#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
CROCCP3	114819	broad.mit.edu	37	1	16812950	16812950	+	RNA	SNP	A	A	G			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr1:16812950A>G	ENST00000263511.4	-	0	1361					NR_023386.1		Q8IVE0	CROL2_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 3						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											TGTCCAGGTCACTTTGCATCT	0.627																																					.													.	.			0			.																																											0	.			CAGGTCACTTTGC	AB067509		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000080947	ENSG00000080947			29405	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 2"""	CROCCL2		11572484	Standard	NR_023386		Approved	KIAA1922	uc001ayt.2	Q8IVE0	OTTHUMG00000037885		1.37:g.16812950A>G			Somatic	51	0.0196078431	1		WXS	Illumina HiSeq	Phase_I	57	0.14	8	.	5	0.20	1	Q96PW6	RNA	SNP	ENST00000263511.4	37																																																																																						0.627	CROCCP3-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000458172.1		XM_057040	
LPHN2	23266	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	82436031	82436031	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr1:82436031T>A	ENST00000370728.1	+	18	3400	c.2755T>A	c.(2755-2757)Ttt>Att	p.F919I	LPHN2_ENST00000370717.2_Missense_Mutation_p.F919I|LPHN2_ENST00000394879.1_Missense_Mutation_p.F906I|LPHN2_ENST00000335786.5_Missense_Mutation_p.F919I|LPHN2_ENST00000370721.1_Missense_Mutation_p.F844I|LPHN2_ENST00000370725.1_Missense_Mutation_p.F919I|LPHN2_ENST00000469377.2_Intron|LPHN2_ENST00000319517.6_Missense_Mutation_p.F906I|LPHN2_ENST00000370723.1_Missense_Mutation_p.F906I|LPHN2_ENST00000370730.1_Missense_Mutation_p.F919I|LPHN2_ENST00000370727.1_Missense_Mutation_p.F919I|LPHN2_ENST00000370715.1_Missense_Mutation_p.F906I|LPHN2_ENST00000359929.3_Missense_Mutation_p.F906I|LPHN2_ENST00000271029.4_Missense_Mutation_p.F919I|LPHN2_ENST00000370713.1_Missense_Mutation_p.F906I			O95490	LPHN2_HUMAN	latrophilin 2	919					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		ACTTCTACACTTTTTCTTTTT	0.353																																					p.F906I													.	.			0			c.T2716A												146.0	146.0	146.0					1																	82436031		2203	4300	6503	SO:0001583	missense	23266	exon14			CTACACTTTTTCT	AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.2755T>A	1.37:g.82436031T>A	ENSP00000359763:p.Phe919Ile		Somatic	110	0	0		WXS	Illumina HiSeq	.	85	0.14	12	NM_012302	7	0.00	0	A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	ENST00000370728.1	37		.	.	.	.	.	.	.	.	.	.	T	24.0	4.479622	0.84747	.	.	ENSG00000117114	ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000370715;ENST00000370713;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.53640	0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.65893	0.2735	M	0.89478	3.035	0.58432	D	0.999999	D;D;D	0.65815	0.986;0.992;0.995	P;P;P	0.61201	0.885;0.853;0.885	T	0.74589	-0.3615	10	0.87932	D	0	.	15.9852	0.80147	0.0:0.0:0.0:1.0	.	906;906;906	O95490-3;O95490-4;O95490-2	.;.;.	I	844;919;919;919;919;906;906;906;906;906;919;906;919;919	ENSP00000359756:F844I;ENSP00000359763:F919I;ENSP00000359765:F919I;ENSP00000359762:F919I;ENSP00000359760:F919I;ENSP00000359758:F906I;ENSP00000353006:F906I;ENSP00000359750:F906I;ENSP00000359748:F906I;ENSP00000322270:F906I;ENSP00000359752:F919I;ENSP00000378344:F906I;ENSP00000271029:F919I;ENSP00000337306:F919I	ENSP00000271029:F919I	F	+	1	0	LPHN2	82208619	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.036000	0.88901	2.172000	0.68678	0.482000	0.46254	TTT			0.353	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000027188.1		NM_012302	
WDR63	126820	mdanderson.org	37	1	85573833	85573833	+	Silent	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr1:85573833G>T	ENST00000294664.6	+	15	1851	c.1671G>T	c.(1669-1671)ctG>ctT	p.L557L	WDR63_ENST00000326813.8_Silent_p.L518L|WDR63_ENST00000370596.1_Silent_p.L518L	NM_145172.3	NP_660155.2	Q8IWG1	WDR63_HUMAN	WD repeat domain 63	557										NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)	36				all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)		TTTTGCATCTGGATCTCTCCT	0.373																																					p.L557L													.	.			0			c.G1671T												154.0	151.0	152.0					1																	85573833		2203	4300	6503	SO:0001819	synonymous_variant	126820	exon15			GCATCTGGATCTC		CCDS702.1, CCDS72818.1	1p22.3	2014-02-21	2013-02-19	2013-02-19	ENSG00000162643	ENSG00000162643		"""WD repeat domain containing"""	30711	protein-coding gene	gene with protein product						21953912	Standard	XM_005270438		Approved	DIC3, FLJ30067, NYD-SP29	uc001dkt.3	Q8IWG1	OTTHUMG00000009953	ENST00000294664.6:c.1671G>T	1.37:g.85573833G>T			Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_145172	0		0	A8K988|Q96L72|Q96NU4	Silent	SNP	ENST00000294664.6	37	CCDS702.1																																																																																					0.373	WDR63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000027565.2		NM_145172	
SPRR1B	6699	broad.mit.edu;mdanderson.org	37	1	153005016	153005016	+	Silent	SNP	C	C	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr1:153005016C>T	ENST00000307098.4	+	2	260	c.195C>T	c.(193-195)tgC>tgT	p.C65C	SPRR1B_ENST00000392661.3_Intron	NM_003125.2	NP_003116.2	P22528	SPR1B_HUMAN	small proline-rich protein 1B	65	6 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)	p.C65*(2)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|ovary(2)|skin(2)	9	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CAGAGCCATGCCACCCCAAGG	0.617																																					p.C65C													SPRR1B,NS,carcinoma,0,1	SPRR1B	18	1	2	Substitution - Nonsense(2)	lung(2)	c.C195T												106.0	105.0	105.0					1																	153005016		2203	4300	6503	SO:0001819	synonymous_variant	6699	exon2			GCCATGCCACCCC	M84757	CCDS30863.1	1q21-q22	2010-06-25	2010-06-25		ENSG00000169469	ENSG00000169469			11260	protein-coding gene	gene with protein product	"""cornifin"""	182266		SPRR1		8325635, 1438308	Standard	NM_003125		Approved	GADD33	uc001fba.3	P22528	OTTHUMG00000013869	ENST00000307098.4:c.195C>T	1.37:g.153005016C>T			Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	80	0.05	4	NM_003125	0		0	B2R5H7|P22529|P22530|Q5T524	Silent	SNP	ENST00000307098.4	37	CCDS30863.1																																																																																					0.617	SPRR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000038906.1		NM_003125	
OR10J1	26476	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	1	159410279	159410279	+	Missense_Mutation	SNP	G	G	A	rs368823977		TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr1:159410279G>A	ENST00000423932.3	+	1	768	c.731G>A	c.(730-732)cGg>cAg	p.R244Q	RP11-550P17.5_ENST00000431862.1_RNA	NM_012351.2	NP_036483.2	P30954	O10J1_HUMAN	olfactory receptor, family 10, subfamily J, member 1	244					G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)|single fertilization (GO:0007338)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|stomach(1)	25	all_hematologic(112;0.0429)					GTTGAGGGCCGGAAGAAGGCT	0.478																																					p.R244Q													OR10J1,NS,carcinoma,+1,1	OR10J1	1	1	0			c.G731A							G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	189.0	175.0	180.0		731	1.8	0.1	1		180	0,8600		0,0,4300	no	missense	OR10J1	NM_012351.2	43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	244/321	159410279	1,13005	2203	4300	6503	SO:0001583	missense	26476	exon1			AGGGCCGGAAGAA	X64995	CCDS1185.1	1q23.2	2012-08-09			ENSG00000196184	ENSG00000196184		"""GPCR / Class A : Olfactory receptors"""	8175	protein-coding gene	gene with protein product						1370859	Standard	NM_012351		Approved	HGMP07J, HSHGMP07J	uc010piv.2	P30954	OTTHUMG00000022737	ENST00000423932.3:c.731G>A	1.37:g.159410279G>A	ENSP00000399078:p.Arg244Gln		Somatic	108	0.0092592593	1		WXS	Illumina HiSeq	.	105	0.06	6	NM_012351	0		0	Q2M1M8|Q5VSV1|Q6IET5|Q96R56	Missense_Mutation	SNP	ENST00000423932.3	37	CCDS1185.1	.	.	.	.	.	.	.	.	.	.	G	10.09	1.255584	0.22965	2.27E-4	0.0	ENSG00000196184	ENST00000423932	T	0.00311	8.15	3.73	1.79	0.24919	GPCR, rhodopsin-like superfamily (1);	0.202066	0.24202	N	0.040602	T	0.00073	0.0002	L	0.55990	1.75	0.18873	N	0.999984	B	0.29253	0.239	B	0.26864	0.074	T	0.27640	-1.0068	10	0.54805	T	0.06	.	8.2618	0.31790	0.1974:0.0:0.8026:0.0	.	244	P30954	O10J1_HUMAN	Q	244	ENSP00000399078:R244Q	ENSP00000399078:R244Q	R	+	2	0	OR10J1	157676903	0.000000	0.05858	0.076000	0.20297	0.709000	0.40893	0.048000	0.14078	0.334000	0.23590	0.650000	0.86243	CGG			0.478	OR10J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000059020.1		NM_012351	
HLX	3142	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	221054636	221054636	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr1:221054636C>G	ENST00000366903.6	+	2	2194	c.693C>G	c.(691-693)aaC>aaG	p.N231K	HLX_ENST00000549319.1_5'UTR|HLA-AS1_ENST00000552026.1_RNA	NM_021958.3	NP_068777.1	Q14774	HLX_HUMAN	H2.0-like homeobox	231					cell differentiation (GO:0030154)|embryonic digestive tract morphogenesis (GO:0048557)|enteric nervous system development (GO:0048484)|liver development (GO:0001889)|multicellular organismal development (GO:0007275)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(9)|lung(11)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(131;0.00914)		ATCCCATTAACGAGGCTTCTG	0.552																																					p.N231K													.	.			0			c.C693G												94.0	96.0	96.0					1																	221054636		2203	4300	6503	SO:0001583	missense	3142	exon2			CATTAACGAGGCT	BC033808	CCDS1527.1	1q41	2011-06-20	2007-07-26	2007-07-26	ENSG00000136630	ENSG00000136630		"""Homeoboxes / ANTP class : NKL subclass"""	4978	protein-coding gene	gene with protein product		142995	"""H2.0 (Drosophila)-like homeo box 1"", ""H2.0-like homeobox 1 (Drosophila)"", ""H2.0-like homeobox 1"""	HLX1		1676597, 7806220	Standard	NM_021958		Approved	HB24	uc001hmv.4	Q14774	OTTHUMG00000037352	ENST00000366903.6:c.693C>G	1.37:g.221054636C>G	ENSP00000355870:p.Asn231Lys		Somatic	147	0	0		WXS	Illumina HiSeq	.	118	0.15	18	NM_021958	15	0.00	0	B2R8A8|Q15988|Q59HE7|Q9NZ75	Missense_Mutation	SNP	ENST00000366903.6	37	CCDS1527.1	.	.	.	.	.	.	.	.	.	.	C	16.28	3.077926	0.55753	.	.	ENSG00000136630	ENST00000366903	D	0.89681	-2.55	5.82	0.873	0.19118	.	0.357028	0.26855	N	0.022143	T	0.78648	0.4316	N	0.24115	0.695	0.80722	D	1	B	0.23650	0.089	B	0.19391	0.025	T	0.64761	-0.6331	10	0.29301	T	0.29	-36.3448	9.9892	0.41860	0.0:0.6695:0.0:0.3305	.	231	Q14774	HLX_HUMAN	K	231	ENSP00000355870:N231K	ENSP00000355870:N231K	N	+	3	2	HLX	219121259	0.961000	0.32948	0.991000	0.47740	0.967000	0.64934	0.160000	0.16462	-0.076000	0.12775	-0.254000	0.11334	AAC			0.552	HLX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000090902.3		NM_021958	
ARID4B	51742	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	235345007	235345007	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr1:235345007C>G	ENST00000264183.3	-	20	3724	c.3227G>C	c.(3226-3228)gGg>gCg	p.G1076A	ARID4B_ENST00000366603.2_Missense_Mutation_p.G1076A|ARID4B_ENST00000494543.1_5'UTR|ARID4B_ENST00000349213.3_Missense_Mutation_p.G990A	NM_016374.5	NP_057458.4	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B (RBP1-like)	1076					histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|large_intestine(2)|lung(1)|ovary(2)	8	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			TTGGAGCTCCCCAGCAACACT	0.478																																					p.G1076A													.	ARID4B	142		0			c.G3227C												111.0	94.0	100.0					1																	235345007		2203	4300	6503	SO:0001583	missense	51742	exon20			AGCTCCCCAGCAA	AF214114	CCDS31060.1, CCDS31061.1	1q42.1-q43	2013-02-07	2006-11-08	2004-01-30	ENSG00000054267	ENSG00000054267		"""-"""	15550	protein-coding gene	gene with protein product		609696	"""retinoblastoma binding protein 1-like 1"", ""AT rich interactive domain 4B (RBP1- like)"""	RBP1L1		11481388	Standard	NM_016374		Approved	BCAA, BRCAA1, SAP180	uc001hwq.3	Q4LE39	OTTHUMG00000039621	ENST00000264183.3:c.3227G>C	1.37:g.235345007C>G	ENSP00000264183:p.Gly1076Ala		Somatic	86	0.011627907	1		WXS	Illumina HiSeq	Phase_I	59	0.17	10	NM_016374	63	0.27	17	A1L465|Q3MHV4|Q5HY99|Q5T2C2|Q5T2C3|Q5T2C4|Q5T2C5|Q5T2C6|Q6P600|Q86UX1|Q86WR4|Q9H915|Q9NYU3|Q9NZB6|Q9NZG4|Q9P2W4|Q9UF62|Q9Y6E1	Missense_Mutation	SNP	ENST00000264183.3	37	CCDS31061.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.57|16.57	3.161176|3.161176	0.57368|0.57368	.|.	.|.	ENSG00000054267|ENSG00000054267	ENST00000391856;ENST00000349213;ENST00000366603;ENST00000264183|ENST00000444620	T;T;T|.	0.27890|.	1.7;1.64;1.64|.	5.17|5.17	5.17|5.17	0.71159|0.71159	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.71298|0.71298	0.3323|0.3323	L|L	0.50333|0.50333	1.59|1.59	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;0.999|.	D;D;D;D|.	0.87578|.	0.998;0.996;0.996;0.991|.	T|T	0.71941|0.71941	-0.4440|-0.4440	10|7	0.02654|0.51188	T|T	1|0.08	-12.6422|-12.6422	18.6926|18.6926	0.91589|0.91589	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	757;1076;990;1076|.	Q4LE39-4;Q4LE39-3;Q4LE39-2;Q4LE39|.	.;.;.;ARI4B_HUMAN|.	A|R	1076;990;1076;1076|476	ENSP00000264184:G990A;ENSP00000355562:G1076A;ENSP00000264183:G1076A|.	ENSP00000264183:G1076A|ENSP00000416063:G476R	G|G	-|-	2|1	0|0	ARID4B|ARID4B	233411630|233411630	1.000000|1.000000	0.71417|0.71417	0.914000|0.914000	0.36105|0.36105	0.979000|0.979000	0.70002|0.70002	5.535000|5.535000	0.67173|0.67173	2.418000|2.418000	0.82041|0.82041	0.585000|0.585000	0.79938|0.79938	GGG|GGG			0.478	ARID4B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000095566.3		NM_016374	
TET1	80312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	70412305	70412305	+	Missense_Mutation	SNP	C	C	G	rs376648844		TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr10:70412305C>G	ENST00000373644.4	+	6	4624	c.4415C>G	c.(4414-4416)aCc>aGc	p.T1472S		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	1472					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						GTAGTGTACACCGGTAAAGAA	0.353																																					p.T1472S													.	.			0			c.C4415G												122.0	123.0	123.0					10																	70412305		2203	4300	6503	SO:0001583	missense	80312	exon6			TGTACACCGGTAA	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.4415C>G	10.37:g.70412305C>G	ENSP00000362748:p.Thr1472Ser		Somatic	72	0	0		WXS	Illumina HiSeq	.	66	0.18	12	NM_030625	69	0.33	23	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	37	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.411869	0.83340	.	.	ENSG00000138336	ENST00000373644	T	0.36340	1.26	5.84	5.84	0.93424	TET cysteine-rich domain (1);	0.055233	0.64402	D	0.000001	T	0.61135	0.2323	M	0.64170	1.965	0.49582	D	0.999808	D	0.89917	1.0	D	0.85130	0.997	T	0.61013	-0.7148	10	0.87932	D	0	.	20.1579	0.98126	0.0:1.0:0.0:0.0	.	1472	Q8NFU7	TET1_HUMAN	S	1472	ENSP00000362748:T1472S	ENSP00000362748:T1472S	T	+	2	0	TET1	70082311	1.000000	0.71417	0.115000	0.21578	0.684000	0.39900	5.571000	0.67404	2.767000	0.95098	0.555000	0.69702	ACC			0.353	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048354.1		NM_030625	
LGI1	9211	broad.mit.edu	37	10	95553006	95553006	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr10:95553006A>G	ENST00000371418.4	+	7	997	c.737A>G	c.(736-738)aAt>aGt	p.N246S	LGI1_ENST00000542308.1_Missense_Mutation_p.N198S|LGI1_ENST00000371413.3_Missense_Mutation_p.N246S	NM_005097.2	NP_005088.1	O95970	LGI1_HUMAN	leucine-rich, glioma inactivated 1	246					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|positive regulation of cell growth (GO:0030307)|positive regulation of synaptic transmission (GO:0050806)|protein homooligomerization (GO:0051260)	cell junction (GO:0030054)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|synapse (GO:0045202)	receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(18)|ovary(2)|skin(1)	29		Colorectal(252;0.124)				TCTTATTTGAATGATGAGTAT	0.358																																					p.N246S													.	LGI1	69		0			c.A737G												137.0	129.0	132.0					10																	95553006		2203	4300	6503	SO:0001583	missense	9211	exon7			ATTTGAATGATGA	AF055636	CCDS7431.1	10q24	2008-08-01	2002-06-05		ENSG00000108231	ENSG00000108231			6572	protein-coding gene	gene with protein product		604619	"""epilepsy, partial"""	EPT		9879993, 11978770, 15079011	Standard	NM_005097		Approved	IB1099, ETL1, EPITEMPIN	uc001kjc.4	O95970	OTTHUMG00000018777	ENST00000371418.4:c.737A>G	10.37:g.95553006A>G	ENSP00000360472:p.Asn246Ser		Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	90	0.04	4	NM_005097	0		0	A8K0Z1|B4E1S0|Q5W001|Q5W002|Q8NI23|Q96LF5	Missense_Mutation	SNP	ENST00000371418.4	37	CCDS7431.1	.	.	.	.	.	.	.	.	.	.	A	9.881	1.201574	0.22121	.	.	ENSG00000108231	ENST00000542308;ENST00000371418;ENST00000371413	T;T;T	0.80994	-1.44;-1.44;-1.44	5.45	5.45	0.79879	.	0.088163	0.85682	D	0.000000	T	0.70064	0.3181	L	0.39020	1.185	0.53688	D	0.999972	B;B;B	0.21147	0.052;0.049;0.009	B;B;B	0.20184	0.022;0.028;0.017	T	0.64626	-0.6363	10	0.02654	T	1	-10.6813	15.6958	0.77494	1.0:0.0:0.0:0.0	.	198;246;246	O95970-3;O95970-2;O95970	.;.;LGI1_HUMAN	S	198;246;246	ENSP00000440763:N198S;ENSP00000360472:N246S;ENSP00000360467:N246S	ENSP00000360467:N246S	N	+	2	0	LGI1	95542996	1.000000	0.71417	0.962000	0.40283	0.957000	0.61999	4.286000	0.58995	2.288000	0.76882	0.528000	0.53228	AAT			0.358	LGI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049445.1		NM_005097	
MKI67	4288	broad.mit.edu;mdanderson.org	37	10	129905196	129905196	+	Silent	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr10:129905196G>T	ENST00000368654.3	-	13	5283	c.4908C>A	c.(4906-4908)tcC>tcA	p.S1636S	MKI67_ENST00000368653.3_Silent_p.S1276S	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	1636	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CTTTCCCCAGGGATGTCTTGA	0.498																																					p.S1636S													.	MKI67	363		0			c.C4908A												217.0	218.0	218.0					10																	129905196		2203	4300	6503	SO:0001819	synonymous_variant	4288	exon13			CCCCAGGGATGTC	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.4908C>A	10.37:g.129905196G>T			Somatic	139	0	0		WXS	Illumina HiSeq	Phase_I	156	0.04	6	NM_002417	81	0.00	0	Q5VWH2	Silent	SNP	ENST00000368654.3	37	CCDS7659.1																																																																																					0.498	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000050999.1		NM_002417	
RASSF7	8045	mdanderson.org	37	11	561874	561874	+	Missense_Mutation	SNP	G	G	A	rs371827786		TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr11:561874G>A	ENST00000397583.3	+	2	539	c.106G>A	c.(106-108)Gca>Aca	p.A36T	C11orf35_ENST00000329451.3_5'Flank|RP11-496I9.1_ENST00000527620.1_RNA|RASSF7_ENST00000524468.1_Intron|RASSF7_ENST00000397582.3_Missense_Mutation_p.A36T|RASSF7_ENST00000431809.1_Missense_Mutation_p.A36T|RASSF7_ENST00000344375.4_Missense_Mutation_p.A36T|RP11-496I9.1_ENST00000527113.1_RNA|RASSF7_ENST00000454668.2_Missense_Mutation_p.A36T	NM_003475.3	NP_003466.1	Q02833	RASF7_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 7	36	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				apoptotic process (GO:0006915)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(3)	8		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGTGGTCATCGCACTAGCCCA	0.627																																					p.A36T	Pancreas(184;1170 3913 7268)												.	.			0			c.G106A							G	THR/ALA,THR/ALA,THR/ALA	0,4404		0,0,2202	90.0	71.0	78.0		106,106,106	3.7	1.0	11		78	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	RASSF7	NM_001143993.1,NM_001143994.1,NM_003475.3	58,58,58	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	36/338,36/321,36/374	561874	1,13003	2202	4300	6502	SO:0001583	missense	8045	exon2			GTCATCGCACTAG	M91083	CCDS7702.1, CCDS44505.1, CCDS44506.1	11p15.5	2008-02-22	2008-02-22	2005-09-14	ENSG00000099849	ENSG00000099849			1166	protein-coding gene	gene with protein product		143023	"""chromosome 11 open reading frame 13"""	C11orf13		1339391	Standard	NM_001143993		Approved	HRC1, HRAS1	uc001lqc.3	Q02833	OTTHUMG00000132004	ENST00000397583.3:c.106G>A	11.37:g.561874G>A	ENSP00000380713:p.Ala36Thr		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_001143994	30	0.00	0	G5E9N9|Q3KP41|Q3KP42	Missense_Mutation	SNP	ENST00000397583.3	37	CCDS7702.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.803888	0.90623	0.0	1.16E-4	ENSG00000099849	ENST00000431809;ENST00000397582;ENST00000344375;ENST00000397583;ENST00000454668;ENST00000528736	T;T;T;T;T;T	0.18810	2.19;2.19;2.19;2.19;2.19;2.19	3.66	3.66	0.41972	Ras-association (3);	0.059988	0.64402	D	0.000003	T	0.51907	0.1702	M	0.90814	3.15	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.70016	0.944;0.967;0.944	T	0.63143	-0.6703	10	0.45353	T	0.12	-4.4257	15.5764	0.76392	0.0:0.0:1.0:0.0	.	36;36;36	G5E9N9;Q02833;Q02833-2	.;RASF7_HUMAN;.	T	36	ENSP00000403068:A36T;ENSP00000380712:A36T;ENSP00000344226:A36T;ENSP00000380713:A36T;ENSP00000405606:A36T;ENSP00000433165:A36T	ENSP00000344226:A36T	A	+	1	0	RASSF7	551874	1.000000	0.71417	0.961000	0.40146	0.873000	0.50193	9.523000	0.98034	1.885000	0.54596	0.561000	0.74099	GCA			0.627	RASSF7-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000254972.2		NM_003475	
