#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
CSF3R	1441	mdanderson.org	37	1	36939198	36939198	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr1:36939198C>A	ENST00000373106.1	-	6	1058	c.511G>T	c.(511-513)Ggg>Tgg	p.G171W	CSF3R_ENST00000440588.2_Missense_Mutation_p.G171W|CSF3R_ENST00000338937.5_Missense_Mutation_p.G171W|CSF3R_ENST00000373104.1_Missense_Mutation_p.G171W|CSF3R_ENST00000361632.4_Missense_Mutation_p.G171W|CSF3R_ENST00000373103.1_Missense_Mutation_p.G171W|CSF3R_ENST00000331941.5_Missense_Mutation_p.G171W|CSF3R_ENST00000487540.2_5'Flank|CSF3R_ENST00000418048.2_Missense_Mutation_p.G171W	NM_000760.3	NP_000751.1	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor (granulocyte)	171	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|defense response (GO:0006952)|neutrophil chemotaxis (GO:0030593)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	ATGGAGTCCCCTTGGGTCTGA	0.612																																					p.G171W													.	.			0			c.G511T												54.0	52.0	53.0					1																	36939198		2203	4300	6503	SO:0001583	missense	1441	exon6			AGTCCCCTTGGGT	M59820	CCDS412.1, CCDS413.1, CCDS414.1	1p35-p34.3	2014-09-17			ENSG00000119535	ENSG00000119535		"""CD molecules"", ""Fibronectin type III domain containing"""	2439	protein-coding gene	gene with protein product		138971		CD114		1371413	Standard	NM_000760		Approved	GCSFR	uc001cax.2	Q99062	OTTHUMG00000008010	ENST00000373106.1:c.511G>T	1.37:g.36939198C>A	ENSP00000362198:p.Gly171Trp		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_156039	20	0.00	0		Missense_Mutation	SNP	ENST00000373106.1	37	CCDS413.1	.	.	.	.	.	.	.	.	.	.	C	12.05	1.821148	0.32237	.	.	ENSG00000119535	ENST00000373106;ENST00000373104;ENST00000373103;ENST00000361632;ENST00000331941;ENST00000418048;ENST00000338937;ENST00000440588	T;T;T;T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27;1.27;1.27;1.27	5.22	2.32	0.28847	Fibronectin, type III (3);Immunoglobulin-like fold (1);	1.640960	0.02942	N	0.140548	T	0.47893	0.1470	L	0.48642	1.525	0.09310	N	1	D;D;D;D	0.71674	0.998;0.997;0.989;0.994	P;P;B;P	0.56042	0.79;0.691;0.398;0.691	T	0.22730	-1.0208	10	0.37606	T	0.19	-3.1664	8.6309	0.33919	0.0:0.7591:0.0:0.2409	.	171;171;171;171	E1B6W6;Q99062-3;Q99062;Q99062-4	.;.;CSF3R_HUMAN;.	W	171	ENSP00000362198:G171W;ENSP00000362196:G171W;ENSP00000362195:G171W;ENSP00000355406:G171W;ENSP00000332180:G171W;ENSP00000401588:G171W;ENSP00000345013:G171W;ENSP00000397568:G171W	ENSP00000332180:G171W	G	-	1	0	CSF3R	36711785	0.000000	0.05858	0.025000	0.17156	0.133000	0.20885	0.156000	0.16382	0.303000	0.22785	-0.208000	0.12717	GGG			0.612	CSF3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000021997.2		NM_156039	
COPA	1314	hgsc.bcm.edu;bcgsc.ca	37	1	160264296	160264298	+	In_Frame_Del	DEL	TCT	TCT	-	rs200807488		TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	TCT	TCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr1:160264296_160264298delTCT	ENST00000241704.7	-	25	2881_2883	c.2652_2654delAGA	c.(2650-2655)gaagat>gat	p.E884del	COPA_ENST00000368069.3_In_Frame_Del_p.E893del	NM_001098398.1|NM_004371.3	NP_001091868.1|NP_004362.2	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha	884					COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pancreatic juice secretion (GO:0030157)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	46	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GAGCTCCAGATCTTCTTCTACAT	0.512																																					p.894_894del													.	COPA	181		0			c.2680_2682del																																									SO:0001651	inframe_deletion	1314	exon25			TCCAGATCTTCTT	U24105	CCDS1202.1, CCDS41424.1	1q23.2	2014-01-30			ENSG00000122218	ENSG00000122218		"""WD repeat domain containing"", ""Endogenous ligands"""	2230	protein-coding gene	gene with protein product	"""proxenin"", ""xenin"""	601924				8647451	Standard	NM_004371		Approved	HEP-COP	uc001fvv.4	P53621	OTTHUMG00000033111	ENST00000241704.7:c.2652_2654delAGA	1.37:g.160264302_160264304delTCT	ENSP00000241704:p.Glu884del		Somatic	189	0	0		WXS	Illumina HiSeq	.	231	0.20	46	NM_001098398	629	0.00	0	Q5T201|Q8IXZ9	In_Frame_Del	DEL	ENST00000241704.7	37	CCDS1202.1																																																																																					0.512	COPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080638.1		NM_004371	
FMO1	2326	mdanderson.org	37	1	171251463	171251463	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr1:171251463G>T	ENST00000354841.4	+	6	1305	c.1174G>T	c.(1174-1176)Gtc>Ttc	p.V392F	FMO1_ENST00000402921.2_Missense_Mutation_p.V329F|FMO1_ENST00000469112.1_3'UTR|FMO1_ENST00000367750.3_Missense_Mutation_p.V392F	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	392					NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	GGCTGTTCGAGTCCTGAAAGG	0.463																																					p.V392F													.	.			0			c.G1174T												51.0	53.0	52.0					1																	171251463		2203	4300	6503	SO:0001583	missense	2326	exon7			GTTCGAGTCCTGA	M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.1174G>T	1.37:g.171251463G>T	ENSP00000346901:p.Val392Phe		Somatic	103	0	0		WXS	Illumina HiSeq	Phase_I	127	0.04	5	NM_002021	2	0.00	0	A8K248|B7Z3P4|Q5QPT2|Q9UJC2	Missense_Mutation	SNP	ENST00000354841.4	37	CCDS1294.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.031265	0.75504	.	.	ENSG00000010932	ENST00000367750;ENST00000402921;ENST00000354841	T;T;T	0.62498	0.02;0.02;0.02	5.77	5.77	0.91146	.	0.135374	0.48767	D	0.000164	T	0.75620	0.3874	M	0.82433	2.59	0.58432	D	0.999995	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.79191	-0.1905	10	0.87932	D	0	-6.8731	12.1394	0.53989	0.079:0.0:0.921:0.0	.	329;392;392	B7Z3P4;B2RCG5;Q01740	.;.;FMO1_HUMAN	F	392;329;392	ENSP00000356724:V392F;ENSP00000385543:V329F;ENSP00000346901:V392F	ENSP00000346901:V392F	V	+	1	0	FMO1	169518087	1.000000	0.71417	0.996000	0.52242	0.892000	0.51952	6.830000	0.75319	2.720000	0.93068	0.557000	0.71058	GTC			0.463	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000086212.1		NM_002021	
PHYH	5264	hgsc.bcm.edu	37	10	13330436	13330436	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr10:13330436C>T	ENST00000263038.4	-	6	660	c.602G>A	c.(601-603)cGg>cAg	p.R201Q	PHYH_ENST00000396920.3_Missense_Mutation_p.R184Q|PHYH_ENST00000396913.2_Missense_Mutation_p.R101Q	NM_006214.3	NP_006205.1	O14832	PAHX_HUMAN	phytanoyl-CoA 2-hydroxylase	201					cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|isoprenoid metabolic process (GO:0006720)|methyl-branched fatty acid metabolic process (GO:0097089)|small molecule metabolic process (GO:0044281)	mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	cofactor binding (GO:0048037)|electron carrier activity (GO:0009055)|L-ascorbic acid binding (GO:0031418)|metal ion binding (GO:0046872)|phytanoyl-CoA dioxygenase activity (GO:0048244)	p.R201Q(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)	25		Ovarian(717;0.0448)			Antihemophilic Factor(DB00025)|Vitamin C(DB00126)	GCCGTTGTTCCGGCTGATGTG	0.627																																					p.R201Q													PHYH,NS,carcinoma,-1,2	PHYH	-1	2	1	Substitution - Missense(1)	prostate(1)	c.G602A												68.0	65.0	66.0					10																	13330436		2203	4300	6503	SO:0001583	missense	5264	exon6			TTGTTCCGGCTGA		CCDS7097.1, CCDS41489.1	10p13	2010-04-27	2006-01-09		ENSG00000107537	ENSG00000107537	1.14.11.18		8940	protein-coding gene	gene with protein product	"""Refsum disease"", ""phytanoyl-CoA dioxygenase"""	602026	"""phytanoyl-CoA hydroxylase (Refsum disease)"", ""phytanoyl-CoA hydroxylase"""			9326939	Standard	XM_005252469		Approved	PAHX, RD, PHYH1	uc001imf.3	O14832	OTTHUMG00000017693	ENST00000263038.4:c.602G>A	10.37:g.13330436C>T	ENSP00000263038:p.Arg201Gln		Somatic	73	0.0136986301	1		WXS	Illumina HiSeq	.	72	0.04	3	NM_006214	73	0.00	0	A8MTS8|B1ALH5	Missense_Mutation	SNP	ENST00000263038.4	37	CCDS7097.1	.	.	.	.	.	.	.	.	.	.	C	16.20	3.055245	0.55325	.	.	ENSG00000107537	ENST00000396913;ENST00000263038;ENST00000396920;ENST00000453759;ENST00000479604	D;D;D;D;D	0.89485	-2.52;-2.52;-2.52;-2.52;-2.52	5.69	3.85	0.44370	.	0.150191	0.56097	N	0.000034	D	0.91994	0.7464	M	0.90019	3.08	0.23820	N	0.996755	P;D	0.56035	0.947;0.974	P;P	0.51229	0.532;0.663	D	0.84800	0.0784	10	0.30854	T	0.27	-19.1168	10.3563	0.43967	0.0:0.7722:0.0:0.2278	.	184;201	B1ALH6;O14832	.;PAHX_HUMAN	Q	101;201;184;101;203	ENSP00000380121:R101Q;ENSP00000263038:R201Q;ENSP00000380126:R184Q;ENSP00000412525:R101Q;ENSP00000420117:R203Q	ENSP00000263038:R201Q	R	-	2	0	PHYH	13370442	0.997000	0.39634	0.224000	0.23877	0.025000	0.11179	3.279000	0.51670	0.764000	0.33197	0.655000	0.94253	CGG			0.627	PHYH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046845.2			
PCDH15	65217	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	55583018	55583018	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr10:55583018T>C	ENST00000320301.6	-	33	4862	c.4468A>G	c.(4468-4470)Att>Gtt	p.I1490V	PCDH15_ENST00000437009.1_Missense_Mutation_p.I1421V|PCDH15_ENST00000395433.1_Missense_Mutation_p.I1467V|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395445.1_Intron|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000395430.1_Missense_Mutation_p.I1487V|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395438.1_Intron|PCDH15_ENST00000395432.2_Missense_Mutation_p.I1450V|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000361849.3_Missense_Mutation_p.I1492V|PCDH15_ENST00000414778.1_Intron	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1490					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TGAGCCTCAATAGTATTGGAA	0.393										HNSCC(58;0.16)																											p.I1497V													.	.			0			c.A4489G												113.0	111.0	111.0					10																	55583018		2203	4300	6503	SO:0001583	missense	65217	exon35			CCTCAATAGTATT	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.4468A>G	10.37:g.55583018T>C	ENSP00000322604:p.Ile1490Val		Somatic	88	0	0		WXS	Illumina HiSeq	.	94	0.26	24	NM_001142763	0		0	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	T	12.46	1.943950	0.34283	.	.	ENSG00000150275	ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009	T;T;T;T;T;T	0.60424	0.26;0.24;0.29;0.24;0.24;0.19	6.02	-2.26	0.06867	.	.	.	.	.	T	0.49949	0.1587	L	0.61218	1.895	0.27132	N	0.96186	B;B;B;B;B;B;B;B	0.09022	0.001;0.002;0.002;0.002;0.002;0.002;0.001;0.002	B;B;B;B;B;B;B;B	0.12837	0.005;0.008;0.008;0.008;0.008;0.008;0.005;0.008	T	0.42749	-0.9433	9	0.20519	T	0.43	.	11.563	0.50788	0.0:0.3938:0.0:0.6062	.	1467;1490;1492;1497;1421;1450;1487;1490	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;Q96QU1	.;.;.;.;.;.;.;PCD15_HUMAN	V	1450;1492;1467;1490;1487;1497;1421	ENSP00000378820:I1450V;ENSP00000354950:I1492V;ENSP00000378821:I1467V;ENSP00000322604:I1490V;ENSP00000378818:I1487V;ENSP00000412628:I1421V	ENSP00000322604:I1490V	I	-	1	0	PCDH15	55253024	0.995000	0.38212	0.004000	0.12327	0.885000	0.51271	0.267000	0.18552	-0.673000	0.05259	-0.297000	0.09499	ATT			0.393	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000048121.2		NM_033056	
NPFFR1	64106	mdanderson.org	37	10	72014845	72014845	+	Silent	SNP	C	C	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr10:72014845C>T	ENST00000277942.6	-	4	1160	c.1161G>A	c.(1159-1161)tcG>tcA	p.S387S		NM_022146.4	NP_071429.1	Q9GZQ6	NPFF1_HUMAN	neuropeptide FF receptor 1	387					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)			endometrium(2)|lung(1)	3						TGCTAGGGCCCGACTCAGAGG	0.746																																					p.S387S													.	.			0			c.G1161A												3.0	4.0	4.0					10																	72014845		1614	3547	5161	SO:0001819	synonymous_variant	64106	exon4			AGGGCCCGACTCA	AB040104	CCDS53539.1	10q21-q22	2012-08-10	2006-02-15	2006-02-15	ENSG00000148734	ENSG00000148734		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	17425	protein-coding gene	gene with protein product	"""neuropeptide FF 1"""	607448	"""G protein-coupled receptor 147"""	GPR147		11024015	Standard	NM_022146		Approved	OT7T022, NPFF1R1	uc021psj.1	Q9GZQ6	OTTHUMG00000018404	ENST00000277942.6:c.1161G>A	10.37:g.72014845C>T			Somatic	12	0	0		WXS	Illumina HiSeq	Phase_I	14	0.14	2	NM_022146	0		0	A2RRF0|Q8NGR0|Q96RN3	Silent	SNP	ENST00000277942.6	37	CCDS53539.1																																																																																					0.746	NPFFR1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048504.2		NM_022146	
ZMIZ1	57178	mdanderson.org	37	10	81061922	81061922	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr10:81061922G>T	ENST00000334512.5	+	18	2650	c.2078G>T	c.(2077-2079)gGa>gTa	p.G693V		NM_020338.3	NP_065071.1	Q9ULJ6	ZMIZ1_HUMAN	zinc finger, MIZ-type containing 1	693					artery morphogenesis (GO:0048844)|cell aging (GO:0007569)|developmental growth (GO:0048589)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|vitellogenesis (GO:0007296)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(1)	30	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			GTGCTGCAAGGACTCCTCAAG	0.632																																					p.G693V													.	.			0			c.G2078T												115.0	107.0	110.0					10																	81061922		2203	4300	6503	SO:0001583	missense	57178	exon18			TGCAAGGACTCCT	AB033050	CCDS7357.1	10q22.3	2012-11-30	2006-10-24	2006-10-24	ENSG00000108175	ENSG00000108175		"""Zinc fingers, MIZ-type"""	16493	protein-coding gene	gene with protein product		607159	"""retinoic acid induced 17"""	RAI17		15626329	Standard	NM_020338		Approved	RP11-519K18.1, KIAA1224, FLJ13541, hZIMP10, Zimp10, MIZ	uc001kaf.2	Q9ULJ6	OTTHUMG00000018560	ENST00000334512.5:c.2078G>T	10.37:g.81061922G>T	ENSP00000334474:p.Gly693Val		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	28	0.11	3	NM_020338	283	0.00	0	Q5JSH9|Q7Z7E6	Missense_Mutation	SNP	ENST00000334512.5	37	CCDS7357.1	.	.	.	.	.	.	.	.	.	.	G	34	5.327494	0.95733	.	.	ENSG00000108175	ENST00000334512;ENST00000360331;ENST00000372347	T	0.35973	1.28	5.51	5.51	0.81932	.	0.000000	0.42294	D	0.000726	T	0.64702	0.2622	M	0.80982	2.52	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.67480	-0.5660	10	0.59425	D	0.04	-15.7626	19.427	0.94746	0.0:0.0:1.0:0.0	.	693	Q9ULJ6	ZMIZ1_HUMAN	V	693;623;598	ENSP00000334474:G693V	ENSP00000334474:G693V	G	+	2	0	ZMIZ1	80731928	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.413000	0.97351	2.577000	0.86979	0.561000	0.74099	GGA			0.632	ZMIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048944.2		NM_020338	
INPP5A	3632	mdanderson.org	37	10	134523943	134523943	+	Silent	SNP	G	G	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr10:134523943G>T	ENST00000368594.3	+	8	907	c.630G>T	c.(628-630)ctG>ctT	p.L210L	INPP5A_ENST00000487614.1_3'UTR|INPP5A_ENST00000368593.3_Silent_p.L210L	NM_005539.3	NP_005530.3	Q14642	I5P1_HUMAN	inositol polyphosphate-5-phosphatase, 40kDa	210					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol dephosphorylation (GO:0046856)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inositol-1,3,4,5-tetrakisphosphate 5-phosphatase activity (GO:0052659)|inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|inositol-polyphosphate 5-phosphatase activity (GO:0004445)|PH domain binding (GO:0042731)			cervix(1)|kidney(1)|large_intestine(2)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		all_cancers(35;8.59e-13)|all_epithelial(44;5.49e-09)|Lung NSC(174;0.000854)|all_lung(145;0.00146)|all_neural(114;0.0299)|Colorectal(31;0.0599)|Breast(234;0.0849)|Melanoma(40;0.124)|all_hematologic(284;0.196)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;0.000102)|Epithelial(32;0.00023)|all cancers(32;0.000326)		ACAAGGCACTGGGCTACGTGC	0.592																																					p.L210L	Pancreas(63;823 1267 11107 20380 51626)												.	.			0			c.G630T												71.0	55.0	60.0					10																	134523943		2203	4300	6503	SO:0001819	synonymous_variant	3632	exon8			GGCACTGGGCTAC	X77567	CCDS7669.2	10q26.3	2008-08-07	2002-08-29		ENSG00000068383	ENSG00000068383	3.1.3.56		6076	protein-coding gene	gene with protein product	"""CTCL tumor antigen HD-CL-02"", ""43 kDa inositol polyphosphate 5-phophatase"", ""inositol polyphosphate 5-phophatase, 40kDa"", ""InsP3 5-phosphatase"", ""type I inositol-1,4,5-trisphosphate 5-phosphatase"""	600106	"""inositol polyphosphate-5-phosphatase, 40kD"""			8013665	Standard	NM_005539		Approved	5PTASE	uc001llp.3	Q14642	OTTHUMG00000019293	ENST00000368594.3:c.630G>T	10.37:g.134523943G>T			Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	54	0.06	3	NM_005539	44	0.00	0	D3DXI3|Q14640|Q5JSF1	Silent	SNP	ENST00000368594.3	37	CCDS7669.2	.	.	.	.	.	.	.	.	.	.	G	8.619	0.890877	0.17613	.	.	ENSG00000068383	ENST00000342652	.	.	.	4.38	-0.523	0.11924	.	.	.	.	.	T	0.54224	0.1845	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47509	-0.9112	4	.	.	.	-15.637	8.338	0.32225	0.0875:0.0:0.2626:0.6499	.	.	.	.	W	182	.	.	G	+	1	0	INPP5A	134373933	1.000000	0.71417	0.972000	0.41901	0.917000	0.54804	1.032000	0.30178	0.028000	0.15324	-0.156000	0.13503	GGG			0.592	INPP5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051085.1		NM_005539	
