#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
CLCNKB	1188	broad.mit.edu	37	1	16383402	16383402	+	Silent	SNP	C	C	T	rs6698427		TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr1:16383402C>T	ENST00000375679.4	+	20	2166	c.2055C>T	c.(2053-2055)gcC>gcT	p.A685A	CLCNKB_ENST00000375667.3_Silent_p.A515A|FAM131C_ENST00000494078.1_5'Flank	NM_000085.4	NP_000076.2	P51801	CLCKB_HUMAN	chloride channel, voltage-sensitive Kb	685					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|skin(6)|stomach(2)|urinary_tract(1)	21		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		ATCCGCCAGCCCCAAAGTGAG	0.587																																					p.A685A													.	CLCNKB	50		0			c.C2055T												66.0	64.0	65.0					1																	16383402		2203	4300	6503	SO:0001819	synonymous_variant	1188	exon20			GCCAGCCCCAAAG	AK098217	CCDS168.1, CCDS57974.1	1p36	2012-09-26	2012-02-23		ENSG00000184908	ENSG00000184908		"""Ion channels / Chloride channels : Voltage-sensitive"""	2027	protein-coding gene	gene with protein product		602023	"""chloride channel Kb"""				Standard	NM_000085		Approved	hClC-Kb		P51801	OTTHUMG00000009530	ENST00000375679.4:c.2055C>T	1.37:g.16383402C>T			Somatic	499	0.002004008	1		WXS	Illumina HiSeq	Phase_I	612	0.01	9	NM_000085	6	0.00	0	B3KUY3|Q5T5Q7|Q5T5Q8	Silent	SNP	ENST00000375679.4	37	CCDS168.1																																																																																					0.587	CLCNKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000026331.1		NM_000085	
SSBP3	23648	broad.mit.edu	37	1	54871665	54871665	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr1:54871665T>C	ENST00000371320.3	-	1	427	c.17A>G	c.(16-18)aAa>aGa	p.K6R	SSBP3_ENST00000371319.3_Missense_Mutation_p.K6R|SSBP3_ENST00000417664.2_5'Flank|SSBP3_ENST00000357475.4_Missense_Mutation_p.K6R	NM_145716.2	NP_663768.1	Q9BWW4	SSBP3_HUMAN	single stranded DNA binding protein 3	6					head morphogenesis (GO:0060323)|hematopoietic progenitor cell differentiation (GO:0002244)|midbrain-hindbrain boundary initiation (GO:0021547)|positive regulation of anterior head development (GO:2000744)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prechordal plate formation (GO:0021501)|protein complex assembly (GO:0006461)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|protein complex (GO:0043234)	single-stranded DNA binding (GO:0003697)			central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	11						CGCCGAGCCTTTGCCTTTGGC	0.736																																					p.K6R													.	SSBP3	65		0			c.A17G												4.0	5.0	5.0					1																	54871665		2079	4010	6089	SO:0001583	missense	23648	exon1			GAGCCTTTGCCTT		CCDS590.1, CCDS591.1, CCDS30726.1	1p32.3	2008-02-05	2001-11-28		ENSG00000157216	ENSG00000157216			15674	protein-coding gene	gene with protein product		607390	"""single-stranded DNA-binding protein 3"""			12079286	Standard	NM_145716		Approved	CSDP, SSDP, FLJ10355, SSDP1	uc001cxe.4	Q9BWW4	OTTHUMG00000008264	ENST00000371320.3:c.17A>G	1.37:g.54871665T>C	ENSP00000360371:p.Lys6Arg		Somatic	119	0.0084033613	1		WXS	Illumina HiSeq	Phase_I	142	0.05	7	NM_001009955	15	0.00	0	A8K0A9|Q5T860|Q5T861|Q9BTM0|Q9BWW3	Missense_Mutation	SNP	ENST00000371320.3	37	CCDS591.1	.	.	.	.	.	.	.	.	.	.	T	14.81	2.645914	0.47258	.	.	ENSG00000157216	ENST00000371320;ENST00000371319;ENST00000357475	.	.	.	2.64	2.64	0.31445	.	0.000000	0.46758	U	0.000271	T	0.45155	0.1328	L	0.38838	1.175	0.35702	D	0.815734	B;B;B	0.18968	0.02;0.004;0.032	B;B;B	0.24006	0.018;0.012;0.05	T	0.52540	-0.8562	9	0.62326	D	0.03	.	8.2855	0.31926	0.0:0.0:0.0:1.0	.	6;6;6	Q9BWW4-2;Q9BWW4-3;Q9BWW4	.;.;SSBP3_HUMAN	R	6	.	ENSP00000350067:K6R	K	-	2	0	SSBP3	54644253	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	3.586000	0.53950	0.978000	0.38470	0.240000	0.17902	AAA			0.736	SSBP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000022721.1		NM_018070	
DIRAS3	9077	hgsc.bcm.edu	37	1	68512245	68512245	+	3'UTR	SNP	T	T	G			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr1:68512245T>G	ENST00000370981.1	-	0	1372				GNG12-AS1_ENST00000413628.1_RNA|GNG12-AS1_ENST00000420587.1_RNA|DIRAS3_ENST00000395201.1_3'UTR			O95661	DIRA3_HUMAN	DIRAS family, GTP-binding RAS-like 3						regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of gene expression by genetic imprinting (GO:0006349)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|cervix(1)|endometrium(2)|large_intestine(1)|lung(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						GTCCACGTTTTCTACACGCTA	0.443																																					.													.	.			0			.												54.0	52.0	52.0					1																	68512245		2203	4300	6503	SO:0001624	3_prime_UTR_variant	9077	.			ACGTTTTCTACAC	U96750	CCDS641.1	1p31	2014-05-09		2005-01-27	ENSG00000162595	ENSG00000162595			687	protein-coding gene	gene with protein product		605193	"""ras homolog gene family, member I"""	ARHI		9874798	Standard	XM_006711027		Approved	NOEY2	uc001ded.3	O95661	OTTHUMG00000009544	ENST00000370981.1:c.*46A>C	1.37:g.68512245T>G			Somatic	61	0	0		WXS	Illumina HiSeq	.	65	0.28	18	.	13	0.62	8	B3KMP3	RNA	SNP	ENST00000370981.1	37	CCDS641.1																																																																																					0.443	DIRAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000026354.2		NM_004675	
SELL	6402	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	169680646	169680646	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr1:169680646G>C	ENST00000236147.4	-	1	193	c.33C>G	c.(31-33)agC>agG	p.S11R	SELL_ENST00000463108.1_5'UTR|C1orf112_ENST00000498289.1_Intron	NM_000655.4	NP_000646.2	P14151	LYAM1_HUMAN	selectin L	0					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|regulation of immune response (GO:0050776)|response to ATP (GO:0033198)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|protease binding (GO:0002020)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	15	all_hematologic(923;0.208)					CCATGGCTTTGCTTGGTCCTT	0.507																																					p.S11R													.	SELL	43		0			c.C33G												112.0	99.0	103.0					1																	169680646		1943	4154	6097	SO:0001583	missense	6402	exon1			GGCTTTGCTTGGT	M25280	CCDS53427.1	1q23-q25	2008-07-31	2008-07-31		ENSG00000188404	ENSG00000188404		"""CD molecules"""	10720	protein-coding gene	gene with protein product		153240	"""lymphocyte adhesion molecule 1"""	LYAM1, LNHR		2664786, 1375831	Standard	NR_029467		Approved	LSEL, LAM1, LAM-1, hLHRc, Leu-8, Lyam-1, PLNHR, CD62L	uc001ggk.3	P14151	OTTHUMG00000034809	ENST00000236147.4:c.33C>G	1.37:g.169680646G>C	ENSP00000236147:p.Ser11Arg		Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	78	0.06	5	NM_000655	6	0.00	0	B2R6Q8|P15023|Q9UJ43	Missense_Mutation	SNP	ENST00000236147.4	37	CCDS53427.1	.	.	.	.	.	.	.	.	.	.	G	11.41	1.631604	0.29068	.	.	ENSG00000188404	ENST00000236147	T	0.15139	2.45	3.76	2.82	0.32997	.	0.967441	0.08478	N	0.939918	T	0.03136	0.0092	N	0.14661	0.345	0.20821	N	0.999843	B	0.10296	0.003	B	0.06405	0.002	T	0.43475	-0.9389	10	0.21540	T	0.41	0.0309	9.2187	0.37364	0.0:0.2213:0.7787:0.0	.	11	Q8WW79	.	R	11	ENSP00000236147:S11R	ENSP00000236147:S11R	S	-	3	2	SELL	167947270	0.295000	0.24389	0.621000	0.29145	0.863000	0.49368	0.379000	0.20585	1.129000	0.42072	0.561000	0.74099	AGC			0.507	SELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000084233.1		NM_000655	
ACBD3	64746	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	226334321	226334321	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr1:226334321T>C	ENST00000366812.5	-	8	1631	c.1577A>G	c.(1576-1578)tAt>tGt	p.Y526C	RP11-275I14.4_ENST00000440540.1_RNA	NM_022735.3	NP_073572.2	Q9H3P7	GCP60_HUMAN	acyl-CoA binding domain containing 3	526	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.				steroid biosynthetic process (GO:0006694)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA binding (GO:0000062)			breast(2)|endometrium(3)|large_intestine(5)|lung(7)|skin(1)|urinary_tract(2)	20	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.121)		TTATCTAGTATAATAGACTCT	0.393																																					p.Y526C													.	.			0			c.A1577G												57.0	60.0	59.0					1																	226334321		2203	4300	6503	SO:0001583	missense	64746	exon8			CTAGTATAATAGA	AB043587	CCDS1551.1	1q41	2013-10-16	2010-04-30	2003-11-12	ENSG00000182827	ENSG00000182827		"""A-kinase anchor proteins"""	15453	protein-coding gene	gene with protein product	"""PBR- and PKA-associated protein 7"""	606809	"""golgi complex associated protein 1, 60kDa"", ""acyl-Coenzyme A binding domain containing 3"""	GOLPH1, GOCAP1		12692076, 20150326	Standard	NM_022735		Approved	GCP60, PAP7	uc001hpy.3	Q9H3P7	OTTHUMG00000037560	ENST00000366812.5:c.1577A>G	1.37:g.226334321T>C	ENSP00000355777:p.Tyr526Cys		Somatic	101	0	0		WXS	Illumina HiSeq	.	124	0.13	16	NM_022735	8	0.13	1	B2RB29|Q5VTJ0|Q6P9F1|Q8IZC5|Q8N4D6|Q9H6U3	Missense_Mutation	SNP	ENST00000366812.5	37	CCDS1551.1	.	.	.	.	.	.	.	.	.	.	T	19.53	3.844571	0.71488	.	.	ENSG00000182827	ENST00000366812	T	0.44083	0.93	5.74	5.74	0.90152	GOLD (2);	0.000000	0.85682	D	0.000000	T	0.70684	0.3252	M	0.88105	2.93	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.77250	-0.2657	10	0.87932	D	0	-12.4839	16.0314	0.80579	0.0:0.0:0.0:1.0	.	526	Q9H3P7	GCP60_HUMAN	C	526	ENSP00000355777:Y526C	ENSP00000355777:Y526C	Y	-	2	0	ACBD3	224400944	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.635000	0.83286	2.193000	0.70182	0.402000	0.26972	TAT			0.393	ACBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000091528.1		NM_022735	
EXOC8	149371	broad.mit.edu	37	1	231472713	231472713	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr1:231472713C>T	ENST00000360394.2	-	1	865	c.779G>A	c.(778-780)cGt>cAt	p.R260H	SPRTN_ENST00000391858.4_5'Flank|SPRTN_ENST00000295050.7_5'Flank|EXOC8_ENST00000366645.1_Missense_Mutation_p.R256H|SPRTN_ENST00000008440.9_5'Flank	NM_175876.3	NP_787072.2	Q8IYI6	EXOC8_HUMAN	exocyst complex component 8	260	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cellular protein localization (GO:0034613)|cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				cervix(2)|endometrium(1)|large_intestine(2)|liver(1)|lung(5)|prostate(1)|skin(1)|stomach(1)	14	Breast(184;0.0871)	all_cancers(173;0.151)|Prostate(94;0.183)				CTGGAAAATACGGCTCTCGGG	0.517																																					p.R260H													.	EXOC8	42		0			c.G779A												76.0	76.0	76.0					1																	231472713		2203	4300	6503	SO:0001583	missense	149371	exon1			AAAATACGGCTCT	AL117352	CCDS1593.1	1q42.2	2013-01-22			ENSG00000116903	ENSG00000116903			24659	protein-coding gene	gene with protein product		615283				12477932	Standard	NM_175876		Approved	SEC84, EXO84, Exo84p	uc001huq.3	Q8IYI6	OTTHUMG00000038025	ENST00000360394.2:c.779G>A	1.37:g.231472713C>T	ENSP00000353564:p.Arg260His		Somatic	135	0	0		WXS	Illumina HiSeq	Phase_I	162	0.03	5	NM_175876	0		0	B3KU33|Q5TE82	Missense_Mutation	SNP	ENST00000360394.2	37	CCDS1593.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.762881	0.89932	.	.	ENSG00000116903	ENST00000360394;ENST00000366645	T;T	0.75821	-0.97;-0.97	5.69	5.69	0.88448	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.81531	0.4842	M	0.67953	2.075	0.80722	D	1	D	0.63046	0.992	P	0.55871	0.786	T	0.76342	-0.2994	10	0.15066	T	0.55	-12.2828	19.815	0.96564	0.0:1.0:0.0:0.0	.	260	Q8IYI6	EXOC8_HUMAN	H	260;256	ENSP00000353564:R260H;ENSP00000355605:R256H	ENSP00000353564:R260H	R	-	2	0	EXOC8	229539336	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	7.818000	0.86416	2.681000	0.91329	0.561000	0.74099	CGT			0.517	EXOC8-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				NM_175876	
GDF10	2662	mdanderson.org	37	10	48429183	48429183	+	Missense_Mutation	SNP	G	G	A	rs375293779		TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr10:48429183G>A	ENST00000224605.2	-	2	968	c.703C>T	c.(703-705)Ccc>Tcc	p.P235S		NM_004962.3	NP_004953.1	P55107	BMP3B_HUMAN	growth differentiation factor 10	235					fat cell differentiation (GO:0045444)|growth (GO:0040007)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)	growth factor activity (GO:0008083)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(20)|skin(1)	31						CTGGGCCGGGGCACCCCCGGG	0.667																																					p.P235S													.	.			0			c.C703T												10.0	14.0	13.0					10																	48429183		2179	4288	6467	SO:0001583	missense	2662	exon2			GCCGGGGCACCCC	L42113	CCDS73117.1	10q11.22	2014-04-10			ENSG00000107623	ENSG00000266524		"""Endogenous ligands"""	4215	protein-coding gene	gene with protein product		601361				8679252	Standard	NM_004962		Approved	BMP-3b	uc001jfb.3	P55107	OTTHUMG00000188319	ENST00000224605.2:c.703C>T	10.37:g.48429183G>A	ENSP00000224605:p.Pro235Ser		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_004962	0		0	Q5VSQ8|Q9UCX6	Missense_Mutation	SNP	ENST00000224605.2	37	CCDS7220.1	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.549996	0.00926	.	.	ENSG00000107623	ENST00000374247;ENST00000224605	T	0.73897	-0.79	5.45	2.58	0.30949	.	0.823836	0.11694	N	0.538558	T	0.60366	0.2263	L	0.44542	1.39	0.09310	N	1	B;B	0.18310	0.002;0.027	B;B	0.18561	0.001;0.022	T	0.43294	-0.9400	10	0.09338	T	0.73	.	5.67	0.17717	0.227:0.1421:0.6309:0.0	.	45;235	Q8N6T2;P55107	.;BMP3B_HUMAN	S	45;235	ENSP00000224605:P235S	ENSP00000224605:P235S	P	-	1	0	GDF10	48049189	0.000000	0.05858	0.000000	0.03702	0.080000	0.17528	-0.025000	0.12413	0.278000	0.22164	0.561000	0.74099	CCC			0.667	GDF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047884.1		NM_004962	
MUC6	4588	bcgsc.ca	37	11	1017556	1017556	+	Silent	SNP	G	G	A	rs77815355		TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr11:1017556G>A	ENST00000421673.2	-	31	5295	c.5245C>T	c.(5245-5247)Cta>Tta	p.L1749L		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1749	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGTGAATGTAGGGATGTAGAG	0.552																																					p.L1749L													.	MUC6	408		0			c.C5245T												824.0	781.0	795.0					11																	1017556		2199	4289	6488	SO:0001819	synonymous_variant	4588	exon31			AATGTAGGGATGT	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5245C>T	11.37:g.1017556G>A			Somatic	128	0.015625	2		WXS	Illumina HiSeq	Phase_1	131	0.08	11	NM_005961	0		0	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1																																																																																					0.552	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382120.2		XM_290540	
PPME1	51400	mdanderson.org	37	11	73936285	73936285	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr11:73936285G>T	ENST00000328257.8	+	5	705	c.382G>T	c.(382-384)Gca>Tca	p.A128S	PPME1_ENST00000398427.4_Missense_Mutation_p.A128S			Q9Y570	PPME1_HUMAN	protein phosphatase methylesterase 1	128					negative regulation of catalytic activity (GO:0043086)|protein demethylation (GO:0006482)|regulation of catalytic activity (GO:0050790)		protein C-terminal methylesterase activity (GO:0051722)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|protein phosphatase inhibitor activity (GO:0004864)|protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(1)|large_intestine(2)|lung(2)	5	Breast(11;3.29e-05)					AGATCTGTCTGCAGAAACAAT	0.303																																					p.A128S													.	.			0			c.G382T												74.0	68.0	70.0					11																	73936285		1795	4055	5850	SO:0001583	missense	51400	exon5			CTGTCTGCAGAAA		CCDS44678.1, CCDS60891.1	11q13.4	2014-03-14			ENSG00000214517	ENSG00000214517	3.1.1.89		30178	protein-coding gene	gene with protein product		611117				10318862	Standard	NM_016147		Approved	PME-1	uc009yty.4	Q9Y570	OTTHUMG00000168115	ENST00000328257.8:c.382G>T	11.37:g.73936285G>T	ENSP00000329867:p.Ala128Ser		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_016147	7	0.00	0	B3KMU6|B5MEE7|J3QT22|Q8WYG8|Q9NVT5|Q9UI18	Missense_Mutation	SNP	ENST00000328257.8	37	CCDS44678.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.351882	0.82132	.	.	ENSG00000214517	ENST00000328257;ENST00000398427	T;T	0.67698	-0.28;-0.28	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.68311	0.2987	L	0.48362	1.52	0.80722	D	1	P	0.37548	0.599	B	0.44224	0.444	T	0.63444	-0.6636	10	0.31617	T	0.26	.	18.8972	0.92429	0.0:0.0:1.0:0.0	.	128	Q9Y570	PPME1_HUMAN	S	128	ENSP00000329867:A128S;ENSP00000381461:A128S	ENSP00000329867:A128S	A	+	1	0	PPME1	73613933	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.441000	0.97557	2.818000	0.97014	0.591000	0.81541	GCA			0.303	PPME1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398254.1		NM_016147	
NCAM1	4684	mdanderson.org	37	11	113105859	113105859	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr11:113105859G>T	ENST00000533760.1	+	13	2013	c.1414G>T	c.(1414-1416)Gcc>Tcc	p.A472S	NCAM1_ENST00000316851.7_Missense_Mutation_p.A590S|NCAM1_ENST00000401611.2_Missense_Mutation_p.A599S|NCAM1_ENST00000397957.4_3'UTR	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	600	Ig-like C2-type 5.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		GATCAGCGCGGCCTCCGAGTT	0.627																																					p.A626S													.	.			0			c.G1876T												29.0	33.0	32.0					11																	113105859		2024	4151	6175	SO:0001583	missense	4684	exon16			AGCGCGGCCTCCG		CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.1414G>T	11.37:g.113105859G>T	ENSP00000473281:p.Ala472Ser		Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_001242607	1	0.00	0	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Missense_Mutation	SNP	ENST00000533760.1	37		.	.	.	.	.	.	.	.	.	.	G	14.69	2.612073	0.46631	.	.	ENSG00000149294	ENST00000531044;ENST00000401611;ENST00000316851;ENST00000433634	T;T	0.53206	1.07;0.63	5.84	4.92	0.64577	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.324116	0.28821	U	0.014029	T	0.35480	0.0933	.	.	.	0.38487	D	0.947875	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.12156	0.007;0.002;0.001;0.006	T	0.20538	-1.0272	9	0.27785	T	0.31	-35.0045	10.4992	0.44796	0.0:0.2631:0.6181:0.1188	.	600;590;600;590	P13591-5;P13591-1;P13591;P13591-3	.;.;NCAM1_HUMAN;.	S	472;599;590;34	ENSP00000384055:A599S;ENSP00000318472:A590S	ENSP00000318472:A590S	A	+	1	0	NCAM1	112611069	0.567000	0.26626	0.880000	0.34516	0.892000	0.51952	1.078000	0.30754	1.453000	0.47775	0.591000	0.81541	GCC			0.627	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000394068.2		NM_000615	
