#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
PIK3CD	5293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	9779982	9779982	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr1:9779982T>C	ENST00000377346.4	+	10	1441	c.1246T>C	c.(1246-1248)Tgc>Cgc	p.C416R	PIK3CD_ENST00000536656.1_Missense_Mutation_p.C381R|PIK3CD_ENST00000543390.1_Missense_Mutation_p.C83R|PIK3CD_ENST00000361110.2_Missense_Mutation_p.C381R	NM_005026.3	NP_005017.3	O00329	PK3CD_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta	416	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|B cell chemotaxis (GO:0035754)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|cytokine production (GO:0001816)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell chemotaxis (GO:0002551)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|natural killer cell activation (GO:0030101)|natural killer cell chemotaxis (GO:0035747)|natural killer cell differentiation (GO:0001779)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|respiratory burst involved in defense response (GO:0002679)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|mast cell granule (GO:0042629)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)	Caffeine(DB00201)	TCTGCAGGACTGCCCCATTGC	0.647																																					p.C416R													.	.			0			c.T1246C												133.0	120.0	124.0					1																	9779982		2203	4300	6503	SO:0001583	missense	5293	exon10			CAGGACTGCCCCA		CCDS104.1	1p36.2	2014-09-17	2012-07-13		ENSG00000171608	ENSG00000171608	2.7.1.153		8977	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase, catalytic, delta polypeptide"", ""phosphoinositide-3-kinase C"""	602839	"""phosphoinositide-3-kinase, catalytic, delta polypeptide"""			9113989, 9455486	Standard	NM_005026		Approved	p110D	uc001aqb.4	O00329	OTTHUMG00000001450	ENST00000377346.4:c.1246T>C	1.37:g.9779982T>C	ENSP00000366563:p.Cys416Arg		Somatic	155	0	0		WXS	Illumina HiSeq	.	149	0.22	33	NM_005026	149	0.29	43	A6NCG0|G1FFP1|O15445|Q5SR49	Missense_Mutation	SNP	ENST00000377346.4	37	CCDS104.1	.	.	.	.	.	.	.	.	.	.	T	14.55	2.569189	0.45798	.	.	ENSG00000171608	ENST00000536656;ENST00000377346;ENST00000361110;ENST00000360563;ENST00000543390	T;T;T;T	0.68903	-0.36;-0.36;-0.36;-0.36	5.23	5.23	0.72850	C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (1);	0.000000	0.85682	D	0.000000	T	0.74906	0.3778	L	0.45581	1.43	0.80722	D	1	P;D;D	0.76494	0.907;0.999;0.983	P;D;P	0.70487	0.664;0.969;0.88	T	0.71856	-0.4466	10	0.25751	T	0.34	-40.0069	15.123	0.72460	0.0:0.0:0.0:1.0	.	416;381;416	B7ZM44;Q5SR50;O00329	.;.;PK3CD_HUMAN	R	381;416;381;381;83	ENSP00000446444:C381R;ENSP00000366563:C416R;ENSP00000354410:C381R;ENSP00000443811:C83R	ENSP00000353766:C381R	C	+	1	0	PIK3CD	9702569	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	6.179000	0.71974	1.975000	0.57531	0.379000	0.24179	TGC			0.647	PIK3CD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000004235.1		NM_005026	
PTPRF	5792	mdanderson.org	37	1	44057118	44057118	+	Silent	SNP	G	G	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr1:44057118G>T	ENST00000359947.4	+	9	1765	c.1425G>T	c.(1423-1425)gtG>gtT	p.V475V	PTPRF_ENST00000372413.3_Silent_p.V475V|PTPRF_ENST00000422171.2_5'Flank|PTPRF_ENST00000372414.3_Silent_p.V475V|PTPRF_ENST00000438120.1_Silent_p.V475V	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	475	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				TCACGACCGTGGGCAGCCTGC	0.692																																					p.V475V													.	.			0			c.G1425T												10.0	11.0	11.0					1																	44057118		2186	4278	6464	SO:0001819	synonymous_variant	5792	exon9			GACCGTGGGCAGC	Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.1425G>T	1.37:g.44057118G>T			Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	24	0.08	2	NM_002840	116	0.00	0	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Silent	SNP	ENST00000359947.4	37	CCDS489.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.10|10.10	1.256585|1.256585	0.22965|0.22965	.|.	.|.	ENSG00000142949|ENSG00000142949	ENST00000412568|ENST00000429895	.|.	.|.	.|.	5.62|5.62	3.7|3.7	0.42460|0.42460	.|.	.|.	.|.	.|.	.|.	T|T	0.54319|0.54319	0.1851|0.1851	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.48885|0.48885	-0.8995|-0.8995	4|4	.|.	.|.	.|.	.|.	5.6254|5.6254	0.17480|0.17480	0.0665:0.1248:0.5499:0.2588|0.0665:0.1248:0.5499:0.2588	.|.	.|.	.|.	.|.	W|L	143|132	.|.	.|.	G|W	+|+	1|2	0|0	PTPRF|PTPRF	43829705|43829705	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.880000|0.880000	0.50808|0.50808	1.473000|1.473000	0.35387|0.35387	0.820000|0.820000	0.34516|0.34516	0.563000|0.563000	0.77884|0.77884	GGG|TGG			0.692	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000019710.1			
Unknown	0	bcgsc.ca	37	1	160864796	160864796	+	IGR	SNP	C	C	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr1:160864796C>T								ITLN1 (9836 upstream) : RP11-312J18.6 (36732 downstream)																							ACAGCACGCTCGACTTCATGC	0.652																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			CACGCTCGACTTC																													1.37:g.160864796C>T			Somatic	70	0	0		WXS	Illumina HiSeq	Phase_1	105	0.42	44	.	17	0.00	0		RNA	SNP		37																																																																																					0	0.652										
ARHGAP30	257106	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	161018593	161018595	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	CTC	CTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr1:161018593_161018595delCTC	ENST00000368013.3	-	12	2536_2538	c.2216_2218delGAG	c.(2215-2220)ggagat>gat	p.G739del	USF1_ENST00000368021.3_5'Flank|USF1_ENST00000435396.1_5'Flank|ARHGAP30_ENST00000368016.3_Intron|ARHGAP30_ENST00000368015.1_In_Frame_Del_p.G562del	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	739	Glu-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)			breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			GTATACTCATCTCCTCCTGGTTC	0.493																																					p.739_740del													.	ARHGAP30	105		0			c.2217_2219del																																									SO:0001651	inframe_deletion	257106	exon12			ACTCATCTCCTCC	AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.2216_2218delGAG	1.37:g.161018596_161018598delCTC	ENSP00000356992:p.Gly739del		Somatic	202	0	0		WXS	Illumina HiSeq	.	285	0.23	65	NM_001025598	106	0.00	0	Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	In_Frame_Del	DEL	ENST00000368013.3	37	CCDS30918.1																																																																																					0.493	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077090.2		NM_181720	
TTC13	79573	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	231075188	231075188	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr1:231075188G>T	ENST00000366661.4	-	8	851	c.844C>A	c.(844-846)Cag>Aag	p.Q282K	TTC13_ENST00000366662.4_Missense_Mutation_p.Q229K|TTC13_ENST00000414259.1_Missense_Mutation_p.Q229K	NM_024525.4	NP_078801.3	Q8NBP0	TTC13_HUMAN	tetratricopeptide repeat domain 13	282										central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	39	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)		COAD - Colon adenocarcinoma(196;0.243)		GCTATAGGCTGGTTTTTGTTC	0.388																																					p.Q282K													.	.			0			c.C844A												95.0	90.0	91.0					1																	231075188		2203	4300	6503	SO:0001583	missense	79573	exon8			TAGGCTGGTTTTT		CCDS1588.1, CCDS44332.1, CCDS44332.2	1q42.2	2013-01-10			ENSG00000143643	ENSG00000143643		"""Tetratricopeptide (TTC) repeat domain containing"""	26204	protein-coding gene	gene with protein product							Standard	NM_024525		Approved	FLJ22584	uc001huf.4	Q8NBP0	OTTHUMG00000037788	ENST00000366661.4:c.844C>A	1.37:g.231075188G>T	ENSP00000355621:p.Gln282Lys		Somatic	55	0	0		WXS	Illumina HiSeq	.	55	0.13	7	NM_024525	1	0.00	0	B1AQI1|B1AQI2|Q8IVP8|Q8NBI0|Q8ND20	Missense_Mutation	SNP	ENST00000366661.4	37	CCDS1588.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.997684	0.93227	.	.	ENSG00000143643	ENST00000366661;ENST00000366662;ENST00000414259	T;T;T	0.59502	0.26;1.21;1.21	5.14	5.14	0.70334	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.73659	0.3615	M	0.62723	1.935	0.80722	D	1	D;D;D;D	0.76494	0.999;0.963;0.996;0.999	D;D;D;D	0.91635	0.999;0.973;0.974;0.997	T	0.70761	-0.4784	10	0.30854	T	0.27	-21.4356	18.598	0.91236	0.0:0.0:1.0:0.0	.	207;229;229;282	Q69YR0;E9PGV4;Q8NBP0-2;Q8NBP0	.;.;.;TTC13_HUMAN	K	282;229;229	ENSP00000355621:Q282K;ENSP00000355622:Q229K;ENSP00000416631:Q229K	ENSP00000355621:Q282K	Q	-	1	0	TTC13	229141811	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.391000	0.81399	0.591000	0.81541	CAG			0.388	TTC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000092229.2		NM_024525	
MUC2	4583	hgsc.bcm.edu	37	11	1093324	1093324	+	Missense_Mutation	SNP	G	G	A	rs201143282		TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr11:1093324G>A	ENST00000441003.2	+	30	5170	c.5143G>A	c.(5143-5145)Ggc>Agc	p.G1715S	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_Missense_Mutation_p.G3S|MUC2_ENST00000359061.5_Missense_Mutation_p.G1682S	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	aacacccaccggcacacagac	0.637																																					p.G1715S													MUC2_ENST00000441003,uveal_tract,malignant_melanoma,0,2	MUC2_ENST00000441003	0	2	0			c.G5143A												178.0	224.0	208.0					11																	1093324		1930	3651	5581	SO:0001583	missense	4583	exon30			CCCACCGGCACAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5143G>A	11.37:g.1093324G>A	ENSP00000415183:p.Gly1715Ser		Somatic	33	0.0606060606	2		WXS	Illumina HiSeq	.	41	0.10	4	NM_002457	0		0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	G	7.149	0.583420	0.13749	.	.	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000333592	T;T;T	0.16743	3.11;3.17;2.32	1.64	0.221	0.15283	.	155.122000	0.02480	U	0.088379	T	0.09686	0.0238	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.22556	-1.0213	9	0.19147	T	0.46	.	3.4701	0.07563	0.7575:0.0:0.2425:0.0	.	1715	E7EUV1	.	S	1715;1682;3	ENSP00000415183:G1715S;ENSP00000351956:G1682S;ENSP00000331373:G3S	ENSP00000331373:G3S	G	+	1	0	MUC2	1083324	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.131000	0.10482	-0.042000	0.13535	-1.076000	0.02234	GGC			0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
KRTAP5-4	387267	hgsc.bcm.edu	37	11	1643254	1643254	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr11:1643254A>G	ENST00000399682.1	-	1	114	c.70T>C	c.(70-72)Tgt>Cgt	p.C24R		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0						keratin filament (GO:0045095)				NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ccagagccacagcccccacag	0.687																																					p.C24R													KRTAP5-4,NS,carcinoma,+2,6	KRTAP5-4	2	6	0			c.T70C												4.0	8.0	7.0					11																	1643254		641	1519	2160	SO:0001583	missense	387267	exon1			AGCCACAGCCCCC	AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.70T>C	11.37:g.1643254A>G	ENSP00000382590:p.Cys24Arg		Somatic	103	0.0097087379	1		WXS	Illumina HiSeq	.	134	0.07	9	NM_001012709	0		0		Missense_Mutation	SNP	ENST00000399682.1	37		.	.	.	.	.	.	.	.	.	.	A	7.309	0.614523	0.14129	.	.	ENSG00000241598	ENST00000399682;ENST00000328953	T	0.01099	5.34	2.15	2.15	0.27550	.	.	.	.	.	T	0.06234	0.0161	M	0.87971	2.92	0.49389	D	0.999781	D	0.59357	0.985	D	0.70487	0.969	T	0.05273	-1.0895	9	0.56958	D	0.05	.	8.2253	0.31564	1.0:0.0:0.0:0.0	.	24	Q6L8H1	KRA54_HUMAN	R	24	ENSP00000382590:C24R	ENSP00000331603:C24R	C	-	1	0	KRTAP5-4	1599830	0.001000	0.12720	0.930000	0.37139	0.032000	0.12392	-0.060000	0.11712	1.242000	0.43836	0.367000	0.22151	TGT			0.687	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000127918.1		NM_001012709	
ABTB2	25841	mdanderson.org	37	11	34184247	34184247	+	Silent	SNP	G	G	A			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr11:34184247G>A	ENST00000435224.2	-	10	2518	c.2094C>T	c.(2092-2094)agC>agT	p.S698S	ABTB2_ENST00000298992.2_Silent_p.S512S	NM_145804.2	NP_665803.2	Q8N961	ABTB2_HUMAN	ankyrin repeat and BTB (POZ) domain containing 2	698					cellular response to toxic substance (GO:0097237)	nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)				CACTGCCCTGGCTCGACGCAT	0.657																																					p.S698S													.	.			0			c.C2094T												71.0	58.0	63.0					11																	34184247		2202	4298	6500	SO:0001819	synonymous_variant	25841	exon10			GCCCTGGCTCGAC	AK056863	CCDS7890.1, CCDS7890.2	11p13	2013-10-02			ENSG00000166016	ENSG00000166016		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23842	protein-coding gene	gene with protein product							Standard	NM_145804		Approved	DKFZP586C1619, BTBD22, ABTB2A	uc001mvl.2	Q8N961	OTTHUMG00000044382	ENST00000435224.2:c.2094C>T	11.37:g.34184247G>A			Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_145804	9	0.00	0	A8K6S9|E9PRW7|Q52LD6|Q6MZW4|Q8NB44	Silent	SNP	ENST00000435224.2	37	CCDS7890.2																																																																																					0.657	ABTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388703.3		NM_145804	
OR4A16	81327	hgsc.bcm.edu	37	11	55110715	55110715	+	Silent	SNP	G	G	A	rs77981146	byFrequency	TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr11:55110715G>A	ENST00000314721.2	+	1	89	c.39G>A	c.(37-39)ctG>ctA	p.L13L		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	13						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L13L(1)		NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						TTGTCCTCCTGGGCCTCACTC	0.388																																					p.L13L													OR4A16,NS,lymphoid_neoplasm,0,1	OR4A16	0	1	1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)	c.G39A												57.0	51.0	53.0					11																	55110715		2201	4296	6497	SO:0001819	synonymous_variant	81327	exon1			CCTCCTGGGCCTC	AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.39G>A	11.37:g.55110715G>A			Somatic	45	0	0		WXS	Illumina HiSeq	.	35	0.11	4	NM_001005274	0		0	Q6IFL3	Silent	SNP	ENST00000314721.2	37	CCDS31499.1																																																																																			0.006		0.388	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000391160.1		NM_001005274	
OR4A16	81327	hgsc.bcm.edu	37	11	55110739	55110739	+	Silent	SNP	G	G	A	rs368036675|rs78513473	byFrequency	TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr11:55110739G>A	ENST00000314721.2	+	1	113	c.63G>A	c.(61-63)gtG>gtA	p.V21V		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	21						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V21V(1)		NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						ATCCTGATGTGAAAAAAACAT	0.413																																					p.V21V													OR4A16,NS,carcinoma,0,1	OR4A16	0	1	1	Substitution - coding silent(1)	lung(1)	c.G63A												74.0	68.0	70.0					11																	55110739		2201	4296	6497	SO:0001819	synonymous_variant	81327	exon1			TGATGTGAAAAAA	AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.63G>A	11.37:g.55110739G>A			Somatic	44	0	0		WXS	Illumina HiSeq	.	52	0.10	5	NM_001005274	0		0	Q6IFL3	Silent	SNP	ENST00000314721.2	37	CCDS31499.1																																																																																			0.002		0.413	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000391160.1		NM_001005274	
