#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
NBPF10	100132406	hgsc.bcm.edu	37	1	145293535	145293535	+	Missense_Mutation	SNP	C	C	G	rs55936365		TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr1:145293535C>G	ENST00000369339.3	+	3	383	c.130C>G	c.(130-132)Cta>Gta	p.L44V	NBPF10_ENST00000342960.5_Missense_Mutation_p.L44V|NBPF10_ENST00000369338.1_Intron|RP11-458D21.5_ENST00000468030.1_3'UTR			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	315						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.L44V(2)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GAAATGTTTTCTAACTCAACT	0.443																																					p.L44V													NBPF10,NS,carcinoma,0,2	NBPF10	0	2	2	Substitution - Missense(2)	kidney(2)	c.C130G																																									SO:0001583	missense	100132406	exon1			TGTTTTCTAACTC	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369339.3:c.130C>G	1.37:g.145293535C>G	ENSP00000358345:p.Leu44Val		Somatic	69	0.0144927536	1		WXS	Illumina HiSeq	.	93	0.05	5	NM_001039703	0		0	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000369339.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.027|0.027	-1.360141|-1.360141	0.01245|0.01245	.|.	.|.	ENSG00000163386|ENSG00000163386	ENST00000369339;ENST00000342960|ENST00000448873	T|.	0.02837|.	4.14|.	0.687|0.687	-1.37|-1.37	0.09056|0.09056	.|.	.|.	.|.	.|.	.|.	T|T	0.01765|0.01765	0.0056|0.0056	N|N	0.01122|0.01122	-1.005|-1.005	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.33007|0.33007	-0.9885|-0.9885	9|6	0.02654|0.33141	T|T	1|0.24	.|.	3.2142|3.2142	0.06692|0.06692	0.3787:0.2355:0.3858:0.0|0.3787:0.2355:0.3858:0.0	rs55936365|rs55936365	44|.	A8MQ30|.	.|.	V|C	44|3	ENSP00000345684:L44V|.	ENSP00000345684:L44V|ENSP00000414194:S3C	L|S	+|+	1|2	2|0	NBPF10|NBPF10	144004892|144004892	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-3.451000|-3.451000	0.00466|0.00466	-3.626000|-3.626000	0.00130|0.00130	-3.729000|-3.729000	0.00022|0.00022	CTA|TCT			0.443	NBPF10-001	KNOWN	not_best_in_genome_evidence|basic	protein_coding	protein_coding		OTTHUMT00000038550.3		NM_001039703	
PIP5K1A	8394	broad.mit.edu	37	1	151205142	151205142	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr1:151205142C>A	ENST00000368888.4	+	7	1024	c.602C>A	c.(601-603)gCg>gAg	p.A201E	PIP5K1A_ENST00000441902.2_Missense_Mutation_p.A189E|PIP5K1A_ENST00000414290.2_5'Flank|PIP5K1A_ENST00000368890.4_Missense_Mutation_p.A188E|PIP5K1A_ENST00000409426.1_Missense_Mutation_p.A189E	NM_001135638.1	NP_001129110.1	Q99755	PI51A_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, alpha	201	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				actin cytoskeleton reorganization (GO:0031532)|activation of Rac GTPase activity (GO:0032863)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|fibroblast migration (GO:0010761)|focal adhesion assembly (GO:0048041)|glycerophospholipid metabolic process (GO:0006650)|keratinocyte differentiation (GO:0030216)|phagocytosis (GO:0006909)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|protein targeting to plasma membrane (GO:0072661)|ruffle assembly (GO:0097178)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|kinase binding (GO:0019900)			breast(1)|central_nervous_system(1)|ovary(1)|skin(1)|stomach(1)	5	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.181)			CATAAAGAGGCGGAATTTCTG	0.507																																					p.A201E	Pancreas(80;36 1443 2325 16095 21302)												PIP5K1A_ENST00000368888,NS,carcinoma,0,1	PIP5K1A	61	1	0			c.C602A												90.0	85.0	87.0					1																	151205142		2203	4300	6503	SO:0001583	missense	8394	exon7			AAGAGGCGGAATT	U78575	CCDS990.1, CCDS44219.1, CCDS44220.1, CCDS44221.1	1q21.3	2010-04-08			ENSG00000143398	ENSG00000143398			8994	protein-coding gene	gene with protein product		603275				8955136, 10828584	Standard	NM_003557		Approved		uc001exj.3	Q99755	OTTHUMG00000012351	ENST00000368888.4:c.602C>A	1.37:g.151205142C>A	ENSP00000357883:p.Ala201Glu		Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	85	0.05	4	NM_001135638	9	0.00	0	A8K4Q0|B4DIN0|Q99754|Q99756	Missense_Mutation	SNP	ENST00000368888.4	37	CCDS44219.1	.	.	.	.	.	.	.	.	.	.	C	33	5.259838	0.95368	.	.	ENSG00000143398	ENST00000349792;ENST00000409426;ENST00000441902;ENST00000368890;ENST00000368888	T;T;T;T;T	0.37058	1.22;1.22;1.22;1.22;1.22	5.22	5.22	0.72569	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.59307	0.2184	M	0.85197	2.74	0.80722	D	1	P;D;P;D	0.76494	0.52;0.999;0.869;0.999	P;D;P;D	0.75020	0.526;0.971;0.557;0.985	T	0.61845	-0.6979	10	0.49607	T	0.09	.	18.6216	0.91323	0.0:1.0:0.0:0.0	.	189;188;201;188	Q99755-4;Q99755-2;Q99755;Q99755-3	.;.;PI51A_HUMAN;.	E	188;189;189;188;201	ENSP00000271663:A188E;ENSP00000386432:A189E;ENSP00000415648:A189E;ENSP00000357885:A188E;ENSP00000357883:A201E	ENSP00000271663:A188E	A	+	2	0	PIP5K1A	149471766	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.606000	0.82863	2.741000	0.93983	0.479000	0.44913	GCG			0.507	PIP5K1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000034425.2		NM_003557	
RP11-739N20.2	0	broad.mit.edu	37	1	204363979	204363980	+	RNA	INS	-	-	A			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr1:204363979_204363980insA	ENST00000443515.1	+	0	146																											atttgtttttcaaaaaaaaaaa	0.307																																					.													.	.			0			.																																											0	.			GTTTTTCAAAAAA																													1.37:g.204363990_204363990dupA			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	8	0.38	3	.	0		0		RNA	INS	ENST00000443515.1	37																																																																																						0.307	RP11-739N20.2-001	KNOWN	basic	antisense	antisense		OTTHUMT00000087972.1			
DNAH14	127602	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	225528369	225528369	+	Silent	SNP	G	G	A			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr1:225528369G>A	ENST00000445597.2	+	47	7956	c.7956G>A	c.(7954-7956)gaG>gaA	p.E2652E	DNAH14_ENST00000430092.1_Silent_p.E3455E|DNAH14_ENST00000439375.2_Silent_p.E3455E			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	2652					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						AAGAACTAGAGGAAAAAACAT	0.338																																					p.E3455E													.	.			0			c.G10365A												87.0	72.0	77.0					1																	225528369		692	1591	2283	SO:0001819	synonymous_variant	127602	exon67			ACTAGAGGAAAAA	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.7956G>A	1.37:g.225528369G>A			Somatic	293	0	0		WXS	Illumina HiSeq	.	277	0.26	71	NM_001373	0		0	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Silent	SNP	ENST00000445597.2	37																																																																																						0.338	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000331217.3		XM_059166	
EGLN1	54583	mdanderson.org	37	1	231557492	231557492	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr1:231557492C>T	ENST00000366641.3	-	1	3298	c.143G>A	c.(142-144)cGt>cAt	p.R48H	EGLN1_ENST00000476717.1_5'Flank	NM_022051.2	NP_071334.1			egl-9 family hypoxia-inducible factor 1											breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|urinary_tract(1)	16		Prostate(94;0.194)|Acute lymphoblastic leukemia(190;0.244)				CCAGTCCTGACGCTGGTGCTC	0.687																																					p.R48H													.	.			0			c.G143A												7.0	8.0	8.0					1																	231557492		2176	4253	6429	SO:0001583	missense	54583	exon1			TCCTGACGCTGGT	AJ310543	CCDS1595.1	1q42.1	2013-08-21	2013-08-21	2001-08-24	ENSG00000135766	ENSG00000135766		"""Zinc fingers, MYND-type"""	1232	protein-coding gene	gene with protein product	"""HIF prolyl hydroxylase 2"""	606425	"""EGL nine (C.elegans) homolog 1"", ""egl nine homolog 1 (C. elegans)"""	C1orf12		11056053	Standard	NM_022051		Approved	SM-20, PHD2, ZMYND6, HIFPH2	uc001huv.2	Q9GZT9	OTTHUMG00000038027	ENST00000366641.3:c.143G>A	1.37:g.231557492C>T	ENSP00000355601:p.Arg48His		Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	15	0.20	3	NM_022051	4	0.00	0		Missense_Mutation	SNP	ENST00000366641.3	37	CCDS1595.1	.	.	.	.	.	.	.	.	.	.	c	24.7	4.555965	0.86231	.	.	ENSG00000135766	ENST00000366641	D	0.87029	-2.2	3.96	3.96	0.45880	Zinc finger, MYND-type (3);	0.507528	0.19541	N	0.111820	D	0.92176	0.7519	M	0.70108	2.13	0.41067	D	0.98542	D	0.76494	0.999	D	0.66847	0.947	D	0.92397	0.5926	10	0.46703	T	0.11	-7.7694	15.9944	0.80230	0.0:1.0:0.0:0.0	.	48	Q9GZT9	EGLN1_HUMAN	H	48	ENSP00000355601:R48H	ENSP00000355601:R48H	R	-	2	0	EGLN1	229624115	1.000000	0.71417	1.000000	0.80357	0.639000	0.38242	2.192000	0.42649	1.753000	0.51906	0.197000	0.17608	CGT			0.687	EGLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000092879.1		NM_022051	
SCCPDH	51097	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	246927615	246927615	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr1:246927615A>T	ENST00000366510.3	+	10	1434	c.1058A>T	c.(1057-1059)aAg>aTg	p.K353M		NM_016002.2	NP_057086.2	Q8NBX0	SCPDL_HUMAN	saccharopine dehydrogenase (putative)	353						lipid particle (GO:0005811)|membrane (GO:0016020)|midbody (GO:0030496)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(9)|ovary(1)	17	all_cancers(71;6.8e-05)|all_epithelial(71;7.93e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0545)|Lung NSC(105;0.0618)	all_cancers(173;0.0343)	OV - Ovarian serous cystadenocarcinoma(106;0.00323)	GBM - Glioblastoma multiforme(49;0.0896)		GGTACAGATAAGAACAAACCA	0.393																																					p.K353M													.	.			0			c.A1058T												129.0	123.0	125.0					1																	246927615		2203	4300	6503	SO:0001583	missense	51097	exon10			CAGATAAGAACAA		CCDS31084.1	1q44	2009-11-06			ENSG00000143653	ENSG00000143653			24275	protein-coding gene	gene with protein product						10810093	Standard	NM_016002		Approved	CGI-49, NET11	uc001ibr.3	Q8NBX0	OTTHUMG00000040221	ENST00000366510.3:c.1058A>T	1.37:g.246927615A>T	ENSP00000355467:p.Lys353Met		Somatic	97	0	0		WXS	Illumina HiSeq	.	83	0.23	19	NM_016002	173	0.26	45	Q8TAR0|Q9Y363	Missense_Mutation	SNP	ENST00000366510.3	37	CCDS31084.1	.	.	.	.	.	.	.	.	.	.	A	17.97	3.519587	0.64634	.	.	ENSG00000143653	ENST00000366510;ENST00000366509	T	0.45668	0.89	6.03	6.03	0.97812	.	0.466243	0.27613	N	0.018596	T	0.56673	0.2001	M	0.70595	2.14	0.49687	D	0.999818	P	0.36660	0.564	P	0.47528	0.549	T	0.57365	-0.7824	10	0.54805	T	0.06	.	16.2389	0.82396	1.0:0.0:0.0:0.0	.	353	Q8NBX0	SCPDL_HUMAN	M	353;165	ENSP00000355467:K353M	ENSP00000355466:K165M	K	+	2	0	SCCPDH	244994238	0.996000	0.38824	0.818000	0.32626	0.323000	0.28346	3.502000	0.53332	2.302000	0.77476	0.533000	0.62120	AAG			0.393	SCCPDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000096902.2		NM_016002	
NET1	10276	mdanderson.org	37	10	5454763	5454763	+	Silent	SNP	C	C	A			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr10:5454763C>A	ENST00000355029.4	+	1	250	c.108C>A	c.(106-108)tcC>tcA	p.S36S	NET1_ENST00000542715.1_5'Flank	NM_001047160.2	NP_001040625.1	Q7Z628	ARHG8_HUMAN	neuroepithelial cell transforming 1	36	Necessary for nuclear localization. {ECO:0000250}.				apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|myoblast migration (GO:0051451)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|kidney(2)|large_intestine(9)|lung(5)|prostate(2)|skin(1)	23						CCGACACCTCCGGGTCGGAGC	0.721																																					p.S36S													.	.			0			c.C108A												4.0	5.0	5.0					10																	5454763		1675	3775	5450	SO:0001819	synonymous_variant	10276	exon1			CACCTCCGGGTCG	AJ010046	CCDS7067.1, CCDS41483.1	10p15	2013-01-10	2008-09-12		ENSG00000173848	ENSG00000173848		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14592	protein-coding gene	gene with protein product		606450				8649828	Standard	NR_073040		Approved	ARHGEF8, NET1A	uc001iia.4	Q7Z628	OTTHUMG00000017596	ENST00000355029.4:c.108C>A	10.37:g.5454763C>A			Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	19	0.16	3	NM_001047160	0		0	Q12773|Q96D82|Q99903|Q9UEN6	Silent	SNP	ENST00000355029.4	37	CCDS41483.1																																																																																					0.721	NET1-005	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000046553.3		NM_005863	
FRMD4A	55691	mdanderson.org	37	10	13698996	13698996	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr10:13698996C>T	ENST00000357447.2	-	22	2961	c.2593G>A	c.(2593-2595)Gct>Act	p.A865T	FRMD4A_ENST00000358621.4_Missense_Mutation_p.A850T|FRMD4A_ENST00000378503.1_Missense_Mutation_p.A865T	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	865					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)				breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						TTGAACTGAGCCTTGACGCTG	0.697																																					p.A865T													.	.			0			c.G2593A												20.0	21.0	21.0					10																	13698996		2203	4300	6503	SO:0001583	missense	55691	exon22			ACTGAGCCTTGAC	AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.2593G>A	10.37:g.13698996C>T	ENSP00000350032:p.Ala865Thr		Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	9	0.22	2	NM_018027	2	0.00	0	A7E2Y3|Q5T377	Missense_Mutation	SNP	ENST00000357447.2	37	CCDS7101.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.691107	0.88735	.	.	ENSG00000151474	ENST00000358621;ENST00000357447;ENST00000378503	D;D;D	0.85629	-2.0;-2.01;-2.01	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	D	0.88540	0.6464	L	0.47716	1.5	0.80722	D	1	D	0.67145	0.996	P	0.58660	0.843	D	0.90000	0.4114	10	0.72032	D	0.01	-18.2791	17.8751	0.88823	0.0:1.0:0.0:0.0	.	865	Q9P2Q2	FRM4A_HUMAN	T	850;865;865	ENSP00000351438:A850T;ENSP00000350032:A865T;ENSP00000367764:A865T	ENSP00000350032:A865T	A	-	1	0	FRMD4A	13739002	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	7.254000	0.78329	2.195000	0.70347	0.174000	0.16983	GCT			0.697	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000046889.1		NM_018027	
