.	.	.	.	.	.	.	.	.	.	G	7.285	0.609833	0.14066	.	.	ENSG00000172575	ENST00000310803;ENST00000450598;ENST00000415523;ENST00000431814;ENST00000539159	D;D;D	0.85171	-1.95;-1.95;-1.95	5.29	5.29	0.74685	Protein kinase C-like, phorbol ester/diacylglycerol binding (1);Diacylglycerol/phorbol-ester binding (1);	0.218383	0.43416	D	0.000568	T	0.62109	0.2401	N	0.00926	-1.1	0.49051	D	0.999748	B;B;B;B	0.06786	0.001;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.61461	-0.7058	10	0.21014	T	0.42	-8.0559	12.4472	0.55657	0.0759:0.0:0.9241:0.0	.	506;506;541;506	C9JM27;C9JCE5;O95267;O95267-2	.;.;GRP1_HUMAN;.	L	541;506;506;506;493	ENSP00000310244:P541L;ENSP00000388540:P506L;ENSP00000444762:P493L	ENSP00000310244:P541L	P	-	2	0	RASGRP1	36580697	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.280000	0.58959	2.752000	0.94435	0.655000	0.94253	CCT		RASGRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418223.1	NM_005739	
FAHD1	81889	broad.mit.edu	37	16	1877620	1877620	+	Silent	SNP	G	G	T	rs144517611	byFrequency	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr16:1877620G>T	ENST00000427358.2	+	1	396	c.390G>T	c.(388-390)ccG>ccT	p.P130P	HAGH_ENST00000566709.1_5'Flank|FAHD1_ENST00000382666.4_Silent_p.P130P|HAGH_ENST00000455446.2_5'Flank|FAHD1_ENST00000382668.4_Silent_p.P130P|HAGH_ENST00000397353.2_5'Flank|HAGH_ENST00000397356.3_5'Flank	NM_031208.3	NP_112485.1	Q6P587	FAHD1_HUMAN	fumarylacetoacetate hydrolase domain containing 1	130						cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetylpyruvate hydrolase activity (GO:0018773)|acylpyruvate hydrolase activity (GO:0047621)|fumarylpyruvate hydrolase activity (GO:0034545)|metal ion binding (GO:0046872)	p.P130P(1)		NS(1)|large_intestine(1)|liver(1)|ovary(2)|urinary_tract(1)	6						CGTCCTGCCCGGTCAGCGCGT	0.617																																					p.P130P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G390T	16						.						46.0	39.0	42.0					16																	1877620		2199	4300	6499	1817621	SO:0001819	synonymous_variant	81889	exon1			BC063017	CCDS10448.1, CCDS32367.1, CCDS45380.1	16p13.3	2011-10-21	2004-08-19	2004-08-26	ENSG00000180185	ENSG00000180185			14169	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 36"""	C16orf36		21878618	Standard	NM_001018104		Approved	DKFZP566J2046	uc002cnd.3	Q6P587	OTTHUMG00000128663	ENST00000427358.2:c.390G>T	16.37:g.1877620G>T		Somatic		Capture	Illumina HiSeq	Phase_I	1817621	NM_031208	B1AK40|B1AK41|Q6FIC7|Q96RY1|Q9H0N6	Silent	SNP	ENST00000427358.2	37	CCDS10448.1																																																																																				FAHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250550.2	NM_001018104	
ABCC1	4363	broad.mit.edu	37	16	16142096	16142096	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr16:16142096C>G	ENST00000399410.3	+	10	1491	c.1316C>G	c.(1315-1317)aCg>aGg	p.T439R	ABCC1_ENST00000345148.5_Missense_Mutation_p.T439R|ABCC1_ENST00000399408.2_Missense_Mutation_p.T439R|ABCC1_ENST00000346370.5_Missense_Mutation_p.T439R|ABCC1_ENST00000349029.5_Missense_Mutation_p.T439R|ABCC1_ENST00000351154.5_Missense_Mutation_p.T439R	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1	439	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.T439R(1)		breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	GACTTGGCCACGTACATTAAC	0.542																																					p.T439R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1316G	16						.						153.0	158.0	156.0					16																	16142096		2090	4226	6316	16049597	SO:0001583	missense	4363	exon10			L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.1316C>G	16.37:g.16142096C>G	ENSP00000382342:p.Thr439Arg	Somatic		Capture	Illumina HiSeq	Phase_I	16049597	NM_019862	A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Missense_Mutation	SNP	ENST00000399410.3	37	CCDS42122.1	.	.	.	.	.	.	.	.	.	.	C	17.48	3.400815	0.62177	.	.	ENSG00000103222	ENST00000399410;ENST00000399408;ENST00000346370;ENST00000351154;ENST00000345148;ENST00000349029;ENST00000536381	D;D;D;D;D;D	0.92348	-3.02;-3.02;-3.02;-3.02;-3.02;-3.02	5.43	5.43	0.79202	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.095200	0.64402	D	0.000001	D	0.95771	0.8624	M	0.73319	2.225	0.53005	D	0.999961	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.991;0.991;0.971;1.0;0.991;1.0;1.0	D	0.95886	0.8903	10	0.66056	D	0.02	-18.473	18.245	0.89982	0.0:1.0:0.0:0.0	.	439;439;439;439;439;439;439	P33527-6;P33527-5;P33527-4;P33527-3;P33527-2;P33527;P33527-9	.;.;.;.;.;MRP1_HUMAN;.	R	439;439;439;439;439;439;113	ENSP00000382342:T439R;ENSP00000382340:T439R;ENSP00000263019:T439R;ENSP00000263017:T439R;ENSP00000263014:T439R;ENSP00000263016:T439R	ENSP00000263014:T439R	T	+	2	0	ABCC1	16049597	1.000000	0.71417	0.980000	0.43619	0.400000	0.30750	4.884000	0.63135	2.561000	0.86390	0.561000	0.74099	ACG		ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109701.1	NM_004996	
UBN1	29855	broad.mit.edu	37	16	4920956	4920956	+	Silent	SNP	A	A	G	rs148310869		TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr16:4920956A>G	ENST00000396658.4	+	10	2245	c.1542A>G	c.(1540-1542)caA>caG	p.Q514Q	UBN1_ENST00000545171.1_Silent_p.Q514Q|UBN1_ENST00000590769.1_Silent_p.Q514Q|UBN1_ENST00000262376.6_Silent_p.Q514Q	NM_016936.3	NP_058632.2	Q9NPG3	UBN1_HUMAN	ubinuclein 1	514					chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of phosphatase activity (GO:0010923)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q514Q(1)		NS(1)|endometrium(6)|kidney(4)|large_intestine(10)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38						AGAAGTTCCAATGGAATGATG	0.522													A|||	1	0.000199681	0.0008	0.0	5008	,	,		19599	0.0		0.0	False		,,,				2504	0.0				p.Q514Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1542G	16						.	A	,	1,4393	2.1+/-5.4	0,1,2196	73.0	72.0	72.0		1542,1542	2.9	1.0	16	dbSNP_134	72	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	UBN1	NM_001079514.1,NM_016936.3	,	0,2,6495	GG,GA,AA		0.0116,0.0228,0.0154	,	514/1135,514/1135	4920956	2,12992	2197	4300	6497	4860957	SO:0001819	synonymous_variant	29855	exon10			AF108460	CCDS10525.1, CCDS73822.1	16p13.3	2010-11-09			ENSG00000118900	ENSG00000118900			12506	protein-coding gene	gene with protein product		609771				10725330	Standard	XM_005255277		Approved		uc002cyb.3	Q9NPG3	OTTHUMG00000129531	ENST00000396658.4:c.1542A>G	16.37:g.4920956A>G		Somatic		Capture	Illumina HiSeq	Phase_I	4860957	NM_016936	B7Z6D3|D3DUE8|Q13079|Q9P1P7	Silent	SNP	ENST00000396658.4	37	CCDS10525.1																																																																																				UBN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251719.1	NM_016936	
DNAH3	55567	broad.mit.edu	37	16	21078692	21078692	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr16:21078692C>T	ENST00000261383.3	-	24	3429	c.3430G>A	c.(3430-3432)Gag>Aag	p.E1144K	DNAH3_ENST00000415178.1_Missense_Mutation_p.E1144K	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1144	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.E1144K(2)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TGAAGCTTCTCTGCCATCCGT	0.468																																					p.E1144K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3430A	16						.						85.0	86.0	86.0					16																	21078692		2201	4300	6501	20986193	SO:0001583	missense	55567	exon24			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.3430G>A	16.37:g.21078692C>T	ENSP00000261383:p.Glu1144Lys	Somatic		Capture	Illumina HiSeq	Phase_I	20986193	NM_017539	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	C	18.96	3.734719	0.69189	.	.	ENSG00000158486	ENST00000261383;ENST00000415178	T;T	0.61627	0.09;0.09	5.64	5.64	0.86602	Dynein heavy chain, domain-2 (1);	0.134633	0.49916	D	0.000138	T	0.54464	0.1860	L	0.43152	1.355	0.58432	D	0.999995	B	0.22003	0.063	B	0.20955	0.032	T	0.49744	-0.8907	10	0.49607	T	0.09	.	19.7101	0.96094	0.0:1.0:0.0:0.0	.	1144	Q8TD57	DYH3_HUMAN	K	1144	ENSP00000261383:E1144K;ENSP00000394245:E1144K	ENSP00000261383:E1144K	E	-	1	0	DNAH3	20986193	1.000000	0.71417	0.998000	0.56505	0.875000	0.50365	5.803000	0.69129	2.655000	0.90218	0.637000	0.83480	GAG		DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
MMP2	4313	broad.mit.edu	37	16	55527187	55527187	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr16:55527187T>A	ENST00000219070.4	+	9	1963	c.1454T>A	c.(1453-1455)aTc>aAc	p.I485N	MMP2_ENST00000543485.1_Missense_Mutation_p.I409N|MMP2_ENST00000570308.1_Missense_Mutation_p.I409N|MMP2_ENST00000437642.2_Missense_Mutation_p.I435N	NM_004530.4	NP_004521.1	P08253	MMP2_HUMAN	matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)	485	Required for inhibitor TIMP2 binding.				angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|bone trabecula formation (GO:0060346)|cellular protein metabolic process (GO:0044267)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|positive regulation of innate immune response (GO:0045089)|proteolysis (GO:0006508)|response to hypoxia (GO:0001666)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|sarcomere (GO:0030017)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)	p.I485N(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|liver(2)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	58		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Captopril(DB01197)|Marimastat(DB00786)	CGTGGTGAGATCTTCTTCTTC	0.537																																					p.I485N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1454A	16						.						219.0	201.0	207.0					16																	55527187		2198	4300	6498	54084688	SO:0001583	missense	4313	exon9				CCDS10752.1, CCDS45487.1	16q13-q21	2008-02-05	2005-08-08		ENSG00000087245	ENSG00000087245	3.4.24.24		7166	protein-coding gene	gene with protein product		120360	"""matrix metalloproteinase 2 (gelatinase A, 72kD gelatinase, 72kD type IV collagenase)"", ""matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)"""	CLG4, CLG4A			Standard	NM_004530		Approved	TBE-1	uc002ehz.4	P08253	OTTHUMG00000133202	ENST00000219070.4:c.1454T>A	16.37:g.55527187T>A	ENSP00000219070:p.Ile485Asn	Somatic		Capture	Illumina HiSeq	Phase_I	54084688	NM_004530	B2R6U1|B4DWH3|E9PE45|Q9UCJ8	Missense_Mutation	SNP	ENST00000219070.4	37	CCDS10752.1	.	.	.	.	.	.	.	.	.	.	T	17.18	3.323065	0.60634	.	.	ENSG00000087245	ENST00000219070;ENST00000543485;ENST00000437642	T;T;T	0.02944	4.1;4.1;4.1	5.33	3.11	0.35812	Hemopexin/matrixin (2);	0.145432	0.64402	D	0.000008	T	0.13756	0.0333	M	0.86805	2.84	0.50467	D	0.999877	P;D	0.53885	0.956;0.963	D;P	0.65443	0.935;0.652	T	0.00112	-1.2043	10	0.87932	D	0	.	8.5836	0.33644	0.0:0.2507:0.0:0.7493	.	435;485	E9PE45;P08253	.;MMP2_HUMAN	N	485;409;435	ENSP00000219070:I485N;ENSP00000444143:I409N;ENSP00000394237:I435N	ENSP00000219070:I485N	I	+	2	0	MMP2	54084688	0.653000	0.27358	1.000000	0.80357	0.998000	0.95712	1.104000	0.31074	2.028000	0.59812	0.460000	0.39030	ATC		MMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256913.3		
CDH8	1006	broad.mit.edu	37	16	61689492	61689492	+	Silent	SNP	G	G	C			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	SOLID			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr16:61689492G>C	ENST00000577390.1	-	11	2742	c.1788C>G	c.(1786-1788)gtC>gtG	p.V596V	CDH8_ENST00000577730.1_Silent_p.V596V|CDH8_ENST00000299345.6_Silent_p.V596V	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	596	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)	p.V596V(1)		biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		TGCAGCCACAGACCCTGATTG	0.463																																					p.V596V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1788G	16						.						158.0	134.0	142.0					16																	61689492		2203	4300	6503	60246993	SO:0001819	synonymous_variant	1006	exon11			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.1788C>G	16.37:g.61689492G>C		Somatic		Capture	Illumina HiSeq	Phase_I	60246993	NM_001796	B3KWC1|Q14DC6|Q9ULB2	Silent	SNP	ENST00000577390.1	37	CCDS10802.1																																																																																				CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796	
NFATC3	4775	broad.mit.edu	37	16	68217251	68217251	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr16:68217251C>T	ENST00000346183.3	+	8	2104	c.2080C>T	c.(2080-2082)Cgt>Tgt	p.R694C	NFATC3_ENST00000329524.4_Missense_Mutation_p.R694C|NFATC3_ENST00000349223.5_Missense_Mutation_p.R694C|NFATC3_ENST00000535127.2_3'UTR|NFATC3_ENST00000575270.1_Missense_Mutation_p.R694C	NM_173165.2	NP_775188.1	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3	694					cellular respiration (GO:0045333)|cellular response to calcium ion (GO:0071277)|cellular response to lithium ion (GO:0071285)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.R694C(2)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	44		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		CCAGTCTCAACGTTTTACTTA	0.383																																					p.R694C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2080T	16						.						139.0	130.0	133.0					16																	68217251		2198	4300	6498	66774752	SO:0001583	missense	4775	exon8			L41067	CCDS10860.1, CCDS10861.1, CCDS10862.1	16q22	2009-11-24			ENSG00000072736	ENSG00000072736		"""Nuclear factor of activated T-cells"""	7777	protein-coding gene	gene with protein product		602698				7749981	Standard	NM_004555		Approved	NFAT4, NFATX	uc002evo.2	Q12968	OTTHUMG00000137555	ENST00000346183.3:c.2080C>T	16.37:g.68217251C>T	ENSP00000300659:p.Arg694Cys	Somatic		Capture	Illumina HiSeq	Phase_I	66774752	NM_173163	O75211|Q14516|Q99840|Q99841|Q99842	Missense_Mutation	SNP	ENST00000346183.3	37	CCDS10860.1	.	.	.	.	.	.	.	.	.	.	C	15.32	2.799395	0.50208	.	.	ENSG00000072736	ENST00000349223;ENST00000346183;ENST00000329524;ENST00000535127	T;T;T	0.09445	2.98;2.98;2.98	5.05	4.09	0.47781	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.050045	0.85682	N	0.000000	T	0.10380	0.0254	L	0.54908	1.71	0.80722	D	1	P;P;P;P	0.46578	0.598;0.88;0.598;0.598	B;B;B;B	0.37550	0.065;0.253;0.065;0.065	T	0.04481	-1.0948	10	0.66056	D	0.02	-5.7809	8.6786	0.34194	0.1504:0.7727:0.0:0.077	.	694;694;694;694	Q12968;Q12968-3;B5B2S0;B5B2S2	NFAC3_HUMAN;.;.;.	C	694;694;694;215	ENSP00000264008:R694C;ENSP00000300659:R694C;ENSP00000331324:R694C	ENSP00000331324:R694C	R	+	1	0	NFATC3	66774752	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.375000	0.66173	1.245000	0.43885	0.563000	0.77884	CGT		NFATC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268890.2	NM_004555	
ALDOC	230	broad.mit.edu	37	17	26901111	26901111	+	Missense_Mutation	SNP	C	C	T	rs145665688	byFrequency	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr17:26901111C>T	ENST00000226253.4	-	7	1248	c.773G>A	c.(772-774)cGt>cAt	p.R258H	ALDOC_ENST00000395319.3_Missense_Mutation_p.R230H|PIGS_ENST00000308360.7_5'Flank|PIGS_ENST00000395346.2_5'Flank|PIGS_ENST00000543734.1_5'Flank|RP11-192H23.5_ENST00000585189.1_RNA|ALDOC_ENST00000395321.2_Missense_Mutation_p.R258H	NM_005165.2	NP_005156.1	P09972	ALDOC_HUMAN	aldolase C, fructose-bisphosphate	258					aging (GO:0007568)|apoptotic process (GO:0006915)|carbohydrate metabolic process (GO:0005975)|epithelial cell differentiation (GO:0030855)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|organ regeneration (GO:0031100)|protein heterotetramerization (GO:0051290)|protein homotetramerization (GO:0051289)|response to hypoxia (GO:0001666)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)	axon (GO:0030424)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	cytoskeletal protein binding (GO:0008092)|fructose-bisphosphate aldolase activity (GO:0004332)	p.R258H(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11	Lung NSC(42;0.00431)					CACAGTGCGACGCAGGGCAGT	0.602																																					p.R258H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G773A	17						.	C	HIS/ARG	2,4404	4.2+/-10.8	0,2,2201	130.0	131.0	131.0		773	5.3	1.0	17	dbSNP_134	131	1,8599	1.2+/-3.3	0,1,4299	yes	missense	ALDOC	NM_005165.2	29	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	possibly-damaging	258/365	26901111	3,13003	2203	4300	6503	23925238	SO:0001583	missense	230	exon7			AF054987	CCDS11236.1	17q11.2	2013-09-20			ENSG00000109107	ENSG00000109107	4.1.2.13		418	protein-coding gene	gene with protein product		103870					Standard	XM_005257947		Approved		uc002hbp.3	P09972	OTTHUMG00000132605	ENST00000226253.4:c.773G>A	17.37:g.26901111C>T	ENSP00000226253:p.Arg258His	Somatic		Capture	Illumina HiSeq	Phase_I	23925238	NM_005165	B2R5R3|Q3SYL3|Q6FH94|Q6P0L5	Missense_Mutation	SNP	ENST00000226253.4	37	CCDS11236.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.168568	0.78339	4.54E-4	1.16E-4	ENSG00000109107	ENST00000395319;ENST00000226253;ENST00000395321	D;D;D	0.86769	-2.17;-2.17;-2.17	5.28	5.28	0.74379	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	D	0.85915	0.5808	L	0.58428	1.81	0.80722	D	1	P;P	0.39131	0.616;0.661	B;B	0.37780	0.146;0.258	D	0.86179	0.1605	10	0.45353	T	0.12	-21.493	18.0486	0.89341	0.0:1.0:0.0:0.0	.	230;258	A8MVZ9;P09972	.;ALDOC_HUMAN	H	230;258;258	ENSP00000378729:R230H;ENSP00000226253:R258H;ENSP00000378731:R258H	ENSP00000226253:R258H	R	-	2	0	ALDOC	23925238	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.955000	0.63638	2.637000	0.89404	0.555000	0.69702	CGT		ALDOC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255839.4		
KANSL1	284058	broad.mit.edu	37	17	44248500	44248500	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr17:44248500G>T	ENST00000262419.6	-	2	1480	c.1010C>A	c.(1009-1011)tCc>tAc	p.S337Y	KANSL1_ENST00000393476.3_5'UTR|KANSL1_ENST00000574590.1_Missense_Mutation_p.S337Y|KANSL1_ENST00000576248.1_5'Flank|KANSL1_ENST00000575318.1_Missense_Mutation_p.S337Y|KANSL1_ENST00000572904.1_Missense_Mutation_p.S337Y|KANSL1_ENST00000432791.1_Missense_Mutation_p.S337Y	NM_001193466.1	NP_001180395	Q7Z3B3	KANL1_HUMAN	KAT8 regulatory NSL complex subunit 1	337					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.S337Y(1)|p.S337C(1)									TGGTCTCAAGGATTCCAAGTT	0.493																																					p.S337Y												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.C1010A	17						.						78.0	95.0	90.0					17																	44248500		2203	4300	6503	41604277	SO:0001583	missense	284058	exon2			BX538006	CCDS11503.1, CCDS11503.2, CCDS74084.1	17q21.31	2012-02-20	2012-02-20	2012-02-20	ENSG00000120071	ENSG00000120071			24565	protein-coding gene	gene with protein product	"""centromere protein 36"""	612452	"""KIAA1267"""	KIAA1267		10574462	Standard	NM_015443		Approved	DKFZP727C091, MSL1v1, CENP-36, NSL1	uc002ikd.3	Q7Z3B3		ENST00000262419.6:c.1010C>A	17.37:g.44248500G>T	ENSP00000262419:p.Ser337Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	41604277	NM_015443	A8K5E4|Q6AW85|Q8IYH1|Q9BRH0|Q9NTE7|Q9UFT0|Q9ULF3	Missense_Mutation	SNP	ENST00000262419.6	37	CCDS11503.1	.	.	.	.	.	.	.	.	.	.	G	17.38	3.374824	0.61735	.	.	ENSG00000120071	ENST00000262419;ENST00000432791	T;T	0.12569	2.67;2.67	5.94	5.94	0.96194	.	0.090582	0.49305	D	0.000143	T	0.17066	0.0410	N	0.19112	0.55	0.80722	D	1	D;B	0.54207	0.965;0.184	P;B	0.51135	0.66;0.082	T	0.00628	-1.1637	10	0.52906	T	0.07	-9.8513	17.0961	0.86635	0.0:0.0:1.0:0.0	.	337;337	C9JHY2;Q7Z3B3	.;K1267_HUMAN	Y	337	ENSP00000262419:S337Y;ENSP00000387393:S337Y	ENSP00000262419:S337Y	S	-	2	0	KIAA1267	41604277	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.394000	0.73223	2.826000	0.97356	0.561000	0.74099	TCC		KANSL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440274.1	NM_015443	
NLRP1	22861	broad.mit.edu	37	17	5418225	5418225	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr17:5418225C>A	ENST00000572272.1	-	17	4270	c.4271G>T	c.(4270-4272)aGc>aTc	p.S1424I	NLRP1_ENST00000269280.4_Missense_Mutation_p.S1380I|RNU7-31P_ENST00000517262.1_RNA|NLRP1_ENST00000262467.5_Intron|NLRP1_ENST00000345221.3_Missense_Mutation_p.S1380I|NLRP1_ENST00000577119.1_Missense_Mutation_p.S1350I|NLRP1_ENST00000354411.3_Missense_Mutation_p.S1394I			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	1424	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)	p.S1424I(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				CCGCATCTGGCTGGGCCTCGT	0.577																																					p.S1350I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4049T	17						.						72.0	76.0	75.0					17																	5418225		2104	4230	6334	5358949	SO:0001583	missense	22861	exon15			AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.4271G>T	17.37:g.5418225C>A	ENSP00000460475:p.Ser1424Ile	Somatic		Capture	Illumina HiSeq	Phase_I	5358949	NM_033007	E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Missense_Mutation	SNP	ENST00000572272.1	37	CCDS42246.1	.	.	.	.	.	.	.	.	.	.	C	16.11	3.029510	0.54790	.	.	ENSG00000091592	ENST00000269280;ENST00000354411;ENST00000345221	T;T	0.25085	1.82;1.82	5.07	-10.1	0.00402	DEATH-like (2);Caspase Recruitment (2);	2.717470	0.01198	N	0.007507	T	0.41073	0.1143	L	0.55481	1.735	0.09310	N	1	D;D;D;D	0.69078	0.996;0.996;0.997;0.996	P;P;D;P	0.64506	0.878;0.878;0.926;0.878	T	0.65331	-0.6194	10	0.87932	D	0	.	12.8987	0.58113	0.0:0.1136:0.1792:0.7072	.	1350;1394;1424;1380	Q9C000-3;Q9C000-4;Q9C000;Q9C000-2	.;.;NALP1_HUMAN;.	I	1424;1394;1380	ENSP00000346390:S1394I;ENSP00000324366:S1380I	ENSP00000269280:S1424I	S	-	2	0	NLRP1	5358949	0.000000	0.05858	0.000000	0.03702	0.086000	0.17979	-1.974000	0.01499	-2.581000	0.00462	-0.145000	0.13849	AGC		NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439517.1	NM_033004	