NCAM1	4684	mdanderson.org	37	11	113105886	113105886	+	Splice_Site	SNP	C	C	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr11:113105886C>T	ENST00000533760.1	+	13	2040	c.1441C>T	c.(1441-1443)Caa>Taa	p.Q481*	NCAM1_ENST00000316851.7_Splice_Site_p.P599S|NCAM1_ENST00000401611.2_Splice_Site_p.Q608*|NCAM1_ENST00000397957.4_3'UTR	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	609	Ig-like C2-type 5.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		GCAGCCAGTCCGTAAGTAAAG	0.617																																					p.P635S													.	.			0			c.C1903T												28.0	33.0	31.0					11																	113105886		1997	4143	6140	SO:0001630	splice_region_variant	4684	exon16			CCAGTCCGTAAGT		CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.1441+1C>T	11.37:g.113105886C>T			Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_001242607	1	0.00	0	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Missense_Mutation	SNP	ENST00000533760.1	37		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	39|39|39	7.572409|7.572409|7.572409	0.98365|0.98365|0.98365	.|.|.	.|.|.	ENSG00000149294|ENSG00000149294|ENSG00000149294	ENST00000433634|ENST00000316851|ENST00000531044;ENST00000401611	.|T|.	.|0.61742|.	.|0.08|.	5.84|5.84|5.84	5.84|5.84|5.84	0.93424|0.93424|0.93424	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|.	0.50939|0.50939|.	0.1645|0.1645|.	.|.|.	.|.|.	.|.|.	0.23708|0.23708|0.23708	N|N|N	0.997059|0.997059|0.997059	B|.|.	0.26744|.|.	0.158|.|.	B|.|.	0.33121|.|.	0.158|.|.	T|T|.	0.46205|0.46205|.	-0.9208|-0.9208|.	7|6|.	0.45353|0.24483|0.36615	T|T|T	0.12|0.36|0.2	-18.7841|-18.7841|-18.7841	14.9168|14.9168|14.9168	0.70805|0.70805|0.70805	0.1431:0.8568:0.0:0.0|0.1431:0.8568:0.0:0.0|0.1431:0.8568:0.0:0.0	.|.|.	599|.|.	P13591-3|.|.	.|.|.	Y|S|X	43|599|481;608	.|ENSP00000318472:P599S|.	ENSP00000390982:H43Y|ENSP00000318472:P599S|ENSP00000384055:Q608X	H|P|Q	+|+|+	1|1|1	0|0|0	NCAM1|NCAM1|NCAM1	112611096|112611096|112611096	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.970000|0.970000|0.970000	0.65996|0.65996|0.65996	4.597000|4.597000|4.597000	0.61062|0.61062|0.61062	2.767000|2.767000|2.767000	0.95098|0.95098|0.95098	0.591000|0.591000|0.591000	0.81541|0.81541|0.81541	CAT|CCA|CAA;CAG			0.617	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000394068.2		NM_000615	Nonsense_Mutation
GRIK4	2900	broad.mit.edu	37	11	120856677	120856677	+	Missense_Mutation	SNP	A	A	C	rs372805470		TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr11:120856677A>C	ENST00000527524.2	+	21	2866	c.2579A>C	c.(2578-2580)cAc>cCc	p.H860P	GRIK4_ENST00000438375.2_Missense_Mutation_p.H860P	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	860					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		GACAGTATCCAcccccgccgg	0.716																																					p.H860P													.	GRIK4	149		0			c.A2579C												3.0	2.0	2.0					11																	120856677		1524	3047	4571	SO:0001583	missense	2900	exon19			GTATCCACCCCCG	S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.2579A>C	11.37:g.120856677A>C	ENSP00000435648:p.His860Pro		Somatic	51	0.2156862745	11		WXS	Illumina HiSeq	Phase_I	61	0.25	15	NM_014619	2	0.50	1	A8K9L1	Missense_Mutation	SNP	ENST00000527524.2	37	CCDS8433.1	.	.	.	.	.	.	.	.	.	.	A	14.28	2.486896	0.44249	.	.	ENSG00000149403	ENST00000527524;ENST00000438375	T;T	0.11712	2.75;2.75	4.46	4.46	0.54185	.	0.116516	0.64402	D	0.000011	T	0.07007	0.0178	N	0.22421	0.69	0.40744	D	0.982851	B	0.27068	0.167	B	0.19148	0.024	T	0.30937	-0.9961	10	0.36615	T	0.2	.	8.9352	0.35695	0.8339:0.0:0.0:0.1661	.	860	Q16099	GRIK4_HUMAN	P	860	ENSP00000435648:H860P;ENSP00000404063:H860P	ENSP00000404063:H860P	H	+	2	0	GRIK4	120361887	0.783000	0.28701	0.748000	0.31131	0.950000	0.60333	1.572000	0.36461	1.635000	0.50512	0.379000	0.24179	CAC			0.716	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000109760.4		NM_014619	
PDE3A	5139	broad.mit.edu	37	12	20522114	20522115	+	5'Flank	INS	-	-	GCGT	rs138187101|rs71039938	byFrequency	TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr12:20522114_20522115insGCGT	ENST00000359062.3	+	0	0				RP11-284H19.1_ENST00000535755.1_RNA	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited						blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	AATTGGGAAGAgcgtgcgtgcg	0.594														639	0.127596	0.0212	0.1628	5008	,	,		12687	0.0337		0.2704	False		,,,				2504	0.1963				.													.	PDE3A	184		0			.																																									SO:0001631	upstream_gene_variant	0	.			GGGAAGAGCGTGC		CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962		12.37:g.20522119_20522122dupGCGT	Exception_encountered		Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	33	0.21	7	.	0		0	O60865|Q13348|Q17RD1	RNA	INS	ENST00000359062.3	37	CCDS31754.1																																																																																					0.594	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401756.2			
BAZ2A	11176	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	56995665	56995665	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr12:56995665delG	ENST00000551812.1	-	20	3935	c.3742delC	c.(3742-3744)ctgfs	p.L1248fs	BAZ2A_ENST00000179765.5_Frame_Shift_Del_p.L1216fs|BAZ2A_ENST00000549884.1_Frame_Shift_Del_p.L1246fs|BAZ2A_ENST00000379441.3_Frame_Shift_Del_p.L1218fs|BAZ2A_ENST00000553222.1_5'Flank	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	1248	Glu-rich.				chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						TCTTGCTCCAGGAACCCCTTA	0.597																																					p.L1248fs													.	BAZ2A	263		0			c.3743delT												29.0	30.0	30.0					12																	56995665		1945	4149	6094	SO:0001589	frameshift_variant	11176	exon20			GCTCCAGGAACCC	AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.3742delC	12.37:g.56995665delG	ENSP00000446880:p.Leu1248fs		Somatic	81	0	0		WXS	Illumina HiSeq	.	71	0.18	13	NM_013449	6	0.00	0	B3KN66|O00536|O15030|Q68DI8|Q96H26	Frame_Shift_Del	DEL	ENST00000551812.1	37	CCDS44924.1																																																																																					0.597	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000408561.1		NM_013449	
CLIP1	6249	hgsc.bcm.edu	37	12	122862115	122862115	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr12:122862115A>G	ENST00000540338.1	-	2	519	c.478T>C	c.(478-480)Tcc>Ccc	p.S160P	CLIP1_ENST00000358808.2_Missense_Mutation_p.S160P|CLIP1_ENST00000361654.4_Missense_Mutation_p.S160P|CLIP1_ENST00000302528.7_Missense_Mutation_p.S160P|CLIP1_ENST00000537178.1_Missense_Mutation_p.S160P			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	160	Ser-rich.				microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		GTGGAGGGGGAGGAAGACACC	0.557																																					p.S160P													.	.			0			c.T478C												174.0	155.0	161.0					12																	122862115		2203	4300	6503	SO:0001583	missense	6249	exon3			AGGGGGAGGAAGA		CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.478T>C	12.37:g.122862115A>G	ENSP00000439093:p.Ser160Pro		Somatic	125	0	0		WXS	Illumina HiSeq	.	115	0.04	5	NM_002956	4	0.00	0	A0AVD3|Q17RS4|Q29RG0	Missense_Mutation	SNP	ENST00000540338.1	37	CCDS58285.1	.	.	.	.	.	.	.	.	.	.	A	3.099	-0.185224	0.06340	.	.	ENSG00000130779	ENST00000302528;ENST00000358808;ENST00000542885;ENST00000537178;ENST00000540338;ENST00000540304;ENST00000537004	T;T;T;T;T;T	0.74106	-0.81;-0.81;-0.81;-0.81;-0.81;-0.81	5.54	3.1	0.35709	Cytoskeleton-associated protein, Gly-rich domain (1);	0.551153	0.21194	N	0.078587	T	0.65144	0.2663	M	0.65975	2.015	0.09310	N	1	B;B;B;B	0.13594	0.008;0.0;0.0;0.0	B;B;B;B	0.13407	0.009;0.001;0.0;0.0	T	0.53683	-0.8404	10	0.29301	T	0.29	-0.3032	2.3745	0.04338	0.5269:0.1379:0.0706:0.2646	.	160;160;160;160	F6VGP8;P30622-2;P30622-1;P30622	.;.;.;CLIP1_HUMAN	P	160;160;5;160;160;160;160	ENSP00000303585:S160P;ENSP00000351665:S160P;ENSP00000445531:S160P;ENSP00000439093:S160P;ENSP00000437786:S160P;ENSP00000441409:S160P	ENSP00000303585:S160P	S	-	1	0	CLIP1	121428068	0.007000	0.16637	0.004000	0.12327	0.223000	0.24884	0.167000	0.16602	0.355000	0.24131	0.482000	0.46254	TCC			0.557	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000401625.1		NM_002956	
DDX51	317781	broad.mit.edu	37	12	132625414	132625414	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr12:132625414C>T	ENST00000397333.3	-	9	1440	c.1402G>A	c.(1402-1404)Ggg>Agg	p.G468R		NM_175066.3	NP_778236.2	Q8N8A6	DDX51_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 51	468					rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			endometrium(1)|lung(5)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.59e-08)|Epithelial(86;3.62e-07)|all cancers(50;2.13e-05)		CCCGAATCCCCGTCCCCATCT	0.617																																					p.G468R													.	DDX51	33		0			c.G1402A												105.0	113.0	110.0					12																	132625414		1936	4124	6060	SO:0001583	missense	317781	exon9			AATCCCCGTCCCC	BC040185	CCDS41865.1	12q24.33	2005-10-12				ENSG00000185163		"""DEAD-boxes"""	20082	protein-coding gene	gene with protein product							Standard	NM_175066		Approved		uc001ujy.4	Q8N8A6		ENST00000397333.3:c.1402G>A	12.37:g.132625414C>T	ENSP00000380495:p.Gly468Arg		Somatic	115	0	0		WXS	Illumina HiSeq	Phase_I	113	0.04	4	NM_175066	73	0.08	6	A8MPT9|Q5CZ71|Q8IXK5|Q96ED1	Missense_Mutation	SNP	ENST00000397333.3	37	CCDS41865.1	.	.	.	.	.	.	.	.	.	.	C	4.681	0.126550	0.08931	.	.	ENSG00000185163	ENST00000397333	T	0.01902	4.57	4.72	-3.95	0.04118	.	1.714690	0.03274	N	0.185190	T	0.02047	0.0064	L	0.43152	1.355	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.47114	-0.9142	10	0.17369	T	0.5	-12.9339	1.3012	0.02079	0.3239:0.336:0.099:0.2411	.	468	Q8N8A6	DDX51_HUMAN	R	468	ENSP00000380495:G468R	ENSP00000380495:G468R	G	-	1	0	DDX51	131191367	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.187000	0.03067	-0.531000	0.06340	-1.402000	0.01139	GGG			0.617	DDX51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398978.1	rescued with RNA-seq	NM_175066	
LINC00621	100996930	hgsc.bcm.edu	37	13	23471388	23471388	+	lincRNA	SNP	A	A	G			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr13:23471388A>G	ENST00000577004.1	-	0	652									long intergenic non-protein coding RNA 621																		agagagagagaggagagagag	0.438																																					.													.	.			0			.																																											646201	.			AGAGAGAGGAGAG	AK091626		13q12.12	2012-10-12			ENSG00000262619	ENSG00000262619		"""Long non-coding RNAs"""	44227	non-coding RNA	RNA, long non-coding							Standard			Approved				OTTHUMG00000177835		13.37:g.23471388A>G			Somatic	45	0	0		WXS	Illumina HiSeq	.	37	0.14	5	.	0		0		RNA	SNP	ENST00000577004.1	37																																																																																						0.438	LINC00621-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000439167.1			
GRK1	6011	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	114321726	114321726	+	Missense_Mutation	SNP	G	G	A	rs184639495		TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr13:114321726G>A	ENST00000335678.6	+	1	257	c.25G>A	c.(25-27)Gtg>Atg	p.V9M		NM_002929.2	NP_002920.1	Q15835	RK_HUMAN	G protein-coupled receptor kinase 1	9	N-terminal.				negative regulation of apoptotic process (GO:0043066)|photoreceptor cell morphogenesis (GO:0008594)|phototransduction, visible light (GO:0007603)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|protein autophosphorylation (GO:0046777)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)|rhodopsin kinase activity (GO:0050254)			ovary(2)	2	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	all cancers(43;0.234)			TTTGGAGACCGTGGTGGCCAA	0.642																																					p.V9M													.	.			0			c.G25A							G	MET/VAL	0,4192		0,0,2096	42.0	50.0	47.0		25	5.2	0.9	13		47	1,8457		0,1,4228	no	missense	GRK1	NM_002929.2	21	0,1,6324	AA,AG,GG		0.0118,0.0,0.0079	probably-damaging	9/564	114321726	1,12649	2096	4229	6325	SO:0001583	missense	6011	exon1			GAGACCGTGGTGG			13q34	2013-09-02	2004-03-23	2004-03-24	ENSG00000185974	ENSG00000185974	2.7.11.14		10013	protein-coding gene	gene with protein product		180381	"""rhodopsin kinase"""	RHOK		8812493, 15057823	Standard	NM_002929		Approved	GPRK1, RK	uc010tkf.2	Q15835	OTTHUMG00000185528	ENST00000335678.6:c.25G>A	13.37:g.114321726G>A	ENSP00000334876:p.Val9Met		Somatic	78	0	0		WXS	Illumina HiSeq	.	38	0.24	9	NM_002929	0		0	Q53X14	Missense_Mutation	SNP	ENST00000335678.6	37		1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	18.07	3.542666	0.65198	0.0	1.18E-4	ENSG00000185974	ENST00000335678	T	0.69685	-0.42	5.21	5.21	0.72293	.	0.059335	0.64402	D	0.000003	T	0.77678	0.4166	.	.	.	0.47584	D	0.999463	D	0.69078	0.997	P	0.57846	0.828	T	0.79271	-0.1872	9	0.51188	T	0.08	-45.0509	16.2679	0.82600	0.0:0.0:1.0:0.0	.	9	Q15835	RK_HUMAN	M	9	ENSP00000334876:V9M	ENSP00000334876:V9M	V	+	1	0	GRK1	113369727	1.000000	0.71417	0.945000	0.38365	0.843000	0.47879	6.800000	0.75165	2.415000	0.81967	0.561000	0.74099	GTG	0		0.642	GRK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000470655.1		NM_002929	
ANG	283	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	21162164	21162164	+	Silent	SNP	G	G	A			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr14:21162164G>A	ENST00000336811.6	+	2	1041	c.441G>A	c.(439-441)ccG>ccA	p.P147P	RNASE4_ENST00000555597.1_Intron|AL163636.6_ENST00000553909.1_Intron|ANG_ENST00000554073.1_Intron|RP11-903H12.3_ENST00000554286.1_RNA|RNASE4_ENST00000304704.4_Intron|ANG_ENST00000397990.4_Silent_p.P147P|RNASE4_ENST00000397995.2_Intron|RNASE4_ENST00000555835.1_Intron	NM_001145.4	NP_001136.1	P03950	ANGI_HUMAN	angiogenin, ribonuclease, RNase A family, 5	147					actin filament polymerization (GO:0030041)|activation of phospholipase A2 activity (GO:0032431)|activation of phospholipase C activity (GO:0007202)|activation of protein kinase B activity (GO:0032148)|angiogenesis (GO:0001525)|cell communication (GO:0007154)|cell death (GO:0008219)|cell migration (GO:0016477)|diacylglycerol biosynthetic process (GO:0006651)|homeostatic process (GO:0042592)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of translation (GO:0017148)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|oocyte maturation (GO:0001556)|ovarian follicle development (GO:0001541)|placenta development (GO:0001890)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein secretion (GO:0050714)|response to hormone (GO:0009725)|response to hypoxia (GO:0001666)|RNA phosphodiester bond hydrolysis (GO:0090501)|rRNA transcription (GO:0009303)	angiogenin-PRI complex (GO:0032311)|basal lamina (GO:0005605)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)	actin binding (GO:0003779)|copper ion binding (GO:0005507)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|heparin binding (GO:0008201)|peptide binding (GO:0042277)|receptor binding (GO:0005102)|ribonuclease activity (GO:0004540)|rRNA binding (GO:0019843)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|ovary(1)|prostate(1)	5	all_cancers(95;0.00387)	all_cancers(140;0.196)|all_epithelial(140;0.156)	Epithelial(56;5.13e-07)|all cancers(55;4.73e-06)	OV - Ovarian serous cystadenocarcinoma(311;3.25e-17)|GBM - Glioblastoma multiforme(265;5.56e-07)		TCCGTCGTCCGTAACCAGCGG	0.552																																					p.P147P													.	.			0			c.G441A												84.0	81.0	82.0					14																	21162164		2203	4300	6503	SO:0001819	synonymous_variant	283	exon2			TCGTCCGTAACCA		CCDS9554.1	14q11.1-q11.2	2014-09-17			ENSG00000214274	ENSG00000214274	3.1.27.-	"""Ribonucleases, RNase A"""	483	protein-coding gene	gene with protein product		105850				1978563	Standard	NM_001145		Approved	RNASE5	uc001vxw.4	P03950	OTTHUMG00000029576	ENST00000336811.6:c.441G>A	14.37:g.21162164G>A			Somatic	174	0	0		WXS	Illumina HiSeq	.	172	0.06	11	NM_001097577	24	0.00	0	Q05CV1|Q53X86|Q6P5T2|Q8WXE7	Silent	SNP	ENST00000336811.6	37	CCDS9554.1																																																																																					0.552	ANG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000073731.3		NM_001097577	
AHNAK2	113146	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	105412772	105412772	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr14:105412772G>A	ENST00000333244.5	-	7	9135	c.9016C>T	c.(9016-9018)Ccg>Tcg	p.P3006S	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3006						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCCACCTTCGGCGCAGACACA	0.597																																					p.P3006S													AHNAK2_ENST00000333244,NS,carcinoma,+2,1	AHNAK2_ENST00000333244	2	1	0			c.C9016T												224.0	235.0	231.0					14																	105412772		2008	4153	6161	SO:0001583	missense	113146	exon7			CCTTCGGCGCAGA	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.9016C>T	14.37:g.105412772G>A	ENSP00000353114:p.Pro3006Ser		Somatic	220	0	0		WXS	Illumina HiSeq	.	209	0.23	49	NM_138420	0		0	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	g	17.71	3.457051	0.63401	.	.	ENSG00000185567	ENST00000333244	T	0.03035	4.07	4.06	1.97	0.26223	.	.	.	.	.	T	0.15046	0.0363	M	0.87180	2.865	0.25321	N	0.989116	D	0.67145	0.996	P	0.62491	0.903	T	0.07462	-1.0771	9	0.30854	T	0.27	.	8.4358	0.32786	0.0:0.3127:0.5268:0.1606	.	3006	Q8IVF2	AHNK2_HUMAN	S	3006	ENSP00000353114:P3006S	ENSP00000353114:P3006S	P	-	1	0	AHNAK2	104483817	.	.	0.001000	0.08648	0.001000	0.01503	.	.	0.653000	0.30826	0.485000	0.47835	CCG			0.597	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000410300.1		NM_138420	