ATAD1	84896	mdanderson.org	37	10	89530769	89530769	+	Silent	SNP	A	A	G			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr10:89530769A>G	ENST00000308448.7	-	7	1098	c.720T>C	c.(718-720)ccT>ccC	p.P240P	ATAD1_ENST00000328142.3_Silent_p.P240P|ATAD1_ENST00000541004.1_Silent_p.P240P|ATAD1_ENST00000400215.3_Intron	NM_032810.2	NP_116199.2	Q8NBU5	ATAD1_HUMAN	ATPase family, AAA domain containing 1	240					ATP catabolic process (GO:0006200)|learning (GO:0007612)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|positive regulation of receptor internalization (GO:0002092)	cell junction (GO:0030054)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			kidney(1)|large_intestine(4)|lung(4)|ovary(1)	10		all_cancers(4;6.78e-12)|Prostate(4;3.56e-12)|all_epithelial(4;5.58e-09)|Melanoma(5;0.0273)|Breast(4;0.0424)|all_hematologic(4;0.0846)|Colorectal(252;0.207)|Glioma(4;0.217)|all_neural(4;0.224)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00131)|GBM - Glioblastoma multiforme(1;1.1e-32)|Lung(2;1.4e-05)|LUSC - Lung squamous cell carcinoma(2;2.69e-05)|Colorectal(12;7.09e-05)|COAD - Colon adenocarcinoma(12;0.000261)|STAD - Stomach adenocarcinoma(243;0.235)		CAAGGTCCTGAGGACGATTGG	0.378																																					p.P240P													.	.			0			c.T720C												118.0	108.0	111.0					10																	89530769		2203	4300	6503	SO:0001819	synonymous_variant	84896	exon7			GTCCTGAGGACGA	AL834370	CCDS7386.1	10q23.31	2010-04-21		2007-02-08	ENSG00000138138	ENSG00000138138		"""ATPases / AAA-type"""	25903	protein-coding gene	gene with protein product		614452				12477932	Standard	NM_032810		Approved	FLJ14600	uc001kez.1	Q8NBU5	OTTHUMG00000018685	ENST00000308448.7:c.720T>C	10.37:g.89530769A>G			Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	57	0.05	3	NM_032810	50	0.00	0	D3DR26|Q6DKG1|Q6P4B9|Q8N3G1|Q8WYR9|Q969Y3	Silent	SNP	ENST00000308448.7	37	CCDS7386.1																																																																																					0.378	ATAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049235.1		NM_032810	
ATAD1	84896	hgsc.bcm.edu	37	10	89544257	89544257	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr10:89544257G>T	ENST00000308448.7	-	5	931	c.553C>A	c.(553-555)Caa>Aaa	p.Q185K	ATAD1_ENST00000495903.1_5'Flank|ATAD1_ENST00000328142.3_Missense_Mutation_p.Q185K|ATAD1_ENST00000541004.1_Missense_Mutation_p.Q185K|ATAD1_ENST00000400215.3_Missense_Mutation_p.Q127K	NM_032810.2	NP_116199.2	Q8NBU5	ATAD1_HUMAN	ATPase family, AAA domain containing 1	185					ATP catabolic process (GO:0006200)|learning (GO:0007612)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|positive regulation of receptor internalization (GO:0002092)	cell junction (GO:0030054)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			kidney(1)|large_intestine(4)|lung(4)|ovary(1)	10		all_cancers(4;6.78e-12)|Prostate(4;3.56e-12)|all_epithelial(4;5.58e-09)|Melanoma(5;0.0273)|Breast(4;0.0424)|all_hematologic(4;0.0846)|Colorectal(252;0.207)|Glioma(4;0.217)|all_neural(4;0.224)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00131)|GBM - Glioblastoma multiforme(1;1.1e-32)|Lung(2;1.4e-05)|LUSC - Lung squamous cell carcinoma(2;2.69e-05)|Colorectal(12;7.09e-05)|COAD - Colon adenocarcinoma(12;0.000261)|STAD - Stomach adenocarcinoma(243;0.235)		ATGGATGGTTGTAGCTTTATG	0.363																																					p.Q185K													.	.			0			c.C553A												115.0	107.0	110.0					10																	89544257		2203	4300	6503	SO:0001583	missense	84896	exon5			ATGGTTGTAGCTT	AL834370	CCDS7386.1	10q23.31	2010-04-21		2007-02-08	ENSG00000138138	ENSG00000138138		"""ATPases / AAA-type"""	25903	protein-coding gene	gene with protein product		614452				12477932	Standard	NM_032810		Approved	FLJ14600	uc001kez.1	Q8NBU5	OTTHUMG00000018685	ENST00000308448.7:c.553C>A	10.37:g.89544257G>T	ENSP00000339017:p.Gln185Lys		Somatic	126	0	0		WXS	Illumina HiSeq	.	98	0.04	4	NM_032810	29	0.00	0	D3DR26|Q6DKG1|Q6P4B9|Q8N3G1|Q8WYR9|Q969Y3	Missense_Mutation	SNP	ENST00000308448.7	37	CCDS7386.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.042816	0.75732	.	.	ENSG00000138138	ENST00000308448;ENST00000328142;ENST00000400215;ENST00000541004	D;D;D;D	0.92495	-3.05;-3.05;-3.05;-3.05	5.35	5.35	0.76521	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.90266	0.6956	L	0.38175	1.15	0.80722	D	1	B;B	0.28667	0.062;0.219	B;B	0.37943	0.25;0.261	D	0.86461	0.1779	9	.	.	.	-6.5995	19.439	0.94809	0.0:0.0:1.0:0.0	.	127;185	B4E2J1;Q8NBU5	.;ATAD1_HUMAN	K	185;185;127;185	ENSP00000339017:Q185K;ENSP00000339016:Q185K;ENSP00000412968:Q127K;ENSP00000445500:Q185K	.	Q	-	1	0	ATAD1	89534237	1.000000	0.71417	0.999000	0.59377	0.958000	0.62258	9.476000	0.97823	2.662000	0.90505	0.563000	0.77884	CAA			0.363	ATAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049235.1		NM_032810	
ZRANB1	54764	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	126631712	126631712	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr10:126631712C>G	ENST00000359653.4	+	1	1021	c.650C>G	c.(649-651)cCt>cGt	p.P217R	RP11-298J20.4_ENST00000508096.1_RNA|RP11-298J20.3_ENST00000449984.1_RNA	NM_017580.2	NP_060050.2	Q9UGI0	ZRAN1_HUMAN	zinc finger, RAN-binding domain containing 1	217					cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|positive regulation of Wnt signaling pathway (GO:0030177)|protein deubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0071947)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)|protein K63-linked deubiquitination (GO:0070536)|regulation of cell morphogenesis (GO:0022604)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	23		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.113)|COAD - Colon adenocarcinoma(40;0.119)		AGGAGATCACCTCCTGCTACG	0.453																																					p.P217R													.	.			0			c.C650G												61.0	61.0	61.0					10																	126631712		2203	4300	6503	SO:0001583	missense	54764	exon1			GATCACCTCCTGC	AJ252060	CCDS7642.1	10q26.12	2014-02-24			ENSG00000019995	ENSG00000019995		"""Zinc fingers, RAN-binding domain containing"", ""OTU domain containing"""	18224	protein-coding gene	gene with protein product		611749				11463333	Standard	NM_017580		Approved	TRABID	uc001lic.3	Q9UGI0	OTTHUMG00000019223	ENST00000359653.4:c.650C>G	10.37:g.126631712C>G	ENSP00000352676:p.Pro217Arg		Somatic	88	0	0		WXS	Illumina HiSeq	.	72	0.14	10	NM_017580	21	0.24	5	B4DZ98|D3DRF4|Q5SQP6|Q69YK3	Missense_Mutation	SNP	ENST00000359653.4	37	CCDS7642.1	.	.	.	.	.	.	.	.	.	.	C	17.74	3.462928	0.63513	.	.	ENSG00000019995	ENST00000359653	T	0.17691	2.26	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.31918	0.0812	L	0.45581	1.43	0.80722	D	1	D	0.62365	0.991	P	0.58013	0.831	T	0.00385	-1.1773	10	0.25106	T	0.35	-25.0125	19.9346	0.97133	0.0:1.0:0.0:0.0	.	217	Q9UGI0	ZRAN1_HUMAN	R	217	ENSP00000352676:P217R	ENSP00000352676:P217R	P	+	2	0	ZRANB1	126621702	1.000000	0.71417	0.926000	0.36857	0.890000	0.51754	7.487000	0.81328	2.712000	0.92718	0.563000	0.77884	CCT			0.453	ZRANB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050898.1		NM_017580	
MUC6	4588	bcgsc.ca	37	11	1016871	1016871	+	Missense_Mutation	SNP	G	G	T	rs554068781		TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr11:1016871G>T	ENST00000421673.2	-	31	5980	c.5930C>A	c.(5929-5931)cCc>cAc	p.P1977H		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1977	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGAAGAGAAGGGACTGCTCCC	0.587																																					p.P1977H													.	MUC6	408		0			c.C5930A												1308.0	1300.0	1302.0					11																	1016871		2203	4299	6502	SO:0001583	missense	4588	exon31			GAGAAGGGACTGC	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5930C>A	11.37:g.1016871G>T	ENSP00000406861:p.Pro1977His		Somatic	459	0.0217864924	10		WXS	Illumina HiSeq	Phase_1	393	0.03	12	NM_005961	0		0	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	12.39	1.923756	0.34002	.	.	ENSG00000184956	ENST00000421673	T	0.18657	2.2	2.69	1.71	0.24356	.	.	.	.	.	T	0.14614	0.0353	L	0.29908	0.895	0.09310	N	1	B	0.29212	0.237	B	0.28553	0.091	T	0.22382	-1.0218	9	0.56958	D	0.05	.	7.0992	0.25327	0.0:0.0:0.7301:0.2699	.	1977	Q6W4X9	MUC6_HUMAN	H	1977	ENSP00000406861:P1977H	ENSP00000406861:P1977H	P	-	2	0	MUC6	1006871	0.015000	0.18098	0.001000	0.08648	0.026000	0.11368	1.250000	0.32850	0.416000	0.25844	0.306000	0.20318	CCC			0.587	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382120.2		XM_290540	
QSER1	79832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	32955965	32955965	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr11:32955965A>G	ENST00000399302.2	+	4	3109	c.2774A>G	c.(2773-2775)cAg>cGg	p.Q925R	QSER1_ENST00000527788.1_Missense_Mutation_p.Q686R	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	925										breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					AATGGAAATCAGGTTACTGTG	0.378																																					p.Q925R													.	.			0			c.A2774G												77.0	71.0	73.0					11																	32955965		1848	4096	5944	SO:0001583	missense	79832	exon4			GAAATCAGGTTAC	AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.2774A>G	11.37:g.32955965A>G	ENSP00000382241:p.Gln925Arg		Somatic	167	0	0		WXS	Illumina HiSeq	.	156	0.24	38	NM_001076786	1	1.00	1	Q6ZU30|Q6ZUR5	Missense_Mutation	SNP	ENST00000399302.2	37	CCDS41631.1	.	.	.	.	.	.	.	.	.	.	A	18.12	3.552436	0.65311	.	.	ENSG00000060749	ENST00000399302;ENST00000078652;ENST00000527788	T;T	0.26957	2.03;1.7	5.69	5.69	0.88448	.	0.000000	0.64402	D	0.000001	T	0.51210	0.1661	M	0.69823	2.125	0.48236	D	0.999613	D;D;D	0.71674	0.996;0.998;0.997	D;D;D	0.80764	0.986;0.994;0.986	T	0.53201	-0.8472	10	0.62326	D	0.03	.	15.9508	0.79835	1.0:0.0:0.0:0.0	.	686;686;925	C9JJ88;Q2KHR3-2;Q2KHR3	.;.;QSER1_HUMAN	R	925;686;686	ENSP00000382241:Q925R;ENSP00000432766:Q686R	ENSP00000078652:Q686R	Q	+	2	0	QSER1	32912541	1.000000	0.71417	0.995000	0.50966	0.979000	0.70002	6.778000	0.75043	2.170000	0.68504	0.459000	0.35465	CAG			0.378	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388448.1		NM_024774	
CHST1	8534	mdanderson.org	37	11	45671900	45671900	+	Missense_Mutation	SNP	C	C	T	rs147129669		TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr11:45671900C>T	ENST00000308064.2	-	4	1244	c.574G>A	c.(574-576)Gtg>Atg	p.V192M	CHST1_ENST00000533673.1_5'Flank|RP11-495O11.1_ENST00000525563.1_RNA	NM_003654.5	NP_003645.1	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6) sulfotransferase 1	192					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|polysaccharide metabolic process (GO:0005976)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	keratan sulfotransferase activity (GO:0045130)|sulfotransferase activity (GO:0008146)			breast(1)|endometrium(3)|large_intestine(10)|lung(17)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)		TCGGCCGCCACGGTCAGGTTG	0.711																																					p.V192M													.	.			0			c.G574A												24.0	24.0	24.0					11																	45671900		2199	4291	6490	SO:0001583	missense	8534	exon4			CCGCCACGGTCAG	U65637	CCDS7913.1	11p11.2	2010-04-29			ENSG00000175264	ENSG00000175264		"""Sulfotransferases, membrane-bound"""	1969	protein-coding gene	gene with protein product		603797				9405439, 9639683	Standard	NM_003654		Approved	C6ST, KSGal6ST	uc001mys.2	O43916		ENST00000308064.2:c.574G>A	11.37:g.45671900C>T	ENSP00000309270:p.Val192Met		Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	22	0.09	2	NM_003654	11	0.00	0	D3DQP2	Missense_Mutation	SNP	ENST00000308064.2	37	CCDS7913.1	.	.	.	.	.	.	.	.	.	.	C	6.499	0.460205	0.12342	.	.	ENSG00000175264	ENST00000308064	T	0.81163	-1.46	4.98	0.228	0.15364	Sulfotransferase domain (1);	0.240843	0.34802	N	0.003666	T	0.51227	0.1662	N	0.10874	0.06	0.21878	N	0.999497	P	0.43477	0.808	B	0.35039	0.194	T	0.50988	-0.8762	10	0.30854	T	0.27	-1.2124	2.5019	0.04636	0.2322:0.2845:0.3841:0.0992	.	192	O43916	CHST1_HUMAN	M	192	ENSP00000309270:V192M	ENSP00000309270:V192M	V	-	1	0	CHST1	45628476	0.017000	0.18338	0.766000	0.31476	0.193000	0.23685	0.164000	0.16542	0.460000	0.27045	0.462000	0.41574	GTG			0.711	CHST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390127.1		NM_003654	