SLC25A22	79751	mdanderson.org	37	11	791955	791955	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr11:791955G>T	ENST00000320230.5	-	10	1413	c.932C>A	c.(931-933)gCg>gAg	p.A311E	CEND1_ENST00000524587.1_5'Flank|CEND1_ENST00000330106.4_5'Flank|SLC25A22_ENST00000531214.1_Missense_Mutation_p.A311E	NM_001191061.1|NM_024698.5	NP_001177990.1|NP_078974.1	Q9H936	GHC1_HUMAN	solute carrier family 25 (mitochondrial carrier: glutamate), member 22	311					L-glutamate transport (GO:0015813)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			endometrium(1)|kidney(1)|lung(2)|urinary_tract(1)	5		all_cancers(49;4.75e-06)|all_epithelial(84;0.00204)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;6.27e-26)|Epithelial(43;4.84e-25)|OV - Ovarian serous cystadenocarcinoma(40;2.72e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CAGGGACTCCGCGATGCCCAG	0.721																																					p.A311E	Colon(93;848 1468 3270 23355 49636)												.	.			0			c.C932A												14.0	13.0	14.0					11																	791955		2178	4272	6450	SO:0001583	missense	79751	exon10			GACTCCGCGATGC	AJ428202	CCDS7715.1	11p15.5	2013-05-22			ENSG00000177542	ENSG00000177542		"""Solute carriers"""	19954	protein-coding gene	gene with protein product		609302				11897791	Standard	NM_024698		Approved	GC1, FLJ13044, NET44, EIEE3	uc001lrj.3	Q9H936	OTTHUMG00000133310	ENST00000320230.5:c.932C>A	11.37:g.791955G>T	ENSP00000322020:p.Ala311Glu		Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	22	0.09	2	NM_001191060	93	0.00	0	A8K366|C9J1H6|E9PJD3|E9PKB2|E9PL68|E9PN26|E9PNQ3|E9PP01|E9PR97|Q8TBU8	Missense_Mutation	SNP	ENST00000320230.5	37	CCDS7715.1	.	.	.	.	.	.	.	.	.	.	G	16.16	3.044590	0.55110	.	.	ENSG00000177542	ENST00000320230;ENST00000531214	T;T	0.78707	-1.2;-1.2	3.87	1.77	0.24775	.	0.144069	0.46145	D	0.000308	T	0.72471	0.3464	L	0.34521	1.04	0.53688	D	0.999972	P	0.43750	0.816	P	0.47573	0.55	T	0.72151	-0.4377	10	0.38643	T	0.18	-16.1951	14.085	0.64949	0.0:0.4514:0.5486:0.0	.	311	Q9H936	GHC1_HUMAN	E	311	ENSP00000322020:A311E;ENSP00000437236:A311E	ENSP00000322020:A311E	A	-	2	0	SLC25A22	781955	0.982000	0.34865	0.113000	0.21522	0.519000	0.34347	2.340000	0.43974	0.946000	0.37632	0.655000	0.94253	GCG			0.721	SLC25A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257107.2			
TSPAN4	7106	mdanderson.org	37	11	864454	864454	+	Silent	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr11:864454G>T	ENST00000397404.1	+	5	532	c.273G>T	c.(271-273)ctG>ctT	p.L91L	TSPAN4_ENST00000397411.2_Silent_p.L91L|TSPAN4_ENST00000409543.2_Silent_p.L91L|TSPAN4_ENST00000409531.1_Silent_p.L110L|TSPAN4_ENST00000397408.1_Silent_p.L91L|TSPAN4_ENST00000397406.1_Silent_p.L91L|TSPAN4_ENST00000397396.1_Silent_p.L27L|TSPAN4_ENST00000525201.1_Silent_p.L27L|TSPAN4_ENST00000346501.4_Silent_p.L91L|TSPAN4_ENST00000397397.2_Silent_p.L91L	NM_001025237.1	NP_001020408.1	O14817	TSN4_HUMAN	tetraspanin 4	91					protein complex assembly (GO:0006461)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	antigen binding (GO:0003823)|integrin binding (GO:0005178)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)	3		all_cancers(49;2.64e-08)|all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)		all cancers(45;4.32e-25)|Epithelial(43;3.29e-24)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGCTGCTGCTGCTGGTGTTCC	0.672																																					p.L91L													.	.			0			c.G273T												97.0	94.0	95.0					11																	864454		2203	4299	6502	SO:0001819	synonymous_variant	7106	exon5			GCTGCTGCTGGTG	AF022813	CCDS7721.1, CCDS41589.1	11p15.5	2013-02-14	2005-03-21	2005-03-21	ENSG00000214063	ENSG00000214063		"""Tetraspanins"""	11859	protein-coding gene	gene with protein product		602644	"""transmembrane 4 superfamily member 7"""	TM4SF7		9360996	Standard	XM_005253102		Approved	NAG-2, TSPAN-4, TETRASPAN	uc001lsf.1	O14817	OTTHUMG00000133305	ENST00000397404.1:c.273G>T	11.37:g.864454G>T			Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_001025237	212	0.00	0	Q6IAP6	Silent	SNP	ENST00000397404.1	37	CCDS7721.1																																																																																					0.672	TSPAN4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257102.2			
DCHS1	8642	mdanderson.org	37	11	6653426	6653426	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr11:6653426G>T	ENST00000299441.3	-	6	3728	c.3317C>A	c.(3316-3318)tCt>tAt	p.S1106Y	RP11-732A19.6_ENST00000526633.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	1106	Cadherin 10. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGGATCCTCAGACAAGCGGGG	0.607																																					p.S1106Y													.	.			0			c.C3317A												101.0	91.0	94.0					11																	6653426		2201	4295	6496	SO:0001583	missense	8642	exon6			TCCTCAGACAAGC	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.3317C>A	11.37:g.6653426G>T	ENSP00000299441:p.Ser1106Tyr		Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_003737	17	0.00	0	O15098	Missense_Mutation	SNP	ENST00000299441.3	37	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	G	15.78	2.935228	0.52866	.	.	ENSG00000166341	ENST00000299441	T	0.03607	3.87	4.66	4.66	0.58398	Cadherin (3);Cadherin-like (1);	0.157032	0.30302	N	0.009937	T	0.13884	0.0336	M	0.68593	2.085	0.36655	D	0.877635	D	0.67145	0.996	D	0.74023	0.982	T	0.02115	-1.1211	10	0.37606	T	0.19	.	11.9884	0.53161	0.0:0.2868:0.7132:0.0	.	1106	Q96JQ0	PCD16_HUMAN	Y	1106	ENSP00000299441:S1106Y	ENSP00000299441:S1106Y	S	-	2	0	DCHS1	6610002	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.716000	0.54904	2.584000	0.87258	0.561000	0.74099	TCT			0.607	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257258.1		NM_003737	
ABCC8	6833	bcgsc.ca	37	11	17464362	17464362	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr11:17464362T>C	ENST00000389817.3	-	10	1603	c.1535A>G	c.(1534-1536)tAc>tGc	p.Y512C	ABCC8_ENST00000302539.4_Missense_Mutation_p.Y512C|ABCC8_ENST00000528202.1_5'Flank			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	512	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	CTCCCAGGCGTACAGCTTCAG	0.602																																					p.Y512C													.	ABCC8	170		0			c.A1535G												100.0	91.0	94.0					11																	17464362		2200	4293	6493	SO:0001583	missense	6833	exon10			CAGGCGTACAGCT	L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.1535A>G	11.37:g.17464362T>C	ENSP00000374467:p.Tyr512Cys		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_1	38	0.00	0	NM_000352	0		0	A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	ENST00000389817.3	37	CCDS31437.1	.	.	.	.	.	.	.	.	.	.	T	26.6	4.754032	0.89843	.	.	ENSG00000006071	ENST00000389817;ENST00000302539;ENST00000379493	D;D	0.92099	-2.97;-2.97	6.02	6.02	0.97574	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.97275	0.9109	H	0.94964	3.605	0.80722	D	1	D;D	0.89917	1.0;0.993	D;D	0.91635	0.999;0.947	D	0.98264	1.0500	10	0.87932	D	0	.	16.5446	0.84426	0.0:0.0:0.0:1.0	.	511;512	B7Z4N0;Q09428	.;ABCC8_HUMAN	C	512;512;526	ENSP00000374467:Y512C;ENSP00000303960:Y512C	ENSP00000303960:Y512C	Y	-	2	0	ABCC8	17420938	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.029000	0.88807	2.311000	0.77944	0.533000	0.62120	TAC			0.602	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000389093.1		NM_000352	
BCL9L	283149	mdanderson.org	37	11	118771819	118771819	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr11:118771819G>T	ENST00000334801.3	-	6	3597	c.2633C>A	c.(2632-2634)cCc>cAc	p.P878H	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	878					canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)			NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		GTTGCTCATGGGCATTGAGCT	0.627																																					p.P878H													.	.			0			c.C2633A												118.0	100.0	106.0					11																	118771819		2200	4295	6495	SO:0001583	missense	283149	exon6			CTCATGGGCATTG	AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.2633C>A	11.37:g.118771819G>T	ENSP00000335320:p.Pro878His		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_182557	13	0.00	0	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Missense_Mutation	SNP	ENST00000334801.3	37	CCDS8403.1	.	.	.	.	.	.	.	.	.	.	G	15.70	2.910352	0.52439	.	.	ENSG00000186174	ENST00000334801;ENST00000526143;ENST00000525300;ENST00000392849;ENST00000431085	T	0.54279	0.58	5.0	5.0	0.66597	.	0.166245	0.28809	N	0.014078	T	0.41971	0.1182	L	0.29908	0.895	0.39311	D	0.965081	B;B	0.22346	0.001;0.068	B;B	0.15052	0.003;0.012	T	0.43114	-0.9411	10	0.72032	D	0.01	-4.3433	13.8237	0.63338	0.0:0.0:1.0:0.0	.	873;878	Q86UU0-2;Q86UU0	.;BCL9L_HUMAN	H	878;841;171;878;878	ENSP00000335320:P878H	ENSP00000335320:P878H	P	-	2	0	BCL9L	118277029	1.000000	0.71417	0.998000	0.56505	0.770000	0.43624	6.215000	0.72206	2.299000	0.77371	0.655000	0.94253	CCC			0.627	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000389653.1		NM_182557	
SLC37A2	219855	mdanderson.org	37	11	124951662	124951662	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr11:124951662G>T	ENST00000403796.2	+	9	1046	c.745G>T	c.(745-747)Gag>Tag	p.E249*	SLC37A2_ENST00000407458.1_Nonsense_Mutation_p.E249*|SLC37A2_ENST00000298280.5_Nonsense_Mutation_p.E249*|SLC37A2_ENST00000308074.4_Nonsense_Mutation_p.E249*	NM_001145290.1	NP_001138762.1	Q8TED4	SPX2_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 2	249					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	27	all_hematologic(175;0.215)	Breast(109;0.012)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.152)|all_lung(97;0.159)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0384)		TGAGCCAGCTGAGAACCAGGA	0.617																																					p.E249X	Melanoma(11;373 620 21213 26083 47768)												.	.			0			c.G745T												63.0	59.0	60.0					11																	124951662		2201	4299	6500	SO:0001587	stop_gained	219855	exon9			CCAGCTGAGAACC	AK074100	CCDS31714.1, CCDS44757.1	11q24.2	2013-07-17	2013-07-17		ENSG00000134955	ENSG00000134955		"""Solute carriers"""	20644	protein-coding gene	gene with protein product			"""solute carrier family 37 (glycerol-3-phosphate transporter), member 2"""				Standard	NM_198277		Approved	FLJ00171	uc010sau.2	Q8TED4	OTTHUMG00000165879	ENST00000403796.2:c.745G>T	11.37:g.124951662G>T	ENSP00000384407:p.Glu249*		Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_198277	19	0.00	0	A8K2P9|Q6P599|Q7Z7P8|Q8TEM2	Nonsense_Mutation	SNP	ENST00000403796.2	37	CCDS44757.1	.	.	.	.	.	.	.	.	.	.	G	18.97	3.734953	0.69189	.	.	ENSG00000134955	ENST00000403796;ENST00000407458;ENST00000298280;ENST00000308074	.	.	.	4.86	3.66	0.41972	.	0.650943	0.15820	N	0.243041	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	-3.147	9.0061	0.36113	0.1338:0.0:0.8662:0.0	.	.	.	.	X	249	.	ENSP00000298280:E249X	E	+	1	0	SLC37A2	124456872	0.040000	0.19996	0.006000	0.13384	0.020000	0.10135	1.723000	0.38053	0.925000	0.37094	0.655000	0.94253	GAG			0.617	SLC37A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000386837.1		XM_166184	
KRT74	121391	mdanderson.org	37	12	52967458	52967458	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr12:52967458C>A	ENST00000305620.2	-	1	151	c.104G>T	c.(103-105)tGt>tTt	p.C35F	KRT74_ENST00000549343.1_Missense_Mutation_p.C35F	NM_175053.3	NP_778223.2	Q7RTS7	K2C74_HUMAN	keratin 74	35	Gly-rich.|Head.				intermediate filament cytoskeleton organization (GO:0045104)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	keratin filament binding (GO:1990254)|structural molecule activity (GO:0005198)			kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	28				BRCA - Breast invasive adenocarcinoma(357;0.191)		GCCAGCTGCACAGTAAGAAGC	0.572																																					p.C35F													.	.			0			c.G104T												57.0	60.0	59.0					12																	52967458		2203	4300	6503	SO:0001583	missense	121391	exon1			GCTGCACAGTAAG	BK000977	CCDS8832.1	12q13.13	2013-06-25			ENSG00000170484	ENSG00000170484		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28929	protein-coding gene	gene with protein product		608248				12648212, 16831889	Standard	NM_175053		Approved	K6IRS4, KRT5C, KRT6IRS4	uc001sap.1	Q7RTS7	OTTHUMG00000169658	ENST00000305620.2:c.104G>T	12.37:g.52967458C>A	ENSP00000307240:p.Cys35Phe		Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_175053	0		0	B5MD61|Q86Y45	Missense_Mutation	SNP	ENST00000305620.2	37	CCDS8832.1	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.075304	0.00379	.	.	ENSG00000170484	ENST00000549343;ENST00000305620	T;T	0.75154	-0.91;-0.91	4.51	2.63	0.31362	.	0.459334	0.16369	N	0.217385	T	0.55832	0.1945	N	0.14661	0.345	0.09310	N	1	B	0.20261	0.043	B	0.20184	0.028	T	0.47032	-0.9148	10	0.41790	T	0.15	.	9.0256	0.36227	0.0:0.8191:0.0:0.1809	.	35	Q7RTS7	K2C74_HUMAN	F	35	ENSP00000447447:C35F;ENSP00000307240:C35F	ENSP00000307240:C35F	C	-	2	0	KRT74	51253725	0.000000	0.05858	0.002000	0.10522	0.016000	0.09150	-0.600000	0.05693	0.576000	0.29452	0.561000	0.74099	TGT			0.572	KRT74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000405324.1		NM_175053	
ANKS1B	56899	broad.mit.edu;mdanderson.org	37	12	100200303	100200303	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr12:100200303G>T	ENST00000547776.2	-	4	547	c.548C>A	c.(547-549)gCa>gAa	p.A183E	ANKS1B_ENST00000547010.1_Intron|ANKS1B_ENST00000329257.7_Missense_Mutation_p.A183E	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	183						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		GTTAGGATGTGCACTGATGAT	0.522																																					p.A183E													.	ANKS1B	180		0			c.C548A												135.0	131.0	133.0					12																	100200303		2127	4247	6374	SO:0001583	missense	56899	exon4			GGATGTGCACTGA	AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.548C>A	12.37:g.100200303G>T	ENSP00000449629:p.Ala183Glu		Somatic	149	0	0		WXS	Illumina HiSeq	Phase_I	113	0.04	5	NM_152788	0		0	A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Missense_Mutation	SNP	ENST00000547776.2	37	CCDS55872.1	.	.	.	.	.	.	.	.	.	.	G	33	5.205341	0.95033	.	.	ENSG00000185046	ENST00000547776;ENST00000329257;ENST00000549866	T;T;T	0.65178	-0.14;-0.14;-0.14	5.54	5.54	0.83059	Ankyrin repeat-containing domain (4);	0.069111	0.56097	D	0.000027	T	0.69735	0.3144	N	0.25789	0.76	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.80764	0.976;0.994	T	0.67074	-0.5762	9	.	.	.	-11.0102	19.4821	0.95014	0.0:0.0:1.0:0.0	.	183;183	F8VVQ4;Q7Z6G8	.;ANS1B_HUMAN	E	183	ENSP00000449629:A183E;ENSP00000331381:A183E;ENSP00000449894:A183E	.	A	-	2	0	ANKS1B	98724434	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	9.848000	0.99507	2.591000	0.87537	0.557000	0.71058	GCA			0.522	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000408421.3		NM_020140	
UBE3B	89910	hgsc.bcm.edu	37	12	109972569	109972569	+	Silent	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr12:109972569G>T	ENST00000342494.3	+	28	3784	c.3189G>T	c.(3187-3189)acG>acT	p.T1063T	UBE3B_ENST00000434735.2_Silent_p.T1063T	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	1063	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						GCATGAACACGGGCTTTGAAC	0.617																																					p.T1063T													UBE3B,colon,carcinoma,0,1	UBE3B	0	1	0			c.G3189T												99.0	87.0	92.0					12																	109972569		2203	4300	6503	SO:0001819	synonymous_variant	89910	exon28			GAACACGGGCTTT	BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.3189G>T	12.37:g.109972569G>T			Somatic	61	0	0		WXS	Illumina HiSeq	.	65	0.05	3	NM_130466	105	0.00	0	A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Silent	SNP	ENST00000342494.3	37	CCDS9129.1																																																																																					0.617	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000403119.1		NM_183415	
MED13L	23389	mdanderson.org	37	12	116420941	116420941	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr12:116420941A>G	ENST00000281928.3	-	21	5142	c.4936T>C	c.(4936-4938)Tca>Cca	p.S1646P		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	1646						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		CCATCCTGTGAGGGCTGAGAA	0.522																																					p.S1646P													MED13L,NS,carcinoma,0,1	MED13L	0	1	0			c.T4936C												90.0	86.0	87.0					12																	116420941		2203	4300	6503	SO:0001583	missense	23389	exon21			CCTGTGAGGGCTG	AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.4936T>C	12.37:g.116420941A>G	ENSP00000281928:p.Ser1646Pro		Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	57	0.05	3	NM_015335	36	0.00	0	A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	ENST00000281928.3	37	CCDS9177.1	.	.	.	.	.	.	.	.	.	.	A	9.680	1.149112	0.21288	.	.	ENSG00000123066	ENST00000281928	T	0.74002	-0.8	5.93	2.01	0.26516	.	1.436790	0.03877	N	0.276593	T	0.48077	0.1480	N	0.03608	-0.345	0.19300	N	0.999975	B	0.02656	0.0	B	0.01281	0.0	T	0.43327	-0.9398	10	0.24483	T	0.36	.	0.6241	0.00783	0.3645:0.2607:0.1298:0.245	.	1646	Q71F56	MD13L_HUMAN	P	1646	ENSP00000281928:S1646P	ENSP00000281928:S1646P	S	-	1	0	MED13L	114905324	0.925000	0.31364	0.782000	0.31804	0.996000	0.88848	0.909000	0.28558	1.056000	0.40484	0.533000	0.62120	TCA			0.522	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000403879.3			
PXN	5829	mdanderson.org	37	12	120659472	120659472	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr12:120659472G>T	ENST00000228307.7	-	6	926	c.785C>A	c.(784-786)gCc>gAc	p.A262D	PXN_ENST00000536957.1_Missense_Mutation_p.A260D|PXN_ENST00000397506.3_5'Flank|PXN_ENST00000458477.2_Missense_Mutation_p.A129D|PXN_ENST00000267257.7_Missense_Mutation_p.A262D|PXN_ENST00000538144.1_5'UTR|PXN_ENST00000424649.2_Missense_Mutation_p.A262D	NM_001080855.2	NP_001074324.1	P49023	PAXI_HUMAN	paxillin	262					activation of MAPK activity (GO:0000187)|branching morphogenesis of an epithelial tube (GO:0048754)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cellular component movement (GO:0006928)|cellular response to reactive oxygen species (GO:0034614)|cytoskeleton organization (GO:0007010)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|growth hormone receptor signaling pathway (GO:0060396)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|muscle contraction (GO:0006936)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of cell shape (GO:0008360)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	beta-catenin binding (GO:0008013)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CTCCCTGGTGGCAGAGGAGGC	0.642																																					p.A262D													.	.			0			c.C785A												56.0	78.0	70.0					12																	120659472		2172	4264	6436	SO:0001583	missense	5829	exon6			CTGGTGGCAGAGG	U14588	CCDS44996.1, CCDS44997.1, CCDS44998.1, CCDS58281.1	12q24	2006-01-23			ENSG00000089159	ENSG00000089159			9718	protein-coding gene	gene with protein product		602505				7534286	Standard	NM_001080855		Approved		uc001txv.3	P49023	OTTHUMG00000169169	ENST00000228307.7:c.785C>A	12.37:g.120659472G>T	ENSP00000228307:p.Ala262Asp		Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	14	0.14	2	NM_001243756	135	0.00	0	B2RAI3|B7ZMB4|O14970|O14971|O60360|Q5HYA4	Missense_Mutation	SNP	ENST00000228307.7	37	CCDS44997.1	.	.	.	.	.	.	.	.	.	.	G	31	5.091107	0.94149	.	.	ENSG00000089159	ENST00000458477;ENST00000228307;ENST00000424649;ENST00000536957;ENST00000267257;ENST00000541856	T;T;T;T;T	0.68765	0.34;-0.29;0.44;-0.35;0.18	5.59	4.69	0.59074	.	0.056009	0.64402	N	0.000001	T	0.79015	0.4375	L	0.59436	1.845	0.80722	D	1	D;D;D	0.89917	0.982;1.0;0.999	D;D;D	0.78314	0.936;0.991;0.98	T	0.81475	-0.0916	10	0.87932	D	0	-13.8406	15.7338	0.77827	0.0:0.0:0.8624:0.1376	.	262;262;262	P49023-2;P49023-3;P49023	.;.;PAXI_HUMAN	D	129;262;262;260;262;21	ENSP00000395536:A129D;ENSP00000228307:A262D;ENSP00000391283:A262D;ENSP00000443887:A260D;ENSP00000267257:A262D	ENSP00000228307:A262D	A	-	2	0	PXN	119143855	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.137000	0.94496	1.316000	0.45131	0.591000	0.81541	GCC			0.642	PXN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000402679.4		NM_002859	
ANKRD20A19P	400110	broad.mit.edu	37	13	24519964	24519964	+	RNA	SNP	G	G	A			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr13:24519964G>A	ENST00000442969.1	-	0	957									ankyrin repeat domain 20 family, member A19, pseudogene																		GTCCTTGACAGCCGCCCTTGG	0.697																																					.													.	.			0			.												9.0	11.0	11.0					13																	24519964		691	1589	2280			0	.			TTGACAGCCGCCC			13q12.12	2012-10-16			ENSG00000196593	ENSG00000196593			42737	pseudogene	pseudogene							Standard	NR_073430		Approved		uc001upb.2		OTTHUMG00000016572		13.37:g.24519964G>A			Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	.	0		0		RNA	SNP	ENST00000442969.1	37																																																																																						0.697	ANKRD20A19P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000044167.2			
