#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
LINC01128	643837	broad.mit.edu	37	1	761957	761958	+	RNA	INS	-	-	T	rs146405013|rs59038458|rs115523412	byFrequency	TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr1:761957_761958insT	ENST00000445118.2	+	0	0				LINC00115_ENST00000473798.1_lincRNA	NR_047519.1|NR_047520.1|NR_047521.1|NR_047522.1|NR_047523.1|NR_047524.1|NR_047525.1																						TCAGAAAACCACTAAGGAATTT	0.386													|||unknown(NO_COVERAGE)	1328	0.265176	0.0499	0.2723	5008	,	,		9059	0.4514		0.3598	False		,,,				2504	0.2618				.													.	.			0			.																																											0	.			AAAACCACTAAGG																													1.37:g.761957_761958insT			Somatic	38	0.8421052632	32		WXS	Illumina HiSeq	Phase_I	36	0.92	33	.	0		0		RNA	INS	ENST00000445118.2	37																																																																																						0.386	RP11-206L10.11-001	KNOWN	basic	lincRNA	processed_transcript		OTTHUMT00000007015.2			
ARHGEF16	27237	mdanderson.org	37	1	3396390	3396390	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr1:3396390G>T	ENST00000378378.4	+	14	2308	c.1903G>T	c.(1903-1905)Gag>Tag	p.E635*	ARHGEF16_ENST00000413250.2_Nonsense_Mutation_p.E339*|ARHGEF16_ENST00000378371.2_Nonsense_Mutation_p.E347*|ARHGEF16_ENST00000378373.1_Nonsense_Mutation_p.E347*	NM_014448.3	NP_055263.2	Q5VV41	ARHGG_HUMAN	Rho guanine nucleotide exchange factor (GEF) 16	635	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				activation of Cdc42 GTPase activity (GO:0032864)|activation of Rac GTPase activity (GO:0032863)|apoptotic signaling pathway (GO:0097190)|cell chemotaxis (GO:0060326)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	PDZ domain binding (GO:0030165)|receptor tyrosine kinase binding (GO:0030971)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			lung(6)|ovary(1)	7	all_cancers(77;0.00276)|all_epithelial(69;0.00102)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.101)	all_epithelial(116;7.14e-21)|all_lung(118;2.24e-08)|Lung NSC(185;3.55e-06)|Breast(487;0.000765)|Renal(390;0.00121)|Hepatocellular(190;0.0046)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.211)		Epithelial(90;8.62e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.62e-22)|GBM - Glioblastoma multiforme(42;2.49e-12)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000681)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		GCCCCAGGTGGAGATCACCAA	0.647																																					p.E635X													.	.			0			c.G1903T												104.0	94.0	98.0					1																	3396390		2202	4298	6500	SO:0001587	stop_gained	27237	exon14			CAGGTGGAGATCA	D89016	CCDS46.2	1p36.3	2013-01-10	2010-04-13		ENSG00000130762	ENSG00000130762		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15515	protein-coding gene	gene with protein product	"""putative neuroblastoma protein"""						Standard	NM_014448		Approved	NBR, GEF16	uc001akg.4	Q5VV41	OTTHUMG00000000625	ENST00000378378.4:c.1903G>T	1.37:g.3396390G>T	ENSP00000367629:p.Glu635*		Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_014448	96	0.00	0	Q86TF0|Q99434	Nonsense_Mutation	SNP	ENST00000378378.4	37	CCDS46.2	.	.	.	.	.	.	.	.	.	.	G	39	7.695659	0.98438	.	.	ENSG00000130762	ENST00000378378;ENST00000378373;ENST00000378371;ENST00000413250	.	.	.	4.86	3.88	0.44766	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-39.9931	14.5141	0.67807	0.0:0.1476:0.8524:0.0	.	.	.	.	X	635;347;347;339	.	ENSP00000367622:E347X	E	+	1	0	ARHGEF16	3386250	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	4.435000	0.59941	2.253000	0.74438	0.491000	0.48974	GAG			0.647	ARHGEF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000001515.1		NM_014448	
ECE1	1889	broad.mit.edu	37	1	21586876	21586876	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr1:21586876G>A	ENST00000374893.6	-	5	577	c.503C>T	c.(502-504)aCg>aTg	p.T168M	ECE1_ENST00000264205.6_Missense_Mutation_p.T165M|ECE1_ENST00000357071.4_Missense_Mutation_p.T156M|ECE1_ENST00000415912.2_Missense_Mutation_p.T152M|ECE1_ENST00000436918.2_Missense_Mutation_p.T168M	NM_001397.2	NP_001388.1	P42892	ECE1_HUMAN	endothelin converting enzyme 1	168					bradykinin catabolic process (GO:0010815)|calcitonin catabolic process (GO:0010816)|ear development (GO:0043583)|embryonic digit morphogenesis (GO:0042733)|endothelin maturation (GO:0034959)|heart development (GO:0007507)|hormone catabolic process (GO:0042447)|peptide hormone processing (GO:0016486)|pharyngeal system development (GO:0060037)|positive regulation of receptor recycling (GO:0001921)|protein processing (GO:0016485)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|substance P catabolic process (GO:0010814)	early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intrinsic component of endosome membrane (GO:0031302)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)|Weibel-Palade body (GO:0033093)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide hormone binding (GO:0017046)|protein homodimerization activity (GO:0042803)			endometrium(5)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	25		Lung NSC(340;1.14e-05)|all_lung(284;1.23e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00147)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0183)|OV - Ovarian serous cystadenocarcinoma(117;4.83e-27)|COAD - Colon adenocarcinoma(152;1.36e-06)|GBM - Glioblastoma multiforme(114;1.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000162)|STAD - Stomach adenocarcinoma(196;0.00326)|KIRC - Kidney renal clear cell carcinoma(1967;0.00755)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.206)		CACGCTGGCCGTGGAGTTTtc	0.572																																					p.T168M													.	ECE1	76		0			c.C503T												209.0	189.0	196.0					1																	21586876		2203	4300	6503	SO:0001583	missense	1889	exon5			CTGGCCGTGGAGT	D49471	CCDS215.1, CCDS44081.1, CCDS44082.1, CCDS44083.1	1p36.1	2008-02-05			ENSG00000117298	ENSG00000117298			3146	protein-coding gene	gene with protein product		600423		ECE		7805846, 7864876, 17592116	Standard	NM_001397		Approved		uc001bei.2	P42892	OTTHUMG00000002625	ENST00000374893.6:c.503C>T	1.37:g.21586876G>A	ENSP00000364028:p.Thr168Met		Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	108	0.04	4	NM_001397	24	0.00	0	A8K3P1|B4E291|Q14217|Q17RN5|Q2Z2K8|Q58GE7|Q5THM5|Q5THM7|Q5THM8|Q9UJQ6|Q9UPF4|Q9UPM4|Q9Y501	Missense_Mutation	SNP	ENST00000374893.6	37	CCDS215.1	.	.	.	.	.	.	.	.	.	.	G	16.00	2.999695	0.54147	.	.	ENSG00000117298	ENST00000415912;ENST00000357071;ENST00000374893;ENST00000436918;ENST00000264205;ENST00000473505	T;T;T;T;T;T	0.74842	-0.88;-0.88;-0.88;-0.88;-0.88;-0.88	5.34	4.39	0.52855	Peptidase M13 (1);	0.198811	0.42053	D	0.000777	T	0.82245	0.4995	L	0.59436	1.845	0.44098	D	0.99686	P;D;D;D;D	0.89917	0.661;1.0;0.965;1.0;1.0	B;D;P;D;D	0.66847	0.227;0.946;0.647;0.947;0.911	T	0.82697	-0.0329	10	0.49607	T	0.09	-16.4304	14.8139	0.70017	0.0:0.1441:0.8559:0.0	.	168;152;168;156;165	B4DKB2;Q2Z2K8;P42892;P42892-2;P42892-4	.;.;ECE1_HUMAN;.;.	M	152;156;168;168;165;54	ENSP00000405088:T152M;ENSP00000349581:T156M;ENSP00000364028:T168M;ENSP00000388439:T168M;ENSP00000264205:T165M;ENSP00000431856:T54M	ENSP00000264205:T165M	T	-	2	0	ECE1	21459463	1.000000	0.71417	0.992000	0.48379	0.695000	0.40330	4.967000	0.63722	2.496000	0.84212	0.313000	0.20887	ACG			0.572	ECE1-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000007470.2		NM_001397	
COL11A1	1301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	103488447	103488447	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr1:103488447C>A	ENST00000370096.3	-	8	1408	c.1096G>T	c.(1096-1098)Gac>Tac	p.D366Y	COL11A1_ENST00000353414.4_Missense_Mutation_p.D327Y|COL11A1_ENST00000358392.2_Missense_Mutation_p.D378Y|COL11A1_ENST00000512756.1_Intron	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	366	Nonhelical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TCCCTGCCGTCTATTTCTTTG	0.348																																					p.D378Y													COL11A1,NS,carcinoma,+2,1	COL11A1	2	1	0			c.G1132T												74.0	73.0	74.0					1																	103488447		2203	4300	6503	SO:0001583	missense	1301	exon8			TGCCGTCTATTTC	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.1096G>T	1.37:g.103488447C>A	ENSP00000359114:p.Asp366Tyr		Somatic	147	0	0		WXS	Illumina HiSeq	.	125	0.12	15	NM_080629	0		0	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	15.56	2.870096	0.51588	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000427239	D;T;D;T	0.88509	-2.37;-0.63;-2.39;-0.58	5.67	4.74	0.60224	.	0.377600	0.27482	N	0.019168	D	0.92561	0.7637	M	0.84846	2.72	0.51012	D	0.999902	D;D;D	0.69078	0.983;0.997;0.971	P;D;P	0.63192	0.874;0.912;0.751	D	0.92348	0.5887	10	0.41790	T	0.15	.	14.7752	0.69726	0.0:0.8561:0.1439:0.0	.	327;378;366	P12107-3;P12107-2;P12107	.;.;COBA1_HUMAN	Y	366;378;327;378	ENSP00000359114:D366Y;ENSP00000351163:D378Y;ENSP00000302551:D327Y;ENSP00000408640:D378Y	ENSP00000302551:D327Y	D	-	1	0	COL11A1	103261035	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	5.141000	0.64814	1.332000	0.45431	0.643000	0.83706	GAC			0.348	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000029997.1		NM_080630	
OLFML3	56944	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	114524091	114524091	+	Silent	SNP	C	C	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr1:114524091C>T	ENST00000320334.4	+	3	995	c.921C>T	c.(919-921)gaC>gaT	p.D307D	OLFML3_ENST00000369551.1_Silent_p.D287D|OLFML3_ENST00000491700.1_3'UTR|OLFML3_ENST00000393300.2_Silent_p.D287D	NM_020190.2	NP_064575.1	Q9NRN5	OLFL3_HUMAN	olfactomedin-like 3	307	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)|vesicle (GO:0031982)				breast(1)|endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|skin(2)|urinary_tract(1)	14	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGACACTGGACACAGAGCAGC	0.557																																					p.D307D													OLFML3,NS,carcinoma,+2,1	OLFML3	2	1	0			c.C921T												98.0	81.0	87.0					1																	114524091		2203	4300	6503	SO:0001819	synonymous_variant	56944	exon3			ACTGGACACAGAG	AF201945	CCDS870.1, CCDS65618.1, CCDS72839.1	1p13.1	2008-02-05			ENSG00000116774	ENSG00000116774			24956	protein-coding gene	gene with protein product		610088					Standard	NM_001286353		Approved	HNOEL-iso, OLF44	uc001eer.1	Q9NRN5	OTTHUMG00000011980	ENST00000320334.4:c.921C>T	1.37:g.114524091C>T			Somatic	95	0	0		WXS	Illumina HiSeq	.	115	0.13	15	NM_020190	54	0.02	1	Q53FR1|Q53HV9|Q5SQL6|Q69AX9|Q8NBJ2	Silent	SNP	ENST00000320334.4	37	CCDS870.1																																																																																					0.557	OLFML3-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033119.1		NM_020190	
NBPF10	100132406	hgsc.bcm.edu	37	1	145293535	145293535	+	Missense_Mutation	SNP	C	C	G	rs55936365		TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr1:145293535C>G	ENST00000369339.3	+	3	383	c.130C>G	c.(130-132)Cta>Gta	p.L44V	RP11-458D21.5_ENST00000468030.1_3'UTR|NBPF10_ENST00000369338.1_Intron|NBPF10_ENST00000342960.5_Missense_Mutation_p.L44V			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	315						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.L44V(2)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GAAATGTTTTCTAACTCAACT	0.443																																					p.L44V													NBPF10,NS,carcinoma,0,2	NBPF10	0	2	2	Substitution - Missense(2)	kidney(2)	c.C130G																																									SO:0001583	missense	100132406	exon1			TGTTTTCTAACTC	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369339.3:c.130C>G	1.37:g.145293535C>G	ENSP00000358345:p.Leu44Val		Somatic	73	0.0273972603	2		WXS	Illumina HiSeq	.	49	0.06	3	NM_001039703	1	0.00	0	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000369339.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.027|0.027	-1.360141|-1.360141	0.01245|0.01245	.|.	.|.	ENSG00000163386|ENSG00000163386	ENST00000369339;ENST00000342960|ENST00000448873	T|.	0.02837|.	4.14|.	0.687|0.687	-1.37|-1.37	0.09056|0.09056	.|.	.|.	.|.	.|.	.|.	T|T	0.01765|0.01765	0.0056|0.0056	N|N	0.01122|0.01122	-1.005|-1.005	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.33007|0.33007	-0.9885|-0.9885	9|6	0.02654|0.33141	T|T	1|0.24	.|.	3.2142|3.2142	0.06692|0.06692	0.3787:0.2355:0.3858:0.0|0.3787:0.2355:0.3858:0.0	rs55936365|rs55936365	44|.	A8MQ30|.	.|.	V|C	44|3	ENSP00000345684:L44V|.	ENSP00000345684:L44V|ENSP00000414194:S3C	L|S	+|+	1|2	2|0	NBPF10|NBPF10	144004892|144004892	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-3.451000|-3.451000	0.00466|0.00466	-3.626000|-3.626000	0.00130|0.00130	-3.729000|-3.729000	0.00022|0.00022	CTA|TCT			0.443	NBPF10-001	KNOWN	not_best_in_genome_evidence|basic	protein_coding	protein_coding		OTTHUMT00000038550.3		NM_001039703	
ARNT	405	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	150785719	150785719	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr1:150785719G>C	ENST00000358595.5	-	21	2409	c.2209C>G	c.(2209-2211)Cgt>Ggt	p.R737G	ARNT_ENST00000505755.1_Missense_Mutation_p.R722G|ARNT_ENST00000515192.1_Missense_Mutation_p.R723G|ARNT_ENST00000354396.2_Missense_Mutation_p.R735G|RNU6-1309P_ENST00000363305.1_RNA	NM_001197325.1|NM_001668.3|NM_178427.2	NP_001184254.1|NP_001659.1|NP_848514.1	P27540	ARNT_HUMAN	aryl hydrocarbon receptor nuclear translocator	737	Gln-rich.				cell differentiation (GO:0030154)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor activity (GO:0004874)|aryl hydrocarbon receptor binding (GO:0017162)|enhancer binding (GO:0035326)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|prostate(2)|skin(4)|stomach(1)	34	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.02)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			GAACTTGAACGATGATGAGGC	0.527			T	ETV6	AML						OREG0013788	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R737G				Dom	yes		1	1q21	405	aryl hydrocarbon receptor nuclear translocator		L	.	.			0			c.C2209G												85.0	86.0	85.0					1																	150785719		2203	4300	6503	SO:0001583	missense	405	exon21			TTGAACGATGATG	AF001307	CCDS970.1, CCDS971.1, CCDS65641.1, CCDS65642.1	1q21	2013-05-21			ENSG00000143437	ENSG00000143437		"""Basic helix-loop-helix proteins"""	700	protein-coding gene	gene with protein product		126110					Standard	NM_001668		Approved	HIF-1beta, bHLHe2	uc001evr.2	P27540	OTTHUMG00000035011	ENST00000358595.5:c.2209C>G	1.37:g.150785719G>C	ENSP00000351407:p.Arg737Gly		Somatic	149	0	0	1735	WXS	Illumina HiSeq	.	169	0.17	28	NM_001668	21	0.19	4	B2R9H1|C4AMA1|F8WAP6|Q59ED4|Q5QP39|Q8NDC7	Missense_Mutation	SNP	ENST00000358595.5	37	CCDS970.1	.	.	.	.	.	.	.	.	.	.	G	1.208	-0.630631	0.03584	.	.	ENSG00000143437	ENST00000358595;ENST00000354396;ENST00000515192;ENST00000394700;ENST00000505755	T;T;T;T	0.04654	3.7;3.7;3.7;3.58	5.85	4.93	0.64822	.	0.541573	0.18474	N	0.140138	T	0.00784	0.0026	N	0.16066	0.365	0.28689	N	0.904695	B;B;B;B;B	0.06786	0.0;0.001;0.001;0.001;0.0	B;B;B;B;B	0.06405	0.001;0.002;0.002;0.002;0.001	T	0.46938	-0.9155	10	0.02654	T	1	.	9.4573	0.38762	0.0:0.2811:0.4824:0.2365	.	721;735;723;722;737	A8K6P0;F8WAP6;P27540-3;P27540-2;P27540	.;.;.;.;ARNT_HUMAN	G	737;735;723;688;722	ENSP00000351407:R737G;ENSP00000346372:R735G;ENSP00000423851:R723G;ENSP00000427571:R722G	ENSP00000346372:R735G	R	-	1	0	ARNT	149052343	1.000000	0.71417	0.985000	0.45067	0.281000	0.26958	3.008000	0.49544	1.454000	0.47793	-0.302000	0.09304	CGT			0.527	ARNT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000084741.2			
