#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
KIF1B	23095	broad.mit.edu	37	1	10342466	10342466	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr1:10342466G>A	ENST00000377086.1	+	15	1511	c.1309G>A	c.(1309-1311)Ggg>Agg	p.G437R	KIF1B_ENST00000263934.6_Missense_Mutation_p.G391R|KIF1B_ENST00000377083.1_Missense_Mutation_p.G391R|KIF1B_ENST00000377093.4_Missense_Mutation_p.G391R|KIF1B_ENST00000377081.1_Missense_Mutation_p.G437R			O60333	KIF1B_HUMAN	kinesin family member 1B	437					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		AGCATCCATGGGGTCCCTCAC	0.478																																					p.G391R													.	KIF1B	242		0			c.G1171A												133.0	122.0	126.0					1																	10342466		2203	4300	6503	SO:0001583	missense	23095	exon13			TCCATGGGGTCCC	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.1309G>A	1.37:g.10342466G>A	ENSP00000366290:p.Gly437Arg		Somatic	157	0	0		WXS	Illumina HiSeq	Phase_I	166	0.03	5	NM_183416	13	0.08	1	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	ENST00000377086.1	37		.	.	.	.	.	.	.	.	.	.	G	17.50	3.404819	0.62288	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377093;ENST00000377086;ENST00000377083;ENST00000377081	T;T;T;T;T	0.73789	-0.63;-0.78;-0.57;-0.78;-0.58	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.65760	0.2722	N	0.19112	0.55	0.54753	D	0.999984	B;P;P;D;B;B;P	0.57257	0.003;0.612;0.528;0.979;0.201;0.343;0.889	B;B;B;B;B;B;P	0.50314	0.002;0.171;0.101;0.381;0.034;0.225;0.637	T	0.60855	-0.7180	10	0.16420	T	0.52	.	12.8703	0.57960	0.0745:0.0:0.9255:0.0	.	423;397;437;411;437;391;391	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2;O60333-3	.;.;.;.;KIF1B_HUMAN;.;.	R	437;391;391;437;391;437	ENSP00000263934:G391R;ENSP00000366297:G391R;ENSP00000366290:G437R;ENSP00000366287:G391R;ENSP00000366284:G437R	ENSP00000263934:G391R	G	+	1	0	KIF1B	10265053	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.004000	0.88535	2.713000	0.92767	0.650000	0.86243	GGG			0.478	KIF1B-001	NOVEL	basic	protein_coding	protein_coding		OTTHUMT00000005102.1	rescued with RNA-seq		
THEMIS2	9473	bcgsc.ca	37	1	28206532	28206532	+	Missense_Mutation	SNP	C	C	T	rs550315014		TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr1:28206532C>T	ENST00000373921.3	+	3	617	c.613C>T	c.(613-615)Cgg>Tgg	p.R205W	THEMIS2_ENST00000373927.3_Intron|THEMIS2_ENST00000328928.7_Missense_Mutation_p.R205W|THEMIS2_ENST00000373925.1_Missense_Mutation_p.R205W	NM_001105556.1	NP_001099026.1	Q5TEJ8	THMS2_HUMAN	thymocyte selection associated family member 2	205	CABIT 1.				cell adhesion (GO:0007155)|inflammatory response (GO:0006954)|T cell receptor signaling pathway (GO:0050852)	cytoplasm (GO:0005737)|nucleus (GO:0005634)											CCTGATCCTGCGGCCCCAGTA	0.627																																					p.R205W													.	.			0			c.C613T												38.0	33.0	35.0					1																	28206532		2203	4300	6503	SO:0001583	missense	9473	exon3			ATCCTGCGGCCCC	AF044896	CCDS30653.1, CCDS30654.1, CCDS41290.1, CCDS65461.1	1p35.2	2012-07-10	2012-07-10	2012-07-10	ENSG00000130775	ENSG00000130775			16839	protein-coding gene	gene with protein product	"""induced by contact to basement membrane 1"""		"""chromosome 1 open reading frame 38"""	C1orf38		16219472	Standard	XM_005246041		Approved	ICB-1, Icb-1	uc001bpc.4	Q5TEJ8	OTTHUMG00000003735	ENST00000373921.3:c.613C>T	1.37:g.28206532C>T	ENSP00000363031:p.Arg205Trp		Somatic	138	0	0		WXS	Illumina HiSeq	Phase_1	104	0.06	6	NM_004848	19	0.00	0	A2RTZ3|B4DZT9|B4DZY3|O60560|Q5TEJ1|Q5TEJ9|Q5TEK1|Q68DP4|Q9BYB6|Q9NS90	Missense_Mutation	SNP	ENST00000373921.3	37	CCDS41290.1	.	.	.	.	.	.	.	.	.	.	C	12.27	1.888443	0.33348	.	.	ENSG00000130775	ENST00000373925;ENST00000328928;ENST00000373921	T;T;T	0.14391	2.51;2.51;2.51	4.81	0.99	0.19807	.	1.013840	0.07899	N	0.972325	T	0.29423	0.0733	L	0.57536	1.79	0.09310	N	1	D;D;D	0.76494	0.996;0.999;0.999	P;D;D	0.69654	0.736;0.965;0.941	T	0.15694	-1.0428	10	0.72032	D	0.01	-4.4009	7.1895	0.25818	0.4938:0.3813:0.0:0.1248	.	205;205;205	Q5TEJ8-5;Q5TEJ8;Q5TEJ8-2	.;THMS2_HUMAN;.	W	205	ENSP00000363035:R205W;ENSP00000329862:R205W;ENSP00000363031:R205W	ENSP00000329862:R205W	R	+	1	2	C1orf38	28079119	0.001000	0.12720	0.082000	0.20525	0.078000	0.17371	-0.064000	0.11636	0.791000	0.33826	-0.410000	0.06199	CGG			0.627	THEMIS2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000011148.1		NM_004848	
COL16A1	1307	mdanderson.org	37	1	32137261	32137261	+	Splice_Site	SNP	C	C	A			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr1:32137261C>A	ENST00000373672.3	-	48	3622		c.e48-1		COL16A1_ENST00000271069.6_Splice_Site	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1						cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		CAGGCGGACCCTGCAAAGGAA	0.602																																					.	Colon(143;498 1786 21362 25193 36625)												.	.			0			c.3106-1G>T												42.0	49.0	47.0					1																	32137261		1903	4120	6023	SO:0001630	splice_region_variant	1307	exon49			CGGACCCTGCAAA	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.3106-1G>T	1.37:g.32137261C>A			Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	87	0.05	4	NM_001856	7	0.00	0	Q16593|Q59F89|Q71RG9	Splice_Site	SNP	ENST00000373672.3	37	CCDS41297.1	.	.	.	.	.	.	.	.	.	.	C	19.44	3.827320	0.71143	.	.	ENSG00000084636	ENST00000373672;ENST00000271069	.	.	.	5.21	5.21	0.72293	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6242	0.68608	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL16A1	31909848	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.679000	0.46909	2.599000	0.87857	0.655000	0.94253	.			0.602	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000011057.2		NM_001856	Intron