DGKZ	8525	hgsc.bcm.edu	37	11	46394020	46394020	+	Silent	SNP	C	C	A			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr11:46394020C>A	ENST00000454345.1	+	12	1659	c.1534C>A	c.(1534-1536)Cga>Aga	p.R512R	DGKZ_ENST00000421244.2_Silent_p.R324R|DGKZ_ENST00000395574.3_Silent_p.R290R|DGKZ_ENST00000543978.1_Intron|DGKZ_ENST00000532868.2_Silent_p.R328R|DGKZ_ENST00000456247.2_Silent_p.R323R|DGKZ_ENST00000527911.1_Silent_p.R324R|DGKZ_ENST00000343674.6_Silent_p.R340R|DGKZ_ENST00000528615.1_Silent_p.R102R|DGKZ_ENST00000318201.8_Silent_p.R301R	NM_001105540.1	NP_001099010.1	Q13574	DGKZ_HUMAN	diacylglycerol kinase, zeta	512	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.|Mediates interaction with RASGRP1.				blood coagulation (GO:0007596)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of Ras protein signal transduction (GO:0046580)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|enzyme inhibitor activity (GO:0004857)|lipid kinase activity (GO:0001727)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein C-terminus binding (GO:0008022)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|pancreas(1)|prostate(1)|skin(1)	25				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		TCTCAATCCCCGACAAGTCTT	0.582																																					p.R512R													.	.			0			c.C1534A												93.0	76.0	82.0					11																	46394020		2202	4297	6499	SO:0001819	synonymous_variant	8525	exon12			AATCCCCGACAAG	U51477	CCDS7918.1, CCDS41640.1, CCDS44579.1, CCDS44580.1, CCDS55757.1, CCDS55758.1, CCDS55759.1, CCDS44579.2	11p11.2	2010-11-24	2010-11-24		ENSG00000149091	ENSG00000149091	2.7.1.107		2857	protein-coding gene	gene with protein product		601441	"""diacylglycerol kinase, zeta 104kDa"""			8626588	Standard	NM_003646		Approved	DAGK5, hDGKzeta, DGK-ZETA, DAGK6	uc001ncn.1	Q13574	OTTHUMG00000166437	ENST00000454345.1:c.1534C>A	11.37:g.46394020C>A			Somatic	135	0	0		WXS	Illumina HiSeq	.	100	0.04	4	NM_001105540	34	0.00	0	B7Z2M9|B7Z6M3|E9PPW4|F6UCU9|G3V0F6|J3KNJ6|O00542|Q6ZVG7|Q8IVW9	Silent	SNP	ENST00000454345.1	37	CCDS41640.1																																																																																					0.582	DGKZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000389772.1		NM_001105540	
SYVN1	84447	broad.mit.edu	37	11	64898172	64898173	+	Frame_Shift_Ins	INS	-	-	GG			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr11:64898172_64898173insGG	ENST00000377190.3	-	11	1158_1159	c.1064_1065insCC	c.(1063-1065)cctfs	p.P355fs	SYVN1_ENST00000526060.1_Frame_Shift_Ins_p.P355fs|SYVN1_ENST00000294256.8_Frame_Shift_Ins_p.P355fs|SYVN1_ENST00000307289.6_Frame_Shift_Ins_p.P304fs|SYVN1_ENST00000526121.1_5'Flank	NM_172230.2	NP_757385.1	Q86TM6	SYVN1_HUMAN	synovial apoptosis inhibitor 1, synoviolin	355	Pro-rich.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|in utero embryonic development (GO:0001701)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						GGTGGGGGGCAGGGGGTGGCCC	0.673																																					p.P355fs													.	SYVN1	55		0			c.1065_1066insCC																																									SO:0001589	frameshift_variant	84447	exon11			GGGGGCAGGGGGT	AB085847	CCDS8097.1, CCDS31605.1	11q13	2013-01-09			ENSG00000162298	ENSG00000162298		"""RING-type (C3HC4) zinc fingers"""	20738	protein-coding gene	gene with protein product	"""HMG-coA reductase degradation 1 homolog (S. cerevisiae)"""	608046				12975321	Standard	NM_032431		Approved	HRD1, DER3	uc001odb.3	Q86TM6		ENST00000377190.3:c.1063_1064dupCC	11.37:g.64898175_64898176dupGG	ENSP00000366395:p.Pro355fs		Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	18	0.39	7	NM_032431	7	0.00	0	Q8N3K3|Q8N6E8|Q96JL5|Q96PK3	Frame_Shift_Ins	INS	ENST00000377190.3	37	CCDS31605.1																																																																																					0.673	SYVN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000385274.1		NM_032431	
EPS8	2059	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	12	15803897	15803897	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr12:15803897G>A	ENST00000281172.5	-	14	1730	c.1294C>T	c.(1294-1296)Cga>Tga	p.R432*	EPS8_ENST00000542903.1_Nonsense_Mutation_p.R172*|EPS8_ENST00000543523.1_Nonsense_Mutation_p.R432*|EPS8_ENST00000543612.1_Nonsense_Mutation_p.R432*|EPS8_ENST00000540613.1_Nonsense_Mutation_p.R172*	NM_004447.5	NP_004438.3	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway substrate 8	432	Pro-rich.				actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|actin filament bundle assembly (GO:0051017)|actin polymerization-dependent cell motility (GO:0070358)|adult locomotory behavior (GO:0008344)|barbed-end actin filament capping (GO:0051016)|behavioral response to ethanol (GO:0048149)|cell proliferation (GO:0008283)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|exit from mitosis (GO:0010458)|positive regulation of signal transduction (GO:0009967)|Rac protein signal transduction (GO:0016601)|regulation of actin filament length (GO:0030832)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|ruffle membrane (GO:0032587)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actin binding (GO:0003779)|Rac GTPase binding (GO:0048365)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		TTGCGGAATCGTGGAACATAT	0.443																																					p.R432X													.	.			0			c.C1294T												125.0	123.0	124.0					12																	15803897		2203	4300	6503	SO:0001587	stop_gained	2059	exon14			GGAATCGTGGAAC	U12535	CCDS31753.1	12p12.3	2008-05-02				ENSG00000151491			3420	protein-coding gene	gene with protein product		600206				8084614	Standard	NM_004447		Approved		uc001rdb.3	Q12929		ENST00000281172.5:c.1294C>T	12.37:g.15803897G>A	ENSP00000281172:p.Arg432*		Somatic	259	0	0		WXS	Illumina HiSeq	.	461	0.05	25	NM_004447	9	0.00	0	A6NMC3|A8K6W2|A8KA66|B4DX66|Q8N6J0	Nonsense_Mutation	SNP	ENST00000281172.5	37	CCDS31753.1	.	.	.	.	.	.	.	.	.	.	G	39	7.438600	0.98286	.	.	ENSG00000151491	ENST00000543523;ENST00000281172;ENST00000543612;ENST00000540613;ENST00000542903;ENST00000543223	.	.	.	5.52	3.63	0.41609	.	0.169902	0.50627	D	0.000109	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	-14.1443	14.3841	0.66931	0.0:0.0:0.722:0.278	.	.	.	.	X	432;432;432;172;172;432	.	ENSP00000281172:R432X	R	-	1	2	EPS8	15695164	0.887000	0.30362	0.036000	0.18154	0.841000	0.47740	3.045000	0.49838	0.627000	0.30340	0.650000	0.86243	CGA			0.443	EPS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401093.1			
HNRNPA1	3178	hgsc.bcm.edu;ucsc.edu	37	12	54676581	54676581	+	Intron	SNP	C	C	T			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr12:54676581C>T	ENST00000340913.6	+	7	729				HNRNPA1_ENST00000546500.1_Intron|CBX5_ENST00000209875.4_5'Flank|RP11-968A15.8_ENST00000553061.1_RNA|HNRNPA1_ENST00000547276.1_Intron|HNRNPA1_ENST00000330752.8_Intron	NM_002136.2|NM_031157.2	NP_002127.1|NP_112420.1	P09651	ROA1_HUMAN	heterogeneous nuclear ribonucleoprotein A1						cell death (GO:0008219)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|nuclear export (GO:0051168)|nuclear import (GO:0051170)|RNA export from nucleus (GO:0006405)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)|single-stranded RNA binding (GO:0003727)			endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20						CTTTTTCTTACAggtggcttt	0.408																																					.	Colon(83;502 1289 8436 16406 24870)												.	.			0			.												55.0	55.0	55.0					12																	54676581		2160	4232	6392	SO:0001627	intron_variant	664709	.			TTCTTACAGGTGG	BC009600	CCDS41793.1, CCDS44909.1	12q13.1	2013-10-11		2007-08-16	ENSG00000135486	ENSG00000135486		"""RNA binding motif (RRM) containing"""	5031	protein-coding gene	gene with protein product		164017		HNRPA1		1733858	Standard	XR_245923		Approved	hnRNPA1, hnRNP-A1	uc001sfl.3	P09651		ENST00000340913.6:c.677-3C>T	12.37:g.54676581C>T			Somatic	65	0	0		WXS	Illumina HiSeq	.	56	0.13	7	.	3	0.67	2	A8K4Z8|Q3MIB7|Q6PJZ7	RNA	SNP	ENST00000340913.6	37	CCDS44909.1																																																																																					0.408	HNRNPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000405480.1		NM_031157	
EP400	57634	broad.mit.edu;mdanderson.org	37	12	132527894	132527894	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr12:132527894G>T	ENST00000333577.4	+	34	6470	c.6361G>T	c.(6361-6363)Gca>Tca	p.A2121S	EP400_ENST00000389561.2_Missense_Mutation_p.A2085S|EP400_ENST00000332482.4_Missense_Mutation_p.A2048S|EP400_ENST00000330386.6_Missense_Mutation_p.A2004S|EP400_ENST00000389562.2_Missense_Mutation_p.A2084S			Q96L91	EP400_HUMAN	E1A binding protein p400	2121					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CCAGAAGTCCGCACAGGAGGG	0.483																																					p.A2085S													.	EP400	370		0			c.G6253T												89.0	80.0	83.0					12																	132527894		2203	4300	6503	SO:0001583	missense	57634	exon33			AAGTCCGCACAGG	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.6361G>T	12.37:g.132527894G>T	ENSP00000333602:p.Ala2121Ser		Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	78	0.05	4	NM_015409	4	0.00	0	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	ENST00000333577.4	37		.	.	.	.	.	.	.	.	.	.	G	10.45	1.352851	0.24512	.	.	ENSG00000183495	ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000541296	D;D;D;D;D	0.90620	-2.7;-2.7;-2.7;-2.7;-2.7	5.74	-11.5	0.00074	.	1.858220	0.02501	N	0.090517	T	0.68412	0.2998	N	0.02011	-0.69	0.09310	N	1	B;B;B	0.11235	0.004;0.004;0.004	B;B;B	0.08055	0.003;0.003;0.003	T	0.66077	-0.6013	10	0.40728	T	0.16	.	0.5557	0.00670	0.3504:0.2492:0.1511:0.2492	.	2085;2004;2084	Q96L91-2;Q96L91-4;Q96L91-5	.;.;.	S	2121;2085;2084;2048;2004;2085	ENSP00000333602:A2121S;ENSP00000374212:A2085S;ENSP00000374213:A2084S;ENSP00000331737:A2048S;ENSP00000330620:A2004S	ENSP00000330620:A2004S	A	+	1	0	EP400	131093847	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.510000	0.00959	-3.461000	0.00159	-0.302000	0.09304	GCA			0.483	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				NM_015409	
SACS	26278	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	23909053	23909053	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr13:23909053C>A	ENST00000382292.3	-	9	9235	c.8962G>T	c.(8962-8964)Gac>Tac	p.D2988Y	SACS_ENST00000382298.3_Missense_Mutation_p.D2988Y|SACS_ENST00000402364.1_Missense_Mutation_p.D2238Y			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	2988					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CGTTTCATGTCTTCGTGAATG	0.368																																					p.D2988Y													.	.			0			c.G8962T												89.0	92.0	91.0					13																	23909053		2203	4299	6502	SO:0001583	missense	26278	exon10			TCATGTCTTCGTG	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.8962G>T	13.37:g.23909053C>A	ENSP00000371729:p.Asp2988Tyr		Somatic	107	0	0		WXS	Illumina HiSeq	.	105	0.17	18	NM_014363	1	0.00	0	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	C	26.1	4.705830	0.89018	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.87729	-2.14;-2.29;-2.14	5.64	5.64	0.86602	.	0.050866	0.85682	D	0.000000	D	0.84124	0.5403	L	0.36672	1.1	0.58432	D	0.99999	P	0.36789	0.57	B	0.36885	0.235	D	0.85062	0.0935	10	0.72032	D	0.01	.	19.7024	0.96060	0.0:1.0:0.0:0.0	.	2988	Q9NZJ4	SACS_HUMAN	Y	2988;2238;2988	ENSP00000371729:D2988Y;ENSP00000385844:D2238Y;ENSP00000371735:D2988Y	ENSP00000371729:D2988Y	D	-	1	0	SACS	22807053	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.784000	0.68990	2.653000	0.90120	0.555000	0.69702	GAC			0.368	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044148.3		NM_014363	
EDDM3B	64184	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	21238469	21238469	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr14:21238469A>G	ENST00000326783.3	+	2	258	c.160A>G	c.(160-162)Atg>Gtg	p.M54V		NM_022360.4	NP_071755.1	P56851	EP3B_HUMAN	epididymal protein 3B	54						extracellular region (GO:0005576)				central_nervous_system(1)|kidney(1)|lung(3)|ovary(1)|skin(1)	7						TGATGTCCTCATGAGAGAAAA	0.388																																					p.M54V													.	.			0			c.A160G												109.0	104.0	106.0					14																	21238469		2203	4300	6503	SO:0001583	missense	64184	exon2			GTCCTCATGAGAG	X76386	CCDS9557.1	14q11.1	2010-03-19	2010-01-27	2010-01-27	ENSG00000181552	ENSG00000181552			19223	protein-coding gene	gene with protein product		611582	"""family with sequence similarity 12, member B (epididymal)"""	FAM12B		7514008	Standard	NM_022360		Approved	HE3-BETA	uc001vyd.3	P56851	OTTHUMG00000029583	ENST00000326783.3:c.160A>G	14.37:g.21238469A>G	ENSP00000314810:p.Met54Val		Somatic	230	0	0		WXS	Illumina HiSeq	.	189	0.12	23	NM_022360	0		0	A0PK89	Missense_Mutation	SNP	ENST00000326783.3	37	CCDS9557.1	.	.	.	.	.	.	.	.	.	.	A	14.32	2.500115	0.44455	.	.	ENSG00000181552	ENST00000326783	T	0.57595	0.39	4.05	4.05	0.47172	Ribonuclease A, domain (3);	0.000000	0.56097	D	0.000027	T	0.65133	0.2662	L	0.59436	1.845	0.32204	N	0.577464	D	0.69078	0.997	D	0.77004	0.989	T	0.72060	-0.4404	10	0.87932	D	0	.	9.3009	0.37845	1.0:0.0:0.0:0.0	.	54	P56851	EP3B_HUMAN	V	54	ENSP00000314810:M54V	ENSP00000314810:M54V	M	+	1	0	EDDM3B	20308309	1.000000	0.71417	0.986000	0.45419	0.950000	0.60333	1.459000	0.35234	1.686000	0.51046	0.459000	0.35465	ATG			0.388	EDDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000073745.2			