ADAMTS14	140766	mdanderson.org	37	10	72489934	72489934	+	Missense_Mutation	SNP	G	G	T	rs202093253		TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr10:72489934G>T	ENST00000373207.1	+	6	1031	c.1031G>T	c.(1030-1032)cGc>cTc	p.R344L	ADAMTS14_ENST00000373208.1_Missense_Mutation_p.R344L	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	344	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						TCCCAGCAGCGCCAGGACCCC	0.647																																					p.R344L													.	.			0			c.G1031T												78.0	68.0	72.0					10																	72489934		2203	4300	6503	SO:0001583	missense	140766	exon6			AGCAGCGCCAGGA	AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.1031G>T	10.37:g.72489934G>T	ENSP00000362303:p.Arg344Leu		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_139155	2	0.00	0	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Missense_Mutation	SNP	ENST00000373207.1	37	CCDS7306.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.796930	0.90453	.	.	ENSG00000138316	ENST00000373208;ENST00000373207	D;D	0.85171	-1.95;-1.95	4.7	4.7	0.59300	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.064036	0.64402	N	0.000005	D	0.87038	0.6078	L	0.53249	1.67	0.47037	D	0.999291	P;P	0.42827	0.791;0.791	P;P	0.49953	0.527;0.627	D	0.84903	0.0843	10	0.29301	T	0.29	.	17.8161	0.88634	0.0:0.0:1.0:0.0	.	344;344	Q8WXS8;Q5T4G1	ATS14_HUMAN;.	L	344	ENSP00000362304:R344L;ENSP00000362303:R344L	ENSP00000362303:R344L	R	+	2	0	ADAMTS14	72159940	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.461000	0.66699	2.608000	0.88229	0.655000	0.94253	CGC			0.647	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000048522.1		NM_080722	
AVPI1	60370	mdanderson.org	37	10	99439617	99439617	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr10:99439617C>T	ENST00000370626.3	-	2	613	c.46G>A	c.(46-48)Gcc>Acc	p.A16T		NM_021732.2	NP_068378.2	Q5T686	AVPI1_HUMAN	arginine vasopressin-induced 1	16					activation of MAPK activity (GO:0000187)|cell cycle (GO:0007049)					breast(1)|endometrium(1)|large_intestine(2)|skin(1)	5		Colorectal(252;0.162)		Epithelial(162;8.37e-11)|all cancers(201;7.94e-09)		TCAATCGGGGCCTGCCAAGGG	0.622																																					p.A16T													.	.			0			c.G46A												10.0	10.0	10.0					10																	99439617		2173	4245	6418	SO:0001583	missense	60370	exon2			TCGGGGCCTGCCA	AF131791	CCDS7470.1	10q24.2	2004-04-05			ENSG00000119986	ENSG00000119986			30898	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_021732		Approved	VIP32, PP5395, VIT32	uc001koi.2	Q5T686	OTTHUMG00000018864	ENST00000370626.3:c.46G>A	10.37:g.99439617C>T	ENSP00000359660:p.Ala16Thr		Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_021732	30	0.00	0	Q53G32|Q9H2R9|Q9HBN9	Missense_Mutation	SNP	ENST00000370626.3	37	CCDS7470.1	.	.	.	.	.	.	.	.	.	.	C	13.78	2.339609	0.41398	.	.	ENSG00000119986	ENST00000370626	T	0.29655	1.56	5.19	3.25	0.37280	.	0.324122	0.24825	N	0.035298	T	0.21022	0.0506	L	0.36672	1.1	0.09310	N	0.999998	B	0.22003	0.063	B	0.21917	0.037	T	0.22661	-1.0210	10	0.15952	T	0.53	-0.5909	8.7381	0.34541	0.0:0.6283:0.292:0.0797	.	16	Q5T686	AVPI1_HUMAN	T	16	ENSP00000359660:A16T	ENSP00000359660:A16T	A	-	1	0	AVPI1	99429607	0.828000	0.29307	0.420000	0.26596	0.909000	0.53808	1.428000	0.34892	0.689000	0.31550	0.561000	0.74099	GCC			0.622	AVPI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049736.1		NM_021732	
SLC25A28	81894	broad.mit.edu	37	10	101370677	101370677	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr10:101370677C>T	ENST00000370495.4	-	4	1052	c.1024G>A	c.(1024-1026)Gca>Aca	p.A342T	SLC25A28_ENST00000496035.1_5'Flank	NM_031212.3	NP_112489.3	Q96A46	MFRN2_HUMAN	solute carrier family 25 (mitochondrial iron transporter), member 28	342					ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|stomach(1)	11		Colorectal(252;0.234)		Epithelial(162;2.57e-10)|all cancers(201;2.01e-08)		ACAGACCATGCGATGGCTGTG	0.517																																					p.A342T													SLC25A28,NS,carcinoma,0,1	SLC25A28	34	1	0			c.G1024A												113.0	110.0	111.0					10																	101370677		1936	4131	6067	SO:0001583	missense	81894	exon4			ACCATGCGATGGC	AF327402	CCDS41559.1	10q24.2	2013-05-22	2012-03-29		ENSG00000155287	ENSG00000155287		"""Solute carriers"""	23472	protein-coding gene	gene with protein product	"""mitoferrin 2"""	609767	"""solute carrier family 25, member 28"""			11297739	Standard	NM_031212		Approved	MRS3/4, MRS4L	uc001kpx.2	Q96A46	OTTHUMG00000018886	ENST00000370495.4:c.1024G>A	10.37:g.101370677C>T	ENSP00000359526:p.Ala342Thr		Somatic	131	0.0152671756	2		WXS	Illumina HiSeq	Phase_I	118	0.03	4	NM_031212	131	0.00	0	Q4VBZ0|Q5T777|Q86VX5|Q969G8|Q9H2J3	Missense_Mutation	SNP	ENST00000370495.4	37	CCDS41559.1	.	.	.	.	.	.	.	.	.	.	C	15.64	2.894522	0.52121	.	.	ENSG00000155287	ENST00000434701;ENST00000370495	T;T	0.76578	-1.03;-1.03	5.26	5.26	0.73747	Mitochondrial carrier domain (2);	0.201030	0.51477	D	0.000081	T	0.59662	0.2210	N	0.11000	0.08	0.52501	D	0.99995	B	0.32829	0.386	B	0.32583	0.148	T	0.61053	-0.7140	10	0.05525	T	0.97	-25.3013	19.056	0.93066	0.0:1.0:0.0:0.0	.	342	Q96A46	MFRN2_HUMAN	T	203;342	ENSP00000399102:A203T;ENSP00000359526:A342T	ENSP00000359526:A342T	A	-	1	0	SLC25A28	101360667	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	5.587000	0.67510	2.735000	0.93741	0.561000	0.74099	GCA			0.517	SLC25A28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049801.1		NM_031212	
MUC5B	727897	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	1271589	1271589	+	Silent	SNP	C	C	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr11:1271589C>T	ENST00000529681.1	+	31	13537	c.13479C>T	c.(13477-13479)tcC>tcT	p.S4493S	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Silent_p.S4496S	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4493	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		TCACCAGCTCCAAAGCCACTC	0.642																																					p.S4493S													.	.			0			c.C13479T												127.0	166.0	153.0					11																	1271589		2173	4265	6438	SO:0001819	synonymous_variant	727897	exon31			CAGCTCCAAAGCC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.13479C>T	11.37:g.1271589C>T			Somatic	343	0	0		WXS	Illumina HiSeq	.	366	0.11	42	NM_002458	0		0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																					0.642	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000390041.2		XM_001126093	
GTF2H1	2965	mdanderson.org	37	11	18354753	18354753	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr11:18354753C>A	ENST00000265963.4	+	2	292	c.132C>A	c.(130-132)agC>agA	p.S44R	GTF2H1_ENST00000531757.1_3'UTR|GTF2H1_ENST00000453096.2_Missense_Mutation_p.S44R|GTF2H1_ENST00000534641.1_5'UTR	NM_005316.3	NP_005307.1	P32780	TF2H1_HUMAN	general transcription factor IIH, polypeptide 1, 62kDa	44					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	core TFIIH complex (GO:0000439)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	20						TTACAATCAGCCATATGTATG	0.348								Nucleotide excision repair (NER)																													p.S44R													.	.			0			c.C132A												97.0	94.0	95.0					11																	18354753		2199	4293	6492	SO:0001583	missense	2965	exon3			AATCAGCCATATG		CCDS7838.1	11p15.1-p14	2012-11-05	2002-08-29		ENSG00000110768	ENSG00000110768		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	4655	protein-coding gene	gene with protein product		189972	"""general transcription factor IIH, polypeptide 1 (62kD subunit)"""			1529339, 8162052	Standard	NM_005316		Approved	BTF2, P62, TFIIH	uc001moh.2	P32780	OTTHUMG00000167690	ENST00000265963.4:c.132C>A	11.37:g.18354753C>A	ENSP00000265963:p.Ser44Arg		Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_001142307	19	0.00	0	B3KXE0|D3DQY2|Q6I9Y7|Q9H5K5|Q9NQD9	Missense_Mutation	SNP	ENST00000265963.4	37	CCDS7838.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.478342	0.84747	.	.	ENSG00000110768	ENST00000453096;ENST00000525831;ENST00000265963	T;T	0.26660	1.72;1.72	5.28	5.28	0.74379	TFIIH p62 subunit, N-terminal (1);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.51822	0.1697	M	0.70275	2.135	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	T	0.46843	-0.9162	10	0.42905	T	0.14	-10.4245	19.2693	0.94002	0.0:1.0:0.0:0.0	.	44	P32780	TF2H1_HUMAN	R	44	ENSP00000393638:S44R;ENSP00000265963:S44R	ENSP00000265963:S44R	S	+	3	2	GTF2H1	18311329	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.436000	0.59948	2.619000	0.88677	0.563000	0.77884	AGC			0.348	GTF2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000395627.2		NM_005316	
Unknown	0	bcgsc.ca	37	11	62815368	62815368	+	IGR	SNP	G	G	A	rs150679703|rs374048942|rs7125680|rs372143980	byFrequency	TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr11:62815368G>A								SLC22A8 (32057 upstream) : SLC22A24 (32043 downstream)																							CCAAGGTGCAGCATGCCATGT	0.562																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GGTGCAGCATGCC																													11.37:g.62815368G>A			Somatic	45	0	0		WXS	Illumina HiSeq	Phase_1	38	0.21	8	.	0		0		RNA	SNP		37																																																																																					0	0.562										
TMEM151A	256472	mdanderson.org	37	11	66061946	66061946	+	Missense_Mutation	SNP	G	G	A	rs202127682	byFrequency	TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr11:66061946G>A	ENST00000327259.4	+	2	373	c.229G>A	c.(229-231)Gcc>Acc	p.A77T		NM_153266.3	NP_694998.1	Q8N4L1	T151A_HUMAN	transmembrane protein 151A	77						integral component of membrane (GO:0016021)				central_nervous_system(1)|kidney(4)|lung(6)	11						GCCCGAGGCCGCCTTGGCCCG	0.731													G|||	2	0.000399361	0.0	0.0	5008	,	,		12107	0.0		0.002	False		,,,				2504	0.0				p.A77T													.	.			0			c.G229A							G	THR/ALA	0,4362		0,0,2181	18.0	19.0	19.0		229	2.8	0.6	11		19	15,8387		0,15,4186	no	missense	TMEM151A	NM_153266.3	58	0,15,6367	AA,AG,GG		0.1785,0.0,0.1175	benign	77/469	66061946	15,12749	2181	4201	6382	SO:0001583	missense	256472	exon2			GAGGCCGCCTTGG	BC033898	CCDS8133.1	11q13.2	2007-10-25	2007-10-25	2007-10-25	ENSG00000179292	ENSG00000179292			28497	protein-coding gene	gene with protein product			"""transmembrane protein 151"""	TMEM151		12477932	Standard	NM_153266		Approved	MGC33486	uc001ohl.3	Q8N4L1	OTTHUMG00000166920	ENST00000327259.4:c.229G>A	11.37:g.66061946G>A	ENSP00000326244:p.Ala77Thr		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	55	0.07	4	NM_153266	0		0	Q8ND14	Missense_Mutation	SNP	ENST00000327259.4	37	CCDS8133.1	4	0.0018315018315018315	0	0.0	2	0.0055248618784530384	0	0.0	2	0.002638522427440633	G	0.678	-0.799401	0.02841	0.0	0.001785	ENSG00000179292	ENST00000327259	.	.	.	4.69	2.83	0.33086	.	0.164918	0.37955	N	0.001876	T	0.24851	0.0603	N	0.22421	0.69	0.41580	D	0.988732	B	0.28128	0.201	B	0.18263	0.021	T	0.05305	-1.0893	9	0.20519	T	0.43	.	9.7953	0.40731	0.1709:0.0:0.8291:0.0	.	77	Q8N4L1	T151A_HUMAN	T	77	.	ENSP00000326244:A77T	A	+	1	0	TMEM151A	65818522	1.000000	0.71417	0.592000	0.28758	0.012000	0.07955	6.114000	0.71560	0.600000	0.29862	-0.254000	0.11334	GCC	0.002		0.731	TMEM151A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000391897.1		NM_153266	
LRP5	4041	bcgsc.ca	37	11	68216457	68216457	+	Silent	SNP	C	C	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr11:68216457C>T	ENST00000294304.7	+	23	4873	c.4767C>T	c.(4765-4767)agC>agT	p.S1589S	LRP5_ENST00000529481.1_3'UTR	NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	1589	Pro-rich.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CGGAGGACAGCTGCCCGCCCT	0.667																																					p.S1589S													.	LRP5	136		0			c.C4767T												52.0	47.0	49.0					11																	68216457		2200	4294	6494	SO:0001819	synonymous_variant	4041	exon23			GGACAGCTGCCCG	AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.4767C>T	11.37:g.68216457C>T			Somatic	24	0	0		WXS	Illumina HiSeq	Phase_1	32	0.13	4	NM_002335	99	0.00	0	Q96TD6|Q9UES7|Q9UP66	Silent	SNP	ENST00000294304.7	37	CCDS8181.1	.	.	.	.	.	.	.	.	.	.	C	8.680	0.904964	0.17760	.	.	ENSG00000162337	ENST00000529702	.	.	.	4.53	4.53	0.55603	.	.	.	.	.	T	0.64360	0.2591	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62872	-0.6762	4	.	.	.	.	13.0255	0.58812	0.0:0.9196:0.0:0.0804	.	.	.	.	V	146	.	.	A	+	2	0	LRP5	67973033	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	2.732000	0.47352	2.367000	0.80283	0.555000	0.69702	GCT			0.667	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000395088.1		NM_002335	
SYTL2	54843	broad.mit.edu	37	11	85445575	85445575	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr11:85445575G>A	ENST00000528231.1	-	6	1071	c.794C>T	c.(793-795)gCg>gTg	p.A265V	SYTL2_ENST00000527523.1_Missense_Mutation_p.A217V|SYTL2_ENST00000524452.1_Missense_Mutation_p.A265V|SYTL2_ENST00000316356.4_Missense_Mutation_p.A266V|SYTL2_ENST00000389960.4_Missense_Mutation_p.A265V	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2	265					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		AGCCCCTCTCGCTTTCAGGGA	0.453																																					p.A266V													SYTL2_ENST00000316356,colon,carcinoma,+1,1	SYTL2	231	1	0			c.C797T												125.0	128.0	127.0					11																	85445575		2203	4299	6502	SO:0001583	missense	54843	exon6			CCTCTCGCTTTCA	AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.794C>T	11.37:g.85445575G>A	ENSP00000431701:p.Ala265Val		Somatic	178	0	0		WXS	Illumina HiSeq	Phase_I	157	0.03	5	NM_001162953	0		0	B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Missense_Mutation	SNP	ENST00000528231.1	37	CCDS53688.1	.	.	.	.	.	.	.	.	.	.	G	3.632	-0.075314	0.07184	.	.	ENSG00000137501	ENST00000389960;ENST00000316356;ENST00000528231;ENST00000527523;ENST00000524452	T;T;T;T;T	0.26660	1.84;1.83;1.83;1.72;1.84	5.87	1.79	0.24919	.	.	.	.	.	T	0.15176	0.0366	L	0.36672	1.1	0.09310	N	0.999999	B;P;B;B;P	0.42161	0.355;0.583;0.242;0.351;0.772	B;B;B;B;B	0.31101	0.079;0.079;0.054;0.05;0.124	T	0.10405	-1.0631	8	.	.	.	.	8.2765	0.31874	0.1647:0.4669:0.3684:0.0	.	217;265;265;266;123	Q9HCH5-14;Q9HCH5-6;Q9HCH5;Q9HCH5-13;Q9HCH5-15	.;.;SYTL2_HUMAN;.;.	V	265;266;265;217;265	ENSP00000374610:A265V;ENSP00000318803:A266V;ENSP00000431701:A265V;ENSP00000434010:A217V;ENSP00000435238:A265V	.	A	-	2	0	SYTL2	85123223	0.007000	0.16637	0.000000	0.03702	0.001000	0.01503	1.912000	0.39946	0.394000	0.25230	-0.897000	0.02905	GCG			0.453	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000392192.1		NM_206927	
ME3	10873	mdanderson.org	37	11	86382933	86382933	+	Silent	SNP	G	G	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr11:86382933G>T	ENST00000393324.3	-	1	307	c.54C>A	c.(52-54)gcC>gcA	p.A18A	ME3_ENST00000543262.1_Silent_p.A18A|ME3_ENST00000359636.2_Silent_p.A18A	NM_001014811.1	NP_001014811.1	Q16798	MAON_HUMAN	malic enzyme 3, NADP(+)-dependent, mitochondrial	18					aerobic respiration (GO:0009060)|malate metabolic process (GO:0006108)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|pyruvate metabolic process (GO:0006090)	mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)			endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|skin(3)|stomach(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)				GGGCGCCGCAGGCCCGGCCCG	0.746																																					p.A18A													.	.			0			c.C54A												5.0	6.0	6.0					11																	86382933		1999	3798	5797	SO:0001819	synonymous_variant	10873	exon1			GCCGCAGGCCCGG	X79440	CCDS8277.1	11q14.2	2012-09-20			ENSG00000151376	ENSG00000151376	1.1.1.40		6985	protein-coding gene	gene with protein product		604626				7818469	Standard	NM_001161586		Approved		uc001pbz.3	Q16798	OTTHUMG00000167217	ENST00000393324.3:c.54C>A	11.37:g.86382933G>T			Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	27	0.07	2	NM_001014811	1	0.00	0	B7Z6V0|Q8TBJ0	Silent	SNP	ENST00000393324.3	37	CCDS8277.1																																																																																					0.746	ME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393767.2			