PTPRF	5792	mdanderson.org	37	1	44085236	44085236	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr1:44085236G>T	ENST00000359947.4	+	28	5264	c.4924G>T	c.(4924-4926)Gag>Tag	p.E1642*	PTPRF_ENST00000422171.2_Nonsense_Mutation_p.E1001*|PTPRF_ENST00000372413.3_Nonsense_Mutation_p.E1633*|PTPRF_ENST00000496447.1_3'UTR|PTPRF_ENST00000372414.3_Nonsense_Mutation_p.E1642*|PTPRF_ENST00000438120.1_Nonsense_Mutation_p.E1633*	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	1642	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CATGGAGCTCGAGTTCAAGGT	0.652																																					p.E1642X													.	.			0			c.G4924T												41.0	44.0	43.0					1																	44085236		2203	4299	6502	SO:0001587	stop_gained	5792	exon28			GAGCTCGAGTTCA	Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.4924G>T	1.37:g.44085236G>T	ENSP00000353030:p.Glu1642*		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_002840	252	0.00	0	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Nonsense_Mutation	SNP	ENST00000359947.4	37	CCDS489.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.533639|5.533639	0.96460|0.96460	.|.	.|.	ENSG00000142949|ENSG00000142949	ENST00000359947;ENST00000438120;ENST00000372414;ENST00000372413;ENST00000422171;ENST00000372407|ENST00000412568;ENST00000414879	.|.	.|.	.|.	4.87|4.87	4.87|4.87	0.63330|0.63330	.|.	0.000000|.	0.34750|.	N|.	0.003720|.	.|T	.|0.74658	.|0.3745	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73658	.|-0.3913	.|3	0.87932|.	D|.	0|.	.|.	18.895|18.895	0.92420|0.92420	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	1642;1633;1642;1633;1001;714|1025;1066	.|.	ENSP00000353030:E1642X|.	E|R	+|+	1|2	0|0	PTPRF|PTPRF	43857823|43857823	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.588000|0.588000	0.36517|0.36517	9.807000|9.807000	0.99171|0.99171	2.629000|2.629000	0.89072|0.89072	0.555000|0.555000	0.69702|0.69702	GAG|CGA			0.652	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000019710.1			
SSBP3	23648	broad.mit.edu	37	1	54871665	54871665	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr1:54871665T>C	ENST00000371320.3	-	1	427	c.17A>G	c.(16-18)aAa>aGa	p.K6R	SSBP3_ENST00000417664.2_5'Flank|SSBP3_ENST00000357475.4_Missense_Mutation_p.K6R|SSBP3_ENST00000371319.3_Missense_Mutation_p.K6R	NM_145716.2	NP_663768.1	Q9BWW4	SSBP3_HUMAN	single stranded DNA binding protein 3	6					head morphogenesis (GO:0060323)|hematopoietic progenitor cell differentiation (GO:0002244)|midbrain-hindbrain boundary initiation (GO:0021547)|positive regulation of anterior head development (GO:2000744)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prechordal plate formation (GO:0021501)|protein complex assembly (GO:0006461)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|protein complex (GO:0043234)	single-stranded DNA binding (GO:0003697)			central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	11						CGCCGAGCCTTTGCCTTTGGC	0.736																																					p.K6R													.	SSBP3	65		0			c.A17G												4.0	5.0	5.0					1																	54871665		2079	4010	6089	SO:0001583	missense	23648	exon1			GAGCCTTTGCCTT		CCDS590.1, CCDS591.1, CCDS30726.1	1p32.3	2008-02-05	2001-11-28		ENSG00000157216	ENSG00000157216			15674	protein-coding gene	gene with protein product		607390	"""single-stranded DNA-binding protein 3"""			12079286	Standard	NM_145716		Approved	CSDP, SSDP, FLJ10355, SSDP1	uc001cxe.4	Q9BWW4	OTTHUMG00000008264	ENST00000371320.3:c.17A>G	1.37:g.54871665T>C	ENSP00000360371:p.Lys6Arg		Somatic	112	0.0089285714	1		WXS	Illumina HiSeq	Phase_I	134	0.08	11	NM_001009955	177	0.00	0	A8K0A9|Q5T860|Q5T861|Q9BTM0|Q9BWW3	Missense_Mutation	SNP	ENST00000371320.3	37	CCDS591.1	.	.	.	.	.	.	.	.	.	.	T	14.81	2.645914	0.47258	.	.	ENSG00000157216	ENST00000371320;ENST00000371319;ENST00000357475	.	.	.	2.64	2.64	0.31445	.	0.000000	0.46758	U	0.000271	T	0.45155	0.1328	L	0.38838	1.175	0.35702	D	0.815734	B;B;B	0.18968	0.02;0.004;0.032	B;B;B	0.24006	0.018;0.012;0.05	T	0.52540	-0.8562	9	0.62326	D	0.03	.	8.2855	0.31926	0.0:0.0:0.0:1.0	.	6;6;6	Q9BWW4-2;Q9BWW4-3;Q9BWW4	.;.;SSBP3_HUMAN	R	6	.	ENSP00000350067:K6R	K	-	2	0	SSBP3	54644253	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	3.586000	0.53950	0.978000	0.38470	0.240000	0.17902	AAA			0.736	SSBP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000022721.1		NM_018070	