TP53	7157	broad.mit.edu	37	17	7577539	7577539	+	Missense_Mutation	SNP	G	G	A	rs397516437|rs121912651		TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr17:7577539G>A	ENST00000269305.4	-	7	931	c.742C>T	c.(742-744)Cgg>Tgg	p.R248W	TP53_ENST00000413465.2_Missense_Mutation_p.R248W|TP53_ENST00000359597.4_Missense_Mutation_p.R248W|TP53_ENST00000455263.2_Missense_Mutation_p.R248W|TP53_ENST00000420246.2_Missense_Mutation_p.R248W|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.R248W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248W(544)|p.R155W(28)|p.R248G(12)|p.0?(8)|p.?(5)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248R(2)|p.R248fs*>39(1)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGGCCTCCGGTTCATGCCG	0.577	R248W(786O_KIDNEY)|R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO320_LARGE_INTESTINE)|R248W(COLO680N_OESOPHAGUS)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(GCT_SOFT_TISSUE)|R248W(HCC2157_BREAST)|R248W(JIMT1_BREAST)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(LUDLU1_LUNG)|R248W(LXF289_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(RD_SOFT_TISSUE)|R248W(SW837_LARGE_INTESTINE)|R248W(VCAP_PROSTATE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R248W	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,haematopoietic_and_lymphoid_tissue,lymph_node,Substitution - Missense,+1 	.	617	Substitution - Missense(585)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(3)|Complex - compound substitution(3)|Substitution - coding silent(2)	large_intestine(156)|breast(72)|ovary(42)|endometrium(38)|oesophagus(38)|skin(37)|haematopoietic_and_lymphoid_tissue(37)|central_nervous_system(35)|stomach(27)|lung(26)|upper_aerodigestive_tract(25)|urinary_tract(19)|biliary_tract(17)|pancreas(12)|prostate(10)|soft_tissue(6)|bone(6)|thyroid(4)|liver(4)|penis(2)|peritoneum(1)|vulva(1)|kidney(1)|cervix(1)	c.C742T	17	GRCh37	CM010465|CM900211	TP53	M	rs121912651	.						151.0	112.0	125.0					17																	7577539		2203	4300	6503	7518264	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.742C>T	17.37:g.7577539G>A	ENSP00000269305:p.Arg248Trp	Somatic		Capture	Illumina HiSeq	Phase_I	7518264	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	18.84	3.710019	0.68730	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.62	2.56	0.30785	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.92507	3.315	0.58432	A	0.999997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.97208	0.9869	9	0.87932	D	0	-9.5643	7.568	0.27890	0.0893:0.0:0.7471:0.1636	.	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	W	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248W;ENSP00000352610:R248W;ENSP00000269305:R248W;ENSP00000398846:R248W;ENSP00000391127:R248W;ENSP00000391478:R248W;ENSP00000425104:R116W;ENSP00000423862:R155W	ENSP00000269305:R248W	R	-	1	2	TP53	7518264	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	1.447000	0.35101	0.644000	0.30656	0.462000	0.41574	CGG		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
ANKFN1	162282	broad.mit.edu	37	17	54452001	54452001	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr17:54452001C>G	ENST00000318698.2	+	7	880	c.845C>G	c.(844-846)aCc>aGc	p.T282S	ANKFN1_ENST00000566473.2_Missense_Mutation_p.T282S	NM_153228.2	NP_694960.2	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	282	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.							p.T282S(1)		NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						CTCATGGTAACCAGCAGCACA	0.458																																					p.T282S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C845G	17						.						220.0	199.0	206.0					17																	54452001		2203	4300	6503	51807000	SO:0001583	missense	162282	exon7			AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000318698.2:c.845C>G	17.37:g.54452001C>G	ENSP00000321627:p.Thr282Ser	Somatic		Capture	Illumina HiSeq	Phase_I	51807000	NM_153228		Missense_Mutation	SNP	ENST00000318698.2	37	CCDS32686.1	.	.	.	.	.	.	.	.	.	.	C	13.39	2.221629	0.39300	.	.	ENSG00000153930	ENST00000318698	T	0.57273	0.41	5.53	4.55	0.56014	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.188195	0.56097	N	0.000036	T	0.42765	0.1217	N	0.26092	0.79	0.39838	D	0.973077	B	0.26775	0.159	B	0.27887	0.084	T	0.34354	-0.9832	10	0.36615	T	0.2	-10.5003	16.9468	0.86232	0.0:0.8725:0.1275:0.0	.	282	Q8N957	ANKF1_HUMAN	S	282	ENSP00000321627:T282S	ENSP00000321627:T282S	T	+	2	0	ANKFN1	51807000	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.515000	0.60489	1.454000	0.47793	0.655000	0.94253	ACC		ANKFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338043.1	NM_153228	
SMAD4	4089	broad.mit.edu	37	18	48591919	48591919	+	Missense_Mutation	SNP	G	G	A	rs377767347		TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr18:48591919G>A	ENST00000342988.3	+	9	1620	c.1082G>A	c.(1081-1083)cGc>cAc	p.R361H	SMAD4_ENST00000588745.1_Missense_Mutation_p.R265H|SMAD4_ENST00000398417.2_Missense_Mutation_p.R361H	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	361	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.		R -> C (in JPS; dbSNP:rs80338963). {ECO:0000269|PubMed:9811934}.|R -> H (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.R361H(12)|p.?(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		GGAGGAGATCGCTTTTGTTTG	0.413																																					p.R361H												SMAD4,small_intestine,duodenum,Substitution - Missense,+1 	.	50	Whole gene deletion(36)|Substitution - Missense(12)|Unknown(2)	pancreas(26)|large_intestine(13)|lung(3)|breast(3)|upper_aerodigestive_tract(2)|stomach(2)|oesophagus(1)	c.G1082A	18	GRCh37	CM004254	SMAD4	M		.						167.0	138.0	148.0					18																	48591919		2203	4300	6503	46845917	SO:0001583	missense	4089	exon9			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1082G>A	18.37:g.48591919G>A	ENSP00000341551:p.Arg361His	Somatic		Capture	Illumina HiSeq	Phase_I	46845917	NM_005359	A8K405	Missense_Mutation	SNP	ENST00000342988.3	37	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	G	35	5.477304	0.96291	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	D;D	0.98120	-4.73;-4.73	5.86	5.86	0.93980	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.98852	0.9612	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99741	1.1015	10	0.87932	D	0	.	18.9646	0.92691	0.0:0.0:1.0:0.0	.	361	Q13485	SMAD4_HUMAN	H	361	ENSP00000341551:R361H;ENSP00000381452:R361H	ENSP00000341551:R361H	R	+	2	0	SMAD4	46845917	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.828000	0.86729	2.771000	0.95319	0.563000	0.77884	CGC		SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359	
THEG	51298	broad.mit.edu	37	19	374392	374392	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr19:374392C>T	ENST00000342640.4	-	2	380	c.338G>A	c.(337-339)aGc>aAc	p.S113N	THEG_ENST00000346878.2_Missense_Mutation_p.S113N	NM_016585.4	NP_057669.1	Q9P2T0	THEG_HUMAN	theg spermatid protein	113					cell differentiation (GO:0030154)|chaperone-mediated protein complex assembly (GO:0051131)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)		p.S113N(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(2)|soft_tissue(1)	29		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CATGGTGGTGCTGGGGAGCTT	0.582																																					p.S113N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G338A	19						.						124.0	116.0	119.0					19																	374392		2203	4300	6503	325392	SO:0001583	missense	51298	exon2			AF268610	CCDS12025.1, CCDS12026.1	19p13.3	2012-02-24	2012-02-24		ENSG00000105549	ENSG00000105549			13706	protein-coding gene	gene with protein product	"""cancer/testis antigen 56"""	609503	"""Theg homolog (mouse)"""			11173852	Standard	NM_016585		Approved	CT56, THEG1	uc002lol.3	Q9P2T0	OTTHUMG00000165491	ENST00000342640.4:c.338G>A	19.37:g.374392C>T	ENSP00000340088:p.Ser113Asn	Somatic		Capture	Illumina HiSeq	Phase_I	325392	NM_199202	A6NMJ8	Missense_Mutation	SNP	ENST00000342640.4	37	CCDS12025.1	.	.	.	.	.	.	.	.	.	.	C	7.341	0.620813	0.14193	.	.	ENSG00000105549	ENST00000342640;ENST00000346878	T;T	0.21734	1.99;2.01	2.35	-1.73	0.08081	.	3.154090	0.00802	N	0.001427	T	0.15046	0.0363	L	0.36672	1.1	0.09310	N	1	P;B	0.36535	0.557;0.13	B;B	0.30572	0.117;0.034	T	0.18650	-1.0330	10	0.48119	T	0.1	-23.3107	4.4843	0.11781	0.0:0.3943:0.4525:0.1532	.	113;113	Q9P2T0-2;Q9P2T0	.;THEG_HUMAN	N	113	ENSP00000340088:S113N;ENSP00000264820:S113N	ENSP00000340088:S113N	S	-	2	0	THEG	325392	0.012000	0.17670	0.000000	0.03702	0.003000	0.03518	0.290000	0.18975	-0.255000	0.09486	0.511000	0.50034	AGC		THEG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384431.2		
RYR1	6261	broad.mit.edu	37	19	38956902	38956902	+	Silent	SNP	G	G	A	rs2228074	byFrequency	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr19:38956902G>A	ENST00000359596.3	+	24	3042	c.3042G>A	c.(3040-3042)gcG>gcA	p.A1014A	RYR1_ENST00000355481.4_Silent_p.A1014A|RYR1_ENST00000360985.3_Silent_p.A1014A			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1014	6 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.A1014A(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	ACATCCCAGCGCGCCGAAACC	0.682													G|||	23	0.00459265	0.0174	0.0	5008	,	,		14338	0.0		0.0	False		,,,				2504	0.0				p.A1014A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3042A	19						.	G	,	45,4353	46.7+/-81.2	0,45,2154	43.0	42.0	42.0		3042,3042	-7.6	0.4	19	dbSNP_98	42	0,8598		0,0,4299	no	coding-synonymous,coding-synonymous	RYR1	NM_000540.2,NM_001042723.1	,	0,45,6453	AA,AG,GG		0.0,1.0232,0.3463	,	1014/5039,1014/5034	38956902	45,12951	2199	4299	6498	43648742	SO:0001819	synonymous_variant	6261	exon24			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.3042G>A	19.37:g.38956902G>A		Somatic		Capture	Illumina HiSeq	Phase_I	43648742	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	37	CCDS33011.1																																																																																				RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
PTPRS	5802	broad.mit.edu	37	19	5220326	5220326	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr19:5220326C>T	ENST00000587303.1	-	20	3593	c.3494G>A	c.(3493-3495)cGt>cAt	p.R1165H	PTPRS_ENST00000262963.6_Missense_Mutation_p.R1161H|PTPRS_ENST00000372412.4_Missense_Mutation_p.R1166H|PTPRS_ENST00000588012.1_Missense_Mutation_p.R1143H|PTPRS_ENST00000592099.1_Missense_Mutation_p.R734H|PTPRS_ENST00000348075.2_Missense_Mutation_p.R1143H|PTPRS_ENST00000353284.2_Missense_Mutation_p.R734H|PTPRS_ENST00000357368.4_Missense_Mutation_p.R1165H|PTPRS_ENST00000588552.1_5'UTR			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	1165					cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.R1165H(1)		NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	TTGGCCTCCACGAGACTTGCG	0.582																																					p.R1165H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3494A	19						.						52.0	50.0	50.0					19																	5220326		2203	4299	6502	5171326	SO:0001583	missense	5802	exon21			U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.3494G>A	19.37:g.5220326C>T	ENSP00000467537:p.Arg1165His	Somatic		Capture	Illumina HiSeq	Phase_I	5171326	NM_002850	O75255|O75870|Q15718|Q16341|Q2M3R7	Missense_Mutation	SNP	ENST00000587303.1	37	CCDS45930.1	.	.	.	.	.	.	.	.	.	.	C	13.60	2.284294	0.40394	.	.	ENSG00000105426	ENST00000536396;ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075;ENST00000355322;ENST00000544524;ENST00000353284	T;T;T;T;T	0.56776	0.61;0.6;0.56;0.44;0.54	3.92	3.92	0.45320	.	0.000000	0.64402	U	0.000003	T	0.67154	0.2863	L	0.59436	1.845	0.45914	D	0.998753	D;D;D;B;D;D	0.89917	0.997;0.996;0.997;0.26;0.995;1.0	D;P;P;B;P;P	0.66847	0.947;0.852;0.897;0.052;0.886;0.904	T	0.70324	-0.4903	10	0.51188	T	0.08	.	16.1393	0.81512	0.0:1.0:0.0:0.0	.	747;734;738;1143;1165;760	F8W800;Q13332-7;F5H2T4;Q13332-6;Q13332;Q59FX6	.;.;.;.;PTPRS_HUMAN;.	H	760;1166;1165;1165;1156;1161;1143;747;738;734	ENSP00000361489:R1166H;ENSP00000349932:R1165H;ENSP00000262963:R1161H;ENSP00000269907:R1143H;ENSP00000327313:R734H	ENSP00000262963:R1161H	R	-	2	0	PTPRS	5171326	0.882000	0.30256	0.806000	0.32338	0.031000	0.12232	2.134000	0.42102	2.027000	0.59764	0.655000	0.94253	CGT		PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450762.2		
RYR1	6261	broad.mit.edu	37	19	38976776	38976776	+	Silent	SNP	C	C	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr19:38976776C>T	ENST00000359596.3	+	34	5481	c.5481C>T	c.(5479-5481)cgC>cgT	p.R1827R	RYR1_ENST00000355481.4_Silent_p.R1827R|RYR1_ENST00000360985.3_Silent_p.R1827R			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1827	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.R1827R(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	AGCACGCTCGCGACCCCGTCG	0.682																																					p.R1827R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5481T	19						.						84.0	83.0	83.0					19																	38976776		2191	4287	6478	43668616	SO:0001819	synonymous_variant	6261	exon34			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.5481C>T	19.37:g.38976776C>T		Somatic		Capture	Illumina HiSeq	Phase_I	43668616	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	37	CCDS33011.1																																																																																				RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
ZNF665	79788	broad.mit.edu	37	19	53668666	53668666	+	Silent	SNP	T	T	C			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr19:53668666T>C	ENST00000600412.1	-	2	997	c.882A>G	c.(880-882)tcA>tcG	p.S294S	ZNF665_ENST00000396424.3_Silent_p.S359S|CTD-2245F17.2_ENST00000600257.1_RNA			Q9H7R5	ZN665_HUMAN	zinc finger protein 665	294					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S294S(1)|p.S359S(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	35				GBM - Glioblastoma multiforme(134;0.0196)		TTGCAAGGTATGAATTGTGCC	0.423																																					p.S359S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A1077G	19						.						106.0	106.0	106.0					19																	53668666		2203	4300	6503	58360478	SO:0001819	synonymous_variant	79788	exon4				CCDS46169.1	19q13.42	2013-01-08				ENSG00000197497		"""Zinc fingers, C2H2-type"", ""-"""	25885	protein-coding gene	gene with protein product							Standard	NM_024733		Approved	FLJ14345	uc010eqm.1	Q9H7R5		ENST00000600412.1:c.882A>G	19.37:g.53668666T>C		Somatic		Capture	Illumina HiSeq	Phase_I	58360478	NM_024733	A8K5T8	Silent	SNP	ENST00000600412.1	37																																																																																					ZNF665-002	PUTATIVE	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000464179.1	NM_024733	
PRAM1	84106	broad.mit.edu	37	19	8564402	8564402	+	Missense_Mutation	SNP	G	G	A	rs200547271		TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr19:8564402G>A	ENST00000423345.4	-	2	810	c.290C>T	c.(289-291)cCg>cTg	p.P97L	PRAM1_ENST00000255612.3_Missense_Mutation_p.P97L			Q96QH2	PRAM_HUMAN	PML-RARA regulated adaptor molecule 1	145	8 X 12 AA repeats of K-P-P-[PQ]-P-[EQ]- [VAF]-T-D-L-P-K.|Pro-rich.				integrin-mediated signaling pathway (GO:0007229)|regulation of neutrophil degranulation (GO:0043313)		lipid binding (GO:0008289)	p.P97L(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)	19						GACCTCAGGCGGCGGGGGCTT	0.642																																					p.P97L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C290T	19						.						14.0	15.0	14.0					19																	8564402		1118	2662	3780	8470402	SO:0001583	missense	84106	exon2			BC028012	CCDS45954.1, CCDS45954.2	19p13.2	2009-01-21				ENSG00000133246			30091	protein-coding gene	gene with protein product		606466				11301322, 15572693	Standard	NM_032152		Approved	PML-RAR	uc002mkd.3	Q96QH2		ENST00000423345.4:c.290C>T	19.37:g.8564402G>A	ENSP00000408342:p.Pro97Leu	Somatic		Capture	Illumina HiSeq	Phase_I	8470402	NM_032152	Q8N6W7	Missense_Mutation	SNP	ENST00000423345.4	37	CCDS45954.2	.	.	.	.	.	.	.	.	.	.	g	5.272	0.235589	0.10023	.	.	ENSG00000133246	ENST00000255612;ENST00000423345	T;T	0.14022	2.54;2.54	3.16	-0.344	0.12628	.	0.453195	0.16503	N	0.211572	T	0.04907	0.0132	N	0.22421	0.69	0.09310	N	1	B;B	0.30482	0.281;0.221	B;B	0.19946	0.027;0.026	T	0.31971	-0.9924	10	0.09843	T	0.71	.	0.3139	0.00292	0.1928:0.253:0.2071:0.3471	.	97;145	Q96QH2-2;Q96QH2	.;PRAM_HUMAN	L	97	ENSP00000255612:P97L;ENSP00000408342:P97L	ENSP00000255612:P97L	P	-	2	0	PRAM1	8470402	0.001000	0.12720	0.043000	0.18650	0.009000	0.06853	0.346000	0.19997	0.027000	0.15297	-0.781000	0.03364	CCG		PRAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397040.3	NM_032152	
MUC16	94025	broad.mit.edu	37	19	9068541	9068541	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr19:9068541G>T	ENST00000397910.4	-	3	19108	c.18905C>A	c.(18904-18906)gCa>gAa	p.A6302E		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6304	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.A6302E(2)|p.A1935E(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ATTGGCCACTGCTGTGTTTAT	0.443																																					p.A6302E												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C18905A	19						.						208.0	196.0	200.0					19																	9068541		2012	4181	6193	8929541	SO:0001583	missense	94025	exon3			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.18905C>A	19.37:g.9068541G>T	ENSP00000381008:p.Ala6302Glu	Somatic		Capture	Illumina HiSeq	Phase_I	8929541	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	4.810	0.150613	0.09185	.	.	ENSG00000181143	ENST00000397910	T	0.30182	1.54	2.41	-0.0291	0.13919	.	.	.	.	.	T	0.33904	0.0879	L	0.43152	1.355	.	.	.	D	0.55172	0.97	P	0.57324	0.818	T	0.39663	-0.9603	8	0.87932	D	0	.	2.8625	0.05591	0.1643:0.0:0.566:0.2697	.	6302	B5ME49	.	E	6302	ENSP00000381008:A6302E	ENSP00000381008:A6302E	A	-	2	0	MUC16	8929541	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.430000	0.06973	0.073000	0.16731	0.195000	0.17529	GCA		MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
AURKC	6795	broad.mit.edu	37	19	57743436	57743436	+	Missense_Mutation	SNP	G	G	A	rs137858773		TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr19:57743436G>A	ENST00000302804.7	+	3	326	c.140G>A	c.(139-141)cGt>cAt	p.R47H	AURKC_ENST00000598785.1_Missense_Mutation_p.R13H|AURKC_ENST00000415300.2_Missense_Mutation_p.R28H|AURKC_ENST00000448930.1_Missense_Mutation_p.R13H|AURKC_ENST00000599062.1_Missense_Mutation_p.R44H	NM_001015878.1	NP_001015878.1	Q9UQB9	AURKC_HUMAN	aurora kinase C	47	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				attachment of spindle microtubules to kinetochore (GO:0008608)|cytokinesis (GO:0000910)|histone modification (GO:0016570)|meiotic nuclear division (GO:0007126)|positive regulation of cytokinesis (GO:0032467)|protein phosphorylation (GO:0006468)|spindle midzone assembly involved in mitosis (GO:0051256)	chromosome passenger complex (GO:0032133)|chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)	p.R13H(1)|p.R47H(1)		breast(1)|endometrium(1)|large_intestine(9)|lung(9)|ovary(3)|prostate(1)|stomach(1)	25		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0122)		GAAATCGGGCGTCCCCTGGGC	0.547																																					p.R13H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G38A	19						.	G	HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	56.0	51.0	53.0		140,83,38	2.8	1.0	19	dbSNP_134	53	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	AURKC	NM_001015878.1,NM_001015879.1,NM_003160.2	29,29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	47/310,28/291,13/276	57743436	1,13005	2203	4300	6503	62435248	SO:0001583	missense	6795	exon3				CCDS33128.1, CCDS46205.1, CCDS46206.1	19q13.43	2013-09-19	2003-07-21	2003-07-23	ENSG00000105146	ENSG00000105146			11391	protein-coding gene	gene with protein product		603495	"""serine/threonine kinase 13 (aurora/IPL1-like)"""	STK13		9799611	Standard	XR_430209		Approved	AurC, ARK3	uc002qoe.3	Q9UQB9	OTTHUMG00000183106	ENST00000302804.7:c.140G>A	19.37:g.57743436G>A	ENSP00000302898:p.Arg47His	Somatic		Capture	Illumina HiSeq	Phase_I	62435248	NM_003160	O60681|O75442|Q6AZY8|Q6DLZ0|Q9UPK5	Missense_Mutation	SNP	ENST00000302804.7	37	CCDS33128.1	.	.	.	.	.	.	.	.	.	.	G	14.71	2.617574	0.46736	0.0	1.16E-4	ENSG00000105146	ENST00000415300;ENST00000448930;ENST00000302804	T;T;T	0.09073	3.02;3.02;3.02	3.79	2.76	0.32466	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.117432	0.64402	N	0.000015	T	0.08268	0.0206	M	0.67517	2.055	0.54753	D	0.999981	P;P;P	0.48294	0.908;0.868;0.603	B;B;B	0.32583	0.148;0.118;0.092	T	0.16660	-1.0395	10	0.87932	D	0	-2.2481	9.6918	0.40134	0.1043:0.0:0.8957:0.0	.	44;47;28	Q5Y191;Q9UQB9;Q9UQB9-3	.;AURKC_HUMAN;.	H	28;13;47	ENSP00000407162:R28H;ENSP00000406798:R13H;ENSP00000302898:R47H	ENSP00000302898:R47H	R	+	2	0	AURKC	62435248	1.000000	0.71417	0.952000	0.39060	0.730000	0.41778	8.093000	0.89531	1.191000	0.43056	-0.266000	0.10368	CGT		AURKC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465089.1	NM_003160	