TULP3	7289	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	3040319	3040319	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr12:3040319A>C	ENST00000448120.2	+	6	660	c.609A>C	c.(607-609)agA>agC	p.R203S	RNU7-166P_ENST00000459397.1_RNA|TULP3_ENST00000397132.2_Missense_Mutation_p.R203S	NM_003324.4	NP_003315.2	O75386	TULP3_HUMAN	tubby like protein 3	203					anterior/posterior pattern specification (GO:0009952)|bone development (GO:0060348)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|central nervous system neuron differentiation (GO:0021953)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic neurocranium morphogenesis (GO:0048702)|G-protein coupled receptor signaling pathway (GO:0007186)|ganglion development (GO:0061548)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cilium (GO:0005929)|extracellular region (GO:0005576)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	enzyme binding (GO:0019899)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)			endometrium(1)|large_intestine(4)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			TCACAGTAAGATGTCGGATAA	0.478																																					p.R203S													.	.			0			c.A609C												104.0	99.0	100.0					12																	3040319		2203	4300	6503	SO:0001583	missense	7289	exon6			AGTAAGATGTCGG	AF045583	CCDS8519.1, CCDS53737.1	12p13	2014-02-21			ENSG00000078246	ENSG00000078246		"""Intraflagellar transport homologs"""	12425	protein-coding gene	gene with protein product		604730				9828123	Standard	NM_003324		Approved	TUBL3	uc001qlj.2	O75386	OTTHUMG00000168152	ENST00000448120.2:c.609A>C	12.37:g.3040319A>C	ENSP00000410051:p.Arg203Ser		Somatic	103	0	0		WXS	Illumina HiSeq	.	189	0.12	22	NM_003324	11	0.00	0	B3KNB7|B7Z6A2|D3DUQ4|F8WBZ9|Q8N5B0	Missense_Mutation	SNP	ENST00000448120.2	37	CCDS8519.1	.	.	.	.	.	.	.	.	.	.	A	15.84	2.951379	0.53186	.	.	ENSG00000078246	ENST00000228245;ENST00000542730;ENST00000448120;ENST00000397132	D;D	0.96491	-4.03;-4.03	5.76	2.48	0.30137	Tubby, C-terminal (3);	0.083846	0.85682	D	0.000000	D	0.94125	0.8116	M	0.67397	2.05	0.26935	N	0.966375	B;P;P	0.46512	0.361;0.604;0.879	B;B;B	0.40940	0.309;0.344;0.3	D	0.89183	0.3545	10	0.87932	D	0	-18.6591	9.333	0.38034	0.334:0.0:0.666:0.0	.	60;203;203	B7Z1E7;O75386;F8WBZ9	.;TULP3_HUMAN;.	S	203;60;203;203	ENSP00000410051:R203S;ENSP00000380321:R203S	ENSP00000228245:R203S	R	+	3	2	TULP3	2910580	1.000000	0.71417	0.901000	0.35422	0.483000	0.33249	1.765000	0.38481	0.759000	0.33084	-0.242000	0.12053	AGA			0.478	TULP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000398468.1		NM_003324	
CTAGE3P	220112	bcgsc.ca	37	13	52482800	52482800	+	IGR	SNP	G	G	T	rs377748800		TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr13:52482800G>T								CCDC70 (42434 upstream) : ATP7B (24008 downstream)																							CATTTCTGAAGGCATTGACCC	0.393																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	220112	.			TCTGAAGGCATTG																													13.37:g.52482800G>T			Somatic	96	0.0104166667	1		WXS	Illumina HiSeq	Phase_1	94	0.15	14	.	4	0.00	0		RNA	SNP		37																																																																																					0	0.393										
SUPT16H	11198	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	21830430	21830430	+	Silent	SNP	A	A	G			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr14:21830430A>G	ENST00000216297.2	-	15	2057	c.1719T>C	c.(1717-1719)taT>taC	p.Y573Y		NM_007192.3	NP_009123.1	Q9Y5B9	SP16H_HUMAN	suppressor of Ty 16 homolog (S. cerevisiae)	573					DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|nucleosome disassembly (GO:0006337)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)		TGCCTGGGCAATAAAAGTTGA	0.408																																					p.Y573Y													.	.			0			c.T1719C												69.0	64.0	65.0					14																	21830430		2203	4300	6503	SO:0001819	synonymous_variant	11198	exon15			TGGGCAATAAAAG	AF152961	CCDS9569.1	14q11.1	2008-08-13	2001-11-28		ENSG00000092201	ENSG00000092201			11465	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 140 kDa subunit"""	605012	"""suppressor of Ty (S.cerevisiae) 16 homolog"""			9489704, 11239457	Standard	NM_007192		Approved	FACT, FACTP140, SPT16/CDC68, FLJ14010, FLJ10857, CDC68	uc001wao.2	Q9Y5B9	OTTHUMG00000029685	ENST00000216297.2:c.1719T>C	14.37:g.21830430A>G			Somatic	82	0	0		WXS	Illumina HiSeq	.	89	0.07	6	NM_007192	35	0.20	7	Q6GMT8|Q6P2F1|Q6PJM1|Q9NRX0	Silent	SNP	ENST00000216297.2	37	CCDS9569.1																																																																																					0.408	SUPT16H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000074025.2			
WDR25	79446	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	100847625	100847625	+	Missense_Mutation	SNP	G	G	A	rs546879041		TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr14:100847625G>A	ENST00000335290.6	+	2	590	c.364G>A	c.(364-366)Gtt>Att	p.V122I	WDR25_ENST00000402312.3_Missense_Mutation_p.V122I|WDR25_ENST00000554998.1_Missense_Mutation_p.V122I|WDR25_ENST00000542471.2_5'Flank|WDR25_ENST00000554175.1_Missense_Mutation_p.V122I	NM_024515.4	NP_078791.3	Q64LD2	WDR25_HUMAN	WD repeat domain 25	122										central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|skin(1)	20		Melanoma(154;0.212)				GACGAGCCATGTTCCAGCCAG	0.547													G|||	1	0.000199681	0.0	0.0	5008	,	,		17348	0.0		0.0	False		,,,				2504	0.001				p.V122I													.	.			0			c.G364A												44.0	49.0	47.0					14																	100847625		2203	4300	6503	SO:0001583	missense	79446	exon2			AGCCATGTTCCAG	BC007953	CCDS32157.1	14q32.32	2013-01-09				ENSG00000176473		"""WD repeat domain containing"""	21064	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 67"""	C14orf67		15587985	Standard	NM_001161476		Approved	MGC4645	uc001yhn.3	Q64LD2		ENST00000335290.6:c.364G>A	14.37:g.100847625G>A	ENSP00000334148:p.Val122Ile		Somatic	115	0	0		WXS	Illumina HiSeq	.	145	0.12	17	NM_001161476	11	0.36	4	A8K7E5|Q6NVV6|Q86TQ4|Q9BTK5	Missense_Mutation	SNP	ENST00000335290.6	37	CCDS32157.1	.	.	.	.	.	.	.	.	.	.	G	11.80	1.745751	0.30955	.	.	ENSG00000176473	ENST00000554998;ENST00000402312;ENST00000335290;ENST00000554175	T;T;T;T	0.60797	0.16;0.16;0.16;2.17	5.0	-4.06	0.03986	.	0.913791	0.09242	N	0.829080	T	0.32466	0.0830	N	0.22421	0.69	0.09310	N	1	B	0.22276	0.067	B	0.17433	0.018	T	0.15549	-1.0433	10	0.25751	T	0.34	-0.0092	2.1858	0.03886	0.4903:0.1321:0.2432:0.1345	.	122	Q64LD2	WDR25_HUMAN	I	122	ENSP00000450661:V122I;ENSP00000385540:V122I;ENSP00000334148:V122I;ENSP00000450727:V122I	ENSP00000334148:V122I	V	+	1	0	WDR25	99917378	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.999000	0.03697	-0.672000	0.05266	-0.136000	0.14681	GTT			0.547	WDR25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000414312.1		NM_024515	
IGHA1	3493	broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	106173780	106173780	+	RNA	SNP	G	G	C			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr14:106173780G>C	ENST00000390547.2	-	0	786				AL928768.3_ENST00000497872.2_lincRNA			P01876	IGHA1_HUMAN	immunoglobulin heavy constant alpha 1						antibacterial humoral response (GO:0019731)|glomerular filtration (GO:0003094)|immune response (GO:0006955)|positive regulation of respiratory burst (GO:0060267)|protein-chromophore linkage (GO:0018298)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|monomeric IgA immunoglobulin complex (GO:0071748)|secretory dimeric IgA immunoglobulin complex (GO:0071752)|secretory IgA immunoglobulin complex (GO:0071751)	antigen binding (GO:0003823)										TGCAGCCAGCGAACCAGCACA	0.687																																					.													.	.			0			.												33.0	47.0	42.0					14																	106173780		2123	4243	6366			0	.			GCCAGCGAACCAG	J00220		14q32.33	2012-10-02			ENSG00000211895	ENSG00000211895		"""Immunoglobulins / IGH locus"""	5478	other	immunoglobulin gene		146900					Standard	NG_001019		Approved			P01876	OTTHUMG00000152494		14.37:g.106173780G>C			Somatic	296	0	0		WXS	Illumina HiSeq	Phase_I	343	0.03	9	.	4502	0.00	1		RNA	SNP	ENST00000390547.2	37																																																																																						0.687	IGHA1-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IG_C_gene		OTTHUMT00000326459.1		NG_001019	
ALPK3	57538	hgsc.bcm.edu	37	15	85401530	85401530	+	Silent	SNP	G	G	A			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr15:85401530G>A	ENST00000258888.5	+	6	4334	c.4167G>A	c.(4165-4167)gaG>gaA	p.E1389E		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1389					heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			AAGAAAGGGAGAGCCCCACGG	0.647																																					p.E1389E													.	.			0			c.G4167A												16.0	20.0	19.0					15																	85401530		2179	4276	6455	SO:0001819	synonymous_variant	57538	exon6			AAGGGAGAGCCCC	AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.4167G>A	15.37:g.85401530G>A			Somatic	25	0	0		WXS	Illumina HiSeq	.	23	0.22	5	NM_020778	0		0	Q9P2L6	Silent	SNP	ENST00000258888.5	37	CCDS10333.1																																																																																					0.647	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000308997.1		NM_020778	
CACNA1H	8912	mdanderson.org	37	16	1252375	1252375	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr16:1252375G>T	ENST00000348261.5	+	9	2173	c.1925G>T	c.(1924-1926)gGc>gTc	p.G642V	CACNA1H_ENST00000358590.4_Missense_Mutation_p.G642V|CACNA1H_ENST00000565831.1_Missense_Mutation_p.G642V	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	642					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	GGACCGCCAGGCACCGGGGGG	0.687																																					p.G642V													.	.			0			c.G1925T												5.0	7.0	6.0					16																	1252375		1917	3990	5907	SO:0001583	missense	8912	exon9			CGCCAGGCACCGG	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.1925G>T	16.37:g.1252375G>T	ENSP00000334198:p.Gly642Val		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_021098	0		0	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	ENST00000348261.5	37	CCDS45375.1	.	.	.	.	.	.	.	.	.	.	G	6.820	0.520460	0.13005	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.96365	-3.99;-3.93	4.04	1.86	0.25419	.	.	.	.	.	D	0.92424	0.7595	L	0.46157	1.445	0.09310	N	0.999998	B;B	0.14438	0.01;0.003	B;B	0.14578	0.011;0.003	D	0.84518	0.0626	9	0.38643	T	0.18	.	4.8673	0.13615	0.1174:0.0:0.5009:0.3816	.	642;642	O95180-2;O95180	.;CAC1H_HUMAN	V	642	ENSP00000334198:G642V;ENSP00000351401:G642V	ENSP00000334198:G642V	G	+	2	0	CACNA1H	1192376	0.012000	0.17670	0.002000	0.10522	0.001000	0.01503	1.716000	0.37981	0.901000	0.36495	0.563000	0.77884	GGC			0.687	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000421601.1		NM_001005407	
ROGDI	79641	mdanderson.org	37	16	4848588	4848588	+	Silent	SNP	G	G	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr16:4848588G>T	ENST00000322048.7	-	7	891	c.513C>A	c.(511-513)atC>atA	p.I171I	RP11-127I20.5_ENST00000592465.1_RNA|ROGDI_ENST00000586336.1_5'UTR	NM_024589.2	NP_078865.1	Q9GZN7	ROGDI_HUMAN	rogdi homolog (Drosophila)	171					hemopoiesis (GO:0030097)|positive regulation of cell proliferation (GO:0008284)	intracellular (GO:0005622)|nucleus (GO:0005634)				endometrium(2)|lung(1)|ovary(1)|skin(1)	5						CGCTGGCGGCGATCTCGGGGA	0.701																																					p.I171I													.	.			0			c.C513A												15.0	17.0	16.0					16																	4848588		2179	4280	6459	SO:0001819	synonymous_variant	79641	exon7			GGCGGCGATCTCG	AK026039	CCDS10523.1	16p13.3	2014-09-17			ENSG00000067836	ENSG00000067836			29478	protein-coding gene	gene with protein product		614574				11230166	Standard	NM_024589		Approved	FLJ22386	uc002cxv.4	Q9GZN7	OTTHUMG00000129479	ENST00000322048.7:c.513C>A	16.37:g.4848588G>T			Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	19	0.16	3	NM_024589	87	0.00	0	Q6IA00	Silent	SNP	ENST00000322048.7	37	CCDS10523.1																																																																																					0.701	ROGDI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251643.3		NM_024589	
VMO1	284013	mdanderson.org	37	17	4689636	4689636	+	Silent	SNP	G	G	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr17:4689636G>T	ENST00000328739.5	-	1	91	c.12C>A	c.(10-12)ggC>ggA	p.G4G	VMO1_ENST00000416307.2_Silent_p.G4G|VMO1_ENST00000441199.2_Silent_p.G4G|GLTPD2_ENST00000331264.7_5'Flank|VMO1_ENST00000354194.4_Silent_p.G4G	NM_182566.2	NP_872372.1	Q7Z5L0	VMO1_HUMAN	vitelline membrane outer layer 1 homolog (chicken)	4						extracellular vesicular exosome (GO:0070062)				kidney(2)|large_intestine(3)|liver(1)|lung(3)|ovary(1)|pancreas(1)	11						TGGCTCCTGCGCCCCGCTCCA	0.597																																					p.G4G													.	.			0			c.C12A												11.0	13.0	12.0					17																	4689636		2199	4288	6487	SO:0001819	synonymous_variant	284013	exon1			TCCTGCGCCCCGC	AF521892	CCDS11055.1, CCDS45585.1, CCDS45586.1, CCDS45587.1	17p13.2	2013-03-07	2005-11-14						30387	protein-coding gene	gene with protein product						22025569	Standard	NM_182566		Approved		uc002fyx.3	Q7Z5L0		ENST00000328739.5:c.12C>A	17.37:g.4689636G>T			Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	11	0.27	3	NM_001144939	3	0.00	0	C9JQ15|E9PAU9|E9PGP4|Q3SXP1|Q8IUY1	Silent	SNP	ENST00000328739.5	37	CCDS11055.1																																																																																					0.597	VMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000439587.1		NM_182566	
DNAH9	1770	mdanderson.org	37	17	11502133	11502133	+	Silent	SNP	C	C	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr17:11502133C>T	ENST00000262442.4	+	1	386	c.318C>T	c.(316-318)acC>acT	p.T106T	DNAH9_ENST00000579828.1_Silent_p.T106T|DNAH9_ENST00000454412.2_Silent_p.T106T	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	106	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TCCTTCGCACCGGGCCCGAGC	0.726																																					p.T106T													DNAH9,NS,carcinoma,+2,1	DNAH9	2	1	0			c.C318T												2.0	3.0	3.0					17																	11502133		1771	3682	5453	SO:0001819	synonymous_variant	1770	exon1			TCGCACCGGGCCC	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.318C>T	17.37:g.11502133C>T			Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	15	0.13	2	NM_001372	1	0.00	0	A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	ENST00000262442.4	37	CCDS11160.1																																																																																					0.726	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252756.2		NM_001372	