ACADM	34	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	76228425	76228425	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr1:76228425C>G	ENST00000370841.4	+	12	1680	c.1243C>G	c.(1243-1245)Cac>Gac	p.H415D	ACADM_ENST00000543667.1_Missense_Mutation_p.H226D|ACADM_ENST00000481374.1_Intron|ACADM_ENST00000370834.5_Missense_Mutation_p.H448D|ACADM_ENST00000541113.1_Missense_Mutation_p.H379D|ACADM_ENST00000420607.2_Missense_Mutation_p.H419D	NM_000016.4|NM_001127328.1	NP_000007.1|NP_001120800.1	P11310	ACADM_HUMAN	acyl-CoA dehydrogenase, C-4 to C-12 straight chain	415					cardiac muscle cell differentiation (GO:0055007)|carnitine biosynthetic process (GO:0045329)|carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|glycogen biosynthetic process (GO:0005978)|liver development (GO:0001889)|medium-chain fatty acid catabolic process (GO:0051793)|medium-chain fatty acid metabolic process (GO:0051791)|oxidation-reduction process (GO:0055114)|post-embryonic development (GO:0009791)|regulation of gluconeogenesis (GO:0006111)|response to cold (GO:0009409)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	axon (GO:0030424)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|identical protein binding (GO:0042802)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)			breast(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|skin(1)	18					Flavin adenine dinucleotide(DB03147)	AGCCCGTGAACACATTGACAA	0.294																																					p.H419D													.	ACADM	50		0			c.C1255G												32.0	34.0	33.0					1																	76228425		2192	4277	6469	SO:0001583	missense	34	exon12			CGTGAACACATTG	M16827	CCDS668.1, CCDS44165.1, CCDS65562.1, CCDS72807.1	1p31	2014-09-17	2010-04-30		ENSG00000117054	ENSG00000117054	1.3.99.3		89	protein-coding gene	gene with protein product		607008	"""acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain"""			3035565	Standard	NM_000016		Approved	MCAD, MCADH, ACAD1	uc009wbp.3	P11310	OTTHUMG00000009784	ENST00000370841.4:c.1243C>G	1.37:g.76228425C>G	ENSP00000359878:p.His415Asp		Somatic	408	0.0049019608	2		WXS	Illumina HiSeq	Phase_I	405	0.15	62	NM_001127328	98	0.19	19	Q5T4U4|Q9NYF1	Missense_Mutation	SNP	ENST00000370841.4	37	CCDS668.1	.	.	.	.	.	.	.	.	.	.	C	16.21	3.059856	0.55325	.	.	ENSG00000117054	ENST00000370841;ENST00000370834;ENST00000541113;ENST00000543667;ENST00000420607	D;D;D;D;D	0.95853	-3.83;-3.83;-3.83;-3.83;-3.83	5.87	5.87	0.94306	Acyl-CoA dehydrogenase/oxidase C-terminal (2);	0.203337	0.50627	D	0.000112	D	0.95255	0.8461	N	0.20685	0.6	0.38499	D	0.948183	P;P;P;P	0.48589	0.889;0.912;0.875;0.897	D;P;D;D	0.72075	0.976;0.53;0.96;0.976	D	0.96687	0.9508	10	0.87932	D	0	.	18.7772	0.91915	0.0:1.0:0.0:0.0	.	379;448;419;415	B7Z9I1;Q5T4U5;P11310-2;P11310	.;.;.;ACADM_HUMAN	D	415;448;379;226;419	ENSP00000359878:H415D;ENSP00000359871:H448D;ENSP00000442324:H379D;ENSP00000446176:H226D;ENSP00000409612:H419D	ENSP00000359871:H448D	H	+	1	0	ACADM	76001013	1.000000	0.71417	0.999000	0.59377	0.266000	0.26442	5.112000	0.64634	2.775000	0.95449	0.650000	0.86243	CAC			0.294	ACADM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000026967.1			
SCAMP3	10067	mdanderson.org	37	1	155230121	155230121	+	Splice_Site	SNP	T	T	C	rs568798961		TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr1:155230121T>C	ENST00000302631.3	-	4	495	c.388A>G	c.(388-390)Act>Gct	p.T130A	SCAMP3_ENST00000472397.1_5'UTR|CLK2_ENST00000497188.1_5'Flank|SCAMP3_ENST00000355379.3_Splice_Site_p.T104A	NM_005698.3	NP_005689.2	O14828	SCAM3_HUMAN	secretory carrier membrane protein 3	130					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|response to retinoic acid (GO:0032526)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|large_intestine(3)|lung(7)|ovary(4)|urinary_tract(1)	19	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TATTACTTACTAGCTGTGCCC	0.572													T|||	1	0.000199681	0.0	0.0	5008	,	,		19894	0.0		0.0	False		,,,				2504	0.001				p.T130A													.	.			0			c.A388G												82.0	83.0	83.0					1																	155230121		2203	4300	6503	SO:0001630	splice_region_variant	10067	exon4			ACTTACTAGCTGT	AF005039	CCDS1105.1, CCDS1106.1	1q21	2013-02-21			ENSG00000116521	ENSG00000116521		"""Secretory carrier membrane proteins"""	10565	protein-coding gene	gene with protein product	"""Propin 1"""	606913		C1orf3		9331372, 9658162	Standard	NM_005698		Approved		uc001fjs.3	O14828	OTTHUMG00000035874	ENST00000302631.3:c.388+1A>G	1.37:g.155230121T>C			Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	84	0.05	4	NM_005698	313	0.03	9	A9Z1W6|B1AVS6|O15128|Q96FR8|Q9BPY0	Missense_Mutation	SNP	ENST00000302631.3	37	CCDS1105.1	.	.	.	.	.	.	.	.	.	.	.	6.903	0.536188	0.13188	.	.	ENSG00000116521	ENST00000302631;ENST00000355379	T;T	0.16597	2.62;2.33	4.2	-1.44	0.08856	.	0.474665	0.22365	N	0.061040	T	0.02571	0.0078	L	0.36672	1.1	0.21473	N	0.999678	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.0	T	0.42498	-0.9448	9	.	.	.	-24.0719	1.5364	0.02546	0.1654:0.1046:0.3415:0.3884	.	104;130	O14828-2;O14828	.;SCAM3_HUMAN	A	130;104	ENSP00000307275:T130A;ENSP00000347540:T104A	.	T	-	1	0	SCAMP3	153496745	0.105000	0.21958	0.028000	0.17463	0.214000	0.24535	0.229000	0.17833	-0.354000	0.08212	-0.344000	0.07964	ACT			0.572	SCAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000087399.1		NM_005698	Missense_Mutation