GOLGA6B	55889	hgsc.bcm.edu	37	15	72954932	72954932	+	Missense_Mutation	SNP	G	G	A	rs371637348		TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr15:72954932G>A	ENST00000421285.3	+	11	1187	c.1187G>A	c.(1186-1188)cGa>cAa	p.R396Q	RN7SL853P_ENST00000477951.2_RNA	NM_018652.4	NP_061122.4	A6NDN3	GOG6B_HUMAN	golgin A6 family, member B	396						Golgi apparatus (GO:0005794)				NS(1)|breast(1)|endometrium(1)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	16						GAGAGGCTGCGAAAGGAGGAG	0.582																																					p.R396Q													GOLGA6B,NS,carcinoma,+1,1	GOLGA6B	1	1	0			c.G1187A												1.0	1.0	1.0					15																	72954932		337	771	1108	SO:0001583	missense	55889	exon11			GGCTGCGAAAGGA		CCDS10245.2	15q24.1	2011-10-25	2010-02-12		ENSG00000215186	ENSG00000215186			32205	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6B"""				Standard	XM_006720604		Approved		uc010uks.1	A6NDN3	OTTHUMG00000133511	ENST00000421285.3:c.1187G>A	15.37:g.72954932G>A	ENSP00000408132:p.Arg396Gln		Somatic	277	0.0036101083	1		WXS	Illumina HiSeq	.	292	0.04	12	NM_018652	0		0	A8MYY7	Missense_Mutation	SNP	ENST00000421285.3	37	CCDS10245.2	.	.	.	.	.	.	.	.	.	.	.	6.034	0.374695	0.11409	.	.	ENSG00000215186	ENST00000421285	T	0.05925	3.37	0.459	0.459	0.16678	.	.	.	.	.	T	0.05731	0.0150	N	0.16602	0.42	0.20703	N	0.999869	D	0.61697	0.99	P	0.55455	0.776	T	0.33599	-0.9862	9	0.13108	T	0.6	.	2.9675	0.05912	0.3843:0.0:0.6157:0.0	.	396	A6NDN3	GOG6B_HUMAN	Q	396	ENSP00000408132:R396Q	ENSP00000408132:R396Q	R	+	2	0	GOLGA6B	70741986	0.102000	0.21896	0.004000	0.12327	0.296000	0.27459	-0.474000	0.06607	0.515000	0.28320	0.089000	0.15464	CGA			0.582	GOLGA6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257474.4		NM_018652	
WASH3P	374666	broad.mit.edu	37	15	102515335	102515335	+	RNA	SNP	C	C	G	rs201001946		TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr15:102515335C>G	ENST00000557932.1	+	0	1181				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)	p.L386V(3)		central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						GGAGCGAAAGCTGGAGAAGAA	0.652																																					.													WASH3P,NS,carcinoma,0,4	WASH3P	56	4	3	Substitution - Missense(3)	prostate(2)|kidney(1)	.																																											0	.			CGAAAGCTGGAGA			15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102515335C>G			Somatic	41	0.0487804878	2		WXS	Illumina HiSeq	Phase_I	51	0.08	4	.	478	0.14	67		RNA	SNP	ENST00000557932.1	37		.	.	.	.	.	.	.	.	.	.	c	1.538	-0.542507	0.04053	.	.	ENSG00000185596	ENST00000338304;ENST00000398121	.	.	.	1.01	1.01	0.19927	.	0.125321	0.53938	D	0.000056	T	0.41926	0.1180	.	.	.	.	.	.	.	.	.	.	.	.	T	0.51044	-0.8755	4	.	.	.	-11.5249	7.9382	0.29941	0.0:1.0:0.0:0.0	.	.	.	.	V	395;386	.	.	L	+	1	2	WASH3P	100332858	1.000000	0.71417	0.999000	0.59377	0.392000	0.30506	1.146000	0.31589	0.863000	0.35553	0.184000	0.17185	CTG			0.652	WASH3P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000417608.1		NM_199163	
TSC2	7249	mdanderson.org	37	16	2097800	2097800	+	5'UTR	SNP	G	G	A			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr16:2097800G>A	ENST00000219476.3	+	0	335				TSC2_ENST00000568454.1_5'Flank|TSC2_ENST00000382538.6_5'Flank|TSC2_ENST00000439673.2_5'Flank|TSC2_ENST00000353929.4_5'Flank|TSC2_ENST00000350773.4_5'Flank|NTHL1_ENST00000219066.1_Silent_p.L17L|TSC2_ENST00000401874.2_5'Flank	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2						acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				CTCCGGGTCAGCATCCTCGCG	0.721			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.L17L			yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	.			0			c.C49T												8.0	10.0	9.0					16																	2097800		2168	4257	6425	SO:0001623	5_prime_UTR_variant	4913	exon1	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	GGGTCAGCATCCT	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.-296G>A	16.37:g.2097800G>A			Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	19	0.11	2	NM_002528	117	0.00	0	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Silent	SNP	ENST00000219476.3	37	CCDS10458.1																																																																																					0.721	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250657.2		NM_000548	
ZNF205	7755	mdanderson.org	37	16	3170289	3170289	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr16:3170289C>G	ENST00000382192.3	+	7	1833	c.1628C>G	c.(1627-1629)gCg>gGg	p.A543G	RP11-473M20.14_ENST00000576490.1_RNA|RP11-473M20.14_ENST00000575139.1_RNA|ZNF205_ENST00000219091.4_Missense_Mutation_p.A543G	NM_001278158.1|NM_003456.2	NP_001265087.1|NP_003447.2	O95201	ZN205_HUMAN	zinc finger protein 205	543					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hydrogen peroxide biosynthetic process (GO:0010729)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	20						gcggcggcggcgggggcTCTG	0.721																																					p.A543G													.	.			0			c.C1628G												5.0	6.0	6.0					16																	3170289		1957	3877	5834	SO:0001583	missense	7755	exon7			CGGCGGCGGGGGC	AF060865	CCDS10494.2	16p13.3	2013-01-08			ENSG00000122386	ENSG00000122386		"""Zinc fingers, C2H2-type"", ""-"""	12996	protein-coding gene	gene with protein product		603436		ZNF210		9787081	Standard	NM_003456		Approved	Zfp13	uc002cub.3	O95201	OTTHUMG00000148676	ENST00000382192.3:c.1628C>G	16.37:g.3170289C>G	ENSP00000371627:p.Ala543Gly		Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	12	0.17	2	NM_003456	83	0.01	1	A8MZK0|D3DUB4|Q9BU95	Missense_Mutation	SNP	ENST00000382192.3	37	CCDS10494.2	.	.	.	.	.	.	.	.	.	.	C	9.874	1.199778	0.22121	.	.	ENSG00000122386	ENST00000382192;ENST00000219091	T;T	0.08807	3.05;3.05	5.54	4.58	0.56647	.	0.676039	0.12206	N	0.489785	T	0.11580	0.0282	N	0.08118	0	0.26180	N	0.979742	D	0.69078	0.997	P	0.62813	0.907	T	0.35724	-0.9777	10	0.44086	T	0.13	-5.873	12.653	0.56772	0.0:0.9174:0.0:0.0826	.	543	O95201	ZN205_HUMAN	G	543	ENSP00000371627:A543G;ENSP00000219091:A543G	ENSP00000219091:A543G	A	+	2	0	ZNF205	3110290	0.001000	0.12720	0.555000	0.28281	0.875000	0.50365	0.602000	0.24134	2.604000	0.88044	0.561000	0.74099	GCG			0.721	ZNF205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000309057.1		NM_003456	
METTL9	51108	mdanderson.org	37	16	21611168	21611168	+	Silent	SNP	C	C	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr16:21611168C>T	ENST00000358154.3	+	1	372	c.114C>T	c.(112-114)agC>agT	p.S38S	METTL9_ENST00000396014.4_Silent_p.S38S	NM_001077180.1|NM_016025.3	NP_001070648.1|NP_057109.3	Q9H1A3	METL9_HUMAN	methyltransferase like 9	38										endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)	7				GBM - Glioblastoma multiforme(48;0.0759)		ACATGACTAgcggcccgggtg	0.771																																					p.S38S													.	.			0			c.C114T												4.0	6.0	5.0					16																	21611168		1799	3735	5534	SO:0001819	synonymous_variant	51108	exon1			GACTAGCGGCCCG	NM_016025, AF151839	CCDS10598.2, CCDS45440.1	16p12.2	2008-11-06			ENSG00000197006	ENSG00000197006			24586	protein-coding gene	gene with protein product	"""DORA reverse strand protein 1"""	609388				10810093, 11132146	Standard	NM_001077180		Approved	DREV1	uc002dje.3	Q9H1A3	OTTHUMG00000131584	ENST00000358154.3:c.114C>T	16.37:g.21611168C>T			Somatic	14	0	0		WXS	Illumina HiSeq	Phase_I	18	0.11	2	NM_016025	9	0.00	0	Q8NBT8|Q9BWJ7|Q9H1A2|Q9Y390	Silent	SNP	ENST00000358154.3	37	CCDS10598.2																																																																																					0.771	METTL9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000254465.1		NM_016025	
EEF2K	29904	mdanderson.org	37	16	22269002	22269002	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr16:22269002T>C	ENST00000263026.5	+	9	1414	c.940T>C	c.(940-942)Tgc>Cgc	p.C314R		NM_013302.3	NP_037434	O00418	EF2K_HUMAN	eukaryotic elongation factor-2 kinase	314	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.				insulin receptor signaling pathway (GO:0008286)|protein autophosphorylation (GO:0046777)|regulation of protein autophosphorylation (GO:0031952)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|elongation factor-2 kinase activity (GO:0004686)|protein kinase activity (GO:0004672)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(8)|large_intestine(2)|lung(13)|ovary(1)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(48;0.0223)		CTCTCATGCCTGCAACCGGAT	0.612																																					p.C314R	NSCLC(195;1411 2157 20319 27471 51856)												.	.			0			c.T940C												130.0	113.0	119.0					16																	22269002		2197	4300	6497	SO:0001583	missense	29904	exon9			CATGCCTGCAACC	U93850	CCDS10604.1	16p12	2008-02-05			ENSG00000103319	ENSG00000103319			24615	protein-coding gene	gene with protein product		606968				9144159, 12051769	Standard	NM_013302		Approved	eEF-2K	uc002dki.3	O00418	OTTHUMG00000094771	ENST00000263026.5:c.940T>C	16.37:g.22269002T>C	ENSP00000263026:p.Cys314Arg		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_013302	2	0.00	0	Q8N588	Missense_Mutation	SNP	ENST00000263026.5	37	CCDS10604.1	.	.	.	.	.	.	.	.	.	.	T	27.0	4.787454	0.90367	.	.	ENSG00000103319	ENST00000263026	T	0.23147	1.92	5.52	5.52	0.82312	MHCK/EF2 kinase (3);Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.63283	0.2498	H	0.94462	3.54	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75181	-0.3408	10	0.87932	D	0	-8.8801	15.643	0.77020	0.0:0.0:0.0:1.0	.	314	O00418	EF2K_HUMAN	R	314	ENSP00000263026:C314R	ENSP00000263026:C314R	C	+	1	0	EEF2K	22176503	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.603000	0.67619	2.094000	0.63399	0.533000	0.62120	TGC			0.612	EEF2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000211580.2		NM_013302	
HSF4	3299	broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	67200242	67200242	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr16:67200242C>T	ENST00000521374.1	+	5	505	c.505C>T	c.(505-507)Cgg>Tgg	p.R169W	HSF4_ENST00000264009.8_Missense_Mutation_p.R169W|HSF4_ENST00000584272.1_Missense_Mutation_p.R169W|HSF4_ENST00000421453.1_Missense_Mutation_p.R169W|HSF4_ENST00000517867.1_3'UTR			Q9ULV5	HSF4_HUMAN	heat shock transcription factor 4	169	Hydrophobic repeat HR-A/B.				camera-type eye development (GO:0043010)|cell development (GO:0048468)|histone H3-K9 demethylation (GO:0033169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotrimerization (GO:0070207)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		GATCTTGTGGCGGGAGGTGGT	0.637																																					p.R169W													.	HSF4	33		0			c.C505T												27.0	36.0	33.0					16																	67200242		2104	4208	6312	SO:0001583	missense	3299	exon7			TTGTGGCGGGAGG	D87673	CCDS42175.1, CCDS45510.1	16q21	2013-01-22			ENSG00000102878	ENSG00000102878			5227	protein-coding gene	gene with protein product		602438	"""cataract, Marner"""	CTM		8972228, 10488131, 12089525	Standard	NM_001538		Approved		uc002erl.2	Q9ULV5	OTTHUMG00000178325	ENST00000521374.1:c.505C>T	16.37:g.67200242C>T	ENSP00000430947:p.Arg169Trp		Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	99	0.06	6	NM_001538	7	0.00	0	Q99472|Q9ULV6	Missense_Mutation	SNP	ENST00000521374.1	37	CCDS42175.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.02|13.02	2.110982|2.110982	0.37242|0.37242	.|.	.|.	ENSG00000102878|ENSG00000102878	ENST00000517750|ENST00000421453;ENST00000264009;ENST00000517685;ENST00000521374;ENST00000517729	.|.	.|.	.|.	4.75|4.75	2.73|2.73	0.32206|0.32206	.|.	.|0.056567	.|0.64402	.|D	.|0.000002	T|T	0.77837|0.77837	0.4190|0.4190	M|M	0.78285|0.78285	2.405|2.405	0.48236|0.48236	D|D	0.999618|0.999618	.|D;D	.|0.89917	.|1.0;0.998	.|D;P	.|0.77004	.|0.989;0.609	T|T	0.78843|0.78843	-0.2044|-0.2044	5|9	.|0.87932	.|D	.|0	-19.0782|-19.0782	13.713|13.713	0.62680|0.62680	0.4497:0.5503:0.0:0.0|0.4497:0.5503:0.0:0.0	.|.	.|169;169	.|Q9ULV5-2;Q9ULV5	.|.;HSF4_HUMAN	V|W	15|169;169;169;169;106	.|.	.|ENSP00000264009:R169W	A|R	+|+	2|1	0|2	HSF4|HSF4	65757743|65757743	0.997000|0.997000	0.39634|0.39634	0.999000|0.999000	0.59377|0.59377	0.739000|0.739000	0.42172|0.42172	0.454000|0.454000	0.21827|0.21827	0.158000|0.158000	0.19367|0.19367	-1.367000|-1.367000	0.01198|0.01198	GCG|CGG			0.637	HSF4-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000375080.1		NM_001538	
DHODH	1723	mdanderson.org	37	16	72056285	72056285	+	Missense_Mutation	SNP	C	C	T	rs267606768		TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr16:72056285C>T	ENST00000219240.4	+	6	751	c.730C>T	c.(730-732)Cgg>Tgg	p.R244W	DHODH_ENST00000573922.1_Intron|DHODH_ENST00000572887.1_Missense_Mutation_p.R244W	NM_001361.4	NP_001352.2	Q02127	PYRD_HUMAN	dihydroorotate dehydrogenase (quinone)	244			R -> W (in POADS). {ECO:0000269|PubMed:19915526}.		'de novo' pyrimidine nucleobase biosynthetic process (GO:0006207)|'de novo' UMP biosynthetic process (GO:0044205)|female pregnancy (GO:0007565)|lactation (GO:0007595)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of apoptotic process (GO:0043065)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|regulation of mitochondrial fission (GO:0090140)|response to caffeine (GO:0031000)|response to drug (GO:0042493)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|neuronal cell body (GO:0043025)	dihydroorotate dehydrogenase activity (GO:0004152)|dihydroorotate oxidase activity (GO:0004158)|drug binding (GO:0008144)|FMN binding (GO:0010181)|ubiquinone binding (GO:0048039)			breast(1)|endometrium(2)|large_intestine(4)|ovary(1)|skin(1)|stomach(1)	10		Ovarian(137;0.125)			Atovaquone(DB01117)|Leflunomide(DB01097)|Teriflunomide(DB08880)	GGATGGCTTGCGGAGAGTGCA	0.627																																					p.R244W													DHODH,colon,carcinoma,0,1	DHODH	0	1	0			c.C730T												27.0	36.0	33.0					16																	72056285		2103	4182	6285	SO:0001583	missense	1723	exon6			GGCTTGCGGAGAG		CCDS42192.1	16q22.2	2012-10-02	2011-09-05		ENSG00000102967	ENSG00000102967	1.3.5.2		2867	protein-coding gene	gene with protein product		126064	"""dihydroorotate dehydrogenase"""			8211381	Standard	NM_001361		Approved		uc002fbp.3	Q02127	OTTHUMG00000178093	ENST00000219240.4:c.730C>T	16.37:g.72056285C>T	ENSP00000219240:p.Arg244Trp		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_001361	40	0.00	0	A8K8C8|Q6P176	Missense_Mutation	SNP	ENST00000219240.4	37	CCDS42192.1	.	.	.	.	.	.	.	.	.	.	C	15.13	2.741097	0.49151	.	.	ENSG00000102967	ENST00000219240	D	0.94862	-3.54	5.82	-1.37	0.09056	Aldolase-type TIM barrel (1);	0.493289	0.25467	N	0.030471	D	0.94712	0.8294	L	0.52905	1.665	0.19300	N	0.999971	D	0.56746	0.977	P	0.53518	0.728	D	0.91066	0.4889	10	0.72032	D	0.01	-7.3583	20.0504	0.97625	0.2809:0.7191:0.0:0.0	.	244	Q02127	PYRD_HUMAN	W	244	ENSP00000219240:R244W	ENSP00000219240:R244W	R	+	1	2	DHODH	70613786	0.865000	0.29922	0.005000	0.12908	0.001000	0.01503	0.692000	0.25482	-0.102000	0.12197	0.561000	0.74099	CGG			0.627	DHODH-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				NM_001361	
COX10-AS1	100874058	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	13928089	13928089	+	RNA	SNP	C	C	T	rs199604193		TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr17:13928089C>T	ENST00000602743.1	-	0	224									COX10 antisense RNA 1																		GGCACAGACACGTGGTGAGGT	0.562																																					.													.	.			0			.																																											94158	.			CAGACACGTGGTG			17p12	2013-05-22	2012-08-15	2010-11-25	ENSG00000236088	ENSG00000236088		"""Long non-coding RNAs"""	38873	non-coding RNA	RNA, long non-coding			"""COX10 antisense RNA (non-protein coding)"", ""COX10 antisense RNA 1 (non-protein coding)"""	COX10AS, COX10-AS			Standard	NR_049718		Approved		uc002goe.1		OTTHUMG00000058771		17.37:g.13928089C>T			Somatic	439	0	0		WXS	Illumina HiSeq	.	423	0.11	47	.	0		0		RNA	SNP	ENST00000602743.1	37																																																																																				0.001		0.562	COX10-AS1-005	KNOWN	basic	antisense	processed_transcript		OTTHUMT00000467585.1			
COX10-AS1	100874058	broad.mit.edu;ucsc.edu	37	17	13928102	13928102	+	RNA	SNP	C	C	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr17:13928102C>T	ENST00000602743.1	-	0	224									COX10 antisense RNA 1																		GGTGAGGTGGCCTGCAGCCTG	0.547																																					.													.	.			0			.																																											0	.			AGGTGGCCTGCAG			17p12	2013-05-22	2012-08-15	2010-11-25	ENSG00000236088	ENSG00000236088		"""Long non-coding RNAs"""	38873	non-coding RNA	RNA, long non-coding			"""COX10 antisense RNA (non-protein coding)"", ""COX10 antisense RNA 1 (non-protein coding)"""	COX10AS, COX10-AS			Standard	NR_049718		Approved		uc002goe.1		OTTHUMG00000058771		17.37:g.13928102C>T			Somatic	389	0.0025706941	1		WXS	Illumina HiSeq	Phase_I	384	0.12	47	.	1	0.00	0		RNA	SNP	ENST00000602743.1	37																																																																																						0.547	COX10-AS1-005	KNOWN	basic	antisense	processed_transcript		OTTHUMT00000467585.1			