KCND3	3752	broad.mit.edu	37	1	112524802	112524802	+	Silent	SNP	G	G	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr1:112524802G>A	ENST00000315987.2	-	2	1026	c.547C>T	c.(547-549)Ctg>Ttg	p.L183L	KCND3_ENST00000302127.4_Silent_p.L183L|KCND3_ENST00000369697.1_Silent_p.L183L	NM_004980.4	NP_004971.2	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 3	183					cell death (GO:0008219)|membrane repolarization (GO:0086009)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.L183L(1)		NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	49		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	TAGAAGACCAGGGCCAGCGTG	0.632																																					p.L183L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C547T	1						.						46.0	44.0	45.0					1																	112524802		2203	4300	6503	112326325	SO:0001819	synonymous_variant	3752	exon2			AF048713	CCDS843.1, CCDS844.1	1p13.2	2014-09-17			ENSG00000171385	ENSG00000171385		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6239	protein-coding gene	gene with protein product		605411	"""spinocerebellar ataxia 22"", ""spinocerebellar ataxia 19"""	SCA22, SCA19		10942109, 16382104, 23280837	Standard	NM_172198		Approved	Kv4.3, KSHIVB	uc001ebu.1	Q9UK17	OTTHUMG00000011989	ENST00000315987.2:c.547C>T	1.37:g.112524802G>A		Somatic		Capture	Illumina HiSeq	Phase_I	112326325	NM_004980	O60576|O60577|Q14D71|Q5T0M0|Q9UH85|Q9UH86|Q9UK16	Silent	SNP	ENST00000315987.2	37	CCDS843.1																																																																																				KCND3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000033144.1	NM_172198	
SV2A	9900	broad.mit.edu	37	1	149884869	149884869	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr1:149884869G>T	ENST00000369146.3	-	2	1014	c.524C>A	c.(523-525)gCg>gAg	p.A175E	SV2A_ENST00000369145.1_Missense_Mutation_p.A175E	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	175					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)	p.A175E(1)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	AGCCATCAGCGCCAGACCAAG	0.567																																					p.A175E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C524A	1						.						114.0	109.0	111.0					1																	149884869		2203	4300	6503	148151493	SO:0001583	missense	9900	exon2			AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.524C>A	1.37:g.149884869G>T	ENSP00000358142:p.Ala175Glu	Somatic		Capture	Illumina HiSeq	Phase_I	148151493	NM_014849	D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Missense_Mutation	SNP	ENST00000369146.3	37	CCDS940.1	.	.	.	.	.	.	.	.	.	.	G	29.4	4.999399	0.93227	.	.	ENSG00000159164	ENST00000369146;ENST00000369145	T;T	0.61392	0.11;0.11	5.02	5.02	0.67125	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.76176	0.3951	M	0.86343	2.81	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	T	0.80317	-0.1433	10	0.72032	D	0.01	-21.4838	17.5091	0.87755	0.0:0.0:1.0:0.0	.	175	Q7L0J3	SV2A_HUMAN	E	175	ENSP00000358142:A175E;ENSP00000358141:A175E	ENSP00000358141:A175E	A	-	2	0	SV2A	148151493	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	9.657000	0.98554	2.606000	0.88127	0.655000	0.94253	GCG		SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033754.1		
FLG	2312	broad.mit.edu	37	1	152283611	152283611	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr1:152283611G>T	ENST00000368799.1	-	3	3786	c.3751C>A	c.(3751-3753)Cag>Aag	p.Q1251K	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1251	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.Q1251K(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTCCCACCTGTGAGTGTCTA	0.557									Ichthyosis																												p.Q1251K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3751A	1						.						279.0	266.0	270.0					1																	152283611		2203	4300	6503	150550235	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.3751C>A	1.37:g.152283611G>T	ENSP00000357789:p.Gln1251Lys	Somatic		Capture	Illumina HiSeq	Phase_I	150550235	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	5.472	0.272146	0.10349	.	.	ENSG00000143631	ENST00000368799	T	0.01629	4.72	2.62	-2.28	0.06826	.	.	.	.	.	T	0.00580	0.0019	M	0.76002	2.32	0.09310	N	1	B	0.17465	0.022	B	0.08055	0.003	T	0.50136	-0.8863	9	0.07482	T	0.82	.	3.5341	0.07788	0.0:0.292:0.4459:0.262	.	1251	P20930	FILA_HUMAN	K	1251	ENSP00000357789:Q1251K	ENSP00000357789:Q1251K	Q	-	1	0	FLG	150550235	0.003000	0.15002	0.000000	0.03702	0.005000	0.04900	0.726000	0.25984	-0.713000	0.04981	0.186000	0.17326	CAG		FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
THBS3	7059	broad.mit.edu	37	1	155166871	155166871	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr1:155166871C>T	ENST00000368378.3	-	21	2653	c.2633G>A	c.(2632-2634)cGc>cAc	p.R878H	THBS3_ENST00000541990.1_Missense_Mutation_p.R407H|RP11-263K19.4_ENST00000454348.1_RNA|RP11-263K19.4_ENST00000453136.1_RNA|THBS3_ENST00000541576.1_Missense_Mutation_p.R275H|RP11-263K19.4_ENST00000436772.1_RNA|THBS3_ENST00000457183.2_Missense_Mutation_p.R758H|MIR92B_ENST00000607575.1_RNA|RP11-263K19.4_ENST00000447623.1_RNA	NM_001252607.1|NM_007112.4	NP_001239536.1|NP_009043.1	P49746	TSP3_HUMAN	thrombospondin 3	878	TSP C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00635}.				bone trabecula formation (GO:0060346)|cell-matrix adhesion (GO:0007160)|growth plate cartilage development (GO:0003417)|ossification involved in bone maturation (GO:0043931)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.R878H(1)		breast(6)|endometrium(4)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(3)	48	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			AAGCTGCCAGCGATAGGAGGT	0.607																																					p.R878H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2633A	1						.						82.0	73.0	76.0					1																	155166871		2203	4300	6503	153433495	SO:0001583	missense	7059	exon21			L38969	CCDS1099.1, CCDS58034.1, CCDS72937.1	1q21	2008-02-05			ENSG00000169231	ENSG00000169231			11787	protein-coding gene	gene with protein product		188062				1601886	Standard	NM_007112		Approved		uc001fix.3	P49746	OTTHUMG00000035710	ENST00000368378.3:c.2633G>A	1.37:g.155166871C>T	ENSP00000357362:p.Arg878His	Somatic		Capture	Illumina HiSeq	Phase_I	153433495	NM_007112	B1AVR8|B4DQ20|Q8WV34	Missense_Mutation	SNP	ENST00000368378.3	37	CCDS1099.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.860896	0.91433	.	.	ENSG00000169231	ENST00000368378;ENST00000541576;ENST00000457183;ENST00000541990	D;D;D;D	0.97328	-4.34;-4.34;-4.34;-4.34	4.54	4.54	0.55810	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Thrombospondin, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.98557	0.9518	M	0.90425	3.115	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;1.0	D	0.99346	1.0913	10	0.87932	D	0	-18.5283	15.1718	0.72878	0.0:1.0:0.0:0.0	.	758;878;878;878	B4DQ20;Q53FK6;Q2HIZ0;P49746	.;.;.;TSP3_HUMAN	H	878;275;758;407	ENSP00000357362:R878H;ENSP00000444792:R275H;ENSP00000392207:R758H;ENSP00000437353:R407H	ENSP00000357362:R878H	R	-	2	0	THBS3	153433495	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.647000	0.83462	2.527000	0.85204	0.591000	0.81541	CGC		THBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086856.1	NM_007112	
MROH9	80133	broad.mit.edu	37	1	170940994	170940994	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr1:170940994C>T	ENST00000367758.3	+	8	685	c.586C>T	c.(586-588)Cac>Tac	p.H196Y	MROH9_ENST00000367759.4_Missense_Mutation_p.H196Y	NM_025063.2	NP_079339.2	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	196								p.H196Y(1)									GGGAATGTGTCACCTCCTCTA	0.443																																					p.H196Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C586T	1						.						301.0	269.0	280.0					1																	170940994		1971	4150	6121	169207618	SO:0001583	missense	80133	exon8			AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367758.3:c.586C>T	1.37:g.170940994C>T	ENSP00000356732:p.His196Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	169207618	NM_025063	A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Missense_Mutation	SNP	ENST00000367758.3	37	CCDS41436.1	.	.	.	.	.	.	.	.	.	.	C	0.008	-1.895972	0.00522	.	.	ENSG00000117501	ENST00000367759;ENST00000367758	T;T	0.66815	-0.23;1.46	5.25	0.805	0.18703	.	0.470904	0.19916	N	0.103192	T	0.20210	0.0486	N	0.12182	0.205	0.22796	N	0.998729	B;B	0.06786	0.001;0.001	B;B	0.09377	0.003;0.004	T	0.28427	-1.0044	10	0.22706	T	0.39	-4.2422	7.3735	0.26815	0.0:0.532:0.0:0.468	.	196;196	F5GWX6;Q5TGP6	.;CA129_HUMAN	Y	196	ENSP00000356733:H196Y;ENSP00000356732:H196Y	ENSP00000356732:H196Y	H	+	1	0	C1orf129	169207618	0.030000	0.19436	0.171000	0.22900	0.001000	0.01503	0.102000	0.15272	0.115000	0.18071	-0.126000	0.14955	CAC		MROH9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000099327.1	NM_025063	
USP48	84196	broad.mit.edu	37	1	22033300	22033300	+	Silent	SNP	C	C	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr1:22033300C>A	ENST00000308271.9	-	16	2673	c.2025G>T	c.(2023-2025)ctG>ctT	p.L675L	USP48_ENST00000400301.1_Silent_p.L675L|USP48_ENST00000529637.1_Silent_p.L687L|USP48_ENST00000374732.3_Silent_p.L213L	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	675	DUSP 2. {ECO:0000255|PROSITE- ProRule:PRU00613}.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)	p.L675L(1)		NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		AGTACTGCTGCAGTTTGCTCC	0.393																																					p.L675L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2025T	1						.						122.0	115.0	118.0					1																	22033300		2203	4300	6503	21905887	SO:0001819	synonymous_variant	84196	exon16			AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.2025G>T	1.37:g.22033300C>A		Somatic		Capture	Illumina HiSeq	Phase_I	21905887	NM_032236	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Silent	SNP	ENST00000308271.9	37	CCDS30623.1																																																																																				USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021372.1	NM_032236	
IPO9	55705	broad.mit.edu	37	1	201837787	201837787	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr1:201837787G>T	ENST00000361565.4	+	16	1936	c.1867G>T	c.(1867-1869)Gcc>Tcc	p.A623S		NM_018085.4	NP_060555.2	Q96P70	IPO9_HUMAN	importin 9	623					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone binding (GO:0042393)|protein transporter activity (GO:0008565)	p.A623S(1)		cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	38						TCCCGTCGTCGCCTCACTGGC	0.532																																					p.A623S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1867T	1						.						90.0	75.0	80.0					1																	201837787		2203	4300	6503	200104410	SO:0001583	missense	55705	exon16			AF410465	CCDS1415.1	1q31.3	2008-02-05			ENSG00000198700	ENSG00000198700		"""Importins"""	19425	protein-coding gene	gene with protein product						11823430, 10574461	Standard	NM_018085		Approved	Imp9, FLJ10402	uc001gwz.3	Q96P70	OTTHUMG00000035805	ENST00000361565.4:c.1867G>T	1.37:g.201837787G>T	ENSP00000354742:p.Ala623Ser	Somatic		Capture	Illumina HiSeq	Phase_I	200104410	NM_018085	B1ASV5|Q8N1Y1|Q8N3I2|Q8NCG9|Q96SU6|Q9NW01|Q9P0A8|Q9ULM8	Missense_Mutation	SNP	ENST00000361565.4	37	CCDS1415.1	.	.	.	.	.	.	.	.	.	.	G	18.45	3.627121	0.66901	.	.	ENSG00000198700	ENST00000361565	T	0.65916	-0.18	6.17	6.17	0.99709	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.47507	0.1449	N	0.24115	0.695	0.80722	D	1	B	0.28998	0.23	B	0.16722	0.016	T	0.40021	-0.9585	10	0.15066	T	0.55	-18.211	18.3732	0.90420	0.0:0.0:1.0:0.0	.	623	Q96P70	IPO9_HUMAN	S	623	ENSP00000354742:A623S	ENSP00000354742:A623S	A	+	1	0	IPO9	200104410	1.000000	0.71417	0.993000	0.49108	0.988000	0.76386	9.339000	0.96797	2.941000	0.99782	0.655000	0.94253	GCC		IPO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087088.1	NM_018085	
WDTC1	23038	broad.mit.edu	37	1	27609910	27609910	+	Silent	SNP	G	G	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr1:27609910G>A	ENST00000319394.3	+	5	796	c.261G>A	c.(259-261)acG>acA	p.T87T	WDTC1_ENST00000361771.3_Silent_p.T87T	NM_001276252.1|NM_015023.3	NP_001263181.1|NP_055838.2	Q8N5D0	WDTC1_HUMAN	WD and tetratricopeptide repeats 1	87					cellular chemical homeostasis (GO:0055082)|cellular response to insulin stimulus (GO:0032869)|glucose metabolic process (GO:0006006)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|regulation of cell size (GO:0008361)	cytosol (GO:0005829)|nucleus (GO:0005634)	enzyme inhibitor activity (GO:0004857)	p.T87T(1)		central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|skin(1)	21		all_cancers(24;3.12e-19)|all_epithelial(13;4.18e-18)|Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.00257)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0443)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;1.02e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00201)|STAD - Stomach adenocarcinoma(196;0.00321)|READ - Rectum adenocarcinoma(331;0.0476)		CCATGCACACGGGACACACCG	0.562																																					p.T87T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G261A	1						.						103.0	86.0	92.0					1																	27609910		2203	4300	6503	27482497	SO:0001819	synonymous_variant	23038	exon5			AK023778	CCDS296.1, CCDS60044.1	1p35.3	2013-01-11			ENSG00000142784	ENSG00000142784		"""DDB1 and CUL4 associated factors"", ""WD repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29175	protein-coding gene	gene with protein product	"""adipose homolog (Drosophila)"", ""DDB1 and CUL4 associated factor 9"""					12717455, 19238144	Standard	NM_015023		Approved	KIAA1037, ADP, DCAF9	uc009vst.3	Q8N5D0	OTTHUMG00000004273	ENST00000319394.3:c.261G>A	1.37:g.27609910G>A		Somatic		Capture	Illumina HiSeq	Phase_I	27482497	NM_015023	D3DPL5|Q5SSC5|Q9NV87|Q9UPW4	Silent	SNP	ENST00000319394.3	37																																																																																					WDTC1-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015023	
ZSCAN20	7579	broad.mit.edu	37	1	33957183	33957183	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr1:33957183A>T	ENST00000361328.3	+	6	1478	c.1325A>T	c.(1324-1326)gAa>gTa	p.E442V	ZSCAN20_ENST00000373413.2_Missense_Mutation_p.E388V	NM_145238.3	NP_660281	P17040	ZSC20_HUMAN	zinc finger and SCAN domain containing 20	442					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E442V(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(2)|pancreas(1)|stomach(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				GAGCAGGAGGAAGGGGGCTGG	0.612																																					p.E442V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1325T	1						.						93.0	106.0	102.0					1																	33957183		1966	4155	6121	33729770	SO:0001583	missense	7579	exon6			X52360	CCDS41300.1	1p34.3	2013-01-08	2007-02-20	2007-02-20	ENSG00000121903	ENSG00000121903		"""-"", ""Zinc fingers, C2H2-type"""	13093	protein-coding gene	gene with protein product		611315	"""zinc finger protein 31 (KOX 29)"", ""zinc finger protein 31"""	ZNF360, ZNF31		2288909	Standard	NM_145238		Approved	KOX29	uc001bxj.4	P17040	OTTHUMG00000004173	ENST00000361328.3:c.1325A>T	1.37:g.33957183A>T	ENSP00000355053:p.Glu442Val	Somatic		Capture	Illumina HiSeq	Phase_I	33729770	NM_145238	A8K2D0|B1ALI4|B1ALI5|B1ALI6|Q6ZN23|Q96FA9|Q96H84	Missense_Mutation	SNP	ENST00000361328.3	37	CCDS41300.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.278288	0.80692	.	.	ENSG00000121903	ENST00000373411;ENST00000326544;ENST00000373413;ENST00000361328;ENST00000401072	T	0.02140	4.43	5.61	4.48	0.54585	.	0.187792	0.37906	N	0.001891	T	0.09555	0.0235	M	0.76838	2.35	0.39944	D	0.974457	D;D;D	0.69078	0.989;0.989;0.997	P;P;P	0.60789	0.836;0.776;0.879	T	0.01059	-1.1465	10	0.72032	D	0.01	-6.576	9.951	0.41638	0.9194:0.0:0.0805:0.0	.	442;388;442	P17040-3;P17040-4;P17040	.;.;ZSC20_HUMAN	V	388;442;388;376;376	ENSP00000362512:E388V	ENSP00000324450:E442V	E	+	2	0	ZSCAN20	33729770	0.999000	0.42202	1.000000	0.80357	0.988000	0.76386	1.904000	0.39868	1.076000	0.40961	0.459000	0.35465	GAA		ZSCAN20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277003.2	NM_145238	
GRIK3	2899	broad.mit.edu	37	1	37346292	37346292	+	Missense_Mutation	SNP	C	C	T	rs148168675		TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr1:37346292C>T	ENST00000373091.3	-	3	509	c.493G>A	c.(493-495)Gac>Aac	p.D165N	GRIK3_ENST00000373093.4_Missense_Mutation_p.D165N	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	165					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)	p.D165N(1)		breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				TGGACCAGGTCGAGGATGGCA	0.622																																					p.D165N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G493A	1						.	C	ASN/ASP	0,4406		0,0,2203	322.0	290.0	301.0		493	4.9	1.0	1	dbSNP_134	301	1,8599	1.2+/-3.3	0,1,4299	no	missense	GRIK3	NM_000831.3	23	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	165/920	37346292	1,13005	2203	4300	6503	37118879	SO:0001583	missense	2899	exon3			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.493G>A	1.37:g.37346292C>T	ENSP00000362183:p.Asp165Asn	Somatic		Capture	Illumina HiSeq	Phase_I	37118879	NM_000831	A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	ENST00000373091.3	37	CCDS416.1	.	.	.	.	.	.	.	.	.	.	C	34	5.335527	0.95758	0.0	1.16E-4	ENSG00000163873	ENST00000373091;ENST00000373093	D;D	0.85013	-1.93;-1.93	4.88	4.88	0.63580	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.93719	0.7993	M	0.90198	3.095	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.74348	0.975;0.983	D	0.94798	0.7968	10	0.66056	D	0.02	.	18.3912	0.90484	0.0:1.0:0.0:0.0	.	165;165	A9Z1Z8;Q13003	.;GRIK3_HUMAN	N	165	ENSP00000362183:D165N;ENSP00000362185:D165N	ENSP00000362183:D165N	D	-	1	0	GRIK3	37118879	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.410000	0.80065	2.426000	0.82243	0.561000	0.74099	GAC		GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1	NM_000831	
MACF1	23499	broad.mit.edu	37	1	39747978	39747978	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr1:39747978C>G	ENST00000372915.3	+	6	729	c.642C>G	c.(640-642)atC>atG	p.I214M	MACF1_ENST00000545844.1_Missense_Mutation_p.I214M|MACF1_ENST00000361689.2_Missense_Mutation_p.I214M|MACF1_ENST00000317713.7_Missense_Mutation_p.I214M|MACF1_ENST00000536367.1_Missense_Mutation_p.I177M|MACF1_ENST00000539005.1_Missense_Mutation_p.I214M|MACF1_ENST00000564288.1_Missense_Mutation_p.I209M|MACF1_ENST00000567887.1_Missense_Mutation_p.I246M			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	214	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.I214M(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ACACAGGAATCAAATGCACCA	0.473																																					p.I214M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C642G	1						.						130.0	116.0	121.0					1																	39747978		2203	4300	6503	39520565	SO:0001583	missense	23499	exon8			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.642C>G	1.37:g.39747978C>G	ENSP00000362006:p.Ile214Met	Somatic		Capture	Illumina HiSeq	Phase_I	39520565	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		.	.	.	.	.	.	.	.	.	.	C	21.5	4.163449	0.78226	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000404645;ENST00000317713;ENST00000539005;ENST00000524432;ENST00000536367;ENST00000530262;ENST00000372900	D;D;D;D;D;D;D;D	0.95554	-3.74;-3.74;-3.74;-3.74;-3.74;-3.74;-3.74;-3.74	5.78	5.78	0.91487	.	.	.	.	.	D	0.96629	0.8900	M	0.66506	2.035	0.32588	N	0.527591	D;B;P	0.53151	0.958;0.012;0.905	P;B;P	0.61201	0.885;0.05;0.672	D	0.97496	1.0057	9	0.87932	D	0	.	11.5156	0.50520	0.1303:0.7278:0.1419:0.0	.	177;214;179	B4E2T3;F8W8Q1;Q9UPN3-3	.;.;.	M	214;214;214;230;214;214;172;177;363;374	ENSP00000439537:I214M;ENSP00000362006:I214M;ENSP00000354573:I214M;ENSP00000313438:I214M;ENSP00000444364:I214M;ENSP00000435070:I172M;ENSP00000440369:I177M;ENSP00000437059:I363M	ENSP00000313438:I214M	I	+	3	3	MACF1	39520565	0.999000	0.42202	1.000000	0.80357	0.999000	0.98932	0.688000	0.25422	2.729000	0.93468	0.650000	0.86243	ATC		MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