ADORA1	134	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	203098167	203098167	+	Silent	SNP	C	C	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr1:203098167C>T	ENST00000367236.4	+	2	1119	c.198C>T	c.(196-198)gcC>gcT	p.A66A	ADORA1_ENST00000367235.1_Silent_p.A66A|ADORA1_ENST00000337894.4_Silent_p.A66A|RP11-335O13.7_ENST00000421055.1_RNA|ADORA1_ENST00000309502.3_Silent_p.A66A	NM_001048230.1	NP_001041695.1	P30542	AA1R_HUMAN	adenosine A1 receptor	66					activation of MAPKK activity (GO:0000186)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|cognition (GO:0050890)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood pressure (GO:0045776)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, non-REM sleep (GO:0042323)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of heart contraction (GO:0045822)|negative regulation of hormone secretion (GO:0046888)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of mucus secretion (GO:0070256)|negative regulation of neurotrophin production (GO:0032900)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of vasodilation (GO:0045908)|nervous system development (GO:0007399)|phagocytosis (GO:0006909)|positive regulation of blood pressure (GO:0045777)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of nucleoside transport (GO:0032244)|positive regulation of peptide secretion (GO:0002793)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of protein dephosphorylation (GO:0035307)|protein targeting to membrane (GO:0006612)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of glomerular filtration (GO:0003093)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|relaxation of vascular smooth muscle (GO:0060087)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|temperature homeostasis (GO:0001659)	asymmetric synapse (GO:0032279)|axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled adenosine receptor activity (GO:0001609)|phospholipase C activity (GO:0004629)|purine nucleoside binding (GO:0001883)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(9)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	25					Adenosine(DB00640)|Aminophylline(DB01223)|Caffeine(DB00201)|Defibrotide(DB04932)|Dyphylline(DB00651)|Enprofylline(DB00824)|Gabapentin(DB00996)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Theobromine(DB01412)|Theophylline(DB00277)	TCCCCCTCGCCATCCTCATCA	0.632																																					p.A66A													.	.			0			c.C198T												227.0	180.0	196.0					1																	203098167		2203	4300	6503	SO:0001819	synonymous_variant	134	exon2			CCTCGCCATCCTC	BC026340	CCDS1434.1	1q32.1	2012-08-08			ENSG00000163485	ENSG00000163485		"""GPCR / Class A : Adenosine receptors"""	262	protein-coding gene	gene with protein product		102775				1662665, 2541503	Standard	NM_001048230		Approved	RDC7	uc001gzf.1	P30542	OTTHUMG00000042125	ENST00000367236.4:c.198C>T	1.37:g.203098167C>T			Somatic	86	0	0		WXS	Illumina HiSeq	.	191	0.07	13	NM_001048230	10	0.00	0	A6NFY5|A6NGP4|A8K1L3|B3KXQ4|D2CGD0|Q6FHK3|Q8TAM8	Silent	SNP	ENST00000367236.4	37	CCDS1434.1																																																																																					0.632	ADORA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000100273.1		NM_000674	
DUSP10	11221	broad.mit.edu	37	1	221879723	221879723	+	Silent	SNP	G	G	A			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr1:221879723G>A	ENST00000366899.3	-	3	1135	c.897C>T	c.(895-897)ggC>ggT	p.G299G	DUSP10_ENST00000468085.1_5'UTR|DUSP10_ENST00000544095.1_5'UTR|DUSP10_ENST00000323825.3_5'UTR	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10	299					inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.G299G(1)		NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		CCGCGGATGCGCCGCCCCCCA	0.582																																					p.G299G													DUSP10,NS,carcinoma,0,1	DUSP10	64	1	1	Substitution - coding silent(1)	prostate(1)	c.C897T												57.0	66.0	63.0					1																	221879723		2203	4300	6503	SO:0001819	synonymous_variant	11221	exon3			GGATGCGCCGCCC	AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.897C>T	1.37:g.221879723G>A			Somatic	177	0	0		WXS	Illumina HiSeq	Phase_I	221	0.03	6	NM_007207	9	0.00	0	D3DTB4|Q6GSI4|Q9H9Z5	Silent	SNP	ENST00000366899.3	37	CCDS1528.1																																																																																					0.582	DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000090716.1		NM_007207	