GAS2L2	246176	broad.mit.edu	37	17	34077157	34077157	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr17:34077157T>G	ENST00000254466.6	-	2	593	c.566A>C	c.(565-567)gAc>gCc	p.D189A	GAS2L2_ENST00000587565.1_Intron	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	189					cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CGGCGAGGGGTCGGGCGGGGG	0.741																																					p.D189A													GAS2L2,right_upper_lobe,carcinoma,0,2	GAS2L2	94	2	0			c.A566C												20.0	26.0	24.0					17																	34077157		2188	4280	6468	SO:0001583	missense	246176	exon2			GAGGGGTCGGGCG	AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.566A>C	17.37:g.34077157T>G	ENSP00000254466:p.Asp189Ala		Somatic	92	0.1847826087	17		WXS	Illumina HiSeq	Phase_I	93	0.35	33	NM_139285	0		0	Q8NHY4	Missense_Mutation	SNP	ENST00000254466.6	37	CCDS11298.1	.	.	.	.	.	.	.	.	.	.	T	7.826	0.718860	0.15372	.	.	ENSG00000132139	ENST00000254466	T	0.18016	2.24	4.98	2.77	0.32553	.	1.437920	0.04140	N	0.319452	T	0.17152	0.0412	L	0.51422	1.61	0.26149	N	0.980163	P	0.37781	0.608	B	0.30401	0.115	T	0.28902	-1.0029	10	0.49607	T	0.09	0.0179	8.0796	0.30737	0.0:0.1677:0.0:0.8323	.	189	Q8NHY3	GA2L2_HUMAN	A	189	ENSP00000254466:D189A	ENSP00000254466:D189A	D	-	2	0	GAS2L2	31101270	0.986000	0.35501	0.134000	0.22075	0.011000	0.07611	2.112000	0.41892	0.749000	0.32854	0.402000	0.26972	GAC			0.741	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256497.1		NM_139285	
UNC13D	201294	mdanderson.org	37	17	73832673	73832673	+	Silent	SNP	G	G	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr17:73832673G>T	ENST00000207549.4	-	14	1657	c.1278C>A	c.(1276-1278)gcC>gcA	p.A426A	UNC13D_ENST00000412096.2_Silent_p.A426A	NM_199242.2	NP_954712.1	Q70J99	UN13D_HUMAN	unc-13 homolog D (C. elegans)	426	Interaction with RAB27A.				defense response to virus (GO:0051607)|germinal center formation (GO:0002467)|granuloma formation (GO:0002432)|natural killer cell degranulation (GO:0043320)|phagocytosis (GO:0006909)|positive regulation of exocytosis (GO:0045921)|regulation of mast cell degranulation (GO:0043304)	endosome (GO:0005768)|exocytic vesicle (GO:0070382)|lysosome (GO:0005764)|membrane (GO:0016020)				central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)			ACTGCAGCCGGGCTGGGGAGT	0.637									Familial Hemophagocytic Lymphohistiocytosis																												p.A426A													.	.			0			c.C1278A												47.0	53.0	51.0					17																	73832673		2203	4300	6503	SO:0001819	synonymous_variant	201294	exon14	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	CAGCCGGGCTGGG	AK024474	CCDS11730.1	17q25.3	2014-09-17				ENSG00000092929			23147	protein-coding gene	gene with protein product		608897					Standard	NM_199242		Approved	Munc13-4	uc002jpp.3	Q70J99		ENST00000207549.4:c.1278C>A	17.37:g.73832673G>T			Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_199242	2	0.00	0	B4DWG9|Q9H7K5	Silent	SNP	ENST00000207549.4	37	CCDS11730.1																																																																																					0.637	UNC13D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000448847.2		XM_113950	
RNF157	114804	mdanderson.org	37	17	74236319	74236319	+	Start_Codon_SNP	SNP	C	C	A			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr17:74236319C>A	ENST00000269391.6	-	1	135	c.3G>T	c.(1-3)atG>atT	p.M1I	RNF157_ENST00000592271.1_Start_Codon_SNP_p.M1I|RNF157_ENST00000319945.6_Start_Codon_SNP_p.M1I	NM_052916.2	NP_443148.1	Q96PX1	RN157_HUMAN	ring finger protein 157	1							zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	25			LUSC - Lung squamous cell carcinoma(166;0.187)			TCAGGGCCCCCATGGCCGCTG	0.796																																					p.M1I	GBM(186;507 2120 27388 27773 52994)												.	.			0			c.G3T												9.0	10.0	10.0					17																	74236319		2150	4235	6385	SO:0001582	initiator_codon_variant	114804	exon1			GGCCCCCATGGCC	AK091467	CCDS32740.1	17q25.3	2004-02-27			ENSG00000141576	ENSG00000141576		"""RING-type (C3HC4) zinc fingers"""	29402	protein-coding gene	gene with protein product						11572484	Standard	NM_052916		Approved	KIAA1917	uc002jqz.3	Q96PX1	OTTHUMG00000132627	ENST00000269391.6:c.3G>T	17.37:g.74236319C>A	ENSP00000269391:p.Met1Ile		Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	18	0.11	2	NM_052916	1	0.00	0	Q8NB72|Q96N56	Missense_Mutation	SNP	ENST00000269391.6	37	CCDS32740.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.464629	0.84425	.	.	ENSG00000141576	ENST00000269391;ENST00000319945	T;T	0.36520	1.25;1.39	2.67	2.67	0.31697	.	0.000000	0.85682	U	0.000000	T	0.57272	0.2042	.	.	.	0.80722	D	1	D;P	0.76494	0.999;0.855	D;P	0.85130	0.997;0.667	T	0.62666	-0.6806	9	0.87932	D	0	-16.2525	10.6051	0.45390	0.0:1.0:0.0:0.0	.	1;1	Q96PX1-2;Q96PX1	.;RN157_HUMAN	I	1	ENSP00000269391:M1I;ENSP00000321837:M1I	ENSP00000269391:M1I	M	-	3	0	RNF157	71747914	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	5.856000	0.69518	1.481000	0.48307	0.393000	0.25936	ATG			0.796	RNF157-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255874.2		XM_290732	Missense_Mutation
USP36	57602	mdanderson.org	37	17	76799979	76799979	+	Silent	SNP	G	G	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr17:76799979G>T	ENST00000542802.3	-	16	2741	c.2298C>A	c.(2296-2298)ccC>ccA	p.P766P	USP36_ENST00000449938.2_Intron|USP36_ENST00000312010.6_Silent_p.P766P			Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36	766					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	34			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			CTGGGGGCTTGGGGGTACTGG	0.637																																					p.P766P													.	.			0			c.C2298A												26.0	32.0	30.0					17																	76799979		1984	3830	5814	SO:0001819	synonymous_variant	57602	exon16			GGGCTTGGGGGTA	AB040886	CCDS32755.1	17q25.3	2008-02-05	2005-08-08			ENSG00000055483		"""Ubiquitin-specific peptidases"""	20062	protein-coding gene	gene with protein product		612543	"""ubiquitin specific protease 36"""			12838346	Standard	NM_025090		Approved	KIAA1453, FLJ12851	uc002jvz.1	Q9P275		ENST00000542802.3:c.2298C>A	17.37:g.76799979G>T			Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_025090	19	0.00	0	Q05C98|Q05DD0|Q6IQ38|Q8NDM8|Q9NVC8	Silent	SNP	ENST00000542802.3	37	CCDS32755.1																																																																																					0.637	USP36-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000437472.3		NM_025090	
TRAPPC8	22878	mdanderson.org	37	18	29470790	29470790	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr18:29470790C>T	ENST00000283351.4	-	12	1971	c.1636G>A	c.(1636-1638)Gca>Aca	p.A546T	TRAPPC8_ENST00000582539.1_Missense_Mutation_p.A492T|TRAPPC8_ENST00000582513.1_Missense_Mutation_p.A546T	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	546					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						AAGCAATGTGCTGCCTGTTCC	0.363																																					p.A546T													.	.			0			c.G1636A												130.0	132.0	131.0					18																	29470790		2203	4300	6503	SO:0001583	missense	22878	exon12			AATGTGCTGCCTG	AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.1636G>A	18.37:g.29470790C>T	ENSP00000283351:p.Ala546Thr		Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_014939	1	0.00	0	A0JP15|B3KME5|Q9H0L2	Missense_Mutation	SNP	ENST00000283351.4	37	CCDS11901.1	.	.	.	.	.	.	.	.	.	.	C	18.52	3.641396	0.67244	.	.	ENSG00000153339	ENST00000283351	T	0.80123	-1.34	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.91603	0.7347	M	0.86502	2.82	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	D	0.92069	0.5663	10	0.72032	D	0.01	.	20.0796	0.97766	0.0:1.0:0.0:0.0	.	546;546	Q6PCC9;Q9Y2L5	.;TPPC8_HUMAN	T	546	ENSP00000283351:A546T	ENSP00000283351:A546T	A	-	1	0	TRAPPC8	27724788	1.000000	0.71417	0.969000	0.41365	0.991000	0.79684	7.230000	0.78097	2.758000	0.94735	0.460000	0.39030	GCA			0.363	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255355.1		NM_014939	
MED16	10025	hgsc.bcm.edu;mdanderson.org	37	19	871976	871976	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr19:871976T>A	ENST00000589119.1	-	11	2047	c.2048A>T	c.(2047-2049)cAg>cTg	p.Q683L	MED16_ENST00000269814.4_Intron|MED16_ENST00000325464.1_Missense_Mutation_p.Q683L|MED16_ENST00000606828.1_5'Flank|MED16_ENST00000395808.3_Missense_Mutation_p.Q683L|MED16_ENST00000312090.6_Missense_Mutation_p.Q683L			Q9Y2X0	MED16_HUMAN	mediator complex subunit 16	683					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|receptor activity (GO:0004872)|thyroid hormone receptor binding (GO:0046966)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CATGCTGTCCTGGGTATCCGA	0.662																																					p.Q683L													.	.			0			c.A2048T												51.0	42.0	45.0					19																	871976		2171	4277	6448	SO:0001583	missense	10025	exon12			CTGTCCTGGGTAT	AF121228	CCDS12047.1	19p13.3	2013-01-10	2007-07-30	2007-07-30		ENSG00000175221		"""WD repeat domain containing"""	17556	protein-coding gene	gene with protein product		604062	"""thyroid hormone receptor associated protein 5"""	THRAP5		10235266, 10198638	Standard	NM_005481		Approved	DRIP92, TRAP95	uc002lqd.1	Q9Y2X0		ENST00000589119.1:c.2048A>T	19.37:g.871976T>A	ENSP00000464810:p.Gln683Leu		Somatic	75	0	0		WXS	Illumina HiSeq	.	85	0.05	4	NM_005481	121	0.00	0	Q6PJT2|Q96AD4|Q96I35|Q9Y652	Missense_Mutation	SNP	ENST00000589119.1	37	CCDS12047.1	.	.	.	.	.	.	.	.	.	.	t	11.57	1.678774	0.29783	.	.	ENSG00000175221	ENST00000325464;ENST00000312090;ENST00000395808	T;T;T	0.40225	1.04;1.04;1.04	3.96	3.96	0.45880	.	0.000000	0.85682	U	0.000000	T	0.38241	0.1033	N	0.12569	0.235	0.80722	D	1	D;D	0.59357	0.981;0.985	D;D	0.74023	0.969;0.982	T	0.21861	-1.0233	10	0.02654	T	1	-29.8702	12.065	0.53583	0.0:0.0:0.0:1.0	.	683;683	Q9Y2X0-3;Q9Y2X0	.;MED16_HUMAN	L	683	ENSP00000325612:Q683L;ENSP00000308528:Q683L;ENSP00000379153:Q683L	ENSP00000308528:Q683L	Q	-	2	0	MED16	822976	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.407000	0.80029	1.437000	0.47472	0.358000	0.22013	CAG			0.662	MED16-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000457902.3		NM_005481	
ZBTB7A	51341	mdanderson.org	37	19	4054919	4054919	+	Silent	SNP	C	C	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr19:4054919C>T	ENST00000322357.4	-	2	590	c.312G>A	c.(310-312)gtG>gtA	p.V104V	ZBTB7A_ENST00000601588.1_Silent_p.V104V	NM_015898.2	NP_056982.1	O95365	ZBT7A_HUMAN	zinc finger and BTB domain containing 7A	104					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	14		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.014)|STAD - Stomach adenocarcinoma(1328;0.18)		GGATGTCACCCACGTTGGCTG	0.692																																					p.V104V													.	.			0			c.G312A												58.0	42.0	48.0					19																	4054919		2200	4298	6498	SO:0001819	synonymous_variant	51341	exon2			GTCACCCACGTTG	AF000561	CCDS12119.1	19p13.3	2013-01-08		2005-04-07		ENSG00000178951		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18078	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 7A, HIV-1 inducer of short transcripts binding protein"", ""lymphoma related factor"""	605878	"""zinc finger and BTB domain containing 7"""	ZBTB7		9973611, 9927193	Standard	NM_015898		Approved	FBI-1, LRF, DKFZp547O146, pokemon, ZNF857A	uc002lzi.3	O95365		ENST00000322357.4:c.312G>A	19.37:g.4054919C>T			Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_015898	3	0.00	0	D6W619|O00456|Q14D41|Q5XG86	Silent	SNP	ENST00000322357.4	37	CCDS12119.1																																																																																					0.692	ZBTB7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000457621.2		NM_015898	
ANKRD24	170961	mdanderson.org	37	19	4216046	4216046	+	Splice_Site	SNP	A	A	G			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr19:4216046A>G	ENST00000600132.1	+	16	1545	c.1269A>G	c.(1267-1269)ccA>ccG	p.P423P	ANKRD24_ENST00000595096.1_3'UTR|ANKRD24_ENST00000318934.4_Splice_Site_p.P423P|ANKRD24_ENST00000262970.5_Splice_Site_p.P513P	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	423										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		CTGACCTTCCAGGTGAGCCCC	0.652																																					p.P423P													.	.			0			c.A1269G												29.0	34.0	32.0					19																	4216046		2036	4172	6208	SO:0001630	splice_region_variant	170961	exon16			CCTTCCAGGTGAG	AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.1270+1A>G	19.37:g.4216046A>G			Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_133475	0		0	O75268|O95781	Silent	SNP	ENST00000600132.1	37	CCDS45925.1																																																																																					0.652	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000458188.1		XM_114000	Silent
MAP1S	55201	mdanderson.org	37	19	17838550	17838550	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr19:17838550C>T	ENST00000324096.4	+	5	2508	c.2357C>T	c.(2356-2358)tCg>tTg	p.S786L	MAP1S_ENST00000544059.2_Missense_Mutation_p.S760L|MAP1S_ENST00000597681.1_3'UTR|CTD-3149D2.4_ENST00000595363.1_RNA	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	786	Necessary for association with microtubules.|Necessary for interaction with RASSF1 isoform A and isoform C.|Necessary for the microtubule-organizing center localization.|Pro-rich.				apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						CCACCCACATCGGTCAGCGAG	0.687																																					p.S786L													.	.			0			c.C2357T												22.0	23.0	22.0					19																	17838550		2195	4299	6494	SO:0001583	missense	55201	exon5			CCACATCGGTCAG	BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.2357C>T	19.37:g.17838550C>T	ENSP00000325313:p.Ser786Leu		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_018174	136	0.00	0	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Missense_Mutation	SNP	ENST00000324096.4	37	CCDS32954.1	.	.	.	.	.	.	.	.	.	.	C	14.61	2.585485	0.46110	.	.	ENSG00000130479	ENST00000324096;ENST00000544059	T;T	0.19938	2.11;2.11	4.77	2.59	0.31030	.	0.000000	0.48767	D	0.000170	T	0.39118	0.1066	M	0.73217	2.22	0.23487	N	0.997576	D;D	0.89917	1.0;1.0	D;D	0.67382	0.951;0.951	T	0.13124	-1.0521	10	0.72032	D	0.01	-28.3034	8.2461	0.31689	0.0:0.7524:0.158:0.0896	.	760;786	B4DH53;Q66K74	.;MAP1S_HUMAN	L	786;760	ENSP00000325313:S786L;ENSP00000439243:S760L	ENSP00000325313:S786L	S	+	2	0	MAP1S	17699550	1.000000	0.71417	0.003000	0.11579	0.000000	0.00434	7.516000	0.81772	0.421000	0.25980	-0.947000	0.02670	TCG			0.687	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466027.1		NM_018174	
CAPNS1	826	broad.mit.edu;mdanderson.org	37	19	36632054	36632054	+	Silent	SNP	C	C	T	rs17879825		TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr19:36632054C>T	ENST00000246533.3	+	2	739	c.141C>T	c.(139-141)ggC>ggT	p.G47G	CAPNS1_ENST00000590874.1_Silent_p.G47G|CAPNS1_ENST00000588815.1_Silent_p.G47G|CAPNS1_ENST00000589146.1_Intron|AD001527.7_ENST00000604228.1_RNA|CAPNS1_ENST00000587718.1_Silent_p.G47G|CAPNS1_ENST00000588780.1_Silent_p.G47G	NM_001003962.1|NM_001749.2	NP_001003962.1|NP_001740.1	P04632	CPNS1_HUMAN	calpain, small subunit 1	47	Gly-rich (hydrophobic).|Poly-Gly.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			cervix(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			gcggcggcggcggtggtggag	0.761																																					p.G47G	Esophageal Squamous(129;1541 1691 5780 18353 34150)												.	CAPNS1	19		0			c.C141T																																									SO:0001819	synonymous_variant	826	exon2			CGGCGGCGGTGGT	X04106	CCDS12489.1	19q13.1	2013-01-10		2001-08-10	ENSG00000126247	ENSG00000126247	3.4.22.52	"""EF-hand domain containing"""	1481	protein-coding gene	gene with protein product		114170		CAPN4		3024120, 3016651	Standard	NM_001003962		Approved	CANP, CANPS, 30K, CDPS	uc002odj.3	P04632		ENST00000246533.3:c.141C>T	19.37:g.36632054C>T			Somatic	54	0.0555555556	3		WXS	Illumina HiSeq	Phase_I	116	0.07	8	NM_001749	3	0.00	0	A8K0P1|Q8WTX3|Q96EW0	Silent	SNP	ENST00000246533.3	37	CCDS12489.1																																																																																					0.761	CAPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000457411.2			
ACTN4	81	mdanderson.org	37	19	39214851	39214851	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr19:39214851G>A	ENST00000252699.2	+	15	1823	c.1747G>A	c.(1747-1749)Gag>Aag	p.E583K	ACTN4_ENST00000424234.2_Missense_Mutation_p.E193K|ACTN4_ENST00000390009.3_Missense_Mutation_p.E364K	NM_004924.4	NP_004915.2	O43707	ACTN4_HUMAN	actinin, alpha 4	583					actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cellular component movement (GO:0051272)|positive regulation of pinocytosis (GO:0048549)|positive regulation of sodium:proton antiporter activity (GO:0032417)|protein localization to tight junction (GO:1902396)|protein transport (GO:0015031)|regulation of apoptotic process (GO:0042981)|response to hypoxia (GO:0001666)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|protein complex (GO:0043234)|pseudopodium (GO:0031143)|ribonucleoprotein complex (GO:0030529)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|nucleoside binding (GO:0001882)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|urinary_tract(3)	30	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CGCCGATAGGGAGCGCGAGGC	0.662																																					p.E583K	Colon(168;199 1940 10254 46213 46384)												.	.			0			c.G1747A												62.0	61.0	61.0					19																	39214851		2203	4300	6503	SO:0001583	missense	81	exon15			GATAGGGAGCGCG	D89980	CCDS12518.1	19q13	2013-01-10			ENSG00000130402	ENSG00000130402		"""EF-hand domain containing"""	166	protein-coding gene	gene with protein product		604638	"""focal segmental glomerulosclerosis 1"""	FSGS1		9461087, 10700177	Standard	NM_004924		Approved		uc002oja.2	O43707	OTTHUMG00000137382	ENST00000252699.2:c.1747G>A	19.37:g.39214851G>A	ENSP00000252699:p.Glu583Lys		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_004924	140	0.00	0	A4K467|D6PXK4|O76048	Missense_Mutation	SNP	ENST00000252699.2	37	CCDS12518.1	.	.	.	.	.	.	.	.	.	.	G	16.74	3.206819	0.58343	.	.	ENSG00000130402	ENST00000252699;ENST00000424234;ENST00000390009;ENST00000440400	T;T;T;T	0.72615	-0.67;-0.67;-0.67;-0.67	3.75	3.75	0.43078	.	0.000000	0.85682	D	0.000000	D	0.83046	0.5169	M	0.87827	2.91	0.54753	D	0.999987	D	0.56746	0.977	P	0.58331	0.837	D	0.87234	0.2262	10	0.87932	D	0	.	14.8549	0.70329	0.0:0.0:1.0:0.0	.	583	O43707	ACTN4_HUMAN	K	583;193;364;19	ENSP00000252699:E583K;ENSP00000411187:E193K;ENSP00000439497:E364K;ENSP00000398393:E19K	ENSP00000252699:E583K	E	+	1	0	ACTN4	43906691	1.000000	0.71417	1.000000	0.80357	0.720000	0.41350	7.577000	0.82486	2.106000	0.64143	0.561000	0.74099	GAG			0.662	ACTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268091.1			