TVP23C	201158	broad.mit.edu	37	17	15441469	15441469	+	Intron	SNP	C	C	T	rs568909748	byFrequency	TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr17:15441469C>T	ENST00000225576.3	-	5	558				TVP23C_ENST00000583206.1_5'Flank|TVP23C_ENST00000438826.3_Splice_Site|TVP23C-CDRT4_ENST00000522212.2_Intron|TVP23C_ENST00000584811.1_Splice_Site|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000428082.2_Splice_Site	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)							integral component of membrane (GO:0016021)											TCCAGTGTTCCGCAAAAGACA	0.393													c|||	3	0.000599042	0.0015	0.0	5008	,	,		17476	0.001		0.0	False		,,,				2504	0.0				.													.	.			0			.																																									SO:0001627	intron_variant	201158	.			GTGTTCCGCAAAA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.462+7629G>A	17.37:g.15441469C>T			Somatic	466	0.0021459227	1		WXS	Illumina HiSeq	Phase_I	353	0.02	7	.	1	0.00	0	Q3LIC7	Splice_Site	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	c	13.58	2.280351	0.40294	.	.	ENSG00000175106	ENST00000438826	.	.	.	4.5	4.5	0.54988	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.0583	0.25111	0.0:0.1033:0.0:0.8967	.	.	.	.	.	-1	.	.	.	-	.	.	FAM18B2	15382194	1.000000	0.71417	0.996000	0.52242	0.698000	0.40448	1.919000	0.40015	0.852000	0.35287	-0.352000	0.07741	.			0.393	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000130705.2		NM_145301	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.			0			c.G152A												274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	0	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr		Somatic	218	0.0504587156	11		RNA-Seq	Illumina HiSeq		201	0.08	17	NM_145301	13	0.38	5	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT			0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000130705.2		NM_145301	
SREBF1	6720	broad.mit.edu	37	17	17740045	17740045	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr17:17740045delG	ENST00000261646.5	-	1	271	c.87delC	c.(85-87)atcfs	p.I29fs	SREBF1_ENST00000338854.5_Frame_Shift_Del_p.I29fs|SREBF1_ENST00000355815.4_Frame_Shift_Del_p.I29fs|SREBF1_ENST00000435530.2_Frame_Shift_Del_p.I29fs	NM_004176.4	NP_004167.3	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription factor 1	29	Transcriptional activation (acidic).				aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|negative regulation of insulin secretion (GO:0046676)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of fatty acid metabolic process (GO:0019217)|regulation of heart rate by chemical signal (GO:0003062)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucagon (GO:0033762)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sterol response element binding (GO:0032810)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	14						ACGCACCTTCGATGTCGGTCA	0.721																																					p.I29fs													.	SREBF1	47		0			c.87delC												8.0	7.0	7.0					17																	17740045		2069	4084	6153	SO:0001589	frameshift_variant	6720	exon1			ACCTTCGATGTCG	BC057388	CCDS11189.1, CCDS32583.1	17p11.2	2013-05-21			ENSG00000072310	ENSG00000072310		"""Basic helix-loop-helix proteins"""	11289	protein-coding gene	gene with protein product		184756				8402897, 7759101	Standard	NM_001005291		Approved	SREBP1, bHLHd1, SREBP-1c	uc002grt.2	P36956	OTTHUMG00000059313	ENST00000261646.5:c.87delC	17.37:g.17740045delG	ENSP00000261646:p.Ile29fs		Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	NM_004176	9	0.00	0	B0I4X3|B0I4X4|D3DXC4|Q16062|Q59F52|Q6P4R7|Q6PFW7|Q6PJ36|Q8TAK9	Frame_Shift_Del	DEL	ENST00000261646.5	37	CCDS11189.1																																																																																					0.721	SREBF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000131771.1		NM_004176	
SREBF1	6720	broad.mit.edu	37	17	17740047	17740047	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr17:17740047delT	ENST00000261646.5	-	1	269	c.85delA	c.(85-87)atcfs	p.I29fs	SREBF1_ENST00000338854.5_Frame_Shift_Del_p.I29fs|SREBF1_ENST00000355815.4_Frame_Shift_Del_p.I29fs|SREBF1_ENST00000435530.2_Frame_Shift_Del_p.I29fs	NM_004176.4	NP_004167.3	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription factor 1	29	Transcriptional activation (acidic).				aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|negative regulation of insulin secretion (GO:0046676)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of fatty acid metabolic process (GO:0019217)|regulation of heart rate by chemical signal (GO:0003062)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucagon (GO:0033762)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sterol response element binding (GO:0032810)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	14						GCACCTTCGATGTCGGTCAGC	0.721																																					p.I29fs													.	SREBF1	47		0			c.85delA												8.0	7.0	8.0					17																	17740047		2069	4090	6159	SO:0001589	frameshift_variant	6720	exon1			CTTCGATGTCGGT	BC057388	CCDS11189.1, CCDS32583.1	17p11.2	2013-05-21			ENSG00000072310	ENSG00000072310		"""Basic helix-loop-helix proteins"""	11289	protein-coding gene	gene with protein product		184756				8402897, 7759101	Standard	NM_001005291		Approved	SREBP1, bHLHd1, SREBP-1c	uc002grt.2	P36956	OTTHUMG00000059313	ENST00000261646.5:c.85delA	17.37:g.17740047delT	ENSP00000261646:p.Ile29fs		Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	NM_004176	9	0.00	0	B0I4X3|B0I4X4|D3DXC4|Q16062|Q59F52|Q6P4R7|Q6PFW7|Q6PJ36|Q8TAK9	Frame_Shift_Del	DEL	ENST00000261646.5	37	CCDS11189.1																																																																																					0.721	SREBF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000131771.1		NM_004176	
MYO15A	51168	broad.mit.edu	37	17	18023051	18023051	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr17:18023051G>T	ENST00000205890.5	+	2	1275	c.937G>T	c.(937-939)Gaa>Taa	p.E313*		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	313					inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.E313K(1)		breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					CGACGATTACGAACCCCCATA	0.612																																					p.E313X													MYO15A,NS,carcinoma,0,1	MYO15A	268	1	1	Substitution - Missense(1)	breast(1)	c.G937T												47.0	54.0	52.0					17																	18023051		1916	4112	6028	SO:0001587	stop_gained	51168	exon2			GATTACGAACCCC	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.937G>T	17.37:g.18023051G>T	ENSP00000205890:p.Glu313*		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	54	0.06	3	NM_016239	0		0	B4DFC7	Nonsense_Mutation	SNP	ENST00000205890.5	37	CCDS42271.1	.	.	.	.	.	.	.	.	.	.	G	36	5.761066	0.96906	.	.	ENSG00000091536	ENST00000205890	.	.	.	5.82	4.83	0.62350	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	16.3486	0.83191	0.0:0.1324:0.8676:0.0	.	.	.	.	X	313	.	ENSP00000205890:E313X	E	+	1	0	MYO15A	17963776	0.162000	0.22906	0.845000	0.33349	0.015000	0.08874	2.752000	0.47516	1.427000	0.47276	0.561000	0.74099	GAA			0.612	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000132048.1		NM_016239	
RNF135	84282	hgsc.bcm.edu;ucsc.edu	37	17	29302829	29302829	+	Intron	SNP	T	T	A			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr17:29302829T>A	ENST00000328381.5	+	1	1245				RNF135_ENST00000324689.4_Intron|RNF135_ENST00000443677.2_Intron|RP11-848P1.2_ENST00000580979.1_RNA|RNF135_ENST00000535306.2_Intron|RP11-848P1.4_ENST00000584499.1_RNA	NM_032322.3	NP_115698.3	Q8IUD6	RN135_HUMAN	ring finger protein 135						innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-beta production (GO:0032728)|protein ubiquitination (GO:0016567)|regulation of innate immune response (GO:0045088)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ligase activity (GO:0016874)|ribonucleoprotein complex binding (GO:0043021)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.?(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(1)|skin(2)|urinary_tract(1)	10		all_cancers(10;8.65e-08)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Myeloproliferative disorder(56;0.0255)				TCCCTGCAGATGACTTCGTTG	0.517																																					.													.	.			1	Unknown(1)	central_nervous_system(1)	.																																									SO:0001627	intron_variant	503645	.			TGCAGATGACTTC	AJ496729	CCDS11262.1, CCDS11263.1, CCDS54104.1	17q11.2	2013-01-09			ENSG00000181481	ENSG00000181481		"""RING-type (C3HC4) zinc fingers"""	21158	protein-coding gene	gene with protein product	"""riplet"""	611358				11468690, 19017631	Standard	NM_001184992		Approved	MGC13061	uc002hfz.3	Q8IUD6	OTTHUMG00000132867	ENST00000328381.5:c.372+4366T>A	17.37:g.29302829T>A			Somatic	97	0	0		WXS	Illumina HiSeq	.	89	0.16	14	.	3	0.00	0	A0AVM5|B2R7G9|B6ZLM5|F5GX60|Q9BSE9	RNA	SNP	ENST00000328381.5	37	CCDS11262.1																																																																																					0.517	RNF135-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000256342.3		NM_032322	
KRT23	25984	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	39092824	39092824	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr17:39092824G>T	ENST00000209718.3	-	2	456	c.32C>A	c.(31-33)cCc>cAc	p.P11H	KRT23_ENST00000436344.3_Intron|KRT23_ENST00000582283.1_5'Flank|AC004231.2_ENST00000418393.1_RNA	NM_015515.3	NP_056330.3	Q9C075	K1C23_HUMAN	keratin 23 (histone deacetylase inducible)	11	Head.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Breast(137;0.000301)|Ovarian(249;0.15)				GGAGGCCGAGGGGGTCTGGCT	0.701																																					p.P11H													.	.			0			c.C32A												28.0	33.0	31.0					17																	39092824		2192	4272	6464	SO:0001583	missense	25984	exon2			GCCGAGGGGGTCT	AF102848	CCDS11380.1, CCDS62182.1	17q21.2	2013-01-16			ENSG00000108244	ENSG00000108244		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6438	protein-coding gene	gene with protein product		606194				11135429, 16831889	Standard	NM_015515		Approved	K23, DKFZP434G032, HAIK1, CK23, MGC26158	uc002hvm.1	Q9C075	OTTHUMG00000133376	ENST00000209718.3:c.32C>A	17.37:g.39092824G>T	ENSP00000209718:p.Pro11His		Somatic	237	0	0		WXS	Illumina HiSeq	.	201	0.11	22	NM_015515	4	0.25	1	A8K084|B7Z7J2|I3L3Q6|Q9NUR6	Missense_Mutation	SNP	ENST00000209718.3	37	CCDS11380.1	.	.	.	.	.	.	.	.	.	.	G	4.074	0.011602	0.07912	.	.	ENSG00000108244	ENST00000209718	D	0.82167	-1.58	5.73	5.8E-4	0.14042	.	1.150020	0.06464	N	0.729943	T	0.65133	0.2662	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.46162	-0.9211	10	0.26408	T	0.33	.	1.6881	0.02845	0.1965:0.0995:0.3207:0.3833	.	11	Q9C075	K1C23_HUMAN	H	11	ENSP00000209718:P11H	ENSP00000209718:P11H	P	-	2	0	KRT23	36346350	0.247000	0.23920	0.000000	0.03702	0.014000	0.08584	0.113000	0.15499	-0.202000	0.10268	-0.321000	0.08615	CCC			0.701	KRT23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257223.1			
LRRC37A	9884	broad.mit.edu	37	17	44409918	44409918	+	Splice_Site	SNP	C	C	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr17:44409918C>T	ENST00000320254.5	+	10	4708	c.4705C>T	c.(4705-4707)Ctc>Ttc	p.L1569F	ARL17B_ENST00000575960.1_Intron|LRRC37A_ENST00000393465.3_Splice_Site_p.L1569F|LRRC37A_ENST00000496930.1_Splice_Site_p.L607F|ARL17B_ENST00000570618.1_Intron|ARL17B_ENST00000434041.2_Intron|ARL17B_ENST00000575698.1_Intron	NM_014834.4	NP_055649.4	A6NMS7	L37A1_HUMAN	leucine rich repeat containing 37A	1569						integral component of membrane (GO:0016021)				endometrium(1)|lung(2)|pancreas(6)|prostate(1)|skin(1)	11		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		TTTTTTTTAGCTCAAAAAAGA	0.323																																					p.L1569F													.	LRRC37A	19		0			c.C4705T												76.0	117.0	103.0					17																	44409918		2188	4284	6472	SO:0001630	splice_region_variant	9884	exon10			TTTTAGCTCAAAA	BC040501	CCDS11504.2	17q21.31	2014-04-01			ENSG00000176681	ENSG00000176681			29069	protein-coding gene	gene with protein product						9628581, 15533724	Standard	NM_014834		Approved	KIAA0563	uc031rbr.1	A6NMS7	OTTHUMG00000149841	ENST00000320254.5:c.4705-1C>T	17.37:g.44409918C>T			Somatic	223	0.0134529148	3		WXS	Illumina HiSeq	Phase_I	302	0.04	13	NM_014834	72	0.00	0	Q68DY2|Q8IWC7	Splice_Site	SNP	ENST00000320254.5	37	CCDS11504.2	.	.	.	.	.	.	.	.	.	.	c	3.038	-0.198190	0.06219	.	.	ENSG00000176681	ENST00000496930;ENST00000393466;ENST00000393465;ENST00000320254	T;T;T	0.51817	0.69;0.69;0.69	2.49	1.46	0.22682	.	.	.	.	.	T	0.40067	0.1102	L	0.55743	1.74	0.23524	N	0.997495	B;P;B	0.35700	0.206;0.516;0.01	B;B;B	0.37422	0.133;0.249;0.003	T	0.24190	-1.0167	8	.	.	.	.	5.6895	0.17821	0.0:0.8391:0.0:0.1609	.	607;689;1569	E9PP10;Q5YKG5;A6NMS7	.;.;L37A1_HUMAN	F	607;1569;1569;1569	ENSP00000437021:L607F;ENSP00000377108:L1569F;ENSP00000326324:L1569F	.	L	+	1	0	LRRC37A	41765680	0.059000	0.20769	0.159000	0.22649	0.353000	0.29299	-0.029000	0.12329	0.573000	0.29400	0.423000	0.28283	CTC			0.323	LRRC37A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000313519.3		NM_014834	Missense_Mutation
HOXB4	3214	mdanderson.org	37	17	46655235	46655235	+	Silent	SNP	G	G	A			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr17:46655235G>A	ENST00000332503.5	-	1	2238	c.447C>T	c.(445-447)caC>caT	p.H149H	HOXB-AS3_ENST00000465846.2_RNA|HOXB3_ENST00000472863.1_Intron|HOXB3_ENST00000465120.3_Intron|HOXB3_ENST00000485909.2_5'Flank|MIR10A_ENST00000385043.1_RNA|HOXB3_ENST00000552000.2_Intron|HOXB3_ENST00000476342.1_Intron|HOXB3_ENST00000489475.1_Intron|HOXB3_ENST00000498678.1_Intron|HOXB3_ENST00000460160.1_Intron	NM_024015.4	NP_076920.1	P17483	HXB4_HUMAN	homeobox B4	149					anterior/posterior pattern specification (GO:0009952)|bone marrow development (GO:0048539)|cell proliferation (GO:0008283)|definitive hemopoiesis (GO:0060216)|embryonic skeletal system morphogenesis (GO:0048704)|hematopoietic stem cell differentiation (GO:0060218)|morphogenesis of an epithelial sheet (GO:0002011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell division (GO:0048103)|spleen development (GO:0048536)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|urinary_tract(2)	9						CCGTGCTCACGTGAACTTTGC	0.687																																					p.H149H													.	.			0			c.C447T												22.0	26.0	25.0					17																	46655235		2168	4218	6386	SO:0001819	synonymous_variant	3214	exon1			GCTCACGTGAACT		CCDS11529.1	17q21.32	2011-06-20	2005-12-22		ENSG00000182742	ENSG00000182742		"""Homeoboxes / ANTP class : HOXL subclass"""	5115	protein-coding gene	gene with protein product		142965	"""homeo box B4"""	HOX2, HOX2F		1973146, 1358459	Standard	NM_024015		Approved		uc002inp.3	P17483	OTTHUMG00000159920	ENST00000332503.5:c.447C>T	17.37:g.46655235G>A			Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_024015	0		0	Q9NTA0	Silent	SNP	ENST00000332503.5	37	CCDS11529.1																																																																																					0.687	HOXB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000358259.2			
SLC39A11	201266	mdanderson.org	37	17	70645040	70645040	+	Silent	SNP	C	C	A			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr17:70645040C>A	ENST00000542342.2	-	9	940	c.852G>T	c.(850-852)gtG>gtT	p.V284V	SLC39A11_ENST00000255559.3_Silent_p.V277V|SLC39A11_ENST00000579988.1_5'UTR	NM_001159770.1	NP_001153242.1	Q8N1S5	S39AB_HUMAN	solute carrier family 39, member 11	284					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			endometrium(1)|large_intestine(4)|liver(2)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	16						CAGCCAGCACCACGGCAAAGG	0.622																																					p.V284V	NSCLC(95;736 1527 12296 39625 41839)												.	.			0			c.G852T												58.0	54.0	55.0					17																	70645040		2203	4300	6503	SO:0001819	synonymous_variant	201266	exon9			CAGCACCACGGCA	AF331643	CCDS11690.1, CCDS54160.1	17q24.3-q25.1	2014-08-12	2013-07-17	2003-10-24	ENSG00000133195	ENSG00000133195		"""Solute carriers"""	14463	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 26"""	C17orf26		11707075	Standard	NM_139177		Approved		uc002jjb.3	Q8N1S5	OTTHUMG00000178306	ENST00000542342.2:c.852G>T	17.37:g.70645040C>A			Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	83	0.06	5	NM_001159770	22	0.00	0	B2R8H7|Q8WZ81	Silent	SNP	ENST00000542342.2	37	CCDS54160.1																																																																																					0.622	SLC39A11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000441442.1			