KIF26B	55083	mdanderson.org	37	1	245851505	245851505	+	Silent	SNP	G	G	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr1:245851505G>T	ENST00000407071.2	+	12	5660	c.5220G>T	c.(5218-5220)ctG>ctT	p.L1740L	KIF26B_ENST00000366518.4_Silent_p.L1359L	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1740	Ser-rich.				establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			GACTCCTCCTGGCCAGCCCCA	0.741																																					p.L1740L													.	.			0			c.G5220T												12.0	14.0	13.0					1																	245851505		1660	3669	5329	SO:0001819	synonymous_variant	55083	exon12			CCTCCTGGCCAGC	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.5220G>T	1.37:g.245851505G>T			Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	31	0.10	3	NM_018012	9	0.00	0	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Silent	SNP	ENST00000407071.2	37	CCDS44342.1																																																																																					0.741	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381037.1		XM_371354	
CAMK1D	57118	mdanderson.org	37	10	12595239	12595239	+	Silent	SNP	A	A	G	rs377417219		TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr10:12595239A>G	ENST00000378847.3	+	2	445	c.108A>G	c.(106-108)gaA>gaG	p.E36E	CAMK1D_ENST00000378845.1_Silent_p.E36E|CAMK1D_ENST00000487696.1_Intron	NM_153498.2	NP_705718.1	Q8IU85	KCC1D_HUMAN	calcium/calmodulin-dependent protein kinase ID	36	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				inflammatory response (GO:0006954)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis (GO:0050766)|positive regulation of respiratory burst (GO:0060267)|regulation of dendrite development (GO:0050773)|regulation of granulocyte chemotaxis (GO:0071622)	calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|stomach(1)	16				GBM - Glioblastoma multiforme(1;3.16e-05)		CCTTTTCCGAAGTGGTTTTAG	0.468																																					p.E36E													CAMK1D_ENST00000378847,NS,malignant_melanoma,+2,6	CAMK1D_ENST00000378847	2	6	0			c.A108G							A	,	0,4406		0,0,2203	157.0	149.0	152.0		108,108	3.9	1.0	10		152	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	CAMK1D	NM_020397.2,NM_153498.2	,	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	,	36/358,36/386	12595239	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	57118	exon2			TTCCGAAGTGGTT	AF286366	CCDS7091.1, CCDS7092.1	10p13	2003-11-05			ENSG00000183049	ENSG00000183049			19341	protein-coding gene	gene with protein product		607957				11050006	Standard	XM_006717481		Approved	CKLiK	uc001ilo.3	Q8IU85	OTTHUMG00000017683	ENST00000378847.3:c.108A>G	10.37:g.12595239A>G			Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_153498	2	0.00	0	B0YIY0|Q9HD31	Silent	SNP	ENST00000378847.3	37	CCDS7091.1																																																																																					0.468	CAMK1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046820.1		NM_020397	
DBX1	120237	mdanderson.org	37	11	20181777	20181777	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr11:20181777C>T	ENST00000524983.2	-	1	382	c.94G>A	c.(94-96)Gca>Aca	p.A32T	DBX1_ENST00000227256.3_Missense_Mutation_p.A32T			A6NMT0	DBX1_HUMAN	developing brain homeobox 1	32					regulation of transcription from RNA polymerase II promoter (GO:0006357)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)	21						CCGGAAAATGCCGACTGCAAG	0.701																																					p.A32T													.	.			0			c.G94A												9.0	9.0	9.0					11																	20181777		1895	3648	5543	SO:0001583	missense	120237	exon1			AAAATGCCGACTG			11p15.1	2011-06-20				ENSG00000109851		"""Homeoboxes / ANTP class : NKL subclass"""	33185	protein-coding gene	gene with protein product						11239429	Standard	NM_001029865		Approved		uc021qey.1	A6NMT0		ENST00000524983.2:c.94G>A	11.37:g.20181777C>T	ENSP00000436881:p.Ala32Thr		Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_001029865	0		0		Missense_Mutation	SNP	ENST00000524983.2	37		.	.	.	.	.	.	.	.	.	.	C	22.6	4.306371	0.81247	.	.	ENSG00000109851	ENST00000524983;ENST00000227256	D;T	0.91295	-2.82;0.16	5.41	5.41	0.78517	.	0.181068	0.47852	N	0.000207	D	0.93132	0.7813	L	0.53249	1.67	0.43803	D	0.996351	D	0.56287	0.975	P	0.57960	0.83	D	0.93558	0.6892	10	0.66056	D	0.02	-11.7772	18.1844	0.89788	0.0:1.0:0.0:0.0	.	32	F8W811	.	T	32	ENSP00000436881:A32T;ENSP00000227256:A32T	ENSP00000227256:A32T	A	-	1	0	DBX1	20138353	0.993000	0.37304	1.000000	0.80357	0.987000	0.75469	2.944000	0.49034	2.539000	0.85634	0.491000	0.48974	GCA			0.701	DBX1-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000387585.2		NM_001029865	