PSME2	5721	mdanderson.org	37	14	24612675	24612675	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr14:24612675G>T	ENST00000216802.5	-	11	1302	c.663C>A	c.(661-663)agC>agA	p.S221R	EMC9_ENST00000216799.4_5'Flank|EMC9_ENST00000558200.1_5'Flank|PSME2_ENST00000471700.2_5'UTR|PSME2_ENST00000560410.1_Missense_Mutation_p.S210R|EMC9_ENST00000419198.2_5'Flank|EMC9_ENST00000560403.1_5'Flank	NM_002818.2	NP_002809.2	Q9UL46	PSME2_HUMAN	proteasome (prosome, macropain) activator subunit 2 (PA28 beta)	221					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome activator complex (GO:0008537)|proteasome complex (GO:0000502)				endometrium(1)|lung(3)|prostate(2)	6				GBM - Glioblastoma multiforme(265;0.00839)		CCAGGTTGCTGCTGATGATAT	0.478																																					p.S221R													.	.			0			c.C663A												103.0	99.0	100.0					14																	24612675		2203	4300	6503	SO:0001583	missense	5721	exon11			GTTGCTGCTGATG		CCDS9614.1	14q11.2	2010-03-10			ENSG00000100911	ENSG00000100911		"""Proteasome (prosome, macropain) subunits"""	9569	protein-coding gene	gene with protein product		602161				7789512	Standard	NM_002818		Approved	PA28beta	uc001wmj.3	Q9UL46	OTTHUMG00000028797	ENST00000216802.5:c.663C>A	14.37:g.24612675G>T	ENSP00000216802:p.Ser221Arg		Somatic	99	0.0101010101	1		WXS	Illumina HiSeq	Phase_I	96	0.04	4	NM_002818	797	0.00	0	Q15129	Missense_Mutation	SNP	ENST00000216802.5	37	CCDS9614.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.032554	0.75504	.	.	ENSG00000100911	ENST00000216802	T	0.43688	0.94	5.15	4.26	0.50523	Proteasome activator pa28, REG beta subunit (2);	0.291936	0.42294	D	0.000735	T	0.52901	0.1763	M	0.65975	2.015	0.43835	D	0.996417	D	0.56287	0.975	P	0.58577	0.841	T	0.49661	-0.8916	10	0.25106	T	0.35	-0.1967	9.8773	0.41211	0.0959:0.0:0.9041:0.0	.	221	Q9UL46	PSME2_HUMAN	R	221	ENSP00000216802:S221R	ENSP00000216802:S221R	S	-	3	2	PSME2	23682515	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.564000	0.53791	1.304000	0.44892	0.561000	0.74099	AGC			0.478	PSME2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000071918.3		NM_002818	
MAPKBP1	23005	mdanderson.org	37	15	42114620	42114620	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr15:42114620G>T	ENST00000456763.2	+	27	3443	c.3247G>T	c.(3247-3249)Ggg>Tgg	p.G1083W	MAPKBP1_ENST00000457542.2_Splice_Site_p.G1077W|MAPKBP1_ENST00000221214.6_Splice_Site_p.G960W|MAPKBP1_ENST00000260357.7_Splice_Site_p.G916W|MAPKBP1_ENST00000514566.1_Splice_Site_p.G1077W|RP11-23P13.4_ENST00000510176.1_RNA	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	1083										breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		AGCTGCTCCAGGTGTGGTCAG	0.597																																					p.G1083W													.	.			0			c.G3247T												29.0	29.0	29.0					15																	42114620		2203	4300	6503	SO:0001630	splice_region_variant	23005	exon27			GCTCCAGGTGTGG	AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.3247+1G>T	15.37:g.42114620G>T			Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_001128608	2	0.00	0	A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Missense_Mutation	SNP	ENST00000456763.2	37	CCDS45239.1	.	.	.	.	.	.	.	.	.	.	.	18.99	3.739212	0.69304	.	.	ENSG00000137802	ENST00000457542;ENST00000221214;ENST00000260357;ENST00000456763;ENST00000514566	T;T;T;T;T	0.53423	0.89;0.95;0.62;0.94;1.08	4.91	4.91	0.64330	.	0.166601	0.52532	D	0.000071	T	0.54727	0.1876	L	0.27053	0.805	0.45822	D	0.998696	D;D;D;D;D;D	0.89917	0.997;0.999;0.999;1.0;1.0;1.0	D;D;D;D;D;D	0.87578	0.958;0.989;0.99;0.993;0.994;0.998	T	0.57723	-0.7762	10	0.72032	D	0.01	-19.6445	12.7101	0.57083	0.0:0.0:0.8349:0.1651	.	916;960;916;1077;1083;1077	F8WC21;O60336-3;B4DYK7;O60336-2;O60336;O60336-6	.;.;.;.;MABP1_HUMAN;.	W	1077;960;916;1083;1077	ENSP00000397570:G1077W;ENSP00000221214:G960W;ENSP00000260357:G916W;ENSP00000393099:G1083W;ENSP00000426154:G1077W	ENSP00000221214:G960W	G	+	1	0	MAPKBP1	39901912	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.669000	0.68081	2.561000	0.86390	0.561000	0.74099	GGG			0.597	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000359745.1		NM_014994	Missense_Mutation
PLA2G4F	255189	broad.mit.edu	37	15	42439919	42439920	+	Frame_Shift_Ins	INS	-	-	C	rs139732075		TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr15:42439919_42439920insC	ENST00000382396.4	-	12	1186_1187	c.1100_1101insG	c.(1099-1101)cgafs	p.R367fs	PLA2G4F_ENST00000397272.3_Frame_Shift_Ins_p.R369fs			Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	367	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid secretion (GO:0050482)|cellular response to antibiotic (GO:0071236)|cellular response to organic cyclic compound (GO:0071407)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	calcium-dependent phospholipase A2 activity (GO:0047498)|lysophospholipase activity (GO:0004622)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		AAGACATGGCTCGGGTTCCACC	0.554																																					p.R367fs													.	PLA2G4F	75		0			c.1101_1102insG																																									SO:0001589	frameshift_variant	255189	exon12			CATGGCTCGGGTT		CCDS32204.1	15q15.1	2008-09-19				ENSG00000168907	3.1.1.4		27396	protein-coding gene	gene with protein product						14702039, 15866882	Standard	NM_213600		Approved	PLA2G4F/Z	uc001zoz.3	Q68DD2		ENST00000382396.4:c.1101dupG	15.37:g.42439920_42439920dupC	ENSP00000371833:p.Arg367fs		Somatic	109	0	0		WXS	Illumina HiSeq	Phase_I	90	0.12	11	NM_213600	2	0.00	0	Q6ZMC8	Frame_Shift_Ins	INS	ENST00000382396.4	37	CCDS32204.1																																																																																					0.554	PLA2G4F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000420463.1		NM_213600	
PIGQ	9091	hgsc.bcm.edu;bcgsc.ca	37	16	629151	629151	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr16:629151G>A	ENST00000026218.5	+	7	1394	c.1306G>A	c.(1306-1308)Gtg>Atg	p.V436M	PIGQ_ENST00000321878.5_Missense_Mutation_p.V436M|PIGQ_ENST00000409527.2_Missense_Mutation_p.V436M	NM_148920.2	NP_683721.1	Q9BRB3	PIGQ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Q	436	Leu-rich.				C-terminal protein lipidation (GO:0006501)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(780;0.00335)				GCGCCAGCGCGTGGACTCCTG	0.647																																					p.V436M													.	.			0			c.G1306A												89.0	80.0	83.0					16																	629151		2201	4300	6501	SO:0001583	missense	9091	exon7			CAGCGCGTGGACT	AB003723	CCDS10411.1, CCDS10412.1	16p13.3	2013-03-28	2006-06-28		ENSG00000007541	ENSG00000007541		"""Phosphatidylinositol glycan anchor biosynthesis"""	14135	protein-coding gene	gene with protein product		605754	"""phosphatidylinositol glycan, class Q"""			9463366, 9729469	Standard	NM_004204		Approved	hGPI1, GPI1	uc002cho.3	Q9BRB3	OTTHUMG00000168047	ENST00000026218.5:c.1306G>A	16.37:g.629151G>A	ENSP00000026218:p.Val436Met		Somatic	108	0	0		WXS	Illumina HiSeq	.	121	0.05	6	NM_148920	28	0.00	0	A2IDE1|D3DU52|O14927|Q96G00|Q96S22|Q9UJH4	Missense_Mutation	SNP	ENST00000026218.5	37	CCDS10411.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.584657	0.86748	.	.	ENSG00000007541	ENST00000409527;ENST00000321878;ENST00000026218;ENST00000540241	T;T;T	0.52754	0.65;0.65;1.94	5.8	4.85	0.62838	.	0.109437	0.64402	N	0.000008	T	0.64461	0.2600	L	0.57130	1.785	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.83275	0.993;0.996;0.927	T	0.66810	-0.5829	10	0.59425	D	0.04	-36.1197	13.931	0.63996	0.0726:0.0:0.9274:0.0	.	450;436;436	E7ERP4;Q9BRB3;Q9BRB3-2	.;PIGQ_HUMAN;.	M	436;436;436;21	ENSP00000386760:V436M;ENSP00000326674:V436M;ENSP00000026218:V436M	ENSP00000026218:V436M	V	+	1	0	PIGQ	569152	1.000000	0.71417	0.975000	0.42487	0.981000	0.71138	9.773000	0.98989	1.475000	0.48197	0.655000	0.94253	GTG			0.647	PIGQ-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000239270.2		NM_004204	
PKD1	5310	mdanderson.org	37	16	2152493	2152493	+	Silent	SNP	C	C	T			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr16:2152493C>T	ENST00000262304.4	-	25	9298	c.9090G>A	c.(9088-9090)ctG>ctA	p.L3030L	PKD1_ENST00000561991.1_5'Flank|PKD1_ENST00000423118.1_Silent_p.L3030L	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	3030	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.		Missing (in PKD1). {ECO:0000269|PubMed:11857740}.		anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CCAGGGGCAGCAGCCCCTCTG	0.697																																					p.L3030L													.	.			0			c.G9090A												10.0	11.0	11.0					16																	2152493		2147	4249	6396	SO:0001819	synonymous_variant	5310	exon25			GGGCAGCAGCCCC	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.9090G>A	16.37:g.2152493C>T			Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_001009944	16	0.00	0	Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	CCDS32369.1																																																																																					0.697	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000341688.1			
RPH3AL	9501	broad.mit.edu	37	17	171132	171133	+	In_Frame_Ins	INS	-	-	CCG			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr17:171132_171133insCCG	ENST00000331302.7	-	4	458_459	c.151_152insCGG	c.(151-153)gag>gCGGag	p.50_51insA	RP11-1260E13.1_ENST00000570501.1_RNA|RP11-1260E13.1_ENST00000572998.1_RNA|RPH3AL_ENST00000576001.1_5'Flank|RPH3AL_ENST00000536489.2_In_Frame_Ins_p.50_51insA|RPH3AL_ENST00000323434.8_In_Frame_Ins_p.50_51insA	NM_001190411.1|NM_006987.3	NP_001177340.1|NP_008918.1	Q9UNE2	RPH3L_HUMAN	rabphilin 3A-like (without C2 domains)	50	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|intracellular protein transport (GO:0006886)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|positive regulation of protein secretion (GO:0050714)|regulation of calcium ion-dependent exocytosis (GO:0017158)|response to drug (GO:0042493)	cytoplasm (GO:0005737)|secretory granule membrane (GO:0030667)	cytoskeletal protein binding (GO:0008092)|metal ion binding (GO:0046872)			NS(2)|breast(1)|kidney(1)|large_intestine(1)|skin(1)	6				UCEC - Uterine corpus endometrioid carcinoma (25;0.023)|all cancers(1;4.96e-06)|Epithelial(1;2.86e-05)|BRCA - Breast invasive adenocarcinoma(1;0.00453)|OV - Ovarian serous cystadenocarcinoma(1;0.0716)|LUAD - Lung adenocarcinoma(1115;0.102)|COAD - Colon adenocarcinoma(4;0.107)		GGCCTCCACCTCCGCCGGGCTG	0.673																																					p.E51delinsAE													.	RPH3AL	18		0			c.152_153insCGG																																									SO:0001652	inframe_insertion	9501	exon4			TCCACCTCCGCCG		CCDS10994.1, CCDS54059.1	17p13.3	2014-07-02			ENSG00000181031	ENSG00000181031		"""Synaptotagmins"""	10296	protein-coding gene	gene with protein product		604881				10395805	Standard	NM_006987		Approved	Noc2	uc021tmx.1	Q9UNE2	OTTHUMG00000090273	ENST00000331302.7:c.149_151dupCGG	17.37:g.171136_171138dupCCG	ENSP00000328977:p.Ala50_Ala50dup		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	59	0.12	7	NM_006987	1	0.00	0	D3DTG7|Q9BSB3	In_Frame_Ins	INS	ENST00000331302.7	37	CCDS10994.1																																																																																					0.673	RPH3AL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206597.2		NM_006987	
CLUH	23277	mdanderson.org	37	17	2595123	2595123	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr17:2595123C>T	ENST00000570628.2	-	24	3709	c.3604G>A	c.(3604-3606)Gtg>Atg	p.V1202M	CLUH_ENST00000435359.1_Missense_Mutation_p.V1202M|RP11-74E22.6_ENST00000608984.1_lincRNA|CLUH_ENST00000538975.1_Missense_Mutation_p.V1202M			O75153	CLU_HUMAN	clustered mitochondria (cluA/CLU1) homolog	1202					intracellular distribution of mitochondria (GO:0048312)	cytoplasm (GO:0005737)											TGCAGGGCCACGGCCTGCTGG	0.692																																					p.V1202M													.	.			0			c.G3604A												22.0	24.0	23.0					17																	2595123		2056	4189	6245	SO:0001583	missense	23277	exon24			GGGCCACGGCCTG	AB014564	CCDS45572.1	17p13.3	2012-12-18	2012-11-30	2012-11-30	ENSG00000132361	ENSG00000132361			29094	protein-coding gene	gene with protein product			"""KIAA0664"""	KIAA0664			Standard	XM_005256567		Approved	CLU1	uc002fuy.1	O75153	OTTHUMG00000177575	ENST00000570628.2:c.3604G>A	17.37:g.2595123C>T	ENSP00000458986:p.Val1202Met		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_015229	186	0.00	0	Q6AHY2|Q6P3X7|Q6ZUG8|Q8N4U7|Q9BTA3|Q9H979	Missense_Mutation	SNP	ENST00000570628.2	37	CCDS45572.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.553070	0.86127	.	.	ENSG00000132361	ENST00000435359;ENST00000322335;ENST00000538975	D;D	0.84070	-1.8;-1.8	5.56	3.42	0.39159	Tetratricopeptide-like helical (1);	0.142130	0.47852	D	0.000202	D	0.89955	0.6865	M	0.80332	2.49	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	D	0.90652	0.4583	10	0.87932	D	0	.	11.2491	0.49015	0.1432:0.7189:0.1379:0.0	.	1202;1203	O75153;C9J6D7	K0664_HUMAN;.	M	1202;1203;1202	ENSP00000388872:V1202M;ENSP00000439628:V1202M	ENSP00000320468:V1203M	V	-	1	0	KIAA0664	2541873	1.000000	0.71417	0.996000	0.52242	0.889000	0.51656	4.915000	0.63355	1.306000	0.44926	0.655000	0.94253	GTG			0.692	CLUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000437807.2		NM_015229	