OR2M5	127059	broad.mit.edu	37	1	248309327	248309327	+	Missense_Mutation	SNP	G	G	A	rs138811069	byFrequency	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr1:248309327G>A	ENST00000366476.1	+	1	878	c.878G>A	c.(877-879)cGc>cAc	p.R293H		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	293						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R293H(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			TACAGCCTCCGCAACAAGGAG	0.493													g|||	4	0.000798722	0.0	0.0	5008	,	,		17073	0.002		0.001	False		,,,				2504	0.001				p.R293H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G878A	1						.	G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	79.0	73.0	75.0		878	3.0	0.2	1	dbSNP_134	75	1,8599	1.2+/-3.3	0,1,4299	no	missense	OR2M5	NM_001004690.1	29	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign	293/313	248309327	2,13004	2203	4300	6503	246375950	SO:0001583	missense	127059	exon1				CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.878G>A	1.37:g.248309327G>A	ENSP00000355432:p.Arg293His	Somatic		Capture	Illumina HiSeq	Phase_I	246375950	NM_001004690		Missense_Mutation	SNP	ENST00000366476.1	37	CCDS31105.1	.	.	.	.	.	.	.	.	.	.	g	11.40	1.627916	0.28978	2.27E-4	1.16E-4	ENSG00000162727	ENST00000366476	T	0.41065	1.01	3.01	3.01	0.34805	.	.	.	.	.	T	0.58509	0.2127	H	0.96333	3.805	0.09310	N	1	B	0.21905	0.062	B	0.18263	0.021	T	0.60172	-0.7315	9	0.72032	D	0.01	.	13.8517	0.63501	0.0:0.0:1.0:0.0	.	293	A3KFT3	OR2M5_HUMAN	H	293	ENSP00000355432:R293H	ENSP00000355432:R293H	R	+	2	0	OR2M5	246375950	0.911000	0.30947	0.216000	0.23742	0.780000	0.44128	1.852000	0.39348	1.356000	0.45884	0.385000	0.25706	CGC		OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097343.1	NM_001004690	
PCSK2	5126	broad.mit.edu	37	20	17434431	17434431	+	Silent	SNP	C	C	T	rs372965651		TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr20:17434431C>T	ENST00000262545.2	+	9	1245	c.930C>T	c.(928-930)gaC>gaT	p.D310D	PCSK2_ENST00000536609.1_Silent_p.D275D|PCSK2_ENST00000377899.1_Silent_p.D291D	NM_002594.3	NP_002585.2	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	310	Peptidase S8.				cellular protein metabolic process (GO:0044267)|embryo development (GO:0009790)|enkephalin processing (GO:0034230)|insulin processing (GO:0030070)|islet amyloid polypeptide processing (GO:0034231)|nervous system development (GO:0007399)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|perikaryon (GO:0043204)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)	p.D310D(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|lung(17)|ovary(3)|pancreas(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	53					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CCTCCGGGGACGGCGGCAGCT	0.672																																					p.D310D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C930T	20						.	C	,,	0,4406		0,0,2203	86.0	68.0	74.0		873,825,930	-4.1	0.6	20		74	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	PCSK2	NM_001201528.1,NM_001201529.1,NM_002594.3	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	291/620,275/604,310/639	17434431	1,13005	2203	4300	6503	17382431	SO:0001819	synonymous_variant	5126	exon9			AK312341	CCDS13125.1, CCDS56179.1, CCDS56180.1	20p11.2	2008-08-01			ENSG00000125851	ENSG00000125851			8744	protein-coding gene	gene with protein product	"""neuroendocrine convertase 2"", ""KEX2-like endoprotease 2"""	162151		NEC2		1765368	Standard	NM_001201528		Approved	PC2, SPC2	uc002wpm.3	P16519	OTTHUMG00000031941	ENST00000262545.2:c.930C>T	20.37:g.17434431C>T		Somatic		Capture	Illumina HiSeq	Phase_I	17382431	NM_002594	B1ANH9|B4DFQ3|Q14927|Q5JYQ1|Q8IWA8|Q9NQG3|Q9NUG1|Q9UJC6	Silent	SNP	ENST00000262545.2	37	CCDS13125.1																																																																																				PCSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078120.2	NM_002594	
CTNNBL1	56259	broad.mit.edu	37	20	36361299	36361299	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr20:36361299C>T	ENST00000361383.6	+	2	166	c.49C>T	c.(49-51)Cgt>Tgt	p.R17C	CTNNBL1_ENST00000405275.2_5'UTR	NM_030877.3	NP_110517.2	Q8WYA6	CTBL1_HUMAN	catenin, beta like 1	17					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|positive regulation of apoptotic process (GO:0043065)|RNA splicing (GO:0008380)|somatic diversification of immunoglobulins (GO:0016445)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)	p.R17C(1)		autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(6)|lung(6)|ovary(3)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				GGGCACAAAACGTCCCCGGGA	0.502																																					p.R17C	Ovarian(184;582 2038 3273 4106 42608)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C49T	20						.						65.0	63.0	64.0					20																	36361299		2203	4300	6503	35794713	SO:0001583	missense	56259	exon2			AL023804	CCDS13298.1	20q11.23-q12	2011-06-03	2002-05-27	2002-05-31	ENSG00000132792	ENSG00000132792			15879	protein-coding gene	gene with protein product	"""nuclear associated protein"""	611537	"""chromosome 20 open reading frame 33"""	C20orf33		12659813, 21385873	Standard	NM_030877		Approved	FLJ21108, P14L, P14, NAP, NYD-SP19	uc021wdj.1	Q8WYA6	OTTHUMG00000032428	ENST00000361383.6:c.49C>T	20.37:g.36361299C>T	ENSP00000355050:p.Arg17Cys	Somatic		Capture	Illumina HiSeq	Phase_I	35794713	NM_030877	B4DE16|Q0VAL9|Q0VAM0|Q53HI8|Q5JWZ2|Q5JWZ3|Q5JWZ7|Q5JWZ8|Q8N454|Q8NCL2|Q8TBD6|Q96KD2|Q9H7A5|Q9NQF9|Q9NTX0|Q9Y3M7	Missense_Mutation	SNP	ENST00000361383.6	37	CCDS13298.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.150455	0.78001	.	.	ENSG00000132792	ENST00000361383	T	0.54866	0.55	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.69984	0.3172	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.70227	0.968	T	0.73154	-0.4072	10	0.87932	D	0	-8.8664	14.1301	0.65247	0.1503:0.8497:0.0:0.0	.	17	Q8WYA6	CTBL1_HUMAN	C	17	ENSP00000355050:R17C	ENSP00000355050:R17C	R	+	1	0	CTNNBL1	35794713	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.821000	0.48065	2.606000	0.88127	0.561000	0.74099	CGT		CTNNBL1-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079125.1	NM_030877	
FERMT1	55612	broad.mit.edu	37	20	6065798	6065798	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr20:6065798T>G	ENST00000217289.4	-	12	2296	c.1508A>C	c.(1507-1509)cAg>cCg	p.Q503P	FERMT1_ENST00000536936.1_Missense_Mutation_p.Q246P|FERMT1_ENST00000478194.1_5'UTR	NM_017671.4	NP_060141.3	Q9BQL6	FERM1_HUMAN	fermitin family member 1	503	FERM.				cell adhesion (GO:0007155)|establishment of epithelial cell polarity (GO:0090162)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)		p.Q503P(2)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	17						GGAAGCCACCTGAGATGCAGA	0.458																																					p.Q503P												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1508C	20						.						140.0	123.0	129.0					20																	6065798		2203	4300	6503	6013798	SO:0001583	missense	55612	exon12			AK000123	CCDS13098.1	20p12.3	2013-01-10	2010-06-24	2007-12-14	ENSG00000101311	ENSG00000101311		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15889	protein-coding gene	gene with protein product	"""kindlin-1"", ""kinderlin"""	607900	"""chromosome 20 open reading frame 42"", ""fermitin family homolog 1 (Drosophila)"""	C20orf42		12697302, 12789646	Standard	NM_017671		Approved	FLJ20116, URP1, KIND1, UNC112A	uc002wmr.3	Q9BQL6	OTTHUMG00000031826	ENST00000217289.4:c.1508A>C	20.37:g.6065798T>G	ENSP00000217289:p.Gln503Pro	Somatic		Capture	Illumina HiSeq	Phase_I	6013798	NM_017671	D3DW10|Q8IX34|Q8IYH2|Q9NWM2|Q9NXQ3	Missense_Mutation	SNP	ENST00000217289.4	37	CCDS13098.1	.	.	.	.	.	.	.	.	.	.	t	5.221	0.226196	0.09916	.	.	ENSG00000101311	ENST00000217289;ENST00000536936;ENST00000339538	T;T	0.45668	0.89;1.5	5.17	-4.13	0.03904	Band 4.1 domain (1);FERM central domain (2);	0.316966	0.34828	N	0.003653	T	0.19765	0.0475	N	0.12637	0.245	0.39701	D	0.971189	B	0.02656	0.0	B	0.04013	0.001	T	0.05599	-1.0875	10	0.25106	T	0.35	-2.6837	12.0306	0.53396	0.1052:0.0:0.5846:0.3103	.	503	Q9BQL6	FERM1_HUMAN	P	503;246;503	ENSP00000217289:Q503P;ENSP00000441063:Q246P	ENSP00000217289:Q503P	Q	-	2	0	FERMT1	6013798	0.935000	0.31712	0.001000	0.08648	0.290000	0.27261	1.499000	0.35671	-1.022000	0.03346	0.454000	0.30748	CAG		FERMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077908.2	NM_017671	
SYS1	90196	broad.mit.edu	37	20	43995561	43995561	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr20:43995561G>T	ENST00000243918.5	+	4	568	c.277G>T	c.(277-279)Gat>Tat	p.D93Y	SYS1_ENST00000372727.1_Missense_Mutation_p.D93Y|SYS1_ENST00000414310.1_Missense_Mutation_p.D72Y|SYS1_ENST00000479779.1_3'UTR|SYS1-DBNDD2_ENST00000452133.1_Intron|SYS1-DBNDD2_ENST00000475242.1_Intron|SYS1_ENST00000426004.1_Intron	NM_033542.3	NP_291020.1	Q8N2H4	SYS1_HUMAN	Sys1 golgi trafficking protein	93					protein transport (GO:0015031)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)		p.D93Y(1)		cervix(1)|endometrium(2)|large_intestine(2)|prostate(1)|skin(1)	7		Myeloproliferative disorder(115;0.0122)				GCAGTGTCTGGATTTCACTGT	0.577																																					p.D93Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G277T	20						.						159.0	138.0	145.0					20																	43995561		2203	4300	6503	43428975	SO:0001583	missense	90196	exon5			AL021578	CCDS13351.1, CCDS56192.1	20q13.12	2014-05-07	2014-05-07	2006-11-06	ENSG00000204070	ENSG00000204070			16162	protein-coding gene	gene with protein product		612979	"""chromosome 20 open reading frame 169"", ""SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae)"""	C20orf169		15077113	Standard	NM_001197129		Approved	dJ453C12.4	uc002xnv.3	Q8N2H4	OTTHUMG00000032579	ENST00000243918.5:c.277G>T	20.37:g.43995561G>T	ENSP00000243918:p.Asp93Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	43428975	NM_001197129	C9JFB3|E1P620|Q5QPU7|Q96SD8|Q9BQZ2|Q9BQZ4|Q9H1F7	Missense_Mutation	SNP	ENST00000243918.5	37	CCDS13351.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.020245	0.93462	.	.	ENSG00000204070	ENST00000372727;ENST00000414310;ENST00000243918;ENST00000453003	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.86644	0.5982	M	0.91038	3.17	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88101	0.2819	9	0.87932	D	0	-23.0603	19.8676	0.96824	0.0:0.0:1.0:0.0	.	93	Q8N2H4	SYS1_HUMAN	Y	93;72;93;93	.	ENSP00000243918:D93Y	D	+	1	0	SYS1	43428975	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.185000	0.94900	2.941000	0.99782	0.655000	0.94253	GAT		SYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079453.2	NM_033542	
SON	6651	broad.mit.edu	37	21	34927006	34927006	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr21:34927006A>T	ENST00000356577.4	+	3	5944	c.5469A>T	c.(5467-5469)agA>agT	p.R1823S	SON_ENST00000300278.4_Missense_Mutation_p.R1823S|SON_ENST00000381692.2_Intron|SON_ENST00000290239.6_Missense_Mutation_p.R1823S|SON_ENST00000381679.4_Missense_Mutation_p.R1823S	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1823					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R1823S(2)		breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						CTTCATTAAGATCTCGAAGTA	0.383																																					p.R1823S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A5469T	21						.						81.0	83.0	82.0					21																	34927006		2203	4300	6503	33848876	SO:0001583	missense	6651	exon3			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.5469A>T	21.37:g.34927006A>T	ENSP00000348984:p.Arg1823Ser	Somatic		Capture	Illumina HiSeq	Phase_I	33848876	NM_032195	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	ENST00000356577.4	37	CCDS13629.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.79|13.79	2.341052|2.341052	0.41498|0.41498	.|.	.|.	ENSG00000159140|ENSG00000159140	ENST00000436227|ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679	.|T;T;T;T	.|0.17528	.|2.27;2.27;2.27;2.27	5.65|5.65	-0.63|-0.63	0.11530|0.11530	.|.	.|0.000000	.|0.56097	.|D	.|0.000035	T|T	0.30885|0.30885	0.0779|0.0779	L|L	0.56769|0.56769	1.78|1.78	0.32338|0.32338	N|N	0.560143|0.560143	.|D;D;D;D;D	.|0.76494	.|0.996;0.998;0.989;0.999;0.999	.|P;P;P;D;P	.|0.65684	.|0.9;0.778;0.756;0.937;0.889	T|T	0.34428|0.34428	-0.9829|-0.9829	5|10	.|0.49607	.|T	.|0.09	.|.	11.9736|11.9736	0.53078|0.53078	0.5087:0.0:0.4913:0.0|0.5087:0.0:0.4913:0.0	.|.	.|1823;1823;1504;1823;1823	.|P18583-10;P18583;P18583-2;P18583-3;P18583-6	.|.;SON_HUMAN;.;.;.	V|S	818|1823	.|ENSP00000348984:R1823S;ENSP00000290239:R1823S;ENSP00000300278:R1823S;ENSP00000371095:R1823S	.|ENSP00000290239:R1823S	D|R	+|+	2|3	0|2	SON|SON	33848876|33848876	0.998000|0.998000	0.40836|0.40836	0.995000|0.995000	0.50966|0.50966	0.998000|0.998000	0.95712|0.95712	0.273000|0.273000	0.18662|0.18662	-0.107000|-0.107000	0.12088|0.12088	0.533000|0.533000	0.62120|0.62120	GAT|AGA		SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927	
C2CD2	25966	broad.mit.edu	37	21	43342136	43342136	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr21:43342136G>A	ENST00000380486.3	-	3	678	c.437C>T	c.(436-438)gCc>gTc	p.A146V	C2CD2_ENST00000329623.7_5'UTR	NM_015500.1	NP_056315.1	Q9Y426	CU025_HUMAN	C2 calcium-dependent domain containing 2	146						cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.A146V(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|ovary(3)|prostate(1)|stomach(1)	15						AGCACCCAAGGCAGGCGTCTC	0.532																																					p.A146V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C437T	21						.						57.0	55.0	56.0					21																	43342136		2203	4300	6503	42215205	SO:0001583	missense	25966	exon3			AB047784	CCDS13677.1, CCDS42933.1	21q22.3	2008-11-24	2007-10-17	2007-10-17	ENSG00000157617	ENSG00000157617			1266	protein-coding gene	gene with protein product	"""TMEM24-like"""		"""chromosome 21 open reading frame 25"""	C21orf25		15289880	Standard	NM_015500		Approved	TMEM24L, DKFZP586F0422, C21orf258	uc002yzw.3	Q9Y426	OTTHUMG00000086779	ENST00000380486.3:c.437C>T	21.37:g.43342136G>A	ENSP00000369853:p.Ala146Val	Somatic		Capture	Illumina HiSeq	Phase_I	42215205	NM_015500	Q5R2V7|Q6AHX8|Q9NSE6	Missense_Mutation	SNP	ENST00000380486.3	37	CCDS42933.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.900879	0.52227	.	.	ENSG00000157617	ENST00000380486	T	0.24723	1.84	4.73	4.73	0.59995	.	0.498237	0.20830	N	0.084908	T	0.25457	0.0619	L	0.54323	1.7	0.09310	N	1	P	0.43094	0.799	B	0.38562	0.276	T	0.17561	-1.0365	10	0.38643	T	0.18	-14.2407	13.567	0.61824	0.0:0.0:1.0:0.0	.	146	Q9Y426	CU025_HUMAN	V	146	ENSP00000369853:A146V	ENSP00000369853:A146V	A	-	2	0	C2CD2	42215205	0.032000	0.19561	0.005000	0.12908	0.007000	0.05969	2.150000	0.42254	2.325000	0.78763	0.655000	0.94253	GCC		C2CD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195228.2	NM_015500	
CCT8L2	150160	broad.mit.edu	37	22	17073278	17073278	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr22:17073278C>T	ENST00000359963.3	-	1	422	c.163G>A	c.(163-165)Ggc>Agc	p.G55S		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	55					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)	p.G55S(1)		breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				TTCTGCCGGCCGTGGGGGCCA	0.642																																					p.G55S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G163A	22						.						64.0	66.0	65.0					22																	17073278		2203	4300	6503	15453278	SO:0001583	missense	150160	exon1			AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.163G>A	22.37:g.17073278C>T	ENSP00000353048:p.Gly55Ser	Somatic		Capture	Illumina HiSeq	Phase_I	15453278	NM_014406	A4QPH3|Q9UJS3	Missense_Mutation	SNP	ENST00000359963.3	37	CCDS13738.1	.	.	.	.	.	.	.	.	.	.	c	15.91	2.972960	0.53614	.	.	ENSG00000198445	ENST00000359963	D	0.89681	-2.55	2.0	2.0	0.26442	.	0.000000	0.35466	U	0.003192	D	0.93012	0.7776	M	0.84433	2.695	0.37124	D	0.900969	D	0.69078	0.997	D	0.69307	0.963	D	0.93154	0.6552	10	0.87932	D	0	-11.292	7.4831	0.27417	0.0:1.0:0.0:0.0	.	55	Q96SF2	TCPQM_HUMAN	S	55	ENSP00000353048:G55S	ENSP00000353048:G55S	G	-	1	0	CCT8L2	15453278	0.121000	0.22262	0.958000	0.39756	0.698000	0.40448	2.840000	0.48215	1.126000	0.42016	0.393000	0.25936	GGC		CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1		
TNRC6B	23112	broad.mit.edu	37	22	40676034	40676034	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr22:40676034C>T	ENST00000454349.2	+	10	3509	c.3298C>T	c.(3298-3300)Cga>Tga	p.R1100*	TNRC6B_ENST00000497559.1_3'UTR|TNRC6B_ENST00000335727.9_Nonsense_Mutation_p.R1047*|TNRC6B_ENST00000301923.9_Nonsense_Mutation_p.R353*|TNRC6B_ENST00000402203.1_Nonsense_Mutation_p.R353*	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	1100					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R1114*(1)		breast(1)	1						TGTGGACAAGCGAGCGATGAA	0.433																																					p.R1047X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3139T	22						.						205.0	204.0	204.0					22																	40676034		1844	4092	5936	39005980	SO:0001587	stop_gained	23112	exon9			AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.3298C>T	22.37:g.40676034C>T	ENSP00000401946:p.Arg1100*	Somatic		Capture	Illumina HiSeq	Phase_I	39005980	NM_015088	B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Nonsense_Mutation	SNP	ENST00000454349.2	37	CCDS54533.1	.	.	.	.	.	.	.	.	.	.	C	43	10.111934	0.99339	.	.	ENSG00000100354	ENST00000301923;ENST00000402203;ENST00000454349;ENST00000400140;ENST00000335727	.	.	.	5.93	3.79	0.43588	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.666	15.1162	0.72404	0.2658:0.7342:0.0:0.0	.	.	.	.	X	353;353;1100;1047;1047	.	ENSP00000306759:R353X	R	+	1	2	TNRC6B	39005980	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.562000	0.45914	0.775000	0.33450	0.655000	0.94253	CGA		TNRC6B-202	KNOWN	basic|CCDS	protein_coding	protein_coding			
SNTG2	54221	broad.mit.edu	37	2	1168837	1168837	+	Missense_Mutation	SNP	G	G	A	rs567910526		TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr2:1168837G>A	ENST00000308624.5	+	8	688	c.559G>A	c.(559-561)Ggt>Agt	p.G187S	SNTG2_ENST00000467759.1_3'UTR|SNTG2_ENST00000407292.1_Intron	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	187					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)	p.G187S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		CTTTGACAGCGGTTTGCATCT	0.468													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18832	0.0		0.0	False		,,,				2504	0.0				p.G187S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G559A	2						.						160.0	162.0	161.0					2																	1168837		1929	4127	6056	1158837	SO:0001583	missense	54221	exon8			AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.559G>A	2.37:g.1168837G>A	ENSP00000311837:p.Gly187Ser	Somatic		Capture	Illumina HiSeq	Phase_I	1158837	NM_018968	Q05AH5	Missense_Mutation	SNP	ENST00000308624.5	37	CCDS46220.1	.	.	.	.	.	.	.	.	.	.	G	14.90	2.673037	0.47781	.	.	ENSG00000172554	ENST00000308624	T	0.38077	1.16	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.42426	0.1202	M	0.62723	1.935	0.80722	D	1	D	0.62365	0.991	P	0.48488	0.579	T	0.29488	-1.0010	10	0.19590	T	0.45	.	15.4969	0.75662	0.0:0.0:1.0:0.0	.	187	Q9NY99	SNTG2_HUMAN	S	187	ENSP00000311837:G187S	ENSP00000311837:G187S	G	+	1	0	SNTG2	1158837	1.000000	0.71417	0.650000	0.29550	0.185000	0.23345	6.238000	0.72350	2.151000	0.67156	0.643000	0.83706	GGT		SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322454.1	NM_018968	
TRIM43	129868	broad.mit.edu	37	2	96259783	96259783	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr2:96259783C>A	ENST00000272395.2	+	2	148	c.12C>A	c.(10-12)gaC>gaA	p.D4E		NM_001164464.1|NM_138800.1	NP_001157936.1|NP_620155.1	Q96BQ3	TRI43_HUMAN	tripartite motif containing 43	4						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.D4E(2)		breast(1)|large_intestine(3)|lung(7)|ovary(1)	12						TGGACTCAGACTTCTCACATG	0.463																																					p.D4E												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C12A	2						.						85.0	88.0	87.0					2																	96259783		2201	4299	6500	95623510	SO:0001583	missense	129868	exon2			BK000505	CCDS2015.1	2q11	2014-02-17	2011-01-25		ENSG00000144015	ENSG00000144015		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19015	protein-coding gene	gene with protein product			"""tripartite motif-containing 43"""				Standard	NM_138800		Approved	TRIM43A	uc002suv.3	Q96BQ3	OTTHUMG00000130401	ENST00000272395.2:c.12C>A	2.37:g.96259783C>A	ENSP00000272395:p.Asp4Glu	Somatic		Capture	Illumina HiSeq	Phase_I	95623510	NM_138800	Q53TJ7	Missense_Mutation	SNP	ENST00000272395.2	37	CCDS2015.1	.	.	.	.	.	.	.	.	.	.	.	0.377	-0.930930	0.02359	.	.	ENSG00000144015	ENST00000272395	T	0.66815	-0.23	1.18	1.18	0.20946	.	.	.	.	.	T	0.41213	0.1149	N	0.13003	0.285	0.09310	N	1	B	0.11235	0.004	B	0.10450	0.005	T	0.22487	-1.0215	9	0.12103	T	0.63	-0.1596	4.5442	0.12073	0.3774:0.6226:0.0:0.0	.	4	Q96BQ3	TRI43_HUMAN	E	4	ENSP00000272395:D4E	ENSP00000272395:D4E	D	+	3	2	TRIM43	95623510	0.001000	0.12720	0.004000	0.12327	0.301000	0.27625	0.014000	0.13333	0.959000	0.37980	0.386000	0.25728	GAC		TRIM43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252784.1	NM_138800	