FOLR2	2350	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	71932007	71932007	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr11:71932007C>G	ENST00000298223.6	+	3	431	c.244C>G	c.(244-246)Cac>Gac	p.H82D	FOLR2_ENST00000454954.2_Missense_Mutation_p.H41D|FOLR2_ENST00000449475.2_Missense_Mutation_p.H99D	NM_000803.4|NM_001113534.1|NM_001113535.1|NM_001113536.1	NP_000794.3|NP_001107006.1|NP_001107007.1|NP_001107008.1	P14207	FOLR2_HUMAN	folate receptor 2 (fetal)	82					folic acid transport (GO:0015884)	anchored component of external side of plasma membrane (GO:0031362)|extracellular region (GO:0005576)|membrane (GO:0016020)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)			breast(3)|large_intestine(3)|ovary(1)|skin(1)	8					Folic Acid(DB00158)	TAACTGGGACCACTGCGGCAA	0.607																																					p.H82D													.	.			0			c.C244G												42.0	43.0	43.0					11																	71932007		2200	4293	6493	SO:0001583	missense	2350	exon3			TGGGACCACTGCG	AK222539	CCDS8212.1	11q13.3-q14.1	2010-04-08			ENSG00000165457	ENSG00000165457			3793	protein-coding gene	gene with protein product		136425				1133088, 7698003	Standard	NM_000803		Approved		uc009ytf.3	P14207	OTTHUMG00000150394	ENST00000298223.6:c.244C>G	11.37:g.71932007C>G	ENSP00000298223:p.His82Asp		Somatic	88	0	0		WXS	Illumina HiSeq	.	96	0.15	14	NM_001113535	49	0.00	0	Q05CA5|Q6GTE8	Missense_Mutation	SNP	ENST00000298223.6	37	CCDS8212.1	.	.	.	.	.	.	.	.	.	.	c	17.35	3.367915	0.61513	.	.	ENSG00000165457	ENST00000449475;ENST00000298223;ENST00000413873;ENST00000454954;ENST00000541003;ENST00000539412;ENST00000536778;ENST00000535625;ENST00000321324;ENST00000538353	T;T;T;T;T;T;T;T;T	0.77489	-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1	4.52	4.52	0.55395	Folate receptor-like (1);	0.000000	0.85682	D	0.000000	D	0.90710	0.7085	M	0.93328	3.405	0.58432	D	0.999996	D	0.76494	0.999	D	0.78314	0.991	D	0.93249	0.6633	10	0.87932	D	0	.	15.9916	0.80208	0.0:1.0:0.0:0.0	.	82	P14207	FOLR2_HUMAN	D	99;82;99;41;128;93;97;82;95;82	ENSP00000405638:H99D;ENSP00000298223:H82D;ENSP00000414094:H41D;ENSP00000443307:H128D;ENSP00000441547:H93D;ENSP00000438568:H97D;ENSP00000444794:H82D;ENSP00000321957:H95D;ENSP00000440337:H82D	ENSP00000298223:H82D	H	+	1	0	FOLR2	71609655	1.000000	0.71417	0.926000	0.36857	0.342000	0.28953	5.862000	0.69560	2.335000	0.79485	0.455000	0.32223	CAC			0.607	FOLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000317923.2		NM_000803	
ARHGEF17	9828	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	73070882	73070882	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr11:73070882C>T	ENST00000263674.3	+	10	4441	c.4091C>T	c.(4090-4092)gCa>gTa	p.A1364V	AP002761.1_ENST00000582555.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	1364					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						CCTCTAGGGGCATCCCAAGCC	0.587																																					p.A1364V													.	.			0			c.C4091T												78.0	71.0	74.0					11																	73070882		2200	4293	6493	SO:0001583	missense	9828	exon10			TAGGGGCATCCCA	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.4091C>T	11.37:g.73070882C>T	ENSP00000263674:p.Ala1364Val		Somatic	115	0	0		WXS	Illumina HiSeq	.	107	0.22	24	NM_014786	38	0.13	5	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	ENST00000263674.3	37	CCDS8221.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.957419	0.73902	.	.	ENSG00000110237	ENST00000263674	T	0.58652	0.32	5.33	4.42	0.53409	.	0.174016	0.51477	N	0.000085	T	0.50086	0.1595	L	0.43152	1.355	0.40742	D	0.982845	B	0.14012	0.009	B	0.09377	0.004	T	0.50800	-0.8785	10	0.62326	D	0.03	-4.0109	13.2367	0.59972	0.0:0.9233:0.0:0.0767	.	1364	Q96PE2	ARHGH_HUMAN	V	1364	ENSP00000263674:A1364V	ENSP00000263674:A1364V	A	+	2	0	ARHGEF17	72748530	1.000000	0.71417	0.967000	0.41034	0.452000	0.32318	7.277000	0.78572	1.256000	0.44068	-0.291000	0.09656	GCA			0.587	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000397365.1		NM_014786	
KRAS	3845	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12V	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)			Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS_ENST00000256078,NS,adenocarcinoma,0,25136	KRAS_ENST00000256078	0	25136	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35T												91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	ACGCCACCAGCTC	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val		Somatic	152	0	0		WXS	Illumina HiSeq	.	228	0.22	51	NM_004985	49	0.43	21	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT			0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000412232.1		NM_033360	
MRPL42	28977	mdanderson.org	37	12	93881369	93881369	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr12:93881369G>T	ENST00000549982.1	+	5	477	c.316G>T	c.(316-318)Gga>Tga	p.G106*	MRPL42_ENST00000547098.1_Nonsense_Mutation_p.G106*|MRPL42_ENST00000548545.1_Nonsense_Mutation_p.G106*|MRPL42_ENST00000361630.2_Nonsense_Mutation_p.G106*|MRPL42_ENST00000552217.1_Nonsense_Mutation_p.G106*|MRPL42_ENST00000393128.4_Nonsense_Mutation_p.G106*	NM_014050.3|NM_172177.3	NP_054769.1|NP_751917.1	Q9Y6G3	RM42_HUMAN	mitochondrial ribosomal protein L42	106					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)	7						CCTTGAGGAAGGACCTATGAT	0.398																																					p.G106X													.	.			0			c.G316T												145.0	131.0	136.0					12																	93881369		2203	4300	6503	SO:0001587	stop_gained	28977	exon5			GAGGAAGGACCTA	AB051626	CCDS9045.1	12q22	2014-02-12			ENSG00000198015	ENSG00000198015		"""Mitochondrial ribosomal proteins / large subunits"", ""Mitochondrial ribosomal proteins / small subunits"""	14493	protein-coding gene	gene with protein product	"""mitochondrial ribosomal protein S32"""	611847				11279123, 11042152	Standard	NM_014050		Approved	MRPS32, MRP-L31, RPML31, PTD007, HSPC204, MRPL31	uc001tcr.3	Q9Y6G3	OTTHUMG00000170157	ENST00000549982.1:c.316G>T	12.37:g.93881369G>T	ENSP00000449884:p.Gly106*		Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_014050	534	0.00	0	Q6FID1|Q96Q48|Q9P0S1	Nonsense_Mutation	SNP	ENST00000549982.1	37	CCDS9045.1	.	.	.	.	.	.	.	.	.	.	G	15.19	2.758894	0.49468	.	.	ENSG00000198015	ENST00000549982;ENST00000361630;ENST00000552217;ENST00000393128	.	.	.	4.84	4.84	0.62591	.	0.068786	0.56097	D	0.000024	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-15.503	11.4691	0.50257	0.0846:0.0:0.9154:0.0	.	.	.	.	X	106	.	ENSP00000355202:G106X	G	+	1	0	MRPL42	92405500	1.000000	0.71417	0.988000	0.46212	0.204000	0.24138	8.230000	0.89793	2.391000	0.81399	0.591000	0.81541	GGA			0.398	MRPL42-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000407715.1		NM_014050	
BTBD11	121551	broad.mit.edu	37	12	108010914	108010914	+	Nonsense_Mutation	SNP	G	G	T	rs147351765		TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr12:108010914G>T	ENST00000280758.5	+	8	2578	c.2050G>T	c.(2050-2052)Gag>Tag	p.E684*	BTBD11_ENST00000420571.2_Nonsense_Mutation_p.E684*|BTBD11_ENST00000490090.2_Nonsense_Mutation_p.E684*|RP11-128P10.1_ENST00000548473.1_RNA|BTBD11_ENST00000357167.4_Nonsense_Mutation_p.E221*	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	684						integral component of membrane (GO:0016021)		p.E684K(2)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						GGAGCATGGCGAGGAGAACTA	0.607																																					p.E684X													BTBD11,scalp,malignant_melanoma,0,3	BTBD11	122	3	2	Substitution - Missense(2)	endometrium(1)|skin(1)	c.G2050T												139.0	116.0	124.0					12																	108010914		2203	4300	6503	SO:0001587	stop_gained	121551	exon8			CATGGCGAGGAGA	AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.2050G>T	12.37:g.108010914G>T	ENSP00000280758:p.Glu684*		Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	78	0.04	3	NM_001018072	5	0.00	0	A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Nonsense_Mutation	SNP	ENST00000280758.5	37	CCDS31893.1	.	.	.	.	.	.	.	.	.	.	G	40	7.942044	0.98574	.	.	ENSG00000151136	ENST00000280758;ENST00000420571;ENST00000490090;ENST00000357167	.	.	.	5.27	5.27	0.74061	.	0.249509	0.47455	D	0.000233	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	18.8886	0.92389	0.0:0.0:1.0:0.0	.	.	.	.	X	684;684;684;221	.	ENSP00000280758:E684X	E	+	1	0	BTBD11	106535044	1.000000	0.71417	0.975000	0.42487	0.961000	0.63080	5.294000	0.65687	2.454000	0.82982	0.655000	0.94253	GAG			0.607	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000318003.1		NM_152322	
HECTD4	283450	broad.mit.edu	37	12	112622338	112622338	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr12:112622338T>G	ENST00000430131.2	-	60	10311	c.9166A>C	c.(9166-9168)Acc>Ccc	p.T3056P	HECTD4_ENST00000550722.1_Missense_Mutation_p.T3332P|HECTD4_ENST00000377560.5_Missense_Mutation_p.T3306P			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	3056					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										ATGGCGGGGGTCAGGCTGCTG	0.647																																					p.T3344P													C12orf51_ENST00000377560,NS,carcinoma,0,2	.		2	0			c.A10030C												32.0	45.0	40.0					12																	112622338		2196	4284	6480	SO:0001583	missense	283450	exon61			CGGGGGTCAGGCT	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.9166A>C	12.37:g.112622338T>G	ENSP00000404379:p.Thr3056Pro		Somatic	32	0.25	8		WXS	Illumina HiSeq	Phase_I	40	0.33	13	NM_001109662	33	0.18	6	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	37		.	.	.	.	.	.	.	.	.	.	T	12.69	2.012573	0.35511	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.50277	0.75;0.75;0.75	5.37	1.39	0.22231	.	.	.	.	.	T	0.27697	0.0681	N	0.14661	0.345	0.38589	D	0.950385	B	0.32968	0.392	B	0.31869	0.137	T	0.09015	-1.0694	9	0.62326	D	0.03	.	7.6591	0.28392	0.0:0.3882:0.0:0.6118	.	3056	Q9Y4D8	K0614_HUMAN	P	3306;3056;3332	ENSP00000366783:T3306P;ENSP00000404379:T3056P;ENSP00000449784:T3332P	ENSP00000366783:T3306P	T	-	1	0	C12orf51	111106721	1.000000	0.71417	0.999000	0.59377	0.600000	0.36913	1.836000	0.39191	-0.021000	0.14009	0.533000	0.62120	ACC			0.647	HECTD4-202	KNOWN	basic	protein_coding	protein_coding				NM_173813	
NCOR2	9612	broad.mit.edu	37	12	124887093	124887093	+	Silent	SNP	C	C	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr12:124887093C>T	ENST00000405201.1	-	14	1497	c.1497G>A	c.(1495-1497)caG>caA	p.Q499Q	NCOR2_ENST00000404121.2_Silent_p.Q69Q|NCOR2_ENST00000397355.1_Silent_p.Q499Q|NCOR2_ENST00000404621.1_Silent_p.Q498Q|NCOR2_ENST00000429285.2_Silent_p.Q498Q|NCOR2_ENST00000356219.3_Silent_p.Q499Q			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	499	Poly-Gln.				cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)	p.Q499Q(9)		breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		gctgctgctgctgttgttgct	0.617																																					p.Q499Q													NCOR2_ENST00000405201,NS,carcinoma,0,11	NCOR2	475	11	9	Substitution - coding silent(9)	endometrium(4)|large_intestine(3)|kidney(2)	c.G1497A												9.0	10.0	10.0					12																	124887093		2051	4183	6234	SO:0001819	synonymous_variant	9612	exon16			CTGCTGCTGTTGT	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1497G>A	12.37:g.124887093C>T			Somatic	41	0.0243902439	1		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_006312	37	0.00	0	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Silent	SNP	ENST00000405201.1	37	CCDS41858.2																																																																																					0.617	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000318173.2		NM_006312	
MYO16	23026	hgsc.bcm.edu	37	13	109318410	109318410	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr13:109318410A>G	ENST00000357550.2	+	1	180	c.139A>G	c.(139-141)Agg>Ggg	p.R47G	MYO16_ENST00000251041.5_Missense_Mutation_p.R47G|MYO16_ENST00000356711.2_Missense_Mutation_p.R47G	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			GTTCCTGAAAAGGCTGAAGCA	0.493																																					p.R69G													MYO16,NS,carcinoma,-2,1	MYO16	-2	1	0			c.A205G												79.0	70.0	73.0					13																	109318410		2203	4300	6503	SO:0001583	missense	23026	exon2			CTGAAAAGGCTGA		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.139A>G	13.37:g.109318410A>G	ENSP00000350160:p.Arg47Gly		Somatic	78	0	0		WXS	Illumina HiSeq	.	65	0.05	3	NM_001198950	1	0.00	0		Missense_Mutation	SNP	ENST00000357550.2	37	CCDS32008.1	.	.	.	.	.	.	.	.	.	.	A	6.554	0.470542	0.12461	.	.	ENSG00000041515	ENST00000356711;ENST00000397258;ENST00000357550;ENST00000251041	T;T;T	0.81330	-1.48;-1.48;-1.22	5.37	2.8	0.32819	.	0.218757	0.21502	U	0.073501	T	0.63850	0.2546	N	0.24115	0.695	0.09310	N	0.999997	B;P	0.35433	0.145;0.501	B;B	0.27608	0.079;0.081	T	0.48328	-0.9045	9	.	.	.	.	11.3838	0.49773	0.7111:0.2889:0.0:0.0	.	47;47	Q9Y6X6-2;Q9Y6X6	.;MYO16_HUMAN	G	47	ENSP00000349145:R47G;ENSP00000350160:R47G;ENSP00000251041:R47G	.	R	+	1	2	MYO16	108116411	0.850000	0.29656	0.004000	0.12327	0.019000	0.09904	3.869000	0.56062	0.294000	0.22547	-0.323000	0.08544	AGG			0.493	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045746.1		NM_015011	
RP11-643G16.4	0	broad.mit.edu	37	14	68082826	68082827	+	RNA	INS	-	-	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr14:68082826_68082827insT	ENST00000559968.1	+	0	1181_1182				Y_RNA_ENST00000364659.1_RNA																							TTCGAGTGCAGTTTTTTTTCTT	0.351																																					.													.	.			0			.																																											0	.			AGTGCAGTTTTTT																													14.37:g.68082834_68082834dupT			Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	INS	ENST00000559968.1	37																																																																																						0.351	RP11-643G16.4-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000417022.1			
ZFP36L1	677	mdanderson.org	37	14	69257094	69257094	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr14:69257094G>T	ENST00000439696.2	-	2	474	c.173C>A	c.(172-174)cCc>cAc	p.P58H	ZFP36L1_ENST00000555997.1_3'UTR|ZFP36L1_ENST00000336440.3_Missense_Mutation_p.P58H	NM_001244701.1|NM_004926.3	NP_001231630.1|NP_004917.2	Q07352	TISB_HUMAN	ZFP36 ring finger protein-like 1	58					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|T cell differentiation in thymus (GO:0033077)|vasculogenesis (GO:0001570)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|kidney(1)|large_intestine(1)|liver(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(1)	21				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		CTTGGAGCTGGGCAGGGTGAC	0.647											OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P127H													.	.			0			c.C380A												20.0	20.0	20.0					14																	69257094		2203	4300	6503	SO:0001583	missense	677	exon3			GAGCTGGGCAGGG	X79066	CCDS9791.1	14q22-q24	2012-11-27	2012-11-27	2001-11-23		ENSG00000185650		"""RING-type (C3HC4) zinc fingers"""	1107	protein-coding gene	gene with protein product		601064	"""zinc finger protein, C3H type, 36-like 1"", ""zinc finger protein 36, C3H type-like 1"""	BRF1		8024689	Standard	NM_004926		Approved	RNF162B, Berg36, ERF1, TIS11B, cMG1	uc021rve.1	Q07352		ENST00000439696.2:c.173C>A	14.37:g.69257094G>T	ENSP00000388402:p.Pro58His		Somatic	31	0	0	1113	WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_001244701	138	0.00	0	Q13851	Missense_Mutation	SNP	ENST00000439696.2	37	CCDS9791.1	.	.	.	.	.	.	.	.	.	.	g	16.16	3.045871	0.55110	.	.	ENSG00000185650	ENST00000439696;ENST00000336440;ENST00000435246;ENST00000557086;ENST00000557022;ENST00000553375	T;T	0.31510	1.49;1.49	4.64	3.74	0.42951	Tis11B-like protein, N-terminal (1);	0.082034	0.47455	U	0.000225	T	0.25382	0.0617	L	0.29908	0.895	0.80722	D	1	B	0.14438	0.01	B	0.21708	0.036	T	0.07328	-1.0778	10	0.62326	D	0.03	-0.4924	13.9828	0.64315	0.0:0.0:0.8473:0.1527	.	58	Q07352	TISB_HUMAN	H	58;58;58;64;36;127	ENSP00000388402:P58H;ENSP00000337386:P58H	ENSP00000337386:P58H	P	-	2	0	ZFP36L1	68326847	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.572000	0.82409	1.168000	0.42723	0.574000	0.79327	CCC			0.647	ZFP36L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000413227.1			