SLC1A2	6506	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	35440503	35440503	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr11:35440503G>A	ENST00000278379.3	-	1	293	c.11C>T	c.(10-12)aCg>aTg	p.T4M	SLC1A2_ENST00000395753.1_Intron|SLC1A2_ENST00000395750.1_Intron|RP4-683L5.1_ENST00000534165.1_RNA|SLC1A2_ENST00000606205.1_Missense_Mutation_p.T4M	NM_004171.3	NP_004162.2	P43004	EAA2_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 2	4					adult behavior (GO:0030534)|cellular response to extracellular stimulus (GO:0031668)|D-aspartate import (GO:0070779)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|positive regulation of glucose import (GO:0046326)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)|visual behavior (GO:0007632)	axolemma (GO:0030673)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glutamate:sodium symporter activity (GO:0015501)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|urinary_tract(1)	24	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)			TCACCCTTCCGTAGATGCCAT	0.677																																					p.T4M	NSCLC(100;1273 1575 12993 16869 47409)|Ovarian(164;45 1946 8965 30452 48454)												.	.			0			c.C11T												44.0	37.0	39.0					11																	35440503		2194	4280	6474	SO:0001583	missense	6506	exon1			CCTTCCGTAGATG	AB209444	CCDS31459.1, CCDS55756.1	11p13-p12	2013-05-22			ENSG00000110436	ENSG00000110436		"""Solute carriers"""	10940	protein-coding gene	gene with protein product		600300				1448170	Standard	NM_004171		Approved	GLT-1, EAAT2	uc001mwd.3	P43004	OTTHUMG00000044391	ENST00000278379.3:c.11C>T	11.37:g.35440503G>A	ENSP00000278379:p.Thr4Met		Somatic	169	0	0		WXS	Illumina HiSeq	.	160	0.29	47	NM_004171	0		0	B4DQE9|Q14417|Q541G6|U3KQQ4	Missense_Mutation	SNP	ENST00000278379.3	37	CCDS31459.1	.	.	.	.	.	.	.	.	.	.	G	13.42	2.231313	0.39399	.	.	ENSG00000110436	ENST00000278379	T	0.56103	0.48	3.81	3.81	0.43845	.	2.890020	0.01150	N	0.006381	T	0.57140	0.2033	N	0.08118	0	0.80722	D	1	P;D	0.76494	0.614;0.999	B;D	0.64877	0.031;0.93	T	0.54629	-0.8265	10	0.72032	D	0.01	16.9264	12.5574	0.56261	0.0:0.0:1.0:0.0	.	4;4	B4DQE9;P43004	.;EAA2_HUMAN	M	4	ENSP00000278379:T4M	ENSP00000278379:T4M	T	-	2	0	SLC1A2	35397079	0.230000	0.23740	0.401000	0.26359	0.975000	0.68041	3.292000	0.51772	1.959000	0.56917	0.561000	0.74099	ACG			0.677	SLC1A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000258181.1		NM_004171	
DLG2	1740	hgsc.bcm.edu	37	11	83544668	83544668	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr11:83544668G>T	ENST00000532653.1	-	12	1698	c.1396C>A	c.(1396-1398)Cag>Aag	p.Q466K	DLG2_ENST00000280241.8_Missense_Mutation_p.Q505K|DLG2_ENST00000376104.2_Missense_Mutation_p.Q571K|DLG2_ENST00000537455.1_Missense_Mutation_p.Q220K|DLG2_ENST00000531015.1_Missense_Mutation_p.Q433K|DLG2_ENST00000330014.6_Missense_Mutation_p.Q405K|DLG2_ENST00000524982.1_Missense_Mutation_p.Q466K|DLG2_ENST00000398301.2_Missense_Mutation_p.Q505K|DLG2_ENST00000376106.3_5'UTR|DLG2_ENST00000543673.1_Missense_Mutation_p.Q571K|DLG2_ENST00000418306.2_Missense_Mutation_p.Q363K|DLG2_ENST00000398309.2_Missense_Mutation_p.Q466K			Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	208	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				GATAGGATCTGGTCTCCTCTC	0.438																																					p.Q571K													DLG2_ENST00000418306,NS,carcinoma,+1,8	DLG2_ENST00000418306	1	8	0			c.C1711A												100.0	109.0	106.0					11																	83544668		2136	4264	6400	SO:0001583	missense	1740	exon17			GGATCTGGTCTCC	U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000532653.1:c.1396C>A	11.37:g.83544668G>T	ENSP00000435849:p.Gln466Lys		Somatic	91	0	0		WXS	Illumina HiSeq	.	86	0.06	5	NM_001142699	0		0	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	ENST00000532653.1	37		.	.	.	.	.	.	.	.	.	.	G	17.07	3.295409	0.60086	.	.	ENSG00000150672	ENST00000398309;ENST00000376104;ENST00000418306;ENST00000543673;ENST00000280241;ENST00000330014;ENST00000537455;ENST00000524982;ENST00000532653;ENST00000546021;ENST00000531015;ENST00000398301	T;T;T;T;T;T;T;T;T;T;T	0.25749	1.78;1.78;1.78;1.78;1.78;1.78;1.78;1.78;1.78;1.78;1.78	5.25	5.25	0.73442	PDZ/DHR/GLGF (4);	0.092240	0.44902	D	0.000420	T	0.35566	0.0936	L	0.39397	1.21	0.80722	D	1	B;B;B;B;P;B;B;B	0.46020	0.036;0.174;0.008;0.001;0.871;0.2;0.014;0.024	B;B;B;B;P;B;B;B	0.51945	0.156;0.216;0.064;0.039;0.685;0.167;0.102;0.061	T	0.01635	-1.1307	9	.	.	.	.	18.8476	0.92213	0.0:0.0:1.0:0.0	.	433;466;466;405;505;571;466;363	E9PIW2;B7Z2T4;E9PN83;B7Z264;Q6ZSU2;Q15700-2;Q15700;Q15700-3	.;.;.;.;.;.;DLG2_HUMAN;.	K	466;571;363;571;505;405;220;466;466;571;433;505	ENSP00000381355:Q466K;ENSP00000365272:Q571K;ENSP00000402275:Q363K;ENSP00000441994:Q571K;ENSP00000280241:Q505K;ENSP00000381353:Q405K;ENSP00000443248:Q220K;ENSP00000432894:Q466K;ENSP00000435849:Q466K;ENSP00000433848:Q433K;ENSP00000381346:Q505K	.	Q	-	1	0	DLG2	83222316	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.540000	0.82074	2.462000	0.83206	0.650000	0.86243	CAG			0.438	DLG2-009	NOVEL	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000259253.2		NM_001364	