HIPK4	147746	mdanderson.org	37	19	40886728	40886728	+	Silent	SNP	G	G	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr19:40886728G>T	ENST00000291823.2	-	3	1454	c.1170C>A	c.(1168-1170)acC>acA	p.T390T		NM_144685.3	NP_653286.2	Q8NE63	HIPK4_HUMAN	homeodomain interacting protein kinase 4	390					histone phosphorylation (GO:0016572)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|regulation of signal transduction by p53 class mediator (GO:1901796)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	20			Lung(22;4.95e-05)|LUSC - Lung squamous cell carcinoma(20;0.000292)			AGTAGTAGGGGGTCCCATCTT	0.642																																					p.T390T													.	.			0			c.C1170A												62.0	68.0	66.0					19																	40886728		2203	4300	6503	SO:0001819	synonymous_variant	147746	exon3			GTAGGGGGTCCCA	BC034501	CCDS12555.1	19q13.2	2008-02-05				ENSG00000160396			19007	protein-coding gene	gene with protein product		611712					Standard	NM_144685		Approved	FLJ32818	uc002onp.3	Q8NE63		ENST00000291823.2:c.1170C>A	19.37:g.40886728G>T			Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_144685	0		0	A8K863|Q96M54	Silent	SNP	ENST00000291823.2	37	CCDS12555.1																																																																																					0.642	HIPK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462593.1		NM_144685	
CNFN	84518	mdanderson.org	37	19	42891589	42891589	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr19:42891589C>T	ENST00000222032.5	-	3	201	c.152G>A	c.(151-153)cGc>cAc	p.R51H	CNFN_ENST00000597255.1_Missense_Mutation_p.R51H	NM_032488.3	NP_115877.2	Q9BYD5	CNFN_HUMAN	cornifelin	51	Cys-rich.				keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				lung(1)|prostate(1)	2		Prostate(69;0.00899)				GTCGGAGATGCGGCAGGCAAG	0.726																																					p.R51H													.	.			0			c.G152A												10.0	12.0	11.0					19																	42891589		2174	4268	6442	SO:0001583	missense	84518	exon3			GAGATGCGGCAGG	AB049591	CCDS12606.1	19q13.31	2006-01-11				ENSG00000105427			30183	protein-coding gene	gene with protein product		611764					Standard	NM_032488		Approved	PLAC8L2	uc002otp.4	Q9BYD5		ENST00000222032.5:c.152G>A	19.37:g.42891589C>T	ENSP00000222032:p.Arg51His		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_032488	20	0.05	1	B2R569	Missense_Mutation	SNP	ENST00000222032.5	37	CCDS12606.1	.	.	.	.	.	.	.	.	.	.	C	17.13	3.310525	0.60414	.	.	ENSG00000105427	ENST00000222032	.	.	.	4.5	4.5	0.54988	.	0.173855	0.38720	N	0.001599	T	0.59622	0.2207	M	0.61703	1.905	0.32294	N	0.565872	D	0.89917	1.0	D	0.68353	0.957	T	0.64761	-0.6331	9	0.33141	T	0.24	-53.373	8.9863	0.35997	0.0:0.8964:0.0:0.1036	.	51	Q9BYD5	CNFN_HUMAN	H	51	.	ENSP00000222032:R51H	R	-	2	0	CNFN	47583429	1.000000	0.71417	1.000000	0.80357	0.013000	0.08279	1.755000	0.38379	2.255000	0.74692	0.545000	0.68477	CGC			0.726	CNFN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463859.1		NM_032488	
CARD8	22900	hgsc.bcm.edu;broad.mit.edu	37	19	48715121	48715122	+	Missense_Mutation	DNP	TC	TC	AA			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	TC	TC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr19:48715121_48715122TC>AA	ENST00000359009.4	-	10	1453_1454	c.1141_1142GA>TT	c.(1141-1143)GAg>TTg	p.E381L	CARD8_ENST00000519940.1_Missense_Mutation_p.E487L|CARD8_ENST00000520015.1_3'UTR|CARD8_ENST00000357778.5_Intron|CARD8_ENST00000447740.2_Missense_Mutation_p.E437L|CARD8_ENST00000521613.1_Missense_Mutation_p.E437L|CARD8_ENST00000391898.3_Missense_Mutation_p.E487L|CTC-453G23.8_ENST00000595201.1_RNA|CARD8_ENST00000520753.1_3'UTR|CARD8_ENST00000520153.1_Missense_Mutation_p.E437L|ZNF114_ENST00000597695.1_Intron			Q9Y2G2	CARD8_HUMAN	caspase recruitment domain family, member 8	381	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)|NLRP3 inflammasome complex (GO:0072559)|nucleus (GO:0005634)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|NACHT domain binding (GO:0032089)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(4)|lung(8)|prostate(1)|skin(1)	15		all_lung(116;0.000112)|Lung NSC(112;0.000192)|all_epithelial(76;0.000349)|all_neural(266;0.0228)|Ovarian(192;0.113)|Prostate(7;0.184)		OV - Ovarian serous cystadenocarcinoma(262;0.000112)|all cancers(93;0.000293)|Epithelial(262;0.0129)|GBM - Glioblastoma multiforme(486;0.0336)		CTCCACCAGCTCCTTCTCATTC	0.55																																					p.E487L													.	.			0			c.G1459T																																									SO:0001583	missense	22900	exon11			ACCAGCTCCTTCT	AB023172	CCDS12712.1, CCDS12712.2, CCDS54287.1, CCDS54288.1, CCDS54289.1	19q13.33	2011-05-24			ENSG00000105483	ENSG00000105483			17057	protein-coding gene	gene with protein product		609051				10231032, 11408476	Standard	NM_001184900		Approved	TUCAN, KIAA0955, CARDINAL, NDPP, Dakar	uc010xzj.2	Q9Y2G2	OTTHUMG00000165047	ENST00000359009.4:c.1141_1142delinsAA	19.37:g.48715121_48715122delinsAA	ENSP00000351901:p.Glu381Leu		Somatic	275	0	0		WXS	Illumina HiSeq	.	195	0.05	10	NM_001184900	9	0.00	0	B5KVR6|B7Z496|B7Z4A2|E9PEM7|G3XAM9|Q6PGP8|Q96P82	Missense_Mutation	DNP	ENST00000359009.4	37																																																																																						0.550	CARD8-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding				NM_014959	
GYS1	2997	mdanderson.org	37	19	49473946	49473946	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr19:49473946G>A	ENST00000323798.3	-	14	1862	c.1666C>T	c.(1666-1668)Cgg>Tgg	p.R556W	GYS1_ENST00000541188.1_Missense_Mutation_p.R476W|GYS1_ENST00000544287.1_Missense_Mutation_p.R189W|GYS1_ENST00000263276.6_Missense_Mutation_p.R492W	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	556					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		CTGCGGAACCGCCGGTCAAGA	0.587											OREG0025611	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R556W													.	.			0			c.C1666T												36.0	39.0	38.0					19																	49473946		2203	4300	6503	SO:0001583	missense	2997	exon14			GGAACCGCCGGTC		CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.1666C>T	19.37:g.49473946G>A	ENSP00000317904:p.Arg556Trp		Somatic	55	0.0181818182	1	962	WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_002103	16	0.00	0	Q9BTT9	Missense_Mutation	SNP	ENST00000323798.3	37	CCDS12747.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.302236	0.81136	.	.	ENSG00000104812	ENST00000323798;ENST00000263276;ENST00000541188;ENST00000544287	T;T;T;T	0.73363	-0.74;-0.74;-0.74;-0.74	5.49	-1.21	0.09524	.	0.110383	0.64402	D	0.000012	D	0.84624	0.5513	M	0.89095	3.005	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.993;0.999;0.996	D	0.83549	0.0100	10	0.87932	D	0	-28.227	8.8061	0.34938	0.0733:0.0:0.4361:0.4906	.	476;492;556	B7Z806;Q9BTT9;P13807	.;.;GYS1_HUMAN	W	556;492;476;189	ENSP00000317904:R556W;ENSP00000263276:R492W;ENSP00000437922:R476W;ENSP00000444004:R189W	ENSP00000263276:R492W	R	-	1	2	GYS1	54165758	1.000000	0.71417	0.994000	0.49952	0.988000	0.76386	1.362000	0.34148	0.042000	0.15717	0.561000	0.74099	CGG			0.587	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319791.1		NM_002103	
FLT3LG	2323	mdanderson.org	37	19	49979713	49979713	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr19:49979713C>A	ENST00000594009.1	+	4	311	c.232C>A	c.(232-234)Ctg>Atg	p.L78M	FLT3LG_ENST00000204637.2_5'UTR|CTD-3148I10.9_ENST00000599536.1_Intron|FLT3LG_ENST00000595510.1_5'UTR|FLT3LG_ENST00000344019.3_Missense_Mutation_p.L78M|FLT3LG_ENST00000597551.1_Missense_Mutation_p.L78M|FLT3LG_ENST00000596435.1_Missense_Mutation_p.L78M|CTD-3148I10.15_ENST00000595815.1_RNA|FLT3LG_ENST00000600429.1_Missense_Mutation_p.L78M	NM_001204503.1	NP_001191432.1	P49771	FLT3L_HUMAN	fms-related tyrosine kinase 3 ligand	78					embryonic hemopoiesis (GO:0035162)|lymphocyte differentiation (GO:0030098)|positive regulation of cell proliferation (GO:0008284)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein phosphorylation (GO:0001934)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)|membrane (GO:0016020)	receptor binding (GO:0005102)			large_intestine(2)|lung(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	10		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00154)|GBM - Glioblastoma multiforme(486;0.0246)		GCGGCTGGTCCTGGCACAGCG	0.642											OREG0025623	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L78M													.	.			0			c.C232A												35.0	35.0	35.0					19																	49979713		2203	4300	6503	SO:0001583	missense	2323	exon4			CTGGTCCTGGCAC	U04806	CCDS12767.1, CCDS62753.1	19q13.3	2014-01-30				ENSG00000090554		"""Endogenous ligands"""	3766	protein-coding gene	gene with protein product		600007				8145851, 7824267	Standard	NM_001204502		Approved		uc010yau.2	P49771		ENST00000594009.1:c.232C>A	19.37:g.49979713C>A	ENSP00000469613:p.Leu78Met		Somatic	49	0	0	966	WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_001204503	34	0.00	0	A0AVC2|B9EGH2|Q05C96	Missense_Mutation	SNP	ENST00000594009.1	37	CCDS12767.1	.	.	.	.	.	.	.	.	.	.	C	17.57	3.421428	0.62622	.	.	ENSG00000090554	ENST00000204637;ENST00000344019	.	.	.	4.36	2.05	0.26809	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.264174	0.31156	U	0.008148	T	0.45418	0.1341	L	0.32530	0.975	0.29292	N	0.869317	D	0.89917	1.0	D	0.85130	0.997	T	0.24799	-1.0150	9	0.72032	D	0.01	-9.8339	4.8708	0.13631	0.0:0.6576:0.2223:0.1201	.	78	P49771	FLT3L_HUMAN	M	78	.	ENSP00000204637:L78M	L	+	1	2	FLT3LG	54671525	0.962000	0.33011	1.000000	0.80357	0.845000	0.48019	1.311000	0.33562	2.131000	0.65755	0.549000	0.68633	CTG			0.642	FLT3LG-007	KNOWN	alternative_3_UTR|alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465305.1			
SPIB	6689	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50926238	50926238	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr19:50926238C>A	ENST00000595883.1	+	4	308	c.283C>A	c.(283-285)Ctg>Atg	p.L95M	SPIB_ENST00000597855.1_Missense_Mutation_p.L95M|CTD-2545M3.6_ENST00000599632.1_Missense_Mutation_p.P229H|SPIB_ENST00000439922.2_Intron|SPIB_ENST00000596074.1_Intron|SPIB_ENST00000270632.7_Missense_Mutation_p.L95M	NM_001243999.1|NM_001244000.1|NM_003121.4	NP_001230928.1|NP_001230929.1|NP_003112.2	Q01892	SPIB_HUMAN	Spi-B transcription factor (Spi-1/PU.1 related)	95					cell differentiation (GO:0030154)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(8)	14		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		GGCCCCCAGCCTGGAGGCCCC	0.647																																					p.L95M													.	.			0			c.C283A												31.0	35.0	33.0					19																	50926238		2195	4279	6474	SO:0001583	missense	6689	exon4			CCCAGCCTGGAGG		CCDS33080.1, CCDS58674.1, CCDS59412.1	19q13.3-q13.4	2008-07-22				ENSG00000269404			11242	protein-coding gene	gene with protein product		606802				1406622	Standard	NM_003121		Approved	SPI-B	uc002psd.3	Q01892		ENST00000595883.1:c.283C>A	19.37:g.50926238C>A	ENSP00000471921:p.Leu95Met		Somatic	235	0	0		WXS	Illumina HiSeq	.	158	0.13	20	NM_001243999	17	0.06	1	A8K9C9|B4DUG6|Q15359	Missense_Mutation	SNP	ENST00000595883.1	37	CCDS33080.1	.	.	.	.	.	.	.	.	.	.	.	14.44	2.536753	0.45176	.	.	ENSG00000142539	ENST00000270632	T	0.61510	0.1	4.98	2.79	0.32731	.	0.372474	0.18563	N	0.137547	T	0.46308	0.1386	M	0.61703	1.905	0.80722	D	1	P;B	0.41102	0.738;0.123	B;B	0.35413	0.202;0.025	T	0.30534	-0.9975	10	0.30854	T	0.27	-0.0853	5.7371	0.18073	0.193:0.7034:0.0:0.1036	.	95;95	Q01892-2;Q01892	.;SPIB_HUMAN	M	95	ENSP00000270632:L95M	ENSP00000270632:L95M	L	+	1	2	SPIB	55618050	0.956000	0.32656	1.000000	0.80357	0.695000	0.40330	0.332000	0.19751	0.577000	0.29470	0.462000	0.41574	CTG			0.647	SPIB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000464744.1		NM_003121	
ALK	238	broad.mit.edu	37	2	29449808	29449808	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr2:29449808T>C	ENST00000389048.3	-	18	3953	c.3047A>G	c.(3046-3048)gAg>gGg	p.E1016G	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	1016					activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	GACGCCATCCTCAGCCAGCAC	0.562			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.E1016G			yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	ALK,left_upper_lobe,carcinoma,+1,1	ALK	533	1	0			c.A3047G												180.0	163.0	169.0					2																	29449808		2203	4300	6503	SO:0001583	missense	238	exon18	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	CCATCCTCAGCCA	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.3047A>G	2.37:g.29449808T>C	ENSP00000373700:p.Glu1016Gly		Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	79	0.04	3	NM_004304	0		0	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Missense_Mutation	SNP	ENST00000389048.3	37	CCDS33172.1	.	.	.	.	.	.	.	.	.	.	T	9.995	1.231973	0.22626	.	.	ENSG00000171094	ENST00000389048	T	0.77877	-1.13	5.38	5.38	0.77491	.	0.148155	0.30177	U	0.010239	T	0.68824	0.3043	L	0.38175	1.15	0.58432	D	0.999993	B	0.10296	0.003	B	0.09377	0.004	T	0.63409	-0.6644	9	.	.	.	.	15.0569	0.71921	0.0:0.0:0.0:1.0	.	1016	Q9UM73	ALK_HUMAN	G	1016	ENSP00000373700:E1016G	.	E	-	2	0	ALK	29303312	0.005000	0.15991	0.898000	0.35279	0.137000	0.21094	1.613000	0.36900	2.040000	0.60383	0.383000	0.25322	GAG			0.562	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000324994.1		NM_004304	
KANSL1L	151050	mdanderson.org	37	2	210894633	210894633	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr2:210894633G>T	ENST00000281772.9	-	10	2428	c.2165C>A	c.(2164-2166)aCt>aAt	p.T722N	AC007038.7_ENST00000452057.1_RNA|KANSL1L_ENST00000418791.1_Missense_Mutation_p.T680N|RP11-260M2.1_ENST00000608095.1_RNA	NM_152519.2	NP_689732.2	A0AUZ9	KAL1L_HUMAN	KAT8 regulatory NSL complex subunit 1-like	722						histone acetyltransferase complex (GO:0000123)											TTCAAGTTTAGTTCTTTCTCC	0.333																																					p.T722N													.	.			0			c.C2165A												127.0	123.0	124.0					2																	210894633		2203	4299	6502	SO:0001583	missense	151050	exon10			AGTTTAGTTCTTT	AK074441	CCDS33370.1	2q34	2012-02-20	2012-02-20	2012-02-20	ENSG00000144445	ENSG00000144445			26310	protein-coding gene	gene with protein product	"""KIAA1267-like"""	613833	"""chromosome 2 open reading frame 67"""	C2orf67		12477932	Standard	NM_152519		Approved	FLJ23861, FLJ32349, MSL1v2, KIAA1267L	uc002vds.3	A0AUZ9	OTTHUMG00000154697	ENST00000281772.9:c.2165C>A	2.37:g.210894633G>T	ENSP00000281772:p.Thr722Asn		Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_152519	0		0	B7ZLN1|I6L9A8|Q53TV8|Q53TW3|Q6IS05|Q8TCI1|Q96MI0|Q9UFC3	Missense_Mutation	SNP	ENST00000281772.9	37	CCDS33370.1	.	.	.	.	.	.	.	.	.	.	G	6.917	0.538843	0.13250	.	.	ENSG00000144445	ENST00000281772;ENST00000418791	.	.	.	5.5	-2.36	0.06663	.	0.498109	0.18237	N	0.147368	T	0.11324	0.0276	N	0.00677	-1.265	0.43292	D	0.995275	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.22487	-1.0215	9	0.08599	T	0.76	.	5.5226	0.16941	0.0687:0.1599:0.4567:0.3147	.	680;722	A0AUZ9-2;A0AUZ9	.;CB067_HUMAN	N	722;680	.	ENSP00000281772:T722N	T	-	2	0	C2orf67	210602878	0.038000	0.19896	0.696000	0.30242	0.810000	0.45777	0.004000	0.13106	-0.544000	0.06232	-0.797000	0.03246	ACT			0.333	KANSL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000336633.3		NM_152519	
RQCD1	9125	broad.mit.edu;mdanderson.org	37	2	219458920	219458920	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr2:219458920G>T	ENST00000273064.6	+	8	1196	c.821G>T	c.(820-822)cGc>cTc	p.R274L	RQCD1_ENST00000509807.2_Missense_Mutation_p.R306L|RQCD1_ENST00000542068.1_Missense_Mutation_p.R274L	NM_005444.2	NP_005435.1	Q92600	RCD1_HUMAN	RCD1 required for cell differentiation1 homolog (S. pombe)	274					cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of ligand-dependent nuclear receptor transcription coactivator activity (GO:2000327)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|sex differentiation (GO:0007548)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|prostate(3)|skin(1)	15		Renal(207;0.0915)		Epithelial(149;1.13e-06)|all cancers(144;0.000192)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACCACGAAACGCTGGCTTGCA	0.582																																					p.R306L													.	RQCD1	32		0			c.G917T												111.0	100.0	104.0					2																	219458920		2203	4300	6503	SO:0001583	missense	9125	exon9			CGAAACGCTGGCT	D87957	CCDS33379.1, CCDS63123.1	2q35	2010-04-23	2001-11-28		ENSG00000144580	ENSG00000144580			10445	protein-coding gene	gene with protein product	"""cancer/testis antigen 129"""	612054	"""rcd1 (required for cell differentiation, S.pombe) homolog 1"""			9447985	Standard	NM_001271634		Approved	RCD1, RCD1+, CNOT9, CT129	uc010zki.3	Q92600	OTTHUMG00000154750	ENST00000273064.6:c.821G>T	2.37:g.219458920G>T	ENSP00000273064:p.Arg274Leu		Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	141	0.04	5	NM_001271634	40	0.00	0	B2RPI0|B5MDQ4|B7Z1E5|Q96IX4	Missense_Mutation	SNP	ENST00000273064.6	37	CCDS33379.1	.	.	.	.	.	.	.	.	.	.	G	17.57	3.423157	0.62733	.	.	ENSG00000144580	ENST00000273064;ENST00000509807;ENST00000542068	T;T;T	0.48522	0.81;0.81;0.81	5.71	4.83	0.62350	Armadillo-type fold (1);	0.094562	0.85682	D	0.000000	T	0.61060	0.2317	M	0.86097	2.795	0.80722	D	1	P;P	0.42973	0.796;0.586	P;B	0.47206	0.541;0.098	T	0.64019	-0.6505	10	0.30854	T	0.27	-11.7312	16.1593	0.81686	0.0:0.0:0.8656:0.1344	.	306;274	B7Z1E5;Q92600	.;RCD1_HUMAN	L	274;306;274	ENSP00000273064:R274L;ENSP00000441357:R306L;ENSP00000443687:R274L	ENSP00000273064:R274L	R	+	2	0	RQCD1	219167164	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.800000	0.99124	1.404000	0.46819	0.591000	0.81541	CGC			0.582	RQCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000336920.1		NM_005444	