PITPNM3	83394	mdanderson.org	37	17	6358884	6358884	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr17:6358884C>T	ENST00000262483.8	-	20	2786	c.2699G>A	c.(2698-2700)cGc>cAc	p.R900H	PITPNM3_ENST00000421306.3_Missense_Mutation_p.R864H|PITPNM3_ENST00000576664.1_5'UTR	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	900					phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		CAGGATCATGCGCGAGTTGTT	0.677																																					p.R900H													.	.			0			c.G2699A												25.0	29.0	27.0					17																	6358884		2196	4298	6494	SO:0001583	missense	83394	exon20			ATCATGCGCGAGT	AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.2699G>A	17.37:g.6358884C>T	ENSP00000262483:p.Arg900His		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_031220	0		0	A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Missense_Mutation	SNP	ENST00000262483.8	37	CCDS11076.1	.	.	.	.	.	.	.	.	.	.	C	35	5.546875	0.96488	.	.	ENSG00000091622	ENST00000262483;ENST00000421306	T;T	0.55413	0.52;0.52	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	T	0.74458	0.3719	M	0.83774	2.66	0.54753	D	0.99998	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.79288	-0.1865	10	0.87932	D	0	.	15.693	0.77469	0.0:1.0:0.0:0.0	.	864;900	F8WEW5;Q9BZ71	.;PITM3_HUMAN	H	900;864	ENSP00000262483:R900H;ENSP00000407882:R864H	ENSP00000262483:R900H	R	-	2	0	PITPNM3	6299608	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.722000	0.84778	2.371000	0.80710	0.505000	0.49811	CGC			0.677	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000219824.2		NM_031220	
ARSG	22901	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	66339910	66339910	+	Silent	SNP	G	G	A			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr17:66339910G>A	ENST00000448504.2	+	3	1180	c.384G>A	c.(382-384)gcG>gcA	p.A128A	ARSG_ENST00000452479.2_5'UTR	NM_014960.4	NP_055775.2	Q96EG1	ARSG_HUMAN	arylsulfatase G	128					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sulfur compound metabolic process (GO:0006790)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular space (GO:0005615)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			NS(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	26			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			TGCAGCAGGCGGGTTACGTCA	0.562																																					p.A128A													ARSG,colon,carcinoma,+1,1	ARSG	1	1	0			c.G384A												66.0	47.0	54.0					17																	66339910		2203	4300	6503	SO:0001819	synonymous_variant	22901	exon3			GCAGGCGGGTTAC	AB023218	CCDS11676.1	17q24.2	2013-07-15	2006-02-15		ENSG00000141337	ENSG00000141337		"""Arylsulfatase family"""	24102	protein-coding gene	gene with protein product		610008				12461688, 16174644	Standard	NM_014960		Approved	KIAA1001	uc002jhc.2	Q96EG1	OTTHUMG00000179810	ENST00000448504.2:c.384G>A	17.37:g.66339910G>A			Somatic	100	0	0		WXS	Illumina HiSeq	.	117	0.05	6	NM_001267727	0		0	Q6UXF2|Q9Y2K4	Silent	SNP	ENST00000448504.2	37	CCDS11676.1																																																																																					0.562	ARSG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000448369.1		NM_014960	
RAB37	326624	mdanderson.org	37	17	72733227	72733227	+	5'Flank	SNP	C	C	T			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr17:72733227C>T	ENST00000392613.5	+	0	0				RAB37_ENST00000392612.3_5'Flank|RAB37_ENST00000340415.3_Intron|RAB37_ENST00000392615.5_Missense_Mutation_p.R27W|RAB37_ENST00000528438.1_Intron|RAB37_ENST00000392614.4_Missense_Mutation_p.R27W|RAB37_ENST00000402449.4_Intron|RAB37_ENST00000392610.1_5'Flank	NM_001006638.2	NP_001006639.1	Q96AX2	RAB37_HUMAN	RAB37, member RAS oncogene family						protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|secretory granule (GO:0030141)	GTP binding (GO:0005525)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	12						GCAGACCCTGCGGCTCTGCGT	0.721																																					p.R27W													.	.			0			c.C79T												12.0	15.0	14.0					17																	72733227		1559	3571	5130	SO:0001631	upstream_gene_variant	326624	exon1			ACCCTGCGGCTCT	BC040547	CCDS11703.1, CCDS32722.1, CCDS54161.1, CCDS54162.1	17q25.2	2008-02-05			ENSG00000172794	ENSG00000172794		"""RAB, member RAS oncogene"""	30268	protein-coding gene	gene with protein product		609956				10722846	Standard	NM_175738		Approved		uc002jlk.3	Q96AX2	OTTHUMG00000134282		17.37:g.72733227C>T	Exception_encountered		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_001163989	1	0.00	0	A8MXF5|A8MYT0|Q8IWA7	Missense_Mutation	SNP	ENST00000392613.5	37	CCDS32722.1	.	.	.	.	.	.	.	.	.	.	C	10.56	1.383881	0.25031	.	.	ENSG00000172794	ENST00000392615;ENST00000392614	T;T	0.64260	0.3;-0.09	3.16	-6.18	0.02085	.	0.316889	0.27768	N	0.017929	T	0.37785	0.1016	.	.	.	0.09310	N	0.999996	B;B	0.09022	0.002;0.001	B;B	0.04013	0.001;0.0	T	0.12734	-1.0536	9	0.72032	D	0.01	.	0.692	0.00893	0.2072:0.1589:0.3238:0.31	.	27;27	A8MZI4;A8MYT0	.;.	W	27	ENSP00000376391:R27W;ENSP00000376390:R27W	ENSP00000376390:R27W	R	+	1	2	RAB37	70244822	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-2.399000	0.01050	-1.514000	0.01786	0.462000	0.41574	CGG			0.721	RAB37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000258872.2		NM_175738	
SLC38A10	124565	mdanderson.org	37	17	79257226	79257226	+	Silent	SNP	G	G	T	rs141775697	byFrequency	TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr17:79257226G>T	ENST00000374759.3	-	4	723	c.340C>A	c.(340-342)Cgg>Agg	p.R114R	SLC38A10_ENST00000288439.5_Silent_p.R114R|SLC38A10_ENST00000546352.1_5'Flank	NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10	114					amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CCGAACAGCCGGGCAAAGAAG	0.612																																					p.R114R													.	.			0			c.C340A												83.0	57.0	66.0					17																	79257226		2201	4299	6500	SO:0001819	synonymous_variant	124565	exon4			ACAGCCGGGCAAA	BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.340C>A	17.37:g.79257226G>T			Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	59	0.05	3	NM_001037984	21	0.00	0	Q6ZRC5|Q8NA99|Q96C66	Silent	SNP	ENST00000374759.3	37	CCDS42397.1																																																																																					0.612	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000397747.1		NM_138570	
MRI1	84245	mdanderson.org	37	19	13879176	13879176	+	Silent	SNP	T	T	C			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr19:13879176T>C	ENST00000319545.8	+	3	432	c.375T>C	c.(373-375)cgT>cgC	p.R125R	MRI1_ENST00000040663.6_Intron	NM_032285.2	NP_115661.1			methylthioribose-1-phosphate isomerase 1											breast(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	6						taaacagacgtgaaacggagc	0.532																																					p.R125R													.	.			0			c.T375C												51.0	45.0	47.0					19																	13879176		1978	3867	5845	SO:0001819	synonymous_variant	84245	exon3			CAGACGTGAAACG		CCDS12297.1, CCDS32923.1	19p13.13	2013-05-29	2013-05-29			ENSG00000037757	5.3.1.23		28469	protein-coding gene	gene with protein product	"""mediator of RhoA-dependent invasion"", ""S-methyl-5-thioribose-1-phosphate isomerase 1"""	615105	"""methylthioribose-1-phosphate isomerase homolog (S. cerevisiae)"""			15215245, 19620624, 23124037	Standard	XR_244089		Approved	MGC3207, Ypr118w, mtnA, MRDI	uc002mxe.3	Q9BV20		ENST00000319545.8:c.375T>C	19.37:g.13879176T>C			Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	55	0.05	3	NM_032285	16	0.00	0		Silent	SNP	ENST00000319545.8	37	CCDS12297.1																																																																																					0.532	MRI1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000453422.1		NM_032285	
PSG4	5672	mdanderson.org	37	19	43699297	43699297	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr19:43699297G>T	ENST00000405312.3	-	4	1075	c.838C>A	c.(838-840)Ctc>Atc	p.L280I	PSG4_ENST00000244295.9_Intron|PSG4_ENST00000433626.2_Missense_Mutation_p.L187I	NM_002780.3	NP_002771.2	Q00888	PSG4_HUMAN	pregnancy specific beta-1-glycoprotein 4	280	Ig-like C2-type 2.				female pregnancy (GO:0007565)	extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	24		Prostate(69;0.00682)				CTGACAGGGAGGCTCTGACCA	0.438																																					p.P280T													.	.			0			c.C838A												232.0	232.0	232.0					19																	43699297		2202	4290	6492	SO:0001583	missense	5672	exon4			CAGGGAGGCTCTG		CCDS33039.1, CCDS46093.1, CCDS62695.1	19q13.2	2013-01-29			ENSG00000243137	ENSG00000243137		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9521	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1-glycoprotein 4"""	176393				2783133	Standard	NM_002780		Approved		uc002ovy.4	Q00888	OTTHUMG00000151544	ENST00000405312.3:c.838C>A	19.37:g.43699297G>T	ENSP00000384770:p.Leu280Ile		Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_002780	0		0	E7EX79|Q13047|Q13048|Q15234|Q15240|Q9UQ76	Missense_Mutation	SNP	ENST00000405312.3	37	CCDS46093.1	.	.	.	.	.	.	.	.	.	.	g	10.66	1.413749	0.25465	.	.	ENSG00000243137	ENST00000405312;ENST00000433626	T;T	0.13420	2.59;2.59	1.61	1.61	0.23674	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.33030	0.0849	M	0.77820	2.39	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	T	0.04017	-1.0984	9	0.54805	T	0.06	.	6.6292	0.22847	0.0:0.0:1.0:0.0	.	187;280	E7EX79;Q00888	.;PSG4_HUMAN	I	280;187	ENSP00000384770:L280I;ENSP00000387864:L187I	ENSP00000384770:L280I	L	-	1	0	PSG4	48391137	0.004000	0.15560	0.105000	0.21289	0.036000	0.12997	0.060000	0.14342	0.877000	0.35895	0.524000	0.50904	CTC			0.438	PSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000323073.1		NM_213633	
SYMPK	8189	broad.mit.edu	37	19	46321272	46321272	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr19:46321272T>G	ENST00000245934.7	-	23	3270	c.3026A>C	c.(3025-3027)tAc>tCc	p.Y1009S	RSPH6A_ENST00000597055.1_5'Flank|RSPH6A_ENST00000221538.3_5'Flank|SYMPK_ENST00000598155.1_5'UTR	NM_004819.2	NP_004810.2	Q92797	SYMPK_HUMAN	symplekin	1009					cell adhesion (GO:0007155)|mRNA polyadenylation (GO:0006378)|positive regulation of protein dephosphorylation (GO:0035307)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(25)|ovary(1)|urinary_tract(1)	45		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		CAGGCGGGGGTACATGGTCAG	0.637																																					p.Y1009S													.	SYMPK	104		0			c.A3026C												46.0	38.0	41.0					19																	46321272		2196	4295	6491	SO:0001583	missense	8189	exon23			CGGGGGTACATGG	U49240	CCDS12676.2	19q13.3	2008-02-05			ENSG00000125755	ENSG00000125755			22935	protein-coding gene	gene with protein product		602388				9330635	Standard	NM_004819		Approved	SYM, SPK	uc002pdn.3	Q92797	OTTHUMG00000150151	ENST00000245934.7:c.3026A>C	19.37:g.46321272T>G	ENSP00000245934:p.Tyr1009Ser		Somatic	78	0.1538461538	12		WXS	Illumina HiSeq	Phase_I	86	0.22	19	NM_004819	255	0.04	9	O00521|O00689|O00733|Q59GT5|Q8N2U5	Missense_Mutation	SNP	ENST00000245934.7	37	CCDS12676.2	.	.	.	.	.	.	.	.	.	.	T	25.9	4.683927	0.88639	.	.	ENSG00000125755	ENST00000245934	T	0.65916	-0.18	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.80325	0.4602	M	0.85041	2.73	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.83582	0.0118	10	0.72032	D	0.01	.	13.295	0.60292	0.0:0.0:0.0:1.0	.	1009	Q92797	SYMPK_HUMAN	S	1009	ENSP00000245934:Y1009S	ENSP00000245934:Y1009S	Y	-	2	0	SYMPK	51013112	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.467000	0.80930	2.039000	0.60335	0.454000	0.30748	TAC			0.637	SYMPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316581.1		NM_004819	
GRWD1	83743	mdanderson.org	37	19	48956276	48956276	+	Silent	SNP	C	C	T			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr19:48956276C>T	ENST00000253237.5	+	7	1568	c.1335C>T	c.(1333-1335)agC>agT	p.S445S	KCNJ14_ENST00000342291.2_5'Flank	NM_031485.3	NP_113673.3	Q9BQ67	GRWD1_HUMAN	glutamate-rich WD repeat containing 1	445						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|stomach(1)	19		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000206)|all cancers(93;0.000207)|Epithelial(262;0.0125)|GBM - Glioblastoma multiforme(486;0.0222)		GCACCATCAGCGTCTGAGGCG	0.602																																					p.S445S													.	.			0			c.C1335T												33.0	36.0	35.0					19																	48956276		2203	4289	6492	SO:0001819	synonymous_variant	83743	exon7			CATCAGCGTCTGA	AF337808	CCDS12720.1	19q13.33	2013-05-21				ENSG00000105447		"""WD repeat domain containing"""	21270	protein-coding gene	gene with protein product	regulator of ribosome biogenesis 1 homolog (S. cerevisiae)	610597				15885502	Standard	NM_031485		Approved	WDR28, GRWD, RRB1	uc002pjd.2	Q9BQ67		ENST00000253237.5:c.1335C>T	19.37:g.48956276C>T			Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	58	0.05	3	NM_031485	109	0.00	0	Q8TF59	Silent	SNP	ENST00000253237.5	37	CCDS12720.1																																																																																					0.602	GRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466122.1		NM_031485	
AHCY	191	mdanderson.org	37	20	32868923	32868923	+	Silent	SNP	A	A	G			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr20:32868923A>G	ENST00000217426.2	-	10	1293	c.1216T>C	c.(1216-1218)Ttg>Ctg	p.L406L	CTD-3216D2.5_ENST00000609218.1_RNA|AHCY_ENST00000538132.1_Silent_p.L378L|RP4-785G19.5_ENST00000512005.1_RNA	NM_000687.2	NP_000678.1	P23526	SAHH_HUMAN	adenosylhomocysteinase	406					cellular nitrogen compound metabolic process (GO:0034641)|chronic inflammatory response to antigenic stimulus (GO:0002439)|circadian sleep/wake cycle (GO:0042745)|homocysteine biosynthetic process (GO:0071268)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|S-adenosylhomocysteine catabolic process (GO:0019510)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|nucleus (GO:0005634)	adenosylhomocysteinase activity (GO:0004013)|adenyl nucleotide binding (GO:0030554)|NAD binding (GO:0051287)			endometrium(6)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						AGCTTGGTCAACTTCACATTC	0.557																																					p.L406L													.	.			0			c.T1216C												80.0	64.0	69.0					20																	32868923		2203	4300	6503	SO:0001819	synonymous_variant	191	exon10			TGGTCAACTTCAC	M61832	CCDS13233.1, CCDS54457.1	20q11.22	2009-06-12	2009-06-12		ENSG00000101444	ENSG00000101444	3.3.1.1		343	protein-coding gene	gene with protein product		180960	"""S-adenosylhomocysteine hydrolase"""			7079734, 6580258	Standard	NM_001161766		Approved	SAHH	uc002xai.3	P23526	OTTHUMG00000140098	ENST00000217426.2:c.1216T>C	20.37:g.32868923A>G			Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	66	0.05	3	NM_000687	627	0.00	1	A8K307|B3KUN3|E1P5P2|F5H737|Q96A36	Silent	SNP	ENST00000217426.2	37	CCDS13233.1																																																																																					0.557	AHCY-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078773.2		NM_000687	