ST6GAL2	84620	broad.mit.edu	37	2	107450536	107450536	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr2:107450536T>C	ENST00000409382.3	-	3	1620	c.1010A>G	c.(1009-1011)aAt>aGt	p.N337S	AC016994.2_ENST00000425419.1_RNA|ST6GAL2_ENST00000409087.3_Missense_Mutation_p.N337S|ST6GAL2_ENST00000361686.4_Missense_Mutation_p.N337S	NM_001142351.1	NP_001135823.1	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2	337					growth (GO:0040007)|multicellular organismal development (GO:0007275)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)	p.N337S(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(30)|ovary(5)|pancreas(6)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	65						GGTGGTTTTATTCCCAACATC	0.383																																					p.N337S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1010G	2						.						217.0	207.0	211.0					2																	107450536		2203	4300	6503	106816968	SO:0001583	missense	84620	exon3			AB059555	CCDS2073.1, CCDS46380.1	2q11-q12	2008-02-05	2005-02-07	2005-02-07	ENSG00000144057	ENSG00000144057	2.4.99.2		10861	protein-coding gene	gene with protein product		608472	"""sialyltransferase 2 (monosialoganglioside sialyltransferase)"""	SIAT2			Standard	NM_032528		Approved	KIAA1877, St6gal2, St6GalII	uc002tdr.3	Q96JF0	OTTHUMG00000130923	ENST00000409382.3:c.1010A>G	2.37:g.107450536T>C	ENSP00000386942:p.Asn337Ser	Somatic		Capture	Illumina HiSeq	Phase_I	106816968	NM_001142351	D3DVK3|Q53QP4|Q86Y44|Q8IUG7|Q96HE4	Missense_Mutation	SNP	ENST00000409382.3	37	CCDS2073.1	.	.	.	.	.	.	.	.	.	.	T	11.48	1.652538	0.29336	.	.	ENSG00000144057	ENST00000361686;ENST00000409382;ENST00000409087	T;T;T	0.78364	-1.17;-1.17;-1.17	6.03	4.87	0.63330	Glycoside hydrolase/deacetylase, beta/alpha-barrel (1);	0.174254	0.64402	N	0.000011	T	0.56262	0.1973	N	0.11427	0.14	0.58432	D	0.999996	B;B	0.22003	0.063;0.002	B;B	0.18871	0.023;0.01	T	0.49753	-0.8906	10	0.08599	T	0.76	-28.4653	11.2601	0.49078	0.0:0.0709:0.0:0.9291	.	337;337	Q96JF0-2;Q96JF0	.;SIAT2_HUMAN	S	337	ENSP00000355273:N337S;ENSP00000386942:N337S;ENSP00000387332:N337S	ENSP00000355273:N337S	N	-	2	0	ST6GAL2	106816968	1.000000	0.71417	0.994000	0.49952	0.989000	0.77384	1.790000	0.38734	1.097000	0.41459	0.533000	0.62120	AAT		ST6GAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330065.1	NM_032528	
MORC1	27136	broad.mit.edu	37	3	108813824	108813824	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr3:108813824T>A	ENST00000483760.1	-	7	558	c.515A>T	c.(514-516)tAt>tTt	p.Y172F	MORC1_ENST00000232603.5_Missense_Mutation_p.Y172F					MORC family CW-type zinc finger 1									p.Y172F(1)		breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						GGAGTATTTATAAATTATAGA	0.343																																					p.Y172F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A515T	3						.						37.0	41.0	40.0					3																	108813824		2202	4296	6498	110296514	SO:0001583	missense	27136	exon7			AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.515A>T	3.37:g.108813824T>A	ENSP00000417282:p.Tyr172Phe	Somatic		Capture	Illumina HiSeq	Phase_I	110296514	NM_014429		Missense_Mutation	SNP	ENST00000483760.1	37		.	.	.	.	.	.	.	.	.	.	T	10.52	1.373837	0.24857	.	.	ENSG00000114487	ENST00000232603;ENST00000483760	T;T	0.05649	3.42;3.41	5.52	0.226	0.15353	ATPase-like, ATP-binding domain (1);	0.304109	0.24109	N	0.041477	T	0.04272	0.0118	L	0.33485	1.01	0.18873	N	0.999986	B;B	0.15141	0.012;0.001	B;B	0.11329	0.006;0.003	T	0.40979	-0.9534	10	0.25751	T	0.34	-4.4238	5.5909	0.17301	0.3985:0.0728:0.0:0.5287	.	172;172	E7ERX1;Q86VD1	.;MORC1_HUMAN	F	172	ENSP00000232603:Y172F;ENSP00000417282:Y172F	ENSP00000232603:Y172F	Y	-	2	0	MORC1	110296514	1.000000	0.71417	0.950000	0.38849	0.609000	0.37215	0.783000	0.26802	-0.096000	0.12329	0.528000	0.53228	TAT		MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000353844.1		
NAALADL2	254827	broad.mit.edu	37	3	175455143	175455143	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr3:175455143T>A	ENST00000454872.1	+	12	2074	c.1946T>A	c.(1945-1947)tTt>tAt	p.F649Y	snoU13_ENST00000606657.1_RNA	NM_207015.2	NP_996898.2	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 2	649						integral component of membrane (GO:0016021)		p.F649Y(1)		central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(20)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	49	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		GTTCTGCCCTTTAATGCACTT	0.303																																					p.F649Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1946A	3						.						114.0	108.0	110.0					3																	175455143		1822	4077	5899	176937837	SO:0001583	missense	254827	exon12				CCDS46960.1	3q26.3	2011-08-16			ENSG00000177694	ENSG00000177694			23219	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase II-type non-peptidase homologue"""	608806				15168106	Standard	NM_207015		Approved		uc003fir.3	Q58DX5	OTTHUMG00000157120	ENST00000454872.1:c.1946T>A	3.37:g.175455143T>A	ENSP00000404705:p.Phe649Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	176937837	NM_207015	Q658X9|Q6H9J8|Q6H9J9|Q6PG38	Missense_Mutation	SNP	ENST00000454872.1	37	CCDS46960.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.271650	0.80469	.	.	ENSG00000177694	ENST00000454872	T	0.40225	1.04	5.38	5.38	0.77491	Transferrin receptor-like, dimerisation domain (1);	0.134368	0.48767	D	0.000168	T	0.37758	0.1015	L	0.32530	0.975	0.32674	N	0.516408	P	0.41475	0.751	B	0.42282	0.382	T	0.54529	-0.8280	10	0.56958	D	0.05	-9.7209	14.6487	0.68780	0.0:0.0:0.0:1.0	.	649	Q58DX5	NADL2_HUMAN	Y	649	ENSP00000404705:F649Y	ENSP00000404705:F649Y	F	+	2	0	NAALADL2	176937837	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.924000	0.63418	2.164000	0.68074	0.477000	0.44152	TTT		NAALADL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347390.2	NM_207015	
CAV3	859	broad.mit.edu	37	3	8787320	8787320	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr3:8787320C>A	ENST00000343849.2	+	2	300	c.223C>A	c.(223-225)Ctg>Atg	p.L75M	CAV3_ENST00000397368.2_Missense_Mutation_p.L75M|CAV3_ENST00000472766.1_Intron|SSUH2_ENST00000478513.1_5'Flank	NM_001234.4|NM_033337.2	NP_001225.1|NP_203123.1	P56539	CAV3_HUMAN	caveolin 3	75	Required for interaction with DAG1.				actin filament organization (GO:0007015)|cardiac muscle cell development (GO:0055013)|caveola assembly (GO:0070836)|cell differentiation (GO:0030154)|cell growth (GO:0016049)|cholesterol homeostasis (GO:0042632)|cytoplasmic microtubule organization (GO:0031122)|endocytosis (GO:0006897)|establishment of protein localization to plasma membrane (GO:0090002)|glucose homeostasis (GO:0042593)|heart trabecula formation (GO:0060347)|membrane raft organization (GO:0031579)|muscle cell cellular homeostasis (GO:0046716)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)|negative regulation of cell size (GO:0045792)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sarcomere organization (GO:0060299)|nucleus localization (GO:0051647)|plasma membrane organization (GO:0007009)|plasma membrane repair (GO:0001778)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein localization (GO:0008104)|protein localization to plasma membrane (GO:0072659)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of calcium ion import (GO:0090279)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart contraction (GO:0008016)|regulation of heart rate (GO:0002027)|regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900825)|regulation of membrane potential (GO:0042391)|regulation of nerve growth factor receptor activity (GO:0051394)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase B signaling (GO:0051896)|regulation of signal transduction by receptor internalization (GO:0038009)|regulation of skeletal muscle contraction (GO:0014819)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|T-tubule organization (GO:0033292)|triglyceride metabolic process (GO:0006641)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|dystrophin-associated glycoprotein complex (GO:0016010)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	calcium channel regulator activity (GO:0005246)|connexin binding (GO:0071253)|ion channel binding (GO:0044325)|potassium channel inhibitor activity (GO:0019870)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein complex scaffold (GO:0032947)|sodium channel regulator activity (GO:0017080)	p.L75M(1)		breast(1)|kidney(2)|large_intestine(4)|lung(3)|prostate(1)	11						GTGCTACCGTCTGTTGTCCAC	0.592																																					p.L75M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C223A	3						.						106.0	81.0	90.0					3																	8787320		2203	4300	6503	8762320	SO:0001583	missense	859	exon2			AF043101	CCDS2569.1	3p25	2014-09-17			ENSG00000182533	ENSG00000182533			1529	protein-coding gene	gene with protein product	"""M-caveolin"""	601253				9536092, 9537420	Standard	NM_033337		Approved	VIP-21, LGMD1C, VIP21, LQT9	uc003brb.3	P56539	OTTHUMG00000090519	ENST00000343849.2:c.223C>A	3.37:g.8787320C>A	ENSP00000341940:p.Leu75Met	Somatic		Capture	Illumina HiSeq	Phase_I	8762320	NM_001234	A8K777|Q3T1A4	Missense_Mutation	SNP	ENST00000343849.2	37	CCDS2569.1	.	.	.	.	.	.	.	.	.	.	C	12.39	1.923787	0.34002	.	.	ENSG00000182533	ENST00000343849;ENST00000397368	D;D	0.94650	-3.48;-3.48	4.63	3.73	0.42828	.	0.190535	0.36338	N	0.002651	D	0.95978	0.8690	M	0.82630	2.6	0.44295	D	0.997164	D	0.53151	0.958	P	0.60345	0.873	D	0.95341	0.8438	10	0.72032	D	0.01	-3.4283	7.1701	0.25715	0.1679:0.7416:0.0:0.0905	.	75	P56539	CAV3_HUMAN	M	75	ENSP00000341940:L75M;ENSP00000380525:L75M	ENSP00000341940:L75M	L	+	1	2	CAV3	8762320	0.330000	0.24705	1.000000	0.80357	0.237000	0.25408	0.748000	0.26305	2.386000	0.81285	0.313000	0.20887	CTG		CAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207008.2	NM_033337	
NBEAL2	23218	broad.mit.edu	37	3	47030195	47030195	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr3:47030195T>G	ENST00000450053.3	+	2	267	c.88T>G	c.(88-90)Ttt>Gtt	p.F30V	NBEAL2_ENST00000292309.5_Missense_Mutation_p.F30V|NBEAL2_ENST00000383740.2_5'UTR	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	30					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)		p.F30V(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		GCTGAAGGCCTTTGTAGGTGC	0.582																																					p.F30V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T88G	3						.						118.0	119.0	119.0					3																	47030195		2067	4189	6256	47005199	SO:0001583	missense	23218	exon2			AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.88T>G	3.37:g.47030195T>G	ENSP00000415034:p.Phe30Val	Somatic		Capture	Illumina HiSeq	Phase_I	47005199	NM_015175	O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	ENST00000450053.3	37	CCDS46817.1	.	.	.	.	.	.	.	.	.	.	T	16.18	3.049169	0.55110	.	.	ENSG00000160796	ENST00000292309;ENST00000450053;ENST00000296147	T;T	0.75260	-0.92;-0.84	4.17	4.17	0.49024	.	.	.	.	.	T	0.80644	0.4662	M	0.73962	2.25	0.80722	D	1	D;B	0.63046	0.992;0.376	P;B	0.57101	0.813;0.115	T	0.80158	-0.1499	9	0.37606	T	0.19	.	10.7348	0.46117	0.0:0.0:0.0:1.0	.	23;30	Q6ZNJ1-4;Q6ZNJ1	.;NBEL2_HUMAN	V	30;30;23	ENSP00000292309:F30V;ENSP00000415034:F30V	ENSP00000292309:F30V	F	+	1	0	NBEAL2	47005199	1.000000	0.71417	0.895000	0.35142	0.435000	0.31806	3.930000	0.56522	1.767000	0.52121	0.459000	0.35465	TTT		NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3	XM_291064	
CSPG5	10675	broad.mit.edu	37	3	47614185	47614185	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr3:47614185C>T	ENST00000383738.2	-	3	3471	c.1373G>A	c.(1372-1374)cGt>cAt	p.R458H	CSPG5_ENST00000456150.1_Missense_Mutation_p.R320H|CSPG5_ENST00000264723.4_Missense_Mutation_p.R458H	NM_001206943.1|NM_001206945.1	NP_001193872.1|NP_001193874.1	O95196	CSPG5_HUMAN	chondroitin sulfate proteoglycan 5 (neuroglycan C)	458	Interaction with GOPC.				axon regeneration (GO:0031103)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|intracellular transport (GO:0046907)|nervous system development (GO:0007399)|regulation of growth (GO:0040008)|regulation of synaptic transmission (GO:0050804)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	growth factor activity (GO:0008083)	p.R458H(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|prostate(2)	22				BRCA - Breast invasive adenocarcinoma(193;0.000266)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		CTTGGTCCTACGCAGCTTGGT	0.602																																					p.R458H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1373A	3						.						130.0	90.0	103.0					3																	47614185		2203	4300	6503	47589189	SO:0001583	missense	10675	exon3			AF059274	CCDS2757.1, CCDS56252.1, CCDS56253.1, CCDS74930.1	3p21.3	2008-07-18			ENSG00000114646	ENSG00000114646			2467	protein-coding gene	gene with protein product		606775				9950058	Standard	NM_006574		Approved	NGC	uc003crp.4	O95196	OTTHUMG00000133518	ENST00000383738.2:c.1373G>A	3.37:g.47614185C>T	ENSP00000373244:p.Arg458His	Somatic		Capture	Illumina HiSeq	Phase_I	47589189	NM_006574	Q71M39|Q71M40	Missense_Mutation	SNP	ENST00000383738.2	37	CCDS56253.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.958418	0.92726	.	.	ENSG00000114646	ENST00000456150;ENST00000383738;ENST00000264723	T;T;T	0.32023	1.49;1.57;1.47	5.25	5.25	0.73442	Neural chondroitin sulphate proteoglycan cytoplasmic (1);	0.133288	0.50627	D	0.000103	T	0.44808	0.1311	L	0.27053	0.805	0.46849	D	0.999225	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.992	T	0.46386	-0.9195	10	0.87932	D	0	-11.1723	17.4347	0.87548	0.0:1.0:0.0:0.0	.	458;458	O95196;O95196-2	CSPG5_HUMAN;.	H	320;458;458	ENSP00000392096:R320H;ENSP00000373244:R458H;ENSP00000264723:R458H	ENSP00000264723:R458H	R	-	2	0	CSPG5	47589189	1.000000	0.71417	0.996000	0.52242	0.964000	0.63967	5.439000	0.66556	2.455000	0.83008	0.561000	0.74099	CGT		CSPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257489.1	NM_006574	
PYDC2	152138	broad.mit.edu	37	3	191179197	191179197	+	Silent	SNP	G	G	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr3:191179197G>A	ENST00000518817.1	+	1	246	c.246G>A	c.(244-246)acG>acA	p.T82T		NM_001083308.1	NP_001076777.1	Q56P42	PYDC2_HUMAN	pyrin domain containing 2	82	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.T82T(2)		breast(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	10						TGAATCAAACGCATCTGTCTG	0.512																																					p.T82T												.	.	2	Substitution - coding silent(2)	large_intestine(1)|breast(1)	c.G246A	3						.						94.0	99.0	97.0					3																	191179197		2141	4280	6421	192661891	SO:0001819	synonymous_variant	152138	exon1					3q28	2008-07-29				ENSG00000253548			33512	protein-coding gene	gene with protein product		615701				17178784	Standard	NM_001083308		Approved	POP2	uc011bso.2	Q56P42		ENST00000518817.1:c.246G>A	3.37:g.191179197G>A		Somatic		Capture	Illumina HiSeq	Phase_I	192661891	NM_001083308		Silent	SNP	ENST00000518817.1	37																																																																																					PYDC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000343231.2	NM_001083308	
RNF212	285498	broad.mit.edu	37	4	1075217	1075217	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr4:1075217C>A	ENST00000433731.2	-	7	515	c.454G>T	c.(454-456)Gcc>Tcc	p.A152S	RNF212_ENST00000382968.5_Missense_Mutation_p.A152S			Q495C1	RN212_HUMAN	ring finger protein 212	152					chiasma assembly (GO:0051026)|meiotic gene conversion (GO:0006311)|protein sumoylation (GO:0016925)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.A152S(2)		endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(23;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (64;0.151)		CTGTCGGGGGCTGATGAGTGA	0.562																																					p.A152S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G454T	4						.						163.0	159.0	160.0					4																	1075217		2203	4300	6503	1065217	SO:0001583	missense	285498	exon7			AK096160	CCDS3345.1, CCDS46996.1, CCDS54704.1	4p16.3	2013-02-27	2007-01-19	2007-01-19	ENSG00000178222	ENSG00000178222		"""RING-type (C3HC4) zinc fingers"""	27729	protein-coding gene	gene with protein product		612041	"""hypothetical protein LOC285498"""	LOC285498		23396135	Standard	NM_001131034		Approved	FLJ38841	uc003gcj.3	Q495C1	OTTHUMG00000118997	ENST00000433731.2:c.454G>T	4.37:g.1075217C>A	ENSP00000389709:p.Ala152Ser	Somatic		Capture	Illumina HiSeq	Phase_I	1065217	NM_001131034	C9J8N0|Q495C0|Q86W82|Q8IY99|Q8N8U7	Missense_Mutation	SNP	ENST00000433731.2	37	CCDS46996.1	.	.	.	.	.	.	.	.	.	.	c	0.703	-0.789979	0.02884	.	.	ENSG00000178222	ENST00000382968;ENST00000433731	T	0.47528	0.84	4.07	-0.156	0.13391	.	.	.	.	.	T	0.30230	0.0758	L	0.36672	1.1	0.09310	N	1	B;B	0.22414	0.02;0.069	B;B	0.24006	0.05;0.034	T	0.30966	-0.9960	9	0.07482	T	0.82	-0.5296	6.6308	0.22855	0.0:0.6467:0.1545:0.1988	.	152;152	Q495C1;Q495C1-5	RN212_HUMAN;.	S	152	ENSP00000389709:A152S	ENSP00000372428:A152S	A	-	1	0	RNF212	1065217	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.069000	0.01381	-0.141000	0.11374	-0.898000	0.02899	GCC		RNF212-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359124.2	NM_194439	
PRDM5	11107	broad.mit.edu	37	4	121719559	121719559	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr4:121719559C>T	ENST00000264808.3	-	10	1291	c.1051G>A	c.(1051-1053)Gag>Aag	p.E351K	PRDM5_ENST00000515109.1_Missense_Mutation_p.E320K|PRDM5_ENST00000428209.2_Missense_Mutation_p.E320K	NM_018699.2	NP_061169.2	Q9NQX1	PRDM5_HUMAN	PR domain containing 5	351					histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|mitotic cell cycle (GO:0000278)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.E351K(1)|p.E351*(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(17)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						TTACAAATCTCGCAATTATAG	0.343																																					p.E351K												.	.	2	Substitution - Nonsense(1)|Substitution - Missense(1)	large_intestine(1)|lung(1)	c.G1051A	4						.						61.0	62.0	62.0					4																	121719559		2202	4300	6502	121939009	SO:0001583	missense	11107	exon10			AF272897	CCDS3716.1, CCDS75187.1, CCDS75188.1	4q25-q26	2013-01-08			ENSG00000138738	ENSG00000138738		"""Zinc fingers, C2H2-type"""	9349	protein-coding gene	gene with protein product		614161					Standard	XM_005262706		Approved	PFM2	uc003idn.3	Q9NQX1	OTTHUMG00000132970	ENST00000264808.3:c.1051G>A	4.37:g.121719559C>T	ENSP00000264808:p.Glu351Lys	Somatic		Capture	Illumina HiSeq	Phase_I	121939009	NM_018699	Q0VAI9|Q0VAJ0|Q6NXQ7	Missense_Mutation	SNP	ENST00000264808.3	37	CCDS3716.1	.	.	.	.	.	.	.	.	.	.	C	19.93	3.917941	0.73098	.	.	ENSG00000138738	ENST00000264808;ENST00000515109;ENST00000428209	T;T;T	0.16597	2.33;3.28;3.28	5.63	5.63	0.86233	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.141585	0.64402	D	0.000007	T	0.22666	0.0547	L	0.28274	0.84	0.80722	D	1	D;D;D	0.64830	0.989;0.994;0.979	P;P;P	0.55749	0.683;0.783;0.594	T	0.01643	-1.1305	10	0.08599	T	0.76	-26.9094	20.0499	0.97621	0.0:1.0:0.0:0.0	.	320;320;351	Q0VAI9;Q9NQX1-2;Q9NQX1	.;.;PRDM5_HUMAN	K	351;320;320	ENSP00000264808:E351K;ENSP00000422309:E320K;ENSP00000404832:E320K	ENSP00000264808:E351K	E	-	1	0	PRDM5	121939009	1.000000	0.71417	0.996000	0.52242	0.780000	0.44128	7.578000	0.82498	2.798000	0.96311	0.655000	0.94253	GAG		PRDM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256528.2		
EXOSC9	5393	broad.mit.edu	37	4	122737580	122737580	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr4:122737580G>C	ENST00000243498.5	+	11	1321	c.1213G>C	c.(1213-1215)Gac>Cac	p.D405H	EXOSC9_ENST00000512454.1_Missense_Mutation_p.D389H|EXOSC9_ENST00000379663.3_Missense_Mutation_p.D422H	NM_005033.2	NP_005024.2	Q06265	EXOS9_HUMAN	exosome component 9	405					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|immune response (GO:0006955)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of cell growth (GO:0030307)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|intermediate filament cytoskeleton (GO:0045111)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|AU-rich element binding (GO:0017091)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.D422H(1)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|urinary_tract(1)	16						TTTGGAACCAGACAAGAATCC	0.279																																					p.D422H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1264C	4						.						66.0	77.0	73.0					4																	122737580		2197	4292	6489	122957030	SO:0001583	missense	5393	exon12			M58460	CCDS3722.2, CCDS34057.1	4q27	2010-05-07	2004-06-16	2004-06-18	ENSG00000123737	ENSG00000123737	3.1.13.-		9137	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 1 (75kD)"""	606180	"""polymyositis/scleroderma autoantigen 1, 75kDa"""	PMSCL1			Standard	XR_427545		Approved	PM/Scl-75, Rrp45p, RRP45, p5, p6	uc003idz.3	Q06265	OTTHUMG00000128783	ENST00000243498.5:c.1213G>C	4.37:g.122737580G>C	ENSP00000243498:p.Asp405His	Somatic		Capture	Illumina HiSeq	Phase_I	122957030	NM_001034194	Q12883|Q4W5P5|Q86Y41|Q86Y48	Missense_Mutation	SNP	ENST00000243498.5	37	CCDS3722.2	.	.	.	.	.	.	.	.	.	.	G	19.77	3.888976	0.72524	.	.	ENSG00000123737	ENST00000243498;ENST00000379663;ENST00000512454	T;T;T	0.26223	1.76;1.77;1.75	6.08	6.08	0.98989	.	0.316334	0.36932	N	0.002321	T	0.21022	0.0506	N	0.14661	0.345	0.26612	N	0.972816	B;B;P	0.41569	0.412;0.214;0.755	B;B;B	0.44224	0.172;0.092;0.444	T	0.14227	-1.0480	10	0.59425	D	0.04	0.1626	13.9726	0.64250	0.0:0.1623:0.8377:0.0	.	389;405;422	D6RIY6;Q06265;Q06265-2	.;EXOS9_HUMAN;.	H	405;422;389	ENSP00000243498:D405H;ENSP00000368984:D422H;ENSP00000425782:D389H	ENSP00000243498:D405H	D	+	1	0	EXOSC9	122957030	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.410000	0.66381	2.894000	0.99253	0.655000	0.94253	GAC		EXOSC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250708.2	NM_005033	