VENTX	27287	mdanderson.org	37	10	135053695	135053695	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr10:135053695G>T	ENST00000325980.9	+	3	1173	c.662G>T	c.(661-663)tGc>tTc	p.C221F		NM_014468.3	NP_055283.1	O95231	VENTX_HUMAN	VENT homeobox	221					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			NS(1)|endometrium(1)|large_intestine(1)|lung(9)|soft_tissue(1)|upper_aerodigestive_tract(1)	14		all_cancers(35;4.15e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;7.8e-06)|Epithelial(32;9.31e-06)|all cancers(32;1.19e-05)		GCTTCCTGCTGCGGGCAGCCT	0.716																																					p.C221F													.	.			0			c.G662T												10.0	12.0	12.0					10																	135053695		2168	4259	6427	SO:0001583	missense	27287	exon3			CCTGCTGCGGGCA	AF068006	CCDS7675.1	10q26.3	2011-06-20	2011-06-01	2005-09-27	ENSG00000151650	ENSG00000151650		"""Homeoboxes / ANTP class : NKL subclass"""	13639	protein-coding gene	gene with protein product		607158	"""VENT-like homeobox 2"", ""VENT homeobox homolog (Xenopus laevis)"""	VENTX2		10790436	Standard	NM_014468		Approved	HPX42B	uc010quy.1	O95231	OTTHUMG00000019307	ENST00000325980.9:c.662G>T	10.37:g.135053695G>T	ENSP00000357556:p.Cys221Phe		Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	18	0.11	2	NM_014468	266	0.00	0	Q32MZ3	Missense_Mutation	SNP	ENST00000325980.9	37	CCDS7675.1	.	.	.	.	.	.	.	.	.	.	G	0.868	-0.733133	0.03135	.	.	ENSG00000151650	ENST00000325980	D	0.90844	-2.74	1.67	0.748	0.18376	.	1.194470	0.06142	U	0.672502	T	0.78616	0.4311	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.63726	-0.6572	10	0.09590	T	0.72	.	3.9536	0.09380	0.2277:0.0:0.7723:0.0	.	221	O95231	VENTX_HUMAN	F	221	ENSP00000357556:C221F	ENSP00000357556:C221F	C	+	2	0	VENTX	134903685	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.781000	0.04648	0.278000	0.22164	0.442000	0.29010	TGC			0.716	VENTX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051116.4		NM_014468	
OR51E1	143503	broad.mit.edu	37	11	4674157	4674157	+	Missense_Mutation	SNP	G	G	T	rs192878981		TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr11:4674157G>T	ENST00000396952.5	+	2	1051	c.401G>T	c.(400-402)cGc>cTc	p.R134L	OR51E1_ENST00000530215.1_Intron	NM_152430.3	NP_689643.2	Q8TCB6	O51E1_HUMAN	olfactory receptor, family 51, subfamily E, member 1	133						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|skin(1)|stomach(2)	30		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;7.37e-14)|GBM - Glioblastoma multiforme(2;2.85e-05)|BRCA - Breast invasive adenocarcinoma(625;0.00222)|LUSC - Lung squamous cell carcinoma(625;0.19)		CACCCACTGCGCCATGCCACA	0.557																																					p.R134L													OR51E1,caecum,carcinoma,-1,3	OR51E1	67	3	0			c.G401T												128.0	99.0	109.0					11																	4674157		2201	4298	6499	SO:0001583	missense	143503	exon2			CACTGCGCCATGC	AY775731	CCDS31358.2	11p15.4	2012-08-22	2004-11-03	2004-11-06	ENSG00000180785	ENSG00000180785		"""GPCR / Class A : Olfactory receptors"""	15194	protein-coding gene	gene with protein product		611267	"""olfactory receptor, family 51, subfamily E, member 1 pseudogene"""	OR51E1P, OR52A3P, GPR164			Standard	NM_152430		Approved	GPR136	uc001lzi.4	Q8TCB6	OTTHUMG00000157024	ENST00000396952.5:c.401G>T	11.37:g.4674157G>T	ENSP00000380155:p.Arg134Leu		Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	73	0.07	5	NM_152430	0		0	A8KAM6|Q5S4P5|Q66X57|Q6IF93	Missense_Mutation	SNP	ENST00000396952.5	37	CCDS31358.2	.	.	.	.	.	.	.	.	.	.	G	17.01	3.279510	0.59758	.	.	ENSG00000180785	ENST00000396952	T	0.01767	4.65	4.98	3.07	0.35406	GPCR, rhodopsin-like superfamily (1);	0.132494	0.33217	N	0.005147	T	0.07052	0.0179	M	0.66378	2.025	0.50467	D	0.999871	P	0.52316	0.952	D	0.65573	0.936	T	0.04427	-1.0952	10	0.87932	D	0	.	9.2214	0.37379	0.2351:0.0:0.7649:0.0	.	133	Q8TCB6	O51E1_HUMAN	L	134	ENSP00000380155:R134L	ENSP00000380155:R134L	R	+	2	0	OR51E1	4630733	0.001000	0.12720	0.999000	0.59377	0.886000	0.51366	0.926000	0.28804	1.340000	0.45581	0.655000	0.94253	CGC			0.557	OR51E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347136.2		NM_152430	
VWCE	220001	mdanderson.org	37	11	61039229	61039229	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr11:61039229C>T	ENST00000335613.5	-	14	2089	c.1703G>A	c.(1702-1704)tGc>tAc	p.C568Y	VWCE_ENST00000535710.1_Missense_Mutation_p.C33Y	NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	568	VWFC 4. {ECO:0000255|PROSITE- ProRule:PRU00220}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						GTCAAGAGAGCAGCCTGGATG	0.532																																					p.C568Y													.	.			0			c.G1703A												112.0	83.0	93.0					11																	61039229		2203	4299	6502	SO:0001583	missense	220001	exon14			AGAGAGCAGCCTG	AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.1703G>A	11.37:g.61039229C>T	ENSP00000334186:p.Cys568Tyr		Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	65	0.06	4	NM_152718	24	0.00	0	A5PKV0|Q7Z7L6|Q86WK8	Missense_Mutation	SNP	ENST00000335613.5	37	CCDS8002.1	.	.	.	.	.	.	.	.	.	.	C	16.67	3.188789	0.57909	.	.	ENSG00000167992	ENST00000335613;ENST00000535710	D;D	0.99388	-5.81;-5.81	4.77	4.77	0.60923	von Willebrand factor, type C (2);	0.000000	0.49916	D	0.000127	D	0.98924	0.9635	L	0.39898	1.24	0.42438	D	0.992709	D	0.71674	0.998	D	0.80764	0.994	D	0.99888	1.1127	10	0.56958	D	0.05	.	15.5959	0.76578	0.0:1.0:0.0:0.0	.	568	Q96DN2	VWCE_HUMAN	Y	568;33	ENSP00000334186:C568Y;ENSP00000442570:C33Y	ENSP00000334186:C568Y	C	-	2	0	VWCE	60795805	1.000000	0.71417	1.000000	0.80357	0.491000	0.33493	3.684000	0.54671	2.187000	0.69744	0.455000	0.32223	TGC			0.532	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398811.1		NM_152718	
Unknown	0	bcgsc.ca	37	11	62815368	62815368	+	IGR	SNP	G	G	A	rs150679703|rs374048942|rs7125680|rs372143980	byFrequency	TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr11:62815368G>A								SLC22A8 (32057 upstream) : SLC22A24 (32043 downstream)																							CCAAGGTGCAGCATGCCATGT	0.562																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GGTGCAGCATGCC																													11.37:g.62815368G>A			Somatic	19	0	0		WXS	Illumina HiSeq	Phase_1	34	0.29	10	.	0		0		RNA	SNP		37																																																																																					0	0.562										
PICALM	8301	ucsc.edu	37	11	85685760	85685760	+	Silent	SNP	T	T	C			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr11:85685760T>C	ENST00000393346.3	-	19	2083	c.1935A>G	c.(1933-1935)tcA>tcG	p.S645S	PICALM_ENST00000526033.1_Silent_p.S638S|PICALM_ENST00000528398.1_Silent_p.S544S|PICALM_ENST00000356360.5_Silent_p.S625S|PICALM_ENST00000532317.1_Silent_p.S603S			Q13492	PICAL_HUMAN	phosphatidylinositol binding clathrin assembly protein	645					axonogenesis (GO:0007409)|cargo loading into vesicle (GO:0035459)|cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|hemopoiesis (GO:0030097)|iron ion homeostasis (GO:0055072)|iron ion import into cell (GO:0097459)|negative regulation of gene expression (GO:0010629)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of receptor-mediated endocytosis (GO:0048261)|positive regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902961)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of neuron death (GO:1901216)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902959)|regulation of endocytosis (GO:0030100)|regulation of protein localization (GO:0032880)|synaptic vesicle maturation (GO:0016188)|vesicle-mediated transport (GO:0016192)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neurofibrillary tangle (GO:0097418)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|vesicle (GO:0031982)	1-phosphatidylinositol binding (GO:0005545)|clathrin adaptor activity (GO:0035615)|clathrin binding (GO:0030276)|clathrin heavy chain binding (GO:0032050)			endometrium(1)|kidney(2)|large_intestine(2)|liver(1)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	19		Acute lymphoblastic leukemia(157;7.42e-07)|all_hematologic(158;0.00092)				CCTGTGCTCCTGATACAGGGC	0.413			T	"""MLLT10, MLL"""	"""TALL, AML, """																																p.S645S				Dom	yes		11	11q14	8301	phosphatidylinositol binding clathrin assembly protein (CALM)		L	.	PICALM	82		0			c.A1935G												205.0	172.0	183.0					11																	85685760		2203	4299	6502	SO:0001819	synonymous_variant	8301	exon19			TGCTCCTGATACA	BC048259	CCDS8272.1, CCDS31653.1, CCDS55783.1, CCDS55784.1	11q14	2008-02-01			ENSG00000073921	ENSG00000073921			15514	protein-coding gene	gene with protein product		603025				8643484	Standard	NM_001206947		Approved	CALM, CLTH	uc001pbm.3	Q13492	OTTHUMG00000166981	ENST00000393346.3:c.1935A>G	11.37:g.85685760T>C			Somatic	75	0	0		WXS	Illumina HiSeq		43	0.09	4	NM_007166	144	0.00	0	B4DTM3|E9PN05|F8VPG7|O60700|Q4LE54|Q6GMQ6|Q86XZ9	Silent	SNP	ENST00000393346.3	37	CCDS8272.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.943|9.943	1.217908|1.217908	0.22373|0.22373	.|.	.|.	ENSG00000073921|ENSG00000073921	ENST00000530692|ENST00000529760;ENST00000532603;ENST00000526961	.|.	.|.	.|.	5.78|5.78	4.66|4.66	0.58398|0.58398	.|.	.|.	.|.	.|.	.|.	T|T	0.60261|0.60261	0.2255|0.2255	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.57353|0.57353	-0.7826|-0.7826	4|4	.|.	.|.	.|.	-2.4982|-2.4982	9.6252|9.6252	0.39746|0.39746	0.0:0.1887:0.0:0.8113|0.0:0.1887:0.0:0.8113	.|.	.|.	.|.	.|.	R|G	182|301;127;257	.|.	.|.	Q|R	-|-	2|1	0|2	PICALM|PICALM	85363408|85363408	0.947000|0.947000	0.32204|0.32204	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	-0.066000|-0.066000	0.11598|0.11598	1.133000|1.133000	0.42147|0.42147	-0.326000|-0.326000	0.08463|0.08463	CAG|AGG			0.413	PICALM-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000392224.1		NM_007166	
PGR	5241	mdanderson.org	37	11	100999388	100999388	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr11:100999388G>T	ENST00000325455.5	-	1	1867	c.414C>A	c.(412-414)agC>agA	p.S138R	PGR_ENST00000534013.1_Intron|PGR_ENST00000263463.5_Missense_Mutation_p.S138R	NM_000926.4|NM_001202474.1|NM_001271162.1	NP_000917.3|NP_001189403.1|NP_001258091.1	P06401	PRGR_HUMAN	progesterone receptor	138	Modulating, Pro-Rich.				cell-cell signaling (GO:0007267)|epithelial cell maturation (GO:0002070)|gene expression (GO:0010467)|negative regulation of gene expression (GO:0010629)|ovulation from ovarian follicle (GO:0001542)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone receptor signaling pathway (GO:0050847)|regulation of epithelial cell proliferation (GO:0050678)|signal transduction (GO:0007165)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	36		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Allylestrenol(DB01431)|Danazol(DB01406)|Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluticasone Propionate(DB00588)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Megestrol acetate(DB00351)|Mifepristone(DB00834)|Norelgestromin(DB06713)|Norethindrone(DB00717)|Norgestimate(DB00957)|Progesterone(DB00396)|Spironolactone(DB00421)	GGCACCAAGAGCTGGTGACCT	0.667																																					p.S138R	Pancreas(124;2271 2354 21954 22882)												.	.			0			c.C414A												17.0	16.0	16.0					11																	100999388		2199	4297	6496	SO:0001583	missense	5241	exon1			CCAAGAGCTGGTG	M15716	CCDS8310.1, CCDS59229.1	11q22-q23	2013-01-16			ENSG00000082175	ENSG00000082175		"""Nuclear hormone receptors"""	8910	protein-coding gene	gene with protein product		607311					Standard	NM_000926		Approved	PR, NR3C3	uc001pgh.2	P06401	OTTHUMG00000167531	ENST00000325455.5:c.414C>A	11.37:g.100999388G>T	ENSP00000325120:p.Ser138Arg		Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	23	0.09	2	NM_000926	0		0	A7LQ08|A7X8B0|B4E3T0|Q8TDS3|Q9UPF7	Missense_Mutation	SNP	ENST00000325455.5	37	CCDS8310.1	.	.	.	.	.	.	.	.	.	.	G	15.93	2.977364	0.53720	.	.	ENSG00000082175	ENST00000325455;ENST00000263463;ENST00000537623	T;T	0.07688	3.17;3.17	4.09	2.19	0.27852	.	0.565884	0.16650	N	0.205259	T	0.11281	0.0275	M	0.65498	2.005	0.24306	N	0.995109	P;P	0.44946	0.846;0.748	B;B	0.43701	0.428;0.428	T	0.14090	-1.0485	10	0.72032	D	0.01	.	5.5482	0.17076	0.2585:0.0:0.7415:0.0	.	138;138	Q8TDS3;P06401	.;PRGR_HUMAN	R	138	ENSP00000325120:S138R;ENSP00000263463:S138R	ENSP00000263463:S138R	S	-	3	2	PGR	100504598	0.053000	0.20554	0.502000	0.27614	0.975000	0.68041	0.196000	0.17176	0.376000	0.24707	0.561000	0.74099	AGC			0.667	PGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394934.1			
ST14	6768	mdanderson.org	37	11	130060496	130060496	+	Missense_Mutation	SNP	G	G	T	rs560453267		TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr11:130060496G>T	ENST00000278742.5	+	7	1200	c.782G>T	c.(781-783)cGc>cTc	p.R261L		NM_021978.3	NP_068813.1	Q9Y5Y6	ST14_HUMAN	suppression of tumorigenicity 14 (colon carcinoma)	261	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				keratinocyte differentiation (GO:0030216)|proteolysis (GO:0006508)	basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|pancreas(2)|prostate(1)|skin(3)	32	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	CTCACCTTCCGCAGCTTTGAC	0.682																																					p.R261L													.	.			0			c.G782T												36.0	29.0	31.0					11																	130060496		2201	4297	6498	SO:0001583	missense	6768	exon7			CCTTCCGCAGCTT	AF118224	CCDS8487.1	11q24-q25	2011-08-31	2005-11-19		ENSG00000149418	ENSG00000149418		"""Serine peptidases / Transmembrane"""	11344	protein-coding gene	gene with protein product	"""epithin"", ""matriptase"""	606797		PRSS14		9925927, 10373424	Standard	NM_021978		Approved	SNC19, HAI, MT-SP1, TMPRSS14	uc001qfw.3	Q9Y5Y6	OTTHUMG00000165768	ENST00000278742.5:c.782G>T	11.37:g.130060496G>T	ENSP00000278742:p.Arg261Leu		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_021978	16	0.00	0	Q9BS01|Q9H3S0|Q9HB36|Q9HCA3	Missense_Mutation	SNP	ENST00000278742.5	37	CCDS8487.1	.	.	.	.	.	.	.	.	.	.	G	16.52	3.146925	0.57151	.	.	ENSG00000149418	ENST00000278742;ENST00000525779	T	0.17370	2.28	5.55	3.35	0.38373	CUB (5);	0.505513	0.15228	N	0.273584	T	0.11367	0.0277	L	0.38175	1.15	0.33427	D	0.580584	P;P	0.44946	0.846;0.793	B;B	0.39904	0.313;0.209	T	0.16070	-1.0415	10	0.24483	T	0.36	.	4.8643	0.13600	0.2867:0.1679:0.5454:0.0	.	71;261	B4DYI7;Q9Y5Y6	.;ST14_HUMAN	L	261;163	ENSP00000278742:R261L	ENSP00000278742:R261L	R	+	2	0	ST14	129565706	0.113000	0.22115	1.000000	0.80357	0.992000	0.81027	0.552000	0.23376	1.357000	0.45904	0.650000	0.86243	CGC			0.682	ST14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000386119.1			
LRP6	4040	broad.mit.edu	37	12	12303884	12303884	+	Silent	SNP	G	G	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr12:12303884G>T	ENST00000261349.4	-	13	2956	c.2880C>A	c.(2878-2880)ccC>ccA	p.P960P	LRP6_ENST00000543091.1_Silent_p.P960P	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	960	Beta-propeller 4.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				GGCTGTGGATGGGAAGGATGA	0.488																																					p.P960P													.	LRP6	170		0			c.C2880A												171.0	150.0	157.0					12																	12303884		2203	4300	6503	SO:0001819	synonymous_variant	4040	exon13			GTGGATGGGAAGG	AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.2880C>A	12.37:g.12303884G>T			Somatic	165	0.0060606061	1		WXS	Illumina HiSeq	Phase_I	203	0.02	4	NM_002336	58	0.00	0	Q17RZ2	Silent	SNP	ENST00000261349.4	37	CCDS8647.1																																																																																					0.488	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000400137.1			
KRAS	3845	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12V	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)			Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS_ENST00000256078,NS,adenocarcinoma,0,25136	KRAS_ENST00000256078	0	25136	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35T												91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	ACGCCACCAGCTC	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val		Somatic	175	0	0		WXS	Illumina HiSeq	.	244	0.18	43	NM_004985	45	0.22	10	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT			0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000412232.1		NM_033360	