BATF	10538	mdanderson.org	37	14	75991478	75991478	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr14:75991478G>T	ENST00000286639.6	+	2	373	c.115G>T	c.(115-117)Gcc>Tcc	p.A39S	BATF_ENST00000555504.1_Missense_Mutation_p.A39S|BATF_ENST00000555795.1_3'UTR	NM_006399.3	NP_006390.1	Q16520	BATF_HUMAN	basic leucine zipper transcription factor, ATF-like	39	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|defense response to protozoan (GO:0042832)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hematopoietic stem cell differentiation (GO:0060218)|isotype switching (GO:0045190)|lymphoid progenitor cell differentiation (GO:0002320)|myeloid dendritic cell differentiation (GO:0043011)|T-helper 17 cell differentiation (GO:0072539)|T-helper 17 cell lineage commitment (GO:0072540)|T-helper 2 cell differentiation (GO:0045064)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|ovary(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.028)		AAATCGTATTGCCGCCCAGAA	0.527																																					p.A39S													.	.			0			c.G115T												90.0	76.0	81.0					14																	75991478		2203	4300	6503	SO:0001583	missense	10538	exon2			CGTATTGCCGCCC	AF016898	CCDS9843.1	14q24	2013-01-10				ENSG00000156127		"""basic leucine zipper proteins"""	958	protein-coding gene	gene with protein product	"""activating transcription factor B"", ""SF-HT-activated gene 2"""	612476				8570175, 8630063	Standard	NM_006399		Approved	B-ATF, SFA-2, BATF1	uc001xrr.3	Q16520		ENST00000286639.6:c.115G>T	14.37:g.75991478G>T	ENSP00000286639:p.Ala39Ser		Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_006399	88	0.00	0		Missense_Mutation	SNP	ENST00000286639.6	37	CCDS9843.1	.	.	.	.	.	.	.	.	.	.	G	35	5.498469	0.96355	.	.	ENSG00000156127	ENST00000286639;ENST00000555504	T	0.62941	-0.01	5.71	5.71	0.89125	Basic-leucine zipper (bZIP) transcription factor (3);bZIP transcription factor, bZIP-1 (1);	0.000000	0.85682	D	0.000000	D	0.84866	0.5567	M	0.92268	3.29	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	D	0.87839	0.2650	10	0.87932	D	0	-4.8307	19.8677	0.96824	0.0:0.0:1.0:0.0	.	39	Q16520	BATF_HUMAN	S	39	ENSP00000286639:A39S	ENSP00000286639:A39S	A	+	1	0	BATF	75061231	1.000000	0.71417	0.975000	0.42487	0.989000	0.77384	9.251000	0.95483	2.709000	0.92574	0.655000	0.94253	GCC			0.527	BATF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000413669.1		NM_006399	
SLC12A6	9990	mdanderson.org	37	15	34544565	34544565	+	Missense_Mutation	SNP	C	C	T	rs375887656	byFrequency	TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr15:34544565C>T	ENST00000354181.3	-	10	1631	c.1139G>A	c.(1138-1140)cGc>cAc	p.R380H	SLC12A6_ENST00000560611.1_Missense_Mutation_p.R380H|RP11-1084A12.2_ENST00000559867.1_RNA|SLC12A6_ENST00000290209.5_Missense_Mutation_p.R329H|SLC12A6_ENST00000397707.2_Missense_Mutation_p.R365H|SLC12A6_ENST00000558589.1_Missense_Mutation_p.R371H|SLC12A6_ENST00000558667.1_Missense_Mutation_p.R380H|SLC12A6_ENST00000451844.2_Missense_Mutation_p.R192H|SLC12A6_ENST00000458406.2_Missense_Mutation_p.R321H|SLC12A6_ENST00000397702.2_Missense_Mutation_p.R321H|SLC12A6_ENST00000560164.1_Missense_Mutation_p.R192H			Q9UHW9	S12A6_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 6	380					angiogenesis (GO:0001525)|cellular hypotonic response (GO:0071476)|cellular hypotonic salinity response (GO:0071477)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|rubidium ion transport (GO:0035826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium ion transmembrane transporter activity (GO:0015079)|potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)|rubidium ion transmembrane transporter activity (GO:0035827)			central_nervous_system(5)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|skin(3)	45		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	TGAAAGGGTGCGGTTACCCAG	0.383													C|||	2	0.000399361	0.0	0.0	5008	,	,		19893	0.002		0.0	False		,,,				2504	0.0				p.R380H													SLC12A6_ENST00000558589,bladder,carcinoma,0,6	SLC12A6_ENST00000558589	0	6	0			c.G1139A												121.0	113.0	115.0					15																	34544565		2201	4298	6499	SO:0001583	missense	9990	exon9			AGGGTGCGGTTAC	AF108831	CCDS10036.1, CCDS42010.1, CCDS42011.1, CCDS42012.1, CCDS58352.1	15q13	2014-09-17	2013-07-18		ENSG00000140199	ENSG00000140199		"""Solute carriers"""	10914	protein-coding gene	gene with protein product		604878	"""agenesis of corpus callosum and peripheral neuropathy (Andermann syndrome)"""	KCC3, ACCPN		10187864, 10347194	Standard	NM_133647		Approved		uc001zhw.3	Q9UHW9	OTTHUMG00000129441	ENST00000354181.3:c.1139G>A	15.37:g.34544565C>T	ENSP00000346112:p.Arg380His		Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	125	0.04	5	NM_133647	95	0.00	0	A0AV76|Q2VI00|Q7Z2E7|Q7Z4G5|Q8TDD4|Q9UFR2|Q9Y642|Q9Y665	Missense_Mutation	SNP	ENST00000354181.3	37	CCDS58352.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.868646	0.91587	.	.	ENSG00000140199	ENST00000290209;ENST00000397707;ENST00000354181;ENST00000397702;ENST00000458406;ENST00000451844	T;T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39;-0.39	5.55	5.55	0.83447	.	0.148153	0.41605	D	0.000841	T	0.71384	0.3333	M	0.68952	2.095	0.80722	D	1	P;P;P;P	0.50943	0.653;0.534;0.94;0.864	B;B;P;B	0.47015	0.147;0.187;0.534;0.426	T	0.71451	-0.4589	10	0.40728	T	0.16	.	18.4277	0.90614	0.0:1.0:0.0:0.0	.	365;380;329;192	Q9UHW9-3;Q9UHW9;A0AV76;B3KXX3	.;S12A6_HUMAN;.;.	H	329;365;371;321;321;192	ENSP00000290209:R329H;ENSP00000380819:R365H;ENSP00000380814:R321H;ENSP00000387725:R321H;ENSP00000390199:R192H	ENSP00000290209:R329H	R	-	2	0	SLC12A6	32331857	1.000000	0.71417	0.989000	0.46669	0.994000	0.84299	7.651000	0.83577	2.890000	0.99128	0.585000	0.79938	CGC			0.383	SLC12A6-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000417991.1		NM_005135	
FAM98B	283742	broad.mit.edu	37	15	38776809	38776809	+	IGR	SNP	T	T	A	rs201831942|rs374461368		TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr15:38776809T>A	ENST00000491535.1	+	0	3111				FAM98B_ENST00000397609.2_Silent_p.G417G	NM_001042429.1	NP_001035894.1	Q52LJ0	FA98B_HUMAN	family with sequence similarity 98, member B							cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-splicing ligase complex (GO:0072669)	poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|skin(1)	8		all_cancers(109;3.11e-17)|all_epithelial(112;2.64e-15)|Lung NSC(122;2.11e-11)|all_lung(180;5.61e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;9e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0209)		ATGGAGGAggtggtggtggtg	0.473																																					p.G417G													.	FAM98B	53		0			c.T1251A							T		2,3092		0,2,1545	25.0	24.0	25.0		1251	-6.5	0.3	15		25	0,6894		0,0,3447	no	coding-synonymous	FAM98B	NM_173611.2		0,2,4992	AA,AT,TT		0.0,0.0646,0.02		417/434	38776809	2,9986	1547	3447	4994	SO:0001628	intergenic_variant	283742	exon8			AGGAGGTGGTGGT		CCDS10047.2	15q14	2006-11-29		2005-11-20	ENSG00000171262	ENSG00000171262			26773	protein-coding gene	gene with protein product						12477932	Standard	NM_173611		Approved	FLJ38426	uc001zkc.3	Q52LJ0	OTTHUMG00000129831		15.37:g.38776809T>A			Somatic	93	0.0107526882	1		WXS	Illumina HiSeq	Phase_I	94	0.05	5	NM_173611	1	0.00	0	A8MUW5|Q8N935	Silent	SNP	ENST00000491535.1	37	CCDS42015.1																																																																																					0.473	FAM98B-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000252071.2		NM_173611	
TLE3	7090	mdanderson.org	37	15	70346959	70346959	+	Silent	SNP	G	G	A	rs367926967		TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr15:70346959G>A	ENST00000558939.1	-	16	3030	c.1653C>T	c.(1651-1653)ggC>ggT	p.G551G	TLE3_ENST00000440567.3_Silent_p.G541G|TLE3_ENST00000539550.1_Silent_p.G478G|TLE3_ENST00000558201.1_Silent_p.G557G|TLE3_ENST00000560589.1_Silent_p.G495G|TLE3_ENST00000557907.1_Silent_p.G543G|TLE3_ENST00000317509.8_Silent_p.G539G|TLE3_ENST00000442299.2_Silent_p.G543G|TLE3_ENST00000451782.2_Silent_p.G548G|TLE3_ENST00000557997.1_Silent_p.G543G|TLE3_ENST00000559048.1_Silent_p.G551G|TLE3_ENST00000558379.1_Silent_p.G546G|TLE3_ENST00000559191.1_Silent_p.G132G|TLE3_ENST00000560939.1_Silent_p.G553G|TLE3_ENST00000559929.1_Silent_p.G561G	NM_001282979.1|NM_001282980.1|NM_001282981.1	NP_001269908.1|NP_001269909.1|NP_001269910.1	Q04726	TLE3_HUMAN	transducin-like enhancer of split 3	551					Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TGCTGGCCTCGCCGCCCACGA	0.657																																					p.G551G													.	.			0			c.C1653T							G	,,	3,4327		0,3,2162	21.0	25.0	24.0		1644,1653,1617	-8.2	0.8	15		24	0,8538		0,0,4269	no	coding-synonymous,coding-synonymous,coding-synonymous	TLE3	NM_001105192.1,NM_005078.2,NM_020908.1	,,	0,3,6431	AA,AG,GG		0.0,0.0693,0.0233	,,	548/770,551/773,539/761	70346959	3,12865	2165	4269	6434	SO:0001819	synonymous_variant	7090	exon16			GGCCTCGCCGCCC	M99438	CCDS45293.1, CCDS45294.1, CCDS58375.1, CCDS61689.1, CCDS61691.1, CCDS61692.1, CCDS73747.1	15q22	2014-03-07	2014-03-07			ENSG00000140332		"""WD repeat domain containing"""	11839	protein-coding gene	gene with protein product		600190	"""transducin-like enhancer of split 3, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005254623		Approved	ESG, ESG3, KIAA1547, HsT18976, GRG3	uc002asm.2	Q04726		ENST00000558939.1:c.1653C>T	15.37:g.70346959G>A			Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_005078	170	0.00	0	B4DPT0|E9PD64|F8W964|Q6PI57|Q8IVV6|Q8WVR2|Q9HCM5	Silent	SNP	ENST00000558939.1	37	CCDS45293.1																																																																																					0.657	TLE3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000416913.1		NM_005078	
CREBBP	1387	mdanderson.org	37	16	3820600	3820600	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr16:3820600G>T	ENST00000262367.5	-	14	3660	c.2851C>A	c.(2851-2853)Cct>Act	p.P951T	CREBBP_ENST00000382070.3_Missense_Mutation_p.P913T	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	951					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GCGTGCACAGGCGTCGGCTGT	0.582			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.P951T				Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	.			0			c.C2851A												116.0	143.0	134.0					16																	3820600		2197	4300	6497	SO:0001583	missense	1387	exon14			GCACAGGCGTCGG	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.2851C>A	16.37:g.3820600G>T	ENSP00000262367:p.Pro951Thr		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_004380	144	0.00	0	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	37	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	G	6.957	0.546380	0.13312	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	D;D	0.84298	-1.83;-1.74	5.87	3.68	0.42216	.	0.148339	0.47852	D	0.000207	T	0.73877	0.3643	N	0.20986	0.625	0.40528	D	0.980906	B;B	0.15141	0.012;0.012	B;B	0.18561	0.022;0.022	T	0.68614	-0.5362	10	0.62326	D	0.03	-4.3227	7.3429	0.26648	0.3749:0.0:0.6251:0.0	.	981;951	Q4LE28;Q92793	.;CBP_HUMAN	T	951;981;913	ENSP00000262367:P951T;ENSP00000371502:P913T	ENSP00000262367:P951T	P	-	1	0	CREBBP	3760601	0.998000	0.40836	0.288000	0.24862	0.200000	0.23975	4.672000	0.61597	0.880000	0.35969	0.655000	0.94253	CCT			0.582	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251591.2		NM_004380	
SOCS1	8651	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	16	11348860	11348860	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr16:11348860C>A	ENST00000332029.2	-	2	626	c.476G>T	c.(475-477)cGc>cTc	p.R159L	RMI2_ENST00000572173.1_Intron	NM_003745.1	NP_003736.1	O15524	SOCS1_HUMAN	suppressor of cytokine signaling 1	159	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cellular response to amino acid stimulus (GO:0071230)|cytokine-mediated signaling pathway (GO:0019221)|fat cell differentiation (GO:0045444)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of protein phosphorylation (GO:0001932)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)	insulin-like growth factor receptor binding (GO:0005159)|kinase inhibitor activity (GO:0019210)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)	p.F144fs*34(1)|p.Y64fs*1(1)|p.R127_*212del(1)|p.0?(1)|p.P158_M161del(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(66)|lung(3)	71						CAGCATGCGGCGCGGCGCCGC	0.726			"""F, O"""		"""Hodgkin Lymphoma, PMBL"""																																p.R159L	Colon(177;456 3548 27231)			Rec	yes		16	16p13.13	8651	suppressor of cytokine signaling 1		L	.	.			5	Deletion - In frame(2)|Deletion - Frameshift(2)|Whole gene deletion(1)	haematopoietic_and_lymphoid_tissue(5)	c.G476T												6.0	8.0	7.0					16																	11348860		2129	4213	6342	SO:0001583	missense	8651	exon2			ATGCGGCGCGGCG	U88326	CCDS10546.1	16p13.13	2013-02-14			ENSG00000185338	ENSG00000185338		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19383	protein-coding gene	gene with protein product		603597				7796808, 9266833	Standard	NM_003745		Approved	SOCS-1, SSI-1, JAB, TIP3, Cish1	uc002dar.1	O15524	OTTHUMG00000129792	ENST00000332029.2:c.476G>T	16.37:g.11348860C>A	ENSP00000329418:p.Arg159Leu		Somatic	10	0	0		WXS	Illumina HiSeq	.	31	0.16	5	NM_003745	42	0.10	4	O15097|Q9NSA7	Missense_Mutation	SNP	ENST00000332029.2	37	CCDS10546.1	.	.	.	.	.	.	.	.	.	.	C	17.09	3.299528	0.60195	.	.	ENSG00000185338	ENST00000332029	T	0.24350	1.86	4.06	4.06	0.47325	SH2 motif (3);	0.260244	0.36374	U	0.002622	T	0.16769	0.0403	N	0.24115	0.695	0.42374	D	0.992461	P	0.40398	0.716	B	0.39660	0.306	T	0.03130	-1.1069	10	0.34782	T	0.22	-24.0711	9.2493	0.37545	0.0:0.9004:0.0:0.0996	.	159	O15524	SOCS1_HUMAN	L	159	ENSP00000329418:R159L	ENSP00000329418:R159L	R	-	2	0	SOCS1	11256361	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	1.533000	0.36040	2.106000	0.64143	0.462000	0.41574	CGC			0.726	SOCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252018.1			
RP11-1166P10.1	0	broad.mit.edu	37	16	31993369	31993371	+	RNA	DEL	CTC	CTC	-	rs541688076|rs60539163	byFrequency	TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	CTC	CTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr16:31993369_31993371delCTC	ENST00000568570.1	+	0	179_181																											TCGTGGACATCTCCTACAGCGAG	0.695														10	0.00199681	0.0015	0.0	5008	,	,		8569	0.002		0.001	False		,,,				2504	0.0051				.													.	.			0			.																																											0	.			GGACATCTCCTAC																													16.37:g.31993369_31993371delCTC			Somatic	20	0.1	2		WXS	Illumina HiSeq	Phase_I	35	0.34	12	.	7	0.00	0		RNA	DEL	ENST00000568570.1	37																																																																																						0.695	RP11-1166P10.1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000432457.1			