STARD13	90627	mdanderson.org	37	13	33701523	33701523	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr13:33701523G>T	ENST00000336934.5	-	6	2025	c.1909C>A	c.(1909-1911)Cac>Aac	p.H637N	STARD13_ENST00000399365.3_Missense_Mutation_p.H519N|STARD13_ENST00000255486.4_Missense_Mutation_p.H629N	NM_001243476.1|NM_178006.3	NP_001230405.1|NP_821074.1	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain containing 13	637					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	40	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		GTCCAGCCGTGCTTGTTGGAC	0.552																																					p.H637N													.	.			0			c.C1909A												54.0	46.0	48.0					13																	33701523		2203	4300	6503	SO:0001583	missense	90627	exon6			AGCCGTGCTTGTT	AL049801	CCDS9348.1, CCDS9349.1, CCDS9350.1	13q13.1	2013-08-13	2007-08-16		ENSG00000133121	ENSG00000133121		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19164	protein-coding gene	gene with protein product		609866	"""START domain containing 13"", ""long intergenic non-protein coding RNA 464"""	LINC00464		8812419	Standard	NM_178006		Approved	GT650, DLC2, ARHGAP37	uc001uuw.3	Q9Y3M8	OTTHUMG00000016708	ENST00000336934.5:c.1909C>A	13.37:g.33701523G>T	ENSP00000338785:p.His637Asn		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	21	0.10	2	NM_178006	6	0.00	0	A2A309|A2A310|Q5HYH1|Q5TAE3|Q6UN61|Q86TP6|Q86WQ3|Q86XT1	Missense_Mutation	SNP	ENST00000336934.5	37	CCDS9348.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.337368	0.81911	.	.	ENSG00000133121	ENST00000399365;ENST00000255486;ENST00000336934;ENST00000399364	T;T;T	0.06294	3.32;3.32;3.33	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.25717	0.0626	M	0.69823	2.125	0.80722	D	1	D;D;P;P	0.76494	0.999;0.997;0.944;0.928	D;D;P;P	0.72982	0.973;0.979;0.76;0.775	T	0.00234	-1.1893	10	0.46703	T	0.11	.	19.1958	0.93689	0.0:0.0:1.0:0.0	.	629;602;637;629	Q9Y3M8-5;Q9Y3M8-4;Q9Y3M8;Q9Y3M8-2	.;.;STA13_HUMAN;.	N	519;629;637;629	ENSP00000382300:H519N;ENSP00000255486:H629N;ENSP00000338785:H637N	ENSP00000255486:H629N	H	-	1	0	STARD13	32599523	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.756000	0.98918	2.552000	0.86080	0.655000	0.94253	CAC			0.552	STARD13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000276118.2		NM_001243466	
PROZ	8858	mdanderson.org	37	13	113813044	113813044	+	Splice_Site	SNP	G	G	T	rs1885956		TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr13:113813044G>T	ENST00000375547.2	+	1	77	c.70G>T	c.(70-72)Gta>Tta	p.V24L	PROZ_ENST00000342783.4_Splice_Site_p.A24S	NM_003891.2	NP_003882.1	P22891	PROZ_HUMAN	protein Z, vitamin K-dependent plasma glycoprotein	24					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(4)|prostate(2)|skin(2)	16	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.216)	all cancers(43;0.104)		Menadione(DB00170)	GGAGCCCTCAGGTAGGCATCT	0.597																																					p.A24S													.	.			0			c.G70T												124.0	77.0	93.0					13																	113813044		2202	4300	6502	SO:0001630	splice_region_variant	8858	exon1			CCCTCAGGTAGGC	M55670	CCDS9531.1, CCDS58300.1	13q34	2008-07-18			ENSG00000126231	ENSG00000126231			9460	protein-coding gene	gene with protein product		176895				2244898, 2403355	Standard	NM_001256134		Approved	PZ	uc010agr.2	P22891	OTTHUMG00000017376	ENST00000375547.2:c.70+1G>T	13.37:g.113813044G>T			Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	29	0.10	3	NM_001256134	0		0	A6NMB4|Q15213|Q5JVF5|Q5JVF6	Missense_Mutation	SNP	ENST00000375547.2	37	CCDS9531.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.19|12.19	1.863778|1.863778	0.32884|0.32884	.|.	.|.	ENSG00000126231|ENSG00000126231	ENST00000342783|ENST00000375547	D|D	0.95069|0.96554	-3.6|-4.05	2.47|2.47	2.47|2.47	0.30058|0.30058	.|Gamma-carboxyglutamic acid-rich (GLA) domain (1);	.|.	.|.	.|.	.|.	D|D	0.94424|0.94424	0.8206|0.8206	L|L	0.58583|0.58583	1.82|1.82	0.20307|0.20307	N|N	0.999912|0.999912	B|B	0.14438|0.22276	0.01|0.067	B|B	0.10450|0.29716	0.005|0.106	D|D	0.90450|0.90450	0.4438|0.4438	9|9	0.87932|0.87932	D|D	0|0	.|.	8.4365|8.4365	0.32791|0.32791	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	24|24	P22891-2|P22891	.|PROZ_HUMAN	S|L	24|24	ENSP00000344458:A24S|ENSP00000364697:V24L	ENSP00000344458:A24S|ENSP00000364697:V24L	A|V	+|+	1|1	0|0	PROZ|PROZ	112861045|112861045	0.997000|0.997000	0.39634|0.39634	0.265000|0.265000	0.24526|0.24526	0.170000|0.170000	0.22686|0.22686	2.855000|2.855000	0.48333|0.48333	1.358000|1.358000	0.45922|0.45922	0.313000|0.313000	0.20887|0.20887	GCC|GTA			0.597	PROZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000045845.1		NM_003891	Missense_Mutation
CUL4A	8451	bcgsc.ca	37	13	113898807	113898807	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr13:113898807A>T	ENST00000375440.4	+	12	1396	c.1312A>T	c.(1312-1314)Atc>Ttc	p.I438F	CUL4A_ENST00000375441.3_Missense_Mutation_p.I338F|CUL4A_ENST00000326335.4_Missense_Mutation_p.I338F|CUL4A_ENST00000451881.1_Missense_Mutation_p.I338F	NM_001008895.1	NP_001008895.1	Q13619	CUL4A_HUMAN	cullin 4A	438					cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of DNA damage checkpoint (GO:2000001)|regulation of nucleotide-excision repair (GO:2000819)|regulation of protein metabolic process (GO:0051246)|somatic stem cell maintenance (GO:0035019)|viral process (GO:0016032)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)				NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|skin(1)	17	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.112)			CAAGATCATGATCCTGTTCAG	0.478																																					p.I438F													.	CUL4A	50		0			c.A1312T												81.0	65.0	70.0					13																	113898807		2203	4300	6503	SO:0001583	missense	8451	exon12			ATCATGATCCTGT	U58090	CCDS9533.1, CCDS41908.1, CCDS73604.1	13q34	2011-05-24			ENSG00000139842	ENSG00000139842			2554	protein-coding gene	gene with protein product		603137				8681378	Standard	NM_001008895		Approved		uc021rmv.1	Q13619	OTTHUMG00000017384	ENST00000375440.4:c.1312A>T	13.37:g.113898807A>T	ENSP00000364589:p.Ile438Phe		Somatic	213	0	0		WXS	Illumina HiSeq	Phase_1	150	0.00	0	NM_001008895	68	0.00	0	A2A2W2|O75834|Q589T6|Q5TC62|Q6UP08|Q9UP17	Missense_Mutation	SNP	ENST00000375440.4	37	CCDS41908.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.515694	0.85389	.	.	ENSG00000139842	ENST00000375441;ENST00000451881;ENST00000326335;ENST00000375440	T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.8	4.77	4.77	0.60923	Cullin, N-terminal (1);Cullin homology (3);	0.000000	0.85682	D	0.000000	D	0.82843	0.5125	M	0.79805	2.47	0.80722	D	1	P;P	0.44090	0.826;0.826	P;P	0.52646	0.705;0.705	D	0.85704	0.1315	10	0.72032	D	0.01	-36.4424	14.5824	0.68300	1.0:0.0:0.0:0.0	.	438;438	Q13619;A8MSH7	CUL4A_HUMAN;.	F	338;338;338;438	ENSP00000364590:I338F;ENSP00000389118:I338F;ENSP00000322132:I338F;ENSP00000364589:I438F	ENSP00000322132:I338F	I	+	1	0	CUL4A	112946808	1.000000	0.71417	0.995000	0.50966	0.825000	0.46686	9.119000	0.94362	1.918000	0.55548	0.397000	0.26171	ATC			0.478	CUL4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045888.3		NM_003589	
IGHV3-21	28444	bcgsc.ca	37	14	106691797	106691797	+	RNA	SNP	T	T	G	rs538335553	byFrequency	TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr14:106691797T>G	ENST00000390607.2	-	0	305									immunoglobulin heavy variable 3-21																		GTAGTATATGTAACTACTACT	0.517																																					.													.	.			0			.												162.0	155.0	157.0					14																	106691797		1941	4132	6073			28444	.			TATATGTAACTAC	Z14073		14q32.33	2012-02-08			ENSG00000211947	ENSG00000211947		"""Immunoglobulins / IGH locus"""	5586	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000152279		14.37:g.106691797T>G			Somatic	157	0	0		WXS	Illumina HiSeq	Phase_1	195	0.00	0	.	159	0.03	4		RNA	SNP	ENST00000390607.2	37																																																																																						0.517	IGHV3-21-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene		OTTHUMT00000325667.1		NG_001019	
SLC12A6	9990	mdanderson.org	37	15	34547512	34547512	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr15:34547512G>T	ENST00000354181.3	-	8	1319	c.827C>A	c.(826-828)aCc>aAc	p.T276N	SLC12A6_ENST00000560611.1_Missense_Mutation_p.T276N|SLC12A6_ENST00000451844.2_Missense_Mutation_p.T88N|SLC12A6_ENST00000290209.5_Missense_Mutation_p.T225N|SLC12A6_ENST00000397707.2_Missense_Mutation_p.T261N|SLC12A6_ENST00000558589.1_Missense_Mutation_p.T267N|SLC12A6_ENST00000558667.1_Missense_Mutation_p.T276N|SLC12A6_ENST00000458406.2_Missense_Mutation_p.T217N|RP11-1084A12.2_ENST00000559867.1_RNA|SLC12A6_ENST00000560164.1_Missense_Mutation_p.T88N|SLC12A6_ENST00000397702.2_Missense_Mutation_p.T217N			Q9UHW9	S12A6_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 6	276					angiogenesis (GO:0001525)|cellular hypotonic response (GO:0071476)|cellular hypotonic salinity response (GO:0071477)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|rubidium ion transport (GO:0035826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium ion transmembrane transporter activity (GO:0015079)|potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)|rubidium ion transmembrane transporter activity (GO:0035827)			central_nervous_system(5)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|skin(3)	45		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	TGCAAATGTGGTACCAAGATA	0.428																																					p.T276N													.	.			0			c.C827A												98.0	103.0	101.0					15																	34547512		2201	4298	6499	SO:0001583	missense	9990	exon7			AATGTGGTACCAA	AF108831	CCDS10036.1, CCDS42010.1, CCDS42011.1, CCDS42012.1, CCDS58352.1	15q13	2014-09-17	2013-07-18		ENSG00000140199	ENSG00000140199		"""Solute carriers"""	10914	protein-coding gene	gene with protein product		604878	"""agenesis of corpus callosum and peripheral neuropathy (Andermann syndrome)"""	KCC3, ACCPN		10187864, 10347194	Standard	NM_133647		Approved		uc001zhw.3	Q9UHW9	OTTHUMG00000129441	ENST00000354181.3:c.827C>A	15.37:g.34547512G>T	ENSP00000346112:p.Thr276Asn		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_133647	20	0.00	0	A0AV76|Q2VI00|Q7Z2E7|Q7Z4G5|Q8TDD4|Q9UFR2|Q9Y642|Q9Y665	Missense_Mutation	SNP	ENST00000354181.3	37	CCDS58352.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.259212	0.80246	.	.	ENSG00000140199	ENST00000290209;ENST00000397707;ENST00000354181;ENST00000397702;ENST00000458406;ENST00000451844	D;D;D;D;D	0.98701	-5.08;-5.08;-5.08;-5.08;-5.08	5.43	5.43	0.79202	Amino acid permease domain (1);	0.061003	0.64402	N	0.000005	D	0.98163	0.9393	L	0.33753	1.03	0.80722	D	1	B;B;P;D	0.54207	0.281;0.333;0.55;0.965	B;P;B;P	0.61722	0.219;0.449;0.401;0.893	D	0.97832	1.0263	10	0.33940	T	0.23	.	18.1759	0.89761	0.0:0.0:1.0:0.0	.	261;276;225;88	Q9UHW9-3;Q9UHW9;A0AV76;B3KXX3	.;S12A6_HUMAN;.;.	N	225;261;267;217;217;88	ENSP00000290209:T225N;ENSP00000380819:T261N;ENSP00000380814:T217N;ENSP00000387725:T217N;ENSP00000390199:T88N	ENSP00000290209:T225N	T	-	2	0	SLC12A6	32334804	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.657000	0.98554	2.826000	0.97356	0.655000	0.94253	ACC			0.428	SLC12A6-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000417991.1		NM_005135	
ATP8B4	79895	broad.mit.edu	37	15	50223331	50223331	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr15:50223331T>C	ENST00000284509.6	-	16	1768	c.1627A>G	c.(1627-1629)Agg>Ggg	p.R543G	ATP8B4_ENST00000559829.1_Missense_Mutation_p.R543G	NM_024837.2	NP_079113.2	Q8TF62	AT8B4_HUMAN	ATPase, class I, type 8B, member 4	543						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(6)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|urinary_tract(1)	73		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		ACAGACATCCTTTTTCTGGTG	0.353																																					p.R543G													.	ATP8B4	173		0			c.A1627G												153.0	140.0	145.0					15																	50223331		2196	4295	6491	SO:0001583	missense	79895	exon16			ACATCCTTTTTCT	AB075819	CCDS32238.1	15q21.2	2010-04-20	2007-09-19		ENSG00000104043	ENSG00000104043		"""ATPases / P-type"""	13536	protein-coding gene	gene with protein product		609123	"""ATPase, Class I, type 8B, member 4"""			11015572	Standard	NM_024837		Approved	ATPIM, KIAA1939	uc001zxu.3	Q8TF62		ENST00000284509.6:c.1627A>G	15.37:g.50223331T>C	ENSP00000284509:p.Arg543Gly		Somatic	148	0	0		WXS	Illumina HiSeq	Phase_I	165	0.02	3	NM_024837	1	0.00	0	Q9H727	Missense_Mutation	SNP	ENST00000284509.6	37	CCDS32238.1	.	.	.	.	.	.	.	.	.	.	T	17.77	3.471095	0.63625	.	.	ENSG00000104043	ENST00000284509	D	0.83914	-1.78	5.61	1.61	0.23674	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.94188	0.8135	H	0.99104	4.43	0.45704	D	0.998617	D	0.89917	1.0	D	0.97110	1.0	D	0.94707	0.7888	10	0.87932	D	0	.	11.7285	0.51722	0.0:0.0:0.3749:0.6251	.	543	Q8TF62	AT8B4_HUMAN	G	543	ENSP00000284509:R543G	ENSP00000284509:R543G	R	-	1	2	ATP8B4	48010623	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.030000	0.41108	0.924000	0.37069	0.477000	0.44152	AGG			0.353	ATP8B4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000418100.1		NM_024837	
USP8	9101	mdanderson.org	37	15	50733583	50733583	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr15:50733583G>T	ENST00000396444.3	+	3	480	c.142G>T	c.(142-144)Gaa>Taa	p.E48*	USP8_ENST00000307179.4_Nonsense_Mutation_p.E48*|USP8_ENST00000433963.1_Nonsense_Mutation_p.E48*|USP8_ENST00000425032.3_Intron|USP8_ENST00000558892.1_3'UTR	NM_001128610.1|NM_005154.3	NP_001122082.1|NP_005145.3	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	48	MIT.				cell proliferation (GO:0008283)|endosome organization (GO:0007032)|mitotic cytokinesis (GO:0000281)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|Ras protein signal transduction (GO:0007265)|ubiquitin-dependent protein catabolic process (GO:0006511)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|midbody (GO:0030496)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		TAAGACAGCAGAAGAATGCAG	0.323																																					p.E48X													.	.			0			c.G142T												79.0	76.0	77.0					15																	50733583		2196	4294	6490	SO:0001587	stop_gained	9101	exon3			ACAGCAGAAGAAT	D29956	CCDS10137.1, CCDS61632.1	15q21.1	2014-03-03	2005-08-08		ENSG00000138592	ENSG00000138592		"""Ubiquitin-specific peptidases"""	12631	protein-coding gene	gene with protein product		603158	"""ubiquitin specific protease 8"""			12838346, 9582025, 24482476	Standard	NM_005154		Approved	HumORF8, KIAA0055, UBPY, SPG59	uc001zyl.4	P40818	OTTHUMG00000131645	ENST00000396444.3:c.142G>T	15.37:g.50733583G>T	ENSP00000379721:p.Glu48*		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_001128610	57	0.00	0	B4DKA8|Q2TB31|Q7Z3U2|Q86VA0|Q8IWI7	Nonsense_Mutation	SNP	ENST00000396444.3	37	CCDS10137.1	.	.	.	.	.	.	.	.	.	.	G	40	7.968036	0.98585	.	.	ENSG00000138592	ENST00000396444;ENST00000433963;ENST00000307179	.	.	.	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-27.2439	20.1392	0.98050	0.0:0.0:1.0:0.0	.	.	.	.	X	48	.	ENSP00000302239:E48X	E	+	1	0	USP8	48520875	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.282000	0.95840	2.751000	0.94390	0.591000	0.81541	GAA			0.323	USP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254541.1		NM_005154	
HERC1	8925	mdanderson.org	37	15	63958659	63958659	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr15:63958659G>T	ENST00000443617.2	-	41	8306	c.8219C>A	c.(8218-8220)cCa>cAa	p.P2740Q		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	2740					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						TCTACTGCTTGGGTCTGACAA	0.438																																					p.P2740Q													.	.			0			c.C8219A												87.0	83.0	84.0					15																	63958659		1861	4098	5959	SO:0001583	missense	8925	exon41			CTGCTTGGGTCTG	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.8219C>A	15.37:g.63958659G>T	ENSP00000390158:p.Pro2740Gln		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_003922	17	0.00	0	Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	37	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.822036	0.90873	.	.	ENSG00000103657	ENST00000443617	T	0.29142	1.58	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.51924	0.1703	L	0.46157	1.445	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.51576	-0.8688	10	0.87932	D	0	.	19.4859	0.95028	0.0:0.0:1.0:0.0	.	2740	Q15751	HERC1_HUMAN	Q	2740	ENSP00000390158:P2740Q	ENSP00000390158:P2740Q	P	-	2	0	HERC1	61745712	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.567000	0.98161	2.680000	0.91292	0.655000	0.94253	CCA			0.438	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000418523.1		NM_003922	
HCN4	10021	mdanderson.org	37	15	73660063	73660063	+	Silent	SNP	C	C	A			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr15:73660063C>A	ENST00000261917.3	-	1	1542	c.549G>T	c.(547-549)tcG>tcT	p.S183S		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	183					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		CGGTGTCCACCGAGGGCTGCT	0.781																																					p.S183S													.	.			0			c.G549T																																									SO:0001819	synonymous_variant	10021	exon1			GTCCACCGAGGGC	AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.549G>T	15.37:g.73660063C>A			Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	16	0.13	2	NM_005477	4	0.00	0	Q9UMQ7	Silent	SNP	ENST00000261917.3	37	CCDS10248.1																																																																																					0.781	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268900.2		NM_005477	
PKD1	5310	mdanderson.org	37	16	2143982	2143982	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr16:2143982G>T	ENST00000262304.4	-	36	10859	c.10651C>A	c.(10651-10653)Ccg>Acg	p.P3551T	RP11-304L19.3_ENST00000565937.1_RNA|RP11-304L19.1_ENST00000570072.1_RNA|PKD1_ENST00000423118.1_Missense_Mutation_p.P3550T	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	3551					anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CACCAGGCCGGCAGCAGGCGC	0.701																																					p.P3551T													.	.			0			c.C10651A												17.0	23.0	21.0					16																	2143982		2174	4288	6462	SO:0001583	missense	5310	exon36			AGGCCGGCAGCAG	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.10651C>A	16.37:g.2143982G>T	ENSP00000262304:p.Pro3551Thr		Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	16	0.13	2	NM_001009944	27	0.00	0	Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	37	CCDS32369.1	.	.	.	.	.	.	.	.	.	.	G	16.36	3.100358	0.56183	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101	T;T	0.67865	-0.29;-0.29	3.61	3.61	0.41365	.	0.060246	0.64402	D	0.000002	T	0.81389	0.4812	M	0.77103	2.36	0.53005	D	0.999965	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.84953	0.0872	10	0.72032	D	0.01	.	15.8087	0.78538	0.0:0.0:1.0:0.0	.	3550;3551	P98161-3;P98161	.;PKD1_HUMAN	T	3551;3550;2885	ENSP00000262304:P3551T;ENSP00000399501:P3550T	ENSP00000262304:P3551T	P	-	1	0	PKD1	2083983	1.000000	0.71417	0.991000	0.47740	0.196000	0.23810	8.920000	0.92779	2.030000	0.59900	0.511000	0.50034	CCG			0.701	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000341688.1			
GLYR1	84656	mdanderson.org	37	16	4855285	4855285	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr16:4855285G>T	ENST00000321919.9	-	16	1690	c.1614C>A	c.(1612-1614)gaC>gaA	p.D538E	GLYR1_ENST00000591451.1_Missense_Mutation_p.D532E|GLYR1_ENST00000381983.3_Missense_Mutation_p.D521E|GLYR1_ENST00000436648.5_Missense_Mutation_p.D457E|ROGDI_ENST00000322048.7_5'Flank	NM_032569.3	NP_115958	Q49A26	GLYR1_HUMAN	glyoxylate reductase 1 homolog (Arabidopsis)	538					pentose-phosphate shunt (GO:0006098)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|NAD binding (GO:0051287)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	19						TGTCAGACTGGTCCAGCGCCT	0.567																																					p.D538E													.	.			0			c.C1614A												112.0	94.0	100.0					16																	4855285		2197	4300	6497	SO:0001583	missense	84656	exon16			AGACTGGTCCAGC	AF244907	CCDS10524.1	16p13.3	2010-02-17			ENSG00000140632	ENSG00000140632			24434	protein-coding gene	gene with protein product	"""nuclear protein 60kDa"""	610660				16352664	Standard	NM_032569		Approved	BM045, HIBDL, NP60, N-PAC	uc002cxx.4	Q49A26	OTTHUMG00000129530	ENST00000321919.9:c.1614C>A	16.37:g.4855285G>T	ENSP00000322716:p.Asp538Glu		Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_032569	105	0.00	0	B4DL47|C9JJ40|C9JJ60|Q5U632|Q6P1Q2|Q6V3W7|Q9BTI1|Q9BXK2	Missense_Mutation	SNP	ENST00000321919.9	37	CCDS10524.1	.	.	.	.	.	.	.	.	.	.	G	15.87	2.959444	0.53400	.	.	ENSG00000140632	ENST00000321919;ENST00000381983;ENST00000436648	T;T;T	0.29655	1.56;1.56;1.56	4.87	4.87	0.63330	Dehydrogenase, multihelical (1);6-phosphogluconate dehydrogenase, C-terminal-like (1);	0.000000	0.85682	D	0.000000	T	0.26919	0.0659	L	0.29908	0.895	0.58432	D	0.999998	B;B;B;B	0.28178	0.007;0.007;0.007;0.202	B;B;B;B	0.28709	0.011;0.016;0.027;0.093	T	0.10567	-1.0624	10	0.72032	D	0.01	-18.1943	16.7915	0.85590	0.0:0.0:1.0:0.0	.	457;532;521;538	Q49A26-5;Q49A26-3;Q49A26-2;Q49A26	.;.;.;GLYR1_HUMAN	E	538;521;457	ENSP00000322716:D538E;ENSP00000371413:D521E;ENSP00000390276:D457E	ENSP00000322716:D538E	D	-	3	2	GLYR1	4795286	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.563000	0.73964	2.230000	0.72887	0.655000	0.94253	GAC			0.567	GLYR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000251717.2		NM_032569	