USP40	55230	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	234394589	234394589	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr2:234394589T>C	ENST00000427112.2	-	28	3264	c.3229A>G	c.(3229-3231)Atc>Gtc	p.I1077V	USP40_ENST00000251722.6_Missense_Mutation_p.I1077V|USP40_ENST00000450966.1_Missense_Mutation_p.I1089V|USP40_ENST00000496298.1_5'UTR			Q9NVE5	UBP40_HUMAN	ubiquitin specific peptidase 40	1077					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(1)|endometrium(6)|kidney(5)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		TCACCAGGGATGCGCACCTGT	0.597																																					p.I1089V													.	.			0			c.A3265G												13.0	15.0	14.0					2																	234394589		2007	4161	6168	SO:0001583	missense	55230	exon28			CAGGGATGCGCAC	AK001647	CCDS46547.1	2q37.1	2005-08-08	2005-08-08		ENSG00000085982	ENSG00000085982		"""Ubiquitin-specific peptidases"""	20069	protein-coding gene	gene with protein product		610570	"""ubiquitin specific protease 40"""			12838346	Standard	NM_018218		Approved	FLJ10785	uc010zmr.2	Q9NVE5	OTTHUMG00000153199	ENST00000427112.2:c.3229A>G	2.37:g.234394589T>C	ENSP00000387898:p.Ile1077Val		Somatic	140	0	0		WXS	Illumina HiSeq	.	114	0.10	11	NM_018218	1	0.00	0	Q6NX38|Q70EL0	Missense_Mutation	SNP	ENST00000427112.2	37	CCDS46547.1	.	.	.	.	.	.	.	.	.	.	T	6.380	0.438151	0.12104	.	.	ENSG00000085982	ENST00000450966;ENST00000251722;ENST00000427112	T;T;T	0.04970	3.52;3.52;3.52	5.61	2.04	0.26737	.	0.881642	0.09881	N	0.743733	T	0.03871	0.0109	N	0.16903	0.455	0.26270	N	0.97843	B	0.13145	0.007	B	0.12156	0.007	T	0.48736	-0.9009	10	0.09843	T	0.71	.	7.5396	0.27731	0.0:0.139:0.2721:0.5888	.	1089	Q9NVE5-3	.	V	1089;1077;1077	ENSP00000415434:I1089V;ENSP00000251722:I1077V;ENSP00000387898:I1077V	ENSP00000251722:I1077V	I	-	1	0	USP40	234059328	1.000000	0.71417	0.996000	0.52242	0.881000	0.50899	0.865000	0.27940	0.067000	0.16545	0.528000	0.53228	ATC			0.597	USP40-017	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000397235.1		XM_114294	
RBM44	375316	mdanderson.org	37	2	238738115	238738115	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr2:238738115G>T	ENST00000409864.1	+	13	3113	c.2859G>T	c.(2857-2859)gaG>gaT	p.E953D	RBM44_ENST00000316997.4_Missense_Mutation_p.E953D			Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44	952						cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)	nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)			breast(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(7)|ovary(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		TGGGTTCTGAGCAAGACAGTG	0.408																																					p.E953D													.	.			0			c.G2859T												108.0	107.0	108.0					2																	238738115		1861	4098	5959	SO:0001583	missense	375316	exon13			TTCTGAGCAAGAC	AK097730	CCDS46554.1	2q37.3	2013-02-12			ENSG00000177483	ENSG00000177483		"""RNA binding motif (RRM) containing"""	24756	protein-coding gene	gene with protein product							Standard	NM_001080504		Approved	FLJ40411	uc002vxi.4	Q6ZP01	OTTHUMG00000152937	ENST00000409864.1:c.2859G>T	2.37:g.238738115G>T	ENSP00000386727:p.Glu953Asp		Somatic	155	0	0		WXS	Illumina HiSeq	Phase_I	126	0.04	5	NM_001080504	0		0	A0AUW3	Missense_Mutation	SNP	ENST00000409864.1	37	CCDS46554.1	.	.	.	.	.	.	.	.	.	.	G	9.489	1.100294	0.20552	.	.	ENSG00000177483	ENST00000316997;ENST00000409864	T;T	0.28454	1.61;1.61	4.37	2.53	0.30540	.	.	.	.	.	T	0.37625	0.1010	M	0.72118	2.19	0.20489	N	0.999896	D	0.56035	0.974	P	0.49853	0.624	T	0.16070	-1.0415	9	0.42905	T	0.14	-6.3804	6.2143	0.20646	0.2289:0.0:0.7711:0.0	.	952	Q6ZP01	RBM44_HUMAN	D	953	ENSP00000321179:E953D;ENSP00000386727:E953D	ENSP00000321179:E953D	E	+	3	2	RBM44	238402854	1.000000	0.71417	0.988000	0.46212	0.053000	0.15095	1.360000	0.34125	0.962000	0.38057	-0.277000	0.10078	GAG			0.408	RBM44-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000328733.2		NM_001080504	
ZNF512B	57473	mdanderson.org	37	20	62595260	62595260	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr20:62595260G>T	ENST00000450537.1	-	9	1547	c.1487C>A	c.(1486-1488)cCt>cAt	p.P496H	ZNF512B_ENST00000369888.1_Missense_Mutation_p.P496H|ZNF512B_ENST00000217130.3_Missense_Mutation_p.P496H			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	496					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					CTGCTCTTCAGGGCCACCTGT	0.652																																					p.P496H													.	.			0			c.C1487A												40.0	43.0	42.0					20																	62595260		2203	4296	6499	SO:0001583	missense	57473	exon9			TCTTCAGGGCCAC	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.1487C>A	20.37:g.62595260G>T	ENSP00000393795:p.Pro496His		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_020713	0		0	Q08AK9|Q9ULM4	Missense_Mutation	SNP	ENST00000450537.1	37	CCDS13548.1	.	.	.	.	.	.	.	.	.	.	G	12.56	1.975832	0.34848	.	.	ENSG00000196700	ENST00000369888;ENST00000450537;ENST00000217130	T;T;T	0.25085	1.82;1.82;1.82	4.62	3.64	0.41730	.	0.465637	0.22147	N	0.063976	T	0.36608	0.0973	L	0.55481	1.735	0.29208	N	0.874766	D	0.69078	0.997	P	0.59012	0.85	T	0.15752	-1.0426	10	0.36615	T	0.2	-3.6184	8.9653	0.35872	0.0:0.1613:0.672:0.1666	.	496	Q96KM6	Z512B_HUMAN	H	496	ENSP00000358904:P496H;ENSP00000393795:P496H;ENSP00000217130:P496H	ENSP00000217130:P496H	P	-	2	0	ZNF512B	62065704	1.000000	0.71417	0.906000	0.35671	0.181000	0.23173	3.116000	0.50399	0.885000	0.36088	0.467000	0.42956	CCT			0.652	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080246.1		NM_020713	
KRTAP10-2	386679	mdanderson.org	37	21	45970730	45970730	+	Silent	SNP	C	C	A			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr21:45970730C>A	ENST00000391621.1	-	1	658	c.612G>T	c.(610-612)ggG>ggT	p.G204G	TSPEAR_ENST00000323084.4_Intron|KRTAP10-2_ENST00000498210.1_Intron|TSPEAR_ENST00000397916.1_Intron	NM_198693.2	NP_941966.1	P60368	KR102_HUMAN	keratin associated protein 10-2	204	22 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				large_intestine(1)|lung(4)|skin(1)	6						GAGAGGAAGCCCCAGAGCAAA	0.632																																					p.G204G													.	.			0			c.G612T												127.0	135.0	132.0					21																	45970730		2203	4300	6503	SO:0001819	synonymous_variant	386679	exon1			GGAAGCCCCAGAG	AJ566381	CCDS42955.1	21q22.3	2007-10-05			ENSG00000205445	ENSG00000205445		"""Keratin associated proteins"""	22967	protein-coding gene	gene with protein product				KRTAP18-2			Standard	NM_198693		Approved	KAP10.2, KAP18.2	uc002zfi.1	P60368	OTTHUMG00000057625	ENST00000391621.1:c.612G>T	21.37:g.45970730C>A			Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	62	0.05	3	NM_198693	2	0.00	0	Q70LJ5	Silent	SNP	ENST00000391621.1	37	CCDS42955.1																																																																																					0.632	KRTAP10-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000128027.1			
ANKRD54	129138	mdanderson.org	37	22	38240339	38240339	+	5'UTR	SNP	G	G	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr22:38240339G>T	ENST00000215941.4	-	0	99				ANKRD54_ENST00000406423.1_5'Flank|ANKRD54_ENST00000609454.1_Intron|MIR658_ENST00000385210.1_RNA|ANKRD54_ENST00000411961.2_5'Flank	NM_138797.2	NP_620152.1	Q6NXT1	ANR54_HUMAN	ankyrin repeat domain 54						nucleocytoplasmic transport (GO:0006913)|positive regulation of erythrocyte differentiation (GO:0045648)|regulation of intracellular signal transduction (GO:1902531)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)	protein kinase regulator activity (GO:0019887)			lung(1)	1	Melanoma(58;0.045)					CTGTCAGCGAGCTGGCGGGCG	0.701																																					.													.	.			0			.												12.0	16.0	15.0					22																	38240339		1555	3576	5131	SO:0001623	5_prime_UTR_variant	724028	.			CAGCGAGCTGGCG	BC014641	CCDS13959.1	22q13.1	2013-01-10			ENSG00000100124	ENSG00000100124		"""Ankyrin repeat domain containing"""	25185	protein-coding gene	gene with protein product		613383				15461802	Standard	NM_138797		Approved	LIAR	uc003auc.3	Q6NXT1	OTTHUMG00000150663	ENST00000215941.4:c.-94C>A	22.37:g.38240339G>T			Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	23	0.13	3	.	1	0.00	0	Q6ZSB1|Q9UGV1	RNA	SNP	ENST00000215941.4	37	CCDS13959.1																																																																																					0.701	ANKRD54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319490.1		NM_138797	
CPT1B	1375	mdanderson.org	37	22	51016211	51016211	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr22:51016211C>T	ENST00000360719.2	-	2	271	c.134G>A	c.(133-135)cGc>cAc	p.R45H	CHKB-CPT1B_ENST00000452668.1_5'Flank|CPT1B_ENST00000395650.2_Missense_Mutation_p.R45H|CPT1B_ENST00000440709.1_Missense_Mutation_p.R45H|CHKB-CPT1B_ENST00000453634.1_3'UTR|CPT1B_ENST00000434492.2_5'UTR|CPT1B_ENST00000312108.7_Missense_Mutation_p.R45H|CPT1B_ENST00000457250.1_Missense_Mutation_p.R45H|CPT1B_ENST00000405237.3_Missense_Mutation_p.R45H|CHKB_ENST00000463053.1_5'Flank	NM_001145135.1|NM_152245.2	NP_001138607.1|NP_689451.1	Q92523	CPT1B_HUMAN	carnitine palmitoyltransferase 1B (muscle)	45					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)		CACCTTGATGCGGATCAGGCG	0.607																																					p.R45H	Esophageal Squamous(170;988 1933 25577 30295 48163)												.	.			0			c.G134A												99.0	87.0	91.0					22																	51016211		2203	4300	6503	SO:0001583	missense	1375	exon2			TTGATGCGGATCA	U62733	CCDS14098.1, CCDS46734.1	22q13.33	2007-07-26			ENSG00000205560	ENSG00000205560			2329	protein-coding gene	gene with protein product		601987				9070950	Standard	NM_152245		Approved	M-CPT1, CPT1-M	uc003bmm.3	Q92523	OTTHUMG00000137390	ENST00000360719.2:c.134G>A	22.37:g.51016211C>T	ENSP00000353945:p.Arg45His		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	58	0.05	3	NM_001145135	8	0.00	0	B7Z4U4|B7Z5T8|E9PCP2|Q13389|Q99655|Q9BY90	Missense_Mutation	SNP	ENST00000360719.2	37	CCDS14098.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.252331	0.80135	.	.	ENSG00000205560	ENST00000405237;ENST00000312108;ENST00000360719;ENST00000457250;ENST00000440709;ENST00000395650;ENST00000417176	D;D;D;D;D;D;T	0.87029	-2.08;-2.08;-2.08;-2.2;-2.15;-2.08;-0.42	5.11	5.11	0.69529	.	0.157513	0.42172	D	0.000746	D	0.92361	0.7576	M	0.81942	2.565	0.80722	D	1	D;D;D	0.89917	0.999;0.993;1.0	P;P;D	0.66084	0.869;0.852;0.941	D	0.92699	0.6173	10	0.59425	D	0.04	-22.0397	11.8511	0.52412	0.0:0.8231:0.1769:0.0	.	45;45;45	E9PCP2;B7Z4U4;Q92523	.;.;CPT1B_HUMAN	H	45	ENSP00000385486:R45H;ENSP00000312189:R45H;ENSP00000353945:R45H;ENSP00000409342:R45H;ENSP00000414713:R45H;ENSP00000379011:R45H;ENSP00000406316:R45H	ENSP00000312189:R45H	R	-	2	0	CPT1B	49363077	0.987000	0.35691	1.000000	0.80357	0.922000	0.55478	2.628000	0.46477	2.378000	0.81104	0.561000	0.74099	CGC			0.607	CPT1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000317264.5		NM_152246	
SLC4A7	9497	mdanderson.org	37	3	27493948	27493948	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr3:27493948G>T	ENST00000295736.5	-	2	145	c.75C>A	c.(73-75)agC>agA	p.S25R	SLC4A7_ENST00000388777.4_5'UTR|SLC4A7_ENST00000445684.1_Missense_Mutation_p.S34R|SLC4A7_ENST00000425128.2_Missense_Mutation_p.S30R|SLC4A7_ENST00000440156.1_Missense_Mutation_p.S34R|SLC4A7_ENST00000437179.1_Missense_Mutation_p.S30R|SLC4A7_ENST00000454389.1_Missense_Mutation_p.S34R|SLC4A7_ENST00000455077.1_Missense_Mutation_p.S30R|SLC4A7_ENST00000446700.1_Missense_Mutation_p.S30R|SLC4A7_ENST00000435667.2_Missense_Mutation_p.S34R|SLC4A7_ENST00000428386.1_Missense_Mutation_p.S25R	NM_003615.4	NP_003606.3	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 7	25					auditory receptor cell development (GO:0060117)|bicarbonate transport (GO:0015701)|cochlear nucleus development (GO:0021747)|ion transport (GO:0006811)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal cell programmed cell death (GO:0046666)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(9)|ovary(4)|skin(1)	38					Sodium bicarbonate(DB01390)	TCACAGTTGAGCTAGTTTTGC	0.318																																					p.S30R													.	.			0			c.C90A												109.0	101.0	104.0					3																	27493948		2203	4299	6502	SO:0001583	missense	9497	exon2			AGTTGAGCTAGTT	AB012130	CCDS33721.1, CCDS58819.1, CCDS58820.1	3p24.1	2013-05-22			ENSG00000033867	ENSG00000033867		"""Solute carriers"""	11033	protein-coding gene	gene with protein product		603353		SLC4A6		10198178, 9610397	Standard	NM_003615		Approved	NBC3, SBC2	uc003cdv.4	Q9Y6M7	OTTHUMG00000155679	ENST00000295736.5:c.75C>A	3.37:g.27493948G>T	ENSP00000295736:p.Ser25Arg		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_001258379	0		0	A6NIA8|B2CI53|B5M449|B5M451|B5M452|B5M453|B6DY52|B6DY53|C9JST9|D3K174|D3K175|O60350|Q6AHZ9|Q9HC88|Q9UIB9	Missense_Mutation	SNP	ENST00000295736.5	37	CCDS33721.1	.	.	.	.	.	.	.	.	.	.	G	7.904	0.735109	0.15574	.	.	ENSG00000033867	ENST00000295736;ENST00000428386;ENST00000454389;ENST00000440156;ENST00000437179;ENST00000446700;ENST00000455077;ENST00000445684;ENST00000435667;ENST00000425128;ENST00000428179	T;T;T;T;T;T;T;T;T;T;T	0.78816	-1.1;-1.12;-1.1;-1.19;-1.12;-1.21;-1.12;-1.19;-1.12;0.3;-1.12	5.55	2.4	0.29515	.	0.042030	0.85682	D	0.000000	T	0.59542	0.2201	N	0.25286	0.73	0.47276	D	0.999375	B;B;B;P;B;B;B;B;B	0.45902	0.381;0.0;0.381;0.868;0.392;0.017;0.001;0.392;0.0	B;B;B;B;B;B;B;B;B	0.40477	0.193;0.004;0.193;0.33;0.084;0.029;0.004;0.084;0.004	T	0.52411	-0.8579	10	0.25106	T	0.35	.	7.2363	0.26072	0.4148:0.0:0.5852:0.0	.	34;30;30;34;34;30;25;25;30	E9PFN4;B5M452;E9PGC1;B5M453;E9PDL9;B6DY53;Q9Y6M7-2;Q9Y6M7;B2CI53	.;.;.;.;.;.;.;S4A7_HUMAN;.	R	25;25;34;34;30;30;30;34;34;30;25	ENSP00000295736:S25R;ENSP00000416368:S25R;ENSP00000390394:S34R;ENSP00000414797:S34R;ENSP00000394252:S30R;ENSP00000406605:S30R;ENSP00000407382:S30R;ENSP00000406804:S34R;ENSP00000395336:S34R;ENSP00000401949:S30R;ENSP00000388703:S25R	ENSP00000295736:S25R	S	-	3	2	SLC4A7	27468952	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.584000	0.46102	0.711000	0.32018	0.591000	0.81541	AGC			0.318	SLC4A7-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000341230.2		NM_003615	
ACTR8	93973	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	53910015	53910015	+	Missense_Mutation	SNP	C	C	T	rs375966881		TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr3:53910015C>T	ENST00000335754.3	-	7	971	c.871G>A	c.(871-873)Gta>Ata	p.V291I	ACTR8_ENST00000482349.1_Missense_Mutation_p.V180I|ACTR8_ENST00000231909.7_Missense_Mutation_p.V41I	NM_022899.4	NP_075050.3	Q9H981	ARP8_HUMAN	ARP8 actin-related protein 8 homolog (yeast)	291					chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	ATP binding (GO:0005524)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.000143)|KIRC - Kidney renal clear cell carcinoma(284;0.00544)|Kidney(284;0.00607)|OV - Ovarian serous cystadenocarcinoma(275;0.111)		ACACAGCATACACTTGTCTTC	0.517																																					p.V291I													.	.			0			c.G871A							C	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	174.0	157.0	163.0		871	4.1	0.1	3		163	0,8600		0,0,4300	no	missense	ACTR8	NM_022899.4	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	291/625	53910015	1,13005	2203	4300	6503	SO:0001583	missense	93973	exon7			AGCATACACTTGT		CCDS2875.1	3p21.31	2011-07-06	2001-11-28		ENSG00000113812	ENSG00000113812		"""INO80 complex subunits"""	14672	protein-coding gene	gene with protein product	"""INO80 complex subunit N"""		"""ARP8 (actin-related protein 8, yeast) homolog"""			18163988, 16230350	Standard	NM_022899		Approved	INO80N	uc003dhd.3	Q9H981	OTTHUMG00000158279	ENST00000335754.3:c.871G>A	3.37:g.53910015C>T	ENSP00000336842:p.Val291Ile		Somatic	192	0	0		WXS	Illumina HiSeq	.	159	0.15	24	NM_022899	25	0.36	9	B3KSW7|Q8N566|Q9H663	Missense_Mutation	SNP	ENST00000335754.3	37	CCDS2875.1	.	.	.	.	.	.	.	.	.	.	C	4.055	0.007850	0.07866	2.27E-4	0.0	ENSG00000113812	ENST00000335754;ENST00000482349;ENST00000231909	D;D;D	0.97941	-3.81;-3.81;-4.62	5.87	4.09	0.47781	.	0.209938	0.42172	N	0.000747	D	0.90745	0.7095	N	0.03967	-0.31	0.24058	N	0.996026	B;B	0.10296	0.003;0.0	B;B	0.19946	0.027;0.001	T	0.80587	-0.1316	10	0.14252	T	0.57	7.6953	9.5325	0.39202	0.0:0.7857:0.0:0.2143	.	291;41	Q9H981;Q9H981-3	ARP8_HUMAN;.	I	291;180;41	ENSP00000336842:V291I;ENSP00000419429:V180I;ENSP00000231909:V41I	ENSP00000231909:V41I	V	-	1	0	ACTR8	53885055	0.103000	0.21917	0.093000	0.20910	0.729000	0.41735	0.584000	0.23864	0.945000	0.37605	0.655000	0.94253	GTA			0.517	ACTR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350562.2		NM_022899	
LEKR1	389170	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	156763256	156763256	+	Missense_Mutation	SNP	C	C	A	rs150686576		TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr3:156763256C>A	ENST00000470811.1	+	14	2219	c.884C>A	c.(883-885)cCg>cAg	p.P295Q	LEKR1_ENST00000356539.4_Missense_Mutation_p.P599Q			Q6ZMV7	LEKR1_HUMAN	leucine, glutamate and lysine rich 1	295										breast(1)|large_intestine(5)|lung(3)|ovary(1)|skin(1)	11			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			CCATTCTCACCGTGTTCCCTC	0.493																																					p.P599Q													.	LEKR1	66		0			c.C1796A												93.0	93.0	93.0					3																	156763256		2203	4300	6503	SO:0001583	missense	389170	exon13			TCTCACCGTGTTC	AK131473	CCDS54660.1	3q25.31	2014-02-12	2008-02-21		ENSG00000197980	ENSG00000197980			33765	protein-coding gene	gene with protein product		613536					Standard	NM_001004316		Approved	FLJ16641	uc021xgh.1	Q6ZMV7	OTTHUMG00000160130	ENST00000470811.1:c.884C>A	3.37:g.156763256C>A	ENSP00000418214:p.Pro295Gln		Somatic	162	0.0061728395	1		WXS	Illumina HiSeq	Phase_I	146	0.10	14	NM_001004316	0		0		Missense_Mutation	SNP	ENST00000470811.1	37		.	.	.	.	.	.	.	.	.	.	C	0.034	-1.314969	0.01331	.	.	ENSG00000178110	ENST00000470811;ENST00000356539	T;T	0.39406	1.08;1.08	4.96	1.88	0.25563	.	0.365474	0.23300	N	0.049700	T	0.30792	0.0776	L	0.54323	1.7	0.09310	N	1	B	0.33883	0.43	B	0.35240	0.198	T	0.13818	-1.0495	10	0.12430	T	0.62	-2.6342	5.2316	0.15424	0.1908:0.511:0.2211:0.077	.	295	Q6ZMV7	LEKR1_HUMAN	Q	295;599	ENSP00000418214:P295Q;ENSP00000348936:P599Q	ENSP00000348936:P599Q	P	+	2	0	LEKR1	158245950	0.000000	0.05858	0.015000	0.15790	0.418000	0.31294	-0.246000	0.08878	0.479000	0.27511	0.655000	0.94253	CCG			0.493	LEKR1-010	KNOWN	upstream_ATG|basic	protein_coding	protein_coding		OTTHUMT00000351625.3		NM_001004316	