ADAD2	161931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	84227812	84227812	+	Intron	SNP	G	G	A			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr16:84227812G>A	ENST00000315906.5	+	2	470				RP11-486L19.2_ENST00000536986.1_RNA|ADAD2_ENST00000268624.3_Missense_Mutation_p.A207T|RP11-486L19.2_ENST00000561900.1_RNA|RP11-486L19.2_ENST00000565643.1_RNA|RP11-486L19.2_ENST00000569834.1_RNA	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2						RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						acgcatccctgctgtggagga	0.602																																					p.A207T													.	.			0			c.G619A												43.0	35.0	38.0					16																	84227812		2192	4287	6479	SO:0001627	intron_variant	161931	exon2			ATCCCTGCTGTGG	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.419-236G>A	16.37:g.84227812G>A			Somatic	73	0	0		WXS	Illumina HiSeq	.	78	0.15	12	NM_139174	0		0	B2RCL6|Q8NA94	Missense_Mutation	SNP	ENST00000315906.5	37	CCDS45536.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.448|7.448	0.642005|0.642005	0.14451|0.14451	.|.	.|.	ENSG00000140955|ENSG00000250685	ENST00000268624|ENST00000536986	T|.	0.18960|.	2.18|.	3.27|3.27	-6.32|-6.32	0.01995|0.01995	.|.	5.342360|.	0.00654|.	N|.	0.000576|.	T|.	0.16642|.	0.0400|.	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|.	0.37337|.	-0.9710|.	10|.	0.21540|0.87932	T|D	0.41|0	.|.	5.5514|5.5514	0.17093|0.17093	0.2904:0.0:0.5714:0.1382|0.2904:0.0:0.5714:0.1382	.|.	207|.	Q8NCV1-2|.	.|.	T|X	207|143	ENSP00000268624:A207T|.	ENSP00000268624:A207T|ENSP00000444170:Q143X	A|Q	+|-	1|1	0|0	ADAD2|AC009123.1	82785313|82785313	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-0.317000|-0.317000	0.08060|0.08060	-1.351000|-1.351000	0.02197|0.02197	-0.300000|-0.300000	0.09419|0.09419	GCT|CAG			0.602	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000433385.1		NM_139174	
FLJ36000	284124	broad.mit.edu	37	17	21906822	21906823	+	lincRNA	INS	-	-	TGTT	rs201476839|rs436179		TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr17:21906822_21906823insTGTT	ENST00000581223.2	+	0	148					NR_027084.1																						gtgtgtgtgtgtgtgtgtgtgt	0.52																																					.													.	.			0			.																																											0	.			GTGTGTGTGTGTG																													17.37:g.21906822_21906823insTGTT			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	9	0.44	4	.	2	0.00	0		RNA	INS	ENST00000581223.2	37																																																																																						0.520	RP11-744K17.9-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000451067.1			
KLHL11	55175	broad.mit.edu	37	17	40010660	40010660	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr17:40010660C>T	ENST00000319121.3	-	2	1519	c.1459G>A	c.(1459-1461)Gca>Aca	p.A487T	RP11-156E6.1_ENST00000560400.1_RNA	NM_018143.1	NP_060613.1	Q9NVR0	KLH11_HUMAN	kelch-like family member 11	487										NS(2)|breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17		Breast(137;0.00156)				ATCTTTGGTGCCGATTCCAAG	0.448																																					p.A487T													KLHL11,colon,carcinoma,+2,1	KLHL11	44	1	0			c.G1459A												93.0	85.0	88.0					17																	40010660		2203	4300	6503	SO:0001583	missense	55175	exon2			TTGGTGCCGATTC		CCDS11411.1	17q21	2013-01-30	2013-01-30		ENSG00000178502	ENSG00000178502		"""Kelch-like"", ""BTB/POZ domain containing"""	19008	protein-coding gene	gene with protein product			"""kelch-like 11 (Drosophila)"""				Standard	NM_018143		Approved	FLJ10572	uc002hyf.1	Q9NVR0	OTTHUMG00000133506	ENST00000319121.3:c.1459G>A	17.37:g.40010660C>T	ENSP00000314608:p.Ala487Thr		Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	164	0.02	4	NM_018143	44	0.00	0		Missense_Mutation	SNP	ENST00000319121.3	37	CCDS11411.1	.	.	.	.	.	.	.	.	.	.	C	18.18	3.565742	0.65651	.	.	ENSG00000178502	ENST00000319121;ENST00000540254	T	0.66638	-0.22	5.26	5.26	0.73747	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	T	0.60274	0.2256	L	0.28274	0.84	0.80722	D	1	B	0.34264	0.446	B	0.36989	0.238	T	0.64778	-0.6327	10	0.87932	D	0	.	19.2191	0.93789	0.0:1.0:0.0:0.0	.	487	Q9NVR0	KLH11_HUMAN	T	487;350	ENSP00000314608:A487T	ENSP00000314608:A487T	A	-	1	0	KLHL11	37264186	1.000000	0.71417	0.968000	0.41197	0.993000	0.82548	7.353000	0.79414	2.606000	0.88127	0.585000	0.79938	GCA			0.448	KLHL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257464.2		NM_018143	
TMUB2	79089	broad.mit.edu	37	17	42266738	42266738	+	Silent	SNP	T	T	G			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr17:42266738T>G	ENST00000587989.1	+	3	537	c.384T>G	c.(382-384)ggT>ggG	p.G128G	TMUB2_ENST00000589184.1_Intron|ASB16-AS1_ENST00000592897.1_RNA|TMUB2_ENST00000589856.1_Silent_p.G108G|TMUB2_ENST00000590235.1_Intron|ASB16-AS1_ENST00000588785.1_RNA|TMUB2_ENST00000587172.1_Intron|ASB16-AS1_ENST00000591166.1_RNA|TMUB2_ENST00000357984.3_Silent_p.G108G|TMUB2_ENST00000538716.2_Silent_p.G128G|TMUB2_ENST00000319511.6_Silent_p.G108G|TMUB2_ENST00000592825.1_Intron|TMUB2_ENST00000589785.1_Silent_p.G108G|TMUB2_ENST00000446571.3_Intron|ASB16-AS1_ENST00000585457.1_RNA			Q71RG4	TMUB2_HUMAN	transmembrane and ubiquitin-like domain containing 2	128						integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(1)|lung(3)	8		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.113)		GAGCTGGGGGTGGTGTTGAGC	0.602																																					p.G128G													.	TMUB2	29		0			c.T384G												53.0	57.0	56.0					17																	42266738		2203	4300	6503	SO:0001819	synonymous_variant	79089	exon3			TGGGGGTGGTGTT		CCDS11479.1, CCDS54134.1	17q21	2006-06-27				ENSG00000168591			28459	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_177441		Approved	MGC3123	uc002ifo.3	Q71RG4		ENST00000587989.1:c.384T>G	17.37:g.42266738T>G			Somatic	51	0.1960784314	10		WXS	Illumina HiSeq	Phase_I	56	0.23	13	NM_001076674	75	0.01	1	B3KU81|Q8NDI2|Q9BPZ5|Q9HAG3	Silent	SNP	ENST00000587989.1	37	CCDS54134.1																																																																																					0.602	TMUB2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000457711.1		NM_177441	
LLGL2	3993	mdanderson.org	37	17	73564574	73564574	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr17:73564574G>T	ENST00000392550.3	+	11	1171	c.1054G>T	c.(1054-1056)Gcc>Tcc	p.A352S	LLGL2_ENST00000577200.1_Missense_Mutation_p.A352S|LLGL2_ENST00000167462.5_Missense_Mutation_p.A352S	NM_001031803.1	NP_001026973.1	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 (Drosophila)	352					cell cycle (GO:0007049)|cell division (GO:0051301)|exocytosis (GO:0006887)|regulation of establishment or maintenance of cell polarity (GO:0032878)	cytoplasm (GO:0005737)	PDZ domain binding (GO:0030165)			NS(1)|breast(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			CGACCCCTATGCCCTGGTGGT	0.642																																					p.A352S													.	.			0			c.G1054T												44.0	37.0	40.0					17																	73564574		2203	4300	6503	SO:0001583	missense	3993	exon11			CCCTATGCCCTGG	X87342	CCDS11725.1, CCDS32733.1, CCDS45776.1	17q25.1	2013-01-10	2001-11-28			ENSG00000073350		"""WD repeat domain containing"""	6629	protein-coding gene	gene with protein product			"""lethal giant larvae (Drosophila) homolog 2"""				Standard	XR_243659		Approved	HGL	uc002joh.3	Q6P1M3		ENST00000392550.3:c.1054G>T	17.37:g.73564574G>T	ENSP00000376333:p.Ala352Ser		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_004524	74	0.00	0	Q14521|Q9BR62	Missense_Mutation	SNP	ENST00000392550.3	37	CCDS32733.1	.	.	.	.	.	.	.	.	.	.	G	14.21	2.468108	0.43839	.	.	ENSG00000073350	ENST00000167462;ENST00000392550;ENST00000545227	T;T	0.11495	2.77;2.77	5.33	5.33	0.75918	WD40 repeat-like-containing domain (1);Lethal giant larvae homologue 2 (1);	0.000000	0.85682	D	0.000000	T	0.30417	0.0764	M	0.75777	2.31	0.58432	D	0.999998	D;D;B;B	0.54601	0.967;0.959;0.23;0.272	P;P;B;B	0.56865	0.808;0.709;0.255;0.283	T	0.01488	-1.1342	10	0.49607	T	0.09	-34.7102	19.014	0.92886	0.0:0.0:1.0:0.0	.	341;341;352;352	B3KX47;G3V1I9;Q6P1M3-2;Q6P1M3	.;.;.;L2GL2_HUMAN	S	352;352;341	ENSP00000167462:A352S;ENSP00000376333:A352S	ENSP00000167462:A352S	A	+	1	0	LLGL2	71076169	1.000000	0.71417	0.974000	0.42286	0.535000	0.34838	7.964000	0.87933	2.475000	0.83589	0.561000	0.74099	GCC			0.642	LLGL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000447633.1		NM_004524	
TBCD	6904	broad.mit.edu	37	17	80851439	80851439	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr17:80851439G>T	ENST00000355528.4	+	17	1710	c.1580G>T	c.(1579-1581)gGt>gTt	p.G527V	TBCD_ENST00000397466.2_Missense_Mutation_p.G141V|TBCD_ENST00000539345.2_Missense_Mutation_p.G527V	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D	527					'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)					Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			TTCCCTCATGGTATTGATATT	0.363																																					p.G527V													.	TBCD	94		0			c.G1580T												121.0	104.0	109.0					17																	80851439		1862	4098	5960	SO:0001583	missense	6904	exon17			CTCATGGTATTGA	BC003094	CCDS45818.1	17q25.3	2006-11-21	2006-11-21			ENSG00000141556			11581	protein-coding gene	gene with protein product		604649	"""tubulin-specific chaperone d"""				Standard	NM_005993		Approved		uc002kfz.3	Q9BTW9		ENST00000355528.4:c.1580G>T	17.37:g.80851439G>T	ENSP00000347719:p.Gly527Val		Somatic	376	0.0026595745	1		WXS	Illumina HiSeq	Phase_I	338	0.02	8	NM_005993	490	0.00	0	O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Missense_Mutation	SNP	ENST00000355528.4	37	CCDS45818.1	.	.	.	.	.	.	.	.	.	.	G	13.34	2.206870	0.39003	.	.	ENSG00000141556	ENST00000355528;ENST00000334614;ENST00000397466;ENST00000536182	T;T	0.56611	0.45;0.45	4.64	4.64	0.57946	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.81809	0.4901	H	0.96777	3.88	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.88739	0.3242	9	.	.	.	.	16.4639	0.84072	0.0:0.0:1.0:0.0	.	527;527;527	Q9BTW9;Q9BTW9-4;F5H8C7	TBCD_HUMAN;.;.	V	527;278;141;527	ENSP00000347719:G527V;ENSP00000380608:G141V	.	G	+	2	0	TBCD	78444728	1.000000	0.71417	0.982000	0.44146	0.035000	0.12851	7.427000	0.80284	2.106000	0.64143	0.514000	0.50259	GGT			0.363	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000439415.1		NM_005993	
ABHD17A	81926	hgsc.bcm.edu	37	19	1881263	1881263	+	Silent	SNP	G	G	A			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr19:1881263G>A	ENST00000292577.7	-	2	736	c.303C>T	c.(301-303)tgC>tgT	p.C101C	ABHD17A_ENST00000590661.1_Silent_p.C101C|ABHD17A_ENST00000250974.9_Silent_p.C101C	NM_001130111.1	NP_001123583.1	Q96GS6	AB17A_HUMAN	abhydrolase domain containing 17A	101						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)	p.C101C(3)									GAACATACATGCAGGAGACGC	0.662																																					p.C101C													FAM108A1,NS,carcinoma,0,2	FAM108A1	0	2	3	Substitution - coding silent(3)	lung(2)|endometrium(1)	c.C303T												35.0	39.0	38.0					19																	1881263		2202	4299	6501	SO:0001819	synonymous_variant	81926	exon2			ATACATGCAGGAG	BC020512	CCDS32867.1, CCDS45902.1	19p13.3	2013-03-15	2013-03-15	2013-03-15	ENSG00000129968	ENSG00000129968		"""Abhydrolase domain containing"""	28756	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 27"", ""family with sequence similarity 108, member A1"""	C19orf27, FAM108A1		14702039	Standard	NM_031213		Approved	MGC5244	uc002lug.3	Q96GS6	OTTHUMG00000171872	ENST00000292577.7:c.303C>T	19.37:g.1881263G>A			Somatic	50	0	0		WXS	Illumina HiSeq	.	57	0.05	3	NM_031213	296	0.00	0	A8K0G8|D6W5Z9|Q6PJU2|Q8WUH9|Q9BWL0|Q9H7Q9	Silent	SNP	ENST00000292577.7	37	CCDS45902.1																																																																																					0.662	ABHD17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000415556.2		NM_031213	
ABHD17A	81926	broad.mit.edu;mdanderson.org	37	19	1881347	1881347	+	Silent	SNP	A	A	G			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr19:1881347A>G	ENST00000292577.7	-	2	652	c.219T>C	c.(217-219)cgT>cgC	p.R73R	ABHD17A_ENST00000590661.1_Silent_p.R73R|ABHD17A_ENST00000250974.9_Silent_p.R73R	NM_001130111.1	NP_001123583.1	Q96GS6	AB17A_HUMAN	abhydrolase domain containing 17A	73						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)										GGAAGTCGGCACGCTCCGTCA	0.716																																					p.R73R													FAM108A1,NS,carcinoma,0,1	FAM108A1	29	1	0			c.T219C												19.0	22.0	21.0					19																	1881347		2188	4262	6450	SO:0001819	synonymous_variant	81926	exon2			GTCGGCACGCTCC	BC020512	CCDS32867.1, CCDS45902.1	19p13.3	2013-03-15	2013-03-15	2013-03-15	ENSG00000129968	ENSG00000129968		"""Abhydrolase domain containing"""	28756	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 27"", ""family with sequence similarity 108, member A1"""	C19orf27, FAM108A1		14702039	Standard	NM_031213		Approved	MGC5244	uc002lug.3	Q96GS6	OTTHUMG00000171872	ENST00000292577.7:c.219T>C	19.37:g.1881347A>G			Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	21	0.14	3	NM_031213	137	0.00	0	A8K0G8|D6W5Z9|Q6PJU2|Q8WUH9|Q9BWL0|Q9H7Q9	Silent	SNP	ENST00000292577.7	37	CCDS45902.1																																																																																					0.716	ABHD17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000415556.2		NM_031213	
ZNF799	90576	ucsc.edu	37	19	12501855	12501855	+	Missense_Mutation	SNP	A	A	G	rs201077492|rs79480756		TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr19:12501855A>G	ENST00000430385.3	-	4	1557	c.1357T>C	c.(1357-1359)Tgt>Cgt	p.C453R	CTD-3105H18.14_ENST00000435033.1_Intron|ZNF799_ENST00000419318.1_Missense_Mutation_p.C421R	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	453					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						GCTTTCCCACATTTGCATTTA	0.388																																					p.C453R													.	ZNF799	111		0			c.T1357C												76.0	81.0	79.0					19																	12501855		2202	4299	6501	SO:0001583	missense	90576	exon4			TCCCACATTTGCA	BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.1357T>C	19.37:g.12501855A>G	ENSP00000411084:p.Cys453Arg		Somatic	140	0.0285714286	4		RNA-Seq	Illumina HiSeq		160	0.03	5	NM_001080821	58	0.16	9		Missense_Mutation	SNP	ENST00000430385.3	37	CCDS45989.1	.	.	.	.	.	.	.	.	.	.	A	15.29	2.790257	0.50102	.	.	ENSG00000196466	ENST00000419318;ENST00000430385	D;D	0.85955	-2.05;-2.05	1.31	1.31	0.21738	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.87791	0.6266	H	0.95950	3.745	0.58432	D	0.999998	B	0.02656	0.0	B	0.10450	0.005	D	0.85733	0.1332	9	0.72032	D	0.01	.	6.6913	0.23174	1.0:0.0:0.0:0.0	.	453	Q96GE5	ZN799_HUMAN	R	421;453	ENSP00000415278:C421R;ENSP00000411084:C453R	ENSP00000415278:C421R	C	-	1	0	ZNF799	12362855	0.997000	0.39634	0.001000	0.08648	0.965000	0.64279	5.185000	0.65076	0.846000	0.35142	0.352000	0.21897	TGT			0.388	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000344099.2	rescued with RNA-seq	NM_001080821	