L3MBTL1	26013	broad.mit.edu	37	20	42169675	42169675	+	Silent	SNP	A	A	G			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr20:42169675A>G	ENST00000427442.2	+	22	2589	c.2430A>G	c.(2428-2430)aaA>aaG	p.K810K	L3MBTL1_ENST00000444063.1_3'UTR|L3MBTL1_ENST00000418998.1_Silent_p.K810K|L3MBTL1_ENST00000373135.3_Silent_p.K742K|L3MBTL1_ENST00000373134.1_3'UTR			Q9Y468	LMBL1_HUMAN	l(3)mbt-like 1 (Drosophila)	0					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of mitosis (GO:0007088)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|nucleosome binding (GO:0031491)|SAM domain binding (GO:0032093)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|ovary(1)|skin(2)	7						AGGAAGGAAAAGGCATCCTGG	0.478																																					p.K810K													.	L3MBTL1	105		0			c.A2430G												173.0	142.0	152.0					20																	42169675		2203	4300	6503	SO:0001819	synonymous_variant	26013	exon22			AGGAAAAGGCATC	U89358	CCDS13319.1, CCDS46602.1, CCDS46602.2	20q13.12	2013-01-10	2010-09-03	2010-09-03	ENSG00000185513	ENSG00000185513		"""Zinc fingers, C2HC-type containing"", ""Sterile alpha motif (SAM) domain containing"""	15905	protein-coding gene	gene with protein product	"""lethal (3) malignant brain tumor l(3)"""	608802	"""l(3)mbt (Drosophila)-like"", ""l(3)mbt-like (Drosophila)"""	L3MBTL		10445843, 17540172	Standard	NM_032107		Approved	ZC2HC3, dJ138B7.3, DKFZp586P1522, KIAA0681	uc010zwh.2	Q9Y468	OTTHUMG00000032503	ENST00000427442.2:c.2430A>G	20.37:g.42169675A>G			Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	145	0.03	4	NM_032107	11	0.00	0	B4DRC9|E1P5W7|Q5H8Y8|Q5H8Y9|Q8IUV7|Q9H1E6|Q9H1G5|Q9UG06|Q9UJB9|Q9Y4C9	Silent	SNP	ENST00000427442.2	37	CCDS46602.2																																																																																					0.478	L3MBTL1-007	KNOWN	upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000079300.3		NM_032107	
ZNF512B	57473	mdanderson.org	37	20	62594604	62594604	+	Silent	SNP	G	G	T			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr20:62594604G>T	ENST00000450537.1	-	12	1872	c.1812C>A	c.(1810-1812)gcC>gcA	p.A604A	ZNF512B_ENST00000369888.1_Silent_p.A604A|ZNF512B_ENST00000217130.3_Silent_p.A604A			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	604					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					GGCTGGAGAAGGCAGCCCCGC	0.721																																					p.A604A													.	.			0			c.C1812A												15.0	11.0	12.0					20																	62594604		2118	4199	6317	SO:0001819	synonymous_variant	57473	exon12			GGAGAAGGCAGCC	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.1812C>A	20.37:g.62594604G>T			Somatic	17	0	0		WXS	Illumina HiSeq	Phase_I	19	0.11	2	NM_020713	5	0.00	0	Q08AK9|Q9ULM4	Silent	SNP	ENST00000450537.1	37	CCDS13548.1																																																																																					0.721	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080246.1		NM_020713	
SOX18	54345	mdanderson.org	37	20	62680648	62680648	+	Silent	SNP	G	G	A			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr20:62680648G>A	ENST00000340356.7	-	1	346	c.222C>T	c.(220-222)cgC>cgT	p.R74R	ZNF512B_ENST00000450537.1_5'Flank	NM_018419.2	NP_060889.1	P35713	SOX18_HUMAN	SRY (sex determining region Y)-box 18	74					angiogenesis (GO:0001525)|blood vessel endothelial cell migration (GO:0043534)|cell maturation (GO:0048469)|embryonic heart tube development (GO:0035050)|endocardial cell differentiation (GO:0060956)|endocardium formation (GO:0060214)|establishment of endothelial barrier (GO:0061028)|hair cycle process (GO:0022405)|hair follicle development (GO:0001942)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of stem cell proliferation (GO:0072091)|stem cell fate specification (GO:0048866)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)	nuclear chromatin (GO:0000790)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			lung(3)	3	all_cancers(38;3.45e-11)|all_epithelial(29;9.12e-13)|Lung NSC(23;2e-09)|all_lung(23;6.77e-09)					GGCGTTCCCCGCGGCCGGCCG	0.776																																					p.R74R	GBM(27;64 690 17108 39708)												.	.			0			c.C222T												15.0	18.0	17.0					20																	62680648		2162	4221	6383	SO:0001819	synonymous_variant	54345	exon1			TTCCCCGCGGCCG	AB033888	CCDS13552.1	20q13.33	2008-07-28			ENSG00000203883	ENSG00000203883		"""SRY (sex determining region Y)-boxes"""	11194	protein-coding gene	gene with protein product		601618				10807548	Standard	NM_018419		Approved		uc002yhs.3	P35713	OTTHUMG00000033017	ENST00000340356.7:c.222C>T	20.37:g.62680648G>A			Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_018419	20	0.00	0	Q0VGA9|Q9NPH8	Silent	SNP	ENST00000340356.7	37	CCDS13552.1																																																																																					0.776	SOX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080265.1			
BAGE2	85319	broad.mit.edu	37	21	11058340	11058340	+	RNA	SNP	A	A	C	rs28617310	byFrequency	TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr21:11058340A>C	ENST00000470054.1	-	0	324							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GGGGTAAAGGAGAGAAATCTC	0.363													a|||	41	0.0081869	0.0136	0.0014	5008	,	,		64928	0.002		0.005	False		,,,				2504	0.0153				.													.	.			0			.																																											85319	.			TAAAGGAGAGAAA	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11058340A>C			Somatic	206	0.0048543689	1		WXS	Illumina HiSeq	Phase_I	207	0.04	8	.	0		0	A8K925|Q08ER0	RNA	SNP	ENST00000470054.1	37																																																																																						0.363	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000157417.3		NM_182482	
BAGE2	85319	broad.mit.edu	37	21	11058348	11058348	+	RNA	SNP	C	C	A			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr21:11058348C>A	ENST00000470054.1	-	0	324							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GGAGAGAAATCTCTTTATAAA	0.343																																					.													.	.			0			.												34.0	29.0	30.0					21																	11058348		692	1591	2283			85319	.			AGAAATCTCTTTA	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11058348C>A			Somatic	174	0.0057471264	1		WXS	Illumina HiSeq	Phase_I	180	0.04	7	.	0		0	A8K925|Q08ER0	RNA	SNP	ENST00000470054.1	37																																																																																						0.343	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000157417.3		NM_182482	
PHF21B	112885	broad.mit.edu;ucsc.edu;mdanderson.org	37	22	45279175	45279175	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr22:45279175C>A	ENST00000313237.5	-	13	1537	c.1387G>T	c.(1387-1389)Gag>Tag	p.E463*	PHF21B_ENST00000403565.1_Nonsense_Mutation_p.E259*|PHF21B_ENST00000404079.2_Nonsense_Mutation_p.E409*|PHF21B_ENST00000396103.3_Nonsense_Mutation_p.E421*	NM_138415.4	NP_612424.1	Q96EK2	PF21B_HUMAN	PHD finger protein 21B	463							zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(14)|ovary(2)|prostate(1)|skin(2)	25		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		GTCTTCAACTCCAGGCATTTC	0.642																																					p.E463X													.	PHF21B	61		0			c.G1387T												35.0	40.0	39.0					22																	45279175		2203	4300	6503	SO:0001587	stop_gained	112885	exon13			TCAACTCCAGGCA	AK091480	CCDS14061.1, CCDS56234.1, CCDS63504.1	22q13.31	2013-01-28			ENSG00000056487	ENSG00000056487		"""Zinc fingers, PHD-type"""	25161	protein-coding gene	gene with protein product			"""PHD finger protein 4"""	PHF4		12477932	Standard	NM_138415		Approved	BHC80L, FLJ34161	uc011aql.2	Q96EK2	OTTHUMG00000151199	ENST00000313237.5:c.1387G>T	22.37:g.45279175C>A	ENSP00000324403:p.Glu463*		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	38	0.13	5	NM_138415	2	0.00	0	B0QYW3|B0QYW4|B3KRU4|B7Z4F8|Q5TFL2|Q6ICC0	Nonsense_Mutation	SNP	ENST00000313237.5	37	CCDS14061.1	.	.	.	.	.	.	.	.	.	.	c	35	5.540177	0.96474	.	.	ENSG00000056487	ENST00000403565;ENST00000313237;ENST00000396103;ENST00000404079	.	.	.	3.49	3.49	0.39957	.	0.192724	0.32401	U	0.006142	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-18.5365	15.2285	0.73369	0.0:1.0:0.0:0.0	.	.	.	.	X	259;463;421;409	.	ENSP00000324403:E463X	E	-	1	0	PHF21B	43657839	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	6.770000	0.74990	1.789000	0.52484	0.299000	0.19835	GAG			0.642	PHF21B-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000321731.2		NM_138415	
VGLL4	9686	mdanderson.org	37	3	11606410	11606410	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr3:11606410A>G	ENST00000413604.1	-	3	531	c.161T>C	c.(160-162)aTg>aCg	p.M54T	VGLL4_ENST00000424529.2_Missense_Mutation_p.M29T|VGLL4_ENST00000451674.2_Missense_Mutation_p.M33T|VGLL4_ENST00000430365.2_Missense_Mutation_p.M119T|VGLL4_ENST00000273038.3_Missense_Mutation_p.M113T|VGLL4_ENST00000404339.1_Missense_Mutation_p.M118T			Q14135	VGLL4_HUMAN	vestigial-like family member 4	113					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|endometrium(1)|large_intestine(1)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				LUSC - Lung squamous cell carcinoma(1;0.089)|Lung(1;0.111)		GTGCAGGCTCATGGTGGGGGC	0.667																																					p.M119T													.	.			0			c.T356C												19.0	22.0	21.0					3																	11606410		2201	4293	6494	SO:0001583	missense	9686	exon3			AGGCTCATGGTGG	D50911	CCDS2606.1, CCDS46754.1, CCDS46755.1, CCDS46756.1, CCDS68342.1, CCDS68343.1	3p25.2	2014-03-03	2014-03-03		ENSG00000144560	ENSG00000144560			28966	protein-coding gene	gene with protein product			"""vestigial like 4 (Drosophila)"""			8590280, 15140898	Standard	NM_001284390		Approved	KIAA0121	uc010hdx.1	Q14135	OTTHUMG00000129739	ENST00000413604.1:c.161T>C	3.37:g.11606410A>G	ENSP00000404624:p.Met54Thr		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	22	0.18	4	NM_001128219	17	0.00	0	B4DTS7|J3KN68|Q7L5V0|Q9BQ78	Missense_Mutation	SNP	ENST00000413604.1	37		.	.	.	.	.	.	.	.	.	.	A	13.47	2.246807	0.39697	.	.	ENSG00000144560	ENST00000273038;ENST00000413604;ENST00000451674;ENST00000424529;ENST00000430365;ENST00000404339;ENST00000445411;ENST00000418000;ENST00000458499;ENST00000417206;ENST00000424709;ENST00000419541;ENST00000437722	T;T;T;T;T;T;T;T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	5.22	5.22	0.72569	.	0.367413	0.32819	N	0.005604	T	0.35098	0.0920	L	0.51422	1.61	0.44508	D	0.997451	B;P;B;P;B	0.38395	0.332;0.477;0.338;0.629;0.338	B;B;B;B;B	0.33254	0.117;0.115;0.115;0.16;0.079	T	0.13575	-1.0504	10	0.18276	T	0.48	-10.8764	15.1024	0.72292	1.0:0.0:0.0:0.0	.	119;33;29;118;113	G5E9M7;Q14135-6;Q14135-5;G5E9F4;Q14135	.;.;.;.;VGLL4_HUMAN	T	113;54;33;29;119;118;113;113;109;113;54;113;54	ENSP00000273038:M113T;ENSP00000404624:M54T;ENSP00000416615:M33T;ENSP00000402878:M29T;ENSP00000404251:M119T;ENSP00000384705:M118T;ENSP00000412923:M113T;ENSP00000394439:M113T;ENSP00000394123:M109T;ENSP00000391932:M113T;ENSP00000391554:M54T;ENSP00000395557:M113T;ENSP00000393100:M54T	ENSP00000273038:M113T	M	-	2	0	VGLL4	11581410	1.000000	0.71417	0.879000	0.34478	0.850000	0.48378	4.767000	0.62286	1.971000	0.57363	0.459000	0.35465	ATG			0.667	VGLL4-004	PUTATIVE	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000339139.2		NM_014667	
ZFYVE20	64145	mdanderson.org	37	3	15115315	15115315	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr3:15115315C>T	ENST00000253699.3	-	14	2942	c.2329G>A	c.(2329-2331)Gcc>Acc	p.A777T	ZFYVE20_ENST00000476527.2_Missense_Mutation_p.A777T	NM_022340.2	NP_071735.2	Q9H1K0	RBNS5_HUMAN	zinc finger, FYVE domain containing 20	777	Necessary for the interaction with EHD1.|Necessary for the interaction with RAB5A.				blood coagulation (GO:0007596)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	endosome (GO:0005768)|endosome membrane (GO:0010008)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|skin(3)|stomach(1)|urinary_tract(2)	26						TTCTGCTTGGCCAGGGTGTGC	0.612																																					p.A777T													.	.			0			c.G2329A												60.0	56.0	57.0					3																	15115315		2203	4300	6503	SO:0001583	missense	64145	exon14			GCTTGGCCAGGGT	AY009133	CCDS2623.1	3p25.1	2014-01-15			ENSG00000131381	ENSG00000131381		"""Zinc fingers, FYVE domain containing"""	20759	protein-coding gene	gene with protein product		609511				11062261	Standard	XR_427283		Approved	Rabenosyn-5	uc003bzm.1	Q9H1K0	OTTHUMG00000129860	ENST00000253699.3:c.2329G>A	3.37:g.15115315C>T	ENSP00000253699:p.Ala777Thr		Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_022340	3	0.00	0	B4DWY8|C9J4P5|Q3KP30|Q59EY8|Q8NAQ1	Missense_Mutation	SNP	ENST00000253699.3	37	CCDS2623.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.820905	0.90873	.	.	ENSG00000131381	ENST00000253699;ENST00000476527	T;T	0.42900	0.96;0.96	5.49	5.49	0.81192	.	0.168469	0.53938	D	0.000050	T	0.44705	0.1306	N	0.22421	0.69	0.80722	D	1	P	0.50819	0.939	P	0.51324	0.666	T	0.46176	-0.9210	10	0.72032	D	0.01	-18.3343	19.3737	0.94500	0.0:1.0:0.0:0.0	.	777	Q9H1K0	RBNS5_HUMAN	T	777	ENSP00000253699:A777T;ENSP00000422551:A777T	ENSP00000253699:A777T	A	-	1	0	ZFYVE20	15090319	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	6.136000	0.71703	2.578000	0.87016	0.591000	0.81541	GCC			0.612	ZFYVE20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252102.2		NM_022340	