LYAR	55646	mdanderson.org	37	4	4285380	4285380	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr4:4285380G>T	ENST00000343470.4	-	3	330	c.90C>A	c.(88-90)tgC>tgA	p.C30*	LYAR_ENST00000452476.1_Nonsense_Mutation_p.C30*	NM_017816.2	NP_060286	Q9NX58	LYAR_HUMAN	Ly1 antibody reactive	30						nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(6)|liver(2)|lung(5)|ovary(1)|prostate(1)	17				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TGCAAGAAAGGCATTCACAGT	0.383																																					p.C30X													.	.			0			c.C90A												104.0	93.0	97.0					4																	4285380		2203	4300	6503	SO:0001587	stop_gained	55646	exon3			AGAAAGGCATTCA	AL136750	CCDS3374.1	4p16.3	2013-01-10	2012-12-07		ENSG00000145220	ENSG00000145220		"""Zinc fingers, C2HC-type containing"""	26021	protein-coding gene	gene with protein product			"""Ly1 antibody reactive homolog (mouse)"""			11230166, 8491376	Standard	NM_001145725		Approved	ZC2HC2, ZLYAR	uc003ght.3	Q9NX58	OTTHUMG00000125477	ENST00000343470.4:c.90C>A	4.37:g.4285380G>T	ENSP00000345917:p.Cys30*		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	29	0.10	3	NM_001145725	103	0.00	0	D3DVS4|Q6FI78|Q9NYS1	Nonsense_Mutation	SNP	ENST00000343470.4	37	CCDS3374.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.273871	0.80580	.	.	ENSG00000145220	ENST00000343470;ENST00000452476;ENST00000513174	.	.	.	5.29	1.41	0.22369	.	0.141504	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-9.574	8.7146	0.34403	0.5312:0.0:0.4688:0.0	.	.	.	.	X	30	.	ENSP00000345917:C30X	C	-	3	2	LYAR	4336281	1.000000	0.71417	0.339000	0.25562	0.622000	0.37654	0.724000	0.25954	0.192000	0.20272	0.591000	0.81541	TGC			0.383	LYAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000246800.2		NM_017816	
BMP2K	55589	broad.mit.edu	37	4	79792085	79792085	+	Missense_Mutation	SNP	G	G	C	rs376418550	byFrequency	TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr4:79792085G>C	ENST00000335016.5	+	11	1546	c.1380G>C	c.(1378-1380)caG>caC	p.Q460H	BMP2K_ENST00000502871.1_Missense_Mutation_p.Q460H	NM_198892.1	NP_942595.1	Q9NSY1	BMP2K_HUMAN	BMP2 inducible kinase	460	Gln/His-rich.				regulation of bone mineralization (GO:0030500)	nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatase regulator activity (GO:0019208)|protein serine/threonine kinase activity (GO:0004674)	p.Q460H(3)		NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	13						ATCCTCACcagcagcagcagc	0.577																																					p.Q460H													BMP2K_ENST00000502871,NS,carcinoma,0,7	BMP2K	169	7	3	Substitution - Missense(3)	endometrium(2)|prostate(1)	c.G1380C												40.0	45.0	44.0					4																	79792085		2203	4300	6503	SO:0001583	missense	55589	exon11			TCACCAGCAGCAG	AB015331	CCDS34019.1, CCDS47083.1	4q21.21	2008-05-15			ENSG00000138756	ENSG00000138756			18041	protein-coding gene	gene with protein product							Standard	NM_017593		Approved	DKFZp434K0614, BIKe	uc003hlk.3	Q9NSY1	OTTHUMG00000160900	ENST00000335016.5:c.1380G>C	4.37:g.79792085G>C	ENSP00000334836:p.Gln460His		Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	47	0.09	4	NM_017593	3	0.00	0	O94791|Q4W5H2|Q8IYF2|Q8N2G7|Q8NHG9|Q9NTG8	Missense_Mutation	SNP	ENST00000335016.5	37	CCDS47083.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.089|8.089	0.774118|0.774118	0.16051|0.16051	.|.	.|.	ENSG00000138756|ENSG00000138756	ENST00000502613|ENST00000502871;ENST00000335016;ENST00000264889	.|T;T	.|0.74002	.|0.79;-0.8	5.12|5.12	2.26|2.26	0.28386|0.28386	.|.	.|1.238260	.|0.06146	.|N	.|0.673324	T|T	0.57504|0.57504	0.2058|0.2058	N|N	0.15975|0.15975	0.35|0.35	0.30181|0.30181	N|N	0.800383|0.800383	.|B;B	.|0.06786	.|0.001;0.0	.|B;B	.|0.04013	.|0.001;0.001	T|T	0.51803|0.51803	-0.8659|-0.8659	5|10	.|0.42905	.|T	.|0.14	0.0809|0.0809	5.9141|5.9141	0.19045|0.19045	0.0722:0.2493:0.5501:0.1284|0.0722:0.2493:0.5501:0.1284	.|.	.|460;460	.|Q9NSY1;Q4W5H2	.|BMP2K_HUMAN;.	P|H	153|460;460;474	.|ENSP00000421768:Q460H;ENSP00000334836:Q460H	.|ENSP00000264889:Q474H	A|Q	+|+	1|3	0|2	BMP2K|BMP2K	80011109|80011109	0.996000|0.996000	0.38824|0.38824	0.995000|0.995000	0.50966|0.50966	0.181000|0.181000	0.23173|0.23173	0.092000|0.092000	0.15066|0.15066	0.524000|0.524000	0.28502|0.28502	0.460000|0.460000	0.39030|0.39030	GCA|CAG			0.577	BMP2K-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				NM_017593	
TRIM23	373	broad.mit.edu	37	5	64905170	64905170	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr5:64905170C>T	ENST00000231524.9	-	6	1315	c.944G>A	c.(943-945)cGt>cAt	p.R315H	TRIM23_ENST00000508808.1_5'UTR|TRIM23_ENST00000274327.7_Missense_Mutation_p.R315H|TRIM23_ENST00000381018.3_Missense_Mutation_p.R315H	NM_001656.3	NP_001647.1	P36406	TRI23_HUMAN	tripartite motif containing 23	315					GTP catabolic process (GO:0006184)|positive regulation of catalytic activity (GO:0043085)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	enzyme activator activity (GO:0008047)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	28		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Breast(144;0.0433)|Ovarian(174;0.0545)|Colorectal(97;0.234)		Lung(70;0.00473)		CAATTTTTCACGAACATGAGC	0.418																																					p.R315H													.	TRIM23	73		0			c.G944A												121.0	111.0	114.0					5																	64905170		2203	4300	6503	SO:0001583	missense	373	exon6			TTTTCACGAACAT	L04510	CCDS3986.1, CCDS3987.1, CCDS43322.1	5q12.3	2013-01-09	2011-01-25	2004-06-04	ENSG00000113595	ENSG00000113595		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	660	protein-coding gene	gene with protein product		601747	"""ADP-ribosylation factor domain protein 1, 64kDa"", ""tripartite motif-containing 23"""	ARFD1		8473324	Standard	NM_001656		Approved	ARD1, RNF46	uc003jty.3	P36406	OTTHUMG00000097802	ENST00000231524.9:c.944G>A	5.37:g.64905170C>T	ENSP00000231524:p.Arg315His		Somatic	265	0	0		WXS	Illumina HiSeq	Phase_I	227	0.03	6	NM_033228	0		0	Q9BZY4|Q9BZY5	Missense_Mutation	SNP	ENST00000231524.9	37	CCDS3987.1	.	.	.	.	.	.	.	.	.	.	C	31	5.101218	0.94245	.	.	ENSG00000113595	ENST00000231524;ENST00000381018;ENST00000274327	T;T;T	0.75367	-0.84;-0.84;-0.93	5.39	5.39	0.77823	B-box, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.85270	0.5658	M	0.61703	1.905	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.999;0.998	D	0.85178	0.1002	10	0.54805	T	0.06	.	19.5154	0.95162	0.0:1.0:0.0:0.0	.	315;315;315	P36406;P36406-2;P36406-3	TRI23_HUMAN;.;.	H	315	ENSP00000231524:R315H;ENSP00000370406:R315H;ENSP00000274327:R315H	ENSP00000231524:R315H	R	-	2	0	TRIM23	64940926	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.445000	0.80570	2.685000	0.91497	0.655000	0.94253	CGT			0.418	TRIM23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000215058.2		NM_001656	
PCDHB4	56131	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140501959	140501959	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr5:140501959G>T	ENST00000194152.1	+	1	379	c.379G>T	c.(379-381)Gat>Tat	p.D127Y	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	127	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGACATAAATGATCACTCTCC	0.423																																					p.D127Y													.	PCDHB4	177		0			c.G379T												51.0	58.0	56.0					5																	140501959		2203	4299	6502	SO:0001583	missense	0	exon1			ATAAATGATCACT	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.379G>T	5.37:g.140501959G>T	ENSP00000194152:p.Asp127Tyr		Somatic	127	0.0078740157	1		WXS	Illumina HiSeq	Phase_I	126	0.21	27	NM_018938	0		0	Q4V761	Missense_Mutation	SNP	ENST00000194152.1	37	CCDS4246.1	.	.	.	.	.	.	.	.	.	.	G	19.98	3.927216	0.73327	.	.	ENSG00000081818	ENST00000194152	T	0.54866	0.55	4.56	4.56	0.56223	Cadherin (1);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	D	0.84902	0.5575	H	0.99415	4.555	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	D	0.91889	0.5522	9	0.87932	D	0	.	17.486	0.87688	0.0:0.0:1.0:0.0	.	127	Q9Y5E5	PCDB4_HUMAN	Y	127	ENSP00000194152:D127Y	ENSP00000194152:D127Y	D	+	1	0	PCDHB4	140482143	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.535000	0.98064	2.513000	0.84729	0.655000	0.94253	GAT			0.423	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251812.2		NM_018938	
FAM114A2	10827	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	153381928	153381928	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr5:153381928C>T	ENST00000351797.4	-	11	1215	c.1139G>A	c.(1138-1140)cGg>cAg	p.R380Q	FAM114A2_ENST00000520667.1_Missense_Mutation_p.R380Q|FAM114A2_ENST00000520313.1_Missense_Mutation_p.R310Q|FAM114A2_ENST00000522858.1_Missense_Mutation_p.R380Q	NM_018691.2	NP_061161.2	Q9NRY5	F1142_HUMAN	family with sequence similarity 114, member A2	380							purine nucleotide binding (GO:0017076)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|skin(1)|urinary_tract(1)	18						AGCCAGGCTCCGGATTGCAAA	0.443																																					p.R380Q													.	.			0			c.G1139A												103.0	98.0	99.0					5																	153381928		2203	4300	6503	SO:0001583	missense	10827	exon11			AGGCTCCGGATTG	AF159700	CCDS4323.1	5q31-q33	2008-06-13	2008-06-13	2008-06-13	ENSG00000055147	ENSG00000055147			1333	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 3"""	C5orf3		10843801	Standard	XM_005268359		Approved	133K02	uc003lvc.3	Q9NRY5	OTTHUMG00000130147	ENST00000351797.4:c.1139G>A	5.37:g.153381928C>T	ENSP00000341597:p.Arg380Gln		Somatic	163	0	0		WXS	Illumina HiSeq	.	174	0.05	9	NM_018691	14	0.07	1	B2R8D8|Q9H7E0	Missense_Mutation	SNP	ENST00000351797.4	37	CCDS4323.1	.	.	.	.	.	.	.	.	.	.	C	14.67	2.605910	0.46527	.	.	ENSG00000055147	ENST00000351797;ENST00000522858;ENST00000520667;ENST00000520313	T;T;T;T	0.17054	2.55;2.55;2.55;2.3	5.98	3.89	0.44902	.	0.183717	0.45867	D	0.000337	T	0.12178	0.0296	L	0.38838	1.175	0.29831	N	0.830052	B;B	0.31435	0.323;0.187	B;B	0.19946	0.027;0.023	T	0.08597	-1.0714	10	0.23302	T	0.38	-1.0568	12.7212	0.57144	0.0:0.8393:0.0:0.1607	.	310;380	E7ESJ7;Q9NRY5	.;F1142_HUMAN	Q	380;380;380;310	ENSP00000341597:R380Q;ENSP00000430489:R380Q;ENSP00000430384:R380Q;ENSP00000429088:R310Q	ENSP00000341597:R380Q	R	-	2	0	FAM114A2	153362121	0.997000	0.39634	0.965000	0.40720	0.940000	0.58332	1.836000	0.39191	1.526000	0.49068	0.655000	0.94253	CGG			0.443	FAM114A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252455.1		NM_018691	
RP11-436D23.1	0	broad.mit.edu	37	6	98472767	98472767	+	lincRNA	DEL	A	A	-			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr6:98472767delA	ENST00000607823.1	+	0	267				MIR2113_ENST00000459007.1_RNA																							CCGAATATGTAAAAAAAAAAT	0.279																																					.													.	.			0			.																																											0	.			ATATGTAAAAAAA																													6.37:g.98472767delA			Somatic	10	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	DEL	ENST00000607823.1	37																																																																																						0.279	RP11-436D23.1-003	KNOWN	not_organism_supported|basic	lincRNA	lincRNA		OTTHUMT00000471318.1			
PRKAR1B	5575	mdanderson.org	37	7	624155	624155	+	Silent	SNP	G	G	T	rs567546251		TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr7:624155G>T	ENST00000406797.1	-	8	933	c.759C>A	c.(757-759)gtC>gtA	p.V253V	PRKAR1B_ENST00000403562.1_Silent_p.V253V|PRKAR1B_ENST00000537384.1_Silent_p.V253V|PRKAR1B_ENST00000544935.1_Silent_p.V253V|PRKAR1B_ENST00000360274.4_Silent_p.V253V	NM_001164761.1	NP_001158233.1	P31321	KAP1_HUMAN	protein kinase, cAMP-dependent, regulatory, type I, beta	253					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)			endometrium(4)|large_intestine(1)|liver(1)|lung(10)|prostate(1)	17		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|Epithelial(4;5.75e-19)|OV - Ovarian serous cystadenocarcinoma(56;2.01e-18)|all cancers(6;3.96e-16)|BRCA - Breast invasive adenocarcinoma(126;0.152)		CTAGGATGGAGACCTTGCTGA	0.587																																					p.V253V													.	.			0			c.C759A												146.0	104.0	118.0					7																	624155		2202	4295	6497	SO:0001819	synonymous_variant	5575	exon8			GATGGAGACCTTG	M65066	CCDS34579.1	7p22.3	2013-09-19			ENSG00000188191	ENSG00000188191	2.7.11.1		9390	protein-coding gene	gene with protein product		176911				1358799, 3479018	Standard	NM_002735		Approved		uc003siw.2	P31321	OTTHUMG00000151411	ENST00000406797.1:c.759C>A	7.37:g.624155G>T			Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_002735	208	0.00	0	Q8N422	Silent	SNP	ENST00000406797.1	37	CCDS34579.1	.	.	.	.	.	.	.	.	.	.	G	9.989	1.230184	0.22542	.	.	ENSG00000188191	ENST00000400758	.	.	.	4.96	3.07	0.35406	.	.	.	.	.	T	0.68650	0.3024	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.65809	-0.6078	4	.	.	.	-0.2254	14.0029	0.64444	0.0:0.2898:0.7102:0.0	.	.	.	.	Y	114	.	.	S	-	2	0	PRKAR1B	590681	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.030000	0.41108	0.453000	0.26858	-0.196000	0.12772	TCT			0.587	PRKAR1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000322525.1			
CARD11	84433	mdanderson.org	37	7	2962882	2962882	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr7:2962882G>T	ENST00000396946.4	-	16	2429	c.2026C>A	c.(2026-2028)Ctc>Atc	p.L676I		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	676	PDZ.				Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		TGGGAGGTGAGGCTGTCGCCA	0.687			Mis		DLBCL																																p.L676I				Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	.	.			0			c.C2026A												43.0	45.0	45.0					7																	2962882		2203	4298	6501	SO:0001583	missense	84433	exon16			AGGTGAGGCTGTC	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.2026C>A	7.37:g.2962882G>T	ENSP00000380150:p.Leu676Ile		Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	31	0.10	3	NM_032415	18	0.00	0	A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	37	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	G	19.29	3.799637	0.70567	.	.	ENSG00000198286	ENST00000396946;ENST00000355508	T;T	0.51817	0.69;0.69	4.89	4.01	0.46588	PDZ/DHR/GLGF (1);	0.072889	0.56097	D	0.000027	T	0.56877	0.2015	L	0.39898	1.24	0.54753	D	0.999988	D	0.89917	1.0	D	0.74348	0.983	T	0.57010	-0.7884	10	0.54805	T	0.06	-24.7458	11.3124	0.49372	0.0851:0.0:0.9149:0.0	.	676	Q9BXL7	CAR11_HUMAN	I	676;147	ENSP00000380150:L676I;ENSP00000347695:L147I	ENSP00000347695:L147I	L	-	1	0	CARD11	2929408	1.000000	0.71417	0.040000	0.18447	0.443000	0.32047	7.407000	0.80029	1.068000	0.40764	0.555000	0.69702	CTC			0.687	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000059344.4		NM_032415	
MPP6	51678	mdanderson.org	37	7	24705705	24705705	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr7:24705705G>T	ENST00000222644.5	+	8	1199	c.949G>T	c.(949-951)Gca>Tca	p.A317S	MPP6_ENST00000396475.2_Missense_Mutation_p.A317S|MPP6_ENST00000409761.1_Missense_Mutation_p.A205S			Q99547	MPH6_HUMAN	membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)	0					maturation of 5.8S rRNA (GO:0000460)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|pancreas(1)|skin(2)	20						AACCAGAAATGCAGGTAGGTT	0.318																																					p.A317S													.	.			0			c.G949T												86.0	100.0	96.0					7																	24705705		2189	4294	6483	SO:0001583	missense	51678	exon9			AGAAATGCAGGTA	AF162130	CCDS5388.1	7p15	2007-08-01			ENSG00000105926	ENSG00000105926			18167	protein-coding gene	gene with protein product		606959				10753959, 11311936	Standard	NM_016447		Approved	PALS2, VAM-1, p55T	uc003swx.3	Q9NZW5	OTTHUMG00000023507	ENST00000222644.5:c.949G>T	7.37:g.24705705G>T	ENSP00000222644:p.Ala317Ser		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_016447	1	0.00	0	B2RAF0	Missense_Mutation	SNP	ENST00000222644.5	37	CCDS5388.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.298052	0.81025	.	.	ENSG00000105926	ENST00000222644;ENST00000409761;ENST00000396475	D;D;D	0.81739	-1.53;-1.53;-1.53	5.32	4.43	0.53597	Src homology-3 domain (1);	0.000000	0.53938	D	0.000051	T	0.73606	0.3608	L	0.53617	1.68	0.80722	D	1	P	0.37824	0.609	B	0.33690	0.168	T	0.70483	-0.4859	10	0.10636	T	0.68	.	15.9924	0.80217	0.0:0.135:0.865:0.0	.	317	Q9NZW5	MPP6_HUMAN	S	317;205;317	ENSP00000222644:A317S;ENSP00000386262:A205S;ENSP00000379737:A317S	ENSP00000222644:A317S	A	+	1	0	MPP6	24672230	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.794000	0.85869	1.216000	0.43427	0.591000	0.81541	GCA			0.318	MPP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250272.4			