RHPN2	85415	hgsc.bcm.edu	37	19	33493842	33493842	+	Missense_Mutation	SNP	C	C	A	rs137892450	byFrequency	TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr19:33493842C>A	ENST00000254260.3	-	8	860	c.825G>T	c.(823-825)atG>atT	p.M275I	RHPN2_ENST00000400226.4_Missense_Mutation_p.M124I	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	275	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					GCACGCTGAGCATGGCAGGGC	0.448																																					p.M275I													RHPN2,NS,neuroblastoma,0,1	RHPN2	0	1	0			c.G825T												54.0	49.0	50.0					19																	33493842		2203	4300	6503	SO:0001583	missense	85415	exon8			GCTGAGCATGGCA	AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.825G>T	19.37:g.33493842C>A	ENSP00000254260:p.Met275Ile		Somatic	43	0.023255814	1		WXS	Illumina HiSeq	.	68	0.04	3	NM_033103	11	0.00	0	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Missense_Mutation	SNP	ENST00000254260.3	37	CCDS12427.1	.	.	.	.	.	.	.	.	.	.	C	17.99	3.524256	0.64747	.	.	ENSG00000131941	ENST00000254260;ENST00000544458;ENST00000400226	T;T	0.16324	2.35;2.35	4.9	4.9	0.64082	BRO1 domain (3);	0.035852	0.85682	D	0.000000	T	0.23370	0.0565	M	0.72576	2.205	0.80722	D	1	P	0.41475	0.751	B	0.36959	0.237	T	0.07158	-1.0787	10	0.44086	T	0.13	-4.5596	18.4946	0.90860	0.0:1.0:0.0:0.0	.	275	Q8IUC4	RHPN2_HUMAN	I	275;5;124	ENSP00000254260:M275I;ENSP00000402244:M124I	ENSP00000254260:M275I	M	-	3	0	RHPN2	38185682	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.752000	0.85141	2.432000	0.82394	0.478000	0.44815	ATG	0		0.448	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450828.2		NM_033103	
NUMBL	9253	broad.mit.edu	37	19	41173907	41173907	+	Silent	SNP	C	C	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr19:41173907C>T	ENST00000252891.4	-	10	1463	c.1296G>A	c.(1294-1296)caG>caA	p.Q432Q	NUMBL_ENST00000540131.1_Silent_p.Q391Q|NUMBL_ENST00000598779.1_Silent_p.Q391Q	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	432	Poly-Gln.				adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			gttgctgttgctgctgctgct	0.657																																					p.Q432Q													.	NUMBL	49		0			c.G1296A												8.0	8.0	8.0					19																	41173907		2126	4142	6268	SO:0001819	synonymous_variant	9253	exon10			CTGTTGCTGCTGC	AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.1296G>A	19.37:g.41173907C>T			Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	55	0.05	3	NM_004756	69	0.00	0	Q7Z4J9	Silent	SNP	ENST00000252891.4	37	CCDS12561.1																																																																																					0.657	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462749.2		NM_004756	
ZNF180	7733	bcgsc.ca	37	19	44977071	44977071	+	IGR	SNP	C	C	G	rs1897824	byFrequency	TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr19:44977071C>G	ENST00000221327.4	-	0	3126				AC069278.4_ENST00000591684.1_lincRNA	NM_013256.3	NP_037388.2	Q9UJW8	ZN180_HUMAN	zinc finger protein 180						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(14)|lung(6)|ovary(2)|urinary_tract(1)	33		Prostate(69;0.0435)				AAGGATTTTGCGTATAGCTCT	0.413																																					.	Esophageal Squamous(180;1353 2003 32862 46574 49854)												.	.			0			.																																									SO:0001628	intergenic_variant	147711	.			ATTTTGCGTATAG	AF192913	CCDS12639.1, CCDS62707.1, CCDS62708.1	19q13.2	2013-01-08	2006-08-22			ENSG00000167384		"""Zinc fingers, C2H2-type"", ""-"""	12970	protein-coding gene	gene with protein product		606740	"""zinc finger protein 180 (HHZ168)"""				Standard	NM_001288762		Approved	HHZ168	uc002ozf.4	Q9UJW8			19.37:g.44977071C>G			Somatic	143	0.020979021	3		WXS	Illumina HiSeq	Phase_1	136	0.10	13	.	2	0.00	0	B2RCN6|B3KV56|K7EQX9|Q58F03|Q9P1U2	RNA	SNP	ENST00000221327.4	37	CCDS12639.1																																																																																					0.413	ZNF180-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000451601.1		NM_013256	
IZUMO2	126123	mdanderson.org	37	19	50657888	50657888	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr19:50657888C>T	ENST00000293405.3	-	6	592	c.592G>A	c.(592-594)Gct>Act	p.A198T		NM_152358.2	NP_689571.2	Q6UXV1	IZUM2_HUMAN	IZUMO family member 2	198						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	7						ACAAAGACAGCCAGAGACACA	0.607																																					p.A198T													.	.			0			c.G592A												134.0	157.0	150.0					19																	50657888		2127	4235	6362	SO:0001583	missense	126123	exon6			AGACAGCCAGAGA	AY358196	CCDS12792.2	19q13.33	2014-02-17	2010-07-29	2010-07-29	ENSG00000161652	ENSG00000161652		"""-"""	28518	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 41"""	C19orf41		19658160, 22957301	Standard	XM_006723007		Approved	MGC33947, SCRL	uc002prp.1	Q6UXV1	OTTHUMG00000074063	ENST00000293405.3:c.592G>A	19.37:g.50657888C>T	ENSP00000293405:p.Ala198Thr		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_152358	3	0.00	0	Q5GRG3|Q5GRG4|Q6ZNM5|Q8NHR8	Missense_Mutation	SNP	ENST00000293405.3	37	CCDS12792.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.94|14.94	2.684238|2.684238	0.47991|0.47991	.|.	.|.	ENSG00000161652|ENSG00000161652	ENST00000293405|ENST00000377000	T|.	0.57273|.	0.41|.	3.43|3.43	1.14|1.14	0.20703|0.20703	.|.	.|.	.|.	.|.	.|.	T|.	0.35998|.	0.0951|.	L|L	0.34521|0.34521	1.04|1.04	0.09310|0.09310	N|N	1|1	P|.	0.52061|.	0.95|.	P|.	0.48921|.	0.595|.	T|.	0.32587|.	-0.9901|.	9|.	0.72032|0.72032	D|D	0.01|0.01	.|.	8.0636|8.0636	0.30648|0.30648	0.4395:0.5605:0.0:0.0|0.4395:0.5605:0.0:0.0	.|.	198|.	Q6UXV1|.	IZUM2_HUMAN|.	T|X	198|162	ENSP00000293405:A198T|.	ENSP00000293405:A198T|ENSP00000366199:W162X	A|W	-|-	1|3	0|0	IZUMO2|IZUMO2	55349700|55349700	0.971000|0.971000	0.33674|0.33674	0.017000|0.017000	0.16124|0.16124	0.079000|0.079000	0.17450|0.17450	1.475000|1.475000	0.35409|0.35409	0.399000|0.399000	0.25367|0.25367	0.305000|0.305000	0.20034|0.20034	GCT|TGG			0.607	IZUMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000157232.1		NM_152358	
COBLL1	22837	broad.mit.edu	37	2	165586537	165586537	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr2:165586537G>T	ENST00000392717.2	-	4	437	c.433C>A	c.(433-435)Cag>Aag	p.Q145K	COBLL1_ENST00000375458.2_Missense_Mutation_p.Q107K|COBLL1_ENST00000342193.4_Missense_Mutation_p.Q107K|COBLL1_ENST00000491126.2_Intron|COBLL1_ENST00000194871.6_Missense_Mutation_p.Q160K|COBLL1_ENST00000409184.3_Missense_Mutation_p.Q145K			Q53SF7	COBL1_HUMAN	cordon-bleu WH2 repeat protein-like 1	145						extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	47						ATGTGGTTCTGTTCAGCTGAC	0.353																																					p.Q107K													.	COBLL1	122		0			c.C319A												164.0	149.0	154.0					2																	165586537		2203	4300	6503	SO:0001583	missense	22837	exon3			GGTTCTGTTCAGC	AB023194	CCDS2223.2, CCDS63045.1	2q24.3	2012-12-07	2012-12-07		ENSG00000082438	ENSG00000082438			23571	protein-coding gene	gene with protein product		610318	"""COBL-like 1"""				Standard	NM_001278458		Approved	KIAA0977	uc002ucp.3	Q53SF7	OTTHUMG00000074019	ENST00000392717.2:c.433C>A	2.37:g.165586537G>T	ENSP00000376478:p.Gln145Lys		Somatic	129	0	0		WXS	Illumina HiSeq	Phase_I	130	0.02	3	NM_014900	14	0.00	0	A6NMZ3|Q6IQ33|Q7Z3I6|Q9BRH4|Q9UG88|Q9Y2I3	Missense_Mutation	SNP	ENST00000392717.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.815|2.815	-0.246123|-0.246123	0.05906|0.05906	.|.	.|.	ENSG00000082438|ENSG00000082438	ENST00000375458;ENST00000342193;ENST00000409184;ENST00000392717;ENST00000194871;ENST00000456693;ENST00000448708;ENST00000439313;ENST00000444537;ENST00000414843|ENST00000452626	D;D;D;D;D;D;D;D;D;D|.	0.91843|.	-2.92;-2.92;-2.92;-2.92;-2.92;-2.92;-2.92;-2.92;-2.92;-2.92|.	5.69|5.69	2.0|2.0	0.26442|0.26442	Cordon-bleu domain (1);|.	0.728809|.	0.14642|.	N|.	0.307126|.	T|T	0.16214|0.16214	0.0390|0.0390	N|N	0.08118|0.08118	0|0	0.22435|0.22435	N|N	0.999104|0.999104	B;B;B|.	0.06786|.	0.001;0.001;0.001|.	B;B;B|.	0.06405|.	0.002;0.002;0.001|.	T|T	0.27088|0.27088	-1.0084|-1.0084	10|5	0.08381|.	T|.	0.77|.	-0.3727|-0.3727	5.4844|5.4844	0.16741|0.16741	0.0:0.1469:0.2966:0.5565|0.0:0.1469:0.2966:0.5565	.|.	145;160;145|.	Q53SF7;B7Z2P5;Q53SF7-2|.	COBL1_HUMAN;.;.|.	K|K	107;107;145;145;160;82;107;114;129;107|109	ENSP00000364607:Q107K;ENSP00000341360:Q107K;ENSP00000387326:Q145K;ENSP00000376478:Q145K;ENSP00000194871:Q160K;ENSP00000397520:Q82K;ENSP00000406062:Q107K;ENSP00000397835:Q114K;ENSP00000409237:Q129K;ENSP00000387967:Q107K|.	ENSP00000194871:Q160K|.	Q|T	-|-	1|2	0|0	COBLL1|COBLL1	165294783|165294783	1.000000|1.000000	0.71417|0.71417	0.775000|0.775000	0.31657|0.31657	0.878000|0.878000	0.50629|0.50629	3.393000|3.393000	0.52544|0.52544	0.106000|0.106000	0.17784|0.17784	-0.271000|-0.271000	0.10264|0.10264	CAG|ACA			0.353	COBLL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding				NM_014900	
GMPPA	29926	mdanderson.org	37	2	220370469	220370469	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr2:220370469G>T	ENST00000358215.3	+	10	1255	c.886G>T	c.(886-888)Gcc>Tcc	p.A296S	AC053503.11_ENST00000429882.1_RNA|GMPPA_ENST00000373917.3_Missense_Mutation_p.A349S|GMPPA_ENST00000313597.5_Missense_Mutation_p.A296S|GMPPA_ENST00000341142.3_Missense_Mutation_p.A296S|GMPPA_ENST00000373908.1_Missense_Mutation_p.A296S	NM_205847.2	NP_995319.1	Q96IJ6	GMPPA_HUMAN	GDP-mannose pyrophosphorylase A	296					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotidyltransferase activity (GO:0016779)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	20		Renal(207;0.0183)		Epithelial(149;3.82e-10)|all cancers(144;6.25e-08)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00807)|READ - Rectum adenocarcinoma(5;0.148)		CGCCAAGGTGGCCCCCTCGGC	0.627																																					p.A296S													.	.			0			c.G886T												48.0	54.0	52.0					2																	220370469		2203	4300	6503	SO:0001583	missense	29926	exon10			AAGGTGGCCCCCT	AF135422	CCDS2441.1	2q36.1	2008-02-05			ENSG00000144591	ENSG00000144591			22923	protein-coding gene	gene with protein product		615495					Standard	NM_205847		Approved		uc002vlr.3	Q96IJ6	OTTHUMG00000058922	ENST00000358215.3:c.886G>T	2.37:g.220370469G>T	ENSP00000350949:p.Ala296Ser		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_205847	124	0.00	0	A6NJ74|A8K3Q6|B3KMT4|Q53GI0|Q9NWC3|Q9Y5P5	Missense_Mutation	SNP	ENST00000358215.3	37	CCDS2441.1	.	.	.	.	.	.	.	.	.	.	g	16.87	3.242550	0.58995	.	.	ENSG00000144591	ENST00000313597;ENST00000373917;ENST00000358215;ENST00000373908;ENST00000341142	T;T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03;-1.03	4.77	4.77	0.60923	Hexapeptide transferase, conserved site (1);	0.057639	0.64402	D	0.000003	T	0.68229	0.2978	N	0.16903	0.455	0.34854	D	0.74198	B;B	0.32862	0.195;0.387	B;B	0.39771	0.122;0.309	T	0.71076	-0.4697	10	0.17832	T	0.49	5.19	17.4151	0.87497	0.0:0.0:1.0:0.0	.	349;296	Q96IJ6-2;Q96IJ6	.;GMPPA_HUMAN	S	296;349;296;296;296	ENSP00000315925:A296S;ENSP00000363027:A349S;ENSP00000350949:A296S;ENSP00000363016:A296S;ENSP00000340760:A296S	ENSP00000315925:A296S	A	+	1	0	GMPPA	220078713	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	6.102000	0.71486	2.183000	0.69458	0.558000	0.71614	GCC			0.627	GMPPA-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000130230.1		NM_013335	
FRG1B	284802	bcgsc.ca	37	20	29628229	29628229	+	Silent	SNP	G	G	T	rs373737774		TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr20:29628229G>T	ENST00000278882.3	+	6	611	c.231G>T	c.(229-231)ggG>ggT	p.G77G	FRG1B_ENST00000358464.4_Silent_p.G77G|FRG1B_ENST00000439954.2_Silent_p.G82G			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	77										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TCACTTAGGGGAAAATGGCTT	0.353																																					.													.	FRG1B	181		0			.																																									SO:0001819	synonymous_variant	284802	.			TTAGGGGAAAATG			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.231G>T	20.37:g.29628229G>T			Somatic	312	0.0224358974	7		WXS	Illumina HiSeq	Phase_1	321	0.07	22	.	136	0.00	0	C4AME5	Silent	SNP	ENST00000278882.3	37																																																																																						0.353	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000078494.2		NR_003579	
PIGT	51604	broad.mit.edu	37	20	44053178	44053178	+	Silent	SNP	C	C	A	rs79813306		TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr20:44053178C>A	ENST00000279036.6	+	11	1523	c.1443C>A	c.(1441-1443)gcC>gcA	p.A481A	PIGT_ENST00000545755.1_Silent_p.A219A|PIGT_ENST00000535404.1_Silent_p.A326A|PIGT_ENST00000372689.5_Silent_p.A414A|PIGT_ENST00000279035.9_Silent_p.A379A|PIGT_ENST00000543458.2_Silent_p.A425A|PIGT_ENST00000341555.5_Silent_p.A287A	NM_015937.5	NP_057021.2	Q969N2	PIGT_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class T	481					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|post-translational protein modification (GO:0043687)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)			breast(1)|endometrium(2)|kidney(5)|large_intestine(4)|lung(7)|pancreas(1)|skin(1)|stomach(1)	22		Myeloproliferative disorder(115;0.0122)				TGGTAGCAGCCAAGCCAGTGG	0.562																																					p.A481A													PIGT,NS,carcinoma,0,1	PIGT	85	1	0			c.C1443A												84.0	79.0	80.0					20																	44053178		2203	4300	6503	SO:0001819	synonymous_variant	51604	exon11			AGCAGCCAAGCCA		CCDS13353.1, CCDS54464.1, CCDS54465.1, CCDS54466.1	20q12-q13.12	2013-02-26	2006-06-28		ENSG00000124155	ENSG00000124155		"""Phosphatidylinositol glycan anchor biosynthesis"""	14938	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610272	"""phosphatidylinositol glycan, class T"""			15713669	Standard	NM_015937		Approved		uc002xoh.3	Q969N2	OTTHUMG00000032574	ENST00000279036.6:c.1443C>A	20.37:g.44053178C>A			Somatic	103	0.0388349515	4		WXS	Illumina HiSeq	Phase_I	122	0.07	8	NM_015937	371	0.02	6	B2RND5|B7Z3N1|B7Z7I8|E1P622|G8JLF5|Q2NL69|Q7Z3N7|Q9BQY7|Q9BQY8|Q9UJG6|Q9Y2Z5	Silent	SNP	ENST00000279036.6	37	CCDS13353.1																																																																																					0.562	PIGT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079434.2		NM_015937	
NCOA3	8202	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	46264898	46264898	+	Silent	SNP	A	A	C			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr20:46264898A>C	ENST00000371998.3	+	12	1959	c.1768A>C	c.(1768-1770)Aga>Cga	p.R590R	NCOA3_ENST00000341724.6_Silent_p.R600R|NCOA3_ENST00000372004.3_Silent_p.R590R|NCOA3_ENST00000371997.3_Silent_p.R600R			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	590	Ser-rich.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						GTCAAATAGCAGAGATCACCT	0.433																																					p.R600R													.	.			0			c.A1798C												64.0	62.0	62.0					20																	46264898		2203	4300	6503	SO:0001819	synonymous_variant	8202	exon12			AATAGCAGAGATC	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.1768A>C	20.37:g.46264898A>C			Somatic	117	0	0		WXS	Illumina HiSeq	.	119	0.15	18	NM_001174088	67	0.22	15	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Silent	SNP	ENST00000371998.3	37	CCDS13407.1																																																																																					0.433	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000080405.1		NM_006534	
PCK1	5105	broad.mit.edu;mdanderson.org	37	20	56138710	56138710	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr20:56138710G>T	ENST00000319441.4	+	6	1052	c.888G>T	c.(886-888)atG>atT	p.M296I	PCK1_ENST00000535860.1_Missense_Mutation_p.M164I|PCK1_ENST00000543666.1_Intron	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	296					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)			endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			TGGCCATGATGAACCCCAGCC	0.567																																					p.M296I													.	PCK1	95		0			c.G888T												104.0	98.0	100.0					20																	56138710		2203	4300	6503	SO:0001583	missense	5105	exon6			CATGATGAACCCC		CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.888G>T	20.37:g.56138710G>T	ENSP00000319814:p.Met296Ile		Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	65	0.08	5	NM_002591	0		0	A8K437|B4DT64|Q8TCA3|Q9UJD2	Missense_Mutation	SNP	ENST00000319441.4	37	CCDS13460.1	.	.	.	.	.	.	.	.	.	.	G	16.69	3.193736	0.58017	.	.	ENSG00000124253	ENST00000319441;ENST00000535860	T;T	0.03831	3.79;3.79	5.27	5.27	0.74061	Phosphoenolpyruvate carboxykinase, C-terminal (1);	0.045081	0.85682	D	0.000000	T	0.11410	0.0278	L	0.61036	1.89	0.58432	D	0.999994	B	0.27416	0.178	B	0.36030	0.216	T	0.04373	-1.0956	10	0.52906	T	0.07	-44.3209	18.8895	0.92392	0.0:0.0:1.0:0.0	.	296	P35558	PCKGC_HUMAN	I	296;164	ENSP00000319814:M296I;ENSP00000444342:M164I	ENSP00000319814:M296I	M	+	3	0	PCK1	55572116	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.780000	0.68956	2.478000	0.83669	0.561000	0.74099	ATG			0.567	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079851.2			