FASN	2194	broad.mit.edu	37	17	80041214	80041214	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr17:80041214A>C	ENST00000306749.2	-	32	5647	c.5429T>G	c.(5428-5430)gTg>gGg	p.V1810G	FASN_ENST00000579758.1_5'Flank	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1810	Enoyl reductase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	AAGCGCCCACACCTCCCGCCA	0.637																																					p.V1810G	Colon(59;314 1043 11189 28578 32273)												.	FASN	154		0			c.T5429G												65.0	64.0	64.0					17																	80041214		2199	4298	6497	SO:0001583	missense	2194	exon32			GCCCACACCTCCC	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.5429T>G	17.37:g.80041214A>C	ENSP00000304592:p.Val1810Gly		Somatic	82	0.2195121951	18		WXS	Illumina HiSeq	Phase_I	90	0.33	30	NM_004104	112	0.08	9	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	37	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	A	15.56	2.870320	0.51588	.	.	ENSG00000169710	ENST00000306749;ENST00000545909	T	0.04502	3.61	4.25	4.25	0.50352	Alcohol dehydrogenase, C-terminal (1);Polyketide synthase, enoylreductase (1);NAD(P)-binding domain (1);	0.306795	0.31020	N	0.008405	T	0.27241	0.0668	M	0.91717	3.235	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.21008	-1.0258	10	0.87932	D	0	-33.2021	13.4806	0.61334	1.0:0.0:0.0:0.0	.	1810	P49327	FAS_HUMAN	G	1810;775	ENSP00000304592:V1810G	ENSP00000304592:V1810G	V	-	2	0	FASN	77634503	1.000000	0.71417	0.566000	0.28421	0.017000	0.09413	8.775000	0.91772	1.760000	0.52011	0.459000	0.35465	GTG			0.637	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000442369.1		NM_004104	
MAP1S	55201	mdanderson.org	37	19	17837105	17837105	+	Silent	SNP	G	G	A	rs547493369		TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr19:17837105G>A	ENST00000324096.4	+	5	1063	c.912G>A	c.(910-912)ctG>ctA	p.L304L	MAP1S_ENST00000597681.1_Intron|MAP1S_ENST00000544059.2_Silent_p.L278L|CTD-3149D2.4_ENST00000595363.1_RNA	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	304	Necessary for the microtubule-organizing center localization.				apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						TCAACAGCCTGCTGCGGCGCA	0.697													G|||	1	0.000199681	0.0008	0.0	5008	,	,		13243	0.0		0.0	False		,,,				2504	0.0				p.L304L													.	.			0			c.G912A												12.0	13.0	13.0					19																	17837105		2195	4290	6485	SO:0001819	synonymous_variant	55201	exon5			CAGCCTGCTGCGG	BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.912G>A	19.37:g.17837105G>A			Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_018174	71	0.00	0	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Silent	SNP	ENST00000324096.4	37	CCDS32954.1																																																																																					0.697	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466027.1		NM_018174	
TIMM50	92609	mdanderson.org	37	19	39971461	39971461	+	5'Flank	SNP	C	C	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr19:39971461C>T	ENST00000607714.1	+	0	0				TIMM50_ENST00000544017.1_5'Flank|TIMM50_ENST00000314349.4_Nonsense_Mutation_p.R93*|TIMM50_ENST00000599794.1_5'Flank			Q3ZCQ8	TIM50_HUMAN	translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae)						cellular protein metabolic process (GO:0044267)|mitochondrial membrane organization (GO:0007006)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein targeting to mitochondrion (GO:0006626)|release of cytochrome c from mitochondria (GO:0001836)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial inner membrane presequence translocase complex (GO:0005744)|mitochondrion (GO:0005739)|nuclear speck (GO:0016607)	interleukin-2 receptor binding (GO:0005134)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|ribonucleoprotein complex binding (GO:0043021)|RNA binding (GO:0003723)			NS(1)|endometrium(3)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)	14	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GAAGAGGGAGCGAGTGGGCGG	0.731																																					p.R93X													.	.			0			c.C277T												11.0	13.0	13.0					19																	39971461		2163	4203	6366	SO:0001631	upstream_gene_variant	92609	exon1			AGGGAGCGAGTGG	BC009072	CCDS33023.1	19q13.2	2010-06-21	2006-04-04		ENSG00000105197	ENSG00000105197		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	23656	protein-coding gene	gene with protein product		607381	"""translocase of inner mitochondrial membrane 50 homolog (yeast)"""			12437925	Standard	NM_001001563		Approved	TIM50L	uc002olu.1	Q3ZCQ8			19.37:g.39971461C>T	Exception_encountered		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	28	0.07	2	NM_001001563	0		0	Q330K1|Q6QA00|Q96FJ5|Q96GY2|Q9H370	Nonsense_Mutation	SNP	ENST00000607714.1	37		.	.	.	.	.	.	.	.	.	.	C	23.6	4.431843	0.83776	.	.	ENSG00000105197	ENST00000314349	.	.	.	2.55	-0.905	0.10527	.	1.256220	0.06100	N	0.665240	.	.	.	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	.	.	.	.	.	.	.	11.689	5.0666	0.14585	0.0:0.4968:0.0:0.5032	.	.	.	.	X	93	.	.	R	+	1	2	TIMM50	44663301	0.001000	0.12720	0.012000	0.15200	0.044000	0.14063	-0.719000	0.04974	-0.107000	0.12088	0.449000	0.29647	CGA			0.731	TIMM50-021	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000470728.1		NM_001001563	
ERCC2	2068	broad.mit.edu	37	19	45855573	45855573	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr19:45855573C>T	ENST00000391945.4	-	22	2161	c.2084G>A	c.(2083-2085)cGc>cAc	p.R695H	ERCC2_ENST00000391944.3_Missense_Mutation_p.R617H	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	695					7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		CTGGATCCAGCGGGGCAGCTT	0.652			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.R695H			yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	.	ERCC2	78		0			c.G2084A												89.0	70.0	77.0					19																	45855573		2203	4300	6503	SO:0001583	missense	2068	exon22	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	ATCCAGCGGGGCA		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.2084G>A	19.37:g.45855573C>T	ENSP00000375809:p.Arg695His		Somatic	85	0.0117647059	1		WXS	Illumina HiSeq	Phase_I	69	0.06	4	NM_000400	124	0.00	0	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	37	CCDS33049.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.614473	0.87359	.	.	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944	D;D;D	0.92595	-3.07;-2.97;-2.97	5.27	5.27	0.74061	.	0.059919	0.64402	D	0.000002	D	0.93207	0.7836	L	0.52126	1.63	0.80722	D	1	B;B;D	0.69078	0.066;0.334;0.997	B;B;P	0.61070	0.096;0.166;0.883	D	0.93163	0.6559	10	0.62326	D	0.03	-27.7118	11.4849	0.50348	0.1795:0.8205:0.0:0.0	.	617;695;388	E7EVE9;P18074;Q6ZNQ5	.;ERCC2_HUMAN;.	H	645;671;695;617	ENSP00000375805:R645H;ENSP00000375809:R695H;ENSP00000375808:R617H	ENSP00000375805:R645H	R	-	2	0	ERCC2	50547413	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.104000	0.64584	2.461000	0.83175	0.561000	0.74099	CGC			0.652	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000109626.2		NM_000400	
DNAAF3	352909	mdanderson.org	37	19	55673073	55673073	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr19:55673073G>T	ENST00000524407.2	-	6	634	c.601C>A	c.(601-603)Cgc>Agc	p.R201S	DNAAF3_ENST00000391720.4_Missense_Mutation_p.R248S|DNAAF3_ENST00000527223.2_Missense_Mutation_p.R269S|CTD-2587H24.5_ENST00000591665.1_RNA|DNAAF3_ENST00000587789.2_5'Flank|DNAAF3_ENST00000455045.1_Missense_Mutation_p.R147S|CTD-2587H24.4_ENST00000587871.1_5'Flank			Q8N9W5	DAAF3_HUMAN	dynein, axonemal, assembly factor 3	201					axonemal dynein complex assembly (GO:0070286)|motile cilium assembly (GO:0044458)	cytoplasm (GO:0005737)											GCGTCGTAGCGGGAGCCCAGG	0.726																																					p.R269S													.	.			0			c.C805A												3.0	5.0	4.0					19																	55673073		1816	3867	5683	SO:0001583	missense	352909	exon6			CGTAGCGGGAGCC	AK097388	CCDS12918.2, CCDS58679.1, CCDS58680.1, CCDS59422.1	19q13.42	2012-10-05	2012-03-09	2012-03-09	ENSG00000167646	ENSG00000167646			30492	protein-coding gene	gene with protein product		614566	"""chromosome 19 open reading frame 51"", ""ciliary dyskinesia, primary 2"""	C19orf51, CILD2		22387996	Standard	NM_001256714		Approved	FLJ40069, FLJ36139, PF22, PCD	uc002qjl.2	Q8N9W5	OTTHUMG00000128547	ENST00000524407.2:c.601C>A	19.37:g.55673073G>T	ENSP00000432046:p.Arg201Ser		Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	27	0.07	2	NM_001256714	17	0.00	0	A8MUY0|E3W9A1|E9PAX5|Q6P4F6|Q8N9W0|Q96AR2	Missense_Mutation	SNP	ENST00000524407.2	37	CCDS59422.1	.	.	.	.	.	.	.	.	.	.	G	31	5.072038	0.93950	.	.	ENSG00000167646	ENST00000301249;ENST00000455045;ENST00000391720	T;T	0.56444	0.46;0.46	4.37	4.37	0.52481	.	0.000000	0.85682	D	0.000000	T	0.75243	0.3823	M	0.85197	2.74	0.53688	D	0.999974	P;D;D;D	0.89917	0.945;1.0;1.0;0.993	P;D;D;P	0.91635	0.51;0.999;0.998;0.851	T	0.80999	-0.1131	10	0.87932	D	0	-22.7741	16.123	0.81375	0.0:0.0:1.0:0.0	.	269;147;222;201	E9PAX5;E3W9A1;Q8N9W5-3;Q8N9W5	.;.;.;CS051_HUMAN	S	269;147;248	ENSP00000394343:R147S;ENSP00000375600:R248S	ENSP00000301249:R269S	R	-	1	0	C19orf51	60364885	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.505000	0.73708	2.153000	0.67306	0.555000	0.69702	CGC			0.726	DNAAF3-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000250388.5		NM_178837	
SLC39A10	57181	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	196581655	196581655	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr2:196581655C>T	ENST00000409086.3	+	7	2266	c.1991C>T	c.(1990-1992)aCa>aTa	p.T664I	SLC39A10_ENST00000541054.1_Missense_Mutation_p.T214I|SLC39A10_ENST00000359634.5_Missense_Mutation_p.T664I	NM_001127257.1	NP_001120729.1	Q9ULF5	S39AA_HUMAN	solute carrier family 39 (zinc transporter), member 10	664					transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(16)|pancreas(1)|prostate(1)|skin(2)	34			OV - Ovarian serous cystadenocarcinoma(117;0.221)			CTGAAAGAAACAGGAATAGCT	0.478																																					p.T664I													.	.			0			c.C1991T												130.0	123.0	126.0					2																	196581655		2203	4300	6503	SO:0001583	missense	57181	exon7			AAGAAACAGGAAT		CCDS33353.1	2q33.1	2013-05-22			ENSG00000196950	ENSG00000196950		"""Solute carriers"""	20861	protein-coding gene	gene with protein product		608733	"""solute carrier family 39 (metal ion transporter), member 10"""			12659941	Standard	NM_020342		Approved	KIAA1265, FLJ90515, DKFZp564L2123	uc002utg.4	Q9ULF5	OTTHUMG00000154380	ENST00000409086.3:c.1991C>T	2.37:g.196581655C>T	ENSP00000386766:p.Thr664Ile		Somatic	122	0	0		WXS	Illumina HiSeq	.	107	0.09	10	NM_020342	5	0.40	2	A8K5C6|B4DGU0|Q3MJA4|Q68CR5|Q6DKH6|Q9Y3Z1	Missense_Mutation	SNP	ENST00000409086.3	37	CCDS33353.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.280625	0.80692	.	.	ENSG00000196950	ENST00000409086;ENST00000359634;ENST00000541054	T;T;T	0.51325	0.71;0.71;0.71	5.54	5.54	0.83059	.	0.048209	0.85682	D	0.000000	T	0.59905	0.2228	L	0.43152	1.355	0.58432	D	0.999997	D	0.54047	0.964	P	0.59595	0.86	T	0.54430	-0.8295	10	0.42905	T	0.14	.	19.6787	0.95950	0.0:1.0:0.0:0.0	.	664	Q9ULF5	S39AA_HUMAN	I	664;664;214	ENSP00000386766:T664I;ENSP00000352655:T664I;ENSP00000437787:T214I	ENSP00000352655:T664I	T	+	2	0	SLC39A10	196289900	1.000000	0.71417	0.995000	0.50966	0.596000	0.36781	7.247000	0.78257	2.890000	0.99128	0.650000	0.86243	ACA			0.478	SLC39A10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000335186.1		XM_047707	
ITSN1	6453	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	35144498	35144498	+	Silent	SNP	G	G	A			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr21:35144498G>A	ENST00000381318.3	+	12	1464	c.1176G>A	c.(1174-1176)gaG>gaA	p.E392E	ITSN1_ENST00000381291.4_Silent_p.E392E|ITSN1_ENST00000488166.1_3'UTR|ITSN1_ENST00000399355.2_Silent_p.E392E|ITSN1_ENST00000399349.1_Silent_p.E392E|ITSN1_ENST00000437442.2_Silent_p.E392E|ITSN1_ENST00000399367.3_Silent_p.E392E|ITSN1_ENST00000399326.3_Silent_p.E392E|ITSN1_ENST00000381285.4_Silent_p.E392E|ITSN1_ENST00000379960.5_Silent_p.E392E|ITSN1_ENST00000399352.1_Silent_p.E392E|ITSN1_ENST00000399353.1_Silent_p.E355E|AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000399338.4_Silent_p.E392E	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)	392	KLERQ.				apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						CGGAGCAGGAGAGGAAGGAGC	0.607																																					p.E392E													.	.			0			c.G1176A												55.0	62.0	60.0					21																	35144498		2203	4300	6503	SO:0001819	synonymous_variant	6453	exon12			GCAGGAGAGGAAG	AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.1176G>A	21.37:g.35144498G>A			Somatic	121	0	0		WXS	Illumina HiSeq	.	165	0.10	17	NM_001001132	10	0.30	3	A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Silent	SNP	ENST00000381318.3	37	CCDS33545.1																																																																																					0.607	ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000140070.4		NM_003024	
IL17REL	400935	mdanderson.org	37	22	50439249	50439249	+	Silent	SNP	G	G	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr22:50439249G>T	ENST00000389983.2	-	5	417	c.153C>A	c.(151-153)acC>acA	p.T51T	IL17REL_ENST00000341280.5_Silent_p.T51T	NM_001001694.2	NP_001001694.2	Q6ZVW7	I17EL_HUMAN	interleukin 17 receptor E-like	51										endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)	6		all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		GCGTCTCCTGGGTGTCCAGGC	0.721																																					p.T51T													.	.			0			c.C153A												15.0	18.0	17.0					22																	50439249		2197	4294	6491	SO:0001819	synonymous_variant	400935	exon5			CTCCTGGGTGTCC	AK123987	CCDS33679.1	22q13.33	2009-01-13			ENSG00000188263	ENSG00000188263			33808	protein-coding gene	gene with protein product		613414					Standard	NM_001001694		Approved	FLJ41993	uc003bje.1	Q6ZVW7	OTTHUMG00000150242	ENST00000389983.2:c.153C>A	22.37:g.50439249G>T			Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	29	0.10	3	NM_001001694	0		0	A6NCN4|A6PVC1	Silent	SNP	ENST00000389983.2	37	CCDS33679.1																																																																																					0.721	IL17REL-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000317011.1		NM_001001694	
LMCD1	29995	bcgsc.ca	37	3	8543418	8543418	+	5'UTR	SNP	G	G	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr3:8543418G>T	ENST00000157600.3	+	0	26				LMCD1-AS1_ENST00000420095.1_RNA|LMCD1-AS1_ENST00000446281.1_RNA|LMCD1-AS1_ENST00000439407.1_RNA|LMCD1-AS1_ENST00000455811.2_RNA|LMCD1-AS1_ENST00000452802.1_RNA|LMCD1_ENST00000397386.3_5'Flank|LMCD1_ENST00000454244.1_5'Flank|LMCD1_ENST00000535732.1_5'Flank	NM_014583.2	NP_055398.1	Q9NZU5	LMCD1_HUMAN	LIM and cysteine-rich domains 1						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|regulation of cardiac muscle hypertrophy (GO:0010611)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)	16				OV - Ovarian serous cystadenocarcinoma(96;0.124)		GGGATTGGCTGGCCTCGCGCG	0.697																																					.													.	LMCD1	38		0			.																																									SO:0001623	5_prime_UTR_variant	29995	.			TTGGCTGGCCTCG	AF169284	CCDS33688.1, CCDS63533.1, CCDS63534.1	3p26-p24	2008-07-18			ENSG00000071282	ENSG00000071282			6633	protein-coding gene	gene with protein product	"""dyxin"""	604859				10662546	Standard	NM_001278233		Approved		uc003bqq.4	Q9NZU5	OTTHUMG00000154971	ENST00000157600.3:c.-207G>T	3.37:g.8543418G>T			Somatic	39	0	0		WXS	Illumina HiSeq	Phase_1	29	0.24	7	.	0		0	B4DG80	Missense_Mutation	SNP	ENST00000157600.3	37	CCDS33688.1																																																																																					0.697	LMCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000337854.1		NM_014583	