PLXNC1	10154	mdanderson.org	37	12	94542977	94542977	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr12:94542977C>T	ENST00000258526.4	+	1	479	c.230C>T	c.(229-231)tCg>tTg	p.S77L		NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	77	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						CACAGCCTCTCGCGCCTGTAC	0.711																																					p.S77L													.	.			0			c.C230T												16.0	19.0	18.0					12																	94542977		2174	4257	6431	SO:0001583	missense	10154	exon1			GCCTCTCGCGCCT	AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.230C>T	12.37:g.94542977C>T	ENSP00000258526:p.Ser77Leu		Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	29	0.10	3	NM_005761	3	0.00	0	Q59H25	Missense_Mutation	SNP	ENST00000258526.4	37	CCDS9049.1	.	.	.	.	.	.	.	.	.	.	C	17.46	3.395721	0.62177	.	.	ENSG00000136040	ENST00000258526	T	0.05258	3.47	4.48	3.59	0.41128	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (2);	0.793652	0.10574	N	0.658833	T	0.08582	0.0213	L	0.57536	1.79	0.80722	D	1	B	0.26041	0.14	B	0.12156	0.007	T	0.05699	-1.0869	10	0.72032	D	0.01	.	8.8437	0.35157	0.1483:0.7703:0.0:0.0814	.	77	O60486	PLXC1_HUMAN	L	77	ENSP00000258526:S77L	ENSP00000258526:S77L	S	+	2	0	PLXNC1	93067108	1.000000	0.71417	0.996000	0.52242	0.941000	0.58515	3.336000	0.52113	0.862000	0.35528	0.455000	0.32223	TCG			0.711	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000408126.2			
METAP2	10988	broad.mit.edu	37	12	95867964	95867964	+	Silent	SNP	T	T	G			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr12:95867964T>G	ENST00000323666.5	+	1	238	c.9T>G	c.(7-9)ggT>ggG	p.G3G	METAP2_ENST00000261220.9_Silent_p.G3G|METAP2_ENST00000551840.1_Silent_p.G3G|METAP2_ENST00000550777.1_Silent_p.G3G|METAP2_ENST00000546753.1_Silent_p.G3G	NM_006838.3	NP_006829.1			methionyl aminopeptidase 2											endometrium(3)|large_intestine(2)|lung(7)|prostate(1)	13						ACATGGCGGGTGTGGAGGAGG	0.652																																					p.G3G													.	METAP2	28		0			c.T9G												34.0	42.0	39.0					12																	95867964		2203	4297	6500	SO:0001819	synonymous_variant	10988	exon1			GGCGGGTGTGGAG	U13261	CCDS9052.1	12q22	2014-09-04			ENSG00000111142		3.4.11.18		16672	protein-coding gene	gene with protein product	"""Peptidase M"""	601870				7644482, 8858118	Standard	NM_006838		Approved	MNPEP, p67, MAP2	uc001tec.3	P50579	OTTHUMG00000170280	ENST00000323666.5:c.9T>G	12.37:g.95867964T>G			Somatic	90	0.2	18		WXS	Illumina HiSeq	Phase_I	110	0.23	25	NM_006838	235	0.07	16		Silent	SNP	ENST00000323666.5	37	CCDS9052.1																																																																																					0.652	METAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000408296.1		NM_006838	
LOC101927592	101927592	broad.mit.edu	37	12	127423596	127423597	+	lincRNA	DEL	TG	TG	-	rs376186206|rs533478047		TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr12:127423596_127423597delTG	ENST00000512624.2	-	0	685																											tgtatgtgtttgtgtgtgtgtg	0.356																																					.													.	.			0			.																																											0	.			TGTGTTTGTGTGT																													12.37:g.127423606_127423607delTG			Somatic	12	0	0		WXS	Illumina HiSeq	Phase_I	8	0.50	4	.	0		0		RNA	DEL	ENST00000512624.2	37																																																																																						0.356	RP11-575F12.1-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000399788.1			
GPC5	2262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	92345961	92345961	+	Silent	SNP	G	G	A			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr13:92345961G>A	ENST00000377067.3	+	3	1218	c.846G>A	c.(844-846)ctG>ctA	p.L282L		NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	282					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				GAGGCTGCCTGGCGCACATGG	0.552																																					p.L282L													.	.			0			c.G846A												111.0	98.0	103.0					13																	92345961		2203	4300	6503	SO:0001819	synonymous_variant	2262	exon3			CTGCCTGGCGCAC	AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.846G>A	13.37:g.92345961G>A			Somatic	57	0	0		WXS	Illumina HiSeq	.	47	0.47	22	NM_004466	0		0	B2R726|O60436|Q9BX27	Silent	SNP	ENST00000377067.3	37	CCDS9468.1																																																																																					0.552	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045454.1		NM_004466	
ATG2B	55102	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	96772134	96772134	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr14:96772134C>A	ENST00000359933.4	-	31	5418	c.4525G>T	c.(4525-4527)Gtt>Ttt	p.V1509F	ATG2B_ENST00000261834.5_5'UTR	NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	1509					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		ATTTTTATAACTGGTTCTTCT	0.373																																					p.V1509F													.	.			0			c.G4525T												94.0	90.0	91.0					14																	96772134		2203	4300	6503	SO:0001583	missense	55102	exon31			TTATAACTGGTTC	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.4525G>T	14.37:g.96772134C>A	ENSP00000353010:p.Val1509Phe		Somatic	81	0	0		WXS	Illumina HiSeq	.	99	0.29	29	NM_018036	13	0.38	5	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	ENST00000359933.4	37	CCDS9944.2	.	.	.	.	.	.	.	.	.	.	C	15.77	2.931561	0.52866	.	.	ENSG00000066739	ENST00000359933	T	0.60424	0.19	5.55	2.69	0.31865	.	0.448845	0.24182	N	0.040791	T	0.47432	0.1445	M	0.66939	2.045	0.25297	N	0.989311	P	0.38250	0.624	B	0.32149	0.141	T	0.46359	-0.9197	10	0.56958	D	0.05	.	5.2487	0.15510	0.1298:0.5749:0.0:0.2952	.	1509	Q96BY7	ATG2B_HUMAN	F	1509	ENSP00000353010:V1509F	ENSP00000261834:V153F	V	-	1	0	ATG2B	95841887	0.857000	0.29778	0.381000	0.26106	0.928000	0.56348	1.688000	0.37690	0.274000	0.22072	0.591000	0.81541	GTT			0.373	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000314037.1		NM_018036	
GABPB1	2553	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	50581739	50581739	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr15:50581739G>C	ENST00000220429.8	-	7	1028	c.860C>G	c.(859-861)tCt>tGt	p.S287C	GABPB1_ENST00000359031.4_Missense_Mutation_p.S275C|GABPB1_ENST00000543881.1_Missense_Mutation_p.S211C|GABPB1_ENST00000429662.2_Missense_Mutation_p.S287C|GABPB1_ENST00000380877.3_Missense_Mutation_p.S275C|GABPB1_ENST00000396464.3_Missense_Mutation_p.S275C|GABPB1_ENST00000560825.1_Missense_Mutation_p.S274C			Q06547	GABP1_HUMAN	GA binding protein transcription factor, beta subunit 1	287	Transcription activation and HCFC1 interaction.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(1)|large_intestine(7)|lung(5)	14						GGTTGGAATAGAGTGCAAATT	0.403																																					p.S287C													.	.			0			c.C860G												119.0	112.0	115.0					15																	50581739		2196	4295	6491	SO:0001583	missense	2553	exon7			GGAATAGAGTGCA	D13316	CCDS10135.1, CCDS10136.1, CCDS32239.1, CCDS45258.1	15q21.2	2013-01-10	2008-02-25	2008-02-25	ENSG00000104064	ENSG00000104064		"""Ankyrin repeat domain containing"""	4074	protein-coding gene	gene with protein product		600610	"""GA binding protein transcription factor, beta subunit 2"""	GABPB2		7958862	Standard	NM_016655		Approved	E4TF1-47, GABPB	uc001zyb.3	Q06547	OTTHUMG00000131642	ENST00000220429.8:c.860C>G	15.37:g.50581739G>C	ENSP00000220429:p.Ser287Cys		Somatic	71	0	0		WXS	Illumina HiSeq	.	122	0.22	27	NM_005254	143	0.26	37	A8IE52|Q06545|Q12940|Q12941|Q12942|Q8IYD0	Missense_Mutation	SNP	ENST00000220429.8	37	CCDS32239.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.461620	0.84425	.	.	ENSG00000104064	ENST00000220429;ENST00000380877;ENST00000543881;ENST00000396464;ENST00000429662;ENST00000359031	T;T;T;T	0.69040	0.68;-0.37;-0.36;-0.37	5.78	5.78	0.91487	.	0.139122	0.51477	D	0.000095	T	0.76723	0.4027	L	0.36672	1.1	0.51767	D	0.999932	D;D;D;D;D	0.76494	0.999;0.997;0.999;0.997;0.999	D;D;D;D;D	0.79784	0.99;0.951;0.993;0.981;0.937	T	0.76545	-0.2920	10	0.54805	T	0.06	-4.0469	20.0203	0.97492	0.0:0.0:1.0:0.0	.	287;287;275;287;275	B7Z726;Q06547-3;Q06547-4;Q06547;Q06547-2	.;.;.;GABP1_HUMAN;.	C	275;287;211;275;287;275	ENSP00000442500:S211C;ENSP00000379728:S275C;ENSP00000395771:S287C;ENSP00000351923:S275C	ENSP00000220429:S275C	S	-	2	0	GABPB1	48369031	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.235000	0.78143	2.730000	0.93505	0.655000	0.94253	TCT			0.403	GABPB1-005	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000418294.1			
BNIP2	663	mdanderson.org	37	15	59981599	59981599	+	5'Flank	SNP	G	G	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr15:59981599G>T	ENST00000607373.1	-	0	0				RP11-361D15.2_ENST00000560199.1_RNA|BNIP2_ENST00000267859.3_Missense_Mutation_p.P14Q|BNIP2_ENST00000415213.2_5'Flank	NM_004330.2	NP_004321.2	Q12982	BNIP2_HUMAN	BCL2/adenovirus E1B 19kDa interacting protein 2						apoptotic process (GO:0006915)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|positive regulation of GTPase activity (GO:0043547)|positive regulation of muscle cell differentiation (GO:0051149)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)	calcium ion binding (GO:0005509)|GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)			NS(1)|large_intestine(2)|lung(5)|ovary(1)	9						ggggcgtggcggcggcggagg	0.721																																					p.P14Q	Ovarian(174;1936 1978 6671 8240 38212)												.	.			0			c.C41A												2.0	5.0	5.0					15																	59981599		542	1399	1941	SO:0001631	upstream_gene_variant	663	exon1			CGTGGCGGCGGCG	U15173	CCDS10174.2	15q21.3	2008-07-18	2002-08-29		ENSG00000140299	ENSG00000140299			1083	protein-coding gene	gene with protein product		603292	"""BCL2/adenovirus E1B 19kD-interacting protein 2"""			7954800	Standard	NM_004330		Approved	Nip2, BNIP-2	uc010uhc.2	Q12982	OTTHUMG00000132727		15.37:g.59981599G>T	Exception_encountered		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	54	0.06	3	NM_004330	0		0	B4DS94	Missense_Mutation	SNP	ENST00000607373.1	37		.	.	.	.	.	.	.	.	.	.	G	10.70	1.425172	0.25639	.	.	ENSG00000140299	ENST00000267859	T	0.38401	1.14	.	.	.	.	.	.	.	.	T	0.25195	0.0612	.	.	.	0.18873	N	0.999987	.	.	.	.	.	.	T	0.27673	-1.0067	3	.	.	.	.	.	.	.	.	.	.	.	Q	14	ENSP00000267859:P14Q	.	P	-	2	0	BNIP2	57768891	0.026000	0.19158	0.037000	0.18230	0.268000	0.26511	1.510000	0.35790	0.064000	0.16427	0.064000	0.15345	CCG			0.721	BNIP2-012	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000470740.1		NM_004330	
GOLGA6D	653643	broad.mit.edu	37	15	75580675	75580676	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr15:75580675_75580676delTG	ENST00000434739.3	+	7	575_576	c.534_535delTG	c.(532-537)gctgtgfs	p.V179fs		NM_001145224.1	NP_001138696.1	P0CG33	GOG6D_HUMAN	golgin A6 family, member D	179						Golgi apparatus (GO:0005794)				kidney(1)|lung(1)	2						CTCTCTGTGCTGTGTCTACACA	0.554																																					p.178_179del													.	GOLGA6D	9		0			c.534_535del									0,3424		0,0,1712						1.6	0.0			12	8,6692		1,6,3343	no	frameshift	GOLGA6D	NM_001145224.1		1,6,5055	A1A1,A1R,RR		0.1194,0.0,0.079				8,10116				SO:0001589	frameshift_variant	653643	exon7			CTGTGCTGTGTCT		CCDS45308.1	15q24.2	2013-05-10	2010-02-12	2009-09-04	ENSG00000140478	ENSG00000140478			32204	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6D"""				Standard	NM_001145224		Approved		uc010uma.2	P0CG33	OTTHUMG00000172672	ENST00000434739.3:c.534_535delTG	15.37:g.75580677_75580678delTG	ENSP00000391085:p.Val179fs		Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	12	0.33	4	NM_001145224	0		0		Frame_Shift_Del	DEL	ENST00000434739.3	37	CCDS45308.1																																																																																					0.554	GOLGA6D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000419798.1		NM_001145224	
KREMEN2	79412	mdanderson.org	37	16	3017029	3017029	+	Silent	SNP	C	C	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr16:3017029C>T	ENST00000303746.5	+	6	1336	c.759C>T	c.(757-759)ggC>ggT	p.G253G	PAQR4_ENST00000318782.8_5'Flank|KREMEN2_ENST00000319500.6_Silent_p.G253G|PAQR4_ENST00000572687.1_5'Flank|KREMEN2_ENST00000575769.1_Silent_p.G253G|PKMYT1_ENST00000571102.1_5'Flank|KREMEN2_ENST00000571007.1_Silent_p.G214G|KREMEN2_ENST00000572045.1_Silent_p.G253G|PAQR4_ENST00000576565.1_5'Flank|KREMEN2_ENST00000575885.1_Silent_p.G214G|PAQR4_ENST00000293978.8_5'Flank			Q8NCW0	KREM2_HUMAN	kringle containing transmembrane protein 2	253	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059, ECO:0000305}.				Wnt signaling pathway (GO:0016055)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|large_intestine(1)	4						GCCCGCCAGGCGCCGCGCTGG	0.736																																					p.G253G													.	.			0			c.C759T												6.0	8.0	8.0					16																	3017029		1868	3761	5629	SO:0001819	synonymous_variant	79412	exon6			GCCAGGCGCCGCG	BC003533	CCDS10483.1, CCDS10484.1, CCDS58412.1, CCDS58413.1	16p13.11	2008-08-04			ENSG00000131650	ENSG00000131650			18797	protein-coding gene	gene with protein product		609899				12050670	Standard	NM_172229		Approved	MGC10791, KRM2	uc002csg.3	Q8NCW0	OTTHUMG00000128976	ENST00000303746.5:c.759C>T	16.37:g.3017029C>T			Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	16	0.13	2	NM_024507	3	0.00	0	B4DXF6|I3L2S2|Q8N2J4|Q8NCW1|Q96GL8|Q9BTP9	Silent	SNP	ENST00000303746.5	37	CCDS10483.1																																																																																					0.736	KREMEN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250964.2		NM_145347	
MEFV	4210	mdanderson.org	37	16	3304633	3304633	+	Silent	SNP	G	G	A			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr16:3304633G>A	ENST00000219596.1	-	2	474	c.435C>T	c.(433-435)agC>agT	p.S145S	MEFV_ENST00000339854.4_Intron|MEFV_ENST00000541159.1_Intron|MEFV_ENST00000536379.1_Intron	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	145					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						CCTCGGGCTGGCTGCACCGCA	0.711																																					p.S145S													.	.			0			c.C435T												12.0	13.0	12.0					16																	3304633		2135	4211	6346	SO:0001819	synonymous_variant	4210	exon2			GGGCTGGCTGCAC	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.435C>T	16.37:g.3304633G>A			Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_000243	0		0	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Silent	SNP	ENST00000219596.1	37	CCDS10498.1																																																																																					0.711	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251464.1		NM_000243	
TAOK2	9344	mdanderson.org	37	16	29996705	29996705	+	Missense_Mutation	SNP	C	C	T	rs373048486		TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr16:29996705C>T	ENST00000308893.4	+	14	2637	c.1594C>T	c.(1594-1596)Cgg>Tgg	p.R532W	TAOK2_ENST00000543033.1_Missense_Mutation_p.R532W|TAOK2_ENST00000416441.2_Missense_Mutation_p.R359W|TAOK2_ENST00000279394.3_Missense_Mutation_p.R532W	NM_001252043.1|NM_016151.3	NP_001238972.1|NP_057235.2	Q9UL54	TAOK2_HUMAN	TAO kinase 2	532					actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|focal adhesion assembly (GO:0048041)|G2 DNA damage checkpoint (GO:0031572)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein targeting to membrane (GO:0006612)|regulation of cell growth (GO:0001558)|regulation of cell shape (GO:0008360)|response to stress (GO:0006950)|stress-activated MAPK cascade (GO:0051403)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase binding (GO:0031434)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(3)|skin(1)	22						TGAGGCGCAGCGGGCTGGCTT	0.677																																					p.R532W													.	.			0			c.C1594T							C	TRP/ARG,TRP/ARG	0,4390		0,0,2195	17.0	18.0	17.0		1594,1594	4.5	1.0	16		17	1,8593		0,1,4296	no	missense,missense	TAOK2	NM_004783.2,NM_016151.2	101,101	0,1,6491	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	532/1050,532/1236	29996705	1,12983	2195	4297	6492	SO:0001583	missense	9344	exon14			GCGCAGCGGGCTG	AB020688	CCDS10662.1, CCDS10663.1, CCDS58448.1	16p11.2	2008-02-05			ENSG00000149930	ENSG00000149930			16835	protein-coding gene	gene with protein product		613199				10048485, 9786855	Standard	NM_016151		Approved	TAO1, KIAA0881, PSK, PSK1, TAO2, MAP3K17	uc002dva.2	Q9UL54	OTTHUMG00000132111	ENST00000308893.4:c.1594C>T	16.37:g.29996705C>T	ENSP00000310094:p.Arg532Trp		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_001252043	222	0.00	0	A5PKY1|A7MCZ2|B2RN35|B7ZM88|O94957|Q6UW73|Q7LC09|Q9NSW2	Missense_Mutation	SNP	ENST00000308893.4	37	CCDS10663.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.306966	0.81247	0.0	1.16E-4	ENSG00000149930	ENST00000416441;ENST00000308893;ENST00000543033;ENST00000279394	T;T;T	0.43294	0.95;0.95;0.95	5.51	4.54	0.55810	.	0.000000	0.85682	D	0.000000	T	0.64702	0.2622	M	0.77820	2.39	0.54753	D	0.999986	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.993;0.999;1.0;0.999;0.998	T	0.67452	-0.5667	9	.	.	.	.	14.3534	0.66719	0.1497:0.8503:0.0:0.0	.	723;359;532;532;532	Q86V37;Q9UL54-3;Q9UL54-2;A0PJ48;Q9UL54	.;.;.;.;TAOK2_HUMAN	W	532	ENSP00000310094:R532W;ENSP00000440336:R532W;ENSP00000279394:R532W	.	R	+	1	2	TAOK2	29904206	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	4.081000	0.57627	1.274000	0.44362	0.563000	0.77884	CGG			0.677	TAOK2-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000255152.2		NM_016151	