RTEL1	51750	hgsc.bcm.edu	37	20	62311958	62311958	+	Intron	SNP	G	G	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr20:62311958G>T	ENST00000360203.5	+	14	1460				RTEL1-TNFRSF6B_ENST00000482936.1_Intron|RTEL1_ENST00000370018.3_Intron|RTEL1_ENST00000318100.4_Intron|RTEL1_ENST00000508582.2_Intron					regulator of telomere elongation helicase 1											NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			AAGGGCCGGGGCTGGGGTCGG	0.697																																					.													.	.			0			.												31.0	33.0	32.0					20																	62311958		692	1589	2281	SO:0001627	intron_variant	100533107	.			GCCGGGGCTGGGG	AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.1136-59G>T	20.37:g.62311958G>T			Somatic	27	0	0		WXS	Illumina HiSeq	.	36	0.25	9	.	0		0		RNA	SNP	ENST00000360203.5	37																																																																																						0.697	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000289781.1		NM_032957	
ZNF512B	57473	mdanderson.org	37	20	62593699	62593699	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr20:62593699G>A	ENST00000450537.1	-	14	2252	c.2192C>T	c.(2191-2193)aCg>aTg	p.T731M	ZNF512B_ENST00000217130.3_Missense_Mutation_p.T731M|ZNF512B_ENST00000369888.1_Missense_Mutation_p.T731M			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	731					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					GGGGTTCAGCGTGGGGAGCCC	0.607																																					p.T731M													.	.			0			c.C2192T												94.0	86.0	89.0					20																	62593699		2203	4300	6503	SO:0001583	missense	57473	exon14			TTCAGCGTGGGGA	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.2192C>T	20.37:g.62593699G>A	ENSP00000393795:p.Thr731Met		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_020713	40	0.00	0	Q08AK9|Q9ULM4	Missense_Mutation	SNP	ENST00000450537.1	37	CCDS13548.1	.	.	.	.	.	.	.	.	.	.	G	14.79	2.641251	0.47153	.	.	ENSG00000196700	ENST00000369888;ENST00000450537;ENST00000217130	T;T;T	0.26067	1.76;1.76;1.76	5.48	4.52	0.55395	.	0.317411	0.33382	N	0.004976	T	0.30293	0.0760	L	0.55481	1.735	0.27430	N	0.954039	D	0.56035	0.974	P	0.49752	0.621	T	0.23154	-1.0196	10	0.87932	D	0	-3.9016	6.9121	0.24340	0.0915:0.0:0.6916:0.2169	.	731	Q96KM6	Z512B_HUMAN	M	731	ENSP00000358904:T731M;ENSP00000393795:T731M;ENSP00000217130:T731M	ENSP00000217130:T731M	T	-	2	0	ZNF512B	62064143	1.000000	0.71417	0.737000	0.30932	0.889000	0.51656	4.359000	0.59449	1.280000	0.44463	0.557000	0.71058	ACG			0.607	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080246.1		NM_020713	
BAGE2	85319	broad.mit.edu	37	21	11058605	11058605	+	RNA	DEL	T	T	-			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr21:11058605delT	ENST00000470054.1	-	0	324							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AACCTAAAGATTTTTTTTTAA	0.269																																					.													.	.			0			.																																											85319	.			TAAAGATTTTTTT	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11058605delT			Somatic	14	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0	A8K925|Q08ER0	RNA	DEL	ENST00000470054.1	37																																																																																						0.269	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000157417.3		NM_182482	
SMPD4P1	645280	broad.mit.edu	37	22	20977441	20977441	+	RNA	DEL	A	A	-	rs531775638|rs76108644|rs398101678	byFrequency	TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr22:20977441delA	ENST00000443839.1	-	0	1396									sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3) pseudogene 1																		AAATTAAGGGaaaaaaaaaac	0.333																																					.													.	.			0			.																																											0	.			TAAGGGAAAAAAA			22q11.21	2011-03-22			ENSG00000223553	ENSG00000223553			39673	pseudogene	pseudogene							Standard	NG_028286		Approved				OTTHUMG00000030245		22.37:g.20977441delA			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	8	0.38	3	.	0		0		RNA	DEL	ENST00000443839.1	37																																																																																						0.333	SMPD4P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000319965.1			
THAP7	80764	hgsc.bcm.edu;broad.mit.edu	37	22	21354471	21354471	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr22:21354471A>G	ENST00000215742.4	-	4	802	c.628T>C	c.(628-630)Tcc>Ccc	p.S210P	THAP7-AS1_ENST00000452284.1_RNA|THAP7-AS1_ENST00000429962.1_RNA|THAP7_ENST00000399133.2_Missense_Mutation_p.S210P|THAP7-AS1_ENST00000436079.1_RNA	NM_030573.2	NP_085050.2	Q9BT49	THAP7_HUMAN	THAP domain containing 7	210					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nuclear speck (GO:0016607)	C2H2 zinc finger domain binding (GO:0070742)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)			cervix(1)|lung(2)|prostate(3)|skin(1)|stomach(1)	8	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			GCTGAGGGGGAGACTGGCCGT	0.662																																					p.S210P													THAP7,trunk,malignant_melanoma,+1,1	THAP7	1	1	0			c.T628C												7.0	8.0	7.0					22																	21354471		2138	4208	6346	SO:0001583	missense	80764	exon4			AGGGGGAGACTGG	BC004346	CCDS13787.1	22q11.2	2013-01-25			ENSG00000184436	ENSG00000184436		"""THAP (C2CH-type zinc finger) domain containing"""	23190	protein-coding gene	gene with protein product		609518				12575992	Standard	NM_030573		Approved	MGC10963	uc002ztr.1	Q9BT49	OTTHUMG00000150879	ENST00000215742.4:c.628T>C	22.37:g.21354471A>G	ENSP00000215742:p.Ser210Pro		Somatic	59	0.0169491525	1		WXS	Illumina HiSeq	.	70	0.07	5	NM_030573	121	0.00	0	B2RD97|D3DX40	Missense_Mutation	SNP	ENST00000215742.4	37	CCDS13787.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.307676	0.81247	.	.	ENSG00000184436	ENST00000215742;ENST00000399133	D;D	0.96992	-4.2;-4.2	4.3	4.3	0.51218	.	0.418178	0.19936	N	0.102742	D	0.95692	0.8599	N	0.24115	0.695	0.48511	D	0.999665	D	0.71674	0.998	D	0.77557	0.99	D	0.94829	0.7994	10	0.42905	T	0.14	-8.1892	11.6959	0.51542	1.0:0.0:0.0:0.0	.	210	Q9BT49	THAP7_HUMAN	P	210	ENSP00000215742:S210P;ENSP00000382084:S210P	ENSP00000215742:S210P	S	-	1	0	THAP7	19684471	0.994000	0.37717	0.476000	0.27291	0.987000	0.75469	3.986000	0.56937	1.900000	0.55004	0.533000	0.62120	TCC			0.662	THAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320405.1		NM_030573	
POM121L9P	29774	broad.mit.edu	37	22	24659809	24659809	+	RNA	SNP	G	G	A	rs376621154		TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr22:24659809G>A	ENST00000414583.2	+	0	3334					NR_003714.1				POM121 transmembrane nucleoporin-like 9, pseudogene																		CCCTATCTGCGCACCCGGAGG	0.612																																					.													.	.			0			.																																											0	.			ATCTGCGCACCCG	AL040062, AL117401		22q11.22	2012-03-13	2012-03-13		ENSG00000128262	ENSG00000128262			30080	pseudogene	pseudogene			"""POM121 membrane glycoprotein-like 9, pseudogene"""				Standard	NR_003714		Approved				OTTHUMG00000150763		22.37:g.24659809G>A			Somatic	10	0	0		WXS	Illumina HiSeq	Phase_I	21	0.14	3	.	2	0.00	0		RNA	SNP	ENST00000414583.2	37																																																																																						0.612	POM121L9P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000319991.1		NM_014549	
POM121L9P	29774	broad.mit.edu	37	22	24659813	24659813	+	RNA	SNP	C	C	T	rs368832816		TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr22:24659813C>T	ENST00000414583.2	+	0	3338					NR_003714.1				POM121 transmembrane nucleoporin-like 9, pseudogene																		ATCTGCGCACCCGGAGGTGGG	0.607																																					.													.	.			0			.																																											0	.			GCGCACCCGGAGG	AL040062, AL117401		22q11.22	2012-03-13	2012-03-13		ENSG00000128262	ENSG00000128262			30080	pseudogene	pseudogene			"""POM121 membrane glycoprotein-like 9, pseudogene"""				Standard	NR_003714		Approved				OTTHUMG00000150763		22.37:g.24659813C>T			Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	19	0.16	3	.	2	0.00	0		RNA	SNP	ENST00000414583.2	37																																																																																						0.607	POM121L9P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000319991.1		NM_014549	
TYMP	1890	mdanderson.org	37	22	50966985	50966985	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr22:50966985G>T	ENST00000252029.3	-	4	634	c.472C>A	c.(472-474)Ctg>Atg	p.L158M	SCO2_ENST00000543927.1_5'Flank|TYMP_ENST00000395681.1_Missense_Mutation_p.L158M|SCO2_ENST00000395693.3_5'Flank|TYMP_ENST00000395678.3_Missense_Mutation_p.L158M|SCO2_ENST00000535425.1_5'Flank|TYMP_ENST00000395680.1_Missense_Mutation_p.L158M|SCO2_ENST00000252785.3_5'Flank	NM_001113755.2|NM_001113756.2|NM_001257988.1|NM_001257989.1|NM_001953.4	NP_001107227.1|NP_001107228.1|NP_001244917.1|NP_001244918.1|NP_001944.1	P19971	TYPH_HUMAN	thymidine phosphorylase	158					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|chemotaxis (GO:0006935)|DNA replication (GO:0006260)|mitochondrial genome maintenance (GO:0000002)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphorylase activity (GO:0004645)|platelet-derived growth factor receptor binding (GO:0005161)|pyrimidine-nucleoside phosphorylase activity (GO:0016154)|thymidine phosphorylase activity (GO:0009032)|transferase activity, transferring pentosyl groups (GO:0016763)			large_intestine(1)|lung(2)|ovary(1)|prostate(1)	5		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)	Capecitabine(DB01101)|Cidofovir(DB00369)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Trifluridine(DB00432)	ATAGACTCCAGCTTATCCAAG	0.577																																					p.L158M													.	.			0			c.C472A												131.0	99.0	110.0					22																	50966985		2203	4300	6503	SO:0001583	missense	1890	exon3			ACTCCAGCTTATC	M63193	CCDS14096.1, CCDS58811.1	22q13	2014-09-17	2008-01-21	2008-01-21	ENSG00000025708	ENSG00000025708	2.4.2.4		3148	protein-coding gene	gene with protein product	"""gliostatin"""	131222	"""endothelial cell growth factor 1 (platelet-derived)"""	MNGIE, ECGF1		1590793, 11733540	Standard	NM_001113755		Approved		uc003bme.5	P19971	OTTHUMG00000150249	ENST00000252029.3:c.472C>A	22.37:g.50966985G>T	ENSP00000252029:p.Leu158Met		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	53	0.06	3	NM_001113756	617	0.00	0	A8MW15|H9KVA0|Q13390|Q8WVB7	Missense_Mutation	SNP	ENST00000252029.3	37	CCDS14096.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.006764	0.74932	.	.	ENSG00000025708	ENST00000395680;ENST00000395681;ENST00000252029;ENST00000395678	D;D;D;D	0.99418	-5.87;-5.87;-5.87;-5.87	4.55	4.55	0.56014	Pyrimidine-nucleoside phosphorylase, conserved site (1);Glycosyl transferase, family 3 (3);	0.091491	0.45867	D	0.000333	D	0.98963	0.9647	L	0.46157	1.445	0.41650	D	0.989125	D;D;D	0.71674	0.979;0.998;0.998	P;D;D	0.67103	0.878;0.949;0.949	D	0.98342	1.0539	10	0.72032	D	0.01	-8.7126	8.4391	0.32805	0.104:0.0:0.896:0.0	.	158;158;158	B4DVR2;E5KRG5;P19971	.;.;TYPH_HUMAN	M	158	ENSP00000379037:L158M;ENSP00000379038:L158M;ENSP00000252029:L158M;ENSP00000379036:L158M	ENSP00000252029:L158M	L	-	1	2	TYMP	49313851	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	2.116000	0.41930	2.364000	0.80123	0.555000	0.69702	CTG			0.577	TYMP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000317081.1		NM_001953	
VGLL4	9686	mdanderson.org	37	3	11606281	11606281	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr3:11606281T>C	ENST00000413604.1	-	3	660	c.290A>G	c.(289-291)gAg>gGg	p.E97G	VGLL4_ENST00000430365.2_Missense_Mutation_p.E162G|VGLL4_ENST00000424529.2_Missense_Mutation_p.E72G|VGLL4_ENST00000451674.2_Missense_Mutation_p.E76G|VGLL4_ENST00000404339.1_Missense_Mutation_p.E161G|VGLL4_ENST00000273038.3_Missense_Mutation_p.E156G			Q14135	VGLL4_HUMAN	vestigial-like family member 4	156					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|endometrium(1)|large_intestine(1)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				LUSC - Lung squamous cell carcinoma(1;0.089)|Lung(1;0.111)		CTGCTGCCGCTCCCCCGGGGT	0.721																																					p.E162G													.	.			0			c.A485G												7.0	7.0	7.0					3																	11606281		2123	4197	6320	SO:0001583	missense	9686	exon3			TGCCGCTCCCCCG	D50911	CCDS2606.1, CCDS46754.1, CCDS46755.1, CCDS46756.1, CCDS68342.1, CCDS68343.1	3p25.2	2014-03-03	2014-03-03		ENSG00000144560	ENSG00000144560			28966	protein-coding gene	gene with protein product			"""vestigial like 4 (Drosophila)"""			8590280, 15140898	Standard	NM_001284390		Approved	KIAA0121	uc010hdx.1	Q14135	OTTHUMG00000129739	ENST00000413604.1:c.290A>G	3.37:g.11606281T>C	ENSP00000404624:p.Glu97Gly		Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	26	0.12	3	NM_001128219	40	0.00	0	B4DTS7|J3KN68|Q7L5V0|Q9BQ78	Missense_Mutation	SNP	ENST00000413604.1	37		.	.	.	.	.	.	.	.	.	.	T	26.1	4.708633	0.89018	.	.	ENSG00000144560	ENST00000273038;ENST00000413604;ENST00000451674;ENST00000424529;ENST00000430365;ENST00000404339;ENST00000445411;ENST00000418000;ENST00000458499;ENST00000417206	T;T;T;T;T;T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.66025	0.2748	M	0.64997	1.995	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.995;0.995;0.995;0.996	T	0.68667	-0.5348	10	0.59425	D	0.04	-36.6273	15.0706	0.72034	0.0:0.0:0.0:1.0	.	162;76;72;161;156	G5E9M7;Q14135-6;Q14135-5;G5E9F4;Q14135	.;.;.;.;VGLL4_HUMAN	G	156;97;76;72;162;161;156;156;152;156	ENSP00000273038:E156G;ENSP00000404624:E97G;ENSP00000416615:E76G;ENSP00000402878:E72G;ENSP00000404251:E162G;ENSP00000384705:E161G;ENSP00000412923:E156G;ENSP00000394439:E156G;ENSP00000394123:E152G;ENSP00000391932:E156G	ENSP00000273038:E156G	E	-	2	0	VGLL4	11581281	1.000000	0.71417	0.994000	0.49952	0.933000	0.57130	7.520000	0.81821	1.965000	0.57142	0.533000	0.62120	GAG			0.721	VGLL4-004	PUTATIVE	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000339139.2		NM_014667	