ZXDC	79364	mdanderson.org	37	3	126180459	126180459	+	Silent	SNP	G	G	T			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr3:126180459G>T	ENST00000389709.3	-	6	2099	c.2046C>A	c.(2044-2046)ccC>ccA	p.P682P	ZXDC_ENST00000336332.5_Silent_p.P682P	NM_025112.4	NP_079388.3	Q2QGD7	ZXDC_HUMAN	ZXD family zinc finger C	682	Required for transcriptional activation.				positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|LRR domain binding (GO:0030275)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(1)	17				GBM - Glioblastoma multiforme(114;0.155)		ACGTGGACTGGGGCAGCCCAT	0.597																																					p.P682P													.	.			0			c.C2046A												51.0	56.0	54.0					3																	126180459		2115	4225	6340	SO:0001819	synonymous_variant	79364	exon6			GGACTGGGGCAGC	AK023923	CCDS43145.1, CCDS43146.1	3q21.3	2014-02-12			ENSG00000070476	ENSG00000070476		"""Zinc fingers, C2H2-type"""	28160	protein-coding gene	gene with protein product		615746				8619474, 9110174	Standard	XM_005247757		Approved	MGC11349, FLJ13861	uc003eiv.3	Q2QGD7	OTTHUMG00000162754	ENST00000389709.3:c.2046C>A	3.37:g.126180459G>T			Somatic	139	0.0071942446	1		WXS	Illumina HiSeq	Phase_I	140	0.04	5	NM_025112	37	0.00	0	C5J0H9|Q6DKI8|Q7L3L1|Q8NAU2	Silent	SNP	ENST00000389709.3	37	CCDS43145.1																																																																																					0.597	ZXDC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000370327.2		NM_025112	
ATR	545	broad.mit.edu	37	3	142222247	142222247	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr3:142222247G>T	ENST00000350721.4	-	30	5366	c.5245C>A	c.(5245-5247)Ctg>Atg	p.L1749M	ATR_ENST00000383101.3_Missense_Mutation_p.L1685M	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	1749	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						ACAGTAGACAGCTGACCAAGA	0.299								Other conserved DNA damage response genes																													p.L1749M													ATR,colon,carcinoma,+1,1	ATR	285	1	0			c.C5245A												56.0	54.0	55.0					3																	142222247		2203	4296	6499	SO:0001583	missense	545	exon30			TAGACAGCTGACC	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.5245C>A	3.37:g.142222247G>T	ENSP00000343741:p.Leu1749Met		Somatic	515	0.0019417476	1		WXS	Illumina HiSeq	Phase_I	549	0.01	7	NM_001184	2	0.00	0	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	ENST00000350721.4	37	CCDS3124.1	.	.	.	.	.	.	.	.	.	.	G	16.27	3.076496	0.55753	.	.	ENSG00000175054	ENST00000350721;ENST00000383101	T;T	0.03889	3.77;3.81	5.34	2.05	0.26809	PIK-related kinase (1);Tetratricopeptide-like helical (1);	0.000000	0.64402	D	0.000001	T	0.13884	0.0336	M	0.75447	2.3	0.58432	D	0.999997	D	0.69078	0.997	D	0.65987	0.94	T	0.02031	-1.1226	10	0.38643	T	0.18	-9.5255	5.5723	0.17204	0.5265:0.0:0.4735:0.0	.	1749	Q13535	ATR_HUMAN	M	1749;1685	ENSP00000343741:L1749M;ENSP00000372581:L1685M	ENSP00000343741:L1749M	L	-	1	2	ATR	143704937	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.116000	0.50399	0.730000	0.32425	0.591000	0.81541	CTG			0.299	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000353995.2		NM_001184	
N4BP2	55728	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	40154443	40154443	+	Silent	SNP	G	G	T			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr4:40154443G>T	ENST00000261435.6	+	17	5603	c.5187G>T	c.(5185-5187)acG>acT	p.T1729T		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	1729	Smr. {ECO:0000255|PROSITE- ProRule:PRU00321}.				nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						CTGTGATTACGGGGAGAGGAA	0.418																																					p.T1729T													.	.			0			c.G5187T												130.0	118.0	122.0					4																	40154443		2203	4300	6503	SO:0001819	synonymous_variant	55728	exon17			GATTACGGGGAGA	AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.5187G>T	4.37:g.40154443G>T			Somatic	203	0	0		WXS	Illumina HiSeq	.	199	0.04	8	NM_018177	20	0.00	0	A0AVR3|Q9NVK2|Q9P2D4	Silent	SNP	ENST00000261435.6	37	CCDS3457.1	.	.	.	.	.	.	.	.	.	.	G	8.970	0.972707	0.18736	.	.	ENSG00000078177	ENST00000513269	.	.	.	5.83	-0.334	0.12666	.	.	.	.	.	T	0.42585	0.1209	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.20075	-1.0286	4	.	.	.	-10.6497	2.7943	0.05397	0.1203:0.1934:0.2688:0.4176	.	.	.	.	W	1359	.	.	G	+	1	0	N4BP2	39830838	0.997000	0.39634	0.982000	0.44146	0.982000	0.71751	0.417000	0.21214	-0.428000	0.07339	0.655000	0.94253	GGG			0.418	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250458.2		NM_018177	
COL25A1	84570	mdanderson.org	37	4	110223132	110223132	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr4:110223132G>T	ENST00000399132.1	-	2	574	c.44C>A	c.(43-45)cCc>cAc	p.P15H	COL25A1_ENST00000399126.1_Missense_Mutation_p.P15H|COL25A1_ENST00000399127.1_Missense_Mutation_p.P15H|AC004051.2_ENST00000500526.1_lincRNA	NM_198721.2	NP_942014.1			collagen, type XXV, alpha 1											NS(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	49		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		CTCGGATCTGGGCTCCCGGCC	0.667																																					p.P15H													.	.			0			c.C44A												34.0	38.0	37.0					4																	110223132		1967	4147	6114	SO:0001583	missense	84570	exon2			GATCTGGGCTCCC	AF293340	CCDS43258.1, CCDS43259.1, CCDS58922.1	4q25	2013-01-16			ENSG00000188517	ENSG00000188517		"""Collagens"""	18603	protein-coding gene	gene with protein product		610004				11927537	Standard	NM_001256074		Approved		uc003hze.2	Q9BXS0	OTTHUMG00000150039	ENST00000399132.1:c.44C>A	4.37:g.110223132G>T	ENSP00000382083:p.Pro15His		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_032518	1	0.00	0		Missense_Mutation	SNP	ENST00000399132.1	37	CCDS43258.1	.	.	.	.	.	.	.	.	.	.	G	8.961	0.970468	0.18659	.	.	ENSG00000188517	ENST00000399132;ENST00000333642;ENST00000401873;ENST00000399127;ENST00000399126;ENST00000443653;ENST00000505591	D;D;D	0.91631	-2.66;-2.78;-2.88	4.88	3.15	0.36227	.	0.347267	0.21337	N	0.076198	T	0.80737	0.4680	N	0.14661	0.345	0.09310	N	1	B;B;B	0.32693	0.232;0.115;0.38	B;B;B	0.34138	0.12;0.176;0.085	T	0.68265	-0.5454	9	.	.	.	1.8489	2.1792	0.03870	0.1678:0.1559:0.5148:0.1615	.	15;15;15	A8MWQ5;Q9BXS0-2;Q9BXS0	.;.;COPA1_HUMAN	H	15	ENSP00000382083:P15H;ENSP00000382078:P15H;ENSP00000382077:P15H	.	P	-	2	0	COL25A1	110442581	0.000000	0.05858	0.006000	0.13384	0.001000	0.01503	0.445000	0.21677	0.775000	0.33450	-0.268000	0.10319	CCC			0.667	COL25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000315938.2		NM_032518	
TRAM1L1	133022	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	118006336	118006336	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr4:118006336G>A	ENST00000310754.4	-	1	400	c.214C>T	c.(214-216)Ctc>Ttc	p.L72F		NM_152402.2	NP_689615.2	Q8N609	TR1L1_HUMAN	translocation associated membrane protein 1-like 1	72					protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22						TAATAATAGAGGGACTTTGAG	0.453																																					p.L72F													.	.			0			c.C214T												67.0	67.0	67.0					4																	118006336		2203	4300	6503	SO:0001583	missense	133022	exon1			AATAGAGGGACTT	AK074617	CCDS3707.1	4q26	2008-02-05			ENSG00000174599	ENSG00000174599			28371	protein-coding gene	gene with protein product						12477932	Standard	NM_152402		Approved	MGC26568	uc003ibv.4	Q8N609	OTTHUMG00000132956	ENST00000310754.4:c.214C>T	4.37:g.118006336G>A	ENSP00000309402:p.Leu72Phe		Somatic	181	0	0		WXS	Illumina HiSeq	.	114	0.17	19	NM_152402	0		0	Q8N2L7	Missense_Mutation	SNP	ENST00000310754.4	37	CCDS3707.1	.	.	.	.	.	.	.	.	.	.	G	1.748	-0.489993	0.04322	.	.	ENSG00000174599	ENST00000310754	T	0.44482	0.92	4.4	3.56	0.40772	TRAM1-like protein (1);	0.369461	0.28338	N	0.015703	T	0.28101	0.0693	L	0.41573	1.285	0.09310	N	0.999996	B	0.12013	0.005	B	0.20384	0.029	T	0.14227	-1.0480	10	0.14656	T	0.56	2.5641	5.6083	0.17391	0.0989:0.0:0.7065:0.1946	.	72	Q8N609	TR1L1_HUMAN	F	72	ENSP00000309402:L72F	ENSP00000309402:L72F	L	-	1	0	TRAM1L1	118225784	1.000000	0.71417	0.031000	0.17742	0.062000	0.15995	2.113000	0.41902	1.446000	0.47643	0.655000	0.94253	CTC			0.453	TRAM1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256513.1		NM_152402	
PCDHA9	9752	mdanderson.org	37	5	140229869	140229869	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr5:140229869G>C	ENST00000532602.1	+	1	2822	c.1789G>C	c.(1789-1791)Gtg>Ctg	p.V597L	PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA9_ENST00000378122.3_Missense_Mutation_p.V597L|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000529310.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	597	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTGCGCGCAGTGGACGCCGA	0.687																																					p.V597L	Melanoma(55;1800 1972 14909)												.	.			0			c.G1789C												62.0	68.0	66.0					5																	140229869		2196	4267	6463	SO:0001583	missense	9752	exon1			CGCGCAGTGGACG	AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.1789G>C	5.37:g.140229869G>C	ENSP00000436042:p.Val597Leu		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_031857	0		0	O15053|Q2M3S5	Missense_Mutation	SNP	ENST00000532602.1	37	CCDS54920.1	.	.	.	.	.	.	.	.	.	.	G	9.170	1.021022	0.19433	.	.	ENSG00000204961	ENST00000532602;ENST00000378122	T;T	0.51817	0.69;0.69	3.36	3.36	0.38483	Cadherin (4);Cadherin-like (1);	0.000000	0.29066	U	0.013244	T	0.64000	0.2559	M	0.67569	2.06	0.09310	N	1	D;D	0.67145	0.995;0.996	D;D	0.77557	0.946;0.99	T	0.55276	-0.8166	10	0.87932	D	0	.	12.1102	0.53836	0.0:0.1745:0.8255:0.0	.	597;597	Q9Y5H5;Q9Y5H5-2	PCDA9_HUMAN;.	L	597	ENSP00000436042:V597L;ENSP00000367362:V597L	ENSP00000367362:V597L	V	+	1	0	PCDHA9	140210053	0.004000	0.15560	0.994000	0.49952	0.286000	0.27126	0.345000	0.19979	1.839000	0.53478	0.313000	0.20887	GTG			0.687	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000372896.2		NM_031857	
FAM196B	100131897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	169309671	169309671	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr5:169309671T>A	ENST00000377365.3	-	2	2613	c.1232A>T	c.(1231-1233)gAc>gTc	p.D411V	DOCK2_ENST00000520908.1_Intron|DOCK2_ENST00000256935.8_Intron|FAM196B_ENST00000523970.1_5'Flank|DOCK2_ENST00000523351.1_Intron|DOCK2_ENST00000540750.1_Intron	NM_001129891.1	NP_001123363.1	A6NMK8	F196B_HUMAN	family with sequence similarity 196, member B	411										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)|skin(1)	5						GCCTTGGAGGTCGCAGAGTTC	0.458																																					p.D411V													.	.			0			c.A1232T												87.0	78.0	81.0					5																	169309671		692	1591	2283	SO:0001583	missense	100131897	exon2			TGGAGGTCGCAGA		CCDS47336.1	5q35.1	2010-02-17	2009-09-11	2009-09-11	ENSG00000204767	ENSG00000204767			37271	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 57"""	C5orf57			Standard	NM_001129891		Approved		uc003mag.2	A6NMK8	OTTHUMG00000163083	ENST00000377365.3:c.1232A>T	5.37:g.169309671T>A	ENSP00000366582:p.Asp411Val		Somatic	143	0	0		WXS	Illumina HiSeq	.	104	0.13	14	NM_001129891	0		0		Missense_Mutation	SNP	ENST00000377365.3	37	CCDS47336.1	.	.	.	.	.	.	.	.	.	.	T	15.39	2.818183	0.50633	.	.	ENSG00000204767	ENST00000377365	T	0.58797	0.31	5.09	5.09	0.68999	.	0.263355	0.36703	N	0.002459	T	0.58779	0.2146	N	0.24115	0.695	0.44188	D	0.997004	D	0.63880	0.993	P	0.61533	0.89	T	0.63506	-0.6622	10	0.87932	D	0	-23.7627	10.9279	0.47201	0.0:0.0:0.2883:0.7117	.	411	A6NMK8	F196B_HUMAN	V	411	ENSP00000366582:D411V	ENSP00000366582:D411V	D	-	2	0	FAM196B	169242249	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.775000	0.47702	2.054000	0.61138	0.533000	0.62120	GAC			0.458	FAM196B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000371629.1		NM_001129891	
SSR1	6745	mdanderson.org	37	6	7313285	7313285	+	Silent	SNP	G	G	T			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr6:7313285G>T	ENST00000244763.4	-	1	155	c.69C>A	c.(67-69)ggC>ggA	p.G23G	SSR1_ENST00000488834.1_Intron|SSR1_ENST00000479365.1_Silent_p.G23G|SSR1_ENST00000489567.1_Silent_p.G23G|SSR1_ENST00000462112.1_Silent_p.G23G|SSR1_ENST00000397511.2_Silent_p.G23G|SSR1_ENST00000534851.1_Silent_p.G23G|SSR1_ENST00000474597.1_Silent_p.G23G	NM_003144.3	NP_003135.2	P43307	SSRA_HUMAN	signal sequence receptor, alpha	23					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|positive regulation of cell proliferation (GO:0008284)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|large_intestine(3)|lung(2)|prostate(1)	9	Ovarian(93;0.0398)					CTCTGGGGCCGCCTCGGAACA	0.637																																					p.G23G													.	.			0			c.C69A												45.0	43.0	44.0					6																	7313285		2194	4285	6479	SO:0001819	synonymous_variant	6745	exon1			GGGGCCGCCTCGG		CCDS4499.1	6p24.3	2010-11-24	2008-08-26		ENSG00000124783	ENSG00000124783			11323	protein-coding gene	gene with protein product	"""translocon-associated protein alpha"""	600868					Standard	NM_001292008		Approved	TRAPA	uc003mxf.4	P43307	OTTHUMG00000014202	ENST00000244763.4:c.69C>A	6.37:g.7313285G>T			Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_003144	75	0.00	0	A8K685|Q53GX2|Q53H19|Q5TAM3|Q6IB43|Q8NBH9|Q96IA2|Q9TNQ8|Q9UN49	Silent	SNP	ENST00000244763.4	37	CCDS4499.1																																																																																					0.637	SSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039775.2			