NOP2	4839	broad.mit.edu	37	12	6666318	6666318	+	Missense_Mutation	SNP	C	C	A	rs2534700		TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr12:6666318C>A	ENST00000322166.5	-	16	2401	c.2280G>T	c.(2278-2280)ttG>ttT	p.L760F	NOP2_ENST00000537442.1_Missense_Mutation_p.L760F|NOP2_ENST00000382421.3_Missense_Mutation_p.L793F|NOP2_ENST00000399466.2_Missense_Mutation_p.L756F|IFFO1_ENST00000396840.2_5'Flank|NOP2_ENST00000541778.1_Missense_Mutation_p.L756F|NOP2_ENST00000542015.1_5'Flank|NOP2_ENST00000545200.1_3'UTR|IFFO1_ENST00000356896.4_5'Flank|IFFO1_ENST00000336604.4_5'Flank	NM_001258308.1|NM_006170.3	NP_001245237.1|NP_006161.2	P46087	NOP2_HUMAN	NOP2 nucleolar protein	760				LP -> FA (in Ref. 1; AAA36398 and 3; CAA39119). {ECO:0000305}.	positive regulation of cell proliferation (GO:0008284)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	19						GCTGCTCTGGCAACTGCTGCT	0.587																																					p.L793F													.	NOP2	44		0			c.G2379T												93.0	95.0	95.0					12																	6666318		1919	4140	6059	SO:0001583	missense	4839	exon17			CTCTGGCAACTGC		CCDS44811.1, CCDS58202.1, CCDS58203.1, CCDS58204.1	12p13	2012-12-10	2012-12-10	2008-10-13	ENSG00000111641	ENSG00000111641		"""NOP2/Sun domain containing"""	7867	protein-coding gene	gene with protein product	"""NOP2/Sun domain family, member 1"""	164031	"""nucleolar protein 1 (120kD)"", ""nucleolar protein 1, 120kDa"", ""nucleolar protein 2 homolog (yeast)"", ""NOP2 nucleolar protein homolog (yeast)"""	NOL1		8088812	Standard	NM_006170		Approved	NOP120, NSUN1, p120	uc021qtz.2	P46087	OTTHUMG00000169163	ENST00000322166.5:c.2280G>T	12.37:g.6666318C>A	ENSP00000313272:p.Leu760Phe		Somatic	228	0	0		WXS	Illumina HiSeq	Phase_I	546	0.02	10	NM_001258309	507	0.03	13	A1A4Z3|B3KPD6|Q05BA7|Q0P5S5|Q3KQS4|Q58F30	Missense_Mutation	SNP	ENST00000322166.5	37	CCDS58203.1	.	.	.	.	.	.	.	.	.	.	C	7.488	0.650114	0.14516	.	.	ENSG00000111641	ENST00000537442;ENST00000382421;ENST00000399466;ENST00000322166;ENST00000541778	T;T;T;T;T	0.18657	2.2;2.2;2.21;2.2;2.21	4.67	1.69	0.24217	.	1.635760	0.03608	N	0.234431	T	0.16085	0.0387	L	0.34521	1.04	0.09310	N	1	B;B	0.10296	0.003;0.003	B;B	0.12837	0.008;0.005	T	0.23868	-1.0176	10	0.21540	T	0.41	0.1509	4.2973	0.10908	0.0:0.5909:0.1913:0.2177	.	760;756	P46087;P46087-2	NOP2_HUMAN;.	F	760;793;756;760;756	ENSP00000444437:L760F;ENSP00000371858:L793F;ENSP00000382392:L756F;ENSP00000313272:L760F;ENSP00000443150:L756F	ENSP00000313272:L760F	L	-	3	2	NOP2	6536579	0.000000	0.05858	0.000000	0.03702	0.429000	0.31625	-0.857000	0.04286	0.550000	0.28991	0.561000	0.74099	TTG			0.587	NOP2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000402614.1		NM_006170	
DDX12P	440081	bcgsc.ca	37	12	9578165	9578165	+	IGR	SNP	C	C	G			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr12:9578165C>G								RP13-735L24.1 (27952 upstream) : SNORA75 (19488 downstream)																							TTGCGGGACGCTGGCCTGACT	0.612																																					.													.	.			0			.												41.0	52.0	49.0					12																	9578165		692	1591	2283	SO:0001628	intergenic_variant	440081	.			GGGACGCTGGCCT																													12.37:g.9578165C>G			Somatic	144	0.0138888889	2		WXS	Illumina HiSeq	Phase_1	430	0.17	71	.	151	0.17	25		RNA	SNP		37																																																																																					0	0.612										
C12orf40	283461	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	40076502	40076502	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr12:40076502A>G	ENST00000324616.5	+	8	930	c.776A>G	c.(775-777)tAc>tGc	p.Y259C	C12orf40_ENST00000405531.3_Missense_Mutation_p.Y259C|C12orf40_ENST00000398716.1_Missense_Mutation_p.Y182C	NM_001031748.2	NP_001026918.2	Q86WS4	CL040_HUMAN	chromosome 12 open reading frame 40	259										breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(6)|prostate(1)|skin(2)	38						CAGTCAGACTACATTACTGAA	0.353																																					p.Y259C													C12orf40,NS,carcinoma,+1,1	C12orf40	1	1	0			c.A776G												133.0	133.0	133.0					12																	40076502		1838	4091	5929	SO:0001583	missense	283461	exon8			CAGACTACATTAC	AK097445	CCDS41770.1	12q12	2008-08-04			ENSG00000180116	ENSG00000180116			26846	protein-coding gene	gene with protein product						12477932	Standard	XM_005268806		Approved	FLJ40126	uc001rmc.3	Q86WS4	OTTHUMG00000133567	ENST00000324616.5:c.776A>G	12.37:g.40076502A>G	ENSP00000317671:p.Tyr259Cys		Somatic	79	0	0		WXS	Illumina HiSeq	.	101	0.24	24	NM_001031748	0		0	B7WNU1|Q8IXY6|Q8N818|V9HW02	Missense_Mutation	SNP	ENST00000324616.5	37	CCDS41770.1	.	.	.	.	.	.	.	.	.	.	A	10.38	1.333298	0.24167	.	.	ENSG00000180116	ENST00000405531;ENST00000398716;ENST00000324616	T;T	0.52754	0.65;0.67	5.36	2.96	0.34315	.	0.267201	0.27258	N	0.020196	T	0.34279	0.0892	N	0.19112	0.55	0.09310	N	1	P	0.51791	0.948	P	0.47162	0.54	T	0.15983	-1.0418	10	0.87932	D	0	.	5.8045	0.18432	0.1539:0.0819:0.0:0.7642	.	259	Q86WS4	CL040_HUMAN	C	259;182;259	ENSP00000383897:Y259C;ENSP00000317671:Y259C	ENSP00000317671:Y259C	Y	+	2	0	C12orf40	38362769	0.036000	0.19791	0.009000	0.14445	0.121000	0.20230	1.401000	0.34589	0.525000	0.28522	-0.649000	0.03915	TAC			0.353	C12orf40-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257664.2		NM_173599	