CCDC14	64770	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	123665686	123665686	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr3:123665686A>T	ENST00000488653.2	-	8	1399	c.1309T>A	c.(1309-1311)Ttg>Atg	p.L437M	CCDC14_ENST00000433542.2_Missense_Mutation_p.L396M|CCDC14_ENST00000483247.1_Intron|CCDC14_ENST00000489746.1_Missense_Mutation_p.L237M|CCDC14_ENST00000485727.1_Missense_Mutation_p.L237M|CCDC14_ENST00000310351.4_Missense_Mutation_p.L277M			Q49A88	CCD14_HUMAN	coiled-coil domain containing 14	437					substantia nigra development (GO:0021762)	centrosome (GO:0005813)				NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)	21		Lung NSC(201;0.0371)|Prostate(884;0.0405)|Myeloproliferative disorder(1037;0.205)		Lung(219;0.00942)|GBM - Glioblastoma multiforme(114;0.159)		TCTCCCAACAAATATTTTATA	0.348																																					p.L396M													.	.			0			c.T1186A												128.0	137.0	134.0					3																	123665686		2203	4300	6503	SO:0001583	missense	64770	exon7			CCAACAAATATTT	AL122079	CCDS3025.2	3q21.1	2014-03-20			ENSG00000175455	ENSG00000175455			25766	protein-coding gene	gene with protein product						12477932	Standard	NM_022757		Approved	FLJ12892, DKFZp434L1050	uc010hrt.3	Q49A88	OTTHUMG00000153005	ENST00000488653.2:c.1309T>A	3.37:g.123665686A>T	ENSP00000420180:p.Leu437Met		Somatic	252	0	0		WXS	Illumina HiSeq	.	294	0.17	51	NM_022757	117	0.24	28	B7Z2T2|B8ZZ41|B8ZZ58|D3DN98|Q7Z3N3|Q86T30|Q8IWF8|Q8WUJ8|Q96K47|Q9H9A3|Q9UFH0	Missense_Mutation	SNP	ENST00000488653.2	37		.	.	.	.	.	.	.	.	.	.	A	19.34	3.808310	0.70797	.	.	ENSG00000175455	ENST00000488653;ENST00000310351;ENST00000485727;ENST00000489746;ENST00000433542;ENST00000409697;ENST00000426152	T;T;T;T;T;T;T	0.62105	0.05;0.05;0.05;0.05;0.05;0.05;0.05	5.55	4.4	0.53042	.	0.159136	0.27214	N	0.020398	T	0.72211	0.3432	M	0.68593	2.085	0.40172	D	0.977194	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.71870	0.975;0.975;0.964	T	0.72571	-0.4253	10	0.51188	T	0.08	.	6.4079	0.21674	0.7522:0.0:0.2478:0.0	.	437;396;237	Q49A88;Q49A88-6;Q49A88-4	CCD14_HUMAN;.;.	M	437;277;237;237;396;418;163	ENSP00000420180:L437M;ENSP00000312031:L277M;ENSP00000418002:L237M;ENSP00000418403:L237M;ENSP00000395706:L396M;ENSP00000386866:L418M;ENSP00000414655:L163M	ENSP00000312031:L277M	L	-	1	2	CCDC14	125148376	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	2.284000	0.43478	1.129000	0.42072	0.482000	0.46254	TTG			0.348	CCDC14-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				NM_022757	
EHHADH	1962	broad.mit.edu	37	3	184971758	184971758	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr3:184971758T>G	ENST00000231887.3	-	1	128	c.53A>C	c.(52-54)aAc>aCc	p.N18T	EHHADH_ENST00000440662.1_Missense_Mutation_p.N18T|hsa-mir-5588_ENST00000581890.1_RNA|EHHADH_ENST00000456310.1_5'UTR|EHHADH_ENST00000475987.1_5'UTR	NM_001166415.1|NM_001966.3	NP_001159887.1|NP_001957.2	Q08426	ECHP_HUMAN	enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase	18	Enoyl-CoA hydratase / isomerase.				fatty acid beta-oxidation (GO:0006635)|internal protein amino acid acetylation (GO:0006475)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|coenzyme binding (GO:0050662)|dodecenoyl-CoA delta-isomerase activity (GO:0004165)|enoyl-CoA hydratase activity (GO:0004300)|enzyme binding (GO:0019899)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(2)|skin(3)	24	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)			GACCGGCGGGTTTCGGAGGCG	0.662																																					p.N18T													.	EHHADH	73		0			c.A53C												42.0	44.0	43.0					3																	184971758		2203	4300	6503	SO:0001583	missense	1962	exon1			GGCGGGTTTCGGA	L07077	CCDS33901.1, CCDS54694.1	3q26.3-q28	2012-07-13	2010-04-30		ENSG00000113790	ENSG00000113790	4.2.1.17, 1.1.1.35, 5.3.3.8		3247	protein-coding gene	gene with protein product		607037	"""enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase"""	ECHD		8188243	Standard	NM_001966		Approved		uc003fpf.3	Q08426	OTTHUMG00000156698	ENST00000231887.3:c.53A>C	3.37:g.184971758T>G	ENSP00000231887:p.Asn18Thr		Somatic	141	0.2056737589	29		WXS	Illumina HiSeq	Phase_I	150	0.20	30	NM_001966	24	0.04	1	A8K6Y3|B4DWG3|D3DNU0|Q58EZ5	Missense_Mutation	SNP	ENST00000231887.3	37	CCDS33901.1	.	.	.	.	.	.	.	.	.	.	T	27.5	4.841591	0.91197	.	.	ENSG00000113790	ENST00000537544;ENST00000231887;ENST00000440662	T;T	0.72615	-0.67;-0.67	4.85	4.85	0.62838	Crotonase, core (1);	0.314464	0.41938	D	0.000793	T	0.77498	0.4139	M	0.78344	2.41	0.48901	D	0.999724	P	0.48503	0.911	P	0.51918	0.684	T	0.80111	-0.1519	10	0.59425	D	0.04	-21.8435	11.0027	0.47616	0.0:0.0:0.0:1.0	.	18	Q08426	ECHP_HUMAN	T	18	ENSP00000231887:N18T;ENSP00000396798:N18T	ENSP00000231887:N18T	N	-	2	0	EHHADH	186454452	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.525000	0.53502	2.160000	0.67779	0.528000	0.53228	AAC			0.662	EHHADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000345326.1			
PTPN13	5783	mdanderson.org	37	4	87707089	87707089	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr4:87707089G>T	ENST00000411767.2	+	40	6408	c.6345G>T	c.(6343-6345)gaG>gaT	p.E2115D	PTPN13_ENST00000436978.1_Splice_Site_p.E2120D|PTPN13_ENST00000427191.2_Splice_Site_p.E2096D|PTPN13_ENST00000316707.6_Splice_Site_p.E1924D|PTPN13_ENST00000511467.1_Splice_Site_p.E2120D			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	2115					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		ATTTTACTGAGGTAACAATAA	0.368																																					p.E2120D													.	.			0			c.G6360T												51.0	46.0	47.0					4																	87707089		1856	4090	5946	SO:0001630	splice_region_variant	5783	exon40			TACTGAGGTAACA		CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.6345+1G>T	4.37:g.87707089G>T			Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_080685	44	0.00	0	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	ENST00000411767.2	37	CCDS47094.1	.	.	.	.	.	.	.	.	.	.	G	13.78	2.340366	0.41498	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.55930	0.49;0.52;0.61;0.49;0.52	5.04	4.15	0.48705	.	0.000000	0.47455	D	0.000238	T	0.68063	0.2960	M	0.73962	2.25	0.42295	D	0.99215	B;D;D;D	0.89917	0.04;1.0;1.0;1.0	B;D;D;D	0.87578	0.026;0.998;0.996;0.998	T	0.68029	-0.5517	10	0.44086	T	0.13	.	8.717	0.34416	0.0901:0.1503:0.7596:0.0	.	1924;2096;2115;2120	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	D	2096;2120;1924;2115;2120;2064	ENSP00000408368:E2096D;ENSP00000394794:E2120D;ENSP00000322675:E1924D;ENSP00000407249:E2115D;ENSP00000426626:E2120D	ENSP00000322675:E1924D	E	+	3	2	PTPN13	87926113	1.000000	0.71417	0.956000	0.39512	0.056000	0.15407	1.314000	0.33597	1.150000	0.42419	0.460000	0.39030	GAG			0.368	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000363191.1			Missense_Mutation
PMPCAP1	133083	bcgsc.ca	37	4	93105127	93105127	+	IGR	SNP	C	C	A			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr4:93105127C>A								RP11-354O24.1 (279641 upstream) : RP11-562F9.2 (84790 downstream)																							GCAGGAGGTCCAAACCTCAGC	0.587																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GAGGTCCAAACCT																													4.37:g.93105127C>A			Somatic	34	0	0		WXS	Illumina HiSeq	Phase_1	29	0.14	4	.	0		0		RNA	SNP		37																																																																																					0	0.587										
FAM105A	54491	mdanderson.org	37	5	14608915	14608915	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr5:14608915T>C	ENST00000274217.3	+	7	806	c.686T>C	c.(685-687)cTt>cCt	p.L229P		NM_019018.2	NP_061891.1	Q9NUU6	F105A_HUMAN	family with sequence similarity 105, member A	229	OTU.							p.S231fs*13(1)		large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Lung NSC(4;0.00592)					TGCAACACCCTTTTTTCAGAT	0.328																																					p.L229P													.	.			1	Deletion - Frameshift(1)	large_intestine(1)	c.T686C												77.0	77.0	77.0					5																	14608915		2203	4300	6503	SO:0001583	missense	54491	exon7			ACACCCTTTTTTC		CCDS3884.1	5p15.2	2014-02-24			ENSG00000145569	ENSG00000145569		"""OTU domain containing"""	25629	protein-coding gene	gene with protein product						12477932	Standard	NM_019018		Approved	FLJ11127, NET20	uc003jfj.3	Q9NUU6	OTTHUMG00000131056	ENST00000274217.3:c.686T>C	5.37:g.14608915T>C	ENSP00000274217:p.Leu229Pro		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_019018	47	0.00	0	Q53H50|Q9H037	Missense_Mutation	SNP	ENST00000274217.3	37	CCDS3884.1	.	.	.	.	.	.	.	.	.	.	T	16.58	3.162069	0.57368	.	.	ENSG00000145569	ENST00000274217	T	0.16597	2.33	4.89	4.89	0.63831	.	0.109676	0.40064	N	0.001185	T	0.41213	0.1149	M	0.72894	2.215	0.58432	D	0.999999	D	0.89917	1.0	D	0.76575	0.988	T	0.37454	-0.9705	10	0.87932	D	0	-8.3487	14.4858	0.67616	0.0:0.0:0.0:1.0	.	229	Q9NUU6	F105A_HUMAN	P	229	ENSP00000274217:L229P	ENSP00000274217:L229P	L	+	2	0	FAM105A	14661915	0.991000	0.36638	0.996000	0.52242	0.879000	0.50718	4.189000	0.58358	1.819000	0.53055	0.477000	0.44152	CTT			0.328	FAM105A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253710.1		NM_019018	
PCDHB10	56126	mdanderson.org	37	5	140573922	140573922	+	Silent	SNP	C	C	T	rs376773467		TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr5:140573922C>T	ENST00000239446.4	+	1	1981	c.1797C>T	c.(1795-1797)aaC>aaT	p.N599N		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	599	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGGGCCAGAACGCCTGGCTGT	0.721																																					p.N599N													.	.			0			c.C1797T												4.0	6.0	5.0					5																	140573922		1101	2431	3532	SO:0001819	synonymous_variant	56126	exon1			CCAGAACGCCTGG	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1797C>T	5.37:g.140573922C>T			Somatic	19	0	0		WXS	Illumina HiSeq	Phase_I	23	0.13	3	NM_018930	0		0	Q96T99	Silent	SNP	ENST00000239446.4	37	CCDS4252.1																																																																																					0.721	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251821.1		NM_018930	
PCDHB18	54660	broad.mit.edu	37	5	140615614	140615614	+	RNA	SNP	G	G	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr5:140615614G>T	ENST00000526308.1	+	0	1677					NR_001281.1		Q96TA0	PCDBI_HUMAN	protocadherin beta 18 pseudogene						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P443P(1)		endometrium(9)|lung(7)|ovary(1)|urinary_tract(1)	18						CCCAGGACCCGCACCTGCCCC	0.647																																					.													PCDHB18,NS,carcinoma,0,2	PCDHB18	72	2	1	Substitution - coding silent(1)	endometrium(1)	.																																											0	.			GGACCCGCACCTG	AF152528		5q31.3	2014-03-20			ENSG00000146001	ENSG00000146001		"""Cadherins / Protocadherins : Clustered"""	14548	pseudogene	pseudogene						10380929	Standard	NR_001281		Approved	PCDH-psi2	uc003ljc.1	Q96TA0	OTTHUMG00000167484		5.37:g.140615614G>T			Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	63	0.08	5	.	8	0.00	0	B3KTF8	RNA	SNP	ENST00000526308.1	37																																																																																						0.647	PCDHB18-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000394776.1			
SYNPO	11346	mdanderson.org	37	5	150028987	150028987	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr5:150028987G>T	ENST00000394243.1	+	3	2256	c.1882G>T	c.(1882-1884)Gtg>Ttg	p.V628L	SYNPO_ENST00000519664.1_Missense_Mutation_p.V384L|SYNPO_ENST00000522122.1_Missense_Mutation_p.V628L|SYNPO_ENST00000307662.4_Missense_Mutation_p.V384L	NM_001166208.1	NP_001159680.1	Q8N3V7	SYNPO_HUMAN	synaptopodin	628					positive regulation of actin filament bundle assembly (GO:0032233)|regulation of stress fiber assembly (GO:0051492)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic membrane (GO:0045211)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin binding (GO:0003779)			NS(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(4)|prostate(1)|urinary_tract(2)	18		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GTTTACTTTCGTGGAGAAGCC	0.612																																					p.V628L													.	.			0			c.G1882T												40.0	46.0	44.0					5																	150028987		2203	4300	6503	SO:0001583	missense	11346	exon3			ACTTTCGTGGAGA	AF499137	CCDS4308.1, CCDS54937.1, CCDS54938.1	5q33.1	2008-02-05			ENSG00000171992	ENSG00000171992			30672	protein-coding gene	gene with protein product		608155				9314539, 10470851	Standard	NM_007286		Approved	KIAA1029	uc003lsn.3	Q8N3V7	OTTHUMG00000130078	ENST00000394243.1:c.1882G>T	5.37:g.150028987G>T	ENSP00000377789:p.Val628Leu		Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	58	0.05	3	NM_001166208	33	0.00	0	A5PKZ8|D3DQG8|O15271|Q9UPX1	Missense_Mutation	SNP	ENST00000394243.1	37	CCDS54937.1	.	.	.	.	.	.	.	.	.	.	G	15.90	2.969705	0.53614	.	.	ENSG00000171992	ENST00000394243;ENST00000522122;ENST00000307662;ENST00000519664	T;T;T;T	0.73047	-0.71;-0.71;-0.71;-0.71	4.9	4.9	0.64082	.	0.000000	0.48767	D	0.000174	T	0.65133	0.2662	L	0.46157	1.445	0.32532	N	0.534791	P;P	0.42993	0.648;0.797	B;P	0.46479	0.107;0.518	T	0.68819	-0.5308	10	0.23302	T	0.38	-19.7627	7.5967	0.28052	0.0849:0.0:0.75:0.1652	.	384;628	Q8N3V7-2;Q8N3V7	.;SYNPO_HUMAN	L	628;628;384;384	ENSP00000377789:V628L;ENSP00000428378:V628L;ENSP00000302139:V384L;ENSP00000429268:V384L	ENSP00000302139:V384L	V	+	1	0	SYNPO	150009180	0.999000	0.42202	0.999000	0.59377	0.985000	0.73830	3.198000	0.51035	2.269000	0.75478	0.561000	0.74099	GTG			0.612	SYNPO-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000252371.1		NM_007286	
DCDC2	51473	broad.mit.edu	37	6	24301981	24301981	+	Silent	SNP	G	G	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr6:24301981G>T	ENST00000378454.3	-	4	820	c.519C>A	c.(517-519)gtC>gtA	p.V173V		NM_001195610.1|NM_016356.3	NP_001182539.1|NP_057440.2	Q9UHG0	DCDC2_HUMAN	doublecortin domain containing 2	173	Doublecortin 2. {ECO:0000255|PROSITE- ProRule:PRU00072}.				cellular defense response (GO:0006968)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|neuron migration (GO:0001764)|visual learning (GO:0008542)					breast(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32		Ovarian(999;0.101)				TTTTTTCTGTGACCATTTGTA	0.428																																					p.V173V													.	DCDC2	53		0			c.C519A												172.0	167.0	169.0					6																	24301981		2203	4300	6503	SO:0001819	synonymous_variant	51473	exon5			TTCTGTGACCATT	AB032980	CCDS4550.1	6p22.1	2008-02-05			ENSG00000146038	ENSG00000146038			18141	protein-coding gene	gene with protein product		605755				10601354, 10574461	Standard	NM_001195610		Approved	RU2, KIAA1154, DCDC2A	uc003ndx.3	Q9UHG0	OTTHUMG00000016275	ENST00000378454.3:c.519C>A	6.37:g.24301981G>T			Somatic	197	0	0		WXS	Illumina HiSeq	Phase_I	171	0.02	4	NM_001195610	4	0.00	0	Q5VTR8|Q5VTR9|Q86W35|Q9UFD1|Q9UHG1|Q9ULR6	Silent	SNP	ENST00000378454.3	37	CCDS4550.1																																																																																					0.428	DCDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000043604.1		NM_016356	