TRRAP	8295	broad.mit.edu	37	7	98601961	98601961	+	Silent	SNP	G	G	A	rs377353131		TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr7:98601961G>A	ENST00000359863.4	+	67	10625	c.10416G>A	c.(10414-10416)tcG>tcA	p.S3472S	TRRAP_ENST00000355540.3_Silent_p.S3443S|TRRAP_ENST00000446306.3_Silent_p.S3461S	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	3472					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GCAATTTCTCGGCACAGACAG	0.478																																					p.S3472S													TRRAP_ENST00000359863,NS,carcinoma,+1,2	TRRAP	863	2	0			c.G10416A							G		1,4405	2.1+/-5.4	0,1,2202	90.0	98.0	95.0		10329	-10.9	0.0	7		95	0,8600		0,0,4300	no	coding-synonymous	TRRAP	NM_003496.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		3443/3831	98601961	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8295	exon67			TTTCTCGGCACAG	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.10416G>A	7.37:g.98601961G>A			Somatic	145	0	0		WXS	Illumina HiSeq	Phase_I	196	0.03	5	NM_001244580	21	0.05	1	A4D265|O75218|Q9Y631|Q9Y6H4	Silent	SNP	ENST00000359863.4	37	CCDS59066.1	.	.	.	.	.	.	.	.	.	.	G	4.110	0.018566	0.07959	2.27E-4	0.0	ENSG00000196367	ENST00000456197	.	.	.	5.46	-10.9	0.00192	.	.	.	.	.	T	0.32041	0.0816	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45131	-0.9282	4	.	.	.	.	1.7594	0.02989	0.4213:0.1249:0.2562:0.1976	.	.	.	.	Q	3201	.	.	R	+	2	0	TRRAP	98439897	0.000000	0.05858	0.044000	0.18714	0.719000	0.41307	-2.136000	0.01305	-3.430000	0.00165	-1.774000	0.00658	CGG			0.478	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000317978.1	rescued with RNA-seq	NM_003496	
TMEM55A	55529	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	92033608	92033608	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr8:92033608G>T	ENST00000285419.3	-	2	445	c.131C>A	c.(130-132)gCc>gAc	p.A44D	GS1-251I9.3_ENST00000517920.1_RNA	NM_018710.2	NP_061180.1	Q8N4L2	TM55A_HUMAN	transmembrane protein 55A	44						endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			breast(1)|endometrium(2)|large_intestine(5)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	13			BRCA - Breast invasive adenocarcinoma(11;0.033)			ACTGGCAATGGCTGTATATGG	0.443																																					p.A44D													.	.			0			c.C131A												109.0	104.0	106.0					8																	92033608		2203	4300	6503	SO:0001583	missense	55529	exon2			GCAATGGCTGTAT	BC033892	CCDS6252.1	8q21.3	2005-08-09			ENSG00000155099	ENSG00000155099			25452	protein-coding gene	gene with protein product		609864				12477932	Standard	NM_018710		Approved	DKFZp762O076	uc003yes.3	Q8N4L2	OTTHUMG00000164019	ENST00000285419.3:c.131C>A	8.37:g.92033608G>T	ENSP00000285419:p.Ala44Asp		Somatic	49	0	0		WXS	Illumina HiSeq	.	56	0.16	9	NM_018710	5	0.00	0	B2R9H4|Q68CU2	Missense_Mutation	SNP	ENST00000285419.3	37	CCDS6252.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.027229	0.93518	.	.	ENSG00000155099	ENST00000285419;ENST00000520014	.	.	.	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.65780	0.2724	N	0.22421	0.69	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.66610	-0.5880	9	0.48119	T	0.1	-7.1517	19.3137	0.94202	0.0:0.0:1.0:0.0	.	44	Q8N4L2	TM55A_HUMAN	D	44;50	.	ENSP00000285419:A44D	A	-	2	0	TMEM55A	92102784	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.263000	0.95617	2.788000	0.95919	0.650000	0.86243	GCC			0.443	TMEM55A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000376778.1		NM_018710	
PLEC	5339	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	8	144991455	144991455	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr8:144991455C>A	ENST00000322810.4	-	32	13114	c.12945G>T	c.(12943-12945)tgG>tgT	p.W4315C	PLEC_ENST00000345136.3_Missense_Mutation_p.W4178C|PLEC_ENST00000357649.2_Missense_Mutation_p.W4182C|PLEC_ENST00000354589.3_Missense_Mutation_p.W4178C|PLEC_ENST00000356346.3_Missense_Mutation_p.W4164C|PLEC_ENST00000354958.2_Missense_Mutation_p.W4156C|PLEC_ENST00000398774.2_Missense_Mutation_p.W4146C|PLEC_ENST00000436759.2_Missense_Mutation_p.W4205C|PLEC_ENST00000527096.1_Missense_Mutation_p.W4201C	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	4315	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						TGATCTCCTCCCACTCGCACT	0.617																																					p.W4315C													.	.			0			c.G12945T												62.0	71.0	68.0					8																	144991455		2136	4231	6367	SO:0001583	missense	5339	exon32			CTCCTCCCACTCG	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.12945G>T	8.37:g.144991455C>A	ENSP00000323856:p.Trp4315Cys		Somatic	43	0	0		WXS	Illumina HiSeq	.	33	0.12	4	NM_201380	147	0.24	36	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	.	.	.	.	.	.	.	.	.	.	C	11.92	1.783997	0.31593	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37	5.24	5.24	0.73138	.	0.000000	0.64402	U	0.000007	D	0.83732	0.5318	M	0.82323	2.585	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.998;0.999;0.999;0.999;0.999	D	0.85784	0.1363	10	0.87932	D	0	.	18.6231	0.91328	0.0:1.0:0.0:0.0	.	4205;4164;4156;4315;4146;4178;4182;4178	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	C	4178;4182;4178;4146;4315;4156;4164;4205;4201	ENSP00000344848:W4178C;ENSP00000350277:W4182C;ENSP00000346602:W4178C;ENSP00000381756:W4146C;ENSP00000323856:W4315C;ENSP00000347044:W4156C;ENSP00000348702:W4164C;ENSP00000388180:W4205C;ENSP00000434583:W4201C	ENSP00000323856:W4315C	W	-	3	0	PLEC	145063443	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.582000	0.82546	2.726000	0.93360	0.549000	0.68633	TGG			0.617	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000383281.1		NM_000445	
LINC01410	103352539	broad.mit.edu	37	9	66465300	66465300	+	lincRNA	DEL	A	A	-	rs112336173		TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr9:66465300delA	ENST00000424345.1	+	0	224																											atcttttagcacccgcttatg	0.423																																					.													.	.			0			.																																											0	.			TTTAGCACCCGCT																													9.37:g.66465300delA			Somatic	3	0	0		WXS	Illumina HiSeq	Phase_I	7	0.29	2	.	1	0.00	0		RNA	DEL	ENST00000424345.1	37																																																																																						0.423	RP11-262H14.1-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000128851.1			
VSIG4	11326	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	65253547	65253547	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chrX:65253547C>A	ENST00000374737.4	-	2	289	c.181G>T	c.(181-183)Ggc>Tgc	p.G61C	VSIG4_ENST00000455586.2_Missense_Mutation_p.G61C|VSIG4_ENST00000412866.2_Missense_Mutation_p.G61C	NM_001257403.1|NM_007268.2	NP_001244332.1|NP_009199.1	Q9Y279	VSIG4_HUMAN	V-set and immunoglobulin domain containing 4	61	Ig-like 1.				complement activation, alternative pathway (GO:0006957)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of T cell proliferation (GO:0042130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GGGTCTGAGCCACGTTGTACC	0.547																																					p.G61C													.	.			0			c.G181T												115.0	80.0	92.0					X																	65253547		2203	4300	6503	SO:0001583	missense	11326	exon2			CTGAGCCACGTTG	AJ132502	CCDS14383.1, CCDS48132.1, CCDS55435.1	Xq12-q13.3	2013-01-29			ENSG00000155659	ENSG00000155659		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17032	protein-coding gene	gene with protein product		300353				10899594, 11004523, 17016555, 17016562	Standard	NM_007268		Approved	Z39IG	uc004dwh.2	Q9Y279	OTTHUMG00000021727	ENST00000374737.4:c.181G>T	X.37:g.65253547C>A	ENSP00000363869:p.Gly61Cys		Somatic	153	0	0		WXS	Illumina HiSeq	.	179	0.30	54	NM_001100431	5	0.00	0	Q6UXI4	Missense_Mutation	SNP	ENST00000374737.4	37	CCDS14383.1	.	.	.	.	.	.	.	.	.	.	C	1.604	-0.525710	0.04141	.	.	ENSG00000155659	ENST00000374737;ENST00000455586;ENST00000412866;ENST00000423830	T;T;T;T	0.08008	3.14;3.14;3.14;4.13	4.93	3.1	0.35709	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.516425	0.18791	N	0.131044	T	0.20210	0.0486	M	0.64997	1.995	0.09310	N	1	D;D;D;D;D	0.89917	0.993;1.0;0.999;0.991;1.0	P;D;D;P;D	0.72338	0.725;0.96;0.966;0.604;0.977	T	0.04255	-1.0965	10	0.72032	D	0.01	-0.1026	5.1717	0.15114	0.0:0.6759:0.209:0.1151	.	61;61;51;61;61	C9J1L3;Q9Y279-2;C9JH67;Q9Y279-3;Q9Y279	.;.;.;.;VSIG4_HUMAN	C	61	ENSP00000363869:G61C;ENSP00000411581:G61C;ENSP00000394143:G61C;ENSP00000414594:G61C	ENSP00000363869:G61C	G	-	1	0	VSIG4	65170272	0.000000	0.05858	0.008000	0.14137	0.009000	0.06853	0.155000	0.16362	0.831000	0.34780	0.594000	0.82650	GGC			0.547	VSIG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000056986.1		NM_007268	
NXF4	55999	hgsc.bcm.edu	37	X	101819124	101819124	+	RNA	SNP	G	G	C			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chrX:101819124G>C	ENST00000360035.2	+	0	1258					NR_002216.1				nuclear RNA export factor 4 pseudogene											endometrium(2)|lung(8)	10						tctctctcctgtctctctgtc	0.557													c|||	93	0.0246358	0.0401	0.013	3775	,	,		13457	0.0159		0.005	False		,,,				2504	0.0102				.													.	.			0			.																																											55999	.			TCTCCTGTCTCTC	AK124700		Xq22	2005-01-24			ENSG00000196970	ENSG00000196970			8074	pseudogene	pseudogene		300318	"""nuclear RNA export factor 4"""			11566096	Standard	NR_002216		Approved		uc004ejf.1		OTTHUMG00000039695		X.37:g.101819124G>C			Somatic	83	0	0		WXS	Illumina HiSeq	.	105	0.08	8	.	0		0		RNA	SNP	ENST00000360035.2	37																																																																																						0.557	NXF4-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000095720.1			
MMGT1	93380	broad.mit.edu	37	X	135055906	135055906	+	5'UTR	SNP	T	T	G			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chrX:135055906T>G	ENST00000305963.2	-	0	316				MMGT1_ENST00000433339.2_Missense_Mutation_p.T42P	NM_173470.1	NP_775741.1	Q8N4V1	MMGT1_HUMAN	membrane magnesium transporter 1						magnesium ion transport (GO:0015693)	early endosome (GO:0005769)|ER membrane protein complex (GO:0072546)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	magnesium ion transmembrane transporter activity (GO:0015095)			cervix(1)|endometrium(1)|kidney(1)	3						CACCGGCGGGTGTCCGCGCGC	0.592																																					.													.	MMGT1	14		0			.																																									SO:0001623	5_prime_UTR_variant	93380	.			GGCGGGTGTCCGC	AL157477	CCDS14653.1	Xq26.3	2012-05-23	2008-11-21	2008-11-21	ENSG00000169446	ENSG00000169446			28100	protein-coding gene	gene with protein product	"""ER membrane protein complex subunit 5"""		"""transmembrane protein 32"""	TMEM32		18057121, 22119785	Standard	NM_173470		Approved	EMC5	uc004ezi.1	Q8N4V1	OTTHUMG00000022499	ENST00000305963.2:c.-72A>C	X.37:g.135055906T>G			Somatic	62	0.2258064516	14		WXS	Illumina HiSeq	Phase_I	94	0.21	20	.	0		0	B2R625|B4DIY3|D3DWG7|Q5JPP7	Missense_Mutation	SNP	ENST00000305963.2	37	CCDS14653.1	.	.	.	.	.	.	.	.	.	.	T	14.67	2.603842	0.46423	.	.	ENSG00000169446	ENST00000433339	.	.	.	5.57	0.42	0.16444	.	.	.	.	.	T	0.26048	0.0635	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.32771	-0.9894	7	0.87932	D	0	.	0.5166	0.00604	0.1683:0.2065:0.196:0.4292	.	42	Q8N4V1-2	.	P	42	.	ENSP00000411359:T42P	T	-	1	0	MMGT1	134883572	0.241000	0.23857	0.146000	0.22360	0.681000	0.39784	0.202000	0.17295	0.061000	0.16311	0.481000	0.45027	ACC			0.592	MMGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058453.3		NM_173470	
BRCC3	79184	broad.mit.edu	37	X	154348401	154348401	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chrX:154348401G>T	ENST00000369462.1	+	11	952	c.927G>T	c.(925-927)atG>atT	p.M309I	MTCP1_ENST00000362018.2_Intron|BRCC3_ENST00000399042.1_Missense_Mutation_p.M310I|BRCC3_ENST00000340647.4_Missense_Mutation_p.M285I|BRCC3_ENST00000369459.2_Missense_Mutation_p.M240I|BRCC3_ENST00000330045.7_Missense_Mutation_p.M284I	NM_024332.3	NP_077308.1	P46736	BRCC3_HUMAN	BRCA1/BRCA2-containing complex, subunit 3	309					double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|histone H2A K63-linked deubiquitination (GO:0070537)|positive regulation of DNA repair (GO:0045739)|protein K63-linked deubiquitination (GO:0070536)|regulation of catalytic activity (GO:0050790)|response to ionizing radiation (GO:0010212)|response to X-ray (GO:0010165)	BRCA1-A complex (GO:0070531)|BRISC complex (GO:0070552)|nuclear ubiquitin ligase complex (GO:0000152)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	enzyme regulator activity (GO:0030234)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|polyubiquitin binding (GO:0031593)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|pancreas(1)|skin(1)	22	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					AAGAGCTTATGCAAGAACTTT	0.418																																					p.M309I													.	BRCC3	44		0			c.G927T												86.0	84.0	84.0					X																	154348401		1944	4137	6081	SO:0001583	missense	79184	exon11			GCTTATGCAAGAA	X64643	CCDS56610.1, CCDS56611.1, CCDS56612.1	Xq28	2013-05-29	2005-11-21	2005-11-21	ENSG00000185515	ENSG00000185515			24185	protein-coding gene	gene with protein product	"""Lys-63-specific deubiquitinase"""	300617	"""chromosome X open reading frame 53"""	CXorf53		1303175, 14636569	Standard	NM_024332		Approved	C6.1A, BRCC36	uc004fna.3	P46736	OTTHUMG00000022658	ENST00000369462.1:c.927G>T	X.37:g.154348401G>T	ENSP00000358474:p.Met309Ile		Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	150	0.03	4	NM_024332	6	0.00	0	A6QRF8|A6QRF9|A8MUX5|A8MWH0|A9Z1Y0|A9Z1Y5|B1B062|B4DQN7|Q16107|Q53YX5|Q9BTZ6	Missense_Mutation	SNP	ENST00000369462.1	37	CCDS56611.1	.	.	.	.	.	.	.	.	.	.	G	16.93	3.259009	0.59321	.	.	ENSG00000185515	ENST00000340647;ENST00000330045;ENST00000369459;ENST00000369462;ENST00000399042;ENST00000457026	T;T;T;T;T	0.42900	0.97;0.97;0.98;0.96;0.96	5.1	4.23	0.50019	.	0.620609	0.17763	N	0.162829	T	0.29914	0.0748	N	0.22421	0.69	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.05550	-1.0878	10	0.42905	T	0.14	-3.3084	11.9698	0.53058	0.0892:0.0:0.9108:0.0	.	284;309	P46736-2;P46736	.;BRCC3_HUMAN	I	285;284;240;309;310;241	ENSP00000344103:M285I;ENSP00000328641:M284I;ENSP00000358471:M240I;ENSP00000358474:M309I;ENSP00000381998:M310I	ENSP00000328641:M284I	M	+	3	0	BRCC3	154001595	1.000000	0.71417	0.996000	0.52242	0.966000	0.64601	4.246000	0.58740	1.220000	0.43490	0.594000	0.82650	ATG			0.418	BRCC3-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000058788.4		NM_024332	
UNC93B1	81622	mdanderson.org	37	11	67770593	67770593	+	Silent	SNP	C	C	A			TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr11:67770593C>A	ENST00000227471.2	-	3	370	c.291G>T	c.(289-291)gtG>gtT	p.V97V	UNC93B1_ENST00000530331.1_5'UTR	NM_030930.2	NP_112192.2	Q9H1C4	UN93B_HUMAN	unc-93 homolog B1 (C. elegans)	97					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	early phagosome (GO:0032009)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)											TGCCATACTTCACCTCGCGGT	0.602																																					.													.	.			0			.												111.0	116.0	115.0					11																	67770593		2175	4274	6449	SO:0001819	synonymous_variant	81622	.			ATACTTCACCTCG	AJ271326	CCDS73334.1	11q13.2	2014-09-17	2001-11-28		ENSG00000110057	ENSG00000110057			13481	protein-coding gene	gene with protein product		608204	"""unc93 (C. elegans) homolog B1"""			11867227	Standard	NM_030930		Approved	UNC93	uc001omw.1	Q9H1C4	OTTHUMG00000167472	ENST00000227471.2:c.291G>T	11.37:g.67770593C>A			Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	.	21	0.00	0	O95764|Q569H6|Q710D4	Silent	SNP	ENST00000227471.2	37																																																																																						0.602	UNC93B1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_030930	
PCSK6	5046	mdanderson.org	37	15	101922323	101922323	+	Nonsense_Mutation	SNP	A	A	T	rs1058260	byFrequency	TCGA-2G-AAFM-01A-11D-A42Y-10	TCGA-2G-AAFM-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8be26d25-830f-4431-baf5-beeeef18d14b	f6c51fe1-7d6d-4ef6-aacb-cddbdd9be8b0	g.chr15:101922323A>T	ENST00000348070.1	-	12	1502	c.1503T>A	c.(1501-1503)tgT>tgA	p.C501*	PCSK6_ENST00000561177.1_5'UTR|PCSK6_ENST00000331826.7_Nonsense_Mutation_p.C336*|PCSK6_ENST00000358417.3_Nonsense_Mutation_p.C501*|PCSK6_ENST00000344273.2_Nonsense_Mutation_p.C501*|PCSK6_ENST00000398181.2_Nonsense_Mutation_p.C501*	NM_002570.3|NM_138320.1	NP_002561.1|NP_612193.1	P29122	PCSK6_HUMAN	proprotein convertase subtilisin/kexin type 6	502					determination of left/right symmetry (GO:0007368)|glycoprotein metabolic process (GO:0009100)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|regulation of BMP signaling pathway (GO:0030510)|secretion by cell (GO:0032940)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|nerve growth factor binding (GO:0048406)|serine-type endopeptidase activity (GO:0004252)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			AGGCGGCCACACACATGTGCT	0.537																																					.													.	.			0			.												59.0	65.0	63.0					15																	101922323		2182	4274	6456	SO:0001587	stop_gained	5046	.			GGCCACACACATG		CCDS73789.1, CCDS73790.1, CCDS73791.1, CCDS73792.1, CCDS73793.1	15q26	2008-07-18	2004-06-14	2004-06-16		ENSG00000140479			8569	protein-coding gene	gene with protein product	"""subtilisin-like protease"", ""subtilisin-like proprotein convertase 4"", ""subtilisin/kexin-like protease PACE4"""	167405	"""paired basic amino acid cleaving system 4"""	PACE4		1741956	Standard	NM_002570		Approved	SPC4	uc002bwy.3	P29122		ENST00000348070.1:c.1503T>A	15.37:g.101922323A>T	ENSP00000305056:p.Cys501*		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	.	5	0.00	0	Q15099|Q15100|Q9UEG7|Q9UEJ1|Q9UEJ2|Q9UEJ7|Q9UEJ8|Q9UEJ9|Q9Y4G9|Q9Y4H0|Q9Y4H1	Nonsense_Mutation	SNP	ENST00000348070.1	37		.	.	.	.	.	.	.	.	.	.	A	27.3	4.819990	0.90873	.	.	ENSG00000140479	ENST00000348070;ENST00000358417;ENST00000344273;ENST00000398181;ENST00000331826	.	.	.	5.73	-9.14	0.00701	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-30.8927	21.4607	0.99954	0.2436:0.0:0.7564:0.0	.	.	.	.	X	501;501;501;501;336	.	ENSP00000332052:C336X	C	-	3	2	PCSK6	99739846	0.008000	0.16893	0.001000	0.08648	0.129000	0.20672	0.033000	0.13754	-1.621000	0.01562	-0.256000	0.11100	TGT			0.537	PCSK6-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				NM_002570	