GPRC5B	51704	mdanderson.org	37	16	19871856	19871856	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr16:19871856G>T	ENST00000300571.2	-	4	1369	c.1178C>A	c.(1177-1179)gCt>gAt	p.A393D	GPRC5B_ENST00000535671.1_Intron|GPRC5B_ENST00000569102.1_5'Flank|GPRC5B_ENST00000537135.1_Missense_Mutation_p.A419D|GPRC5B_ENST00000569479.1_Missense_Mutation_p.A393D|GPRC5B_ENST00000569847.1_Missense_Mutation_p.A393D	NM_016235.1	NP_057319.1	Q9NZH0	GPC5B_HUMAN	G protein-coupled receptor, class C, group 5, member B	393					glucose homeostasis (GO:0042593)|locomotory behavior (GO:0007626)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein tyrosine kinase activity (GO:0061098)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						ACTTGGCGGAGCAGTTGGGAT	0.438																																					p.A393D													.	.			0			c.C1178A												108.0	97.0	101.0					16																	19871856		2197	4300	6497	SO:0001583	missense	51704	exon4			GGCGGAGCAGTTG	AF202640	CCDS10581.1	16p12	2014-01-30	2014-01-30		ENSG00000167191	ENSG00000167191		"""GPCR / Class C : Orphans"""	13308	protein-coding gene	gene with protein product		605948	"""G protein-coupled receptor, family C, group 1, member B"", ""G protein-coupled receptor, family C, group 5, member B"""			10493829, 10783259	Standard	XM_005255357		Approved	RAIG-2	uc002dgt.3	Q9NZH0	OTTHUMG00000131460	ENST00000300571.2:c.1178C>A	16.37:g.19871856G>T	ENSP00000300571:p.Ala393Asp		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	53	0.06	3	NM_016235	140	0.00	0	D2DFB0|O75205|Q8NBZ8	Missense_Mutation	SNP	ENST00000300571.2	37	CCDS10581.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.422769	0.83559	.	.	ENSG00000167191	ENST00000300571;ENST00000538074;ENST00000537135	T;T	0.33654	1.44;1.4	5.34	5.34	0.76211	.	0.063132	0.64402	D	0.000008	T	0.54549	0.1865	L	0.46157	1.445	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	T	0.46679	-0.9174	9	.	.	.	.	18.3923	0.90487	0.0:0.0:1.0:0.0	.	419;393	B7Z831;Q9NZH0	.;GPC5B_HUMAN	D	393;242;419	ENSP00000300571:A393D;ENSP00000441775:A419D	.	A	-	2	0	GPRC5B	19779357	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.094000	0.76944	2.637000	0.89404	0.563000	0.77884	GCT			0.438	GPRC5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254285.1			
SMPD3	55512	mdanderson.org	37	16	68405129	68405129	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr16:68405129G>T	ENST00000219334.5	-	3	1559	c.956C>A	c.(955-957)gCc>gAc	p.A319D	SMPD3_ENST00000568373.1_Missense_Mutation_p.A319D|SMPD3_ENST00000563226.1_Missense_Mutation_p.A319D|SMPD3_ENST00000566009.1_5'Flank	NM_018667.3	NP_061137.1	Q9NY59	NSMA2_HUMAN	sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II)	319					cell cycle (GO:0007049)|glycosphingolipid metabolic process (GO:0006687)|hematopoietic progenitor cell differentiation (GO:0002244)|peptide hormone secretion (GO:0030072)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	Golgi cis cisterna (GO:0000137)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	Phosphatidylserine(DB00144)	CTTGCTGTTGGCACCTGGCTC	0.692																																					p.A319D													.	.			0			c.C956A												34.0	37.0	36.0					16																	68405129		2198	4300	6498	SO:0001583	missense	55512	exon3			CTGTTGGCACCTG	AJ250460	CCDS10867.1	16q22.1	2008-02-05			ENSG00000103056	ENSG00000103056			14240	protein-coding gene	gene with protein product		605777				10823942	Standard	NM_018667		Approved	NSMASE2	uc002ewa.3	Q9NY59	OTTHUMG00000137559	ENST00000219334.5:c.956C>A	16.37:g.68405129G>T	ENSP00000219334:p.Ala319Asp		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_018667	1	0.00	0	B7ZL82|Q2M1S8	Missense_Mutation	SNP	ENST00000219334.5	37	CCDS10867.1	.	.	.	.	.	.	.	.	.	.	G	1.005	-0.689664	0.03328	.	.	ENSG00000103056	ENST00000219334	.	.	.	5.2	2.15	0.27550	.	0.680582	0.15514	N	0.258405	T	0.16981	0.0408	N	0.14661	0.345	0.09310	N	0.999999	B;B;B	0.19583	0.037;0.037;0.037	B;B;B	0.14023	0.01;0.01;0.01	T	0.29305	-1.0016	9	0.12430	T	0.62	-0.7815	5.8797	0.18848	0.1656:0.2983:0.5361:0.0	.	319;319;319	B7ZL82;B7ZL84;Q9NY59	.;.;NSMA2_HUMAN	D	319	.	ENSP00000219334:A319D	A	-	2	0	SMPD3	66962630	0.995000	0.38212	0.088000	0.20740	0.464000	0.32679	2.800000	0.47900	0.194000	0.20326	-0.379000	0.06801	GCC			0.692	SMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268895.3		NM_018667	
ZC3H18	124245	broad.mit.edu	37	16	88664670	88664670	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr16:88664670A>C	ENST00000301011.5	+	4	973	c.773A>C	c.(772-774)gAc>gCc	p.D258A	ZC3H18_ENST00000452588.2_Missense_Mutation_p.D282A	NM_144604.3	NP_653205.3	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	258						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(9)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	42				BRCA - Breast invasive adenocarcinoma(80;0.0542)		ACCAAAGCCGACCCCTTCCCG	0.532																																					p.D258A	Ovarian(121;375 2276 20373 38669)												ZC3H18,NS,carcinoma,+1,1	ZC3H18	90	1	0			c.A773C												75.0	76.0	75.0					16																	88664670		2198	4300	6498	SO:0001583	missense	124245	exon4			AAGCCGACCCCTT	BC001584	CCDS10967.1, CCDS73924.1	16q24.2-q24.3	2012-07-05			ENSG00000158545	ENSG00000158545		"""Zinc fingers, CCCH-type domain containing"""	25091	protein-coding gene	gene with protein product						17579712	Standard	NM_144604		Approved	NHN1	uc002fky.3	Q86VM9	OTTHUMG00000137679	ENST00000301011.5:c.773A>C	16.37:g.88664670A>C	ENSP00000301011:p.Asp258Ala		Somatic	54	0.1666666667	9		WXS	Illumina HiSeq	Phase_I	45	0.31	14	NM_144604	84	0.07	6	Q96DG4|Q96MP7	Missense_Mutation	SNP	ENST00000301011.5	37	CCDS10967.1	.	.	.	.	.	.	.	.	.	.	A	19.55	3.848755	0.71603	.	.	ENSG00000158545	ENST00000301011;ENST00000289509;ENST00000452588;ENST00000545404	T;T	0.31510	1.52;1.49	5.39	5.39	0.77823	.	0.259903	0.42964	D	0.000626	T	0.27697	0.0681	L	0.34521	1.04	0.47245	D	0.99936	B;B;B	0.33694	0.421;0.167;0.421	B;B;B	0.37601	0.254;0.169;0.254	T	0.05550	-1.0878	10	0.35671	T	0.21	-7.2366	13.9823	0.64313	1.0:0.0:0.0:0.0	.	282;282;258	E7ERS3;B4DTK7;Q86VM9	.;.;ZCH18_HUMAN	A	258;282;282;141	ENSP00000301011:D258A;ENSP00000416951:D282A	ENSP00000289509:D282A	D	+	2	0	ZC3H18	87192171	1.000000	0.71417	0.913000	0.36048	0.980000	0.70556	8.709000	0.91379	2.037000	0.60232	0.379000	0.24179	GAC			0.532	ZC3H18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000269168.1		NM_144604	
C1QBP	708	hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	17	5336638	5336638	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr17:5336638G>A	ENST00000225698.4	-	5	755	c.674C>T	c.(673-675)aCa>aTa	p.T225I	CTC-524C5.2_ENST00000575890.1_RNA|C1QBP_ENST00000574444.1_Missense_Mutation_p.T121I	NM_001212.3	NP_001203.1	Q07021	C1QBP_HUMAN	complement component 1, q subcomponent binding protein	225					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)|mature ribosome assembly (GO:0042256)|mRNA processing (GO:0006397)|negative regulation of defense response to virus (GO:0050687)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of MDA-5 signaling pathway (GO:0039534)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of mitochondrial translation (GO:0070131)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of trophoblast cell migration (GO:1901165)|regulation of complement activation (GO:0030449)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adrenergic receptor binding (GO:0031690)|complement component C1q binding (GO:0001849)|hyaluronic acid binding (GO:0005540)|kininogen binding (GO:0030984)|mitochondrial ribosome binding (GO:0097177)|mRNA binding (GO:0003729)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			lung(2)|ovary(1)	3					Hyaluronan(DB08818)	TGTGTTGAGTGTATAATTAGT	0.478																																					p.T225I													.	.			0			c.C674T												98.0	95.0	96.0					17																	5336638		2203	4300	6503	SO:0001583	missense	708	exon5			TTGAGTGTATAAT	X75913	CCDS11071.1	17p13.3	2009-05-07				ENSG00000108561			1243	protein-coding gene	gene with protein product	"""C1q globular domain-binding protein"", ""hyaluronan-binding protein 1"", ""splicing factor SF2-associated protein"""	601269		HABP1		8567680, 8195709	Standard	NM_001212		Approved	gC1Q-R, gC1qR, p32, SF2p32	uc002gby.1	Q07021		ENST00000225698.4:c.674C>T	17.37:g.5336638G>A	ENSP00000225698:p.Thr225Ile		Somatic	136	0	0		WXS	Illumina HiSeq	.	130	0.08	11	NM_001212	1771	0.19	328	Q2HXR8|Q9NNY8	Missense_Mutation	SNP	ENST00000225698.4	37	CCDS11071.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.466255	0.84425	.	.	ENSG00000108561	ENST00000225698	.	.	.	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.69124	0.3076	M	0.72118	2.19	0.80722	D	1	P	0.41978	0.767	P	0.46144	0.505	T	0.71027	-0.4711	9	0.46703	T	0.11	-9.1601	17.2517	0.87044	0.0:0.0:1.0:0.0	.	225	Q07021	C1QBP_HUMAN	I	225	.	ENSP00000225698:T225I	T	-	2	0	C1QBP	5277362	1.000000	0.71417	0.971000	0.41717	0.933000	0.57130	7.545000	0.82128	2.655000	0.90218	0.655000	0.94253	ACA			0.478	C1QBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000439388.1		NM_001212	
ANKRD13B	124930	mdanderson.org	37	17	27936112	27936112	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr17:27936112G>T	ENST00000394859.3	+	6	728	c.574G>T	c.(574-576)Gcc>Tcc	p.A192S	RP11-68I3.2_ENST00000581474.1_RNA	NM_152345.4	NP_689558.4	Q86YJ7	AN13B_HUMAN	ankyrin repeat domain 13B	192						endosome (GO:0005768)|plasma membrane (GO:0005886)				cervix(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	16						AGACACAAGCGCCGTGGTCAT	0.672																																					p.A192S													.	.			0			c.G574T												34.0	40.0	38.0					17																	27936112		2203	4300	6503	SO:0001583	missense	124930	exon6			ACAAGCGCCGTGG	AK092673	CCDS11251.1	17q11.2	2013-01-10			ENSG00000198720	ENSG00000198720		"""Ankyrin repeat domain containing"""	26363	protein-coding gene	gene with protein product		615124					Standard	NM_152345		Approved	FLJ25555	uc002hei.3	Q86YJ7	OTTHUMG00000132731	ENST00000394859.3:c.574G>T	17.37:g.27936112G>T	ENSP00000378328:p.Ala192Ser		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_152345	0		0	Q8N7S9	Missense_Mutation	SNP	ENST00000394859.3	37	CCDS11251.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.976671	0.74360	.	.	ENSG00000198720	ENST00000394859	T	0.45276	0.9	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.69160	0.3080	M	0.82433	2.59	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.69316	-0.5177	10	0.46703	T	0.11	-14.2015	19.6515	0.95815	0.0:0.0:1.0:0.0	.	192	Q86YJ7	AN13B_HUMAN	S	192	ENSP00000378328:A192S	ENSP00000378328:A192S	A	+	1	0	ANKRD13B	24960238	1.000000	0.71417	0.736000	0.30914	0.057000	0.15508	9.753000	0.98904	2.739000	0.93911	0.655000	0.94253	GCC			0.672	ANKRD13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256077.1		NM_152345	
RHOT1	55288	broad.mit.edu;ucsc.edu;mdanderson.org	37	17	30536465	30536465	+	Intron	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr17:30536465G>T	ENST00000333942.6	+	18	1978				RHOT1_ENST00000583994.1_Splice_Site|RHOT1_ENST00000354266.3_Intron|RHOT1_ENST00000545287.2_Intron|RHOT1_ENST00000358365.3_Splice_Site|RHOT1_ENST00000581094.1_3'UTR|RHOT1_ENST00000394692.2_Splice_Site	NM_018307.3	NP_060777.3	Q8IXI2	MIRO1_HUMAN	ras homolog family member T1						cellular homeostasis (GO:0019725)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrion transport along microtubule (GO:0047497)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				AAACTGCTTTGTAAGTTACTT	0.343																																					.													.	RHOT1	69		0			c.1835+1G>T												66.0	67.0	67.0					17																	30536465		2203	4300	6503	SO:0001627	intron_variant	55288	exon19			TGCTTTGTAAGTT	AJ517412	CCDS32610.1, CCDS32611.1, CCDS32612.1, CCDS74030.1, CCDS74031.1	17q11.2-q12	2013-01-10	2012-02-27	2004-03-24		ENSG00000126858		"""EF-hand domain containing"""	21168	protein-coding gene	gene with protein product	"""mitochondrial Rho (MIRO) GTPase 1"""	613888	"""ras homolog gene family, member T1"""	ARHT1		12482879	Standard	NM_001033567		Approved	MIRO-1, FLJ11040	uc002hgw.3	Q8IXI2		ENST00000333942.6:c.1739+1137G>T	17.37:g.30536465G>T			Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	34	0.12	4	NM_001033568	0		0	A4FVB6|A6NFV0|B4DG48|J9JIH9|Q6NUR3|Q6P9F8|Q6PJG1|Q6YMW8|Q86UB0|Q8IW28|Q8IXJ7|Q9H067|Q9H9N8|Q9NUZ2	Splice_Site	SNP	ENST00000333942.6	37	CCDS32612.1	.	.	.	.	.	.	.	.	.	.	G	13.42	2.230557	0.39399	.	.	ENSG00000126858	ENST00000358365;ENST00000394692	.	.	.	5.95	4.93	0.64822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.6344	0.51196	0.0:0.0:0.8231:0.1769	.	.	.	.	.	-1	.	.	.	+	.	.	RHOT1	27560578	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.918000	0.48829	2.824000	0.97209	0.655000	0.94253	.			0.343	RHOT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000447097.1		NM_018307	
ERBB2	2064	broad.mit.edu	37	17	37884152	37884152	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr17:37884152A>C	ENST00000269571.5	+	27	3782	c.3623A>C	c.(3622-3624)cAc>cCc	p.H1208P	MIR4728_ENST00000580969.1_RNA|ERBB2_ENST00000584450.1_3'UTR|ERBB2_ENST00000540147.1_Missense_Mutation_p.H1178P|ERBB2_ENST00000541774.1_Missense_Mutation_p.H1193P|ERBB2_ENST00000445658.2_Missense_Mutation_p.H932P|MIEN1_ENST00000474210.1_5'Flank|ERBB2_ENST00000584601.1_Missense_Mutation_p.H1178P|ERBB2_ENST00000406381.2_Missense_Mutation_p.H1178P			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	1208					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	CCTCAGCCCCACCCTCCTCCT	0.622		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																											p.H1208P				Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	.	ERBB2	429		0			c.A3623C												50.0	57.0	55.0					17																	37884152		2203	4300	6503	SO:0001583	missense	2064	exon27			AGCCCCACCCTCC	X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.3623A>C	17.37:g.37884152A>C	ENSP00000269571:p.His1208Pro		Somatic	101	0.0594059406	6		WXS	Illumina HiSeq	Phase_I	123	0.08	10	NM_004448	71	0.03	2	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	SNP	ENST00000269571.5	37	CCDS32642.1	.	.	.	.	.	.	.	.	.	.	A	9.831	1.188352	0.21954	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000445658;ENST00000269571;ENST00000540147	T;T;T;T;T	0.75260	-0.92;-0.92;-0.89;-0.92;-0.92	4.96	2.58	0.30949	.	.	.	.	.	T	0.55593	0.1930	L	0.29908	0.895	0.50813	D	0.999891	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.55276	-0.8166	9	0.35671	T	0.21	.	2.5122	0.04659	0.5889:0.1824:0.0913:0.1374	.	932;1193;1208	B4DTR1;P04626-4;P04626	.;.;ERBB2_HUMAN	P	1178;1193;932;1208;1178	ENSP00000385185:H1178P;ENSP00000446466:H1193P;ENSP00000404047:H932P;ENSP00000269571:H1208P;ENSP00000443562:H1178P	ENSP00000269571:H1208P	H	+	2	0	ERBB2	35137678	0.000000	0.05858	0.994000	0.49952	0.415000	0.31203	0.400000	0.20932	1.855000	0.53841	0.460000	0.39030	CAC			0.622	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000445621.2			
LUC7L3	51747	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	48821082	48821082	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr17:48821082T>A	ENST00000505658.1	+	6	631	c.442T>A	c.(442-444)Tct>Act	p.S148T	LUC7L3_ENST00000393227.2_Missense_Mutation_p.S148T|LUC7L3_ENST00000240304.1_Missense_Mutation_p.S148T|LUC7L3_ENST00000544170.1_Missense_Mutation_p.S72T			O95232	LC7L3_HUMAN	LUC7-like 3 (S. cerevisiae)	148					mRNA splice site selection (GO:0006376)|RNA splicing (GO:0008380)	focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|U1 snRNP (GO:0005685)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	12						AGAATTAGGGTCTGAAGGAAA	0.388																																					p.S148T													.	.			0			c.T442A												74.0	75.0	75.0					17																	48821082		2203	4300	6503	SO:0001583	missense	51747	exon6			TTAGGGTCTGAAG		CCDS11573.1	17q21.33	2010-02-17			ENSG00000108848	ENSG00000108848			24309	protein-coding gene	gene with protein product	"""cisplatin resistance associated overexpressed protein"", ""CRE-associated protein"""	609434				10631324, 12565863	Standard	NM_016424		Approved	LUC7A, CROP, OA48-18, CREAP-1, FLJ11063, CRA, hLuc7A	uc002iss.3	O95232	OTTHUMG00000162257	ENST00000505658.1:c.442T>A	17.37:g.48821082T>A	ENSP00000425092:p.Ser148Thr		Somatic	139	0	0		WXS	Illumina HiSeq	.	135	0.18	24	NM_006107	463	0.23	107	B3KN54|D3DTY1|Q6PHR9|Q9NUY0|Q9P2S7	Missense_Mutation	SNP	ENST00000505658.1	37	CCDS11573.1	.	.	.	.	.	.	.	.	.	.	T	11.87	1.768843	0.31320	.	.	ENSG00000108848	ENST00000505658;ENST00000393227;ENST00000240304;ENST00000542316;ENST00000544170	T;T;T;T	0.43688	1.24;1.24;1.24;0.94	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.34279	0.0892	L	0.27053	0.805	0.80722	D	1	B;B;B	0.25904	0.137;0.0;0.0	B;B;B	0.37304	0.246;0.001;0.002	T	0.16394	-1.0404	10	0.17369	T	0.5	-7.0678	11.6095	0.51052	0.1332:0.0:0.0:0.8668	.	72;148;148	B4DJ96;O95232;A8K3C5	.;LC7L3_HUMAN;.	T	148;148;148;148;72	ENSP00000425092:S148T;ENSP00000376919:S148T;ENSP00000240304:S148T;ENSP00000444253:S72T	ENSP00000240304:S148T	S	+	1	0	LUC7L3	46176081	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	6.162000	0.71874	2.201000	0.70794	0.460000	0.39030	TCT			0.388	LUC7L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000368205.2		NM_016424	
GGA3	23163	mdanderson.org	37	17	73236094	73236094	+	Silent	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr17:73236094G>T	ENST00000245541.6	-	13	1575	c.1359C>A	c.(1357-1359)tcC>tcA	p.S453S	GGA3_ENST00000578348.1_Silent_p.S331S|GGA3_ENST00000538886.1_Silent_p.S331S|GGA3_ENST00000582717.1_Silent_p.S381S|GGA3_ENST00000582486.1_Silent_p.S381S|GGA3_ENST00000351904.7_Silent_p.S420S	NM_138619.2	NP_619525.1	Q9NZ52	GGA3_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 3	453	Poly-Ser.|Unstructured hinge.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|endosome (GO:0005768)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			breast(2)|endometrium(3)|large_intestine(4)|liver(1)|lung(4)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	20			all cancers(21;2.39e-06)|Epithelial(20;2.38e-05)			AGCTGCTTGAGGAGGGGGCTG	0.657																																					p.S453S													.	.			0			c.C1359A												17.0	20.0	19.0					17																	73236094		2138	4184	6322	SO:0001819	synonymous_variant	23163	exon13			GCTTGAGGAGGGG	AF190864	CCDS11716.1, CCDS11717.1, CCDS54164.1, CCDS58597.1	17q25	2010-02-12	2010-02-12			ENSG00000125447			17079	protein-coding gene	gene with protein product		606006				10747089, 10749927	Standard	NR_033345		Approved	KIAA0154	uc002jni.2	Q9NZ52		ENST00000245541.6:c.1359C>A	17.37:g.73236094G>T			Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_138619	112	0.00	0	B7Z7E2|B7Z7M9|J3KRN0|Q15017|Q6IS16|Q9UJY3	Silent	SNP	ENST00000245541.6	37	CCDS11717.1																																																																																					0.657	GGA3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000446645.1		NM_138619	
DOHH	83475	mdanderson.org	37	19	3496779	3496779	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr19:3496779G>T	ENST00000427575.1	-	2	485	c.34C>A	c.(34-36)Cag>Aag	p.Q12K	DOHH_ENST00000250937.3_Missense_Mutation_p.Q12K	NM_001145165.1	NP_001138637.1			deoxyhypusine hydroxylase/monooxygenase											central_nervous_system(1)|large_intestine(1)|lung(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCAGCGTCTGCCCGATGGCA	0.672																																					p.Q12K													DOHH,NS,carcinoma,+2,1	DOHH	2	1	0			c.C34A												34.0	37.0	36.0					19																	3496779		2203	4300	6503	SO:0001583	missense	83475	exon2			GCGTCTGCCCGAT	BC002817	CCDS12108.1	19p13.3	2008-02-05	2006-05-22	2006-05-22		ENSG00000129932			28662	protein-coding gene	gene with protein product		611262	"""HEAT-like (PBS lyase) repeat containing 1"""	HLRC1		16371467, 16533814	Standard	NM_031304		Approved	MGC4293	uc002lxs.3	Q9BU89		ENST00000427575.1:c.34C>A	19.37:g.3496779G>T	ENSP00000398882:p.Gln12Lys		Somatic	18	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_001145165	95	0.00	0		Missense_Mutation	SNP	ENST00000427575.1	37	CCDS12108.1	.	.	.	.	.	.	.	.	.	.	G	0.179	-1.064124	0.01934	.	.	ENSG00000129932	ENST00000427575;ENST00000250937	.	.	.	4.28	3.21	0.36854	Armadillo-like helical (1);	0.730757	0.12829	N	0.435760	T	0.11750	0.0286	N	0.01405	-0.89	0.19300	N	0.999974	B	0.02656	0.0	B	0.01281	0.0	T	0.22347	-1.0219	9	0.02654	T	1	-6.9083	10.7584	0.46251	0.0:0.0:0.801:0.199	.	12	Q9BU89	DOHH_HUMAN	K	12	.	ENSP00000250937:Q12K	Q	-	1	0	DOHH	3447779	0.972000	0.33761	0.039000	0.18376	0.518000	0.34316	2.224000	0.42945	0.730000	0.32425	0.561000	0.74099	CAG			0.672	DOHH-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452932.1		NM_031304	