FBXW7	55294	broad.mit.edu	37	4	153245393	153245393	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr4:153245393C>A	ENST00000281708.4	-	11	3027	c.1798G>T	c.(1798-1800)Gat>Tat	p.D600Y	FBXW7_ENST00000603548.1_Missense_Mutation_p.D600Y|FBXW7_ENST00000263981.5_Missense_Mutation_p.D520Y|FBXW7_ENST00000393956.3_Missense_Mutation_p.D424Y|FBXW7_ENST00000296555.5_Missense_Mutation_p.D482Y|FBXW7_ENST00000603841.1_Missense_Mutation_p.D600Y	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	600					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.D600Y(2)|p.D520Y(1)|p.D361Y(1)|p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				ACTGTAGAATCTGCATTCCCA	0.388			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.D520Y			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	.	.	5	Substitution - Missense(4)|Unknown(1)	large_intestine(4)|haematopoietic_and_lymphoid_tissue(1)	c.G1558T	4						.						125.0	116.0	119.0					4																	153245393		2203	4300	6503	153464843	SO:0001583	missense	55294	exon10			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1798G>T	4.37:g.153245393C>A	ENSP00000281708:p.Asp600Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	153464843	NM_018315	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.689117	0.88735	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	D;D;D;D	0.89415	-2.51;-2.51;-2.51;-2.51	5.45	5.45	0.79879	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.96969	0.9010	H	0.98133	4.155	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98335	1.0535	10	0.87932	D	0	-19.794	19.2767	0.94034	0.0:1.0:0.0:0.0	.	424;600;482;520	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	Y	600;482;520;424	ENSP00000281708:D600Y;ENSP00000296555:D482Y;ENSP00000263981:D520Y;ENSP00000377528:D424Y	ENSP00000263981:D520Y	D	-	1	0	FBXW7	153464843	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.547000	0.85894	0.655000	0.94253	GAT		FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
FBXW7	55294	broad.mit.edu	37	4	153249469	153249469	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr4:153249469C>T	ENST00000281708.4	-	9	2538	c.1309G>A	c.(1309-1311)Gga>Aga	p.G437R	FBXW7_ENST00000603548.1_Missense_Mutation_p.G437R|FBXW7_ENST00000263981.5_Missense_Mutation_p.G357R|FBXW7_ENST00000393956.3_Missense_Mutation_p.G261R|FBXW7_ENST00000296555.5_Missense_Mutation_p.G319R|FBXW7_ENST00000603841.1_Missense_Mutation_p.G437R	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	437					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.G437R(2)|p.G357R(1)|p.?(1)|p.G198R(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TCTGTAGATCCACTAATGATG	0.408			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.G357R			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	.	.	5	Substitution - Missense(4)|Unknown(1)	large_intestine(4)|haematopoietic_and_lymphoid_tissue(1)	c.G1069A	4						.						313.0	265.0	281.0					4																	153249469		2203	4300	6503	153468919	SO:0001583	missense	55294	exon8			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1309G>A	4.37:g.153249469C>T	ENSP00000281708:p.Gly437Arg	Somatic		Capture	Illumina HiSeq	Phase_I	153468919	NM_018315	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.977609	0.92982	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62	5.9	5.9	0.94986	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.91560	0.7334	H	0.98901	4.365	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.94264	0.7505	10	0.87932	D	0	-19.4993	20.2787	0.98501	0.0:1.0:0.0:0.0	.	261;437;319;357	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	R	437;319;357;261	ENSP00000281708:G437R;ENSP00000296555:G319R;ENSP00000263981:G357R;ENSP00000377528:G261R	ENSP00000263981:G357R	G	-	1	0	FBXW7	153468919	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.798000	0.96311	0.650000	0.86243	GGA		FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
GLRB	2743	broad.mit.edu	37	4	158073917	158073917	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr4:158073917G>A	ENST00000264428.4	+	9	1222	c.952G>A	c.(952-954)Gct>Act	p.A318T	GLRB_ENST00000509282.1_Missense_Mutation_p.A318T|GLRB_ENST00000541722.1_Intron|GLRB_ENST00000512619.1_Intron	NM_000824.4	NP_000815.1	P48167	GLRB_HUMAN	glycine receptor, beta	318					acrosome reaction (GO:0007340)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|extracellular-glycine-gated ion channel activity (GO:0016933)|glycine binding (GO:0016594)	p.A318T(1)		central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(6)|skin(5)|upper_aerodigestive_tract(1)	27	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0564)|COAD - Colon adenocarcinoma(41;0.0642)|Kidney(143;0.0707)	Enflurane(DB00228)|Glycine(DB00145)|Lindane(DB00431)	AACCCTTGCCGCTGAGCTTCC	0.463																																					p.A318T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G952A	4						.						190.0	181.0	184.0					4																	158073917		2203	4300	6503	158293367	SO:0001583	missense	2743	exon9			U33267	CCDS3796.1, CCDS54813.1	4q31.3	2008-02-05			ENSG00000109738	ENSG00000109738			4329	protein-coding gene	gene with protein product		138492				9676428, 8717357	Standard	NM_000824		Approved		uc003ipj.2	P48167	OTTHUMG00000161954	ENST00000264428.4:c.952G>A	4.37:g.158073917G>A	ENSP00000264428:p.Ala318Thr	Somatic		Capture	Illumina HiSeq	Phase_I	158293367	NM_001166060	A8K3K2|D3DP23|F5GWE1	Missense_Mutation	SNP	ENST00000264428.4	37	CCDS3796.1	.	.	.	.	.	.	.	.	.	.	G	12.89	2.073419	0.36566	.	.	ENSG00000109738	ENST00000264428;ENST00000509282	D;D	0.84223	-1.82;-1.82	5.61	5.61	0.85477	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.245990	0.42548	D	0.000681	T	0.77572	0.4150	N	0.21617	0.685	0.80722	D	1	B	0.23591	0.088	B	0.19946	0.027	T	0.74788	-0.3546	10	0.62326	D	0.03	.	15.1522	0.72709	0.0:0.1407:0.8593:0.0	.	318	P48167	GLRB_HUMAN	T	318	ENSP00000264428:A318T;ENSP00000427186:A318T	ENSP00000264428:A318T	A	+	1	0	GLRB	158293367	1.000000	0.71417	0.577000	0.28562	0.420000	0.31355	5.062000	0.64326	2.642000	0.89623	0.650000	0.86243	GCT		GLRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366507.1	NM_000824	
ADAM29	11086	broad.mit.edu	37	4	175898763	175898763	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr4:175898763G>A	ENST00000359240.3	+	5	2757	c.2087G>A	c.(2086-2088)cGa>cAa	p.R696Q	RP13-577H12.2_ENST00000507525.1_RNA|ADAM29_ENST00000404450.4_Missense_Mutation_p.R696Q|ADAM29_ENST00000445694.1_Missense_Mutation_p.R696Q|ADAM29_ENST00000514159.1_Missense_Mutation_p.R696Q	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	696					spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R696Q(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		TGTCTTTATCGACTTTGTAAA	0.343																																					p.R696Q	Ovarian(140;1727 1835 21805 25838 41440)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2087A	4						.						36.0	39.0	38.0					4																	175898763		2203	4300	6503	176135338	SO:0001583	missense	11086	exon3			AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.2087G>A	4.37:g.175898763G>A	ENSP00000352177:p.Arg696Gln	Somatic		Capture	Illumina HiSeq	Phase_I	176135338	NM_001130705	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	ENST00000359240.3	37	CCDS3823.1	.	.	.	.	.	.	.	.	.	.	G	4.343	0.063028	0.08388	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000404450;ENST00000514159	T;T;T;T	0.01981	4.52;4.52;4.52;4.52	3.08	-6.16	0.02098	.	2.137520	0.03034	U	0.152525	T	0.01092	0.0036	N	0.14661	0.345	0.09310	N	1	P	0.42456	0.78	B	0.23419	0.046	T	0.44436	-0.9328	9	.	.	.	.	5.6034	0.17367	0.2097:0.0:0.1896:0.6008	.	696	Q9UKF5	ADA29_HUMAN	Q	696	ENSP00000352177:R696Q;ENSP00000414544:R696Q;ENSP00000384229:R696Q;ENSP00000423517:R696Q	.	R	+	2	0	ADAM29	176135338	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.938000	0.00684	-2.371000	0.00602	-0.196000	0.12772	CGA		ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding			
APC	324	broad.mit.edu	37	5	112173299	112173299	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr5:112173299A>T	ENST00000457016.1	+	16	2388	c.2008A>T	c.(2008-2010)Aaa>Taa	p.K670*	APC_ENST00000257430.4_Nonsense_Mutation_p.K670*|APC_ENST00000508376.2_Nonsense_Mutation_p.K670*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	670	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.K670*(2)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		ACAACACTTAAAATCTCATAG	0.368		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.K652X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Nonsense,0 	.	3	Substitution - Nonsense(2)|Unknown(1)	large_intestine(2)|skin(1)	c.A1954T	5						.						71.0	73.0	72.0					5																	112173299		2202	4300	6502	112201198	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2008A>T	5.37:g.112173299A>T	ENSP00000413133:p.Lys670*	Somatic		Capture	Illumina HiSeq	Phase_I	112201198	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	A	37	6.015398	0.97205	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-27.4247	16.4943	0.84223	1.0:0.0:0.0:0.0	.	.	.	.	X	670;652;670;670;670	.	ENSP00000257430:K670X	K	+	1	0	APC	112201198	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	7.013000	0.76373	2.291000	0.77112	0.533000	0.62120	AAA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APC	324	broad.mit.edu	37	5	112175507	112175507	+	Nonsense_Mutation	SNP	C	C	T	rs587782518		TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr5:112175507C>T	ENST00000457016.1	+	16	4596	c.4216C>T	c.(4216-4218)Cag>Tag	p.Q1406*	APC_ENST00000257430.4_Nonsense_Mutation_p.Q1406*|APC_ENST00000508376.2_Nonsense_Mutation_p.Q1406*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1406	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q1406*(15)|p.Q1406fs*11(1)|p.?(1)|p.K1192fs*3(1)|p.I1401fs*2(1)|p.Y1376fs*41(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CAGCTCCGTTCAGAGTGAACC	0.468		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q1388X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,colon,Substitution - Nonsense,0 	.	20	Substitution - Nonsense(15)|Deletion - Frameshift(3)|Unknown(1)|Insertion - Frameshift(1)	large_intestine(18)|soft_tissue(1)|skin(1)	c.C4162T	5	GRCh37	CI084250|CM023011	APC	I|M		.						113.0	105.0	108.0					5																	112175507		2202	4300	6502	112203406	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4216C>T	5.37:g.112175507C>T	ENSP00000413133:p.Gln1406*	Somatic		Capture	Illumina HiSeq	Phase_I	112203406	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	41	8.658788	0.98903	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	5.3	0.74995	.	0.187376	0.50627	D	0.000103	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.0613	15.6825	0.77381	0.0:0.8637:0.1363:0.0	.	.	.	.	X	1406	.	.	Q	+	1	0	APC	112203406	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.175000	0.77632	1.615000	0.50252	0.655000	0.94253	CAG		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PCDHB4	56131	broad.mit.edu	37	5	140502512	140502512	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr5:140502512T>A	ENST00000194152.1	+	1	932	c.932T>A	c.(931-933)aTt>aAt	p.I311N	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	311	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I311N(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTCGAAAAAATTAAATCTTAC	0.373																																					p.I311N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T932A	5						.						111.0	129.0	123.0					5																	140502512		2203	4300	6503	140482696	SO:0001583	missense	56131	exon1			AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.932T>A	5.37:g.140502512T>A	ENSP00000194152:p.Ile311Asn	Somatic		Capture	Illumina HiSeq	Phase_I	140482696	NM_018938	Q4V761	Missense_Mutation	SNP	ENST00000194152.1	37	CCDS4246.1	.	.	.	.	.	.	.	.	.	.	T	7.613	0.675177	0.14841	.	.	ENSG00000081818	ENST00000194152	T	0.51817	0.69	4.41	1.89	0.25635	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.46927	0.1418	L	0.42529	1.33	0.09310	N	1	P	0.44195	0.828	P	0.52267	0.694	T	0.32402	-0.9908	9	0.54805	T	0.06	.	4.1179	0.10090	0.1906:0.239:0.0:0.5704	.	311	Q9Y5E5	PCDB4_HUMAN	N	311	ENSP00000194152:I311N	ENSP00000194152:I311N	I	+	2	0	PCDHB4	140482696	0.000000	0.05858	0.173000	0.22940	0.965000	0.64279	-1.008000	0.03663	0.293000	0.22520	0.528000	0.53228	ATT		PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251812.2	NM_018938	
LIFR	3977	broad.mit.edu	37	5	38490321	38490321	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr5:38490321C>A	ENST00000263409.4	-	15	2300	c.2138G>T	c.(2137-2139)cGc>cTc	p.R713L	LIFR_ENST00000453190.2_Missense_Mutation_p.R713L|LIFR_ENST00000503088.1_5'Flank	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	713	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)	p.R713L(1)		NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					AATCATGGAGCGTAATAATTG	0.318			T	PLAG1	salivary adenoma																																p.R713L	Melanoma(13;4 730 6426 9861 34751)		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2138T	5						.						97.0	106.0	103.0					5																	38490321		2202	4290	6492	38526078	SO:0001583	missense	3977	exon15			X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.2138G>T	5.37:g.38490321C>A	ENSP00000263409:p.Arg713Leu	Somatic		Capture	Illumina HiSeq	Phase_I	38526078	NM_001127671	Q6LCD9	Missense_Mutation	SNP	ENST00000263409.4	37	CCDS3927.1	.	.	.	.	.	.	.	.	.	.	C	19.95	3.920870	0.73213	.	.	ENSG00000113594	ENST00000263409;ENST00000453190	T;T	0.52754	0.65;0.65	6.05	6.05	0.98169	Fibronectin, type III (1);	0.390921	0.30285	N	0.009971	T	0.44746	0.1308	L	0.56769	1.78	0.28933	N	0.891453	D	0.54207	0.965	P	0.45071	0.468	T	0.52902	-0.8513	10	0.34782	T	0.22	-20.2531	7.9601	0.30066	0.0:0.8154:0.0:0.1846	.	713	P42702	LIFR_HUMAN	L	713	ENSP00000263409:R713L;ENSP00000398368:R713L	ENSP00000263409:R713L	R	-	2	0	LIFR	38526078	0.111000	0.22076	0.632000	0.29296	0.935000	0.57460	1.910000	0.39927	2.878000	0.98634	0.650000	0.86243	CGC		LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253823.1	NM_002310	
PCDHB8	56128	broad.mit.edu	37	5	140559748	140559748	+	Silent	SNP	G	G	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr5:140559748G>A	ENST00000239444.2	+	1	2378	c.2133G>A	c.(2131-2133)gcG>gcA	p.A711A	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	711					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A711A(1)		NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGTTCGTGGCGGTGCTGCTGT	0.677																																					p.A711A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2133A	5						.						93.0	95.0	95.0					5																	140559748		2202	4299	6501	140539932	SO:0001819	synonymous_variant	56128	exon1			AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.2133G>A	5.37:g.140559748G>A		Somatic		Capture	Illumina HiSeq	Phase_I	140539932	NM_019120	B9EGV1	Silent	SNP	ENST00000239444.2	37	CCDS4250.1																																																																																				PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2	NM_019120	
HIST1H3D	8351	broad.mit.edu	37	6	26197369	26197369	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr6:26197369T>A	ENST00000356476.2	-	1	109	c.110A>T	c.(109-111)aAg>aTg	p.K37M	HIST1H3D_ENST00000377831.5_Missense_Mutation_p.K37M|HIST1H2BF_ENST00000359985.1_5'Flank			P68431	H31_HUMAN	histone cluster 1, H3d	37					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)	p.K37M(1)		NS(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)	14		all_hematologic(11;0.196)				GTGGGGCTTCTTCACGCCGCC	0.652																																					p.K37M	GBM(108;3816 4467)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A110T	6						.						44.0	49.0	48.0					6																	26197369		2203	4298	6501	26305348	SO:0001583	missense	8351	exon2			Z80784	CCDS4590.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197409	ENSG00000197409		"""Histones / Replication-dependent"""	4767	protein-coding gene	gene with protein product		602811	"""H3 histone family, member B"", ""histone 1, H3d"""	H3FB		9119399, 12408966	Standard	NM_003530		Approved	H3/b	uc003ngv.4	P68431	OTTHUMG00000014433	ENST00000356476.2:c.110A>T	6.37:g.26197369T>A	ENSP00000366999:p.Lys37Met	Somatic		Capture	Illumina HiSeq	Phase_I	26305348	NM_003530	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000356476.2	37	CCDS4590.1	.	.	.	.	.	.	.	.	.	.	.	15.18	2.755542	0.49362	.	.	ENSG00000197409	ENST00000356476;ENST00000377831	T;T	0.56776	0.44;0.44	4.14	2.96	0.34315	.	.	.	.	.	T	0.45657	0.1353	.	.	.	0.35625	D	0.809751	.	.	.	.	.	.	T	0.50346	-0.8839	6	0.87932	D	0	.	8.6974	0.34305	0.0:0.0929:0.0:0.9071	.	.	.	.	M	37	ENSP00000366999:K37M;ENSP00000367062:K37M	ENSP00000366999:K37M	K	-	2	0	HIST1H3D	26305348	1.000000	0.71417	1.000000	0.80357	0.753000	0.42808	5.801000	0.69115	0.565000	0.29255	0.533000	0.62120	AAG		HIST1H3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040096.1	NM_003530	
MOG	4340	broad.mit.edu	37	6	29633972	29633972	+	Silent	SNP	G	G	A	rs148630553	byFrequency	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	SOLID			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr6:29633972G>A	ENST00000376917.3	+	3	709	c.480G>A	c.(478-480)gcG>gcA	p.A160A	MOG_ENST00000396704.3_Silent_p.A160A|MOG_ENST00000431798.2_Silent_p.A160A|MOG_ENST00000376898.3_Silent_p.A160A|MOG_ENST00000533330.2_3'UTR|MOG_ENST00000376888.2_Silent_p.A44A|MOG_ENST00000376894.4_Silent_p.A160A|MOG_ENST00000483013.1_Silent_p.A44A|MOG_ENST00000376902.3_3'UTR|MOG_ENST00000494692.1_Silent_p.A160A|MOG_ENST00000396701.2_Silent_p.A160A|MOG_ENST00000416766.2_Intron|MOG_ENST00000376891.4_Silent_p.A160A|MOG_ENST00000490427.1_Silent_p.A44A	NM_002433.4|NM_206809.3	NP_002424.3|NP_996532.2	Q16653	MOG_HUMAN	myelin oligodendrocyte glycoprotein	160					cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|positive regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034126)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A160A(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|skin(2)	19						TTCTCCTCGCGGTGCTGCCTG	0.557																																					p.A160A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G480A	6						.						297.0	250.0	267.0					6																	29633972		1511	2709	4220	29741951	SO:0001819	synonymous_variant	4340	exon3				CCDS4667.1, CCDS34366.1, CCDS34367.1, CCDS34368.1, CCDS34369.1, CCDS34370.1, CCDS47394.1, CCDS47395.1, CCDS47395.2, CCDS54977.1	6p22.1	2014-01-16			ENSG00000204655	ENSG00000204655		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	7197	protein-coding gene	gene with protein product		159465					Standard	NM_002433		Approved	BTN6, BTNL11	uc003nne.3	Q16653	OTTHUMG00000031099	ENST00000376917.3:c.480G>A	6.37:g.29633972G>A		Somatic		Capture	Illumina HiSeq	Phase_I	29741951	NM_001008229	A6NDR4|A6NNJ9|A8MY31|B0UZR9|E9PGF0|F8W9D5|O00713|O00714|O00715|Q13054|Q13055|Q14855|Q29ZN8|Q56UY0|Q5JNX7|Q5JNY1|Q5JNY2|Q5JNY4|Q5SSB5|Q5SSB6|Q5STL9|Q5STM0|Q5STM1|Q5STM2|Q5STM5|Q5SUK5|Q5SUK7|Q5SUK8|Q5SUK9|Q5SUL0|Q5SUL1|Q8IYG5|Q92891|Q92892|Q92893|Q92894|Q92895|Q93053|Q96KU9|Q96KV0|Q96KV1|Q99605	Silent	SNP	ENST00000376917.3	37	CCDS34370.1																																																																																				MOG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076160.3	NM_002433	