BAG6	7917	broad.mit.edu;mdanderson.org	37	6	31612829	31612829	+	Silent	SNP	A	A	G			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr6:31612829A>G	ENST00000375964.6	-	10	1594	c.1281T>C	c.(1279-1281)gcT>gcC	p.A427A	BAG6_ENST00000404765.2_Silent_p.A421A|BAG6_ENST00000211379.5_Silent_p.A421A|BAG6_ENST00000362049.6_Silent_p.A421A|BAG6_ENST00000439687.2_Silent_p.A421A|BAG6_ENST00000375976.4_Silent_p.A421A|BAG6_ENST00000470875.1_5'Flank	NM_004639.3|NM_080703.2	NP_004630.3|NP_542434.1	P46379	BAG6_HUMAN	BCL2-associated athanogene 6	427	4 X 29 AA approximate repeats.|Pro-rich.				brain development (GO:0007420)|cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|embryo development (GO:0009790)|immune system process (GO:0002376)|internal peptidyl-lysine acetylation (GO:0018393)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|kidney development (GO:0001822)|lung development (GO:0030324)|negative regulation of apoptotic process (GO:0043066)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of proteolysis (GO:0045861)|protein stabilization (GO:0050821)|regulation of cell proliferation (GO:0042127)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)|ubiquitin-dependent protein catabolic process (GO:0006511)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)|nucleus (GO:0005634)	polyubiquitin binding (GO:0031593)|proteasome binding (GO:0070628)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(2)|pancreas(2)|skin(3)|urinary_tract(2)	36						CTGGCGGGGGAGCCCCCTCAG	0.652																																					p.A427A													.	BAG6	73		0			c.T1281C												65.0	82.0	76.0					6																	31612829		1507	2707	4214	SO:0001819	synonymous_variant	7917	exon10			CGGGGGAGCCCCC	M31294	CCDS4709.1, CCDS47403.1, CCDS56414.1, CCDS56415.1	6p21.3	2011-06-14	2010-12-09	2010-12-09	ENSG00000204463	ENSG00000204463			13919	protein-coding gene	gene with protein product		142590	"""HLA-B associated transcript 3"""	BAT3		2156268	Standard	NM_004639		Approved	G3, D6S52E	uc003nvf.4	P46379	OTTHUMG00000031171	ENST00000375964.6:c.1281T>C	6.37:g.31612829A>G			Somatic	58	0.1034482759	6		WXS	Illumina HiSeq	Phase_I	48	0.13	6	NM_004639	476	0.23	110	A2ADJ7|A3KQ42|A3KQ44|A6NGY6|A6PWF7|B0UX84|B4DZ12|B4E3V4|E7EMZ4|F8VXY4|O95874|Q5HYL9|Q5SQ35|Q5SQ36|Q5SQ37|Q5SQ41|Q5SRP8|Q5SRP9|Q5STC1|Q5STX1|Q5STX3|Q96SA6|Q9BCN4	Silent	SNP	ENST00000375964.6	37	CCDS47403.1	.	.	.	.	.	.	.	.	.	.	A	10.16	1.274367	0.23307	.	.	ENSG00000204463	ENST00000453833	.	.	.	4.98	-2.44	0.06502	.	.	.	.	.	T	0.20941	0.0504	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35574	-0.9783	4	.	.	.	.	0.4792	0.00545	0.2441:0.1461:0.2853:0.3245	.	.	.	.	P	82	.	.	S	-	1	0	BAG6	31720808	0.001000	0.12720	0.178000	0.23040	0.821000	0.46438	-1.151000	0.03175	-0.421000	0.07416	0.525000	0.51046	TCC			0.652	BAG6-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				NM_080703	
MSH5	4439	hgsc.bcm.edu	37	6	31729509	31729509	+	Intron	SNP	T	T	C			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr6:31729509T>C	ENST00000375755.3	+	23	2467				MSH5_ENST00000375740.3_Intron|SAPCD1-AS1_ENST00000419679.1_RNA|MSH5-SAPCD1_ENST00000491552.1_Intron|SAPCD1_ENST00000425424.1_5'Flank|SAPCD1_ENST00000415669.2_5'Flank|MSH5_ENST00000375703.3_Intron|MSH5_ENST00000431848.2_Intron|MSH5_ENST00000534153.4_Intron|MSH5_ENST00000375750.3_Intron|MSH5_ENST00000395853.1_Intron|MSH5-SAPCD1_ENST00000493662.2_Intron|MSH5_ENST00000375742.3_Intron	NM_002441.4	NP_002432.1	O43196	MSH5_HUMAN	mutS homolog 5						ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)			breast(1)|ovary(2)|skin(2)	5						ATCCCTTCCCTTTTCTCCCTC	0.537								Direct reversal of damage;Mismatch excision repair (MMR)																													.													.	.			0			.												327.0	295.0	305.0					6																	31729509		876	1991	2867	SO:0001627	intron_variant	100532732	.			CTTCCCTTTTCTC	AF070071	CCDS4720.1, CCDS34409.1, CCDS34410.1, CCDS34409.2	6p21.3	2013-09-12	2013-09-12		ENSG00000204410	ENSG00000204410			7328	protein-coding gene	gene with protein product		603382	"""mutS (E. coli) homolog 5"", ""mutS homolog 5 (E. coli)"""			9740671, 9787078, 17977839	Standard	NM_002441		Approved		uc011hbg.2	O43196	OTTHUMG00000167551	ENST00000375755.3:c.2182-86T>C	6.37:g.31729509T>C			Somatic	76	0	0		WXS	Illumina HiSeq	.	61	0.07	4	.	2	0.00	0	B0V033|B0V034|O60586|Q5BLU9|Q5SSR1|Q8IW44|Q9BQC7	RNA	SNP	ENST00000375755.3	37	CCDS4720.1																																																																																					0.537	MSH5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000076243.4			
GPR115	221393	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	47678504	47678504	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr6:47678504A>G	ENST00000283303.2	+	4	440	c.182A>G	c.(181-183)aAc>aGc	p.N61S	GPR115_ENST00000371220.1_Missense_Mutation_p.N118S|GPR115_ENST00000327753.3_Missense_Mutation_p.N61S	NM_153838.3	NP_722580.3	Q8IZF3	GP115_HUMAN	G protein-coupled receptor 115	61					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	52						TCTTCTTCCAACTGCAGCCAG	0.388																																					p.N61S	GBM(22;431 510 9010 26644 32828)												.	.			0			c.A182G												86.0	91.0	89.0					6																	47678504		2203	4300	6503	SO:0001583	missense	221393	exon4			CTTCCAACTGCAG	AK095395	CCDS4922.2	6p12.3	2014-08-08			ENSG00000153294	ENSG00000153294		"""-"", ""GPCR / Class B : Orphans"""	19011	protein-coding gene	gene with protein product		614268				12435584	Standard	NM_153838		Approved	FLJ38076, PGR18	uc003oza.1	Q8IZF3	OTTHUMG00000014800	ENST00000283303.2:c.182A>G	6.37:g.47678504A>G	ENSP00000283303:p.Asn61Ser		Somatic	184	0	0		WXS	Illumina HiSeq	.	193	0.11	22	NM_153838	0		0	B3KTD0|Q2PNZ0|Q5T5B5|Q5T5B6|Q86SN9|Q8IXE6	Missense_Mutation	SNP	ENST00000283303.2	37	CCDS4922.2	.	.	.	.	.	.	.	.	.	.	A	6.524	0.464824	0.12402	.	.	ENSG00000153294	ENST00000371220;ENST00000327753;ENST00000283303	T;T;T	0.32023	1.69;1.47;1.47	5.71	-1.55	0.08558	.	0.697062	0.14476	N	0.317274	T	0.04407	0.0121	L	0.36672	1.1	0.09310	N	0.99999	B	0.09022	0.002	B	0.10450	0.005	T	0.38200	-0.9672	10	0.07813	T	0.8	-2.3821	1.0661	0.01611	0.3858:0.2993:0.17:0.1449	.	61	Q8IZF3	GP115_HUMAN	S	118;61;61	ENSP00000360264:N118S;ENSP00000328319:N61S;ENSP00000283303:N61S	ENSP00000283303:N61S	N	+	2	0	GPR115	47786463	0.339000	0.24784	0.855000	0.33649	0.745000	0.42441	0.597000	0.24059	-0.078000	0.12730	-0.336000	0.08194	AAC			0.388	GPR115-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040819.2		NM_153838	
MCM7	4176	mdanderson.org	37	7	99697366	99697366	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr7:99697366G>T	ENST00000303887.5	-	3	767	c.122C>A	c.(121-123)gCt>gAt	p.A41D	AP4M1_ENST00000359593.4_5'Flank|AP4M1_ENST00000422582.1_5'Flank|MCM7_ENST00000343023.6_Missense_Mutation_p.A41D|AP4M1_ENST00000429084.1_5'Flank|AP4M1_ENST00000421755.1_5'Flank|MCM7_ENST00000354230.3_5'UTR	NM_005916.3	NP_005907.3	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	41					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of phosphorylation (GO:0042325)|response to drug (GO:0042493)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(5)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TTCCCGATGAGCCAGCCGAAC	0.532																																					p.A41D													.	.			0			c.C122A												75.0	69.0	71.0					7																	99697366		2203	4300	6503	SO:0001583	missense	4176	exon3			CGATGAGCCAGCC		CCDS5683.1, CCDS5684.1	7q21.3-q22.1	2014-06-12	2007-04-04		ENSG00000166508	ENSG00000166508			6950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 104"""	600592	"""minichromosome maintenance deficient (S. cerevisiae) 7"", ""MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)"""	MCM2		7842741	Standard	NM_005916		Approved	CDC47, PPP1R104	uc003usw.1	P33993	OTTHUMG00000154671	ENST00000303887.5:c.122C>A	7.37:g.99697366G>T	ENSP00000307288:p.Ala41Asp		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	53	0.06	3	NM_005916	1290	0.00	0	A4D2A1|A4D2A2|E9PGN9|Q15076|Q96D34|Q96GL1	Missense_Mutation	SNP	ENST00000303887.5	37	CCDS5683.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.178774	0.78564	.	.	ENSG00000166508	ENST00000343023;ENST00000303887	T;T	0.14022	2.54;2.54	4.4	4.4	0.53042	Nucleic acid-binding, OB-fold-like (1);	0.000000	0.85682	D	0.000000	T	0.46014	0.1371	M	0.92604	3.325	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.58584	-0.7611	10	0.59425	D	0.04	-0.5901	14.5272	0.67897	0.0:0.0:1.0:0.0	.	41	P33993	MCM7_HUMAN	D	41	ENSP00000344006:A41D;ENSP00000307288:A41D	ENSP00000307288:A41D	A	-	2	0	MCM7	99535302	1.000000	0.71417	1.000000	0.80357	0.311000	0.27955	9.013000	0.93629	2.255000	0.74692	0.557000	0.71058	GCT			0.532	MCM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000336534.3			
LRCH4	4034	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	100173407	100173407	+	Splice_Site	SNP	T	T	C			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr7:100173407T>C	ENST00000310300.6	-	17	1829		c.e17-2		LRCH4_ENST00000497245.1_Splice_Site|SAP25_ENST00000538735.1_5'Flank	NM_002319.3	NP_002310.2	O75427	LRCH4_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 4						nervous system development (GO:0007399)	PML body (GO:0016605)				NS(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	23	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GAGTTTTGGCTGGGGTGGGTG	0.577																																					.													.	.			0			c.1777-2A>G												109.0	115.0	113.0					7																	100173407		2203	4300	6503	SO:0001630	splice_region_variant	4034	exon18			TTTGGCTGGGGTG	AF053356	CCDS34706.1	7q22	2008-05-20	2004-05-27	2004-05-28	ENSG00000077454	ENSG00000077454			6691	protein-coding gene	gene with protein product				LRN, LRRN1		9799793	Standard	XM_005250346		Approved		uc003uvj.3	O75427	OTTHUMG00000159544	ENST00000310300.6:c.1777-2A>G	7.37:g.100173407T>C			Somatic	156	0	0		WXS	Illumina HiSeq	.	171	0.15	26	NM_002319	2	0.00	0	A4D2D5|Q8WV85|Q96ID0	Splice_Site	SNP	ENST00000310300.6	37	CCDS34706.1	.	.	.	.	.	.	.	.	.	.	T	17.36	3.369351	0.61624	.	.	ENSG00000077454	ENST00000485554;ENST00000310300;ENST00000422462;ENST00000497245	.	.	.	4.4	4.4	0.53042	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.2403	0.43308	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	LRCH4	100011343	1.000000	0.71417	0.995000	0.50966	0.970000	0.65996	6.695000	0.74593	1.994000	0.58287	0.454000	0.30748	.			0.577	LRCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356110.1		NM_002319	Intron
MIR1207	100302175	mdanderson.org	37	8	129061433	129061433	+	RNA	SNP	G	G	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr8:129061433G>T	ENST00000408249.1	+	0	36					NR_031612.1				microRNA 1207																		GGGCTGGCTGGGTCTGGTAGT	0.562																																					.													.	.			0			.												49.0	54.0	53.0					8																	129061433		1568	3582	5150			100302175	.			TGGCTGGGTCTGG			8	2011-09-12		2008-12-18	ENSG00000221176	ENSG00000221176		"""ncRNAs / Micro RNAs"""	35273	non-coding RNA	RNA, micro				MIRN1207			Standard	NR_031612		Approved	hsa-mir-1207	uc022bbj.1				8.37:g.129061433G>T			Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	.	0		0		RNA	SNP	ENST00000408249.1	37																																																																																						0.562	MIR1207-201	KNOWN	basic	miRNA	miRNA				NR_031612	
SLC24A2	25769	broad.mit.edu	37	9	19786692	19786692	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chr9:19786692G>T	ENST00000341998.2	-	1	234	c.173C>A	c.(172-174)gCc>gAc	p.A58D	SLC24A2_ENST00000286344.3_Missense_Mutation_p.A58D	NM_001193288.2|NM_020344.3	NP_001180217.1|NP_065077.1	Q9UI40	NCKX2_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 2	58					cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	cadmium ion binding (GO:0046870)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium, potassium:sodium antiporter activity (GO:0008273)|manganese ion binding (GO:0030145)|nickel cation binding (GO:0016151)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|symporter activity (GO:0015293)			endometrium(3)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		CTCAGAAAAGGCACTGATTGA	0.423																																					p.A58D													SLC24A2,NS,carcinoma,-1,1	SLC24A2	93	1	0			c.C173A												103.0	104.0	104.0					9																	19786692		2203	4300	6503	SO:0001583	missense	25769	exon1			GAAAAGGCACTGA	AF097366	CCDS6493.1, CCDS55297.1	9p22.1	2013-05-22			ENSG00000155886	ENSG00000155886		"""Solute carriers"""	10976	protein-coding gene	gene with protein product		609838				10662833	Standard	NM_020344		Approved	NCKX2	uc003zoa.2	Q9UI40	OTTHUMG00000019646	ENST00000341998.2:c.173C>A	9.37:g.19786692G>T	ENSP00000344801:p.Ala58Asp		Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	140	0.03	4	NM_001193288	0		0	B7ZLL8|Q9NTN5|Q9NZQ4	Missense_Mutation	SNP	ENST00000341998.2	37	CCDS6493.1	.	.	.	.	.	.	.	.	.	.	G	18.87	3.714676	0.68730	.	.	ENSG00000155886	ENST00000341998;ENST00000286344	T;T	0.78481	-1.17;-1.18	5.7	4.8	0.61643	.	0.239692	0.41823	D	0.000818	T	0.78110	0.4232	L	0.49126	1.545	0.80722	D	1	P;P	0.45634	0.565;0.863	P;P	0.48400	0.576;0.451	T	0.76782	-0.2832	9	.	.	.	.	14.5437	0.68013	0.0702:0.0:0.9298:0.0	.	58;58	Q9UI40-2;Q9UI40	.;NCKX2_HUMAN	D	58	ENSP00000344801:A58D;ENSP00000286344:A58D	.	A	-	2	0	SLC24A2	19776692	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.138000	0.77305	1.408000	0.46895	0.655000	0.94253	GCC			0.423	SLC24A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051866.2		NM_020344	
MT-ND1	4535	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	M	3643	3643	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chrM:3643G>A	ENST00000361390.2	+	1	337	c.337G>A	c.(337-339)Gtt>Att	p.V113I	MT-RNR1_ENST00000389680.2_RNA|MT-CO1_ENST00000361624.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1	113					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	CTAGCCTAGCCGTTTACTCAA	0.522																																					p.V113I													.	.			0			c.G337A																																									SO:0001583	missense	10625	exon1			CTAGCCGTTTACT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886		ENST00000361390.2:c.337G>A	M.37:g.3643G>A	ENSP00000354687:p.Val113Ile		Somatic	18	0	0		WXS	Illumina HiSeq	.	11	0.45	5	ENST00000361390	0		0	C0JKH6|Q37523	Missense_Mutation	SNP	ENST00000361390.2	37																																																																																						0.522	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024026	
IL3RA	3563	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	1501338	1501338	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAEW-01A-11D-A42Y-10	TCGA-2G-AAEW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef64460-0ab5-4867-9675-da4a7d84310e	5f232b73-5281-4be0-9679-0920bcb4dd29	g.chrX:1501338C>G	ENST00000331035.4	+	12	1466	c.1117C>G	c.(1117-1119)Cag>Gag	p.Q373E	IL3RA_ENST00000381469.2_Missense_Mutation_p.Q295E	NM_001267713.1|NM_002183.3	NP_001254642.1|NP_002174.1	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha (low affinity)	373					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-3 receptor activity (GO:0004912)			lung(1)|skin(2)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	GACTGAAGTACAGGTCGTGCA	0.642																																					p.Q373E													.	.			0			c.C1117G												220.0	226.0	224.0					X																	1501338		2203	4296	6499	SO:0001583	missense	3563	exon12			GAAGTACAGGTCG	M74782	CCDS14113.1, CCDS59158.1	Xp22.3 and Yp13.3	2008-07-21			ENSG00000185291	ENSG00000185291		"""Pseudoautosomal regions / PAR1"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6012	protein-coding gene	gene with protein product		308385, 430000				1833064	Standard	NM_002183		Approved	CD123	uc004cps.3	P26951	OTTHUMG00000021059	ENST00000331035.4:c.1117C>G	X.37:g.1501338C>G	ENSP00000327890:p.Gln373Glu		Somatic	498	0	0		WXS	Illumina HiSeq	.	481	0.15	74	NM_002183	117	0.02	2	A8K3F3|B9VI81|Q5HYQ7|Q5HYQ8|Q9UEH7	Missense_Mutation	SNP	ENST00000331035.4	37	CCDS14113.1	.	.	.	.	.	.	.	.	.	.	.	10.93	1.489979	0.26686	.	.	ENSG00000185291	ENST00000331035;ENST00000381469	T;T	0.36699	1.5;1.24	1.7	1.7	0.24286	.	0.963797	0.08374	U	0.955588	T	0.16981	0.0408	N	0.22421	0.69	0.09310	N	1	P;P	0.39424	0.673;0.544	B;B	0.32022	0.139;0.066	T	0.05616	-1.0874	10	0.02654	T	1	.	6.6614	0.23016	0.0:1.0:0.0:0.0	.	294;373	P26951-2;P26951	.;IL3RA_HUMAN	E	373;295	ENSP00000327890:Q373E;ENSP00000370878:Q295E	ENSP00000327890:Q373E	Q	+	1	0	IL3RA	1461338	0.020000	0.18652	0.011000	0.14972	0.439000	0.31926	1.276000	0.33156	0.912000	0.36772	0.100000	0.15512	CAG			0.642	IL3RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055600.3			