SAFB	6294	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	5667118	5667118	+	Missense_Mutation	SNP	G	G	T	rs201604799		TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr19:5667118G>T	ENST00000292123.5	+	18	2503	c.2396G>T	c.(2395-2397)gGg>gTg	p.G799V	SAFB_ENST00000592224.1_Missense_Mutation_p.G798V|SAFB_ENST00000538656.1_Missense_Mutation_p.G641V|SAFB_ENST00000588852.1_Missense_Mutation_p.G799V|SAFB_ENST00000454510.1_Missense_Mutation_p.G730V|SAFB_ENST00000433404.1_Missense_Mutation_p.G629V	NM_001201338.1|NM_001201339.1|NM_002967.3	NP_001188267.1|NP_001188268.1|NP_002958.2	Q15424	SAFB1_HUMAN	scaffold attachment factor B	799	Arg-rich.|Gly-rich.|Interaction with SAFB2.				chromatin organization (GO:0006325)|growth (GO:0040007)|hormone metabolic process (GO:0042445)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(6)|ovary(2)|skin(1)	23				UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)		GATGGCTGGGGGGGCTATGGC	0.652																																					p.G799V	Colon(88;338 1345 6184 8214 20897)												.	.			0			c.G2396T												32.0	37.0	35.0					19																	5667118		2200	4288	6488	SO:0001583	missense	6294	exon18			GCTGGGGGGGCTA	L43631	CCDS12142.1, CCDS56077.1, CCDS59339.1, CCDS59340.1	19p13.3-p13.2	2013-02-12				ENSG00000160633		"""RNA binding motif (RRM) containing"""	10520	protein-coding gene	gene with protein product	"""Hsp27 ERE-TATA binding protein"""	602895				9605873, 8600450	Standard	NM_002967		Approved	HET, SAFB1	uc002mcg.3	Q15424		ENST00000292123.5:c.2396G>T	19.37:g.5667118G>T	ENSP00000292123:p.Gly799Val		Somatic	124	0	0		WXS	Illumina HiSeq	.	126	0.20	25	NM_002967	434	0.31	134	A0AV56|B7Z5B6|B7ZLP6|F5H0H3|O60406|Q59HH8	Missense_Mutation	SNP	ENST00000292123.5	37	CCDS12142.1	.	.	.	.	.	.	.	.	.	.	G	16.41	3.114538	0.56505	.	.	ENSG00000160633	ENST00000454510;ENST00000540206;ENST00000433404;ENST00000292123;ENST00000538656	T;T;T;T	0.11169	2.81;2.97;2.82;2.8	3.89	3.89	0.44902	.	0.114998	0.39687	N	0.001295	T	0.23806	0.0576	M	0.67397	2.05	0.54753	D	0.999986	D;D;D;D;D;D;D	0.57257	0.964;0.964;0.979;0.964;0.964;0.964;0.964	P;P;P;P;P;P;P	0.54270	0.562;0.562;0.747;0.562;0.562;0.562;0.562	T	0.03240	-1.1057	10	0.72032	D	0.01	-21.7955	14.4178	0.67163	0.0:0.0:1.0:0.0	.	598;641;730;798;799;799;798	B7Z1C7;B7Z2F6;F5H0H3;B7ZLP5;A0AV56;Q15424;B7ZLP6	.;.;.;.;.;SAFB1_HUMAN;.	V	730;694;629;799;641	ENSP00000415895:G730V;ENSP00000404545:G629V;ENSP00000292123:G799V;ENSP00000438880:G641V	ENSP00000292123:G799V	G	+	2	0	SAFB	5618118	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.797000	0.62503	1.883000	0.54544	0.555000	0.69702	GGG			0.652	SAFB-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000451641.2			
SLC25A23	79085	mdanderson.org	37	19	6442129	6442129	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr19:6442129G>T	ENST00000301454.4	-	10	1370	c.1264C>A	c.(1264-1266)Cta>Ata	p.L422I	SLC25A23_ENST00000601760.1_Intron|SLC25A23_ENST00000414491.2_Missense_Mutation_p.L183I	NM_024103.2	NP_077008.2	Q9BV35	SCMC3_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23	422					adenine nucleotide transport (GO:0051503)|cellular response to calcium ion (GO:0071277)|regulation of cellular respiration (GO:0043457)|regulation of oxidative phosphorylation (GO:0002082)|regulation of sequestering of calcium ion (GO:0051282)|transmembrane transport (GO:0055085)|urea homeostasis (GO:0097274)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|pancreas(1)|skin(1)	17						ATGTGACGTAGCAGACCCAGC	0.637																																					p.L422I													.	.			0			c.C1264A												24.0	21.0	22.0					19																	6442129		2203	4300	6503	SO:0001583	missense	79085	exon10			GACGTAGCAGACC	AJ619962	CCDS32882.1	19p13.1	2014-02-06			ENSG00000125648	ENSG00000125648		"""Solute carriers"", ""EF-hand domain containing"""	19375	protein-coding gene	gene with protein product		608746				15123600	Standard	NM_024103		Approved	FLJ30339, MGC2615, APC2	uc002mex.1	Q9BV35	OTTHUMG00000180852	ENST00000301454.4:c.1264C>A	19.37:g.6442129G>T	ENSP00000301454:p.Leu422Ile		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_024103	48	0.00	0	B4DGB6|Q4LBC2|Q705K3|Q86Y43|Q8N2N4|Q96NQ4	Missense_Mutation	SNP	ENST00000301454.4	37	CCDS32882.1	.	.	.	.	.	.	.	.	.	.	G	12.92	2.081780	0.36758	.	.	ENSG00000125648	ENST00000301454;ENST00000414491	T;T	0.79033	-1.23;-1.23	5.0	1.34	0.21922	Mitochondrial carrier domain (2);	.	.	.	.	T	0.60534	0.2276	N	0.20766	0.605	0.80722	D	1	B;B	0.22003	0.063;0.011	B;B	0.27887	0.084;0.021	T	0.50939	-0.8768	9	0.39692	T	0.17	.	5.6539	0.17633	0.5488:0.0:0.4512:0.0	.	183;422	E7ESZ5;Q9BV35	.;SCMC3_HUMAN	I	422;183	ENSP00000301454:L422I;ENSP00000408814:L183I	ENSP00000301454:L422I	L	-	1	2	SLC25A23	6393129	1.000000	0.71417	0.166000	0.22797	0.985000	0.73830	2.656000	0.46716	0.501000	0.28013	0.448000	0.29417	CTA			0.637	SLC25A23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000453325.1		NM_024103	
CAMSAP3	57662	mdanderson.org	37	19	7677030	7677030	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr19:7677030G>T	ENST00000160298.4	+	11	1752	c.1651G>T	c.(1651-1653)Gtg>Ttg	p.V551L	CAMSAP3_ENST00000446248.2_Missense_Mutation_p.V578L	NM_020902.1	NP_065953.1	Q9P1Y5	CAMP3_HUMAN	calmodulin regulated spectrin-associated protein family, member 3	551					epithelial cell-cell adhesion (GO:0090136)|microtubule anchoring (GO:0034453)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of organelle organization (GO:0033043)|zonula adherens maintenance (GO:0045218)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)|zonula adherens (GO:0005915)	microtubule minus-end binding (GO:0051011)			cervix(1)|endometrium(7)|kidney(3)|lung(6)|urinary_tract(2)	19						CCCGAAGGCGGTGGCTTCGTC	0.632																																					p.V578L													.	.			0			c.G1732T												22.0	26.0	25.0					19																	7677030		1938	4119	6057	SO:0001583	missense	57662	exon13			AAGGCGGTGGCTT	AB040976	CCDS42489.1, CCDS45947.1	19p13.3-p13.2	2014-06-12	2011-08-18	2011-08-18		ENSG00000076826			29307	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 80"""	612685	"""KIAA1543"""	KIAA1543		11318610, 10819331, 19041755, 19508979	Standard	NM_001080429		Approved	Nezha, PPP1R80	uc002mgu.4	Q9P1Y5		ENST00000160298.4:c.1651G>T	19.37:g.7677030G>T	ENSP00000160298:p.Val551Leu		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_001080429	48	0.00	0	Q8NDF1	Missense_Mutation	SNP	ENST00000160298.4	37	CCDS42489.1	.	.	.	.	.	.	.	.	.	.	g	0.103	-1.149758	0.01714	.	.	ENSG00000076826	ENST00000446248;ENST00000160298	T;T	0.14144	2.53;2.53	3.29	3.29	0.37713	.	2.376970	0.02896	U	0.134773	T	0.06416	0.0165	N	0.02011	-0.69	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.001;0.003	T	0.18241	-1.0343	10	0.16896	T	0.51	-0.8115	9.055	0.36401	0.1186:0.0:0.8814:0.0	.	551;578	Q9P1Y5;Q9P1Y5-2	CAMP3_HUMAN;.	L	578;551	ENSP00000416797:V578L;ENSP00000160298:V551L	ENSP00000160298:V551L	V	+	1	0	KIAA1543	7583030	0.003000	0.15002	0.005000	0.12908	0.102000	0.19082	1.330000	0.33781	1.773000	0.52216	0.446000	0.29264	GTG			0.632	CAMSAP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000459300.1		XM_048362	
CBLC	23624	mdanderson.org	37	19	45284237	45284237	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr19:45284237G>T	ENST00000270279.3	+	2	492	c.429G>T	c.(427-429)aaG>aaT	p.K143N	CBLC_ENST00000341505.4_Missense_Mutation_p.K143N	NM_012116.3	NP_036248.3	Q9ULV8	CBLC_HUMAN	Cbl proto-oncogene C, E3 ubiquitin protein ligase	143	4H.|Cbl-PTB. {ECO:0000255|PROSITE- ProRule:PRU00839}.				cell surface receptor signaling pathway (GO:0007166)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of MAP kinase activity (GO:0043407)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|ligase activity (GO:0016874)|phosphotyrosine binding (GO:0001784)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|lung(6)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Lung NSC(12;0.00136)|all_lung(12;0.00371)	Ovarian(192;0.231)				CCGGGGGAAAGTACTGTGGAC	0.627			M		AML																																p.K143N				Rec	yes		19	19q13.2	23624	Cas-Br-M (murine) ecotropic retroviral transforming sequence c		L	.	.			0			c.G429T												77.0	72.0	74.0					19																	45284237		2203	4300	6503	SO:0001583	missense	23624	exon2			GGGAAAGTACTGT	AB028645	CCDS12643.1, CCDS46109.1	19q13.2	2013-07-09	2013-07-09		ENSG00000142273	ENSG00000142273		"""RING-type (C3HC4) zinc fingers"""	15961	protein-coding gene	gene with protein product		608453	"""Cas-Br-M (murine) ectropic retroviral transforming sequence c"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence c"""			10362357, 10571044	Standard	NM_012116		Approved	CBL-3, CBL-SL, RNF57	uc002ozs.3	Q9ULV8	OTTHUMG00000150715	ENST00000270279.3:c.429G>T	19.37:g.45284237G>T	ENSP00000270279:p.Lys143Asn		Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_012116	4	0.00	0	Q8N1E5|Q9Y5Z2|Q9Y5Z3	Missense_Mutation	SNP	ENST00000270279.3	37	CCDS12643.1	.	.	.	.	.	.	.	.	.	.	.	4.176	0.031288	0.08101	.	.	ENSG00000142273	ENST00000270279;ENST00000341505	T;T	0.76316	-1.01;-1.01	5.07	-1.53	0.08611	Adaptor protein Cbl, N-terminal helical (3);Adaptor protein Cbl, PTB domain (1);	1.345540	0.04824	N	0.437505	T	0.71247	0.3317	L	0.57536	1.79	0.25398	N	0.988468	B;B	0.30361	0.277;0.247	B;B	0.35240	0.146;0.198	T	0.57213	-0.7850	10	0.41790	T	0.15	-9.8315	1.1698	0.01823	0.2735:0.2932:0.2971:0.1362	.	143;143	Q9ULV8-2;Q9ULV8	.;CBLC_HUMAN	N	143	ENSP00000270279:K143N;ENSP00000340250:K143N	ENSP00000270279:K143N	K	+	3	2	CBLC	49976077	0.000000	0.05858	0.256000	0.24389	0.080000	0.17528	-0.245000	0.08890	0.137000	0.18759	0.491000	0.48974	AAG			0.627	CBLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319732.2		NM_012116	
SSC5D	284297	mdanderson.org	37	19	56028595	56028595	+	Silent	SNP	C	C	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr19:56028595C>T	ENST00000389623.6	+	14	2975	c.2952C>T	c.(2950-2952)tcC>tcT	p.S984S		NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	984	Pro-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						CTCCAGGTTCCCCGAGGAAAC	0.731																																					p.S984S													.	.			0			c.C2952T												2.0	4.0	3.0					19																	56028595		533	1349	1882	SO:0001819	synonymous_variant	284297	exon14			AGGTTCCCCGAGG		CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.2952C>T	19.37:g.56028595C>T			Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	22	0.09	2	NM_001144950	0		0	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Silent	SNP	ENST00000389623.6	37	CCDS46196.1																																																																																					0.731	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000453345.2		XM_001718392	
ANKRD36BP2	645784	broad.mit.edu	37	2	89088242	89088243	+	RNA	INS	-	-	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr2:89088242_89088243insT	ENST00000393525.3	+	0	1015									ankyrin repeat domain 36B pseudogene 2																		AAAGttttttctttttttttat	0.332																																					.													.	.			0			.																																											0	.			TTTTTTCTTTTTT			2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89088251_89088251dupT			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	7	0.43	3	.	0		0		RNA	INS	ENST00000393525.3	37																																																																																						0.332	ANKRD36BP2-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000323523.1			
FSIP2	401024	broad.mit.edu	37	2	186680198	186680198	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr2:186680198G>T	ENST00000424728.1	+	19	20426	c.20426G>T	c.(20425-20427)gGt>gTt	p.G6809V	FSIP2_ENST00000343098.5_Splice_Site_p.G6898V			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	6809										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						TCATCTACTGGGTATATGAAA	0.333																																					p.G6898V													.	FSIP2	251		0			c.G20693T												63.0	57.0	59.0					2																	186680198		1808	4068	5876	SO:0001630	splice_region_variant	401024	exon19			CTACTGGGTATAT	AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.20426+1G>T	2.37:g.186680198G>T			Somatic	307	0	0		WXS	Illumina HiSeq	Phase_I	310	0.02	5	NM_173651	0		0	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Splice_Site	SNP	ENST00000424728.1	37		.	.	.	.	.	.	.	.	.	.	G	13.90	2.375289	0.42105	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.57907	0.37;0.39	4.98	4.98	0.66077	.	0.786233	0.11125	N	0.596973	T	0.51669	0.1688	N	0.24115	0.695	0.80722	D	1	.	.	.	.	.	.	T	0.50215	-0.8854	8	0.62326	D	0.03	.	13.9516	0.64121	0.0:0.0:1.0:0.0	.	.	.	.	V	6898;6809	ENSP00000344403:G6898V;ENSP00000401306:G6809V	ENSP00000344403:G6898V	G	+	2	0	FSIP2	186388443	0.998000	0.40836	0.878000	0.34440	0.002000	0.02628	4.082000	0.57635	2.738000	0.93877	0.655000	0.94253	GGT			0.333	FSIP2-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000332778.3		NM_173651	Missense_Mutation
NBEAL1	65065	broad.mit.edu	37	2	204000666	204000666	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr2:204000666G>T	ENST00000449802.1	+	27	4326	c.3993G>T	c.(3991-3993)ttG>ttT	p.L1331F		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	1331										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						AGTGGAGTTTGGAGGATAGAC	0.398																																					p.L1331F													.	NBEAL1	266		0			c.G3993T												88.0	80.0	83.0					2																	204000666		1846	4098	5944	SO:0001583	missense	65065	exon27			GAGTTTGGAGGAT	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.3993G>T	2.37:g.204000666G>T	ENSP00000399903:p.Leu1331Phe		Somatic	304	0	0		WXS	Illumina HiSeq	Phase_I	303	0.02	6	NM_001114132	0		0	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	ENST00000449802.1	37	CCDS46495.1	.	.	.	.	.	.	.	.	.	.	G	10.84	1.464922	0.26335	.	.	ENSG00000144426	ENST00000449802;ENST00000340268	T	0.55234	0.53	5.28	-0.0239	0.13941	.	0.907276	0.09495	N	0.794379	T	0.28732	0.0712	L	0.29908	0.895	0.41125	D	0.985842	P;B	0.35383	0.498;0.28	B;B	0.31191	0.125;0.08	T	0.30851	-0.9964	10	0.08837	T	0.75	.	2.0563	0.03582	0.3664:0.1181:0.3947:0.1209	.	1331;1320	Q6ZS30;C9JGK5	NBEL1_HUMAN;.	F	1331	ENSP00000399903:L1331F	ENSP00000344985:L1331F	L	+	3	2	NBEAL1	203708911	1.000000	0.71417	0.167000	0.22817	0.936000	0.57629	0.709000	0.25734	-0.321000	0.08627	-0.145000	0.13849	TTG			0.398	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000333982.4			
TMEM74B	55321	mdanderson.org	37	20	1164436	1164436	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr20:1164436C>T	ENST00000381894.3	-	1	681	c.10G>A	c.(10-12)Gca>Aca	p.A4T	TMEM74B_ENST00000481747.1_Intron	NM_018354.1	NP_060824.1	Q9NUR3	TM74B_HUMAN	transmembrane protein 74B	4						integral component of membrane (GO:0016021)											TACCCCTGTGCTGGTGGCATC	0.483																																					p.A4T													.	.			0			c.G10A												135.0	123.0	127.0					20																	1164436		2203	4300	6503	SO:0001583	missense	55321	exon1			CCTGTGCTGGTGG	AK002052	CCDS13011.1	20p13	2011-11-23	2011-11-23	2011-11-23	ENSG00000125895	ENSG00000125895			15893	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 46"""	C20orf46			Standard	XM_005260748		Approved	FLJ11190	uc002weq.1	Q9NUR3	OTTHUMG00000031655	ENST00000381894.3:c.10G>A	20.37:g.1164436C>T	ENSP00000371318:p.Ala4Thr		Somatic	44	0.0227272727	1		WXS	Illumina HiSeq	Phase_I	35	0.11	4	NM_018354	4	0.00	0	D3DVW5	Missense_Mutation	SNP	ENST00000381894.3	37	CCDS13011.1	.	.	.	.	.	.	.	.	.	.	C	7.903	0.734837	0.15574	.	.	ENSG00000125895	ENST00000381894;ENST00000429036	T;T	0.48836	0.85;0.8	3.5	2.54	0.30619	.	.	.	.	.	T	0.22085	0.0532	N	0.02011	-0.69	0.09310	N	1	B	0.20780	0.048	B	0.19391	0.025	T	0.19160	-1.0314	9	0.54805	T	0.06	.	8.9235	0.35625	0.0:0.7718:0.2282:0.0	.	4	Q9NUR3	CT046_HUMAN	T	4	ENSP00000371318:A4T;ENSP00000400552:A4T	ENSP00000371318:A4T	A	-	1	0	C20orf46	1112436	0.000000	0.05858	0.002000	0.10522	0.005000	0.04900	0.158000	0.16422	1.028000	0.39785	0.491000	0.48974	GCA			0.483	TMEM74B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077496.2		NM_018354	
PYGB	5834	mdanderson.org	37	20	25262727	25262727	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr20:25262727A>C	ENST00000216962.4	+	12	1572	c.1462A>C	c.(1462-1464)Acc>Ccc	p.T488P		NM_002862.3	NP_002853.2	P11216	PYGB_HUMAN	phosphorylase, glycogen; brain	488					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycogen phosphorylase activity (GO:0008184)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	31						CAATGGCATCACCCCCCGCCG	0.582																																					p.T488P													.	.			0			c.A1462C												56.0	62.0	60.0					20																	25262727		2203	4300	6503	SO:0001583	missense	5834	exon12			GGCATCACCCCCC		CCDS13171.1	20p11.21	2013-03-01			ENSG00000100994	ENSG00000100994	2.4.1.1	"""Glycogen phosphorylases"""	9723	protein-coding gene	gene with protein product	"""glycogen phosphorylase, brain form"""	138550					Standard	NM_002862		Approved		uc002wup.3	P11216	OTTHUMG00000032117	ENST00000216962.4:c.1462A>C	20.37:g.25262727A>C	ENSP00000216962:p.Thr488Pro		Somatic	40	0.175	7		WXS	Illumina HiSeq	Phase_I	49	0.39	19	NM_002862	980	0.25	246	Q96AK1|Q9NPX8	Missense_Mutation	SNP	ENST00000216962.4	37	CCDS13171.1	.	.	.	.	.	.	.	.	.	.	A	16.30	3.085153	0.55861	.	.	ENSG00000100994	ENST00000216962	D	0.94138	-3.36	3.92	3.92	0.45320	.	0.000000	0.85682	D	0.000000	D	0.97999	0.9341	H	0.98951	4.38	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98648	1.0678	10	0.87932	D	0	-20.7376	12.8872	0.58051	1.0:0.0:0.0:0.0	.	488	P11216	PYGB_HUMAN	P	488	ENSP00000216962:T488P	ENSP00000216962:T488P	T	+	1	0	PYGB	25210727	1.000000	0.71417	0.959000	0.39883	0.090000	0.18270	8.900000	0.92551	1.767000	0.52121	0.374000	0.22700	ACC			0.582	PYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078415.2		NM_002862	
DLGAP4	22839	broad.mit.edu	37	20	35075236	35075236	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr20:35075236G>T	ENST00000373907.2	+	6	1743	c.1544G>T	c.(1543-1545)cGt>cTt	p.R515L	DLGAP4_ENST00000373913.3_Missense_Mutation_p.R515L|DLGAP4_ENST00000339266.5_Missense_Mutation_p.R515L|DLGAP4_ENST00000401952.2_Missense_Mutation_p.R515L			Q9Y2H0	DLGP4_HUMAN	discs, large (Drosophila) homolog-associated protein 4	515					cell-cell signaling (GO:0007267)	membrane (GO:0016020)|synapse (GO:0045202)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(20)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				AGCTACCTGCGTGCCATCCAG	0.652																																					p.R515L													DLGAP4,colon,carcinoma,+1,1	DLGAP4	111	1	0			c.G1544T												34.0	28.0	30.0					20																	35075236		2203	4299	6502	SO:0001583	missense	22839	exon6			ACCTGCGTGCCAT	AF088030	CCDS13274.1, CCDS13275.1	20q11.23	2010-02-05			ENSG00000080845	ENSG00000080845			24476	protein-coding gene	gene with protein product						9115257	Standard	XM_005260329		Approved	DAP4, KIAA0964, SAPAP4	uc010zvp.2	Q9Y2H0	OTTHUMG00000032390	ENST00000373907.2:c.1544G>T	20.37:g.35075236G>T	ENSP00000363014:p.Arg515Leu		Somatic	122	0	0		WXS	Illumina HiSeq	Phase_I	107	0.04	4	NM_014902	20	0.00	0	E1P5T5|Q5QPG4|Q5T2Y4|Q5T2Y5|Q9H137|Q9H138|Q9H1L7	Missense_Mutation	SNP	ENST00000373907.2	37		.	.	.	.	.	.	.	.	.	.	G	36	5.654943	0.96724	.	.	ENSG00000080845	ENST00000373913;ENST00000401952;ENST00000373907;ENST00000339266	D;D;D;D	0.91237	-2.81;-2.81;-2.81;-2.81	5.66	5.66	0.87406	.	0.103029	0.64402	D	0.000003	D	0.95626	0.8578	M	0.82056	2.57	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95776	0.8813	10	0.87932	D	0	.	18.7402	0.91770	0.0:0.0:1.0:0.0	.	515	Q9Y2H0-1	.	L	515	ENSP00000363023:R515L;ENSP00000384954:R515L;ENSP00000363014:R515L;ENSP00000341633:R515L	ENSP00000341633:R515L	R	+	2	0	DLGAP4	34508650	1.000000	0.71417	0.976000	0.42696	0.991000	0.79684	9.869000	0.99810	2.668000	0.90789	0.462000	0.41574	CGT			0.652	DLGAP4-007	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000079025.2		NM_014902	
LAMA5	3911	mdanderson.org	37	20	60903333	60903333	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr20:60903333G>T	ENST00000252999.3	-	35	4682	c.4616C>A	c.(4615-4617)aCa>aAa	p.T1539K		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	1539	Laminin EGF-like 14. {ECO:0000255|PROSITE-ProRule:PRU00460}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GGTAGGGTCTGTGAGCTCCTG	0.657																																					p.T1539K													.	.			0			c.C4616A												23.0	23.0	23.0					20																	60903333		2192	4292	6484	SO:0001583	missense	3911	exon35			GGGTCTGTGAGCT	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.4616C>A	20.37:g.60903333G>T	ENSP00000252999:p.Thr1539Lys		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_005560	65	0.00	0	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	37	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	G	13.38	2.219116	0.39201	.	.	ENSG00000130702	ENST00000252999	T	0.54866	0.55	4.48	1.05	0.20165	EGF-like, laminin (3);	0.459431	0.24154	N	0.041045	T	0.53110	0.1776	L	0.59967	1.855	0.09310	N	1	P	0.37914	0.611	P	0.48598	0.583	T	0.46527	-0.9185	10	0.52906	T	0.07	.	5.6292	0.17501	0.2595:0.1419:0.5986:0.0	.	1539	O15230	LAMA5_HUMAN	K	1539	ENSP00000252999:T1539K	ENSP00000252999:T1539K	T	-	2	0	LAMA5	60336728	0.348000	0.24861	0.058000	0.19502	0.578000	0.36192	1.504000	0.35726	0.280000	0.22209	0.462000	0.41574	ACA			0.657	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080014.2		NM_005560	