LIMD1	8994	broad.mit.edu	37	3	45637462	45637462	+	Missense_Mutation	SNP	C	C	T	rs371029378		TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr3:45637462C>T	ENST00000273317.4	+	1	1112	c.1091C>T	c.(1090-1092)gCg>gTg	p.A364V	LIMD1_ENST00000440097.1_Missense_Mutation_p.A364V|LIMD1_ENST00000465039.1_Intron	NM_014240.2	NP_055055.1	Q9UGP4	LIMD1_HUMAN	LIM domains containing 1	364					cell migration (GO:0016477)|cytoplasmic mRNA processing body assembly (GO:0033962)|cytoskeleton organization (GO:0007010)|gene silencing by miRNA (GO:0035195)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of hippo signaling (GO:0035331)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|phosphorylation (GO:0016310)|positive regulation of gene silencing by miRNA (GO:2000637)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|RISC complex (GO:0016442)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.011)|KIRC - Kidney renal clear cell carcinoma(197;0.0264)|Kidney(197;0.0315)		CAGCAGGGTGCGGTCCCTGGG	0.632																																					p.A364V													.	LIMD1	34		0			c.C1091T							C	VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	66.0	65.0	65.0		1091	-0.5	0.0	3		65	0,8600		0,0,4300	no	missense	LIMD1	NM_014240.2	64	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	364/677	45637462	1,13005	2203	4300	6503	SO:0001583	missense	8994	exon1			AGGGTGCGGTCCC	AJ132408	CCDS2729.1	3p21.31	2008-02-01			ENSG00000144791	ENSG00000144791			6612	protein-coding gene	gene with protein product		604543				10647888	Standard	NM_014240		Approved		uc003coq.3	Q9UGP4	OTTHUMG00000133453	ENST00000273317.4:c.1091C>T	3.37:g.45637462C>T	ENSP00000273317:p.Ala364Val		Somatic	212	0	0		WXS	Illumina HiSeq	Phase_I	194	0.02	4	NM_014240	0		0	Q17RQ1|Q9BQQ9|Q9NQ47	Missense_Mutation	SNP	ENST00000273317.4	37	CCDS2729.1	.	.	.	.	.	.	.	.	.	.	C	4.329	0.060465	0.08339	2.27E-4	0.0	ENSG00000144791	ENST00000440097;ENST00000273317	T;T	0.57907	0.37;0.57	4.51	-0.47	0.12131	.	1.995580	0.02416	N	0.082088	T	0.34687	0.0906	N	0.17082	0.46	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.09079	-1.0691	10	0.22109	T	0.4	.	5.4033	0.16308	0.0:0.4736:0.1363:0.3901	.	364	Q9UGP4	LIMD1_HUMAN	V	364	ENSP00000394537:A364V;ENSP00000273317:A364V	ENSP00000273317:A364V	A	+	2	0	LIMD1	45612466	0.000000	0.05858	0.001000	0.08648	0.120000	0.20174	-0.016000	0.12613	-0.337000	0.08426	0.655000	0.94253	GCG			0.632	LIMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257327.1		NM_014240	
PLXNB1	5364	mdanderson.org	37	3	48445924	48445924	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr3:48445924G>T	ENST00000358536.4	-	38	6646	c.6377C>A	c.(6376-6378)gCt>gAt	p.A2126D	PLXNB1_ENST00000448774.2_Missense_Mutation_p.A737D|PLXNB1_ENST00000358459.4_Missense_Mutation_p.A1943D|PLXNB1_ENST00000456774.1_Missense_Mutation_p.A1943D|PLXNB1_ENST00000296440.6_Missense_Mutation_p.A2126D	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	2126					axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		TTCCACAGCAGCTGCAATCTG	0.592																																					p.A2126D													.	.			0			c.C6377A												56.0	54.0	55.0					3																	48445924		2203	4300	6503	SO:0001583	missense	5364	exon38			ACAGCAGCTGCAA	X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.6377C>A	3.37:g.48445924G>T	ENSP00000351338:p.Ala2126Asp		Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_001130082	65	0.00	0	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Missense_Mutation	SNP	ENST00000358536.4	37	CCDS2765.1	.	.	.	.	.	.	.	.	.	.	G	32	5.138151	0.94560	.	.	ENSG00000164050	ENST00000296440;ENST00000358459;ENST00000358536;ENST00000448774;ENST00000456774	T;T;T;T;T	0.13307	3.76;3.81;3.76;2.6;3.81	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	T	0.36717	0.0977	M	0.68952	2.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.08391	-1.0724	10	0.49607	T	0.09	.	17.035	0.86471	0.0:0.0:1.0:0.0	.	2126;1943	O43157;O43157-2	PLXB1_HUMAN;.	D	2126;1943;2126;737;1943	ENSP00000296440:A2126D;ENSP00000351242:A1943D;ENSP00000351338:A2126D;ENSP00000389320:A737D;ENSP00000414199:A1943D	ENSP00000296440:A2126D	A	-	2	0	PLXNB1	48420928	1.000000	0.71417	0.935000	0.37517	0.997000	0.91878	9.767000	0.98960	2.258000	0.74832	0.650000	0.86243	GCT			0.592	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000344454.1		NM_002673	
C3orf58	205428	mdanderson.org	37	3	143691653	143691653	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr3:143691653C>T	ENST00000315691.3	+	1	1014	c.479C>T	c.(478-480)gCg>gTg	p.A160V	C3orf58_ENST00000495414.1_5'Flank|C3orf58_ENST00000493396.1_3'UTR|C3orf58_ENST00000441925.2_5'Flank	NM_173552.3	NP_775823.1	Q8NDZ4	DIA1_HUMAN	chromosome 3 open reading frame 58	160					cardiac muscle cell proliferation (GO:0060038)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)	COPI vesicle coat (GO:0030126)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						ACGCCCGAGGCGGTGGAGGGC	0.736																																					p.A160V													.	.			0			c.C479T												6.0	5.0	6.0					3																	143691653		2070	4088	6158	SO:0001583	missense	205428	exon1			CCGAGGCGGTGGA	AK095161	CCDS3130.1, CCDS46929.1	3q24	2013-12-06			ENSG00000181744	ENSG00000181744			28490	protein-coding gene	gene with protein product	"""deleted in autism 1"", ""hypoxia and Akt induced stem cell factor"""	612200				21283809, 23784961, 24269490	Standard	NM_173552		Approved	MGC33365, DIA1, HASF	uc003evo.3	Q8NDZ4	OTTHUMG00000159380	ENST00000315691.3:c.479C>T	3.37:g.143691653C>T	ENSP00000320081:p.Ala160Val		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	16	0.19	3	NM_173552	0		0	B2RCF2|B7Z1W3	Missense_Mutation	SNP	ENST00000315691.3	37	CCDS3130.1	.	.	.	.	.	.	.	.	.	.	C	8.770	0.925705	0.18056	.	.	ENSG00000181744	ENST00000315691	T	0.28255	1.62	3.61	3.61	0.41365	.	0.074953	0.56097	D	0.000031	T	0.07052	0.0179	N	0.00289	-1.7	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.17379	-1.0371	10	0.15952	T	0.53	.	9.3333	0.38034	0.0:0.9003:0.0:0.0997	.	160	Q8NDZ4	CC058_HUMAN	V	160	ENSP00000320081:A160V	ENSP00000320081:A160V	A	+	2	0	C3orf58	145174343	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.859000	0.55987	1.863000	0.54032	0.561000	0.74099	GCG			0.736	C3orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000355038.1		NM_173552	
NDUFB5	4711	mdanderson.org	37	3	179322665	179322665	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr3:179322665G>T	ENST00000259037.3	+	1	176	c.62G>T	c.(61-63)cGg>cTg	p.R21L	MRPL47_ENST00000259038.2_5'Flank|MRPL47_ENST00000476781.1_5'Flank|NDUFB5_ENST00000472629.1_Missense_Mutation_p.R21L|NDUFB5_ENST00000493866.1_Missense_Mutation_p.R21L|MRPL47_ENST00000392659.2_5'Flank	NM_002492.3	NP_002483.1	O43674	NDUB5_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa	21					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(1)|lung(6)|skin(1)	8	all_cancers(143;9.62e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.18)			CTGTCTGGCCGGCCCCTTGGC	0.652																																					p.R21L													.	.			0			c.G62T												30.0	30.0	30.0					3																	179322665		2203	4300	6503	SO:0001583	missense	4711	exon1			CTGGCCGGCCCCT	AF047181	CCDS3234.1, CCDS56297.1, CCDS75054.1	3q27.1	2011-07-04	2002-08-29		ENSG00000136521	ENSG00000136521		"""Mitochondrial respiratory chain complex / Complex I"""	7700	protein-coding gene	gene with protein product	"""complex I SGDH subunit"""	603841	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5 (16kD, SGDH)"""			9425316	Standard	NM_002492		Approved	SGDH, CI-SGDH, MGC12314	uc003fkc.3	O43674	OTTHUMG00000157480	ENST00000259037.3:c.62G>T	3.37:g.179322665G>T	ENSP00000259037:p.Arg21Leu		Somatic	106	0	0		WXS	Illumina HiSeq	Phase_I	72	0.04	3	NM_001199958	149	0.00	0	Q561V6	Missense_Mutation	SNP	ENST00000259037.3	37	CCDS3234.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.15|12.15	1.852752|1.852752	0.32699|0.32699	.|.	.|.	ENSG00000136521|ENSG00000136521	ENST00000482604|ENST00000259037;ENST00000493866;ENST00000472629	.|T;T;T	.|0.55588	.|1.12;0.51;1.12	5.75|5.75	4.82|4.82	0.62117|0.62117	.|.	.|0.296492	.|0.35555	.|N	.|0.003137	T|T	0.54464|0.54464	0.1860|0.1860	M|M	0.82630|0.82630	2.6|2.6	0.36785|0.36785	D|D	0.884546|0.884546	.|P;P	.|0.48162	.|0.906;0.551	.|B;B	.|0.40602	.|0.334;0.313	T|T	0.63897|0.63897	-0.6533|-0.6533	6|10	0.48119|0.26408	T|T	0.1|0.33	-0.8876|-0.8876	13.8406|13.8406	0.63437|0.63437	0.0:0.1532:0.8467:0.0|0.0:0.1532:0.8467:0.0	.|.	.|21;21	.|Q561V6;O43674	.|.;NDUB5_HUMAN	C|L	18|21	.|ENSP00000259037:R21L;ENSP00000419656:R21L;ENSP00000419248:R21L	ENSP00000419099:G13C|ENSP00000259037:R21L	G|R	+|+	1|2	0|0	NDUFB5|NDUFB5	180805359|180805359	0.929000|0.929000	0.31497|0.31497	0.959000|0.959000	0.39883|0.39883	0.015000|0.015000	0.08874|0.08874	1.164000|1.164000	0.31810|0.31810	2.878000|2.878000	0.98634|0.98634	0.650000|0.650000	0.86243|0.86243	GGC|CGG			0.652	NDUFB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348937.2		NM_002492	
DSPP	1834	bcgsc.ca	37	4	88537027	88537027	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr4:88537027C>A	ENST00000282478.7	+	4	3246	c.3213C>A	c.(3211-3213)gaC>gaA	p.D1071E	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Missense_Mutation_p.D1071E			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1071	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		atagcagtgacagcagtgaca	0.542																																					p.D1071E													.	DSPP	174		0			c.C3213A												56.0	66.0	63.0					4																	88537027		1577	2848	4425	SO:0001583	missense	1834	exon5			CAGTGACAGCAGT	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3213C>A	4.37:g.88537027C>A	ENSP00000282478:p.Asp1071Glu		Somatic	115	0.0086956522	1		WXS	Illumina HiSeq	Phase_1	99	0.07	7	NM_014208	0		0	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	c	2.636	-0.285341	0.05605	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88124	-2.34;-2.34	1.15	-2.31	0.06765	.	.	.	.	.	T	0.69196	0.3084	L	0.38175	1.15	0.09310	N	1	P	0.46952	0.887	B	0.36766	0.232	T	0.66364	-0.5942	9	0.02654	T	1	.	2.058	0.03586	0.2533:0.3578:0.0:0.3889	.	1071	Q9NZW4	DSPP_HUMAN	E	1071	ENSP00000382213:D1071E;ENSP00000282478:D1071E	ENSP00000282478:D1071E	D	+	3	2	DSPP	88756051	0.029000	0.19370	0.018000	0.16275	0.040000	0.13550	-0.117000	0.10708	-0.986000	0.03498	0.282000	0.19409	GAC			0.542	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000363616.3		NM_014208	
FAM170A	340069	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	118965473	118965473	+	Nonsense_Mutation	SNP	C	C	T	rs567555202		TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr5:118965473C>T	ENST00000515256.1	+	1	182	c.10C>T	c.(10-12)Cga>Tga	p.R4*				A1A519	F170A_HUMAN	family with sequence similarity 170, member A	4					positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(7)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	24						CATGAAACGACGACAAAAGAG	0.468													C|||	1	0.000199681	0.0	0.0	5008	,	,		19050	0.0		0.0	False		,,,				2504	0.001				p.R4X													.	.			0			c.C10T												170.0	167.0	168.0					5																	118965473		1871	4114	5985	SO:0001587	stop_gained	340069	exon1			AAACGACGACAAA	AF427126	CCDS43353.1, CCDS54889.1	5q23.1	2008-06-12			ENSG00000164334	ENSG00000164334			27963	protein-coding gene	gene with protein product						12477932	Standard	NM_182761		Approved		uc003ksn.3	A1A519	OTTHUMG00000162946	ENST00000515256.1:c.10C>T	5.37:g.118965473C>T	ENSP00000422684:p.Arg4*		Somatic	74	0	0		WXS	Illumina HiSeq	.	101	0.20	20	NM_182761	7	0.00	0	Q66LM8|Q7Z4V2|Q8IW94	Nonsense_Mutation	SNP	ENST00000515256.1	37		.	.	.	.	.	.	.	.	.	.	C	29.0	4.971024	0.92919	.	.	ENSG00000164334	ENST00000296787;ENST00000515256;ENST00000509264	.	.	.	4.24	-2.63	0.06133	.	0.000000	0.38164	N	0.001785	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-9.347	14.3842	0.66931	0.7722:0.2278:0.0:0.0	.	.	.	.	X	4	.	.	R	+	1	2	FAM170A	118993372	0.002000	0.14202	0.002000	0.10522	0.825000	0.46686	-0.180000	0.09754	-0.541000	0.06257	0.561000	0.74099	CGA			0.468	FAM170A-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000371126.1		NM_182761	
PDE6A	5145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	149323894	149323894	+	Missense_Mutation	SNP	C	C	T	rs147159579	byFrequency	TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr5:149323894C>T	ENST00000255266.5	-	1	462	c.343G>A	c.(343-345)Gtc>Atc	p.V115I		NM_000440.2	NP_000431.2	P16499	PDE6A_HUMAN	phosphodiesterase 6A, cGMP-specific, rod, alpha	115	GAF 1.				cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	44			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Caffeine(DB00201)	TCCTTGTGGACATTGAAAAGC	0.572													C|||	2	0.000399361	0.0008	0.0	5008	,	,		18050	0.0		0.0	False		,,,				2504	0.001				p.V115I													.	.			0			c.G343A							C	ILE/VAL	9,4397	17.9+/-39.9	0,9,2194	91.0	87.0	89.0		343	5.5	1.0	5	dbSNP_134	89	0,8600		0,0,4300	yes	missense	PDE6A	NM_000440.2	29	0,9,6494	TT,TC,CC		0.0,0.2043,0.0692	benign	115/861	149323894	9,12997	2203	4300	6503	SO:0001583	missense	5145	exon1			TGTGGACATTGAA		CCDS4299.1	5q31.2-q34	2013-02-14			ENSG00000132915	ENSG00000132915	3.1.4.17	"""Phosphodiesterases"""	8785	protein-coding gene	gene with protein product		180071		PDEA		2155175	Standard	NM_000440		Approved	RP43	uc003lrg.4	P16499	OTTHUMG00000130047	ENST00000255266.5:c.343G>A	5.37:g.149323894C>T	ENSP00000255266:p.Val115Ile		Somatic	111	0	0		WXS	Illumina HiSeq	.	122	0.11	13	NM_000440	0		0	Q0P638	Missense_Mutation	SNP	ENST00000255266.5	37	CCDS4299.1	.	.	.	.	.	.	.	.	.	.	C	19.20	3.781610	0.70222	0.002043	0.0	ENSG00000132915	ENST00000255266	T	0.67523	-0.27	5.47	5.47	0.80525	GAF (2);	0.000000	0.85682	D	0.000000	T	0.70937	0.3281	L	0.58583	1.82	0.53005	D	0.999962	B	0.27316	0.175	B	0.39971	0.315	T	0.68017	-0.5520	10	0.38643	T	0.18	.	16.8098	0.85716	0.0:1.0:0.0:0.0	.	115	P16499	PDE6A_HUMAN	I	115	ENSP00000255266:V115I	ENSP00000255266:V115I	V	-	1	0	PDE6A	149304087	1.000000	0.71417	0.982000	0.44146	0.770000	0.43624	4.809000	0.62591	2.569000	0.86673	0.561000	0.74099	GTC	0.001		0.572	PDE6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252326.2			
FLT4	2324	mdanderson.org	37	5	180055910	180055910	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr5:180055910C>T	ENST00000261937.6	-	8	1153	c.1075G>A	c.(1075-1077)Gca>Aca	p.A359T	FLT4_ENST00000393347.3_Missense_Mutation_p.A359T|FLT4_ENST00000424276.2_5'UTR|FLT4_ENST00000502649.1_Missense_Mutation_p.A359T	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	359	Ig-like C2-type 4.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GGGTACGCTGCCAGCTTCACG	0.632																																					p.A359T	Colon(97;1075 1466 27033 27547 35871)												.	.			0			c.G1075A												29.0	32.0	31.0					5																	180055910		2200	4293	6493	SO:0001583	missense	2324	exon8			ACGCTGCCAGCTT	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.1075G>A	5.37:g.180055910C>T	ENSP00000261937:p.Ala359Thr		Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_182925	1	0.00	0	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	ENST00000261937.6	37	CCDS4457.1	.	.	.	.	.	.	.	.	.	.	C	8.893	0.954569	0.18431	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649;ENST00000376868	T;T;T	0.75477	-0.93;-0.94;-0.93	4.68	2.79	0.32731	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.59032	0.2164	N	0.13003	0.285	0.31092	N	0.710685	P;B;B	0.35575	0.51;0.142;0.142	B;B;B	0.39840	0.311;0.216;0.216	T	0.54977	-0.8212	9	0.14252	T	0.57	.	12.4375	0.55608	0.4661:0.5339:0.0:0.0	.	359;359;359	P35916-3;E9PD35;P35916	.;.;VGFR3_HUMAN	T	359;359;359;169	ENSP00000261937:A359T;ENSP00000377016:A359T;ENSP00000426057:A359T	ENSP00000261937:A359T	A	-	1	0	FLT4	179988516	0.978000	0.34361	0.860000	0.33809	0.401000	0.30781	2.477000	0.45180	0.442000	0.26555	0.561000	0.74099	GCA			0.632	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253527.4			