ITGAL	3683	mdanderson.org	37	16	30532938	30532938	+	Silent	SNP	G	G	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr16:30532938G>T	ENST00000356798.6	+	31	3645	c.3465G>T	c.(3463-3465)ctG>ctT	p.L1155L	ITGAL_ENST00000358164.5_Silent_p.L1071L|ITGAL_ENST00000433423.2_Silent_p.L389L	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	1155					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	CCGGCTGCCTGAAGCCCCTCC	0.607																																					p.L1155L	NSCLC(110;1462 1641 3311 33990 49495)												.	.			0			c.G3465T												61.0	64.0	63.0					16																	30532938		2197	4300	6497	SO:0001819	synonymous_variant	3683	exon31			CTGCCTGAAGCCC		CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.3465G>T	16.37:g.30532938G>T			Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_002209	124	0.00	0	O43746|Q45H73|Q96HB1|Q9UBC8	Silent	SNP	ENST00000356798.6	37	CCDS32433.1																																																																																					0.607	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000434508.2			
UPF3AP2	147150	hgsc.bcm.edu	37	17	20279706	20279706	+	RNA	SNP	C	C	T	rs146426615	byFrequency	TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr17:20279706C>T	ENST00000578315.1	-	0	0									UPF3A pseudogene 2																		ttcctcttcccgcaaacgttt	0.333													C|||	23	0.00459265	0.0174	0.0	5008	,	,		18411	0.0		0.0	False		,,,				2504	0.0				.													.	.			0			.																																											348254	.			TCTTCCCGCAAAC			17p11.2	2013-09-13	2013-09-13			ENSG00000214832			30567	pseudogene	pseudogene			"""UPF3 regulator of nonsense transcripts homolog A (yeast) pseudogene 2"""			11997339	Standard	NG_001546		Approved						17.37:g.20279706C>T			Somatic	89	0	0		WXS	Illumina HiSeq	.	89	0.25	22	.	170	0.00	0		RNA	SNP	ENST00000578315.1	37																																																																																				0.005		0.333	UPF3AP2-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000443627.1		NG_001546	
RNF43	54894	mdanderson.org	37	17	56435856	56435856	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr17:56435856G>T	ENST00000584437.1	-	8	3236	c.1281C>A	c.(1279-1281)caC>caA	p.H427Q	RNF43_ENST00000577625.1_Missense_Mutation_p.H300Q|RNF43_ENST00000500597.2_Missense_Mutation_p.H386Q|RNF43_ENST00000583753.1_Missense_Mutation_p.H386Q|RNF43_ENST00000407977.2_Missense_Mutation_p.H427Q|RNF43_ENST00000577716.1_Missense_Mutation_p.H427Q|RNF43_ENST00000581868.1_Missense_Mutation_p.H300Q|BZRAP1-AS1_ENST00000583841.1_RNA			Q68DV7	RNF43_HUMAN	ring finger protein 43	427					negative regulation of Wnt signaling pathway (GO:0030178)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|stem cell proliferation (GO:0072089)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(5)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(14)|lung(9)|ovary(2)|pancreas(10)|prostate(1)|skin(4)	60	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AAGCAGCAGGGTGCTGTGAGG	0.647																																					p.H427Q													.	.			0			c.C1281A												42.0	46.0	44.0					17																	56435856		2203	4300	6503	SO:0001583	missense	54894	exon9			AGCAGGGTGCTGT		CCDS11607.1	17q23.2	2013-01-09						"""RING-type (C3HC4) zinc fingers"""	18505	protein-coding gene	gene with protein product		612482					Standard	NM_017763		Approved	FLJ20315, DKFZp781H0392, URCC	uc002iwh.4	Q68DV7		ENST00000584437.1:c.1281C>A	17.37:g.56435856G>T	ENSP00000463069:p.His427Gln		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	72	0.06	4	NM_017763	15	0.00	0	A8K4R2|B7Z443|B7Z5D5|B7Z5J5|Q65ZA4|Q6AI04|Q9NXD0	Missense_Mutation	SNP	ENST00000584437.1	37	CCDS11607.1	.	.	.	.	.	.	.	.	.	.	G	9.567	1.120040	0.20877	.	.	ENSG00000108375	ENST00000407977;ENST00000500597	T;T	0.08720	3.19;3.06	4.2	2.16	0.27623	.	0.294510	0.26241	N	0.025502	T	0.12305	0.0299	L	0.29908	0.895	0.31727	N	0.637555	D;D;P	0.69078	0.962;0.997;0.937	P;D;P	0.63793	0.764;0.918;0.585	T	0.09509	-1.0671	10	0.30854	T	0.27	-10.5688	7.315	0.26495	0.2113:0.0:0.7887:0.0	.	386;427;427	Q68DV7-2;Q68DV7-4;Q68DV7	.;.;RNF43_HUMAN	Q	427;386	ENSP00000385328:H427Q;ENSP00000441969:H386Q	ENSP00000385328:H427Q	H	-	3	2	RNF43	53790855	0.999000	0.42202	0.522000	0.27862	0.352000	0.29268	0.417000	0.21214	0.398000	0.25338	0.195000	0.17529	CAC			0.647	RNF43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000444713.1		NM_017763	
LOC101928766	101928766	broad.mit.edu	37	17	77899577	77899577	+	lincRNA	DEL	C	C	-			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr17:77899577delC	ENST00000576738.1	-	0	947				RP11-353N14.4_ENST00000574526.1_lincRNA																							CAGCTCTGGTCCCCCGGCCCC	0.677																																					.													.	.			0			.																																											0	.			TCTGGTCCCCCGG																													17.37:g.77899577delC			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	DEL	ENST00000576738.1	37																																																																																						0.677	RP11-353N14.5-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000437142.1			
TXNDC2	84203	hgsc.bcm.edu	37	18	9886894	9886894	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr18:9886894A>G	ENST00000306084.6	+	2	617	c.418A>G	c.(418-420)Aaa>Gaa	p.K140E	TXNDC2_ENST00000357775.5_Missense_Mutation_p.K73E|TXNDC2_ENST00000426718.3_3'UTR|TXNDC2_ENST00000536353.2_Missense_Mutation_p.K73E	NM_001098529.1	NP_001091999.1	Q86VQ3	TXND2_HUMAN	thioredoxin domain containing 2 (spermatozoa)	140	22 X 15 AA approximate tandem repeat of Q-P-K-X-G-D-I-P-K-S-[PS]-E-[KE]-X-I.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)|multicellular organismal development (GO:0007275)|oxidation-reduction process (GO:0055114)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)	nutrient reservoir activity (GO:0045735)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)	p.K140E(2)|p.K73E(2)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(7)|urinary_tract(1)	31						GTCCTCAGAAAAAGCCATCCA	0.547																																					p.K140E													TXNDC2_ENST00000306084,bladder,carcinoma,0,4	TXNDC2_ENST00000306084	0	4	4	Substitution - Missense(4)	urinary_tract(2)|lung(2)	c.A418G												133.0	131.0	132.0					18																	9886894		2203	4300	6503	SO:0001583	missense	84203	exon2			TCAGAAAAAGCCA	AF080095	CCDS11846.1, CCDS42414.1	18p11.31-p11.2	2009-03-11	2009-03-11	2007-08-16	ENSG00000168454	ENSG00000168454			16470	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 1"""					11230166, 11399755	Standard	NM_001098529		Approved	SPTRX1	uc002koi.4	Q86VQ3	OTTHUMG00000131602	ENST00000306084.6:c.418A>G	18.37:g.9886894A>G	ENSP00000304908:p.Lys140Glu		Somatic	90	0.0111111111	1		WXS	Illumina HiSeq	.	58	0.05	3	NM_001098529	0		0	A5YM73|Q8N7U4|Q96RX3|Q9H0L8	Missense_Mutation	SNP	ENST00000306084.6	37	CCDS42414.1	.	.	.	.	.	.	.	.	.	.	a	8.625	0.892206	0.17613	.	.	ENSG00000168454	ENST00000536353;ENST00000357775;ENST00000306084;ENST00000426718	T;T;T	0.20069	2.1;2.3;2.3	3.48	-6.96	0.01622	.	1.199930	0.06365	N	0.712409	T	0.12774	0.0310	L	0.35854	1.095	0.09310	N	1	B	0.25048	0.117	B	0.25884	0.064	T	0.32693	-0.9897	9	.	.	.	.	5.8007	0.18412	0.5013:0.2415:0.2572:0.0	.	140	Q86VQ3	TXND2_HUMAN	E	73;73;140;140	ENSP00000437393:K73E;ENSP00000350419:K73E;ENSP00000304908:K140E	.	K	+	1	0	TXNDC2	9876894	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.892000	0.04131	-1.042000	0.03262	-1.380000	0.01176	AAA			0.547	TXNDC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000254487.1			
CABLES1	91768	mdanderson.org	37	18	20716388	20716388	+	Missense_Mutation	SNP	C	C	T	rs371732182		TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr18:20716388C>T	ENST00000256925.7	+	1	662	c.662C>T	c.(661-663)gCg>gTg	p.A221V	CABLES1_ENST00000400473.2_Intron|AC105247.1_ENST00000411067.1_RNA	NM_001100619.2	NP_001094089.1	Q8TDN4	CABL1_HUMAN	Cdk5 and Abl enzyme substrate 1	221	Interacts with CDK3. {ECO:0000250}.				blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|nervous system development (GO:0007399)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)	cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			breast(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|stomach(1)	11	all_cancers(21;0.000102)|all_epithelial(16;2.48e-06)|Lung NSC(20;0.00696)|all_lung(20;0.0197)|Colorectal(14;0.0202)|Ovarian(20;0.127)					CAGGTGCCGGCGGCCGCCTTT	0.692																																					p.A221V													.	.			0			c.C662T							C	VAL/ALA	0,3762		0,0,1881	13.0	17.0	15.0		662	2.6	0.5	18		15	1,8197		0,1,4098	no	missense	CABLES1	NM_001100619.2	64	0,1,5979	TT,TC,CC		0.0122,0.0,0.0084	benign	221/634	20716388	1,11959	1881	4099	5980	SO:0001583	missense	91768	exon1			TGCCGGCGGCCGC	BC037218	CCDS42417.1, CCDS42418.1, CCDS58615.1	18q11.2	2005-08-16				ENSG00000134508			25097	protein-coding gene	gene with protein product		609194				12477932	Standard	NM_138375		Approved	HsT2563, FLJ35924	uc002kuc.2	Q8TDN4		ENST00000256925.7:c.662C>T	18.37:g.20716388C>T	ENSP00000256925:p.Ala221Val		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_001100619	13	0.00	0	B4DK60|Q8N3Y8|Q8NA22|Q9BTG1	Missense_Mutation	SNP	ENST00000256925.7	37	CCDS42417.1	.	.	.	.	.	.	.	.	.	.	C	15.52	2.858725	0.51376	0.0	1.22E-4	ENSG00000134508	ENST00000256925	T	0.49432	0.78	3.54	2.62	0.31277	.	0.785513	0.11805	N	0.527780	T	0.20941	0.0504	N	0.08118	0	0.58432	D	0.999999	P	0.39782	0.688	B	0.23018	0.043	T	0.03034	-1.1080	10	0.42905	T	0.14	-3.7384	8.6887	0.34254	0.0:0.7649:0.2351:0.0	.	221	Q8TDN4	CABL1_HUMAN	V	221	ENSP00000256925:A221V	ENSP00000256925:A221V	A	+	2	0	CABLES1	18970386	0.375000	0.25089	0.526000	0.27913	0.751000	0.42716	1.130000	0.31393	0.773000	0.33404	0.456000	0.33151	GCG			0.692	CABLES1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000445198.2		NM_138375	
INSR	3643	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	19	7143086	7143086	+	Silent	SNP	G	G	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr19:7143086G>T	ENST00000302850.5	-	12	2425	c.2283C>A	c.(2281-2283)cgC>cgA	p.R761R	INSR_ENST00000341500.5_Silent_p.R749R	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	761	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	CAAGGGACCTGCGTTTCCGAG	0.527																																					p.R761R													.	.			0			c.C2283A												80.0	68.0	72.0					19																	7143086		2203	4300	6503	SO:0001819	synonymous_variant	3643	exon12			GGACCTGCGTTTC	M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.2283C>A	19.37:g.7143086G>T			Somatic	99	0	0		WXS	Illumina HiSeq	.	112	0.04	5	NM_000208	28	0.00	0	Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Silent	SNP	ENST00000302850.5	37	CCDS12176.1																																																																																					0.527	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000458544.1			
ANKLE1	126549	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	17396520	17396520	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr19:17396520A>C	ENST00000394458.3	+	8	1843	c.1567A>C	c.(1567-1569)Atc>Ctc	p.I523L	ANKLE1_ENST00000594072.1_Missense_Mutation_p.I486L|ANKLE1_ENST00000598347.1_Intron|ANKLE1_ENST00000433424.2_3'UTR|ANKLE1_ENST00000404085.1_Missense_Mutation_p.I519L	NM_152363.4	NP_689576	Q8NAG6	ANKL1_HUMAN	ankyrin repeat and LEM domain containing 1	523	GIY-YIG. {ECO:0000255|PROSITE- ProRule:PRU00977}.									large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	7						GGTGCGTCAGATCTTGGACAT	0.612																																					p.I523L													FLJ39369,NS,carcinoma,-2,1	FLJ39369	-2	1	0			c.A1567C												115.0	94.0	101.0					19																	17396520		2203	4300	6503	SO:0001583	missense	126549	exon8			CGTCAGATCTTGG	AK096688	CCDS12354.2, CCDS12354.3	19p13.11	2013-01-10	2008-03-25	2008-03-25	ENSG00000160117	ENSG00000160117		"""Ankyrin repeat domain containing"""	26812	protein-coding gene	gene with protein product	"""LEM domain containing 6"""		"""ankyrin repeat domain 41"""	ANKRD41			Standard	NM_152363		Approved	FLJ39369, LEMD6	uc002nga.2	Q8NAG6	OTTHUMG00000150839	ENST00000394458.3:c.1567A>C	19.37:g.17396520A>C	ENSP00000377971:p.Ile523Leu		Somatic	72	0	0		WXS	Illumina HiSeq	.	90	0.29	26	NM_152363	5	0.80	4	A8VU82|Q8N8J8	Missense_Mutation	SNP	ENST00000394458.3	37	CCDS12354.2	.	.	.	.	.	.	.	.	.	.	A	22.7	4.326604	0.81690	.	.	ENSG00000160117	ENST00000404261;ENST00000404085;ENST00000394458	D	0.85484	-1.99	5.19	5.19	0.71726	.	0.127745	0.50627	D	0.000120	D	0.92896	0.7740	M	0.89353	3.025	0.80722	D	1	P;B;D	0.76494	0.913;0.441;0.999	P;B;D	0.76071	0.636;0.138;0.987	D	0.93940	0.7222	10	0.72032	D	0.01	.	12.9894	0.58610	1.0:0.0:0.0:0.0	.	483;523;486	Q8NAG6-1;Q8NAG6;A0JLW0	.;ANKL1_HUMAN;.	L	523;519;486	ENSP00000384008:I519L	ENSP00000377971:I486L	I	+	1	0	ANKLE1	17257520	1.000000	0.71417	0.707000	0.30419	0.617000	0.37484	8.371000	0.90123	1.961000	0.56991	0.402000	0.26972	ATC			0.612	ANKLE1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000325392.2		NM_152363	
MEF2B	100271849	mdanderson.org	37	19	19256659	19256659	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr19:19256659G>T	ENST00000602424.2	-	10	1668	c.942C>A	c.(940-942)tgC>tgA	p.C314*	MEF2B_ENST00000409447.2_Silent_p.R270R|MEF2B_ENST00000424583.2_Silent_p.R352R|MEF2BNB-MEF2B_ENST00000444486.3_Nonsense_Mutation_p.C314*|MEF2B_ENST00000410050.1_Silent_p.R359R|MEF2BNB-MEF2B_ENST00000514819.3_Nonsense_Mutation_p.C331*|MEF2B_ENST00000409224.1_3'UTR|MEF2BNB-MEF2B_ENST00000602276.1_5'Flank|MEF2B_ENST00000162023.5_Silent_p.R352R	NM_005919.3	NP_005910.1	Q02080	MEF2B_HUMAN	myocyte enhancer factor 2B	314					muscle organ development (GO:0007517)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|haematopoietic_and_lymphoid_tissue(21)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(5;0.00011)|Epithelial(12;0.00412)			GGCCCAGGCCGCAGAGGCTCT	0.731																																					p.C314X													.	.			0			c.C942A												2.0	3.0	3.0					19																	19256659		1736	3551	5287	SO:0001587	stop_gained	4207	exon10			CAGGCCGCAGAGG	X63380	CCDS12394.1, CCDS46024.1	19p13.11	2010-05-12	2007-04-24					"""Myocyte enhancer factors"""	6995	protein-coding gene	gene with protein product		600661				1516833, 8575763	Standard	NM_001145785		Approved	RSRFR2	uc002nll.2	Q02080		ENST00000602424.2:c.942C>A	19.37:g.19256659G>T	ENSP00000473308:p.Cys314*		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_005919	4	0.00	0	A0AV80|B4DVH7|B7ZVY1|G5E9M1	Nonsense_Mutation	SNP	ENST00000602424.2	37	CCDS12394.1	.	.	.	.	.	.	.	.	.	.	G	42	9.714687	0.99245	.	.	ENSG00000213999	ENST00000444486	.	.	.	3.86	-1.17	0.09648	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	3.0934	0.06301	0.3357:0.0:0.475:0.1894	.	.	.	.	X	314	.	ENSP00000390762:C314X	C	-	3	2	MEF2B	19117659	0.228000	0.23718	0.000000	0.03702	0.860000	0.49131	0.672000	0.25187	0.015000	0.14971	0.313000	0.20887	TGC			0.731	MEF2B-202	KNOWN	basic|CCDS	protein_coding	protein_coding				NM_005919	
ZNF738	148203	hgsc.bcm.edu	37	19	21558947	21558947	+	Intron	SNP	G	G	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr19:21558947G>T	ENST00000311015.3	+	4	530				ZNF738_ENST00000380870.4_Intron|ZNF738_ENST00000597810.1_Intron			Q8NE65	ZN738_HUMAN	zinc finger protein 738						protein polyubiquitination (GO:0000209)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|lung(1)	2						GTCACATAGGGCCATCTTCTG	0.403																																					.													.	.			0			.																																									SO:0001627	intron_variant	148203	.			CATAGGGCCATCT	BC034499		19p12	2013-01-16			ENSG00000172687	ENSG00000172687			32469	other	unknown							Standard	NR_027130		Approved		uc002nps.4	Q8NE65	OTTHUMG00000141298	ENST00000311015.3:c.319+181G>T	19.37:g.21558947G>T			Somatic	17	0	0		WXS	Illumina HiSeq	.	36	0.22	8	.	5	0.40	2	A8K4N7	RNA	SNP	ENST00000311015.3	37																																																																																						0.403	ZNF738-001	NOVEL	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding		OTTHUMT00000280564.1		NR_027130	