SREBF2	6721	mdanderson.org	37	22	42293166	42293166	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr22:42293166G>T	ENST00000361204.4	+	14	2771		c.e14+1		SREBF2_ENST00000491541.1_Splice_Site	NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2						cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						TCCGCCCTGGGTAAGCACCTG	0.572																																					.													.	.			0			c.2605+1G>T												32.0	32.0	32.0					22																	42293166		2203	4300	6503	SO:0001630	splice_region_variant	6721	exon14			CCCTGGGTAAGCA	U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.2605+1G>T	22.37:g.42293166G>T			Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_004599	4	0.00	0	Q05BD5|Q6GTH7|Q86V36|Q9UH04	Splice_Site	SNP	ENST00000361204.4	37	CCDS14023.1	.	.	.	.	.	.	.	.	.	.	G	11.18	1.561434	0.27915	.	.	ENSG00000198911	ENST00000361204;ENST00000457567	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3823	0.87408	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SREBF2	40623112	1.000000	0.71417	0.974000	0.42286	0.085000	0.17905	6.372000	0.73123	2.543000	0.85770	0.655000	0.94253	.			0.572	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000321956.1		NM_004599	Intron
FBLN2	2199	mdanderson.org	37	3	13655520	13655520	+	Missense_Mutation	SNP	C	C	T	rs148310871	byFrequency	TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr3:13655520C>T	ENST00000295760.7	+	5	1654	c.1585C>T	c.(1585-1587)Cgg>Tgg	p.R529W	FBLN2_ENST00000404922.3_Missense_Mutation_p.R529W|FBLN2_ENST00000535798.1_Missense_Mutation_p.R555W|FBLN2_ENST00000492059.1_Missense_Mutation_p.R529W	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	529	Anaphylatoxin-like 3. {ECO:0000255|PROSITE-ProRule:PRU00022}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			CCTCCGCGTGCGGGCCGAGGG	0.602													C|||	2	0.000399361	0.0	0.0	5008	,	,		19418	0.0		0.002	False		,,,				2504	0.0				p.R529W													FBLN2_ENST00000492059,colon,carcinoma,-1,1	FBLN2_ENST00000492059	-1	1	0			c.C1585T												44.0	52.0	49.0					3																	13655520		2057	4181	6238	SO:0001583	missense	2199	exon5			CGCGTGCGGGCCG	X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.1585C>T	3.37:g.13655520C>T	ENSP00000295760:p.Arg529Trp		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_001998	32	0.00	0	B7Z9C5|Q8IUI0|Q8IUI1	Missense_Mutation	SNP	ENST00000295760.7	37	CCDS46762.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	11.98	1.800155	0.31869	.	.	ENSG00000163520	ENST00000535798;ENST00000404922;ENST00000295760;ENST00000492059	T;T;T;T	0.23552	1.9;1.9;1.9;1.9	4.27	0.956	0.19608	Anaphylatoxin/fibulin (4);	0.336770	0.25872	N	0.027758	T	0.31263	0.0791	N	0.24115	0.695	0.09310	N	0.999997	D;D;D	0.89917	1.0;0.999;0.999	D;P;P	0.65987	0.94;0.866;0.855	T	0.15065	-1.0450	10	0.87932	D	0	.	11.7629	0.51914	0.7113:0.2887:0.0:0.0	.	529;529;555	P98095;P98095-2;F5H1F3	FBLN2_HUMAN;.;.	W	555;529;529;529	ENSP00000445705:R555W;ENSP00000384169:R529W;ENSP00000295760:R529W;ENSP00000420042:R529W	ENSP00000295760:R529W	R	+	1	2	FBLN2	13630521	0.994000	0.37717	0.220000	0.23810	0.200000	0.23975	1.924000	0.40065	0.396000	0.25283	0.591000	0.81541	CGG	0		0.602	FBLN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000340083.3		NM_001004019	
ACVR2B	93	bcgsc.ca	37	3	38518867	38518867	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr3:38518867C>T	ENST00000352511.4	+	2	614	c.142C>T	c.(142-144)Cgc>Tgc	p.R48C		NM_001106.3	NP_001097.2	Q13705	AVR2B_HUMAN	activin A receptor, type IIB	48					activation of protein kinase activity (GO:0032147)|activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|determination of left/right symmetry (GO:0007368)|embryonic foregut morphogenesis (GO:0048617)|gastrulation with mouth forming second (GO:0001702)|heart development (GO:0007507)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm development (GO:0007498)|odontogenesis of dentin-containing tooth (GO:0042475)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|response to glucose (GO:0009749)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|venous blood vessel development (GO:0060841)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)			lung(1)	1	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0565)|Kidney(284;0.071)		CGGCCTGGAGCGCTGCGAAGG	0.647																																					p.R48C													.	ACVR2B	88		0			c.C142T												65.0	59.0	61.0					3																	38518867		2203	4300	6503	SO:0001583	missense	93	exon2			CTGGAGCGCTGCG	X77533	CCDS2679.1	3p22	2006-11-06			ENSG00000114739	ENSG00000114739			174	protein-coding gene	gene with protein product		602730				8161782, 9621519	Standard	NM_001106		Approved	ActR-IIB	uc003cif.3	Q13705	OTTHUMG00000131291	ENST00000352511.4:c.142C>T	3.37:g.38518867C>T	ENSP00000340361:p.Arg48Cys		Somatic	80	0	0		WXS	Illumina HiSeq	Phase_1	61	0.00	0	NM_001106	13	0.00	0	Q4VAV0	Missense_Mutation	SNP	ENST00000352511.4	37	CCDS2679.1	.	.	.	.	.	.	.	.	.	.	C	19.35	3.809914	0.70797	.	.	ENSG00000114739	ENST00000352511	D	0.98512	-4.97	4.17	4.17	0.49024	TGF-beta receptor/activin receptor, type I/II (1);	0.053892	0.85682	D	0.000000	D	0.97835	0.9289	L	0.53249	1.67	0.80722	D	1	D	0.62365	0.991	P	0.58970	0.849	D	0.97038	0.9755	10	0.42905	T	0.14	.	12.1902	0.54266	0.1706:0.8294:0.0:0.0	.	48	Q13705	AVR2B_HUMAN	C	48	ENSP00000340361:R48C	ENSP00000340361:R48C	R	+	1	0	ACVR2B	38493871	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	5.685000	0.68204	2.318000	0.78349	0.655000	0.94253	CGC			0.647	ACVR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254059.3		NM_001106	
TKT	7086	mdanderson.org	37	3	53275169	53275169	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr3:53275169G>T	ENST00000462138.1	-	3	406	c.318C>A	c.(316-318)gaC>gaA	p.D106E	TKT_ENST00000296289.6_Missense_Mutation_p.D59E|TKT_ENST00000423525.2_Missense_Mutation_p.D106E|TKT_ENST00000423516.1_Missense_Mutation_p.D106E			P29401	TKT_HUMAN	transketolase	106					carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|glyceraldehyde-3-phosphate biosynthetic process (GO:0046166)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|regulation of growth (GO:0040008)|small molecule metabolic process (GO:0044281)|xylulose biosynthetic process (GO:0005999)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|peroxisome (GO:0005777)|vesicle (GO:0031982)	cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|transketolase activity (GO:0004802)			endometrium(5)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17		Prostate(884;0.0959)		BRCA - Breast invasive adenocarcinoma(193;0.000159)|OV - Ovarian serous cystadenocarcinoma(275;0.000314)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)		GCCCGTCCAAGTCGGAGCTGA	0.647																																					p.D106E	Colon(133;1506 2347 35238 42177)												.	.			0			c.C318A												59.0	57.0	57.0					3																	53275169		2203	4300	6503	SO:0001583	missense	7086	exon3			GTCCAAGTCGGAG		CCDS2871.1, CCDS58834.1	3p14.3	2008-07-31	2008-07-31		ENSG00000163931	ENSG00000163931	2.2.1.1		11834	protein-coding gene	gene with protein product	"""Wernicke-Korsakoff syndrome"""	606781				1567394	Standard	NM_001064		Approved		uc011beq.2	P29401	OTTHUMG00000158192	ENST00000462138.1:c.318C>A	3.37:g.53275169G>T	ENSP00000417773:p.Asp106Glu		Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_001135055	1038	0.00	0	A8K089|B4DE31|E7EPA7|Q8TBA3|Q96HH3	Missense_Mutation	SNP	ENST00000462138.1	37	CCDS2871.1	.	.	.	.	.	.	.	.	.	.	G	9.116	1.007786	0.19199	.	.	ENSG00000163931	ENST00000462138;ENST00000423525;ENST00000423516;ENST00000296289	T;T;T;T	0.21734	1.99;1.99;1.99;1.99	5.9	3.66	0.41972	Transketolase, N-terminal (1);	0.252596	0.44902	D	0.000416	T	0.16471	0.0396	L	0.55834	1.745	0.37263	D	0.907087	B;B	0.21381	0.035;0.055	B;B	0.30572	0.048;0.117	T	0.09662	-1.0664	10	0.06494	T	0.89	-25.0468	5.7732	0.18265	0.2051:0.1701:0.6249:0.0	.	106;106	E7EPA7;P29401	.;TKT_HUMAN	E	106;106;106;59	ENSP00000417773:D106E;ENSP00000405455:D106E;ENSP00000391481:D106E;ENSP00000296289:D59E	ENSP00000296289:D59E	D	-	3	2	TKT	53250209	0.063000	0.20901	0.977000	0.42913	0.243000	0.25628	0.823000	0.27366	2.792000	0.96026	0.655000	0.94253	GAC			0.647	TKT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350356.1			
MAGI1	9223	hgsc.bcm.edu	37	3	65425594	65425594	+	Silent	SNP	C	C	T	rs552500635	byFrequency	TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr3:65425594C>T	ENST00000497477.2	-	9	1229	c.1230G>A	c.(1228-1230)caG>caA	p.Q410Q	MAGI1_ENST00000402939.2_Silent_p.Q410Q|MAGI1_ENST00000330909.8_Silent_p.Q410Q|MAGI1_ENST00000483466.1_Silent_p.Q410Q|MAGI1_ENST00000470990.1_5'UTR			Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	410	Poly-Gln.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		gctgctgttgctgctgctgtt	0.542											OREG0015658	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	722	0.144169	0.0893	0.1282	5008	,	,		14940	0.2024		0.0825	False		,,,				2504	0.2331				p.Q410Q													MAGI1_ENST00000402939,NS,carcinoma,0,9	MAGI1_ENST00000402939	0	9	0			c.G1230A												65.0	61.0	62.0					3																	65425594		2199	4283	6482	SO:0001819	synonymous_variant	9223	exon9			CTGTTGCTGCTGC	AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000497477.2:c.1230G>A	3.37:g.65425594C>T			Somatic	28	0.0357142857	1	1084	WXS	Illumina HiSeq	.	40	0.25	10	NM_001033057	7	0.00	0	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Silent	SNP	ENST00000497477.2	37		.	.	.	.	.	.	.	.	.	.	C	1.063	-0.672234	0.03403	.	.	ENSG00000151276	ENST00000460329	.	.	.	3.3	-0.172	0.13327	.	.	.	.	.	T	0.20292	0.0488	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.22556	-1.0213	4	.	.	.	0.8958	1.6281	0.02727	0.1431:0.3787:0.1264:0.3517	.	.	.	.	N	291	.	.	S	-	2	0	MAGI1	65400634	0.371000	0.25056	0.001000	0.08648	0.001000	0.01503	-1.015000	0.03637	-0.726000	0.04895	-0.813000	0.03139	AGC			0.542	MAGI1-007	NOVEL	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000349132.2		NM_004742	
MED12L	116931	broad.mit.edu;ucsc.edu;mdanderson.org	37	3	151093929	151093929	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr3:151093929G>A	ENST00000474524.1	+	26	3913	c.3875G>A	c.(3874-3876)tGt>tAt	p.C1292Y	P2RY12_ENST00000302632.3_Intron|MED12L_ENST00000273432.4_Missense_Mutation_p.C1152Y	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	1292						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CAGCTTATCTGTTATCCTCAT	0.388																																					p.C1292Y													.	MED12L	271		0			c.G3875A												82.0	81.0	82.0					3																	151093929		2203	4300	6503	SO:0001583	missense	116931	exon26			TTATCTGTTATCC	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.3875G>A	3.37:g.151093929G>A	ENSP00000417235:p.Cys1292Tyr		Somatic	66	0.0151515152	1		WXS	Illumina HiSeq	Phase_I	78	0.15	12	NM_053002	7	0.00	0	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	ENST00000474524.1	37	CCDS33876.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.766029	0.90020	.	.	ENSG00000144893	ENST00000474524;ENST00000273432	T;T	0.65549	0.02;-0.16	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.80665	0.4666	M	0.75085	2.285	0.80722	D	1	D;D;D	0.89917	1.0;0.997;0.995	D;D;D	0.85130	0.997;0.994;0.986	T	0.81376	-0.0961	10	0.87932	D	0	-16.3698	19.874	0.96863	0.0:0.0:1.0:0.0	.	1152;1291;1292	F8WAE6;Q86YW9-4;Q86YW9	.;.;MD12L_HUMAN	Y	1292;1152	ENSP00000417235:C1292Y;ENSP00000273432:C1152Y	ENSP00000273432:C1152Y	C	+	2	0	MED12L	152576619	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	9.293000	0.96082	2.788000	0.95919	0.650000	0.86243	TGT			0.388	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000357707.2		NM_053002	
DSPP	1834	bcgsc.ca	37	4	88536118	88536118	+	Silent	SNP	T	T	C			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr4:88536118T>C	ENST00000282478.7	+	4	2337	c.2304T>C	c.(2302-2304)agT>agC	p.S768S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S768S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	768	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtgacagcagtgatagcagtg	0.517																																					p.S768S													.	DSPP	174		0			c.T2304C												74.0	85.0	81.0					4																	88536118		1649	2989	4638	SO:0001819	synonymous_variant	1834	exon5			CAGCAGTGATAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2304T>C	4.37:g.88536118T>C			Somatic	88	0	0		WXS	Illumina HiSeq	Phase_1	85	0.01	1	NM_014208	0		0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																					0.517	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000363616.3		NM_014208	
SEC24B	10427	mdanderson.org	37	4	110460718	110460718	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr4:110460718G>T	ENST00000265175.5	+	24	3749	c.3694G>T	c.(3694-3696)Gat>Tat	p.D1232Y	SEC24B_ENST00000504968.2_Splice_Site_p.D1262Y|SEC24B_ENST00000399100.2_Splice_Site_p.D1197Y	NM_006323.2	NP_006314.2	O95487	SC24B_HUMAN	SEC24 family member B	1232					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|aorta morphogenesis (GO:0035909)|auditory receptor cell stereocilium organization (GO:0060088)|cellular protein metabolic process (GO:0044267)|cochlear nucleus development (GO:0021747)|COPII vesicle coating (GO:0048208)|coronary artery morphogenesis (GO:0060982)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|lung lobe morphogenesis (GO:0060463)|membrane organization (GO:0061024)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|pulmonary artery morphogenesis (GO:0061156)|regulation of cargo loading into COPII-coated vesicle (GO:1901301)|regulation of establishment of planar polarity involved in neural tube closure (GO:0090178)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|membrane (GO:0016020)	transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		TTCTTCCAGAGATGAGAGTCC	0.373																																					p.D1232Y													.	.			0			c.G3694T												75.0	66.0	68.0					4																	110460718		1813	4072	5885	SO:0001630	splice_region_variant	10427	exon24			TCCAGAGATGAGA	AJ131245	CCDS43260.1, CCDS47124.1, CCDS75179.1	4q25	2013-10-21	2013-10-21		ENSG00000138802	ENSG00000138802			10704	protein-coding gene	gene with protein product		607184	"""SEC24 (S. cerevisiae) related gene family, member B"", ""SEC24 family, member B (S. cerevisiae)"""			10075675, 10329445	Standard	XM_005262688		Approved		uc003hzk.3	O95487	OTTHUMG00000161372	ENST00000265175.5:c.3693-1G>T	4.37:g.110460718G>T			Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_006323	47	0.00	0	B7ZKM8|B7ZKN4|Q0VG08	Missense_Mutation	SNP	ENST00000265175.5	37	CCDS47124.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.423270	0.83559	.	.	ENSG00000138802	ENST00000504968;ENST00000399100;ENST00000265175	T;T;T	0.32515	1.45;1.45;1.45	5.31	5.31	0.75309	.	0.095400	0.64402	D	0.000001	T	0.60379	0.2264	M	0.81942	2.565	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.78314	0.973;0.938;0.973;0.991;0.98	T	0.64232	-0.6456	10	0.87932	D	0	-27.5696	19.1814	0.93625	0.0:0.0:1.0:0.0	.	1146;831;1262;1197;1232	B4DTM6;B4E2E1;B7ZKM8;O95487-2;O95487	.;.;.;.;SC24B_HUMAN	Y	1262;1197;1232	ENSP00000428564:D1262Y;ENSP00000382051:D1197Y;ENSP00000265175:D1232Y	ENSP00000265175:D1232Y	D	+	1	0	SEC24B	110680167	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	9.538000	0.98072	2.779000	0.95612	0.591000	0.81541	GAT			0.373	SEC24B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000364693.2			Missense_Mutation
PLEKHG4B	153478	mdanderson.org	37	5	143516	143516	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr5:143516G>T	ENST00000283426.6	+	3	691	c.641G>T	c.(640-642)aGa>aTa	p.R214I	Y_RNA_ENST00000362670.1_RNA	NM_052909.3	NP_443141.3	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B	214							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(1)|large_intestine(2)|lung(2)|prostate(3)|skin(3)	11			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		CGTCATGGCAGAGCAGTGGTG	0.627																																					p.R214I													.	.			0			c.G641T												59.0	63.0	62.0					5																	143516		2202	4295	6497	SO:0001583	missense	153478	exon3			ATGGCAGAGCAGT	BC008352	CCDS34124.1	5p15.33	2013-01-11			ENSG00000153404	ENSG00000153404		"""Pleckstrin homology (PH) domain containing"""	29399	protein-coding gene	gene with protein product						11572484	Standard	NM_052909		Approved	KIAA1909	uc003jak.2	Q96PX9	OTTHUMG00000161570	ENST00000283426.6:c.641G>T	5.37:g.143516G>T	ENSP00000283426:p.Arg214Ile		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_052909	26	0.00	0		Missense_Mutation	SNP	ENST00000283426.6	37	CCDS34124.1	.	.	.	.	.	.	.	.	.	.	.	13.84	2.357241	0.41801	.	.	ENSG00000153404	ENST00000283426;ENST00000502646	T;T	0.66815	-0.23;-0.23	2.67	2.67	0.31697	.	.	.	.	.	T	0.81158	0.4764	M	0.86268	2.805	0.42957	D	0.994396	D	0.89917	1.0	D	0.87578	0.998	T	0.82824	-0.0266	9	0.56958	D	0.05	.	11.0441	0.47849	0.0:0.0:1.0:0.0	.	214	Q96PX9	PKH4B_HUMAN	I	214;128	ENSP00000283426:R214I;ENSP00000422493:R128I	ENSP00000283426:R214I	R	+	2	0	PLEKHG4B	196516	0.991000	0.36638	0.063000	0.19743	0.036000	0.12997	3.734000	0.55037	1.182000	0.42928	0.467000	0.42956	AGA			0.627	PLEKHG4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000365359.1		NM_052909	
BRD9	65980	mdanderson.org	37	5	884147	884147	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr5:884147G>T	ENST00000467963.1	-	8	1038	c.872C>A	c.(871-873)aCg>aAg	p.T291K	BRD9_ENST00000483173.1_Missense_Mutation_p.T238K|BRD9_ENST00000435709.2_Missense_Mutation_p.T175K|BRD9_ENST00000323510.4_Missense_Mutation_p.T195K|BRD9_ENST00000388890.4_Missense_Mutation_p.T175K|BRD9_ENST00000494422.1_Intron	NM_023924.4	NP_076413.3	Q9H8M2	BRD9_HUMAN	bromodomain containing 9	291					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		lysine-acetylated histone binding (GO:0070577)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(3)	29			Epithelial(17;0.00202)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00815)|Lung(60;0.185)			GGTACTGTCCGTCAAGCTGCA	0.632																																					p.T291K													BRD9_ENST00000467963,NS,carcinoma,+1,4	BRD9_ENST00000467963	1	4	0			c.C872A												117.0	92.0	100.0					5																	884147		2203	4300	6503	SO:0001583	missense	65980	exon8			CTGTCCGTCAAGC	AK023503	CCDS34127.1, CCDS34128.1, CCDS34127.2, CCDS34128.2	5p15.33	2008-02-05			ENSG00000028310	ENSG00000028310			25818	protein-coding gene	gene with protein product						12477932	Standard	NM_023924		Approved	FLJ13441	uc003jbq.3	Q9H8M2	OTTHUMG00000159258	ENST00000467963.1:c.872C>A	5.37:g.884147G>T	ENSP00000419765:p.Thr291Lys		Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_023924	72	0.00	0	A6NFY8|B4DMQ2|B4DR93|Q2XUS1|Q6UWU9|Q8IUS4|Q9H5Q5|Q9H7R9	Missense_Mutation	SNP	ENST00000467963.1	37	CCDS34127.2	.	.	.	.	.	.	.	.	.	.	G	8.343	0.829097	0.16749	.	.	ENSG00000028310	ENST00000323510;ENST00000388890;ENST00000483173;ENST00000467963;ENST00000435709;ENST00000489093	T;T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85;0.85	5.03	3.23	0.37069	.	0.047167	0.85682	D	0.000000	T	0.41926	0.1180	L	0.60455	1.87	0.80722	D	1	P;P;B;B	0.42161	0.772;0.483;0.427;0.427	B;B;B;B	0.43783	0.431;0.155;0.184;0.184	T	0.41752	-0.9491	10	0.02654	T	1	-11.7047	11.3623	0.49651	0.1429:0.0:0.8571:0.0	.	238;291;195;175	B4DMQ2;Q9H8M2;Q9H8M2-1;Q9H8M2-3	.;BRD9_HUMAN;.;.	K	195;175;238;291;175;195	ENSP00000323557:T195K;ENSP00000373542:T175K;ENSP00000419845:T238K;ENSP00000419765:T291K;ENSP00000402984:T175K;ENSP00000420722:T195K	ENSP00000323557:T195K	T	-	2	0	BRD9	937147	1.000000	0.71417	0.611000	0.29010	0.840000	0.47671	8.846000	0.92159	0.516000	0.28340	0.609000	0.83330	ACG			0.632	BRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000354113.1		NM_023924	
FBN2	2201	mdanderson.org	37	5	127623058	127623058	+	Silent	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr5:127623058G>T	ENST00000508053.1	-	60	7796	c.6822C>A	c.(6820-6822)tcC>tcA	p.S2274S	FBN2_ENST00000262464.4_Silent_p.S2274S			P35556	FBN2_HUMAN	fibrillin 2	2274	EGF-like 38; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TGCATTCATAGGACCCAAAAG	0.488																																					p.S2274S													.	.			0			c.C6822A												163.0	149.0	154.0					5																	127623058		2203	4300	6503	SO:0001819	synonymous_variant	2201	exon54			TTCATAGGACCCA	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.6822C>A	5.37:g.127623058G>T			Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_001999	0		0	B4DU01|Q59ES6	Silent	SNP	ENST00000508053.1	37	CCDS34222.1																																																																																					0.488	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000371618.2		NM_001999	