SCAF8	22828	broad.mit.edu	37	6	155154100	155154100	+	Silent	SNP	A	A	G			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	SOLID			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr6:155154100A>G	ENST00000367178.3	+	20	3963	c.3387A>G	c.(3385-3387)cgA>cgG	p.R1129R	SCAF8_ENST00000417268.1_Silent_p.R1129R|SCAF8_ENST00000367186.4_Silent_p.R1195R|TIAM2_ENST00000461783.3_5'UTR	NM_014892.3	NP_055707.3	Q9UPN6	SCAF8_HUMAN	SR-related CTD-associated factor 8	1129	Arg-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase core enzyme binding (GO:0043175)	p.R1129R(1)		breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(15)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	46						GAAACTATCGATTTGATCCTA	0.473																																					p.R1129R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A3387G	6						.						82.0	90.0	88.0					6																	155154100		2203	4300	6503	155195792	SO:0001819	synonymous_variant	22828	exon20			AB029039	CCDS5247.1, CCDS69226.1, CCDS75541.1	6q25.1-q25.3	2013-02-12	2011-01-10	2011-01-10	ENSG00000213079	ENSG00000213079		"""RNA binding motif (RRM) containing"""	20959	protein-coding gene	gene with protein product			"""RNA binding motif protein 16"""	RBM16		10470851	Standard	NM_001286189		Approved	KIAA1116	uc003qpz.3	Q9UPN6	OTTHUMG00000015877	ENST00000367178.3:c.3387A>G	6.37:g.155154100A>G		Somatic		Capture	Illumina HiSeq	Phase_I	155195792	NM_014892	B7Z888|Q5TBU6|Q6NSK3|Q9BQN8|Q9BX43	Silent	SNP	ENST00000367178.3	37	CCDS5247.1																																																																																				SCAF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042798.1	NM_014892	
KCND2	3751	broad.mit.edu	37	7	120385934	120385934	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr7:120385934A>T	ENST00000331113.4	+	5	2533	c.1568A>T	c.(1567-1569)cAa>cTa	p.Q523L	RP4-797C5.2_ENST00000450480.1_RNA	NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	523					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.Q523L(1)		NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	TCTTCACAACAAGGAGTCACC	0.438																																					p.Q523L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1568T	7						.						146.0	122.0	130.0					7																	120385934		2203	4300	6503	120173170	SO:0001583	missense	3751	exon5			AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.1568A>T	7.37:g.120385934A>T	ENSP00000333496:p.Gln523Leu	Somatic		Capture	Illumina HiSeq	Phase_I	120173170	NM_012281	O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Missense_Mutation	SNP	ENST00000331113.4	37	CCDS5776.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.83|14.83	2.652305|2.652305	0.47362|0.47362	.|.	.|.	ENSG00000184408|ENSG00000184408	ENST00000425288|ENST00000331113	.|D	.|0.82803	.|-1.65	5.63|5.63	4.45|4.45	0.53987|0.53987	.|Potassium channel, voltage dependent, Kv4, C-terminal (1);	.|0.137306	.|0.51477	.|D	.|0.000098	.|T	.|0.76513	.|0.3998	L|L	0.38175|0.38175	1.15|1.15	0.41315|0.41315	D|D	0.987132|0.987132	.|B	.|0.17268	.|0.021	.|B	.|0.29524	.|0.103	.|T	.|0.68228	.|-0.5464	.|9	.|.	.|.	.|.	.|.	12.7549|12.7549	0.57328|0.57328	0.8628:0.1371:0.0:0.0|0.8628:0.1371:0.0:0.0	.|.	.|523	.|Q9NZV8	.|KCND2_HUMAN	X|L	109|523	.|ENSP00000333496:Q523L	.|.	K|Q	+|+	1|2	0|0	KCND2|KCND2	120173170|120173170	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	3.736000|3.736000	0.55052|0.55052	0.934000|0.934000	0.37316|0.37316	0.533000|0.533000	0.62120|0.62120	AAG|CAA		KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346996.1	NM_012281	
RBAK-RBAKDN	100533952	broad.mit.edu	37	7	5112573	5112573	+	Silent	SNP	G	G	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr7:5112573G>A	ENST00000407184.1	+	8	722	c.456G>A	c.(454-456)acG>acA	p.T152T	RBAK-RBAKDN_ENST00000396904.2_3'UTR|RBAKDN_ENST00000498308.1_lincRNA					RBAK-RBAKDN readthrough																		TGGCGGAGACGGAGAGCTGCG	0.657																																					.												.	.	0			.	7						.						32.0	44.0	40.0					7																	5112573		2202	4299	6501	5079099	SO:0001819	synonymous_variant	389458	.				CCDS56463.1	7p22.1	2013-05-20				ENSG00000272968			42971	other	readthrough							Standard	NM_001204513		Approved				OTTHUMG00000186010	ENST00000407184.1:c.456G>A	7.37:g.5112573G>A		Somatic		Capture	Illumina HiSeq	Phase_I	5079099	.		Missense_Mutation	SNP	ENST00000407184.1	37																																																																																					RBAK-RBAKDN-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	protein_coding	OTTHUMT00000472007.1		
HERPUD2	64224	broad.mit.edu	37	7	35674865	35674865	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr7:35674865C>T	ENST00000396081.1	-	6	1625	c.821G>A	c.(820-822)cGa>cAa	p.R274Q	HERPUD2_ENST00000426180.1_5'UTR|HERPUD2_ENST00000311350.3_Missense_Mutation_p.R274Q	NM_022373.4	NP_071768.3	Q9BSE4	HERP2_HUMAN	HERPUD family member 2	274					response to unfolded protein (GO:0006986)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.R274Q(1)		kidney(3)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)	18						TAGCCAGTCTCGATTGAAGTC	0.433																																					p.R274Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G821A	7						.						205.0	194.0	198.0					7																	35674865		2203	4300	6503	35641390	SO:0001583	missense	64224	exon7			BC020264	CCDS5446.1	7p14.2	2006-03-20	2006-03-20		ENSG00000122557	ENSG00000122557			21915	protein-coding gene	gene with protein product	"""homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 2"""						Standard	NM_022373		Approved	FLJ22313	uc003tes.4	Q9BSE4	OTTHUMG00000128687	ENST00000396081.1:c.821G>A	7.37:g.35674865C>T	ENSP00000379390:p.Arg274Gln	Somatic		Capture	Illumina HiSeq	Phase_I	35641390	NM_022373	A4D1Y8|Q9H6F9	Missense_Mutation	SNP	ENST00000396081.1	37	CCDS5446.1	.	.	.	.	.	.	.	.	.	.	C	37	6.065724	0.97251	.	.	ENSG00000122557	ENST00000396081;ENST00000311350	T;T	0.20069	2.1;2.1	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.47728	0.1461	L	0.61036	1.89	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.22730	-1.0208	10	0.54805	T	0.06	-19.5002	20.422	0.99049	0.0:1.0:0.0:0.0	.	274	Q9BSE4	HERP2_HUMAN	Q	274	ENSP00000379390:R274Q;ENSP00000310729:R274Q	ENSP00000310729:R274Q	R	-	2	0	HERPUD2	35641390	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.072000	0.71238	2.832000	0.97577	0.655000	0.94253	CGA		HERPUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250584.1	NM_022373	
ABCA13	154664	broad.mit.edu	37	7	48427433	48427433	+	Missense_Mutation	SNP	C	C	T	rs373647440		TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr7:48427433C>T	ENST00000435803.1	+	36	11374	c.11350C>T	c.(11350-11352)Cgg>Tgg	p.R3784W		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3784					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.R3784W(1)|p.R3729W(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						ATTTGGTTTACGGAAACCATG	0.294																																					p.Y3729Y												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C11187T	7						.	C	TRP/ARG	0,3586		0,0,1793	97.0	86.0	89.0		11350	-3.4	0.0	7		89	1,8125		0,1,4062	no	missense	ABCA13	NM_152701.3	101	0,1,5855	TT,TC,CC		0.0123,0.0,0.0085	probably-damaging	3784/5059	48427433	1,11711	1793	4063	5856	48397979	SO:0001583	missense	154664	exon34			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.11350C>T	7.37:g.48427433C>T	ENSP00000411096:p.Arg3784Trp	Somatic		Capture	Illumina HiSeq	Phase_I	48397979	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	C	13.96	2.392525	0.42410	0.0	1.23E-4	ENSG00000179869	ENST00000435803	D	0.86297	-2.1	5.36	-3.39	0.04868	.	0.601905	0.15681	N	0.249939	D	0.87787	0.6265	M	0.69523	2.12	0.09310	N	1	D;D	0.76494	0.998;0.999	P;P	0.62298	0.9;0.849	T	0.78081	-0.2343	10	0.52906	T	0.07	.	2.4468	0.04508	0.3302:0.4:0.1493:0.1204	.	1486;3784	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	W	3784	ENSP00000411096:R3784W	ENSP00000411096:R3784W	R	+	1	2	ABCA13	48397979	0.127000	0.22367	0.003000	0.11579	0.008000	0.06430	0.419000	0.21247	-0.786000	0.04516	-2.245000	0.00285	CGG		ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
SLC25A13	10165	broad.mit.edu	37	7	95820475	95820475	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr7:95820475T>C	ENST00000265631.5	-	7	836	c.700A>G	c.(700-702)Aga>Gga	p.R234G	SLC25A13_ENST00000542654.1_Missense_Mutation_p.R126G|SLC25A13_ENST00000416240.2_Missense_Mutation_p.R234G			Q9UJS0	CMC2_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 13	234					aspartate transport (GO:0015810)|ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular respiration (GO:0045333)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|transporter activity (GO:0005215)	p.R234G(1)		breast(4)|central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|prostate(1)|skin(4)	42	all_cancers(62;7.75e-08)|all_epithelial(64;1.16e-07)		STAD - Stomach adenocarcinoma(171;0.194)		L-Aspartic Acid(DB00128)	TAGATCTTTCTAATGAGTTCC	0.393																																					p.R234G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A700G	7						.						178.0	177.0	177.0					7																	95820475		2203	4300	6503	95658411	SO:0001583	missense	10165	exon7			AF118838	CCDS5645.1, CCDS55130.1	7q21.3	2013-05-22	2012-03-29		ENSG00000004864	ENSG00000004864		"""Solute carriers"", ""EF-hand domain containing"""	10983	protein-coding gene	gene with protein product	"""mitochondrial aspartate glutamate carrier 2"""	603859	"""solute carrier family 25, member 13 (citrin)"""	CTLN2		10369257	Standard	NM_014251		Approved	CITRIN, ARALAR2	uc003uog.4	Q9UJS0	OTTHUMG00000023074	ENST00000265631.5:c.700A>G	7.37:g.95820475T>C	ENSP00000265631:p.Arg234Gly	Somatic		Capture	Illumina HiSeq	Phase_I	95658411	NM_014251	O14566|O14575|Q546F9|Q9NZW1|Q9UNI7	Missense_Mutation	SNP	ENST00000265631.5	37	CCDS5645.1	.	.	.	.	.	.	.	.	.	.	T	13.80	2.345787	0.41599	.	.	ENSG00000004864	ENST00000265631;ENST00000416240;ENST00000542654	T;T;T	0.81247	-1.47;-1.47;-1.47	5.18	5.18	0.71444	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.79493	0.4455	M	0.63428	1.95	0.52501	D	0.999959	P;P;P	0.39940	0.696;0.57;0.57	B;B;B	0.40602	0.333;0.334;0.334	T	0.78991	-0.1985	10	0.33940	T	0.23	-22.589	15.5118	0.75789	0.0:0.0:0.0:1.0	.	126;234;234	F5GX33;Q546F9;Q9UJS0	.;.;CMC2_HUMAN	G	234;234;126	ENSP00000265631:R234G;ENSP00000400101:R234G;ENSP00000440484:R126G	ENSP00000265631:R234G	R	-	1	2	SLC25A13	95658411	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.677000	0.46892	2.313000	0.78055	0.455000	0.32223	AGA		SLC25A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059395.2	NM_014251	
LMTK2	22853	broad.mit.edu	37	7	97823749	97823749	+	Silent	SNP	C	C	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr7:97823749C>T	ENST00000297293.5	+	11	4265	c.3972C>T	c.(3970-3972)aaC>aaT	p.N1324N		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	1324					early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)	p.N1324N(2)		NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					TCCTCAGCAACGAGGACGGAA	0.637																																					p.N1324N												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C3972T	7						.						105.0	101.0	102.0					7																	97823749		2203	4300	6503	97661685	SO:0001819	synonymous_variant	22853	exon11			AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.3972C>T	7.37:g.97823749C>T		Somatic		Capture	Illumina HiSeq	Phase_I	97661685	NM_014916	A4D272|Q75MG7|Q9UPS3	Silent	SNP	ENST00000297293.5	37	CCDS5654.1																																																																																				LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334560.1	NM_014916	
ARPC1B	10095	broad.mit.edu	37	7	98985759	98985759	+	Silent	SNP	G	G	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr7:98985759G>A	ENST00000451682.1	+	6	576	c.267G>A	c.(265-267)acG>acA	p.T89T	ARPC1B_ENST00000474880.1_3'UTR|ARPC1B_ENST00000252725.5_Silent_p.T89T|ARPC1A_ENST00000432884.2_3'UTR			O15143	ARC1B_HUMAN	actin related protein 2/3 complex, subunit 1B, 41kDa	89					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	structural constituent of cytoskeleton (GO:0005200)	p.T89T(2)		central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(2)|lung(1)	11	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			GGAAGCCCACGCTGGTCATCC	0.642																																					p.T89T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G267A	7						.						63.0	60.0	61.0					7																	98985759		2203	4300	6503	98823695	SO:0001819	synonymous_variant	10095	exon4			AF006084	CCDS5661.1	7q22.1	2013-03-14	2002-08-29		ENSG00000130429	ENSG00000130429		"""Actin related protein 2/3 complex subunits"", ""WD repeat domain containing"""	704	protein-coding gene	gene with protein product	"""ARP2/3 protein complex subunit p41"", ""actin related protein 2/3 complex, subunit 1A (41 kD)"""	604223	"""actin related protein 2/3 complex, subunit 1B (41 kD)"""			9230079, 9359840	Standard	NM_005720		Approved	ARC41, p40-ARC, p41-ARC	uc003upz.3	O15143	OTTHUMG00000154552	ENST00000451682.1:c.267G>A	7.37:g.98985759G>A		Somatic		Capture	Illumina HiSeq	Phase_I	98823695	NM_005720	Q9BU00	Silent	SNP	ENST00000451682.1	37	CCDS5661.1																																																																																				ARPC1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335894.1	NM_005720	
RBM33	155435	broad.mit.edu	37	7	155503909	155503909	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr7:155503909C>T	ENST00000401878.3	+	8	1159	c.961C>T	c.(961-963)Cct>Tct	p.P321S	RBM33_ENST00000486747.1_3'UTR	NM_053043.2	NP_444271.2	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33	321	Pro-rich.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.P321S(2)		breast(3)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	27	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		CCAGGCTCCCCCTCCACCGCC	0.547																																					p.P321S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C961T	7						.						12.0	15.0	14.0					7																	155503909		1913	4118	6031	155196670	SO:0001583	missense	155435	exon8			AL832196	CCDS5941.2	7q36.3	2013-02-12			ENSG00000184863	ENSG00000184863		"""RNA binding motif (RRM) containing"""	27223	protein-coding gene	gene with protein product			"""proline rich 8"""	PRR8			Standard	NM_053043		Approved	DKFZp686F102, MGC20460, DKFZp434D1319	uc010lqk.1	Q96EV2	OTTHUMG00000150260	ENST00000401878.3:c.961C>T	7.37:g.155503909C>T	ENSP00000384160:p.Pro321Ser	Somatic		Capture	Illumina HiSeq	Phase_I	155196670	NM_053043	A4D244|B5MC24|Q52LF5|Q75LN9|Q75ML5|Q9NSV0	Missense_Mutation	SNP	ENST00000401878.3	37	CCDS5941.2	.	.	.	.	.	.	.	.	.	.	C	6.800	0.516673	0.12944	.	.	ENSG00000184863	ENST00000401878;ENST00000440108	T	0.44482	0.92	4.64	4.64	0.57946	.	.	.	.	.	T	0.42245	0.1194	L	0.51422	1.61	0.80722	D	1	B;B	0.31174	0.311;0.311	B;B	0.39562	0.303;0.303	T	0.24548	-1.0157	9	0.23891	T	0.37	.	12.9926	0.58627	0.0:1.0:0.0:0.0	.	38;321	B4DVQ2;Q96EV2	.;RBM33_HUMAN	S	321;222	ENSP00000384160:P321S	ENSP00000384160:P321S	P	+	1	0	RBM33	155196670	0.177000	0.23109	0.045000	0.18777	0.190000	0.23558	2.825000	0.48096	2.144000	0.66660	0.557000	0.71058	CCT		RBM33-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317225.3	NM_001008408	
CSMD3	114788	broad.mit.edu	37	8	113308235	113308235	+	Splice_Site	SNP	G	G	T	rs369949755		TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr8:113308235G>T	ENST00000297405.5	-	54	8685	c.8441C>A	c.(8440-8442)gCg>gAg	p.A2814E	CSMD3_ENST00000343508.3_Splice_Site_p.A2774E|CSMD3_ENST00000352409.3_Splice_Site_p.A2744E|CSMD3_ENST00000455883.2_Splice_Site_p.A2645E	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2814	Sushi 17. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A2814V(1)|p.A2814E(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ACAATGACCCGCTGAAATACG	0.299										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.A2814E												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.C8441A	8						.						57.0	56.0	56.0					8																	113308235		2203	4300	6503	113377411	SO:0001630	splice_region_variant	114788	exon54			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.8441-1C>A	8.37:g.113308235G>T		Somatic		Capture	Illumina HiSeq	Phase_I	113377411	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	19.40	3.820679	0.71028	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.24908	1.83;1.83;1.83;1.83;1.83	5.31	5.31	0.75309	Complement control module (2);Sushi/SCR/CCP (1);	0.000000	0.64402	D	0.000001	T	0.50480	0.1618	M	0.84156	2.68	0.80722	D	1	P;P;D	0.65815	0.937;0.896;0.995	P;P;D	0.65443	0.712;0.669;0.935	T	0.52419	-0.8578	10	0.07325	T	0.83	.	18.9718	0.92718	0.0:0.0:1.0:0.0	.	2645;2814;2774	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	E	2774;2814;2084;2645;2744	ENSP00000345799:A2774E;ENSP00000297405:A2814E;ENSP00000341558:A2084E;ENSP00000412263:A2645E;ENSP00000343124:A2744E	ENSP00000297405:A2814E	A	-	2	0	CSMD3	113377411	1.000000	0.71417	1.000000	0.80357	0.304000	0.27724	6.622000	0.74233	2.480000	0.83734	0.655000	0.94253	GCG		CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	Missense_Mutation
RAD21	5885	broad.mit.edu	37	8	117866561	117866561	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr8:117866561T>A	ENST00000297338.2	-	9	1371	c.1084A>T	c.(1084-1086)Atg>Ttg	p.M362L	RAD21_ENST00000518055.1_5'Flank|RAD21_ENST00000523547.1_5'Flank|RAD21_ENST00000523986.1_5'Flank	NM_006265.2	NP_006256.1	O60216	RAD21_HUMAN	RAD21 homolog (S. pombe)	362	Interaction with STAG1.|Interaction with WAPAL and PDS5B.				apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|protein localization to chromatin (GO:0071168)|reciprocal meiotic recombination (GO:0007131)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.M362L(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|stomach(1)	32	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)					TCTTTCCACATCATCAATTTC	0.383																																					p.M362L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1084T	8						.						113.0	113.0	113.0					8																	117866561		2203	4300	6503	117935742	SO:0001583	missense	5885	exon9			BC050381	CCDS6321.1	8q24.11	2014-09-17	2001-11-28		ENSG00000164754	ENSG00000164754			9811	protein-coding gene	gene with protein product	"""sister chromatid cohesion 1"""	606462	"""RAD21 (S. pombe) homolog"""			8812457	Standard	NM_006265		Approved	KIAA0078, hHR21, SCC1	uc003yod.3	O60216	OTTHUMG00000164959	ENST00000297338.2:c.1084A>T	8.37:g.117866561T>A	ENSP00000297338:p.Met362Leu	Somatic		Capture	Illumina HiSeq	Phase_I	117935742	NM_006265	A8K0E0|Q15001|Q99568	Missense_Mutation	SNP	ENST00000297338.2	37	CCDS6321.1	.	.	.	.	.	.	.	.	.	.	T	9.386	1.074311	0.20227	.	.	ENSG00000164754	ENST00000297338	T	0.74209	-0.82	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.78972	0.4368	M	0.66939	2.045	0.80722	D	1	P	0.35745	0.518	P	0.47827	0.558	T	0.74038	-0.3793	10	0.11182	T	0.66	-1.4875	15.8526	0.78943	0.0:0.0:0.0:1.0	.	362	O60216	RAD21_HUMAN	L	362	ENSP00000297338:M362L	ENSP00000297338:M362L	M	-	1	0	RAD21	117935742	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	8.040000	0.89188	2.156000	0.67533	0.377000	0.23210	ATG		RAD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381184.1	NM_006265	
EXT1	2131	broad.mit.edu	37	8	118842542	118842542	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr8:118842542A>G	ENST00000378204.2	-	4	2017	c.1211T>C	c.(1210-1212)cTt>cCt	p.L404P		NM_000127.2	NP_000118.2	Q16394	EXT1_HUMAN	exostosin glycosyltransferase 1	404					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular polysaccharide biosynthetic process (GO:0033692)|embryonic skeletal joint development (GO:0072498)|endoderm development (GO:0007492)|gastrulation (GO:0007369)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm development (GO:0007498)|olfactory bulb development (GO:0021772)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transferase activity, transferring glycosyl groups (GO:0016757)	p.L404P(1)		breast(1)|endometrium(7)|kidney(1)|large_intestine(12)|lung(10)|ovary(3)|prostate(1)|stomach(1)|urinary_tract(2)	38	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			CTGCTGTCTAAGTGCTAGGAT	0.388			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Langer-Giedion syndrome;Hereditary Multiple Exostoses																												p.L404P		yes	Rec		Multiple Exostoses Type 1	8	8q24.11-q24.13	2131	multiple exostoses type 1 gene		M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1211C	8						.						93.0	92.0	92.0					8																	118842542		2203	4300	6503	118911723	SO:0001583	missense	2131	exon4	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II;HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses	S79639	CCDS6324.1	8q24.11	2014-09-17	2013-03-01		ENSG00000182197	ENSG00000182197	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3512	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608177	"""Langer-Giedion syndrome chromosome region"", ""exostoses (multiple) 1"", ""exostosin 1"""	LGCR, LGS			Standard	NM_000127		Approved	ttv	uc003yok.1	Q16394	OTTHUMG00000059718	ENST00000378204.2:c.1211T>C	8.37:g.118842542A>G	ENSP00000367446:p.Leu404Pro	Somatic		Capture	Illumina HiSeq	Phase_I	118911723	NM_000127	B2R7V2|Q9BVI9	Missense_Mutation	SNP	ENST00000378204.2	37	CCDS6324.1	.	.	.	.	.	.	.	.	.	.	a	28.8	4.953446	0.92660	.	.	ENSG00000182197	ENST00000378204	D	0.96992	-4.2	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	D	0.97977	0.9334	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	D	0.98737	1.0715	10	0.87932	D	0	-12.9545	16.8061	0.85666	1.0:0.0:0.0:0.0	.	404	Q16394	EXT1_HUMAN	P	404	ENSP00000367446:L404P	ENSP00000367446:L404P	L	-	2	0	EXT1	118911723	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.335000	0.96500	2.367000	0.80283	0.528000	0.53228	CTT		EXT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132768.3	NM_000127	