ZNF192P1	651302	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	28134497	28134497	+	RNA	SNP	C	C	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr6:28134497C>T	ENST00000440790.2	+	0	600					NR_103448.1				zinc finger protein 192 pseudogene 1																		AAGAAGTTTGCCCAGAGCTCA	0.458																																					.													.	.			0			.												100.0	96.0	97.0					6																	28134497		692	1591	2283			0	.			AGTTTGCCCAGAG			6p22.1	2012-10-05	2011-08-31	2011-08-31	ENSG00000226314	ENSG00000226314			18777	pseudogene	pseudogene	"""zinc finger protein 389, pseudogene"""		"""zinc finger protein 389"""	ZNF389			Standard	NR_103448		Approved	dJ265C24.4, ZNF389P	uc021yrq.2		OTTHUMG00000014513		6.37:g.28134497C>T			Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	86	0.10	9	.	4	0.00	0		RNA	SNP	ENST00000440790.2	37																																																																																						0.458	ZNF192P1-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000040181.1			
MAP3K4	4216	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	161533755	161533755	+	Silent	SNP	G	G	A			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr6:161533755G>A	ENST00000392142.4	+	25	4723	c.4575G>A	c.(4573-4575)gcG>gcA	p.A1525A	MAP3K4_ENST00000348824.7_Silent_p.A1471A|MAP3K4_ENST00000366919.2_Silent_p.A1475A|MAP3K4_ENST00000366920.2_Silent_p.A1521A	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	1525	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		ATGGGCGTGCGGCCGACATCT	0.527																																					p.A1525A													.	.			0			c.G4575A												134.0	131.0	132.0					6																	161533755		2203	4300	6503	SO:0001819	synonymous_variant	4216	exon25			GCGTGCGGCCGAC	AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.4575G>A	6.37:g.161533755G>A			Somatic	153	0	0		WXS	Illumina HiSeq	.	130	0.05	7	NM_005922	90	0.22	20	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Silent	SNP	ENST00000392142.4	37	CCDS34565.1																																																																																					0.527	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000042988.3			
CASD1	64921	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	94183874	94183874	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr7:94183874A>T	ENST00000297273.4	+	17	2401	c.2114A>T	c.(2113-2115)aAa>aTa	p.K705I		NM_022900.4	NP_075051.4	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1	705						integral component of membrane (GO:0016021)				NS(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	31	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			TGGTTTGGAAAAATTTCATTA	0.343																																					p.K705I													.	.			0			c.A2114T												125.0	125.0	125.0					7																	94183874		2202	4299	6501	SO:0001583	missense	64921	exon17			TTGGAAAAATTTC	AF355594	CCDS5636.1	7q22	2006-03-09			ENSG00000127995	ENSG00000127995			16014	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 12"""	611686				11703667, 11528394	Standard	NM_022900		Approved	FLJ21213, FLJ21879, C7orf12	uc003uni.4	Q96PB1	OTTHUMG00000023356	ENST00000297273.4:c.2114A>T	7.37:g.94183874A>T	ENSP00000297273:p.Lys705Ile		Somatic	93	0	0		WXS	Illumina HiSeq	.	115	0.13	15	NM_022900	16	0.00	0	B3KW13|O14574|Q3LIE2|Q6P4R4|Q9H6T9|Q9H770	Missense_Mutation	SNP	ENST00000297273.4	37	CCDS5636.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.190063	0.78789	.	.	ENSG00000127995	ENST00000297273	T	0.48836	0.8	5.3	1.64	0.23874	.	0.047167	0.85682	D	0.000000	T	0.63022	0.2476	M	0.85197	2.74	0.53688	D	0.999976	P;P	0.37101	0.582;0.582	P;P	0.52031	0.688;0.688	T	0.64715	-0.6342	10	0.87932	D	0	.	8.8589	0.35245	0.7106:0.0:0.2894:0.0	.	705;705	Q8WZ77;Q96PB1	.;CASD1_HUMAN	I	705	ENSP00000297273:K705I	ENSP00000297273:K705I	K	+	2	0	CASD1	94021810	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.103000	0.41806	0.420000	0.25954	0.477000	0.44152	AAA			0.343	CASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255216.1		NM_022900	
PPP1R3A	5506	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	113518008	113518008	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr7:113518008C>T	ENST00000284601.3	-	4	3207	c.3139G>A	c.(3139-3141)Gac>Aac	p.D1047N		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	1047					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						GCAGAGCTGTCAGATTCCTTT	0.378																																					p.D1047N													.	.			0			c.G3139A												185.0	185.0	185.0					7																	113518008		2203	4299	6502	SO:0001583	missense	5506	exon4			AGCTGTCAGATTC	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.3139G>A	7.37:g.113518008C>T	ENSP00000284601:p.Asp1047Asn		Somatic	109	0	0		WXS	Illumina HiSeq	.	103	0.06	6	NM_002711	0		0	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	37	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	C	1.265	-0.614767	0.03663	.	.	ENSG00000154415	ENST00000284601	T	0.15487	2.42	5.41	2.45	0.29901	.	1.142880	0.06353	N	0.710193	T	0.09905	0.0243	N	0.11427	0.14	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21348	-1.0248	10	0.42905	T	0.14	-0.1235	6.45	0.21898	0.0:0.6439:0.138:0.2181	.	1047	Q16821	PPR3A_HUMAN	N	1047	ENSP00000284601:D1047N	ENSP00000284601:D1047N	D	-	1	0	PPP1R3A	113305244	0.188000	0.23250	0.014000	0.15608	0.024000	0.10985	1.374000	0.34283	1.407000	0.46875	0.650000	0.86243	GAC			0.378	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000346724.1		NM_002711	
KCP	375616	broad.mit.edu	37	7	128528680	128528683	+	RNA	DEL	ACAT	ACAT	-	rs367800907|rs111627364|rs34671938	byFrequency	TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	ACAT	ACAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr7:128528680_128528683delACAT	ENST00000476647.2	-	0	2555							Q6ZWJ8	KCP_HUMAN	kielin/chordin-like protein							extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)	4						acacacacacacatacagacacac	0.48																																					.													.	KCP	16		0			.																																											375616	.			ACACACACATACA	AK122706		7q32.3	2009-11-06	2009-02-18	2009-02-18	ENSG00000135253	ENSG00000135253			17585	protein-coding gene	gene with protein product	"""kielin"""	609344	"""cysteine rich BMP regulator 2 (chordin-like)"""	CRIM2		15793581	Standard	NM_001135914		Approved	FLJ33365, NET67	uc011kor.2	Q6ZWJ8	OTTHUMG00000158363		7.37:g.128528680_128528683delACAT			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0	Q8NBE0	RNA	DEL	ENST00000476647.2	37																																																																																						0.480	KCP-006	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000403051.1		NM_199349	
CSMD1	64478	mdanderson.org	37	8	3326282	3326282	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr8:3326282G>T	ENST00000520002.1	-	13	2071	c.1516C>A	c.(1516-1518)Cag>Aag	p.Q506K	CSMD1_ENST00000602557.1_Missense_Mutation_p.Q506K|CSMD1_ENST00000400186.3_Missense_Mutation_p.Q506K|CSMD1_ENST00000542608.1_Missense_Mutation_p.Q505K|CSMD1_ENST00000539096.1_Missense_Mutation_p.Q505K|CSMD1_ENST00000602723.1_Missense_Mutation_p.Q506K|CSMD1_ENST00000537824.1_Missense_Mutation_p.Q505K			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	506	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TCATCCGACTGCAGATGTAGC	0.463																																					p.Q505K													.	.			0			c.C1513A												56.0	55.0	56.0					8																	3326282		1947	4154	6101	SO:0001583	missense	64478	exon12			CCGACTGCAGATG			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.1516C>A	8.37:g.3326282G>T	ENSP00000430733:p.Gln506Lys		Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_033225	0		0	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	G	18.59	3.656196	0.67586	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.27104	1.69;1.69;1.69;1.69;1.69	5.14	5.14	0.70334	.	.	.	.	.	T	0.20088	0.0483	N	0.17800	0.525	0.52099	D	0.999943	P	0.42039	0.769	B	0.39152	0.292	T	0.02698	-1.1122	9	0.36615	T	0.2	.	18.653	0.91437	0.0:0.0:1.0:0.0	.	506	E5RIG2	.	K	506;506;368;505;505;505	ENSP00000383047:Q506K;ENSP00000430733:Q506K;ENSP00000441462:Q505K;ENSP00000446243:Q505K;ENSP00000441675:Q505K	ENSP00000320445:Q368K	Q	-	1	0	CSMD1	3313690	1.000000	0.71417	0.984000	0.44739	0.941000	0.58515	9.362000	0.97126	2.548000	0.85928	0.551000	0.68910	CAG			0.463	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000374500.2		NM_033225	
MCPH1	79648	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	6302344	6302344	+	Silent	SNP	G	G	A	rs201084851	byFrequency	TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr8:6302344G>A	ENST00000344683.5	+	8	1177	c.1101G>A	c.(1099-1101)ccG>ccA	p.P367P	MCPH1_ENST00000522905.1_Silent_p.P319P|MCPH1_ENST00000519480.1_Silent_p.P367P	NM_024596.3	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin 1	367					cerebral cortex development (GO:0021987)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)		AGPAT5/MCPH1(2)	central_nervous_system(1)|large_intestine(4)|skin(1)	6		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		ATTCACCTCCGAAGGAAAAAT	0.502																																					p.P367P	Colon(95;1448 1467 8277 34473 35819)												MCPH1_ENST00000344683,colon,carcinoma,+1,1	MCPH1_ENST00000344683	1	1	0			c.G1101A							G	,,	1,3899		0,1,1949	41.0	40.0	40.0		1101,957,1101	-8.9	0.0	8		40	0,8324		0,0,4162	no	coding-synonymous,coding-synonymous,coding-synonymous	MCPH1	NM_001172574.1,NM_001172575.1,NM_024596.3	,,	0,1,6111	AA,AG,GG		0.0,0.0256,0.0082	,,	367/611,319/563,367/836	6302344	1,12223	1950	4162	6112	SO:0001819	synonymous_variant	79648	exon8			ACCTCCGAAGGAA	AK022909	CCDS43689.1, CCDS55190.1, CCDS55191.1	8p23.1	2012-11-26	2007-11-26		ENSG00000147316	ENSG00000147316			6954	protein-coding gene	gene with protein product	"""BRCT-repeat inhibitor of TERT expression 1"""	607117	"""microcephaly, primary autosomal recessive 1"""			9683597, 17925396	Standard	NM_024596		Approved	FLJ12847, BRIT1	uc003wqi.3	Q8NEM0	OTTHUMG00000163618	ENST00000344683.5:c.1101G>A	8.37:g.6302344G>A			Somatic	163	0	0		WXS	Illumina HiSeq	.	127	0.06	8	NM_001172574	10	0.00	0	B4DWW2|E9PGU5|E9PH63|Q66GU1|Q9H9C7	Silent	SNP	ENST00000344683.5	37	CCDS43689.1																																																																																					0.502	MCPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000374532.2		NM_024596	
EGR3	1960	hgsc.bcm.edu;broad.mit.edu	37	8	22548865	22548865	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr8:22548865delG	ENST00000317216.2	-	2	642	c.285delC	c.(283-285)tccfs	p.S95fs	EGR3_ENST00000519492.1_3'UTR|EGR3_ENST00000522910.1_Frame_Shift_Del_p.S57fs|EGR3_ENST00000524088.1_5'UTR|RP11-459E5.1_ENST00000523627.1_RNA	NM_001199881.1|NM_004430.2	NP_001186810.1|NP_004421.2	Q06889	EGR3_HUMAN	early growth response 3	95					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|circadian rhythm (GO:0007623)|endothelial cell chemotaxis (GO:0035767)|muscle organ development (GO:0007517)|negative regulation of apoptotic process (GO:0043066)|neuromuscular synaptic transmission (GO:0007274)|peripheral nervous system development (GO:0007422)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of gamma-delta T cell differentiation (GO:0045586)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		Prostate(55;0.0421)|Breast(100;0.102)		Colorectal(74;0.0145)|BRCA - Breast invasive adenocarcinoma(99;0.053)|COAD - Colon adenocarcinoma(73;0.0608)		GGCACCAGTTGGAAGGGGAGT	0.627																																					p.N96fs													.	EGR3	33		0			c.286delA												63.0	66.0	65.0					8																	22548865		2203	4300	6503	SO:0001589	frameshift_variant	1960	exon2			CCAGTTGGAAGGG	X63741	CCDS6033.1, CCDS56528.1	8p23-p21	2013-01-08			ENSG00000179388	ENSG00000179388		"""Zinc fingers, C2H2-type"""	3240	protein-coding gene	gene with protein product	"""zinc finger protein pilot"""	602419				1906159, 11909874	Standard	NM_004430		Approved	PILOT	uc003xcm.1	Q06889	OTTHUMG00000097825	ENST00000317216.2:c.285delC	8.37:g.22548865delG	ENSP00000318057:p.Ser95fs		Somatic	124	0	0		WXS	Illumina HiSeq	.	121	0.09	11	NM_004430	1	0.00	0	A8K8U9|B4DHJ5|E7EW38|Q2M3W2	Frame_Shift_Del	DEL	ENST00000317216.2	37	CCDS6033.1																																																																																					0.627	EGR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000215098.1		NM_004430	
GDF6	392255	mdanderson.org	37	8	97157137	97157137	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr8:97157137C>T	ENST00000287020.5	-	2	1121	c.1022G>A	c.(1021-1023)cGc>cAc	p.R341H		NM_001001557.2	NP_001001557.1	Q6KF10	GDF6_HUMAN	growth differentiation factor 6	341					activin receptor signaling pathway (GO:0032924)|apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|growth (GO:0040007)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal cell apoptotic process (GO:1990009)	extracellular space (GO:0005615)				breast(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	27	Breast(36;2.67e-05)					CTTGCCATGGCGACTGGCGAA	0.726																																					p.R341H													GDF6,NS,carcinoma,0,1	GDF6	0	1	0			c.G1022A												30.0	25.0	27.0					8																	97157137		2202	4299	6501	SO:0001583	missense	392255	exon2			CCATGGCGACTGG		CCDS34926.1	8q22.1	2014-01-29			ENSG00000156466	ENSG00000156466			4221	protein-coding gene	gene with protein product		601147	"""segmentation syndrome 1"""	SGM1		10022976, 18425797	Standard	NM_001001557		Approved	BMP13, KFS, KFS1	uc003yhp.3	Q6KF10	OTTHUMG00000164710	ENST00000287020.5:c.1022G>A	8.37:g.97157137C>T	ENSP00000287020:p.Arg341His		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_001001557	0		0	Q6PI58	Missense_Mutation	SNP	ENST00000287020.5	37	CCDS34926.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.152653	0.78001	.	.	ENSG00000156466	ENST00000287020	D	0.82081	-1.57	4.57	3.7	0.42460	Transforming growth factor-beta, C-terminal (1);	0.080541	0.49305	D	0.000154	D	0.85336	0.5673	L	0.36672	1.1	0.54753	D	0.999989	D	0.89917	1.0	D	0.72625	0.978	D	0.85158	0.0990	10	0.52906	T	0.07	.	11.6902	0.51510	0.0:0.9125:0.0:0.0875	.	341	Q6KF10	GDF6_HUMAN	H	341	ENSP00000287020:R341H	ENSP00000287020:R341H	R	-	2	0	GDF6	97226313	1.000000	0.71417	0.849000	0.33467	0.777000	0.43975	5.574000	0.67424	1.141000	0.42275	0.557000	0.71058	CGC			0.726	GDF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000379862.2		NM_001001557	