GRAMD1A	57655	broad.mit.edu	37	19	35510143	35510143	+	Missense_Mutation	SNP	G	G	T	rs538898774		TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr19:35510143G>T	ENST00000317991.5	+	12	1454	c.1262G>T	c.(1261-1263)cGg>cTg	p.R421L	GRAMD1A_ENST00000599564.1_Missense_Mutation_p.R508L|GRAMD1A_ENST00000504615.2_Missense_Mutation_p.R187L|CTD-2527I21.14_ENST00000605640.1_RNA|GRAMD1A_ENST00000411896.2_Missense_Mutation_p.R414L	NM_020895.3	NP_065946.2	Q96CP6	GRM1A_HUMAN	GRAM domain containing 1A	421						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			CACCAGCGCCGGGTGCTGACG	0.672													G|||	1	0.000199681	0.0	0.0	5008	,	,		14552	0.001		0.0	False		,,,				2504	0.0				p.R421L													.	GRAMD1A	39		0			c.G1262T												40.0	48.0	45.0					19																	35510143		2140	4251	6391	SO:0001583	missense	57655	exon12			AGCGCCGGGTGCT	AK074864	CCDS42546.1, CCDS46046.1	19q13.13	2008-02-05	2005-11-02	2005-11-02		ENSG00000089351			29305	protein-coding gene	gene with protein product			"""KIAA1533"""	KIAA1533		10819331	Standard	NM_020895		Approved	FLJ90346	uc010xse.1	Q96CP6		ENST00000317991.5:c.1262G>T	19.37:g.35510143G>T	ENSP00000441032:p.Arg421Leu		Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	109	0.03	3	NM_020895	578	0.00	0	A6NKY7|Q8NC77|Q9P1Z5	Missense_Mutation	SNP	ENST00000317991.5	37	CCDS42546.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.661880	0.88251	.	.	ENSG00000089351	ENST00000453966;ENST00000504615;ENST00000317991;ENST00000411896	T;T;T	0.75477	-0.94;-0.09;-0.04	4.62	4.62	0.57501	.	0.077118	0.51477	N	0.000100	D	0.87018	0.6073	M	0.86178	2.8	0.58432	D	0.999998	D;D;D;D	0.89917	1.0;0.993;1.0;1.0	D;D;D;D	0.97110	0.999;0.982;0.998;1.0	D	0.89214	0.3566	10	0.87932	D	0	.	14.9985	0.71451	0.0:0.0:1.0:0.0	.	421;421;187;414	Q96CP6-3;Q96CP6;B3KQF7;Q96CP6-2	.;GRM1A_HUMAN;.;.	L	507;187;421;414	ENSP00000423728:R187L;ENSP00000441032:R421L;ENSP00000439267:R414L	ENSP00000441032:R421L	R	+	2	0	GRAMD1A	40201983	0.998000	0.40836	0.981000	0.43875	0.881000	0.50899	8.823000	0.92018	2.388000	0.81334	0.491000	0.48974	CGG			0.672	GRAMD1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000461557.1		NM_020895	
ZNF180	7733	bcgsc.ca	37	19	44977078	44977078	+	IGR	SNP	C	C	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr19:44977078C>T	ENST00000221327.4	-	0	3126				AC069278.4_ENST00000591684.1_lincRNA	NM_013256.3	NP_037388.2	Q9UJW8	ZN180_HUMAN	zinc finger protein 180						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(14)|lung(6)|ovary(2)|urinary_tract(1)	33		Prostate(69;0.0435)				TTGCGTATAGCTCTGTTCTTC	0.408																																					.	Esophageal Squamous(180;1353 2003 32862 46574 49854)												.	.			0			.																																									SO:0001628	intergenic_variant	147711	.			GTATAGCTCTGTT	AF192913	CCDS12639.1, CCDS62707.1, CCDS62708.1	19q13.2	2013-01-08	2006-08-22			ENSG00000167384		"""Zinc fingers, C2H2-type"", ""-"""	12970	protein-coding gene	gene with protein product		606740	"""zinc finger protein 180 (HHZ168)"""				Standard	NM_001288762		Approved	HHZ168	uc002ozf.4	Q9UJW8			19.37:g.44977078C>T			Somatic	92	0	0		WXS	Illumina HiSeq	Phase_1	132	0.06	8	.	0		0	B2RCN6|B3KV56|K7EQX9|Q58F03|Q9P1U2	RNA	SNP	ENST00000221327.4	37	CCDS12639.1																																																																																					0.408	ZNF180-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000451601.1		NM_013256	
HIF3A	64344	broad.mit.edu	37	19	46825102	46825102	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr19:46825102A>C	ENST00000377670.4	+	10	1245	c.1214A>C	c.(1213-1215)gAc>gCc	p.D405A	HIF3A_ENST00000472815.1_Missense_Mutation_p.D336A|HIF3A_ENST00000420102.2_Missense_Mutation_p.D354A|HIF3A_ENST00000244303.6_Missense_Mutation_p.D336A|AC007193.10_ENST00000596807.1_RNA|HIF3A_ENST00000600383.1_Missense_Mutation_p.D336A|HIF3A_ENST00000339613.2_Missense_Mutation_p.D349A|HIF3A_ENST00000300862.3_Missense_Mutation_p.D403A	NM_152795.3	NP_690008.2	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit	405					cellular response to hypoxia (GO:0071456)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(14)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	33		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		CTGGCCGCTGACCCCCGCCGT	0.692																																					p.D405A													HIF3A_ENST00000377670,bladder,carcinoma,0,2	HIF3A	154	2	0			c.A1214C												39.0	47.0	44.0					19																	46825102		2200	4298	6498	SO:0001583	missense	64344	exon10			CCGCTGACCCCCG	AK027725	CCDS12681.2, CCDS12682.1, CCDS42580.1, CCDS42580.2	19q13	2013-05-21			ENSG00000124440	ENSG00000124440		"""Basic helix-loop-helix proteins"""	15825	protein-coding gene	gene with protein product		609976				11573933, 11734856	Standard	NM_152794		Approved	IPAS, MOP7, PASD7, bHLHe17	uc002peh.3	Q9Y2N7	OTTHUMG00000141296	ENST00000377670.4:c.1214A>C	19.37:g.46825102A>C	ENSP00000366898:p.Asp405Ala		Somatic	87	0.0804597701	7		WXS	Illumina HiSeq	Phase_I	99	0.15	15	NM_152795	19	0.16	3	B0M185|B4DNA2|Q58A43|Q66K72|Q8WXA1|Q96K34|Q9H7Z9|Q9HAI2	Missense_Mutation	SNP	ENST00000377670.4	37	CCDS12681.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.21|13.21	2.169902|2.169902	0.38315|0.38315	.|.	.|.	ENSG00000124440|ENSG00000124440	ENST00000244302;ENST00000377670;ENST00000244303;ENST00000339613;ENST00000291300;ENST00000300862;ENST00000420102|ENST00000472815	T;T;T;T;T|.	0.65549|.	0.59;-0.15;0.46;0.59;-0.16|.	4.98|4.98	4.98|4.98	0.66077|0.66077	.|.	0.000000|.	0.47455|.	D|.	0.000236|.	T|.	0.45498|.	0.1345|.	L|L	0.27053|0.27053	0.805|0.805	0.34263|0.34263	D|D	0.680161|0.680161	D;D;P;D;P;P;D|.	0.89917|.	0.974;1.0;0.94;0.998;0.9;0.9;0.998|.	P;D;P;D;B;B;D|.	0.80764|.	0.806;0.994;0.546;0.991;0.344;0.344;0.991|.	T|.	0.56541|.	-0.7962|.	10|.	0.15499|.	T|.	0.54|.	.|.	11.3632|11.3632	0.49655|0.49655	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	354;336;403;354;349;405;405|.	F5H884;B4DNA2;Q9Y2N7-2;B4DSD9;A8MPQ1;Q9Y2N7;B0M185|.	.;.;.;.;.;HIF3A_HUMAN;.|.	A|C	405;405;336;349;349;403;354|377	ENSP00000366898:D405A;ENSP00000244303:D336A;ENSP00000341877:D349A;ENSP00000300862:D403A;ENSP00000407771:D354A|.	ENSP00000244302:D405A|.	D|X	+|+	2|3	0|0	HIF3A|HIF3A	51516942|51516942	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.945000|0.945000	0.59286|0.59286	4.596000|4.596000	0.61055|0.61055	2.010000|2.010000	0.58986|0.58986	0.533000|0.533000	0.62120|0.62120	GAC|TGA			0.692	HIF3A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000280556.3			
ASXL2	55252	mdanderson.org	37	2	25965421	25965421	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr2:25965421G>T	ENST00000435504.4	-	13	4078	c.3785C>A	c.(3784-3786)gCc>gAc	p.A1262D	ASXL2_ENST00000404843.1_Missense_Mutation_p.A745D|ASXL2_ENST00000336112.4_Missense_Mutation_p.A1234D|ASXL2_ENST00000272341.4_Missense_Mutation_p.A745D			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	1262					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TAAATCTCTGGCTAGGGTCTT	0.443																																					p.A1262D													.	.			0			c.C3785A												53.0	52.0	52.0					2																	25965421		1940	4144	6084	SO:0001583	missense	55252	exon12			TCTCTGGCTAGGG			2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.3785C>A	2.37:g.25965421G>T	ENSP00000391447:p.Ala1262Asp		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	86	0.05	4	NM_018263	64	0.00	0	Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Missense_Mutation	SNP	ENST00000435504.4	37		.	.	.	.	.	.	.	.	.	.	G	18.12	3.553359	0.65425	.	.	ENSG00000143970	ENST00000435504;ENST00000336112;ENST00000404843;ENST00000272341	T;T;T;T	0.29397	1.65;1.65;1.57;1.57	6.02	6.02	0.97574	.	0.065958	0.64402	D	0.000007	T	0.54191	0.1843	M	0.64997	1.995	0.27783	N	0.943078	D;D	0.76494	0.999;0.964	D;P	0.71414	0.973;0.621	T	0.46555	-0.9183	10	0.41790	T	0.15	-11.6502	19.1045	0.93287	0.0:0.0:1.0:0.0	.	745;1262	Q76L83-2;Q76L83	.;ASXL2_HUMAN	D	1262;1234;745;745	ENSP00000391447:A1262D;ENSP00000337250:A1234D;ENSP00000383920:A745D;ENSP00000272341:A745D	ENSP00000272341:A745D	A	-	2	0	ASXL2	25818925	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	6.716000	0.74702	2.865000	0.98341	0.655000	0.94253	GCC			0.443	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000325593.3		NM_018263	
SFTPB	6439	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	2	85890852	85890852	+	Missense_Mutation	SNP	C	C	T	rs371267944		TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr2:85890852C>T	ENST00000519937.2	-	7	810	c.791G>A	c.(790-792)cGc>cAc	p.R264H	SFTPB_ENST00000393822.3_Missense_Mutation_p.R276H|SFTPB_ENST00000342375.3_Missense_Mutation_p.R264H|SFTPB_ENST00000409383.1_Missense_Mutation_p.R276H			P07988	PSPB_HUMAN	surfactant protein B	264	Saposin B-type 2. {ECO:0000255|PROSITE- ProRule:PRU00415}.				organ morphogenesis (GO:0009887)|respiratory gaseous exchange (GO:0007585)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|lysosome (GO:0005764)				central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(3)	16						GGGCAGCATGCGGCCCAGCAG	0.682																																					p.R276H													.	.			0			c.G827A							C	HIS/ARG,HIS/ARG	0,4398		0,0,2199	25.0	26.0	26.0		827,827	0.3	0.1	2		26	1,8593		0,1,4296	no	missense,missense	SFTPB	NM_000542.3,NM_198843.2	29,29	0,1,6495	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	276/394,276/394	85890852	1,12991	2199	4297	6496	SO:0001583	missense	6439	exon8			AGCATGCGGCCCA	J02761	CCDS1983.1, CCDS1983.2	2p12-p11.2	2008-08-26	2008-08-26		ENSG00000168878	ENSG00000168878			10801	protein-coding gene	gene with protein product		178640	"""surfactant, pulmonary-associated protein B"""	SFTP3		2924687, 1346779	Standard	NM_198843		Approved	SP-B	uc002sqh.3	P07988	OTTHUMG00000130181	ENST00000519937.2:c.791G>A	2.37:g.85890852C>T	ENSP00000428719:p.Arg264His		Somatic	61	0	0		WXS	Illumina HiSeq	.	96	0.05	5	NM_198843	1	0.00	0	Q96R04	Missense_Mutation	SNP	ENST00000519937.2	37		.	.	.	.	.	.	.	.	.	.	C	8.609	0.888762	0.17540	0.0	1.16E-4	ENSG00000168878	ENST00000519937;ENST00000393822;ENST00000342375;ENST00000409383;ENST00000441838	D;D;D;D	0.84146	-1.81;-1.81;-1.81;-1.81	5.34	0.34	0.15985	Saposin-like (2);Saposin-like type B, 2 (1);Saposin B (2);	0.000000	0.53938	D	0.000045	T	0.72614	0.3482	L	0.32530	0.975	0.21604	N	0.999625	B;B	0.20988	0.05;0.047	B;B	0.19148	0.01;0.024	T	0.55101	-0.8193	10	0.18710	T	0.47	-16.5632	8.5805	0.33626	0.0:0.5865:0.0:0.4135	.	276;264	D6W5L6;P07988	.;PSPB_HUMAN	H	266;276;264;276;232	ENSP00000428719:R266H;ENSP00000377409:R276H;ENSP00000345161:R264H;ENSP00000386346:R276H	ENSP00000345161:R264H	R	-	2	0	SFTPB	85744363	0.030000	0.19436	0.119000	0.21687	0.406000	0.30931	0.017000	0.13399	0.005000	0.14708	-0.215000	0.12644	CGC			0.682	SFTPB-001	KNOWN	alternative_3_UTR|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000252499.3		NM_198843	
FER1L5	90342	mdanderson.org	37	2	97361797	97361797	+	RNA	SNP	G	G	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr2:97361797G>T	ENST00000457909.1	+	0	3569							A0AVI2	FR1L5_HUMAN	fer-1-like family member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(9)|large_intestine(9)|lung(6)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	38						AGCGCTGTCTGAGAAGAAGCA	0.607																																					p.E1383X													FER1L5,right_upper_lobe,carcinoma,-2,1	FER1L5	-2	1	0			c.G4147T												63.0	67.0	66.0					2																	97361797		2018	4179	6197			90342	exon36			CTGTCTGAGAAGA	BC126368		2q11.2	2014-06-27	2014-06-27		ENSG00000249715	ENSG00000249715			19044	protein-coding gene	gene with protein product			"""fer-1-like 5 (C. elegans)"""				Standard	XM_006712826		Approved	DKFZp434I0121	uc010fia.3	A0AVI2	OTTHUMG00000154929		2.37:g.97361797G>T			Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_001113382	0		0	Q17RH2|Q6ZU24	Nonsense_Mutation	SNP	ENST00000457909.1	37		.	.	.	.	.	.	.	.	.	.	G	1.650	-0.514282	0.04200	.	.	ENSG00000214272	ENST00000414152;ENST00000436930;ENST00000397978	.	.	.	3.55	-3.95	0.04118	.	1935.970000	0.00166	U	0.000001	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	.	4.8075	0.13328	0.4649:0.3071:0.228:0.0	.	.	.	.	X	1383;1397;101	.	ENSP00000442027:E101X	E	+	1	0	FER1L5	96725524	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.167000	0.03126	-0.911000	0.03843	-0.300000	0.09419	GAG			0.607	FER1L5-001	KNOWN	basic|exp_conf	retained_intron	pseudogene		OTTHUMT00000339030.1		NM_001077400	
IMP4	92856	mdanderson.org	37	2	131103261	131103261	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr2:131103261G>T	ENST00000259239.3	+	5	1136	c.428G>T	c.(427-429)cGg>cTg	p.R143L	IMP4_ENST00000409935.1_Missense_Mutation_p.R143L	NM_033416.1	NP_219484.1	Q96G21	IMP4_HUMAN	IMP4, U3 small nucleolar ribonucleoprotein	143	Brix. {ECO:0000255|PROSITE- ProRule:PRU00034}.				rRNA processing (GO:0006364)	nucleolus (GO:0005730)|ribonucleoprotein complex (GO:0030529)				central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|urinary_tract(1)	18	Colorectal(110;0.1)					CACGAGCATCGGGGCACACCT	0.662																																					p.R143L													.	.			0			c.G428T												53.0	57.0	56.0					2																	131103261		2203	4300	6503	SO:0001583	missense	92856	exon5			AGCATCGGGGCAC	BC010042	CCDS2160.1	2q21.1	2014-02-19	2014-02-19		ENSG00000136718	ENSG00000136718			30856	protein-coding gene	gene with protein product		612981	"""IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast)"""			8619474, 9110174, 12655004	Standard	NM_033416		Approved	MGC19606, BXDC4	uc002tra.1	Q96G21	OTTHUMG00000131627	ENST00000259239.3:c.428G>T	2.37:g.131103261G>T	ENSP00000259239:p.Arg143Leu		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	59	0.05	3	NM_033416	716	0.00	0	Q3ZTT3	Missense_Mutation	SNP	ENST00000259239.3	37	CCDS2160.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.6|24.6	4.546168|4.546168	0.86022|0.86022	.|.	.|.	ENSG00000136718|ENSG00000136718	ENST00000452955|ENST00000259239;ENST00000409935;ENST00000409649;ENST00000428740	.|T;T;T;T	.|0.52754	.|0.65;0.65;0.65;0.65	5.06|5.06	5.06|5.06	0.68205|0.68205	.|Brix domain (3);Anticodon-binding (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.66287|0.66287	0.2774|0.2774	M|M	0.82630|0.82630	2.6|2.6	0.80722|0.80722	D|D	1|1	.|P	.|0.46912	.|0.886	.|P	.|0.54460	.|0.753	T|T	0.71984|0.71984	-0.4427|-0.4427	5|10	.|0.72032	.|D	.|0.01	-4.8637|-4.8637	16.312|16.312	0.82874|0.82874	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|143	.|Q96G21	.|IMP4_HUMAN	W|L	132|143;143;58;88	.|ENSP00000259239:R143L;ENSP00000386411:R143L;ENSP00000386716:R58L;ENSP00000389701:R88L	.|ENSP00000259239:R143L	G|R	+|+	1|2	0|0	IMP4|IMP4	130819731|130819731	0.991000|0.991000	0.36638|0.36638	0.999000|0.999000	0.59377|0.59377	0.430000|0.430000	0.31655|0.31655	3.287000|3.287000	0.51732|0.51732	2.517000|2.517000	0.84864|0.84864	0.655000|0.655000	0.94253|0.94253	GGG|CGG			0.662	IMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254520.2		NM_033416	
CCDC150	284992	broad.mit.edu	37	2	197511227	197511227	+	Splice_Site	SNP	A	A	G			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr2:197511227A>G	ENST00000389175.4	+	2	310	c.175A>G	c.(175-177)Aga>Gga	p.R59G	CCDC150_ENST00000472405.2_Intron|CCDC150_ENST00000423093.2_5'UTR|CCDC150_ENST00000272831.7_5'UTR	NM_001080539.1	NP_001074008.1	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	59										breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(14)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	33						TGGTGAAAAAAGGTAACAAAA	0.363																																					p.R59G													.	CCDC150	96		0			c.A175G												79.0	74.0	75.0					2																	197511227		1868	4107	5975	SO:0001630	splice_region_variant	284992	exon2			GAAAAAAGGTAAC		CCDS46478.1	2q33.1	2008-04-10			ENSG00000144395	ENSG00000144395			26834	protein-coding gene	gene with protein product							Standard	NM_001080539		Approved	FLJ39660	uc002utp.1	Q8NCX0	OTTHUMG00000154475	ENST00000389175.4:c.176+1A>G	2.37:g.197511227A>G			Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	138	0.02	3	NM_001080539	1	0.00	0	Q6P5U6|Q6P663|Q8N8V5	Splice_Site	SNP	ENST00000389175.4	37	CCDS46478.1	.	.	.	.	.	.	.	.	.	.	A	10.88	1.474910	0.26511	.	.	ENSG00000144395	ENST00000389175;ENST00000536389	T	0.31769	1.48	4.32	3.13	0.36017	.	0.155742	0.42053	D	0.000769	T	0.31451	0.0797	M	0.65975	2.015	0.80722	D	1	B;P	0.46142	0.027;0.873	B;B	0.42361	0.015;0.385	T	0.09357	-1.0678	10	0.66056	D	0.02	.	7.7057	0.28648	0.7731:0.2269:0.0:0.0	.	59;59	Q8NCX0;F5H6M2	CC150_HUMAN;.	G	59	ENSP00000373827:R59G	ENSP00000373827:R59G	R	+	1	2	CCDC150	197219472	0.999000	0.42202	0.964000	0.40570	0.508000	0.34012	1.847000	0.39299	0.787000	0.33731	0.533000	0.62120	AGA			0.363	CCDC150-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000335377.2		NM_001080539	Missense_Mutation