DEK	7913	bcgsc.ca	37	6	18264096	18264096	+	Missense_Mutation	SNP	C	C	G	rs147127829	byFrequency	TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr6:18264096C>G	ENST00000397239.3	-	2	570	c.123G>C	c.(121-123)gaG>gaC	p.E41D	DEK_ENST00000244776.7_Missense_Mutation_p.E41D	NM_003472.3	NP_003463.1	P35659	DEK_HUMAN	DEK proto-oncogene	41	Asp/Glu-rich (highly acidic).				chromatin modification (GO:0016568)|regulation of double-strand break repair (GO:2000779)|regulation of double-strand break repair via nonhomologous end joining (GO:2001032)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	7	Ovarian(93;0.00769)|Breast(50;0.0495)	all_hematologic(90;0.053)	OV - Ovarian serous cystadenocarcinoma(7;0.00291)|all cancers(50;0.031)|Epithelial(50;0.0332)			cctcctcctcctcgtcgtcct	0.562			T	NUP214	AML								C|||	10	0.00199681	0.0068	0.0	5008	,	,		14423	0.0		0.0	False		,,,				2504	0.001				p.E41D				Dom	yes		6	6p23	7913	DEK oncogene (DNA binding)		L	.	DEK	31		0			c.G123C							-	ASP/GLU,ASP/GLU	8,4398	14.3+/-33.2	0,8,2195	43.0	47.0	45.0		123,123	-3.7	0.1	6	dbSNP_134	45	0,8600		0,0,4300	yes	missense,missense	DEK	NM_001134709.1,NM_003472.3	45,45	0,8,6495	GG,GC,CC		0.0,0.1816,0.0615	benign,benign	41/342,41/376	18264096	8,12998	2203	4300	6503	SO:0001583	missense	7913	exon2			CTCCTCCTCGTCG	X64229	CCDS34344.1, CCDS47382.1	6p23	2014-06-25	2014-06-25		ENSG00000124795	ENSG00000124795			2768	protein-coding gene	gene with protein product		125264	"""DEK oncogene (DNA binding)"", ""DEK oncogene"""			1549122	Standard	NM_003472		Approved	D6S231E	uc003ncr.1	P35659	OTTHUMG00000014319	ENST00000397239.3:c.123G>C	6.37:g.18264096C>G	ENSP00000380414:p.Glu41Asp		Somatic	113	0	0		WXS	Illumina HiSeq	Phase_1	103	0.04	4	NM_003472	144	0.00	0	B2R6K6|B4DN37|Q5TGV4|Q5TGV5	Missense_Mutation	SNP	ENST00000397239.3	37	CCDS34344.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	6.267	0.417416	0.11870	0.001816	0.0	ENSG00000124795	ENST00000397239;ENST00000244776;ENST00000515742	T;T;T	0.51817	0.76;0.85;0.69	4.57	-3.65	0.04502	.	0.440668	0.20131	N	0.098587	T	0.09598	0.0236	L	0.48642	1.525	0.22880	N	0.998611	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.38585	-0.9654	10	0.12766	T	0.61	-5.206	1.3254	0.02124	0.2162:0.3697:0.1081:0.306	.	41;41	B4DN37;P35659	.;DEK_HUMAN	D	41;41;46	ENSP00000380414:E41D;ENSP00000244776:E41D;ENSP00000423553:E46D	ENSP00000244776:E41D	E	-	3	2	DEK	18372075	0.003000	0.15002	0.050000	0.19076	0.529000	0.34654	-2.192000	0.01245	-1.460000	0.01911	-2.294000	0.00264	GAG			0.562	DEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039962.4			
HIST1H2AI	8329	broad.mit.edu	37	6	27776148	27776148	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr6:27776148C>T	ENST00000358739.3	+	1	250	c.161C>T	c.(160-162)gCg>gTg	p.A54V	HIST1H2BL_ENST00000377401.2_5'Flank|HIST1H3H_ENST00000369163.2_5'Flank	NM_003509.2	NP_003500.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ai	54						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			lung(3)	3						TACCTGGCGGCGGTGCTGGAG	0.677																																					p.A54V													.	HIST1H2AI	9		0			c.C161T												12.0	15.0	14.0					6																	27776148		2094	4157	6251	SO:0001583	missense	8329	exon1			TGGCGGCGGTGCT	Z83742	CCDS4626.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000196747	ENSG00000196747		"""Histones / Replication-dependent"""	4725	protein-coding gene	gene with protein product		602787	"""H2A histone family, member C"", ""histone 1, H2ai"""	H2AFC		9439656, 12408966	Standard	NM_003509		Approved	H2A/c		P0C0S8	OTTHUMG00000014484	ENST00000358739.3:c.161C>T	6.37:g.27776148C>T	ENSP00000351589:p.Ala54Val		Somatic	131	0	0		WXS	Illumina HiSeq	Phase_I	137	0.10	14	NM_003509	41	0.17	7	P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	ENST00000358739.3	37	CCDS4626.1	.	.	.	.	.	.	.	.	.	.	.	18.67	3.673528	0.67928	.	.	ENSG00000196747	ENST00000358739	T	0.71103	-0.54	4.53	3.64	0.41730	.	0.000000	0.39909	N	0.001233	T	0.74152	0.3679	.	.	.	0.39437	D	0.96718	.	.	.	.	.	.	T	0.79095	-0.1944	7	0.72032	D	0.01	.	14.2543	0.66040	0.0:0.8492:0.1508:0.0	.	.	.	.	V	54	ENSP00000351589:A54V	ENSP00000351589:A54V	A	+	2	0	HIST1H2AI	27884127	1.000000	0.71417	0.993000	0.49108	0.572000	0.35998	7.066000	0.76734	1.183000	0.42943	0.556000	0.70494	GCG			0.677	HIST1H2AI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040152.1		NM_003509	
COL11A2	1302	mdanderson.org	37	6	33140407	33140407	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr6:33140407G>A	ENST00000374708.4	-	37	2798	c.2540C>T	c.(2539-2541)gCa>gTa	p.A847V	COL11A2_ENST00000374712.1_Missense_Mutation_p.A852V|COL11A2_ENST00000477772.1_Intron|COL11A2_ENST00000374713.1_Missense_Mutation_p.A886V|COL11A2_ENST00000357486.1_Missense_Mutation_p.A912V|COL11A2_ENST00000341947.2_Missense_Mutation_p.A933V|COL11A2_ENST00000374714.1_Missense_Mutation_p.A907V|COL11A2_ENST00000361917.1_Missense_Mutation_p.A826V|COL11A2_ENST00000395197.1_Missense_Mutation_p.A873V	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	933	Collagen-like 4.|Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						GGTTTCTCCTGCTGCTCCCTA	0.602																																					p.A933V	Melanoma(1;90 116 3946 5341 17093)												.	.			0			c.C2798T												36.0	40.0	38.0					6																	33140407		1509	2709	4218	SO:0001583	missense	1302	exon39			TCTCCTGCTGCTC	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.2540C>T	6.37:g.33140407G>A	ENSP00000363840:p.Ala847Val		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_080680	0		0	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Missense_Mutation	SNP	ENST00000374708.4	37	CCDS43452.1	.	.	.	.	.	.	.	.	.	.	G	18.85	3.712354	0.68730	.	.	ENSG00000204248	ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917	D;D;D;D;D;D;D;D	0.94376	-2.58;-3.41;-2.58;-2.58;-3.41;-2.58;-2.58;-3.41	5.03	5.03	0.67393	.	0.350553	0.27176	N	0.020571	D	0.82646	0.5082	N	0.20328	0.56	0.42082	D	0.991255	P;P;B	0.46220	0.874;0.571;0.421	B;B;B	0.41723	0.365;0.28;0.073	D	0.84217	0.0459	10	0.40728	T	0.16	.	10.8676	0.46864	0.0:0.0:0.8123:0.1877	.	826;847;933	P13942-8;P13942-6;P13942	.;.;COBA2_HUMAN	V	847;933;912;907;886;873;852;826	ENSP00000363840:A847V;ENSP00000339915:A933V;ENSP00000350079:A912V;ENSP00000363846:A907V;ENSP00000363845:A886V;ENSP00000378623:A873V;ENSP00000363844:A852V;ENSP00000355123:A826V	ENSP00000339915:A933V	A	-	2	0	COL11A2	33248385	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	7.453000	0.80700	2.632000	0.89209	0.643000	0.83706	GCA			0.602	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000076032.2			
B3GALT4	8705	bcgsc.ca	37	6	33245604	33245604	+	Silent	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr6:33245604G>T	ENST00000451237.1	+	1	688	c.408G>T	c.(406-408)ggG>ggT	p.G136G		NM_003782.3	NP_003773.1	O96024	B3GT4_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4	136					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ganglioside galactosyltransferase activity (GO:0047915)|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|urinary_tract(2)	13						CAGCCCAGGGGGATATCTTGC	0.627																																					p.G136G													.	B3GALT4	30		0			c.G408T												55.0	62.0	59.0					6																	33245604		2203	4299	6502	SO:0001819	synonymous_variant	8705	exon1			CCAGGGGGATATC	Y15061	CCDS34425.1	6p21.3	2013-02-19			ENSG00000235863	ENSG00000235863		"""Beta 3-glycosyltransferases"""	919	protein-coding gene	gene with protein product		603095				9582303	Standard	NM_003782		Approved	beta3Gal-T4, GalT4	uc003odr.3	O96024	OTTHUMG00000031100	ENST00000451237.1:c.408G>T	6.37:g.33245604G>T			Somatic	44	0	0		WXS	Illumina HiSeq	Phase_1	40	0.00	0	NM_003782	16	0.00	0		Silent	SNP	ENST00000451237.1	37	CCDS34425.1																																																																																					0.627	B3GALT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076162.2			
ITPR3	3710	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	33652420	33652420	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr6:33652420C>G	ENST00000374316.5	+	39	6152	c.5092C>G	c.(5092-5094)Cgg>Ggg	p.R1698G	ITPR3_ENST00000605930.1_Missense_Mutation_p.R1698G			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	1698					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	CCTCCAGAACCGGAAGTCCAC	0.637																																					p.R1698G													.	.			0			c.C5092G												77.0	81.0	80.0					6																	33652420		2203	4300	6503	SO:0001583	missense	3710	exon38			CAGAACCGGAAGT	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.5092C>G	6.37:g.33652420C>G	ENSP00000363435:p.Arg1698Gly		Somatic	121	0	0		WXS	Illumina HiSeq	.	98	0.20	20	NM_002224	137	0.23	31	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	37	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	C	13.19	2.163419	0.38217	.	.	ENSG00000096433	ENST00000374316	D	0.92965	-3.14	5.05	5.05	0.67936	.	0.409731	0.25222	N	0.032237	T	0.80116	0.4564	L	0.33485	1.01	0.37828	D	0.928617	B	0.15473	0.013	B	0.14578	0.011	T	0.74728	-0.3567	10	0.23302	T	0.38	-34.9464	11.7843	0.52032	0.2224:0.7776:0.0:0.0	.	1698	Q14573	ITPR3_HUMAN	G	1698	ENSP00000363435:R1698G	ENSP00000363435:R1698G	R	+	1	2	ITPR3	33760398	1.000000	0.71417	0.998000	0.56505	0.938000	0.57974	3.709000	0.54853	2.505000	0.84491	0.655000	0.94253	CGG			0.637	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040204.2		NM_002224	
ZNF76	7629	mdanderson.org	37	6	35259494	35259494	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr6:35259494A>G	ENST00000373953.3	+	9	1177	c.911A>G	c.(910-912)aAt>aGt	p.N304S	ZNF76_ENST00000440666.2_Missense_Mutation_p.N278S|ZNF76_ENST00000339411.5_Missense_Mutation_p.N304S	NM_003427.3	NP_003418.2	P36508	ZNF76_HUMAN	zinc finger protein 76	304					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)	16						AACTATAAGAATCACGTGCGC	0.607																																					p.N304S	Esophageal Squamous(52;92 1039 20612 23956 34676)												.	.			0			c.A911G												43.0	41.0	42.0					6																	35259494		2203	4300	6503	SO:0001583	missense	7629	exon9			ATAAGAATCACGT	M91592	CCDS4801.1, CCDS75435.1	6p21.31	2013-01-08	2011-02-25		ENSG00000065029	ENSG00000065029		"""Zinc fingers, C2H2-type"""	13149	protein-coding gene	gene with protein product		194549	"""zinc finger protein 76 (expressed in testis)"""	D6S229E		1427894	Standard	XM_005249364		Approved	Zfp523, ZNF523	uc003oki.1	P36508	OTTHUMG00000014564	ENST00000373953.3:c.911A>G	6.37:g.35259494A>G	ENSP00000363064:p.Asn304Ser		Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	18	0.17	3	NM_003427	60	0.00	0	Q9BQB2	Missense_Mutation	SNP	ENST00000373953.3	37	CCDS4801.1	.	.	.	.	.	.	.	.	.	.	A	26.8	4.774283	0.90108	.	.	ENSG00000065029	ENST00000469195;ENST00000448999;ENST00000373953;ENST00000417184;ENST00000440666;ENST00000339411	T;T;T;T	0.17370	2.28;2.28;2.28;2.28	5.1	5.1	0.69264	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.47852	D	0.000208	T	0.14874	0.0359	N	0.11106	0.095	0.58432	D	0.999991	D;D;D	0.76494	0.997;0.996;0.999	D;D;D	0.83275	0.985;0.99;0.996	T	0.23691	-1.0181	10	0.59425	D	0.04	.	14.2576	0.66062	1.0:0.0:0.0:0.0	.	304;304;304	B7Z851;P36508-2;P36508	.;.;ZNF76_HUMAN	S	304;304;304;304;278;304	ENSP00000419106:N304S;ENSP00000363064:N304S;ENSP00000392243:N278S;ENSP00000344097:N304S	ENSP00000344097:N304S	N	+	2	0	ZNF76	35367472	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.100000	0.94213	2.145000	0.66743	0.533000	0.62120	AAT			0.607	ZNF76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040279.2		NM_003427	
GTF2IRD2P1	401375	broad.mit.edu	37	7	72669366	72669367	+	RNA	INS	-	-	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr7:72669366_72669367insT	ENST00000425256.1	-	0	633									GTF2I repeat domain containing 2 pseudogene 1																		CTTCCCCACAAttttttttttt	0.441																																					.													.	.			0			.																																											0	.			CCCACAATTTTTT	AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72669377_72669377dupT			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	6	0.50	3	.	0		0		RNA	INS	ENST00000425256.1	37																																																																																						0.441	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000345921.1		NR_002164	
ANKIB1	54467	mdanderson.org	37	7	91991528	91991528	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr7:91991528G>T	ENST00000265742.3	+	10	1803	c.1427G>T	c.(1426-1428)tGt>tTt	p.C476F		NM_019004.1	NP_061877.1	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	476							zinc ion binding (GO:0008270)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(19)|skin(1)	41	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			CATGAGCCTTGTGACTGCCAA	0.353																																					p.C476F													.	.			0			c.G1427T												74.0	68.0	70.0					7																	91991528		1844	4096	5940	SO:0001583	missense	54467	exon10			AGCCTTGTGACTG	AB037807	CCDS47639.1	7q21.3	2013-01-10			ENSG00000001629	ENSG00000001629		"""Ankyrin repeat domain containing"""	22215	protein-coding gene	gene with protein product							Standard	NM_019004		Approved	DKFZP434A0225, KIAA1386	uc003ulw.2	Q9P2G1	OTTHUMG00000155859	ENST00000265742.3:c.1427G>T	7.37:g.91991528G>T	ENSP00000265742:p.Cys476Phe		Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_019004	73	0.00	0	Q6GMS4|Q6P3S9|Q9NTD7|Q9NW49	Missense_Mutation	SNP	ENST00000265742.3	37	CCDS47639.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.707642	0.89018	.	.	ENSG00000001629	ENST00000265742	T	0.62941	-0.01	4.93	4.93	0.64822	Zinc finger, C6HC-type (2);	0.000000	0.85682	D	0.000000	T	0.81245	0.4782	M	0.86268	2.805	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.84727	0.0743	10	0.87932	D	0	.	16.6952	0.85333	0.0:0.0:1.0:0.0	.	476	Q9P2G1	AKIB1_HUMAN	F	476	ENSP00000265742:C476F	ENSP00000265742:C476F	C	+	2	0	ANKIB1	91829464	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.526000	0.98042	2.442000	0.82660	0.655000	0.94253	TGT			0.353	ANKIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000342018.1			
PTCD1	26024	mdanderson.org	37	7	99032854	99032854	+	Silent	SNP	C	C	A	rs373379334		TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr7:99032854C>A	ENST00000292478.4	-	2	262	c.12G>T	c.(10-12)gtG>gtT	p.V4V	ATP5J2-PTCD1_ENST00000437572.1_5'UTR|PTCD1_ENST00000485746.1_5'Flank|PTCD1_ENST00000555673.1_Silent_p.V53V|ATP5J2-PTCD1_ENST00000413834.1_Silent_p.V53V	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	4					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			GAGCGAGTCTCACGAAGTCCA	0.552																																					p.V53V													.	.			0			c.G159T												52.0	57.0	55.0					7																	99032854		2203	4299	6502	SO:0001819	synonymous_variant	100526740	exon3			GAGTCTCACGAAG	AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.12G>T	7.37:g.99032854C>A			Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	14	0.14	2	NM_001198879	77	0.00	0	Q3ZB78|Q66K60|Q9UDV2	Silent	SNP	ENST00000292478.4	37	CCDS34691.1																																																																																					0.552	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000336391.1		NM_015545	
FLNC	2318	broad.mit.edu;ucsc.edu	37	7	128490068	128490068	+	Silent	SNP	A	A	G			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr7:128490068A>G	ENST00000325888.8	+	31	5499	c.5238A>G	c.(5236-5238)gaA>gaG	p.E1746E	RP11-309L24.2_ENST00000469965.1_RNA|FLNC_ENST00000346177.6_Intron	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1746	Hinge 1.				cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						AGCCCTCTGAAGTGCCACAGC	0.716																																					p.E1746E													.	FLNC	339		0			c.A5238G												13.0	19.0	17.0					7																	128490068		2080	4186	6266	SO:0001819	synonymous_variant	2318	exon31			CTCTGAAGTGCCA	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.5238A>G	7.37:g.128490068A>G			Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	16	0.25	4	NM_001458	9	0.00	0	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Silent	SNP	ENST00000325888.8	37	CCDS43644.1																																																																																					0.716	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000059948.3			
KCP	375616	broad.mit.edu	37	7	128548294	128548316	+	RNA	DEL	AAGAAAGAAAGAAGAAAGAAAGA	AAGAAAGAAAGAAGAAAGAAAGA	-	rs200627678|rs200276693|rs139059512|rs202067497|rs370991615|rs370653893|rs10565205|rs55898241		TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	AAGAAAGAAAGAAGAAAGAAAGA	AAGAAAGAAAGAAGAAAGAAAGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr7:128548294_128548316delAAGAAAGAAAGAAGAAAGAAAGA	ENST00000476647.2	-	0	263				AC025594.1_ENST00000408474.1_RNA			Q6ZWJ8	KCP_HUMAN	kielin/chordin-like protein							extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)	4						agaagaaaggaagaaagaaagaagaaagaaagaaagaaagaaa	0.372																																					.													.	KCP	16		0			.																																											375616	.			GAAAGGAAGAAAG	AK122706		7q32.3	2009-11-06	2009-02-18	2009-02-18	ENSG00000135253	ENSG00000135253			17585	protein-coding gene	gene with protein product	"""kielin"""	609344	"""cysteine rich BMP regulator 2 (chordin-like)"""	CRIM2		15793581	Standard	NM_001135914		Approved	FLJ33365, NET67	uc011kor.2	Q6ZWJ8	OTTHUMG00000158363		7.37:g.128548294_128548316delAAGAAAGAAAGAAGAAAGAAAGA			Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	5	0.00	0	.	0		0	Q8NBE0	RNA	DEL	ENST00000476647.2	37																																																																																						0.372	KCP-006	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000403051.1		NM_199349	
DUSP4	1846	mdanderson.org	37	8	29207576	29207576	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr8:29207576G>A	ENST00000240100.2	-	1	609	c.220C>T	c.(220-222)Cgg>Tgg	p.R74W	RP4-676L2.1_ENST00000567818.1_RNA|DUSP4_ENST00000240101.2_5'Flank	NM_001394.6	NP_001385.1	Q13115	DUS4_HUMAN	dual specificity phosphatase 4	74	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				endoderm formation (GO:0001706)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein dephosphorylation (GO:0006470)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|protein tyrosine/threonine phosphatase activity (GO:0008330)			endometrium(1)|large_intestine(1)|lung(4)	6				KIRC - Kidney renal clear cell carcinoma(542;0.094)|Kidney(114;0.113)		GCCCGCCGCCGCACGATGGTG	0.682																																					p.R74W													.	.			0			c.C220T												15.0	17.0	16.0					8																	29207576		2185	4285	6470	SO:0001583	missense	1846	exon1			GCCGCCGCACGAT	U21108	CCDS6072.1, CCDS6073.1	8p12-p11	2011-06-09			ENSG00000120875	ENSG00000120875		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3070	protein-coding gene	gene with protein product	"""VH1 homologous phosphatase 2"", ""MAP kinase phosphatase 2"""	602747				7535768, 9205128	Standard	NM_001394		Approved	HVH2, MKP-2, TYP	uc003xhm.3	Q13115	OTTHUMG00000133395	ENST00000240100.2:c.220C>T	8.37:g.29207576G>A	ENSP00000240100:p.Arg74Trp		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_001394	10	0.00	0	B2RBU5|D3DSU4|G5E930|Q13524	Missense_Mutation	SNP	ENST00000240100.2	37	CCDS6072.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.574644	0.86542	.	.	ENSG00000120875	ENST00000240100	T	0.46063	0.88	3.89	3.89	0.44902	Rhodanese-like (5);	0.123056	0.53938	D	0.000054	T	0.62196	0.2408	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.65455	-0.6164	10	0.72032	D	0.01	.	9.1045	0.36689	0.0:0.0:0.7818:0.2182	.	74	Q13115	DUS4_HUMAN	W	74	ENSP00000240100:R74W	ENSP00000240100:R74W	R	-	1	2	DUSP4	29263495	0.997000	0.39634	1.000000	0.80357	0.967000	0.64934	2.576000	0.46033	2.456000	0.83038	0.491000	0.48974	CGG			0.682	DUSP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257249.1		NM_001394	
UBR5	51366	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	103277378	103277378	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr8:103277378C>A	ENST00000520539.1	-	53	8157	c.7551G>T	c.(7549-7551)agG>agT	p.R2517S	UBR5_ENST00000518205.1_Missense_Mutation_p.R245S|UBR5_ENST00000220959.4_Missense_Mutation_p.R2516S|UBR5_ENST00000521922.1_Missense_Mutation_p.R2510S	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	2517	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			TCTTGCCAGGCCTTGGAGTAT	0.358																																					p.R2517S	Ovarian(131;96 1741 5634 7352 27489)												.	.			0			c.G7551T												118.0	116.0	117.0					8																	103277378		2203	4300	6503	SO:0001583	missense	51366	exon53			GCCAGGCCTTGGA	AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.7551G>T	8.37:g.103277378C>A	ENSP00000429084:p.Arg2517Ser		Somatic	115	0	0		WXS	Illumina HiSeq	.	155	0.10	16	NM_015902	124	0.16	20	B2RP24|J3KMW7|O94970|Q9NPL3	Missense_Mutation	SNP	ENST00000520539.1	37	CCDS34933.1	.	.	.	.	.	.	.	.	.	.	C	19.05	3.752675	0.69533	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000518205;ENST00000521922	T;T;T;T	0.55588	0.51;0.51;0.51;0.51	5.26	-1.61	0.08399	HECT (4);	0.058419	0.64402	N	0.000003	T	0.56645	0.1999	L	0.55743	1.74	0.42024	D	0.990997	D;D	0.53462	0.96;0.96	P;P	0.61477	0.889;0.889	T	0.56092	-0.8036	10	0.87932	D	0	.	6.569	0.22529	0.0:0.419:0.2143:0.3667	.	2510;2517	E7EMW7;O95071	.;UBR5_HUMAN	S	2517;2516;245;2510	ENSP00000429084:R2517S;ENSP00000220959:R2516S;ENSP00000428693:R245S;ENSP00000427819:R2510S	ENSP00000220959:R2516S	R	-	3	2	UBR5	103346554	0.724000	0.28038	0.992000	0.48379	0.994000	0.84299	-0.118000	0.10692	-0.275000	0.09219	-0.140000	0.14226	AGG			0.358	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000380075.2		NM_015902	