PHF20L1	51105	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	133826993	133826993	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr8:133826993C>T	ENST00000395386.2	+	10	1341	c.1042C>T	c.(1042-1044)Cgc>Tgc	p.R348C	PHF20L1_ENST00000220847.7_5'UTR|PHF20L1_ENST00000395390.2_Missense_Mutation_p.R323C	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1	348							zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			AGGGAAGGCTCGCAGCAAGAA	0.413																																					p.R348C													.	PHF20L1	129		0			c.C1042T												130.0	132.0	131.0					8																	133826993		2203	4300	6503	SO:0001583	missense	51105	exon10			AAGGCTCGCAGCA	AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.1042C>T	8.37:g.133826993C>T	ENSP00000378784:p.Arg348Cys		Somatic	261	0.0038314176	1		WXS	Illumina HiSeq	Phase_I	245	0.09	23	NM_016018	14	0.14	2	A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	Missense_Mutation	SNP	ENST00000395386.2	37	CCDS6367.2	.	.	.	.	.	.	.	.	.	.	C	19.32	3.805385	0.70682	.	.	ENSG00000129292	ENST00000395383;ENST00000361997;ENST00000395386;ENST00000315808;ENST00000395382;ENST00000395390	T;T;T;T;T	0.70164	-0.32;-0.46;0.52;-0.41;0.53	5.83	5.83	0.93111	.	0.216430	0.49916	D	0.000138	T	0.75213	0.3819	L	0.29908	0.895	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.976;0.982	T	0.76457	-0.2952	10	0.62326	D	0.03	-13.7152	19.1015	0.93276	0.0:1.0:0.0:0.0	.	323;348;348	F8W9L8;A8MW92;A8MW92-4	.;P20L1_HUMAN;.	C	352;323;348;348;218;323	ENSP00000378781:R352C;ENSP00000355301:R323C;ENSP00000378784:R348C;ENSP00000324519:R348C;ENSP00000378788:R323C	ENSP00000324519:R348C	R	+	1	0	PHF20L1	133896175	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.359000	0.66074	2.762000	0.94881	0.591000	0.81541	CGC			0.413	PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000308949.3		NM_016018	
MAFA	389692	mdanderson.org	37	8	144512464	144512464	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr8:144512464G>T	ENST00000333480.2	-	1	112	c.113C>A	c.(112-114)gCc>gAc	p.A38D	MAFA_ENST00000528185.1_5'Flank	NM_201589.3	NP_963883.2	Q8NHW3	MAFA_HUMAN	v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog A	38					insulin secretion (GO:0030073)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to glucose (GO:0009749)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|lung(1)|upper_aerodigestive_tract(2)	4	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.237)			GAAGCGCTCGGCCTCGGGAGG	0.697										HNSCC(29;0.082)																											p.A38D													.	.			0			c.C113A												22.0	19.0	20.0					8																	144512464		2147	4233	6380	SO:0001583	missense	389692	exon1			CGCTCGGCCTCGG	AY083269	CCDS34955.1	8q24.3	2013-07-09	2013-07-09			ENSG00000182759			23145	protein-coding gene	gene with protein product		610303					Standard	NM_201589		Approved	RIPE3b1, hMafA	uc003yyc.2	Q8NHW3		ENST00000333480.2:c.113C>A	8.37:g.144512464G>T	ENSP00000328364:p.Ala38Asp		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_201589	2	0.00	0		Missense_Mutation	SNP	ENST00000333480.2	37	CCDS34955.1	.	.	.	.	.	.	.	.	.	.	g	16.91	3.252666	0.59212	.	.	ENSG00000182759	ENST00000333480	D	0.98437	-4.93	3.27	3.27	0.37495	.	0.000000	0.53938	U	0.000060	D	0.97607	0.9216	L	0.27053	0.805	0.49483	D	0.999793	D	0.89917	1.0	D	0.80764	0.994	D	0.97637	1.0146	10	0.48119	T	0.1	.	14.5433	0.68011	0.0:0.0:1.0:0.0	.	38	Q8NHW3	MAFA_HUMAN	D	38	ENSP00000328364:A38D	ENSP00000328364:A38D	A	-	2	0	MAFA	144583607	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	6.470000	0.73558	1.375000	0.46248	0.409000	0.27619	GCC			0.697	MAFA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381511.2		NM_201589	
MT-ND2	4536	hgsc.bcm.edu;broad.mit.edu	37	M	2596	2596	+	5'Flank	SNP	G	G	A			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chrM:2596G>A	ENST00000361453.3	+	0	0				MT-TW_ENST00000387382.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						CGTGCAaaggtagcataatca	0.478																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	6053	.			AAGGTAGCATAAT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2596G>A	Exception_encountered		Somatic	66	0	0		WXS	Illumina HiSeq	.	97	0.12	12	.	0		0	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	ENST00000361453.3	37																																																																																						0.478	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024027	
MT-ATP6	4508	hgsc.bcm.edu;broad.mit.edu	37	M	9035	9035	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chrM:9035T>C	ENST00000361899.2	+	1	509	c.509T>C	c.(508-510)cTc>cCc	p.L170P	MT-ND4L_ENST00000361335.1_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-ND3_ENST00000361227.2_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TG_ENST00000387429.1_RNA			P00846	ATP6_HUMAN	mitochondrially encoded ATP synthase 6	170					ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(7)|kidney(8)|prostate(1)	18						AGGCCACCTACTCATGCACCT	0.443																																					p.L170P													.	.			0			c.T509C																																									SO:0001583	missense	0	exon1			ACCTACTCATGCA			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198899	ENSG00000198899		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	7414	protein-coding gene	gene with protein product		516060	"""ATP synthase 6"", ""spicular retinitis pigmentosa with dementia, seizures, ataxia, proximal muscle weakness and sensory deficit"""	MTATP6, RP		7219534	Standard			Approved	ATP6, ATPase-6, Su6m		P00846		ENST00000361899.2:c.509T>C	M.37:g.9035T>C	ENSP00000354632:p.Leu170Pro		Somatic	15	0	0		WXS	Illumina HiSeq	.	40	0.55	22	ENST00000361899	0		0	Q34772|Q5S8W5|Q5S9E7|Q5S9I6|Q5SA31|Q6RPB7|Q6VHC0|Q6VHE0|Q6WQF4|Q7YCC1|Q7YCF8|Q7YCG1|Q85KU8|Q85KX1|Q85L05|Q8HNQ4|Q8HNQ8|Q8WCX6|Q9B2U5|Q9B2Z2	Missense_Mutation	SNP	ENST00000361899.2	37																																																																																						0.443	MT-ATP6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024031	
SUPT20HL1	100130302	bcgsc.ca	37	X	24382372	24382372	+	IGR	SNP	A	A	G	rs2695489		TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chrX:24382372A>G								AC004552.1 (15349 upstream) : PDK3 (100965 downstream)																							tgctgctgctattgctgctgc	0.577																																					p.I499V													.	.			0			c.A1495G												10.0	8.0	8.0					X																	24382372		1496	3415	4911	SO:0001628	intergenic_variant	0	exon1			GCTGCTATTGCTG																													X.37:g.24382372A>G			Somatic	218	0.0366972477	8		WXS	Illumina HiSeq	Phase_1	224	0.11	24	NM_001136234	0		0		RNA	SNP		37																																																																																					0	0.577										
HUWE1	10075	broad.mit.edu	37	X	53622246	53622246	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chrX:53622246G>T	ENST00000342160.3	-	29	3738	c.3281C>A	c.(3280-3282)cCg>cAg	p.P1094Q	HUWE1_ENST00000262854.6_Missense_Mutation_p.P1094Q|HUWE1_ENST00000218328.8_Missense_Mutation_p.P1094Q			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	1094					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						GGCAGGTGTCGGTGCTGTAGT	0.542																																					p.P1094Q													.	HUWE1	724		0			c.C3281A												99.0	70.0	80.0					X																	53622246		2203	4300	6503	SO:0001583	missense	10075	exon30			GGTGTCGGTGCTG	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.3281C>A	X.37:g.53622246G>T	ENSP00000340648:p.Pro1094Gln		Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	101	0.04	4	NM_031407	1	0.00	0	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.510054	0.85282	.	.	ENSG00000086758	ENST00000342160;ENST00000262854;ENST00000218328	T;T;T	0.50548	1.03;1.03;0.74	5.67	4.8	0.61643	.	0.062472	0.64402	D	0.000005	T	0.67683	0.2919	M	0.72894	2.215	0.58432	D	0.999997	D	0.89917	1.0	D	0.85130	0.997	T	0.71833	-0.4473	10	0.87932	D	0	.	14.7374	0.69424	0.0:0.1421:0.8579:0.0	.	1094	Q7Z6Z7	HUWE1_HUMAN	Q	1094	ENSP00000340648:P1094Q;ENSP00000262854:P1094Q;ENSP00000218328:P1094Q	ENSP00000218328:P1094Q	P	-	2	0	HUWE1	53638971	1.000000	0.71417	0.994000	0.49952	0.983000	0.72400	8.894000	0.92506	1.257000	0.44085	0.594000	0.82650	CCG			0.542	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056766.1		XM_497119	
AMER1	139285	broad.mit.edu	37	X	63412939	63412939	+	Silent	SNP	T	T	C			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chrX:63412939T>C	ENST00000330258.3	-	2	500	c.228A>G	c.(226-228)ggA>ggG	p.G76G	AMER1_ENST00000403336.1_Silent_p.G76G|AMER1_ENST00000374869.3_Silent_p.G76G	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	76					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									CTTTGCTCCGTCCCCCTCCAA	0.537																																					p.G76G													.	.			67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)	c.A228G												129.0	102.0	111.0					X																	63412939		2203	4300	6503	SO:0001819	synonymous_variant	139285	exon2			GCTCCGTCCCCCT	AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.228A>G	X.37:g.63412939T>C			Somatic	129	0	0		WXS	Illumina HiSeq	Phase_I	110	0.03	3	NM_152424	0		0	A2IB86|Q8N885	Silent	SNP	ENST00000330258.3	37	CCDS14377.2																																																																																					0.537	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316584.1		NM_152424	
CHM	1121	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	85218961	85218961	+	Silent	SNP	G	G	A			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chrX:85218961G>A	ENST00000357749.2	-	5	440	c.411C>T	c.(409-411)gcC>gcT	p.A137A	CHM_ENST00000537751.1_5'UTR|CHM_ENST00000467744.2_Intron	NM_000390.2	NP_000381.1	P24386	RAE1_HUMAN	choroideremia (Rab escort protein 1)	137					blood vessel development (GO:0001568)|protein geranylgeranylation (GO:0018344)|protein targeting to membrane (GO:0006612)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytosol (GO:0005829)|Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|prostate(1)	20		all_lung(315;5.41e-06)				TAGGCAGGAAGGCAGAATCTG	0.458																																					p.A137A													.	.			0			c.C411T												86.0	75.0	78.0					X																	85218961		2203	4300	6503	SO:0001819	synonymous_variant	1121	exon5			CAGGAAGGCAGAA	X78121	CCDS14454.1, CCDS48139.1	Xq21.1-q21.3	2014-09-17			ENSG00000188419	ENSG00000188419			1940	protein-coding gene	gene with protein product		300390		TCD, DXS540		1373238	Standard	XM_006724615		Approved	REP-1	uc004eet.3	P24386	OTTHUMG00000021937	ENST00000357749.2:c.411C>T	X.37:g.85218961G>A			Somatic	101	0	0		WXS	Illumina HiSeq	.	125	0.26	33	NM_000390	1	0.00	0	A1L4D2|O43732	Silent	SNP	ENST00000357749.2	37	CCDS14454.1																																																																																					0.458	CHM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057396.3		NM_000390	
RNF113A	7737	mdanderson.org	37	X	119005138	119005138	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chrX:119005138T>C	ENST00000371442.2	-	1	653	c.439A>G	c.(439-441)Aag>Gag	p.K147E	NDUFA1_ENST00000371437.4_5'Flank	NM_006978.2	NP_008909.1	O15541	R113A_HUMAN	ring finger protein 113A	147							zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(6)	15						TCATCCTCCTTGCCCCTCAGC	0.512																																					p.K147E													.	.			0			c.A439G												373.0	347.0	356.0					X																	119005138		2203	4300	6503	SO:0001583	missense	7737	exon1			CCTCCTTGCCCCT	X98253	CCDS14589.1	Xq24	2013-10-22	2005-03-22	2005-03-22	ENSG00000125352	ENSG00000125352		"""RING-type (C3HC4) zinc fingers"""	12974	protein-coding gene	gene with protein product			"""zinc finger protein 183 (RING finger, C3HC4 type)"""	ZNF183		9224902	Standard	NM_006978		Approved	RNF113, Cwc24	uc004esb.3	O15541	OTTHUMG00000022283	ENST00000371442.2:c.439A>G	X.37:g.119005138T>C	ENSP00000360497:p.Lys147Glu		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_006978	49	0.00	0	B2RBR7	Missense_Mutation	SNP	ENST00000371442.2	37	CCDS14589.1	.	.	.	.	.	.	.	.	.	.	T	16.71	3.199008	0.58126	.	.	ENSG00000125352	ENST00000371442	T	0.32023	1.47	5.49	4.29	0.51040	.	0.000000	0.85682	D	0.000000	T	0.24851	0.0603	L	0.54323	1.7	0.58432	D	0.999998	P	0.38395	0.629	B	0.30029	0.11	T	0.02588	-1.1137	10	0.44086	T	0.13	-8.3392	9.8468	0.41032	0.0:0.0:0.1702:0.8298	.	147	O15541	R113A_HUMAN	E	147	ENSP00000360497:K147E	ENSP00000360497:K147E	K	-	1	0	RNF113A	118889166	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.854000	0.62918	0.698000	0.31739	0.486000	0.48141	AAG			0.512	RNF113A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058071.1		NM_006978	
FLNA	2316	broad.mit.edu	37	X	153595838	153595838	+	Silent	SNP	G	G	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chrX:153595838G>T	ENST00000369850.3	-	5	1031	c.795C>A	c.(793-795)ccC>ccA	p.P265P	FLNA_ENST00000360319.4_Silent_p.P265P|FLNA_ENST00000344736.4_Silent_p.P265P|FLNA_ENST00000422373.1_Silent_p.P265P	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	265	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCTTGGCCTTGGGGAACTGGG	0.627																																					p.P265P													.	FLNA	373		0			c.C795A												72.0	78.0	76.0					X																	153595838		2197	4300	6497	SO:0001819	synonymous_variant	0	exon5			GGCCTTGGGGAAC	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.795C>A	X.37:g.153595838G>T			Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	70	0.06	4	NM_001456	11	0.00	0	E9KL45|Q5HY53|Q5HY55|Q8NF52	Silent	SNP	ENST00000369850.3	37	CCDS48194.1																																																																																					0.627	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000058942.3			
NPRL3	8131	mdanderson.org	37	16	150464	150464	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFL-01A-21D-A42Y-10	TCGA-2G-AAFL-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	333fc09a-ce23-4f10-a8b7-86fa54bd8184	a4aa42af-abd7-409c-a27c-12fbfe1801fd	g.chr16:150464G>T	ENST00000399953.3	-	7	1075	c.673C>A	c.(673-675)Ctg>Atg	p.L225M	NPRL3_ENST00000399951.3_Missense_Mutation_p.L46M|NPRL3_ENST00000405960.3_5'UTR	NM_001077350.2|NM_001243247.1|NM_001243248.1|NM_001243249.1	NP_001070818.1|NP_001230176.1|NP_001230177.1|NP_001230178.1	Q12980	NPRL3_HUMAN	nitrogen permease regulator-like 3 (S. cerevisiae)	225					aorta morphogenesis (GO:0035909)|cardiac muscle tissue development (GO:0048738)|palate development (GO:0060021)|ventricular septum development (GO:0003281)		GTPase activator activity (GO:0005096)			endometrium(1)|large_intestine(3)|ovary(2)	6						CTCACCTCCAGCCAGCTGTTG	0.572																																					.													.	.			0			.												40.0	47.0	45.0					16																	150464		2076	4211	6287	SO:0001583	missense	8131	.			CCTCCAGCCAGCT		CCDS73794.1, CCDS73795.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000103148	ENSG00000103148			14124	protein-coding gene	gene with protein product	"""conserved gene telomeric to alpha globin cluster"""	600928	"""chromosome 16 open reading frame 35"""	C16orf35		8575760	Standard	NM_001243247		Approved	CGTHBA, RMD11, NPR3, MARE, HS-40	uc002cfr.3	Q12980	OTTHUMG00000047792	ENST00000399953.3:c.673C>A	16.37:g.150464G>T	ENSP00000382834:p.Leu225Met		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	.	37	0.00	0	D3DU40|Q1W6H0|Q4TT56|Q92469	Missense_Mutation	SNP	ENST00000399953.3	37		.	.	.	.	.	.	.	.	.	.	G	27.9	4.873037	0.91664	.	.	ENSG00000103148	ENST00000399953;ENST00000262313;ENST00000399951	.	.	.	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	T	0.79551	0.4465	.	.	.	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;1.0;0.999	D;D;D;D	0.91635	0.99;0.961;0.999;0.998	T	0.81455	-0.0925	8	0.56958	D	0.05	-36.3627	17.0865	0.86612	0.0:0.0:1.0:0.0	.	147;200;200;225	B7Z220;Q4TT55;B7Z6Q0;Q12980	.;.;.;NPRL3_HUMAN	M	225;200;46	.	ENSP00000262313:L200M	L	-	1	2	NPRL3	90464	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.519000	0.98025	2.587000	0.87381	0.655000	0.94253	CTG			0.572	NPRL3-202	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_001039476	