SNRPB	6628	hgsc.bcm.edu;mdanderson.org	37	20	2442419	2442419	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr20:2442419G>A	ENST00000438552.2	-	7	868	c.706C>T	c.(706-708)Cgc>Tgc	p.R236C	SNRPB_ENST00000381342.2_3'UTR|SNORD119_ENST00000515997.1_RNA	NM_198216.1	NP_937859.1	P14678	RSMB_HUMAN	small nuclear ribonucleoprotein polypeptides B and B1	236	Repeat-rich region.				gene expression (GO:0010467)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|histone pre-mRNA 3'end processing complex (GO:0071204)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)|U7 snRNP (GO:0005683)	histone pre-mRNA DCP binding (GO:0071208)|poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	10						CTTGGTGGGCGCATTCCCGGG	0.547																																					p.R236C													SNRPB,NS,carcinoma,+1,1	SNRPB	1	1	0			c.C706T												48.0	51.0	50.0					20																	2442419		2203	4300	6503	SO:0001583	missense	6628	exon7			GTGGGCGCATTCC		CCDS13026.1, CCDS13027.1	20p13	2011-10-11			ENSG00000125835	ENSG00000125835			11153	protein-coding gene	gene with protein product		182282		SNRPB1		1376292	Standard	NM_003091		Approved	COD, SmB/SmB', Sm-B/B', snRNP-B	uc002wfz.1	P14678	OTTHUMG00000031694	ENST00000438552.2:c.706C>T	20.37:g.2442419G>A	ENSP00000412566:p.Arg236Cys		Somatic	84	0	0		WXS	Illumina HiSeq	.	92	0.04	4	NM_198216	3376	0.00	3	Q15490|Q6IB35|Q9UIS5	Missense_Mutation	SNP	ENST00000438552.2	37	CCDS13026.1	.	.	.	.	.	.	.	.	.	.	G	12.87	2.066100	0.36470	.	.	ENSG00000125835	ENST00000438552;ENST00000303103	T	0.45668	0.89	4.7	3.74	0.42951	.	0.298090	0.36338	N	0.002646	T	0.12263	0.0298	N	0.01874	-0.695	0.80722	D	1	P	0.50710	0.938	B	0.22753	0.041	T	0.16512	-1.0400	10	0.87932	D	0	.	10.0794	0.42379	0.1001:0.0:0.8999:0.0	.	236	P14678	RSMB_HUMAN	C	236;284	ENSP00000412566:R236C	ENSP00000303591:R284C	R	-	1	0	SNRPB	2390419	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.037000	0.41174	1.315000	0.45114	0.561000	0.74099	CGC			0.547	SNRPB-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000077585.2			
ANKRD30BP2	149992	broad.mit.edu	37	21	14415103	14415103	+	RNA	SNP	C	C	G	rs369320513		TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr21:14415103C>G	ENST00000507941.1	+	0	95									ankyrin repeat domain 30B pseudogene 2																		CTGACAGGCTCTGCAATGCCA	0.338																																					.													.	.			0			.																																											0	.			CAGGCTCTGCAAT	AF427490		21q11.2	2010-06-14	2010-06-14	2010-06-14	ENSG00000224309	ENSG00000224309			16620	pseudogene	pseudogene	"""cancer/testis antigen 85"""		"""chromosome 21 open reading frame 99"""	C21orf99		12036297, 17114284	Standard	NR_026916		Approved	CT85, CTSP-1	uc002yja.4		OTTHUMG00000074164		21.37:g.14415103C>G			Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	33	0.18	6	.	0		0		RNA	SNP	ENST00000507941.1	37																																																																																						0.338	ANKRD30BP2-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000372094.1		NR_026916	
ANKRD30BP2	149992	broad.mit.edu	37	21	14415122	14415122	+	RNA	SNP	C	C	T	rs373171837		TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr21:14415122C>T	ENST00000507941.1	+	0	95									ankyrin repeat domain 30B pseudogene 2																		CAGAGGGAGGCTTGTGCAAAT	0.353																																					.													.	.			0			.																																											0	.			GGGAGGCTTGTGC	AF427490		21q11.2	2010-06-14	2010-06-14	2010-06-14	ENSG00000224309	ENSG00000224309			16620	pseudogene	pseudogene	"""cancer/testis antigen 85"""		"""chromosome 21 open reading frame 99"""	C21orf99		12036297, 17114284	Standard	NR_026916		Approved	CT85, CTSP-1	uc002yja.4		OTTHUMG00000074164		21.37:g.14415122C>T			Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	30	0.17	5	.	0		0		RNA	SNP	ENST00000507941.1	37																																																																																						0.353	ANKRD30BP2-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000372094.1		NR_026916	
DRICH1	51233	broad.mit.edu	37	22	23974156	23974156	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr22:23974156T>C	ENST00000317749.5	-	1	352	c.55A>G	c.(55-57)Aag>Gag	p.K19E	KB-1572G7.3_ENST00000390329.3_RNA	NM_016449.3	NP_057533.2	Q6PGQ1	DRIC1_HUMAN		19										endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)|skin(1)	11						GGTGCGTCCTTCCCCCTGGGC	0.532																																					p.K19E													.	C22orf43	18		0			c.A55G												93.0	95.0	95.0					22																	23974156		1965	4139	6104	SO:0001583	missense	51233	exon1			CGTCCTTCCCCCT																												ENST00000317749.5:c.55A>G	22.37:g.23974156T>C	ENSP00000316137:p.Lys19Glu		Somatic	159	0.0188679245	3		WXS	Illumina HiSeq	Phase_I	233	0.03	8	NM_016449	0		0	Q6ICJ8|Q6P4I3|Q9NU31	Missense_Mutation	SNP	ENST00000317749.5	37	CCDS42985.1	.	.	.	.	.	.	.	.	.	.	t	6.700	0.497794	0.12762	.	.	ENSG00000189269	ENST00000317749	T	0.32515	1.45	0.14	-0.28	0.12886	.	.	.	.	.	T	0.30324	0.0761	L	0.34521	1.04	0.09310	N	1	P	0.49696	0.927	P	0.56563	0.801	T	0.20306	-1.0279	8	0.51188	T	0.08	.	.	.	.	.	19	Q6PGQ1	CV043_HUMAN	E	19	ENSP00000316137:K19E	ENSP00000316137:K19E	K	-	1	0	C22orf43	22304156	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	-0.944000	0.03913	-1.393000	0.02079	-1.425000	0.01104	AAG			0.532	C22orf43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319708.2			
TCF20	6942	broad.mit.edu	37	22	42608228	42608228	+	Silent	SNP	T	T	C			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr22:42608228T>C	ENST00000359486.3	-	1	3220	c.3084A>G	c.(3082-3084)ggA>ggG	p.G1028G	TCF20_ENST00000404876.1_5'Flank|TCF20_ENST00000335626.4_Silent_p.G1028G	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	1028					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						GATGAGGGTCTCCCCCTGGGC	0.527																																					p.G1028G													.	TCF20	164		0			c.A3084G												60.0	61.0	61.0					22																	42608228		2203	4300	6503	SO:0001819	synonymous_variant	6942	exon1			AGGGTCTCCCCCT	U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.3084A>G	22.37:g.42608228T>C			Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	95	0.04	4	NM_181492	109	0.00	0	A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Silent	SNP	ENST00000359486.3	37	CCDS14033.1																																																																																					0.527	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320531.1		NM_181492	
PLXNB2	23654	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	50728449	50728449	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr22:50728449C>A	ENST00000449103.1	-	3	705	c.565G>T	c.(565-567)Gac>Tac	p.D189Y	PLXNB2_ENST00000359337.4_Missense_Mutation_p.D189Y			O15031	PLXB2_HUMAN	plexin B2	189	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TCAGTCCGGTCCAACAGCCGA	0.622																																					p.D189Y													.	.			0			c.G565T												90.0	97.0	94.0					22																	50728449		2192	4282	6474	SO:0001583	missense	23654	exon3			TCCGGTCCAACAG		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.565G>T	22.37:g.50728449C>A	ENSP00000409171:p.Asp189Tyr		Somatic	130	0	0		WXS	Illumina HiSeq	.	189	0.17	32	NM_012401	154	0.18	28	A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	ENST00000449103.1	37	CCDS43035.1	.	.	.	.	.	.	.	.	.	.	C	5.792	0.330456	0.10956	.	.	ENSG00000196576	ENST00000449103;ENST00000359337;ENST00000414275;ENST00000432455	T;T;T	0.10860	2.83;2.83;2.83	4.51	3.49	0.39957	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.210279	0.33144	N	0.005231	T	0.10594	0.0259	L	0.60845	1.875	0.36773	D	0.883925	B	0.30511	0.282	B	0.39299	0.296	T	0.13737	-1.0498	10	0.02654	T	1	.	4.5448	0.12076	0.213:0.5735:0.1297:0.0837	.	189	O15031	PLXB2_HUMAN	Y	189	ENSP00000409171:D189Y;ENSP00000352288:D189Y;ENSP00000392620:D189Y	ENSP00000352288:D189Y	D	-	1	0	PLXNB2	49070576	1.000000	0.71417	1.000000	0.80357	0.287000	0.27160	2.603000	0.46266	1.111000	0.41721	0.462000	0.41574	GAC			0.622	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316874.3		NM_012401	
EMC3-AS1	442075	broad.mit.edu	37	3	10035779	10035783	+	RNA	DEL	AGTCT	AGTCT	-	rs35714562|rs199577504		TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	AGTCT	AGTCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr3:10035779_10035783delAGTCT	ENST00000326237.3	+	0	354																											GGGGAAGAGAAGTCTGATCTGACAT	0.38																																					.													.	.			0			.																																											0	.			AAGAGAAGTCTGA																													3.37:g.10035779_10035783delAGTCT			Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	12	0.33	4	.	1	0.00	0		RNA	DEL	ENST00000326237.3	37																																																																																						0.380	AC034193.5-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000339468.1			
CADM2	253559	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	86010725	86010725	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr3:86010725A>G	ENST00000407528.2	+	7	933	c.871A>G	c.(871-873)Aat>Gat	p.N291D	CADM2_ENST00000405615.2_Missense_Mutation_p.N293D|CADM2_ENST00000383699.3_Missense_Mutation_p.N300D	NM_001167674.1	NP_001161146.1	Q8N3J6	CADM2_HUMAN	cell adhesion molecule 2	291	Ig-like C2-type 2.				adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|synapse (GO:0045202)				endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(1)|prostate(1)|skin(4)	38		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		CAAAACGGATAATGGTACATA	0.418																																					p.N300D													CADM2_ENST00000383699,NS,lymphoid_neoplasm,-2,2	CADM2_ENST00000383699	-2	2	0			c.A898G												150.0	137.0	142.0					3																	86010725		2203	4300	6503	SO:0001583	missense	253559	exon8			ACGGATAATGGTA	AF538973	CCDS33792.1, CCDS54613.1, CCDS54614.1	3p12.2	2013-01-11	2007-02-07	2007-02-07	ENSG00000175161	ENSG00000175161		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	29849	protein-coding gene	gene with protein product	"""nectin-like 3"""	609938	"""immunoglobulin superfamily, member 4D"""	IGSF4D			Standard	NM_153184		Approved	NECL3, Necl-3, SynCAM2	uc003dqj.3	Q8N3J6	OTTHUMG00000158990	ENST00000407528.2:c.871A>G	3.37:g.86010725A>G	ENSP00000384575:p.Asn291Asp		Somatic	109	0	0		WXS	Illumina HiSeq	.	119	0.15	18	NM_001167675	1	0.00	0	G3XHN7|G3XHN8|Q3KQY9|Q658Q7|Q8IZP8	Missense_Mutation	SNP	ENST00000407528.2	37	CCDS54614.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.568614	0.86439	.	.	ENSG00000175161	ENST00000383699;ENST00000407528;ENST00000405615	T;T;T	0.66460	-0.21;-0.21;-0.21	5.16	5.16	0.70880	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.73016	0.3533	L	0.28504	0.86	0.80722	D	1	D;D;D	0.76494	0.996;0.998;0.999	D;D;D	0.83275	0.954;0.994;0.996	T	0.75082	-0.3443	10	0.51188	T	0.08	.	15.2809	0.73784	1.0:0.0:0.0:0.0	.	293;300;291	Q8N3J6-3;G3XHN4;Q8N3J6	.;.;CADM2_HUMAN	D	300;291;293	ENSP00000373200:N300D;ENSP00000384575:N291D;ENSP00000384193:N293D	ENSP00000373200:N300D	N	+	1	0	CADM2	86093415	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	8.880000	0.92407	2.061000	0.61500	0.528000	0.53228	AAT			0.418	CADM2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000352822.1		NM_153184	
DHFRL1	200895	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	93780000	93780000	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr3:93780000C>G	ENST00000394221.2	-	2	805	c.356G>C	c.(355-357)aGt>aCt	p.S119T	NSUN3_ENST00000314622.4_5'Flank|DHFRL1_ENST00000314636.2_Missense_Mutation_p.S119T|DHFRL1_ENST00000481631.1_Intron	NM_001195643.1	NP_001182572.1	Q86XF0	DYRL1_HUMAN	dihydrofolate reductase-like 1	119	DHFR. {ECO:0000255|PROSITE- ProRule:PRU00660}.				glycine biosynthetic process (GO:0006545)|nucleotide biosynthetic process (GO:0009165)|one-carbon metabolic process (GO:0006730)|tetrahydrofolate biosynthetic process (GO:0046654)|tetrahydrofolate metabolic process (GO:0046653)|thymidine biosynthetic process (GO:0046105)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	dihydrofolate reductase activity (GO:0004146)|mRNA binding (GO:0003729)|NADP binding (GO:0050661)			kidney(1)|large_intestine(2)|lung(3)|skin(1)|stomach(1)	8						ATAAACAGAACTGCCACCAAC	0.378																																					p.S119T													.	.			0			c.G356C												128.0	133.0	131.0					3																	93780000		2203	4300	6503	SO:0001583	missense	200895	exon2			ACAGAACTGCCAC	AL832912	CCDS2926.1	3q11.2	2005-08-16	2005-02-07		ENSG00000178700	ENSG00000178700			27309	protein-coding gene	gene with protein product			"""dihydrofolate reductase pseudogene 4"""	DHFRP4		12477932	Standard	NM_001195643		Approved	FLJ16119	uc003drj.3	Q86XF0	OTTHUMG00000159014	ENST00000394221.2:c.356G>C	3.37:g.93780000C>G	ENSP00000377768:p.Ser119Thr		Somatic	184	0	0		WXS	Illumina HiSeq	.	177	0.15	27	NM_001195643	10	0.30	3	D3DN30|Q6P4I9	Missense_Mutation	SNP	ENST00000394221.2	37	CCDS2926.1	.	.	.	.	.	.	.	.	.	.	C	12.44	1.937940	0.34189	.	.	ENSG00000178700	ENST00000314636;ENST00000394221	T;T	0.72282	-0.64;-0.64	1.25	1.25	0.21368	Dihydrofolate reductase domain (2);Dihydrofolate reductase-like domain (2);	0.046120	0.85682	U	0.000000	T	0.66548	0.2800	M	0.66439	2.03	0.58432	D	0.999997	P	0.38250	0.624	B	0.41236	0.351	T	0.65508	-0.6151	10	0.44086	T	0.13	-14.7781	8.4404	0.32812	0.0:1.0:0.0:0.0	.	119	Q86XF0	DYRL1_HUMAN	T	119	ENSP00000319170:S119T;ENSP00000377768:S119T	ENSP00000319170:S119T	S	-	2	0	DHFRL1	95262690	1.000000	0.71417	0.998000	0.56505	0.963000	0.63663	2.423000	0.44705	1.020000	0.39573	0.449000	0.29647	AGT			0.378	DHFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000352910.1		NM_176815	
ALDH1L1	10840	mdanderson.org	37	3	125872417	125872417	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr3:125872417G>T	ENST00000393434.2	-	7	1077	c.728C>A	c.(727-729)aCa>aAa	p.T243K	ALDH1L1_ENST00000273450.3_Missense_Mutation_p.T253K|ALDH1L1_ENST00000452905.2_Missense_Mutation_p.T142K|ALDH1L1_ENST00000413612.1_5'UTR|ALDH1L1_ENST00000393431.2_Missense_Mutation_p.T243K|ALDH1L1_ENST00000472186.1_Missense_Mutation_p.T243K|ALDH1L1_ENST00000455064.2_Missense_Mutation_p.T68K	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	243					10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	GTTGAAAAATGTCAGTTTCTG	0.582																																					p.T253K													.	.			0			c.C758A												79.0	81.0	80.0					3																	125872417		2203	4300	6503	SO:0001583	missense	10840	exon7			AAAAATGTCAGTT	AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.728C>A	3.37:g.125872417G>T	ENSP00000377083:p.Thr243Lys		Somatic	63	0.0158730159	1		WXS	Illumina HiSeq	Phase_I	91	0.05	5	NM_001270364	0		0	B4DG36|E9PBX3|Q68CS1	Missense_Mutation	SNP	ENST00000393434.2	37	CCDS3034.1	.	.	.	.	.	.	.	.	.	.	G	10.26	1.301163	0.23650	.	.	ENSG00000144908	ENST00000273450;ENST00000472186;ENST00000452905;ENST00000393434;ENST00000393431;ENST00000455064	T;T;T;T;T;T	0.33216	1.42;1.42;1.42;1.42;1.42;1.42	4.78	3.9	0.45041	Formyl transferase, C-terminal-like (1);Formyl transferase, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.41351	0.1155	L	0.33339	1.005	0.48901	D	0.999722	D;D;B;D;B	0.89917	1.0;0.999;0.299;1.0;0.299	D;D;B;D;B	0.87578	0.989;0.992;0.219;0.998;0.219	T	0.14980	-1.0453	10	0.44086	T	0.13	.	10.7546	0.46230	0.0951:0.0:0.9049:0.0	.	68;142;295;148;243	B4DGC8;E9PBX3;Q59G10;Q9UFA9;O75891	.;.;.;.;AL1L1_HUMAN	K	253;243;142;243;243;68	ENSP00000273450:T253K;ENSP00000420293:T243K;ENSP00000395881:T142K;ENSP00000377083:T243K;ENSP00000377081:T243K;ENSP00000414126:T68K	ENSP00000273450:T253K	T	-	2	0	ALDH1L1	127355107	1.000000	0.71417	0.846000	0.33378	0.015000	0.08874	7.855000	0.86950	1.001000	0.39076	-0.373000	0.07131	ACA			0.582	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000354391.1		NM_012190	