ADCY8	114	mdanderson.org	37	8	131880105	131880105	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr8:131880105G>T	ENST00000286355.5	-	9	4289	c.2197C>A	c.(2197-2199)Ctt>Att	p.L733I	ADCY8_ENST00000377928.3_Intron	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	733					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			GAAGAAGGAAGCAAACTTTGT	0.348										HNSCC(32;0.087)																											p.L733I													.	.			0			c.C2197A												90.0	81.0	84.0					8																	131880105		2203	4300	6503	SO:0001583	missense	114	exon9			AAGGAAGCAAACT	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.2197C>A	8.37:g.131880105G>T	ENSP00000286355:p.Leu733Ile		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_001115	0		0		Missense_Mutation	SNP	ENST00000286355.5	37	CCDS6363.1	.	.	.	.	.	.	.	.	.	.	G	7.705	0.693942	0.15039	.	.	ENSG00000155897	ENST00000286355	T	0.36878	1.23	5.9	5.9	0.94986	.	0.058076	0.64402	D	0.000001	T	0.24736	0.0600	N	0.16567	0.415	0.80722	D	1	B	0.18013	0.025	B	0.15052	0.012	T	0.08351	-1.0726	10	0.13108	T	0.6	.	17.776	0.88508	0.0:0.0:1.0:0.0	.	733	P40145	ADCY8_HUMAN	I	733	ENSP00000286355:L733I	ENSP00000286355:L733I	L	-	1	0	ADCY8	131949287	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.078000	0.76821	2.806000	0.96561	0.655000	0.94253	CTT			0.348	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000380080.1			
RHPN1	114822	mdanderson.org	37	8	144462334	144462334	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr8:144462334G>A	ENST00000289013.6	+	10	1306	c.1205G>A	c.(1204-1206)cGc>cAc	p.R402H		NM_052924.2	NP_443156.2	Q8TCX5	RHPN1_HUMAN	rhophilin, Rho GTPase binding protein 1	427	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)		small GTPase regulator activity (GO:0005083)			endometrium(1)|large_intestine(1)|lung(7)	9	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.156)			CTGGAGGAGCGCAGGCAGCTT	0.682																																					p.R402H													.	.			0			c.G1205A												8.0	11.0	10.0					8																	144462334		1988	4001	5989	SO:0001583	missense	114822	exon10			AGGAGCGCAGGCA	AB067516	CCDS47927.1	8q24.3	2003-02-06			ENSG00000158106	ENSG00000158106			19973	protein-coding gene	gene with protein product		601031				11572484	Standard	NM_052924		Approved	KIAA1929, RHPN, ODF5	uc003yyb.3	Q8TCX5	OTTHUMG00000165006	ENST00000289013.6:c.1205G>A	8.37:g.144462334G>A	ENSP00000289013:p.Arg402His		Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	28	0.11	3	NM_052924	9	0.00	0	Q8TAV1|Q96PV9	Missense_Mutation	SNP	ENST00000289013.6	37	CCDS47927.1	.	.	.	.	.	.	.	.	.	.	G	14.64	2.595447	0.46318	.	.	ENSG00000158106	ENST00000289013	T	0.56941	0.43	3.96	2.04	0.26737	.	0.177666	0.47852	N	0.000204	T	0.70090	0.3184	M	0.85777	2.775	0.37549	D	0.918638	D	0.89917	1.0	D	0.76071	0.987	T	0.72001	-0.4422	10	0.72032	D	0.01	-20.4788	7.6973	0.28602	0.0965:0.1653:0.7382:0.0	.	402	Q8TCX5-2	.	H	402	ENSP00000289013:R402H	ENSP00000289013:R402H	R	+	2	0	RHPN1	144533477	0.082000	0.21442	0.869000	0.34112	0.059000	0.15707	1.990000	0.40717	0.233000	0.21120	-0.350000	0.07774	CGC			0.682	RHPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381417.1			
Unknown	0	bcgsc.ca	37	9	68433564	68433564	+	IGR	SNP	C	C	A			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr9:68433564C>A								MIR4477B (18176 upstream) : CR786580.2 (78781 downstream)																							AAGCCATTTTCCCCTAAGTGA	0.338																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			CATTTTCCCCTAA																													9.37:g.68433564C>A			Somatic	129	0.015503876	2		WXS	Illumina HiSeq	Phase_1	149	0.06	9	.	0		0		RNA	SNP		37																																																																																					0	0.338										
LOC100132077	100132077	broad.mit.edu	37	9	97108464	97108464	+	lincRNA	DEL	T	T	-			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr9:97108464delT	ENST00000454869.1	+	0	698					NR_033937.1																						aaaaaCAATCttttttttttg	0.433																																					.													.	.			0			.																																											0	.			ACAATCTTTTTTT																													9.37:g.97108464delT			Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	14	0.36	5	.	0		0		RNA	DEL	ENST00000454869.1	37																																																																																						0.433	RP11-307E17.8-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000053177.1			
ZNF782	158431	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	99581871	99581871	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr9:99581871C>A	ENST00000481138.1	-	6	1095	c.434G>T	c.(433-435)tGc>tTc	p.C145F	ZNF782_ENST00000535338.1_Missense_Mutation_p.C13F|ZNF782_ENST00000466833.1_5'UTR	NM_001001662.1	NP_001001662.1	Q6ZMW2	ZN782_HUMAN	zinc finger protein 782	145					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(8)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)	33		Acute lymphoblastic leukemia(62;0.0527)				GAGCCCCTGGCAAGCAGACCC	0.438																																					p.C145F													.	.			0			c.G434T												98.0	101.0	100.0					9																	99581871		2203	4300	6503	SO:0001583	missense	158431	exon6			CCCTGGCAAGCAG	AK131468	CCDS35075.1	9q22.33	2013-01-08			ENSG00000196597	ENSG00000196597		"""Zinc fingers, C2H2-type"", ""-"""	33110	protein-coding gene	gene with protein product							Standard	NM_001001662		Approved	FLJ16636	uc004awp.1	Q6ZMW2	OTTHUMG00000020310	ENST00000481138.1:c.434G>T	9.37:g.99581871C>A	ENSP00000419397:p.Cys145Phe		Somatic	64	0	0		WXS	Illumina HiSeq	.	56	0.09	5	NM_001001662	7	0.29	2	B2RNR0	Missense_Mutation	SNP	ENST00000481138.1	37	CCDS35075.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.326|1.326	-0.598082|-0.598082	0.03744|0.03744	.|.	.|.	ENSG00000196597|ENSG00000196597	ENST00000481138;ENST00000535338;ENST00000478850|ENST00000289032	T;T;T|.	0.04654|.	3.66;3.58;6.19|.	3.53|3.53	-1.82|-1.82	0.07857|0.07857	.|.	0.950157|.	0.08533|.	N|.	0.931676|.	T|T	0.06781|0.06781	0.0173|0.0173	N|N	0.00677|0.00677	-1.265|-1.265	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.34976|0.34976	-0.9807|-0.9807	9|5	.|.	.|.	.|.	.|.	2.8884|2.8884	0.05668|0.05668	0.3397:0.3154:0.0:0.3449|0.3397:0.3154:0.0:0.3449	.|.	145|.	Q6ZMW2|.	ZN782_HUMAN|.	F|F	145;13;145|133	ENSP00000419397:C145F;ENSP00000440624:C13F;ENSP00000417577:C145F|.	.|.	C|L	-|-	2|3	0|2	ZNF782|ZNF782	98621692|98621692	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.033000|0.033000	0.12548|0.12548	-1.123000|-1.123000	0.03263|0.03263	-0.325000|-0.325000	0.08577|0.08577	-0.250000|-0.250000	0.11733|0.11733	TGC|TTG			0.438	ZNF782-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356810.1		NM_001001662	
TTF1	7270	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	135275424	135275424	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr9:135275424T>C	ENST00000334270.2	-	3	1628	c.1589A>G	c.(1588-1590)cAa>cGa	p.Q530R		NM_001205296.1|NM_007344.3	NP_001192225.1|NP_031370.2	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase I	530					chromatin remodeling (GO:0006338)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|negative regulation of DNA replication (GO:0008156)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		AAGCTCACCTTGTGCTTTAAA	0.448																																					p.Q530R													.	.			0			c.A1589G												135.0	126.0	129.0					9																	135275424		2203	4300	6503	SO:0001583	missense	7270	exon3			TCACCTTGTGCTT	BC050734	CCDS6948.1, CCDS75925.1	9q34.3	2008-02-05			ENSG00000125482	ENSG00000125482			12397	protein-coding gene	gene with protein product		600777				7597036	Standard	NM_007344		Approved		uc004cbl.3	Q15361	OTTHUMG00000020836	ENST00000334270.2:c.1589A>G	9.37:g.135275424T>C	ENSP00000333920:p.Gln530Arg		Somatic	149	0	0		WXS	Illumina HiSeq	.	148	0.21	31	NM_007344	42	0.31	13	A1L160|Q4VXF3|Q58EY2|Q6P5T5	Missense_Mutation	SNP	ENST00000334270.2	37	CCDS6948.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.032803	0.75504	.	.	ENSG00000125482	ENST00000334270;ENST00000245588	T	0.14893	2.47	5.14	3.96	0.45880	.	0.000000	0.64402	D	0.000006	T	0.29882	0.0747	M	0.63843	1.955	0.35413	D	0.792571	D	0.63880	0.993	P	0.58391	0.838	T	0.38222	-0.9671	10	0.59425	D	0.04	.	8.3523	0.32310	0.1737:0.0:0.0:0.8263	.	530	Q15361	TTF1_HUMAN	R	530	ENSP00000333920:Q530R	ENSP00000245588:Q530R	Q	-	2	0	TTF1	134265245	1.000000	0.71417	0.960000	0.40013	0.916000	0.54674	2.329000	0.43876	1.951000	0.56629	0.460000	0.39030	CAA			0.448	TTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054784.2		NM_007344	
DDX31	64794	broad.mit.edu	37	9	135537931	135537931	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr9:135537931G>T	ENST00000372159.3	-	2	693	c.542C>A	c.(541-543)cCa>cAa	p.P181Q	DDX31_ENST00000544003.1_Missense_Mutation_p.P85Q|DDX31_ENST00000480876.1_5'UTR|DDX31_ENST00000438527.3_Missense_Mutation_p.P52Q|DDX31_ENST00000310532.2_Missense_Mutation_p.P181Q|DDX31_ENST00000372153.1_Missense_Mutation_p.P181Q	NM_022779.7	NP_073616.6	Q9H8H2	DDX31_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 31	181						nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(145;2.67e-06)|Epithelial(140;7.61e-05)		ATGCTTCTTTGGAGAAAACAT	0.413																																					p.P181Q													.	DDX31	76		0			c.C542A												178.0	175.0	176.0					9																	135537931		2203	4300	6503	SO:0001583	missense	64794	exon2			TTCTTTGGAGAAA	AF427339	CCDS6951.1, CCDS6952.1	9q34.2	2012-04-17	2003-06-13		ENSG00000125485	ENSG00000125485		"""DEAD-boxes"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16715	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 25"""		"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31"""				Standard	NM_022779		Approved	FLJ13633, FLJ23349, FLJ14578, PPP1R25	uc004cbq.1	Q9H8H2	OTTHUMG00000020843	ENST00000372159.3:c.542C>A	9.37:g.135537931G>T	ENSP00000361232:p.Pro181Gln		Somatic	148	0.0067567568	1		WXS	Illumina HiSeq	Phase_I	144	0.03	5	NM_022779	66	0.00	0	Q5K6N2|Q5K6N3|Q5K6N4|Q5VZJ4|Q5VZJ9|Q96E91|Q96NY2|Q96SX5|Q9H5K6	Missense_Mutation	SNP	ENST00000372159.3	37	CCDS6951.1	.	.	.	.	.	.	.	.	.	.	G	10.92	1.487467	0.26686	.	.	ENSG00000125485	ENST00000372159;ENST00000372155;ENST00000372153;ENST00000438527;ENST00000310532;ENST00000544003	T;T;T;T;T	0.54071	4.42;3.98;4.39;3.56;0.59	5.6	3.75	0.43078	.	0.058655	0.64402	D	0.000002	T	0.52693	0.1750	L	0.34521	1.04	0.40342	D	0.979047	D;D;B	0.53885	0.958;0.963;0.437	P;P;B	0.55508	0.563;0.777;0.091	T	0.50457	-0.8826	10	0.41790	T	0.15	-4.5583	10.712	0.45988	0.0715:0.1318:0.7967:0.0	.	181;181;181	Q9H8H2-2;Q9H8H2-3;Q9H8H2	.;.;DDX31_HUMAN	Q	181;181;181;52;181;85	ENSP00000361232:P181Q;ENSP00000361226:P181Q;ENSP00000387730:P52Q;ENSP00000310539:P181Q;ENSP00000442425:P85Q	ENSP00000310539:P181Q	P	-	2	0	DDX31	134527752	1.000000	0.71417	0.627000	0.29227	0.107000	0.19398	3.456000	0.53000	0.700000	0.31782	0.655000	0.94253	CCA			0.413	DDX31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000054794.1		NM_138620	
NOTCH1	4851	mdanderson.org	37	9	139399468	139399468	+	Missense_Mutation	SNP	G	G	T	rs370713185		TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr9:139399468G>T	ENST00000277541.6	-	26	4750	c.4675C>A	c.(4675-4677)Ctg>Atg	p.L1559M		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	1559					anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L1559L(1)|p.L1560L(1)		breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GCACAGTCCAGCCCGTCCCAC	0.682			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																											p.L1559M				Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	NOTCH1_ENST00000277541,NS,lymphoid_neoplasm,0,2	NOTCH1_ENST00000277541	0	2	2	Substitution - coding silent(2)	haematopoietic_and_lymphoid_tissue(2)	c.C4675A												17.0	23.0	21.0					9																	139399468		2179	4282	6461	SO:0001583	missense	4851	exon26			AGTCCAGCCCGTC	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.4675C>A	9.37:g.139399468G>T	ENSP00000277541:p.Leu1559Met		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	44	0.09	4	NM_017617	29	0.00	0	Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	37	CCDS43905.1	.	.	.	.	.	.	.	.	.	.	G	17.67	3.447010	0.63178	.	.	ENSG00000148400	ENST00000277541	T	0.81415	-1.49	4.08	3.16	0.36331	Notch domain (5);	0.000000	0.64402	U	0.000002	D	0.86560	0.5962	M	0.68952	2.095	0.58432	D	0.999994	D	0.89917	1.0	D	0.97110	1.0	D	0.86123	0.1570	10	0.46703	T	0.11	.	11.048	0.47870	0.095:0.0:0.905:0.0	.	1559	P46531	NOTC1_HUMAN	M	1559	ENSP00000277541:L1559M	ENSP00000277541:L1559M	L	-	1	2	NOTCH1	138519289	0.998000	0.40836	1.000000	0.80357	0.962000	0.63368	2.601000	0.46249	1.814000	0.52955	0.579000	0.79373	CTG			0.682	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055087.1		NM_017617	
TPRN	286262	mdanderson.org	37	9	140094386	140094386	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr9:140094386G>T	ENST00000409012.4	-	1	864	c.778C>A	c.(778-780)Cac>Aac	p.H260N	TPRN_ENST00000321773.2_Missense_Mutation_p.H199N|TPRN_ENST00000541945.1_Intron	NM_001128228.2	NP_001121700.2	Q4KMQ1	TPRN_HUMAN	taperin	260	Pro-rich.				sensory perception of sound (GO:0007605)	stereocilium (GO:0032420)				breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)	8						GGGGGCGGGTGGAGGGAGGGA	0.751																																					p.H260N													.	.			0			c.C778A												2.0	2.0	2.0					9																	140094386		547	1295	1842	SO:0001583	missense	286262	exon1			GCGGGTGGAGGGA	AK074735	CCDS56594.1	9q34.3	2011-01-06	2010-03-24	2010-03-24	ENSG00000176058	ENSG00000176058			26894	protein-coding gene	gene with protein product		613354	"""chromosome 9 open reading frame 75"", ""deafness, autosomal recessive 79"""	C9orf75, DFNB79		20170898, 20170899	Standard	NM_001128228		Approved	FLJ90254	uc004clu.3	Q4KMQ1	OTTHUMG00000020984	ENST00000409012.4:c.778C>A	9.37:g.140094386G>T	ENSP00000387100:p.His260Asn		Somatic	12	0	0		WXS	Illumina HiSeq	Phase_I	26	0.08	2	NM_001128228	15	0.00	0	B7ZKU5|Q5VSG5|Q5VSG6|Q6IPP2|Q8NCH2	Missense_Mutation	SNP	ENST00000409012.4	37	CCDS56594.1	.	.	.	.	.	.	.	.	.	.	G	10.42	1.343926	0.24339	.	.	ENSG00000176058	ENST00000333046;ENST00000409012;ENST00000321773	.	.	.	3.3	1.39	0.22231	.	.	.	.	.	T	0.27489	0.0675	L	0.29908	0.895	0.22280	N	0.999234	B	0.28026	0.198	B	0.26864	0.074	T	0.17992	-1.0351	8	0.41790	T	0.15	.	5.7452	0.18116	0.3822:0.0:0.6178:0.0	.	260	Q4KMQ1	TPRN_HUMAN	N	58;260;199	.	ENSP00000313704:H199N	H	-	1	0	TPRN	139214207	0.829000	0.29322	0.309000	0.25155	0.935000	0.57460	0.365000	0.20348	-0.002000	0.14469	0.306000	0.20318	CAC			0.751	TPRN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000055323.3		NM_173691	
MT-ND2	4536	hgsc.bcm.edu;broad.mit.edu	37	M	2573	2573	+	5'Flank	SNP	G	G	A			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chrM:2573G>A	ENST00000361453.3	+	0	0				MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TW_ENST00000387382.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						TTTAACGGCCGCGGTACCCTA	0.493																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	6053	.			GGCCGCGGTACCC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2573G>A	Exception_encountered		Somatic	49	0	0		WXS	Illumina HiSeq	.	48	0.19	9	.	0		0	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	ENST00000361453.3	37																																																																																						0.493	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024027	
NAP1L3	4675	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	92927246	92927246	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chrX:92927246G>C	ENST00000373079.3	-	1	1321	c.1058C>G	c.(1057-1059)cCt>cGt	p.P353R	NAP1L3_ENST00000475430.2_Missense_Mutation_p.P346R|FAM133A_ENST00000355813.5_5'Flank|FAM133A_ENST00000538690.1_5'Flank|FAM133A_ENST00000322139.4_5'Flank|FAM133A_ENST00000332647.4_5'Flank	NM_004538.5	NP_004529.2	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	353					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	34						GTAACTTACAGGCTGGCCAGG	0.408																																					p.P353R													.	NAP1L3	81		0			c.C1058G												47.0	44.0	45.0					X																	92927246		2203	4300	6503	SO:0001583	missense	4675	exon1			CTTACAGGCTGGC		CCDS14465.1	Xq21.3-q22	2008-08-01			ENSG00000186310	ENSG00000186310			7639	protein-coding gene	gene with protein product		300117				8976385	Standard	NM_004538		Approved	MB20, NPL3, MGC26312	uc004efq.3	Q99457	OTTHUMG00000021974	ENST00000373079.3:c.1058C>G	X.37:g.92927246G>C	ENSP00000362171:p.Pro353Arg		Somatic	98	0.0102040816	1		WXS	Illumina HiSeq	Phase_I	114	0.26	30	NM_004538	20	0.30	6	B2RCM0|O60788	Missense_Mutation	SNP	ENST00000373079.3	37	CCDS14465.1	.	.	.	.	.	.	.	.	.	.	G	13.47	2.245928	0.39697	.	.	ENSG00000186310	ENST00000373079;ENST00000543136	T	0.26067	1.76	3.68	2.81	0.32909	.	0.054104	0.85682	D	0.000000	T	0.39200	0.1069	L	0.48218	1.51	0.35695	D	0.815181	D	0.89917	1.0	D	0.87578	0.998	T	0.48281	-0.9049	10	0.72032	D	0.01	.	8.34	0.32239	0.1234:0.0:0.8766:0.0	.	353	Q99457	NP1L3_HUMAN	R	353;346	ENSP00000362171:P353R	ENSP00000362171:P353R	P	-	2	0	NAP1L3	92813902	1.000000	0.71417	0.434000	0.26772	0.734000	0.41952	3.096000	0.50243	0.931000	0.37242	0.529000	0.55759	CCT			0.408	NAP1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057449.1		NM_004538	
PNCK	139728	broad.mit.edu	37	X	152939604	152939604	+	5'Flank	SNP	G	G	T			TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chrX:152939604G>T	ENST00000370150.1	-	0	0				PNCK_ENST00000475172.1_5'Flank|PNCK_ENST00000393831.2_5'UTR|PNCK_ENST00000340888.3_5'Flank|PNCK_ENST00000370142.1_Intron|PNCK_ENST00000447676.2_Silent_p.A9A|PNCK_ENST00000370145.4_5'Flank			Q6P2M8	KCC1B_HUMAN	pregnancy up-regulated nonubiquitous CaM kinase							cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			breast(2)|lung(3)|skin(1)	6	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGGCTGACCCGGCCACTTGCC	0.667																																					p.A9A													.	PNCK	70		0			c.C27A												31.0	31.0	31.0					X																	152939604		1565	3574	5139	SO:0001631	upstream_gene_variant	139728	exon1			TGACCCGGCCACT	BC033746	CCDS35503.2, CCDS48189.1	Xq28	2013-10-14	2013-10-14		ENSG00000130822	ENSG00000130822			13415	protein-coding gene	gene with protein product		300680	"""pregnancy upregulated non-ubiquitously expressed CaM kinase"", ""pregnancy up-regulated non-ubiquitously expressed CaM kinase"""			12477932	Standard	NM_001039582		Approved	MGC45419, CaMK1b	uc011myu.2	Q6P2M8	OTTHUMG00000024216		X.37:g.152939604G>T	Exception_encountered		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	54	0.07	4	NM_001039582	1	0.00	0	B4DJR8|B4E1A6|B7WPG0|D3DWU7|Q8N4R0	Silent	SNP	ENST00000370150.1	37																																																																																						0.667	PNCK-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000061044.2		NM_198452	
ABCD1	215	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	X	152991228	152991228	+	Missense_Mutation	SNP	C	C	A	rs398123112		TCGA-2G-AAFG-01A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb18732a-4468-45f8-b285-a159c6251ec5	b3717c8e-343c-48c0-8d20-5035da43230c	g.chrX:152991228C>A	ENST00000218104.3	+	1	906	c.507C>A	c.(505-507)caC>caA	p.H169Q	ABCD1_ENST00000370129.4_5'Flank|BCAP31_ENST00000458587.2_5'Flank|BCAP31_ENST00000345046.6_5'Flank|BCAP31_ENST00000441714.1_5'Flank	NM_000033.3	NP_000024.2	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member 1	169	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.|Interaction with PEX19.				alpha-linolenic acid metabolic process (GO:0036109)|ATP catabolic process (GO:0006200)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|linoleic acid metabolic process (GO:0043651)|long-chain fatty acid catabolic process (GO:0042758)|peroxisomal long-chain fatty acid import (GO:0015910)|peroxisomal membrane transport (GO:0015919)|peroxisome organization (GO:0007031)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid catabolic process (GO:0042760)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|peroxisomal fatty-acyl-CoA transporter activity (GO:0005325)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(2)	18	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGGTGGCCCACGCCTACCGCC	0.637																																					p.H169Q													.	.			0			c.C507A												54.0	47.0	49.0					X																	152991228		2203	4299	6502	SO:0001583	missense	215	exon1			GGCCCACGCCTAC	Z21876	CCDS14728.1	Xq28	2012-03-14			ENSG00000101986	ENSG00000101986		"""ATP binding cassette transporters / subfamily D"""	61	protein-coding gene	gene with protein product		300371		ALD		8441467, 6795626	Standard	NM_000033		Approved	AMN, ALDP, adrenoleukodystrophy	uc004fif.2	P33897	OTTHUMG00000024215	ENST00000218104.3:c.507C>A	X.37:g.152991228C>A	ENSP00000218104:p.His169Gln		Somatic	58	0	0		WXS	Illumina HiSeq	.	61	0.16	10	NM_000033	41	0.22	9	Q6GTZ2	Missense_Mutation	SNP	ENST00000218104.3	37	CCDS14728.1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.042981	0.55003	.	.	ENSG00000101986	ENST00000218104	D	0.99701	-6.45	5.37	-9.33	0.00639	ABC transporter, N-terminal (1);ABC transporter, integral membrane type 1 (1);	0.000000	0.85682	D	0.000000	D	0.99661	0.9874	M	0.92555	3.32	0.58432	D	0.999997	D	0.69078	0.997	D	0.74348	0.983	D	0.99865	1.1088	10	0.66056	D	0.02	-28.4494	21.1647	0.99947	0.0:0.1486:0.0:0.8514	.	169	P33897	ABCD1_HUMAN	Q	169	ENSP00000218104:H169Q	ENSP00000218104:H169Q	H	+	3	2	ABCD1	152644422	0.000000	0.05858	0.307000	0.25127	0.973000	0.67179	-1.768000	0.01794	-2.757000	0.00371	-0.395000	0.06472	CAC			0.637	ABCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000061041.1		NM_000033	