PRKDC	5591	broad.mit.edu	37	8	48840396	48840396	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr8:48840396A>C	ENST00000314191.2	-	20	2250	c.2194T>G	c.(2194-2196)Ttt>Gtt	p.F732V	PRKDC_ENST00000338368.3_Missense_Mutation_p.F732V|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	732					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)	p.F732V(2)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	GACAGAAGAAAGGTCAAACAA	0.423								Non-homologous end-joining																													p.F732V	Esophageal Squamous(79;1091 1253 12329 31680 40677)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T2194G	8						.						141.0	148.0	146.0					8																	48840396		1989	4159	6148	49002949	SO:0001583	missense	5591	exon20				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.2194T>G	8.37:g.48840396A>C	ENSP00000313420:p.Phe732Val	Somatic		Capture	Illumina HiSeq	Phase_I	49002949	NM_001081640	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	ENST00000314191.2	37		.	.	.	.	.	.	.	.	.	.	A	27.6	4.843556	0.91197	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.68331	4.16;-0.32	5.35	5.35	0.76521	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.81254	0.4784	.	.	.	0.80722	D	1	D;D;D	0.71674	0.997;0.998;0.985	D;D;P	0.67103	0.949;0.948;0.783	D	0.84113	0.0402	9	0.87932	D	0	.	15.6202	0.76799	1.0:0.0:0.0:0.0	.	732;732;732	P78527-2;E7EUY0;P78527	.;.;PRKDC_HUMAN	V	732	ENSP00000313420:F732V;ENSP00000345182:F732V	ENSP00000313420:F732V	F	-	1	0	PRKDC	49002949	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	8.655000	0.91098	2.145000	0.66743	0.460000	0.39030	TTT		PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640	
MATN2	4147	broad.mit.edu	37	8	99028888	99028888	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr8:99028888G>A	ENST00000520016.1	+	10	1818	c.1694G>A	c.(1693-1695)aGa>aAa	p.R565K	MATN2_ENST00000524308.1_Missense_Mutation_p.R524K|MATN2_ENST00000254898.5_Missense_Mutation_p.R565K|MATN2_ENST00000522025.2_Missense_Mutation_p.R281K|MATN2_ENST00000521689.1_Missense_Mutation_p.R565K			O00339	MATN2_HUMAN	matrilin 2	565	EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)	p.R565K(2)		breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(2)|urinary_tract(1)	31	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			AAAACCTGCAGAAGTAAGTTT	0.443																																					p.R565K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1694A	8						.						73.0	71.0	71.0					8																	99028888		1901	4117	6018	99098064	SO:0001583	missense	4147	exon11			U69263	CCDS55264.1, CCDS55265.1	8q22.1-q22.2	2008-05-15							6908	protein-coding gene	gene with protein product		602108				9083061, 11852232	Standard	XM_005250920		Approved		uc003yic.3	O00339		ENST00000520016.1:c.1694G>A	8.37:g.99028888G>A	ENSP00000430487:p.Arg565Lys	Somatic		Capture	Illumina HiSeq	Phase_I	99098064	NM_030583	A8K106|E7EW74|E9PD48|E9PGL2|Q6UWA5|Q7Z5X1|Q8NDE6|Q96FT5|Q9NSZ1	Missense_Mutation	SNP	ENST00000520016.1	37	CCDS55264.1	.	.	.	.	.	.	.	.	.	.	G	13.99	2.401497	0.42613	.	.	ENSG00000132561	ENST00000521689;ENST00000254898;ENST00000378716;ENST00000524308;ENST00000522025;ENST00000520016	D;D;D;D;D	0.97279	-2.2;-2.2;-4.32;-4.32;-2.2	5.68	1.9	0.25705	Epidermal growth factor-like (1);	0.357941	0.27388	N	0.019586	D	0.91533	0.7326	N	0.20685	0.6	0.35795	D	0.822685	B;B;B;B	0.11235	0.001;0.001;0.004;0.001	B;B;B;B	0.12837	0.002;0.002;0.007;0.008	D	0.86073	0.1539	10	0.32370	T	0.25	-11.6303	8.2239	0.31558	0.3965:0.0:0.6035:0.0	.	524;565;565;565	C9JH87;E9PF03;O00339-2;O00339	.;.;.;MATN2_HUMAN	K	565;565;524;524;281;565	ENSP00000429977:R565K;ENSP00000254898:R565K;ENSP00000430221:R524K;ENSP00000429010:R281K;ENSP00000430487:R565K	ENSP00000254898:R565K	R	+	2	0	MATN2	99098064	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	0.772000	0.26647	0.347000	0.23924	0.563000	0.77884	AGA		MATN2-004	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380332.1		
CYP11B1	1584	broad.mit.edu	37	8	143957761	143957761	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr8:143957761G>A	ENST00000292427.4	-	5	882	c.850C>T	c.(850-852)Caa>Taa	p.Q284*	CYP11B1_ENST00000377675.3_Nonsense_Mutation_p.Q355*|CYP11B1_ENST00000517471.1_Nonsense_Mutation_p.Q284*	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	284					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)	p.Q284*(1)		central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	GTGTACTGTTGAGGGCGGCTG	0.572									Familial Hyperaldosteronism type I																												p.Q284X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C850T	8						.						116.0	97.0	103.0					8																	143957761		2203	4300	6503	143954763	SO:0001587	stop_gained	1584	exon5	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.850C>T	8.37:g.143957761G>A	ENSP00000292427:p.Gln284*	Somatic		Capture	Illumina HiSeq	Phase_I	143954763	NM_001026213	Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Nonsense_Mutation	SNP	ENST00000292427.4	37	CCDS6392.1	.	.	.	.	.	.	.	.	.	.	.	16.64	3.178836	0.57692	.	.	ENSG00000160882	ENST00000292427;ENST00000517471;ENST00000377675	.	.	.	4.1	-1.72	0.08107	.	2.112300	0.02205	N	0.062592	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	.	0.8811	0.01234	0.1777:0.2647:0.2825:0.2751	.	.	.	.	X	284;284;355	.	ENSP00000292427:Q284X	Q	-	1	0	CYP11B1	143954763	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.016000	0.13377	-0.715000	0.04968	-0.913000	0.02753	CAA		CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2		
ZNF483	158399	broad.mit.edu	37	9	114304173	114304173	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr9:114304173C>T	ENST00000309235.5	+	6	1116	c.958C>T	c.(958-960)Cat>Tat	p.H320Y	ZNF483_ENST00000358151.4_Intron	NM_133464.2	NP_597721.2	Q8TF39	ZN483_HUMAN	zinc finger protein 483	320					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H320Y(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(11)|ovary(1)|skin(5)	31						CTTAATTAAACATCTGAGAGT	0.388																																					p.H320Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C958T	9						.						102.0	115.0	111.0					9																	114304173		2203	4300	6503	113343994	SO:0001583	missense	158399	exon6			AB075842	CCDS35105.1, CCDS35106.1	9q32	2013-01-09			ENSG00000173258	ENSG00000173258		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23384	protein-coding gene	gene with protein product							Standard	NM_001007169		Approved	ZKSCAN16, KIAA1962, ZSCAN48	uc004bff.2	Q8TF39	OTTHUMG00000020490	ENST00000309235.5:c.958C>T	9.37:g.114304173C>T	ENSP00000311679:p.His320Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	113343994	NM_133464	Q5VZN2|Q8NAE1	Missense_Mutation	SNP	ENST00000309235.5	37	CCDS35106.1	.	.	.	.	.	.	.	.	.	.	C	13.53	2.265743	0.40095	.	.	ENSG00000173258	ENST00000309235	T	0.04758	3.56	4.33	1.51	0.23008	.	0.133398	0.34628	N	0.003803	T	0.08758	0.0217	M	0.86028	2.79	0.80722	D	1	B	0.15930	0.015	B	0.15052	0.012	T	0.04065	-1.0980	10	0.59425	D	0.04	-9.1043	7.999	0.30286	0.0:0.7218:0.0:0.2782	.	320	Q8TF39	ZN483_HUMAN	Y	320	ENSP00000311679:H320Y	ENSP00000311679:H320Y	H	+	1	0	ZNF483	113343994	0.808000	0.29022	0.867000	0.34043	0.387000	0.30353	2.434000	0.44802	0.365000	0.24400	-0.136000	0.14681	CAT		ZNF483-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053641.1	XM_088567	
ZNF483	158399	broad.mit.edu	37	9	114304373	114304373	+	Silent	SNP	G	G	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr9:114304373G>A	ENST00000309235.5	+	6	1316	c.1158G>A	c.(1156-1158)ggG>ggA	p.G386G	ZNF483_ENST00000358151.4_Intron	NM_133464.2	NP_597721.2	Q8TF39	ZN483_HUMAN	zinc finger protein 483	386					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G386G(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(11)|ovary(1)|skin(5)	31						TTCATTTGGGGGATAGGTCCC	0.418																																					p.G386G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1158A	9						.						83.0	92.0	89.0					9																	114304373		2203	4300	6503	113344194	SO:0001819	synonymous_variant	158399	exon6			AB075842	CCDS35105.1, CCDS35106.1	9q32	2013-01-09			ENSG00000173258	ENSG00000173258		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23384	protein-coding gene	gene with protein product							Standard	NM_001007169		Approved	ZKSCAN16, KIAA1962, ZSCAN48	uc004bff.2	Q8TF39	OTTHUMG00000020490	ENST00000309235.5:c.1158G>A	9.37:g.114304373G>A		Somatic		Capture	Illumina HiSeq	Phase_I	113344194	NM_133464	Q5VZN2|Q8NAE1	Silent	SNP	ENST00000309235.5	37	CCDS35106.1																																																																																				ZNF483-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053641.1	XM_088567	
FREM1	158326	broad.mit.edu	37	9	14868886	14868886	+	Silent	SNP	G	G	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr9:14868886G>A	ENST00000380880.3	-	2	873	c.90C>T	c.(88-90)cgC>cgT	p.R30R	FREM1_ENST00000380881.4_Silent_p.R30R|FREM1_ENST00000422223.2_Silent_p.R30R			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	30					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)	p.R30R(1)		breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		CCCTCACCCCGCGGTTGATGC	0.582																																					p.R30R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C90T	9						.						29.0	32.0	31.0					9																	14868886		1998	4172	6170	14858886	SO:0001819	synonymous_variant	158326	exon3			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.90C>T	9.37:g.14868886G>A		Somatic		Capture	Illumina HiSeq	Phase_I	14858886	NM_144966	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Silent	SNP	ENST00000380880.3	37	CCDS47952.1																																																																																				FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966	
OR1K1	392392	broad.mit.edu	37	9	125562783	125562783	+	Missense_Mutation	SNP	C	C	T	rs143894111		TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chr9:125562783C>T	ENST00000277309.2	+	1	414	c.382C>T	c.(382-384)Cgg>Tgg	p.R128W		NM_080859.1	NP_543135.1	Q8NGR3	OR1K1_HUMAN	olfactory receptor, family 1, subfamily K, member 1	128						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R128W(1)		endometrium(1)|large_intestine(8)|lung(2)|ovary(1)|skin(4)|stomach(1)	17						CGTGGCCATCCGGCACCCCCT	0.612													C|||	1	0.000199681	0.0	0.0014	5008	,	,		20798	0.0		0.0	False		,,,				2504	0.0				p.R128W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C382T	9						.	C	TRP/ARG	0,4406		0,0,2203	94.0	67.0	76.0		382	1.6	0.1	9	dbSNP_134	76	3,8597	3.0+/-9.4	0,3,4297	no	missense	OR1K1	NM_080859.1	101	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	probably-damaging	128/317	125562783	3,13003	2203	4300	6503	124602604	SO:0001583	missense	392392	exon1			AL359512	CCDS35132.1	9q33	2013-09-20			ENSG00000165204	ENSG00000165204		"""GPCR / Class A : Olfactory receptors"""	8212	protein-coding gene	gene with protein product							Standard	NM_080859		Approved	hg99, MNAB	uc011lze.2	Q8NGR3	OTTHUMG00000020625	ENST00000277309.2:c.382C>T	9.37:g.125562783C>T	ENSP00000277309:p.Arg128Trp	Somatic		Capture	Illumina HiSeq	Phase_I	124602604	NM_080859	B9EH41|Q4VXB7|Q96R23	Missense_Mutation	SNP	ENST00000277309.2	37	CCDS35132.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	11.49	1.654119	0.29425	0.0	3.49E-4	ENSG00000165204	ENST00000277309	T	0.01455	4.87	4.49	1.64	0.23874	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35585	U	0.003114	T	0.02455	0.0075	N	0.12746	0.255	0.24930	N	0.991924	D	0.76494	0.999	P	0.60286	0.872	T	0.46076	-0.9217	10	0.87932	D	0	.	6.8581	0.24052	0.0:0.5241:0.0:0.4759	.	128	Q8NGR3	OR1K1_HUMAN	W	128	ENSP00000277309:R128W	ENSP00000277309:R128W	R	+	1	2	OR1K1	124602604	0.642000	0.27260	0.080000	0.20451	0.025000	0.11179	0.405000	0.21015	0.162000	0.19483	-0.251000	0.11542	CGG		OR1K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053958.1		
ZC3H12B	340554	broad.mit.edu	37	X	64709236	64709236	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chrX:64709236T>G	ENST00000338957.4	+	1	622	c.555T>G	c.(553-555)gaT>gaG	p.D185E	ZC3H12B_ENST00000423889.3_Missense_Mutation_p.D174E	NM_001010888.3	NP_001010888.3	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	185							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)	p.D35E(1)|p.D121E(1)		breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						ATGAAATAGATAACAGTGACA	0.438																																					p.D185E												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T555G	X						.						67.0	65.0	66.0					X																	64709236		1909	4101	6010	64625961	SO:0001583	missense	340554	exon1			BX647241	CCDS48131.1, CCDS48131.2	Xq12	2012-07-05	2005-06-14	2005-06-14	ENSG00000102053	ENSG00000102053		"""Zinc fingers, CCCH-type domain containing"""	17407	protein-coding gene	gene with protein product	"""MCP induced protein 2"""	300889	"""chromosome X open reading frame 32"""	CXorf32		18178554	Standard	NM_001010888		Approved	MCPIP2	uc010nko.3	Q5HYM0	OTTHUMG00000021719	ENST00000338957.4:c.555T>G	X.37:g.64709236T>G	ENSP00000340839:p.Asp185Glu	Somatic		Capture	Illumina HiSeq	Phase_I	64625961	NM_001010888	B2RTQ3|E9PAJ6|Q5H9C0	Missense_Mutation	SNP	ENST00000338957.4	37	CCDS48131.2	.	.	.	.	.	.	.	.	.	.	T	15.23	2.772088	0.49680	.	.	ENSG00000102053	ENST00000338957;ENST00000423889;ENST00000218172	T;T	0.23552	1.9;1.9	5.05	2.36	0.29203	.	0.092939	0.64402	D	0.000001	T	0.38268	0.1034	L	0.49350	1.555	0.43857	D	0.996453	D	0.76494	0.999	D	0.78314	0.991	T	0.03453	-1.1035	10	0.33940	T	0.23	0.4858	7.9917	0.30244	0.0:0.6437:0.0:0.3563	.	174	Q5HYM0	ZC12B_HUMAN	E	185;174;121	ENSP00000340839:D185E;ENSP00000408077:D174E	ENSP00000218172:D121E	D	+	3	2	ZC3H12B	64625961	0.996000	0.38824	0.997000	0.53966	0.973000	0.67179	0.459000	0.21908	0.183000	0.20059	-0.298000	0.09462	GAT		ZC3H12B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378734.2	XM_293334	
KIAA2022	340533	broad.mit.edu	37	X	73963619	73963619	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chrX:73963619C>A	ENST00000055682.6	-	3	1384	c.773G>T	c.(772-774)tGg>tTg	p.W258L		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	258					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)	p.W258L(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						GAAGTAACCCCAATCCTGATT	0.398																																					p.W258L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G773T	X						.						128.0	118.0	121.0					X																	73963619		2203	4300	6503	73880344	SO:0001583	missense	340533	exon3				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.773G>T	X.37:g.73963619C>A	ENSP00000055682:p.Trp258Leu	Somatic		Capture	Illumina HiSeq	Phase_I	73880344	NM_001008537	A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	ENST00000055682.6	37	CCDS35337.1	.	.	.	.	.	.	.	.	.	.	C	18.66	3.671415	0.67814	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.60424	0.19;0.19	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.73410	0.3583	L	0.50333	1.59	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74680	-0.3584	10	0.87932	D	0	-3.7722	19.3296	0.94280	0.0:1.0:0.0:0.0	.	258	Q5QGS0	K2022_HUMAN	L	258	ENSP00000362567:W258L;ENSP00000055682:W258L	ENSP00000055682:W258L	W	-	2	0	KIAA2022	73880344	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.487000	0.81328	2.517000	0.84864	0.600000	0.82982	TGG		KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537	
POU3F4	5456	broad.mit.edu	37	X	82764140	82764140	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chrX:82764140G>T	ENST00000373200.2	+	1	872	c.808G>T	c.(808-810)Gac>Tac	p.D270Y	RP3-326L13.3_ENST00000607789.1_lincRNA|RP3-326L13.2_ENST00000607095.1_RNA	NM_000307.3	NP_000298	P49335	PO3F4_HUMAN	POU class 3 homeobox 4	270					cochlea morphogenesis (GO:0090103)|forebrain neuron differentiation (GO:0021879)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|sensory perception of sound (GO:0007605)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	AT DNA binding (GO:0003680)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D270Y(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	37						GACCAGCATTGACAAGATCGC	0.577																																					p.D270Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G808T	X						.						47.0	41.0	43.0					X																	82764140		2203	4300	6503	82650796	SO:0001583	missense	5456	exon1			X82324	CCDS14450.1	Xq21.1	2011-06-20	2007-07-13		ENSG00000196767	ENSG00000196767		"""Homeoboxes / POU class"""	9217	protein-coding gene	gene with protein product	"""brain-4"""	300039	"""POU domain class 3, transcription factor 4"""	DFN3		7911044, 7581392	Standard	NM_000307		Approved	BRN4, OTF9, DFNX2	uc004eeg.2	P49335	OTTHUMG00000021919	ENST00000373200.2:c.808G>T	X.37:g.82764140G>T	ENSP00000362296:p.Asp270Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	82650796	NM_000307	B2RC71|Q5H9G9|Q99410	Missense_Mutation	SNP	ENST00000373200.2	37	CCDS14450.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.960594	0.74016	.	.	ENSG00000196767	ENST00000373200	D	0.95656	-3.77	5.07	5.07	0.68467	Homeodomain-related (1);	0.000000	0.85682	D	0.000000	D	0.97704	0.9247	M	0.83012	2.62	0.80722	D	1	D	0.67145	0.996	D	0.70935	0.971	D	0.98645	1.0677	10	0.87932	D	0	.	17.4614	0.87620	0.0:0.0:1.0:0.0	.	270	P49335	PO3F4_HUMAN	Y	270	ENSP00000362296:D270Y	ENSP00000362296:D270Y	D	+	1	0	POU3F4	82650796	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.764000	0.85297	2.244000	0.73946	0.525000	0.51046	GAC		POU3F4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057368.2	NM_000307	
MPP1	4354	broad.mit.edu	37	X	154019307	154019307	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AG-A011-01A-01W-A00K-09	TCGA-AG-A011-10A-01W-A00K-09	g.chrX:154019307T>C	ENST00000369534.3	-	4	509	c.362A>G	c.(361-363)aAt>aGt	p.N121S	MPP1_ENST00000393531.1_Missense_Mutation_p.N121S|MPP1_ENST00000413259.3_Missense_Mutation_p.N91S|MPP1_ENST00000462825.1_Intron	NM_001166460.1|NM_001166461.1|NM_002436.3	NP_001159932.1|NP_001159933.1|NP_002427.1	Q00013	EM55_HUMAN	membrane protein, palmitoylated 1, 55kDa	121	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				nucleotide phosphorylation (GO:0046939)|regulation of neutrophil chemotaxis (GO:0090022)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)	p.N121S(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(9)|ovary(2)|prostate(1)	21	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					ATTTGTGCCATTGATTTCTAG	0.418																																					p.N121S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A362G	X						.						299.0	241.0	261.0					X																	154019307		2203	4300	6503	153672501	SO:0001583	missense	4354	exon4				CCDS14762.1, CCDS55544.1, CCDS55545.1	Xq28	2008-03-04	2002-08-29		ENSG00000130830	ENSG00000130830			7219	protein-coding gene	gene with protein product		305360	"""membrane protein, palmitoylated 1 (55kD)"""	DXS552E		1713685	Standard	NM_002436		Approved	PEMP	uc004fmp.2	Q00013	OTTHUMG00000024244	ENST00000369534.3:c.362A>G	X.37:g.154019307T>C	ENSP00000358547:p.Asn121Ser	Somatic		Capture	Illumina HiSeq	Phase_I	153672501	NM_002436	B4DZV5|G3XAI1|Q2TSB6|Q5J7V5	Missense_Mutation	SNP	ENST00000369534.3	37	CCDS14762.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.200247	0.79015	.	.	ENSG00000130830	ENST00000369534;ENST00000413259;ENST00000393531;ENST00000393529;ENST00000369531	T;T;T;T;T	0.59224	0.28;0.28;0.28;0.28;0.28	5.61	4.44	0.53790	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.80529	0.4640	H	0.94183	3.505	0.54753	D	0.999986	B;P;D;P	0.89917	0.41;0.902;1.0;0.902	B;P;D;P	0.97110	0.26;0.897;1.0;0.897	T	0.82436	-0.0458	10	0.87932	D	0	.	9.5197	0.39126	0.0:0.0848:0.0:0.9152	.	104;91;121;121	B4E325;B4DZV5;G3XAI1;Q00013	.;.;.;EM55_HUMAN	S	121;91;121;75;104	ENSP00000358547:N121S;ENSP00000400155:N91S;ENSP00000377165:N121S;ENSP00000377163:N75S;ENSP00000358544:N104S	ENSP00000358544:N104S	N	-	2	0	MPP1	153672501	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.558000	0.82253	0.751000	0.32900	0.481000	0.45027	AAT		MPP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061191.3	NM_002436	