EIF4G1	1981	mdanderson.org	37	3	184042695	184042695	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr3:184042695G>T	ENST00000346169.2	+	18	2920	c.2649G>T	c.(2647-2649)gaG>gaT	p.E883D	EIF4G1_ENST00000424196.1_Missense_Mutation_p.E890D|EIF4G1_ENST00000434061.2_Missense_Mutation_p.E688D|EIF4G1_ENST00000319274.6_Missense_Mutation_p.E883D|EIF4G1_ENST00000352767.3_Missense_Mutation_p.E890D|EIF4G1_ENST00000392537.2_Missense_Mutation_p.E796D|EIF4G1_ENST00000350481.5_Missense_Mutation_p.E719D|EIF4G1_ENST00000441154.1_Missense_Mutation_p.E720D|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000414031.1_Missense_Mutation_p.E843D|EIF4G1_ENST00000427845.1_Missense_Mutation_p.E797D|EIF4G1_ENST00000435046.2_Missense_Mutation_p.E687D|EIF4G1_ENST00000342981.4_Missense_Mutation_p.E884D|SNORD66_ENST00000390856.1_RNA|EIF4G1_ENST00000382330.3_Missense_Mutation_p.E890D|EIF4G1_ENST00000411531.1_Missense_Mutation_p.E844D	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	883	eIF3/EIF4A-binding.				cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TGAAGGAAGAGCTGGAAGAGG	0.493																																					p.E890D													.	.			0			c.G2670T												65.0	77.0	73.0					3																	184042695		2203	4300	6503	SO:0001583	missense	1981	exon18			GGAAGAGCTGGAA	D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.2649G>T	3.37:g.184042695G>T	ENSP00000316879:p.Glu883Asp		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_001194947	666	0.00	0	D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	Missense_Mutation	SNP	ENST00000346169.2	37	CCDS3259.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.433568	0.83776	.	.	ENSG00000114867	ENST00000346169;ENST00000414031;ENST00000392537;ENST00000382330;ENST00000426123;ENST00000350481;ENST00000352767;ENST00000427845;ENST00000342981;ENST00000319274;ENST00000424196;ENST00000411531;ENST00000444861;ENST00000441154;ENST00000434061;ENST00000435046	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.24350	1.86;1.86;1.86;1.86;1.86;1.86;1.86;1.86;1.86;1.86;1.86;1.86;1.86;1.86;1.86;1.86	5.65	4.77	0.60923	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	T	0.44477	0.1295	L	0.59912	1.85	0.58432	D	0.999994	D;P;P;P	0.89917	1.0;0.917;0.917;0.938	D;P;D;D	0.91635	0.999;0.863;0.914;0.91	T	0.27400	-1.0075	10	0.40728	T	0.16	-20.1969	11.0756	0.48030	0.1431:0.0:0.8569:0.0	.	890;884;883;890	E9PFM1;D3DNT2;Q04637;B2RU10	.;.;IF4G1_HUMAN;.	D	883;843;796;890;824;719;890;797;884;883;890;844;719;720;688;687	ENSP00000316879:E883D;ENSP00000391935:E843D;ENSP00000376320:E796D;ENSP00000371767:E890D;ENSP00000403269:E824D;ENSP00000317600:E719D;ENSP00000338020:E890D;ENSP00000407682:E797D;ENSP00000343450:E884D;ENSP00000323737:E883D;ENSP00000416255:E890D;ENSP00000395974:E844D;ENSP00000398145:E719D;ENSP00000399858:E720D;ENSP00000411826:E688D;ENSP00000404754:E687D	ENSP00000323737:E883D	E	+	3	2	EIF4G1	185525389	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.036000	0.57304	1.373000	0.46208	0.561000	0.74099	GAG			0.493	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000345733.1		NM_182917	
LOC90768	90768	mdanderson.org	37	4	183063907	183063907	+	RNA	SNP	C	C	A			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr4:183063907C>A	ENST00000315302.2	-	0	1155				AC108142.1_ENST00000508968.1_RNA|RP11-402C9.1_ENST00000505389.1_RNA|AC108142.1_ENST00000511052.1_RNA|AC108142.1_ENST00000505873.1_RNA|AC108142.1_ENST00000513752.1_RNA|AC108142.1_ENST00000509012.1_RNA	NR_027107.1																						ACTGCTGGTCCCAGGAGAGGG	0.741																																					.													.	.			0			.																																											0	.			CTGGTCCCAGGAG																													4.37:g.183063907C>A			Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	28	0.11	3	.	0		0		RNA	SNP	ENST00000315302.2	37																																																																																						0.741	AC108142.1-001	KNOWN	basic	antisense	antisense		OTTHUMT00000257786.2			
MROH2B	133558	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	41009457	41009457	+	Silent	SNP	C	C	T	rs549275471	byFrequency	TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr5:41009457C>T	ENST00000399564.4	-	32	3795	c.3345G>A	c.(3343-3345)ggG>ggA	p.G1115G	MROH2B_ENST00000506092.2_Silent_p.G670G	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	1115																	GCAAGAGTTTCCCACTGGAGG	0.512													C|||	4	0.000798722	0.0	0.0	5008	,	,		17682	0.0		0.0	False		,,,				2504	0.0041				p.G1115G													HEATR7B2,NS,carcinoma,-1,3	HEATR7B2	-1	3	0			c.G3345A												125.0	125.0	125.0					5																	41009457		1881	4113	5994	SO:0001819	synonymous_variant	133558	exon32			GAGTTTCCCACTG		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.3345G>A	5.37:g.41009457C>T			Somatic	85	0	0		WXS	Illumina HiSeq	.	69	0.12	8	NM_173489	0		0	Q68DM1|Q7Z4U4|Q8N7X3	Silent	SNP	ENST00000399564.4	37	CCDS47202.1																																																																																					0.512	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000367558.2		NM_173489	
CCNI2	645121	mdanderson.org	37	5	132084162	132084162	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr5:132084162G>T	ENST00000378731.1	+	2	604	c.553G>T	c.(553-555)Gtg>Ttg	p.V185L	SEPT8_ENST00000481030.1_5'Flank	NM_001039780.2	NP_001034869.1	Q6ZMN8	CCNI2_HUMAN	cyclin I family, member 2	185					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)					haematopoietic_and_lymphoid_tissue(1)|prostate(1)|urinary_tract(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CCTGATTTCAGTGAAGGTAGG	0.542																																					p.V185L													CCNI2,NS,carcinoma,-2,1	CCNI2	-2	1	0			c.G553T												77.0	74.0	75.0					5																	132084162		2203	4300	6503	SO:0001583	missense	645121	exon2			ATTTCAGTGAAGG	BC132837	CCDS34236.1, CCDS75297.1	5q31.1	2014-07-03			ENSG00000205089	ENSG00000205089			33869	protein-coding gene	gene with protein product						23707792	Standard	NM_001287252		Approved	FLJ16793	uc003kxq.1	Q6ZMN8	OTTHUMG00000059737	ENST00000378731.1:c.553G>T	5.37:g.132084162G>T	ENSP00000368005:p.Val185Leu		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	54	0.07	4	NM_001039780	33	0.00	0	B2RNE2|B7ZMB7|B7ZMB8	Missense_Mutation	SNP	ENST00000378731.1	37	CCDS34236.1	.	.	.	.	.	.	.	.	.	.	g	13.05	2.122733	0.37436	.	.	ENSG00000205089	ENST00000378731	T	0.11495	2.77	4.74	0.76	0.18442	Cyclin, N-terminal (1);Cyclin-like (3);	0.717261	0.13229	N	0.403816	T	0.10165	0.0249	L	0.35644	1.08	0.09310	N	1	B;B;B	0.25563	0.014;0.016;0.129	B;B;B	0.34180	0.048;0.026;0.177	T	0.35076	-0.9803	10	0.51188	T	0.08	.	7.15	0.25606	0.1526:0.2821:0.5653:0.0	.	186;185;185	B7ZMB7;B7ZMB8;Q6ZMN8	.;.;CCNI2_HUMAN	L	185	ENSP00000368005:V185L	ENSP00000368005:V185L	V	+	1	0	CCNI2	132112061	0.001000	0.12720	0.000000	0.03702	0.044000	0.14063	0.872000	0.28037	-0.006000	0.14370	0.651000	0.88453	GTG			0.542	CCNI2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000132833.1		NM_001039780	
ZBTB9	221504	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	33424120	33424120	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr6:33424120A>G	ENST00000395064.2	+	2	1511	c.1243A>G	c.(1243-1245)Atc>Gtc	p.I415V		NM_152735.3	NP_689948.1	Q96C00	ZBTB9_HUMAN	zinc finger and BTB domain containing 9	415					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|skin(1)|upper_aerodigestive_tract(2)	11						TGGCTGTGGCATCTGCAACAA	0.572																																					p.I415V													.	.			0			c.A1243G												79.0	65.0	70.0					6																	33424120		2203	4300	6503	SO:0001583	missense	221504	exon2			TGTGGCATCTGCA	AK122644	CCDS4780.1	6p21.31	2013-01-09			ENSG00000213588	ENSG00000213588		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	28323	protein-coding gene	gene with protein product						12477932	Standard	NM_152735		Approved	MGC23166, ZNF919	uc003oeq.3	Q96C00	OTTHUMG00000140180	ENST00000395064.2:c.1243A>G	6.37:g.33424120A>G	ENSP00000378503:p.Ile415Val		Somatic	72	0	0		WXS	Illumina HiSeq	.	102	0.23	23	NM_152735	170	0.30	51	A2AB19	Missense_Mutation	SNP	ENST00000395064.2	37	CCDS4780.1	.	.	.	.	.	.	.	.	.	.	A	1.213	-0.629016	0.03610	.	.	ENSG00000213588	ENST00000395064	T	0.14640	2.49	5.1	1.29	0.21616	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.398008	0.19337	U	0.116742	T	0.01661	0.0053	N	0.13003	0.285	0.29467	N	0.857319	B	0.02656	0.0	B	0.04013	0.001	T	0.48234	-0.9053	10	0.10377	T	0.69	.	6.6474	0.22943	0.5414:0.0:0.4586:0.0	.	415	Q96C00	ZBTB9_HUMAN	V	415	ENSP00000378503:I415V	ENSP00000378503:I415V	I	+	1	0	ZBTB9	33532098	0.797000	0.28877	1.000000	0.80357	0.997000	0.91878	1.087000	0.30865	0.365000	0.24400	0.533000	0.62120	ATC			0.572	ZBTB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000276533.1		NM_152735	
TNFRSF21	27242	mdanderson.org	37	6	47277201	47277201	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr6:47277201C>T	ENST00000296861.2	-	1	440	c.47G>A	c.(46-48)cGc>cAc	p.R16H		NM_014452.3	NP_055267.1	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily, member 21	16					adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|B cell apoptotic process (GO:0001783)|cellular lipid metabolic process (GO:0044255)|cellular response to tumor necrosis factor (GO:0071356)|humoral immune response (GO:0006959)|myelination (GO:0042552)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of myelination (GO:0031642)|negative regulation of T cell proliferation (GO:0042130)|neuron apoptotic process (GO:0051402)|oligodendrocyte apoptotic process (GO:0097252)|regulation of oligodendrocyte differentiation (GO:0048713)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(7)|pancreas(1)|skin(2)	21			Lung(136;0.189)			GCGGGCGATGCGGCTGCAGGA	0.741																																					p.R16H													.	.			0			c.G47A																																									SO:0001583	missense	27242	exon1			GCGATGCGGCTGC	AF068868	CCDS4921.1	6p21.1	2011-08-11			ENSG00000146072	ENSG00000146072		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	13469	protein-coding gene	gene with protein product	"""death receptor 6"""	605732				9714541	Standard	NM_014452		Approved	DR6, CD358	uc003oyv.3	O75509	OTTHUMG00000014796	ENST00000296861.2:c.47G>A	6.37:g.47277201C>T	ENSP00000296861:p.Arg16His		Somatic	12	0	0		WXS	Illumina HiSeq	Phase_I	18	0.17	3	NM_014452	71	0.01	1	B2RDI9|Q0D2P5|Q96D86	Missense_Mutation	SNP	ENST00000296861.2	37	CCDS4921.1	.	.	.	.	.	.	.	.	.	.	C	17.74	3.464545	0.63513	.	.	ENSG00000146072	ENST00000296861	T	0.64803	-0.12	4.24	4.24	0.50183	.	0.347355	0.21379	N	0.075509	T	0.30262	0.0759	L	0.36672	1.1	0.30463	N	0.774055	P	0.42973	0.796	B	0.29176	0.099	T	0.37384	-0.9708	10	0.66056	D	0.02	.	12.0024	0.53240	0.0:1.0:0.0:0.0	.	16	O75509	TNR21_HUMAN	H	16	ENSP00000296861:R16H	ENSP00000296861:R16H	R	-	2	0	TNFRSF21	47385160	1.000000	0.71417	0.977000	0.42913	0.669000	0.39330	2.241000	0.43097	2.174000	0.68829	0.561000	0.74099	CGC			0.741	TNFRSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040814.1		NM_014452	
ERMARD	55780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	170159980	170159980	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr6:170159980C>A	ENST00000366773.3	+	7	685	c.652C>A	c.(652-654)Ctg>Atg	p.L218M	ERMARD_ENST00000366772.2_Missense_Mutation_p.L218M|ERMARD_ENST00000588451.1_Missense_Mutation_p.L92M|ERMARD_ENST00000392095.4_Missense_Mutation_p.L92M|ERMARD_ENST00000418781.3_Missense_Mutation_p.L218M	NM_001278532.1|NM_018341.1	NP_001265461.1|NP_060811.1	Q5T6L9	EMARD_HUMAN	ER membrane-associated RNA degradation	218					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											GGGTCAGTTACTGAAGAGTTA	0.363																																					p.L218M													.	.			0			c.C652A												218.0	199.0	205.0					6																	170159980		2203	4300	6503	SO:0001583	missense	55780	exon7			CAGTTACTGAAGA	AK002014	CCDS34576.1, CCDS64572.1, CCDS64573.1, CCDS64574.1	6q27	2013-08-28	2013-08-28	2013-08-28	ENSG00000130023	ENSG00000130023			21056	protein-coding gene	gene with protein product		615532	"""chromosome 6 open reading frame 70"""	C6orf70		23768067	Standard	NM_018341		Approved	FLJ11152, dJ266L20.3	uc003qxg.1	Q5T6L9	OTTHUMG00000016067	ENST00000366773.3:c.652C>A	6.37:g.170159980C>A	ENSP00000355735:p.Leu218Met		Somatic	67	0	0		WXS	Illumina HiSeq	.	80	0.21	17	NM_018341	61	0.26	16	B4DFH0|F8WAF1|Q3ZCS8|Q5T6L8|Q9NUT5|Q9NVU2	Missense_Mutation	SNP	ENST00000366773.3	37	CCDS34576.1	.	.	.	.	.	.	.	.	.	.	C	15.54	2.862410	0.51482	.	.	ENSG00000130023	ENST00000366773;ENST00000366772;ENST00000418781;ENST00000392095	T;T	0.55413	0.52;0.52	4.93	3.81	0.43845	.	0.000000	0.41500	D	0.000869	T	0.58366	0.2117	M	0.80028	2.48	0.23533	N	0.997474	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	T	0.53187	-0.8474	10	0.72032	D	0.01	.	5.0835	0.14668	0.0:0.7738:0.0:0.2262	.	218;218;218	Q5T6L9-3;Q5T6L9-2;Q5T6L9	.;.;CF070_HUMAN	M	218;218;218;92	ENSP00000355735:L218M;ENSP00000375945:L92M	ENSP00000355734:L218M	L	+	1	2	C6orf70	169901905	0.132000	0.22450	0.140000	0.22221	0.718000	0.41266	0.617000	0.24359	2.444000	0.82710	0.563000	0.77884	CTG			0.363	ERMARD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000043238.2		NM_018341	
RNF216	54476	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	5781139	5781139	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr7:5781139A>T	ENST00000425013.2	-	4	562	c.338T>A	c.(337-339)gTc>gAc	p.V113D	RNF216_ENST00000389902.3_Missense_Mutation_p.V170D	NM_207111.3|NM_207116.2	NP_996994.1|NP_996999.1	Q9NWF9	RN216_HUMAN	ring finger protein 216	113					apoptotic process (GO:0006915)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of defense response to virus by host (GO:0050691)|regulation of interferon-beta production (GO:0032648)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)		FBXL18/RNF216(2)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|urinary_tract(4)	33		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		TCTGGGGTTGACAATGTCATT	0.473																																					p.V170D													.	RNF216	71		0			c.T509A												277.0	258.0	264.0					7																	5781139		2203	4300	6503	SO:0001583	missense	54476	exon4			GGGTTGACAATGT	AY062174	CCDS34594.1, CCDS34595.1	7p22.1	2014-02-12	2007-08-20		ENSG00000011275	ENSG00000011275		"""RING-type (C3HC4) zinc fingers"""	21698	protein-coding gene	gene with protein product		609948					Standard	NM_207111		Approved	TRIAD3, UBCE7IP1, ZIN	uc003sox.2	Q9NWF9	OTTHUMG00000155500	ENST00000425013.2:c.338T>A	7.37:g.5781139A>T	ENSP00000404602:p.Val113Asp		Somatic	185	0.0108108108	2		WXS	Illumina HiSeq	Phase_I	261	0.19	50	NM_207111	329	0.23	76	Q6Y691|Q75ML7|Q7Z2H7|Q7Z7C1|Q8NHW7|Q9NYT1	Missense_Mutation	SNP	ENST00000425013.2	37	CCDS34595.1	.	.	.	.	.	.	.	.	.	.	A	16.71	3.199159	0.58126	.	.	ENSG00000011275	ENST00000425013;ENST00000389902	T;T	0.56275	0.47;0.58	6.11	4.93	0.64822	.	0.464398	0.20993	N	0.081992	T	0.45518	0.1346	L	0.48642	1.525	0.50632	D	0.999888	B;P	0.37038	0.256;0.579	B;B	0.38755	0.133;0.281	T	0.46665	-0.9175	10	0.87932	D	0	-1.6742	6.6088	0.22739	0.6257:0.2991:0.0752:0.0	.	113;170	Q9NWF9;Q9NWF9-1	RN216_HUMAN;.	D	113;170	ENSP00000404602:V113D;ENSP00000374552:V170D	ENSP00000374550:V113D	V	-	2	0	RNF216	5747665	0.311000	0.24536	0.820000	0.32676	0.993000	0.82548	1.679000	0.37597	1.095000	0.41419	0.533000	0.62120	GTC			0.473	RNF216-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000340374.1		NM_207111	
C7orf26	79034	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	6634134	6634134	+	Silent	SNP	G	G	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr7:6634134G>T	ENST00000344417.5	+	3	750	c.483G>T	c.(481-483)ccG>ccT	p.P161P	C7orf26_ENST00000359073.5_Silent_p.P142P|C7orf26_ENST00000472693.1_3'UTR	NM_024067.2	NP_076972.2	Q96N11	CG026_HUMAN	chromosome 7 open reading frame 26	161										endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	11		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)		GTTTGGTGCCGGGATCCATTC	0.532																																					p.P161P													.	.			0			c.G483T												220.0	195.0	203.0					7																	6634134		2203	4300	6503	SO:0001819	synonymous_variant	79034	exon3			GGTGCCGGGATCC	BC005121	CCDS5353.1	7p22.1	2011-11-24			ENSG00000146576	ENSG00000146576			21702	protein-coding gene	gene with protein product							Standard	NM_024067		Approved	MGC2718	uc003sqo.1	Q96N11	OTTHUMG00000125517	ENST00000344417.5:c.483G>T	7.37:g.6634134G>T			Somatic	89	0	0		WXS	Illumina HiSeq	.	125	0.16	20	NM_024067	404	0.20	80	Q9BQ43	Silent	SNP	ENST00000344417.5	37	CCDS5353.1																																																																																					0.532	C7orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000246844.2		NM_024067	