ITPR3	3710	broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	33638313	33638313	+	Missense_Mutation	SNP	C	C	T	rs147317574		TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr6:33638313C>T	ENST00000374316.5	+	20	3461	c.2401C>T	c.(2401-2403)Cgt>Tgt	p.R801C	ITPR3_ENST00000605930.1_Missense_Mutation_p.R801C			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	801					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	CAAGTTTGCCCGTCTCTGGAC	0.647																																					p.R801C													.	ITPR3	409		0			c.C2401T							C	CYS/ARG	0,4406		0,0,2203	71.0	66.0	67.0		2401	4.9	1.0	6	dbSNP_134	67	1,8599	1.2+/-3.3	0,1,4299	no	missense	ITPR3	NM_002224.3	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	801/2672	33638313	1,13005	2203	4300	6503	SO:0001583	missense	3710	exon19			TTTGCCCGTCTCT	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.2401C>T	6.37:g.33638313C>T	ENSP00000363435:p.Arg801Cys		Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	85	0.06	5	NM_002224	0		0	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	37	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	C	32	5.176606	0.94846	0.0	1.16E-4	ENSG00000096433	ENST00000374316	D	0.95690	-3.78	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	D	0.97763	0.9266	M	0.84948	2.725	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98730	1.0712	10	0.87932	D	0	-24.4877	18.1189	0.89565	0.0:1.0:0.0:0.0	.	801	Q14573	ITPR3_HUMAN	C	801	ENSP00000363435:R801C	ENSP00000363435:R801C	R	+	1	0	ITPR3	33746291	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.728000	0.84847	2.281000	0.76405	0.563000	0.77884	CGT			0.647	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040204.2		NM_002224	
GTF2IRD2P1	401375	broad.mit.edu	37	7	72667516	72667516	+	RNA	DEL	A	A	-			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr7:72667516delA	ENST00000425256.1	-	0	711									GTF2I repeat domain containing 2 pseudogene 1																		ACCCTATGTCAAAAAATAATT	0.353																																					.													.	.			0			.																																											0	.			TATGTCAAAAAAT	AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72667516delA			Somatic	880	0	0		WXS	Illumina HiSeq	Phase_I	1005	0.01	7	.	0		0		RNA	DEL	ENST00000425256.1	37																																																																																						0.353	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000345921.1		NR_002164	
SDC2	6383	mdanderson.org	37	8	97506502	97506502	+	Start_Codon_SNP	SNP	G	G	T			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr8:97506502G>T	ENST00000302190.4	+	1	924	c.3G>T	c.(1-3)atG>atT	p.M1I	SDC2_ENST00000522911.1_Intron|SDC2_ENST00000520233.1_3'UTR|SDC2_ENST00000518385.1_Start_Codon_SNP_p.M1I	NM_002998.3	NP_002989.2	P34741	SDC2_HUMAN	syndecan 2	1					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dendrite morphogenesis (GO:0048813)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|regulation of dendrite morphogenesis (GO:0048814)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)			breast(1)|cervix(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|stomach(2)	16	Breast(36;3.41e-05)				Sargramostim(DB00020)	TGGGGAATATGCGGCGCGCGT	0.692																																					p.M1I													.	.			0			c.G3T												32.0	32.0	32.0					8																	97506502		2123	4174	6297	SO:0001582	initiator_codon_variant	6383	exon1			GAATATGCGGCGC	BC030133	CCDS6272.1	8q22-q23	2011-08-11	2007-02-15		ENSG00000169439	ENSG00000169439		"""Proteoglycans / Cell Surface : Syndecans"", ""CD molecules"""	10659	protein-coding gene	gene with protein product	"""syndecan proteoglycan 2"""	142460	"""heparan sulfate proteoglycan 1, cell surface-associated"""	HSPG, HSPG1		8187643	Standard	NM_002998		Approved	fibroglycan, SYND2, CD362	uc003yhv.1	P34741	OTTHUMG00000164689	ENST00000302190.4:c.3G>T	8.37:g.97506502G>T	ENSP00000307046:p.Met1Ile		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	24	0.08	2	NM_002998	32	0.00	0	B3KQA3|Q6PIS6|Q9H6V1	Missense_Mutation	SNP	ENST00000302190.4	37	CCDS6272.1	.	.	.	.	.	.	.	.	.	.	G	10.72	1.428909	0.25726	.	.	ENSG00000169439	ENST00000302190;ENST00000518385;ENST00000545117;ENST00000546193	T;T	0.36340	1.46;1.26	4.55	3.68	0.42216	.	0.198001	0.42420	D	0.000713	T	0.29945	0.0749	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.13255	-1.0516	9	0.87932	D	0	-9.4888	9.8338	0.40958	0.0978:0.0:0.9022:0.0	.	1	P34741	SDC2_HUMAN	I	1	ENSP00000307046:M1I;ENSP00000429045:M1I	ENSP00000307046:M1I	M	+	3	0	SDC2	97575678	1.000000	0.71417	0.998000	0.56505	0.079000	0.17450	3.282000	0.51693	1.133000	0.42147	-0.251000	0.11542	ATG			0.692	SDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000379750.1		NM_002998	Missense_Mutation
AGO2	27161	mdanderson.org	37	8	141551323	141551323	+	Silent	SNP	G	G	T	rs536908785		TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr8:141551323G>T	ENST00000220592.5	-	15	2086	c.1974C>A	c.(1972-1974)cgC>cgA	p.R658R	AGO2_ENST00000519980.1_Silent_p.R658R	NM_012154.3	NP_036286.2	Q9UKV8	AGO2_HUMAN	argonaute RISC catalytic component 2	658	Interaction with GW182 family members. {ECO:0000255}.|Piwi. {ECO:0000255|HAMAP-Rule:MF_03031}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|mRNA cap binding complex (GO:0005845)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|RISC complex (GO:0016442)	endoribonuclease activity (GO:0004521)|endoribonuclease activity, cleaving siRNA-paired mRNA (GO:0070551)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|siRNA binding (GO:0035197)|translation initiation factor activity (GO:0003743)										TGGGCTTGAAGCGCGTGGACT	0.627																																					p.R658R													.	.			0			c.C1974A												115.0	89.0	98.0					8																	141551323		2202	4300	6502	SO:0001819	synonymous_variant	27161	exon15			CTTGAAGCGCGTG	AF121255	CCDS6380.1, CCDS55279.1	8q24.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000123908	ENSG00000123908		"""Argonaute/PIWI family"""	3263	protein-coding gene	gene with protein product	"""argonaute 2"""	606229	"""eukaryotic translation initiation factor 2C, 2"""	EIF2C2		10534406, 12906857	Standard	NM_012154		Approved	hAGO2, Q10	uc003yvn.3	Q9UKV8	OTTHUMG00000164232	ENST00000220592.5:c.1974C>A	8.37:g.141551323G>T			Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	71	0.06	4	NM_012154	12	0.00	0	Q8TCZ5|Q8WV58|Q96ID1	Silent	SNP	ENST00000220592.5	37	CCDS6380.1																																																																																					0.627	AGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000377866.4			
TRPM6	140803	mdanderson.org	37	9	77359051	77359051	+	Silent	SNP	G	G	T			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chr9:77359051G>T	ENST00000360774.1	-	32	5331	c.5094C>A	c.(5092-5094)gcC>gcA	p.A1698A	TRPM6_ENST00000361255.3_Silent_p.A1693A|TRPM6_ENST00000449912.2_Silent_p.A1693A|TRPM6_ENST00000451710.3_Silent_p.A1702A|TRPM6_ENST00000376871.3_Silent_p.A535A|TRPM6_ENST00000376864.4_Silent_p.A1702A|TRPM6_ENST00000376872.3_Silent_p.A653A	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1698					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						TTTTTAAGGAGGCTGAGATCT	0.373																																					p.A1698A													.	.			0			c.C5094A												158.0	149.0	152.0					9																	77359051		2203	4300	6503	SO:0001819	synonymous_variant	140803	exon32			TAAGGAGGCTGAG	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.5094C>A	9.37:g.77359051G>T			Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	58	0.05	3	NM_017662	1	0.00	0	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Silent	SNP	ENST00000360774.1	37	CCDS6647.1																																																																																					0.373	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000052693.1		NM_017662	
NUDT10	170685	bcgsc.ca	37	X	51075767	51075767	+	5'UTR	SNP	T	T	A			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chrX:51075767T>A	ENST00000376006.3	+	0	170				NUDT10_ENST00000356450.2_5'UTR	NM_153183.2	NP_694853.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 10						ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)			cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	16	Ovarian(276;0.236)					CGGCAGCAGCTGCGTCGGCGG	0.692																																					.	NSCLC(90;1817 2035 37909 38249)												.	NUDT10	28		0			.												10.0	8.0	9.0					X																	51075767		1994	3887	5881	SO:0001623	5_prime_UTR_variant	170685	.			AGCAGCTGCGTCG	AF469196	CCDS35278.1	Xp11.22-p11.1	2014-05-20			ENSG00000122824	ENSG00000122824		"""Nudix motif containing"""	17621	protein-coding gene	gene with protein product		300527				12105228	Standard	NM_153183		Approved	DIPP3a, hDIPP3alpha	uc004dph.3	Q8NFP7	OTTHUMG00000021530	ENST00000376006.3:c.-51T>A	X.37:g.51075767T>A			Somatic	154	0.012987013	2		WXS	Illumina HiSeq	Phase_1	260	0.08	20	.	12	0.00	0	Q8NBN1|Q8NCB9|Q8NG25	Missense_Mutation	SNP	ENST00000376006.3	37	CCDS35278.1																																																																																					0.692	NUDT10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056578.1		NM_153183	
HMGN5	79366	broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	80370324	80370324	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chrX:80370324C>A	ENST00000358130.2	-	7	1001	c.673G>T	c.(673-675)Gat>Tat	p.D225Y	HMGN5_ENST00000491275.1_5'Flank	NM_030763.2	NP_110390.1	P82970	HMGN5_HUMAN	high mobility group nucleosome binding domain 5	225					chromatin modification (GO:0016568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	10						acttttacatctttcccctct	0.353																																					p.D225Y													.	HMGN5	29		0			c.G673T												325.0	287.0	301.0					X																	80370324		1627	2886	4513	SO:0001583	missense	79366	exon7			TTACATCTTTCCC	AF250329	CCDS14448.1	Xq13.3	2011-07-01	2011-04-05	2009-09-15	ENSG00000198157	ENSG00000198157		"""High-mobility group / Canonical"""	8013	protein-coding gene	gene with protein product		300385	"""nucleosomal binding protein 1"", ""high-mobility group nucleosome binding domain 5"""	NSBP1		11161810, 19748358	Standard	NM_030763		Approved		uc004eee.1	P82970	OTTHUMG00000021911	ENST00000358130.2:c.673G>T	X.37:g.80370324C>A	ENSP00000350848:p.Asp225Tyr		Somatic	256	0	0		WXS	Illumina HiSeq	Phase_I	329	0.03	11	NM_030763	32	0.00	0	Q5JSL1	Missense_Mutation	SNP	ENST00000358130.2	37	CCDS14448.1	.	.	.	.	.	.	.	.	.	.	C	10.85	1.465547	0.26335	.	.	ENSG00000198157	ENST00000358130	.	.	.	3.61	3.61	0.41365	.	0.458443	0.16055	N	0.231772	T	0.20495	0.0493	N	0.08118	0	0.09310	N	1	P	0.47350	0.894	P	0.46543	0.52	T	0.05500	-1.0881	9	0.87932	D	0	.	9.805	0.40789	0.0:1.0:0.0:0.0	.	225	P82970	HMGN5_HUMAN	Y	225	.	ENSP00000350848:D225Y	D	-	1	0	HMGN5	80256980	0.000000	0.05858	0.108000	0.21378	0.022000	0.10575	-0.702000	0.05069	2.063000	0.61619	0.538000	0.68166	GAT			0.353	HMGN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057354.1		NM_030763	
ELF4	2000	broad.mit.edu	37	X	129215228	129215228	+	Splice_Site	SNP	A	A	G			TCGA-2G-AAFO-01A-31D-A42Y-10	TCGA-2G-AAFO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0182096a-fcfd-4c9a-837f-e329734c86f8	2a0fd75c-32f0-4393-a404-dd5568031036	g.chrX:129215228A>G	ENST00000308167.5	-	2	455		c.e2+1		ELF4_ENST00000335997.7_Splice_Site	NM_001421.3	NP_001412.1			E74-like factor 4 (ets domain transcription factor)											breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	22						CTGGGGCCATACCTGGTGGAT	0.537			T	ERG	AML																																.				Dom	yes		X	Xq26	2000	E74-like factor 4 (ets domain transcription factor)		L	.	ELF4	67		0			c.75+2T>C												231.0	174.0	193.0					X																	129215228		2203	4300	6503	SO:0001630	splice_region_variant	2000	exon3			GGCCATACCTGGT	U32645	CCDS14617.1	Xq26	2014-09-17			ENSG00000102034	ENSG00000102034			3319	protein-coding gene	gene with protein product		300775				8895518	Standard	NM_001421		Approved	MEF, ELFR	uc004eve.4	Q99607	OTTHUMG00000022390	ENST00000308167.5:c.75+1T>C	X.37:g.129215228A>G			Somatic	148	0	0		WXS	Illumina HiSeq	Phase_I	189	0.02	3	NM_001421	0		0		Splice_Site	SNP	ENST00000308167.5	37	CCDS14617.1	.	.	.	.	.	.	.	.	.	.	A	17.11	3.306633	0.60305	.	.	ENSG00000102034	ENST00000335997;ENST00000308167;ENST00000434609	.	.	.	4.38	4.38	0.52667	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.2975	0.37824	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ELF4	129042909	1.000000	0.71417	0.992000	0.48379	0.909000	0.53808	6.101000	0.71479	1.523000	0.49018	0.356000	0.21956	.			0.537	ELF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058243.1		NM_001421	Intron