ZNF680	340252	ucsc.edu	37	7	63981631	63981631	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr7:63981631G>A	ENST00000309683.6	-	4	1652	c.1501C>T	c.(1501-1503)Cgg>Tgg	p.R501W	ZNF680_ENST00000476563.1_5'Flank	NM_178558.4	NP_848653.2	Q8NEM1	ZN680_HUMAN	zinc finger protein 680	501					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	27		Lung NSC(55;0.118)|all_lung(88;0.243)				TGTGAGGACCGGTTAAAAGCT	0.358																																					p.R501W													ZNF680,NS,carcinoma,+1,1	ZNF680	58	1	0			c.C1501T												65.0	69.0	67.0					7																	63981631		2203	4300	6503	SO:0001583	missense	340252	exon4			AGGACCGGTTAAA	AK074911	CCDS34644.1, CCDS47594.1	7q11.21	2013-01-08			ENSG00000173041	ENSG00000173041		"""Zinc fingers, C2H2-type"", ""-"""	26897	protein-coding gene	gene with protein product	"""hypothetical protein FLJ90430"""					12477932	Standard	NM_178558		Approved	FLJ90430	uc003tta.2	Q8NEM1	OTTHUMG00000156542	ENST00000309683.6:c.1501C>T	7.37:g.63981631G>A	ENSP00000309330:p.Arg501Trp		Somatic	132	0	0		RNA-Seq	Illumina HiSeq		180	0.01	1	NM_178558	105	0.23	24	B3KVJ4|Q6ZNF3|Q8NC79	Missense_Mutation	SNP	ENST00000309683.6	37	CCDS34644.1	.	.	.	.	.	.	.	.	.	.	g	16.13	3.035027	0.54896	.	.	ENSG00000173041	ENST00000309683	T	0.58210	0.35	1.31	-2.46	0.06461	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.51466	0.1676	L	0.45285	1.41	0.09310	N	1	D	0.89917	1.0	D	0.64877	0.93	T	0.41142	-0.9525	9	0.27082	T	0.32	.	2.0402	0.03549	0.2511:0.0:0.4566:0.2924	.	501	Q8NEM1	ZN680_HUMAN	W	501	ENSP00000309330:R501W	ENSP00000309330:R501W	R	-	1	2	ZNF680	63619066	0.000000	0.05858	0.000000	0.03702	0.125000	0.20455	0.133000	0.15912	-0.859000	0.04105	-0.359000	0.07587	CGG			0.358	ZNF680-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000344568.1		NM_178558	
CASD1	64921	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	7	94167043	94167043	+	Nonsense_Mutation	SNP	T	T	G			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr7:94167043T>G	ENST00000297273.4	+	9	1390	c.1103T>G	c.(1102-1104)tTa>tGa	p.L368*		NM_022900.4	NP_075051.4	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1	368						integral component of membrane (GO:0016021)				NS(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	31	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			GAAATACTTTTACAATCTTTC	0.348																																					p.L368X													.	.			0			c.T1103G												107.0	120.0	115.0					7																	94167043		2203	4300	6503	SO:0001587	stop_gained	64921	exon9			TACTTTTACAATC	AF355594	CCDS5636.1	7q22	2006-03-09			ENSG00000127995	ENSG00000127995			16014	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 12"""	611686				11703667, 11528394	Standard	NM_022900		Approved	FLJ21213, FLJ21879, C7orf12	uc003uni.4	Q96PB1	OTTHUMG00000023356	ENST00000297273.4:c.1103T>G	7.37:g.94167043T>G	ENSP00000297273:p.Leu368*		Somatic	99	0	0		WXS	Illumina HiSeq	.	172	0.23	39	NM_022900	67	0.16	11	B3KW13|O14574|Q3LIE2|Q6P4R4|Q9H6T9|Q9H770	Nonsense_Mutation	SNP	ENST00000297273.4	37	CCDS5636.1	.	.	.	.	.	.	.	.	.	.	T	39	7.789653	0.98492	.	.	ENSG00000127995	ENST00000297273	.	.	.	5.51	5.51	0.81932	.	0.304630	0.31415	N	0.007690	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.9173	0.79531	0.0:0.0:0.0:1.0	.	.	.	.	X	368	.	ENSP00000297273:L368X	L	+	2	0	CASD1	94004979	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	6.051000	0.71072	2.226000	0.72624	0.477000	0.44152	TTA			0.348	CASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255216.1		NM_022900	
EPHB4	2050	hgsc.bcm.edu;broad.mit.edu	37	7	100421432	100421432	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr7:100421432delC	ENST00000358173.3	-	3	713	c.245delG	c.(244-246)ggcfs	p.G82fs	RN7SL750P_ENST00000582814.1_RNA|EPHB4_ENST00000477446.1_5'UTR|EPHB4_ENST00000360620.3_Frame_Shift_Del_p.G82fs	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	82	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					GTGGACGGCGCCCCGCCGTGG	0.672																																					p.G82fs	GBM(200;2113 3072 25865 52728)												EPHB4,NS,carcinoma,0,1	EPHB4	106		0			c.246delC												45.0	41.0	43.0					7																	100421432		2202	4299	6501	SO:0001589	frameshift_variant	2050	exon3			ACGGCGCCCCGCC	AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.245delG	7.37:g.100421432delC	ENSP00000350896:p.Gly82fs		Somatic	48	0	0		WXS	Illumina HiSeq	.	72	0.15	11	NM_004444	300	0.00	0	B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Frame_Shift_Del	DEL	ENST00000358173.3	37	CCDS5706.1																																																																																					0.672	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347222.1		NM_004444	
KCP	375616	broad.mit.edu	37	7	128548302	128548304	+	RNA	DEL	AAG	AAG	-	rs55898241|rs370991615|rs370653893|rs10565205|rs202067497		TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	AAG	AAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr7:128548302_128548304delAAG	ENST00000476647.2	-	0	263				AC025594.1_ENST00000408474.1_RNA			Q6ZWJ8	KCP_HUMAN	kielin/chordin-like protein							extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)	4						ggaagaaagaaagaagaaagaaa	0.369																																					.													.	KCP	16		0			.																																											375616	.			GAAAGAAAGAAGA	AK122706		7q32.3	2009-11-06	2009-02-18	2009-02-18	ENSG00000135253	ENSG00000135253			17585	protein-coding gene	gene with protein product	"""kielin"""	609344	"""cysteine rich BMP regulator 2 (chordin-like)"""	CRIM2		15793581	Standard	NM_001135914		Approved	FLJ33365, NET67	uc011kor.2	Q6ZWJ8	OTTHUMG00000158363		7.37:g.128548305_128548307delAAG			Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	12	0.50	6	.	0		0	Q8NBE0	RNA	DEL	ENST00000476647.2	37																																																																																						0.369	KCP-006	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000403051.1		NM_199349	
XKR6	286046	mdanderson.org	37	8	10755923	10755923	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr8:10755923C>T	ENST00000416569.2	-	3	1491	c.1465G>A	c.(1465-1467)Gca>Aca	p.A489T	XKR6_ENST00000304437.2_Missense_Mutation_p.A210T	NM_173683.3	NP_775954.2	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related family, member 6	489						integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(8)|ovary(2)|prostate(1)|skin(3)	31				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		AGCATCATTGCGATCCCAGCC	0.522																																					p.A489T													XKR6,colon,carcinoma,0,1	XKR6	0	1	0			c.G1465A												91.0	80.0	84.0					8																	10755923		2203	4300	6503	SO:0001583	missense	286046	exon3			TCATTGCGATCCC	BC024146	CCDS5978.2	8p23.1	2009-05-27	2006-01-12	2005-07-28	ENSG00000171044	ENSG00000171044			27806	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 7"", ""chromosome 8 open reading frame 21"", ""X Kell blood group precursor-related family, member 6"", ""chromosome 8 open reading frame 5"""	C8orf7, C8orf21, C8orf5			Standard	NM_173683		Approved		uc003wtk.1	Q5GH73	OTTHUMG00000129351	ENST00000416569.2:c.1465G>A	8.37:g.10755923C>T	ENSP00000416707:p.Ala489Thr		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	68	0.06	4	NM_173683	0		0	Q8TBA0	Missense_Mutation	SNP	ENST00000416569.2	37	CCDS5978.2	.	.	.	.	.	.	.	.	.	.	C	13.42	2.230769	0.39399	.	.	ENSG00000171044	ENST00000304437;ENST00000416569	T;T	0.64085	-0.08;-0.08	5.37	3.55	0.40652	.	0.569202	0.18153	N	0.150009	T	0.50222	0.1603	L	0.39514	1.22	0.35038	D	0.759446	B	0.12013	0.005	B	0.11329	0.006	T	0.51576	-0.8688	10	0.26408	T	0.33	-16.5139	10.0335	0.42114	0.0:0.8356:0.0:0.1644	.	489	Q5GH73	XKR6_HUMAN	T	210;489	ENSP00000307120:A210T;ENSP00000416707:A489T	ENSP00000307120:A210T	A	-	1	0	XKR6	10793333	0.996000	0.38824	0.189000	0.23252	0.888000	0.51559	3.304000	0.51866	0.625000	0.30304	0.561000	0.74099	GCA			0.522	XKR6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000383958.1		NM_173683	
PKHD1L1	93035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	110498968	110498968	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr8:110498968A>T	ENST00000378402.5	+	59	9902	c.9798A>T	c.(9796-9798)gaA>gaT	p.E3266D		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3266					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TAGTTGGTGAAGATTACCCCG	0.433										HNSCC(38;0.096)																											p.E3266D													.	.			0			c.A9798T												218.0	218.0	218.0					8																	110498968		1953	4129	6082	SO:0001583	missense	93035	exon59			TGGTGAAGATTAC	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.9798A>T	8.37:g.110498968A>T	ENSP00000367655:p.Glu3266Asp		Somatic	195	0	0		WXS	Illumina HiSeq	.	287	0.16	47	NM_177531	0		0	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	A	9.955	1.221348	0.22457	.	.	ENSG00000205038	ENST00000378402;ENST00000526472	D;D	0.83506	-1.73;-1.73	5.42	1.42	0.22433	Pectin lyase fold/virulence factor (1);	0.185291	0.45606	N	0.000342	T	0.65533	0.2700	N	0.21617	0.685	0.23533	N	0.997478	B	0.06786	0.001	B	0.08055	0.003	T	0.45687	-0.9244	10	0.16896	T	0.51	.	5.6988	0.17871	0.6927:0.1409:0.1663:0.0	.	3266	Q86WI1	PKHL1_HUMAN	D	3266;194	ENSP00000367655:E3266D;ENSP00000437376:E194D	ENSP00000367655:E3266D	E	+	3	2	PKHD1L1	110568144	1.000000	0.71417	1.000000	0.80357	0.401000	0.30781	1.104000	0.31074	0.055000	0.16094	-0.376000	0.06991	GAA			0.433	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381017.1		NM_177531	
RAD21	5885	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	117861253	117861254	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr8:117861253_117861254delCT	ENST00000297338.2	-	13	1922_1923	c.1635_1636delAG	c.(1633-1638)tcagggfs	p.G547fs	RAD21_ENST00000517749.1_De_novo_Start_InFrame|UTP23_ENST00000517820.1_Stop_Codon_Del|RAD21_ENST00000518055.1_Frame_Shift_Del_p.G92fs|RAD21_ENST00000523986.1_Frame_Shift_Del_p.G51fs|UTP23_ENST00000520733.1_Frame_Shift_Del_p.L58fs	NM_006265.2	NP_006256.1	O60216	RAD21_HUMAN	RAD21 homolog (S. pombe)	547					apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|protein localization to chromatin (GO:0071168)|reciprocal meiotic recombination (GO:0007131)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|stomach(1)	32	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)					TGATCGCCCCCTGATGCATCTT	0.406																																					p.546_546del													.	RAD21	95		0			c.1636_1637del																																									SO:0001589	frameshift_variant	5885	exon13			CGCCCCCTGATGC	BC050381	CCDS6321.1	8q24.11	2014-09-17	2001-11-28		ENSG00000164754	ENSG00000164754			9811	protein-coding gene	gene with protein product	"""sister chromatid cohesion 1"""	606462	"""RAD21 (S. pombe) homolog"""			8812457	Standard	NM_006265		Approved	KIAA0078, hHR21, SCC1	uc003yod.3	O60216	OTTHUMG00000164959	ENST00000297338.2:c.1635_1636delAG	8.37:g.117861253_117861254delCT	ENSP00000297338:p.Gly547fs		Somatic	192	0	0		WXS	Illumina HiSeq	.	162	0.20	33	NM_006265	563	0.29	164	A8K0E0|Q15001|Q99568	Frame_Shift_Del	DEL	ENST00000297338.2	37	CCDS6321.1																																																																																					0.406	RAD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381184.1		NM_006265	
Unknown	0	bcgsc.ca	37	9	45376969	45376969	+	IGR	SNP	C	C	A			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chr9:45376969C>A								RP11-449H15.2 (164468 upstream) : RP11-187C18.5 (16875 downstream)																							CCTCTCTCAGCACCCAGCAGA	0.483																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	441420	.			TCTCAGCACCCAG																													9.37:g.45376969C>A			Somatic	57	0.0526315789	3		WXS	Illumina HiSeq	Phase_1	65	0.22	14	.	1	0.00	0		RNA	SNP		37																																																																																					0	0.483										
AMER1	139285	mdanderson.org	37	X	63410102	63410102	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chrX:63410102C>T	ENST00000330258.3	-	2	3337	c.3065G>A	c.(3064-3066)cGt>cAt	p.R1022H	AMER1_ENST00000374869.3_Intron|AMER1_ENST00000403336.1_Intron	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	1022	Pro-rich.				adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									GTGTGAGGGACGAGCTAGTTG	0.567																																					p.R1022H													.	.			67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)	c.G3065A												51.0	57.0	55.0					X																	63410102		2119	4214	6333	SO:0001583	missense	139285	exon2			GAGGGACGAGCTA	AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.3065G>A	X.37:g.63410102C>T	ENSP00000329117:p.Arg1022His		Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	76	0.05	4	NM_152424	19	0.00	0	A2IB86|Q8N885	Missense_Mutation	SNP	ENST00000330258.3	37	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	C	13.66	2.304721	0.40795	.	.	ENSG00000184675	ENST00000330258	T	0.59772	0.24	4.93	4.07	0.47477	.	.	.	.	.	T	0.40015	0.1100	L	0.27053	0.805	0.80722	D	1	B	0.25272	0.122	B	0.18263	0.021	T	0.16660	-1.0395	8	.	.	.	-6.5728	9.5686	0.39414	0.0:0.8994:0.0:0.1006	.	1022	Q5JTC6	F123B_HUMAN	H	1022	ENSP00000329117:R1022H	.	R	-	2	0	FAM123B	63326827	0.023000	0.18921	0.723000	0.30687	0.152000	0.21847	1.247000	0.32815	1.210000	0.43336	0.529000	0.55759	CGT			0.567	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316584.1		NM_152424	
SRPK3	26576	mdanderson.org	37	X	153046776	153046776	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAF6-01A-11D-A42Y-10	TCGA-2G-AAF6-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a7112f-6a25-40c7-9e6a-c9bf107e05a4	9a637380-4a84-4cfc-8a4c-4a61515e9229	g.chrX:153046776G>T	ENST00000370101.3	+	2	211	c.165G>T	c.(163-165)caG>caT	p.Q55H	SRPK3_ENST00000370108.3_Missense_Mutation_p.Q55H|SRPK3_ENST00000370100.1_Missense_Mutation_p.Q13H|SRPK3_ENST00000393786.3_Missense_Mutation_p.Q55H|SRPK3_ENST00000489426.1_Missense_Mutation_p.Q122H|SRPK3_ENST00000370104.1_Missense_Mutation_p.Q55H	NM_001170760.1|NM_014370.3	NP_001164231.1|NP_055185.2	Q9UPE1	SRPK3_HUMAN	SRSF protein kinase 3	55					cell differentiation (GO:0030154)|muscle tissue development (GO:0060537)|skeletal muscle tissue development (GO:0007519)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(2)|lung(4)|ovary(2)|pancreas(2)|urinary_tract(1)	13	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					ACGAGGAACAGGAAGACCCCA	0.672																																					p.Q55H	Esophageal Squamous(167;766 3400 32156)												.	.			0			c.G165T												31.0	32.0	31.0					X																	153046776		2199	4293	6492	SO:0001583	missense	26576	exon2			GGAACAGGAAGAC	AF027406	CCDS35441.1, CCDS55537.1, CCDS55538.1	Xq28	2010-06-23	2010-06-23	2006-08-17	ENSG00000184343	ENSG00000184343			11402	protein-coding gene	gene with protein product			"""serine/threonine kinase 23"", ""SFRS protein kinase 3"""	STK23		16140986	Standard	NM_014370		Approved	MSSK1	uc004fil.3	Q9UPE1	OTTHUMG00000024207	ENST00000370101.3:c.165G>T	X.37:g.153046776G>T	ENSP00000359119:p.Gln55His		Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	127	0.04	5	NM_001170761	0		0	Q13583|Q4F970|Q562F5|Q9UM62	Missense_Mutation	SNP	ENST00000370101.3	37	CCDS35441.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.78|17.78	3.472500|3.472500	0.63737|0.63737	.|.	.|.	ENSG00000184343|ENSG00000184343	ENST00000489426;ENST00000393786;ENST00000370104;ENST00000370108;ENST00000370101;ENST00000370100|ENST00000430541	T;T;T;T;T;T|.	0.58940|.	0.3;0.42;0.39;0.43;0.39;0.41|.	4.21|4.21	4.21|4.21	0.49690|0.49690	.|.	0.000000|.	0.49916|.	D|.	0.000140|.	T|T	0.74786|0.74786	0.3762|0.3762	M|M	0.81942|0.81942	2.565|2.565	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.71674|.	0.993;0.997;0.998;0.996;0.988|.	D;D;D;P;D|.	0.87578|.	0.963;0.993;0.998;0.859;0.945|.	T|T	0.77332|0.77332	-0.2627|-0.2627	10|5	0.87932|.	D|.	0|.	-27.5527|-27.5527	13.035|13.035	0.58864|0.58864	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	13;55;55;55;122|.	Q9UPE1-2;Q9UPE1-4;Q9UPE1-3;Q9UPE1;E7ETV6|.	.;.;.;SRPK3_HUMAN;.|.	H|M	122;55;55;55;55;13|69	ENSP00000420058:Q122H;ENSP00000377376:Q55H;ENSP00000359122:Q55H;ENSP00000359126:Q55H;ENSP00000359119:Q55H;ENSP00000359118:Q13H|.	ENSP00000359118:Q13H|.	Q|R	+|+	3|2	2|0	SRPK3|SRPK3	152699970|152699970	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.456000|0.456000	0.32438|0.32438	3.795000|3.795000	0.55499|0.55499	1.928000|1.928000	0.55862|0.55862	0.529000|0.529000	0.55759|0.55759	CAG|AGG			0.672	SRPK3-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000354501.1		NM_014370	