LRRK2	120892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	40757322	40757322	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr12:40757322C>T	ENST00000298910.7	+	48	7205	c.7147C>T	c.(7147-7149)Ctc>Ttc	p.L2383F		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2383					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				AACTGAAAAACTCTGTGGACT	0.378																																					p.L2383F													.	.			0			c.C7147T												119.0	122.0	121.0					12																	40757322		2203	4300	6503	SO:0001583	missense	120892	exon48			GAAAAACTCTGTG	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.7147C>T	12.37:g.40757322C>T	ENSP00000298910:p.Leu2383Phe		Somatic	118	0	0		WXS	Illumina HiSeq	.	131	0.24	32	NM_198578	6	0.00	0	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	37	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	C	17.30	3.353638	0.61293	.	.	ENSG00000188906	ENST00000298910	T	0.38240	1.15	5.28	5.28	0.74379	WD40 repeat-like-containing domain (1);Armadillo-like helical (1);	0.209202	0.48767	D	0.000178	T	0.46541	0.1398	L	0.56769	1.78	0.33025	D	0.529374	D;D	0.57899	0.981;0.981	P;P	0.52514	0.701;0.701	T	0.61372	-0.7076	10	0.54805	T	0.06	.	13.4929	0.61407	0.1565:0.8435:0.0:0.0	.	2383;2383	Q17RV3;Q5S007	.;LRRK2_HUMAN	F	2383	ENSP00000298910:L2383F	ENSP00000298910:L2383F	L	+	1	0	LRRK2	39043589	1.000000	0.71417	1.000000	0.80357	0.800000	0.45204	2.792000	0.47837	2.475000	0.83589	0.467000	0.42956	CTC			0.378	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000277179.1		XM_058513	
CLIP1	6249	mdanderson.org	37	12	122819222	122819222	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr12:122819222C>T	ENST00000540338.1	-	12	2640	c.2599G>A	c.(2599-2601)Gca>Aca	p.A867T	CLIP1_ENST00000545889.1_Missense_Mutation_p.A442T|CLIP1_ENST00000537178.1_Missense_Mutation_p.A821T|CLIP1_ENST00000361654.4_Missense_Mutation_p.A745T|CLIP1_ENST00000302528.7_Missense_Mutation_p.A856T|CLIP1_ENST00000358808.2_Missense_Mutation_p.A856T			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	867					microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		ACAGAGACTGCCTCCTCTGAA	0.368																																					p.A867T													.	.			0			c.G2599A												55.0	55.0	55.0					12																	122819222		2203	4298	6501	SO:0001583	missense	6249	exon13			AGACTGCCTCCTC		CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.2599G>A	12.37:g.122819222C>T	ENSP00000439093:p.Ala867Thr		Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_001247997	36	0.00	0	A0AVD3|Q17RS4|Q29RG0	Missense_Mutation	SNP	ENST00000540338.1	37	CCDS58285.1	.	.	.	.	.	.	.	.	.	.	C	12.65	2.002904	0.35320	.	.	ENSG00000130779	ENST00000545889;ENST00000302528;ENST00000358808;ENST00000542885;ENST00000537178;ENST00000540338;ENST00000540304	T;T;T;T;T;D	0.82893	2.73;-1.19;-1.19;0.7;0.7;-1.66	5.47	3.48	0.39840	.	0.561250	0.19247	N	0.119023	T	0.78317	0.4264	L	0.58101	1.795	0.36132	D	0.846205	B;B;B	0.30937	0.019;0.011;0.301	B;B;B	0.32677	0.06;0.06;0.15	T	0.76291	-0.3013	10	0.19590	T	0.45	-4.655	11.2257	0.48882	0.1528:0.7728:0.0:0.0744	.	821;856;867	P30622-2;P30622-1;P30622	.;.;CLIP1_HUMAN	T	442;856;856;586;821;867;714	ENSP00000438743:A442T;ENSP00000303585:A856T;ENSP00000351665:A856T;ENSP00000445531:A821T;ENSP00000439093:A867T;ENSP00000437786:A714T	ENSP00000303585:A856T	A	-	1	0	CLIP1	121385175	0.998000	0.40836	0.985000	0.45067	0.347000	0.29111	0.794000	0.26958	1.310000	0.45006	-0.253000	0.11424	GCA			0.368	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000401625.1		NM_002956	
Unknown	0	bcgsc.ca	37	12	126996133	126996133	+	IGR	SNP	G	G	A			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr12:126996133G>A								RP5-944M2.3 (38797 upstream) : RP11-407A16.4 (116584 downstream)																							GCTGAAACCAGCAAATGTAGC	0.453																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			AAACCAGCAAATG																													12.37:g.126996133G>A			Somatic	33	0	0		WXS	Illumina HiSeq	Phase_1	30	0.17	5	.	0		0		RNA	SNP		37																																																																																					0	0.453										
ATP8A2	51761	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	26133183	26133183	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr13:26133183G>T	ENST00000381655.2	+	14	1478	c.1336G>T	c.(1336-1338)Gcc>Tcc	p.A446S	ATP8A2_ENST00000255283.8_Missense_Mutation_p.A406S	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	406					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		GTGCAGCATTGCCGGAGTAAC	0.308																																					p.A446S													.	ATP8A2	181		0			c.G1336T												138.0	129.0	132.0					13																	26133183		1895	4137	6032	SO:0001583	missense	51761	exon14			AGCATTGCCGGAG	AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.1336G>T	13.37:g.26133183G>T	ENSP00000371070:p.Ala446Ser		Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	71	0.10	7	NM_016529	0		0	Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Missense_Mutation	SNP	ENST00000381655.2	37	CCDS41873.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.598067	0.87055	.	.	ENSG00000132932	ENST00000381655;ENST00000255283;ENST00000544544	T;T	0.61859	0.07;0.07	4.47	4.47	0.54385	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.058546	0.64402	D	0.000002	T	0.75466	0.3853	M	0.74546	2.27	0.58432	D	0.999993	D;D;D	0.62365	0.991;0.982;0.991	D;D;D	0.70016	0.967;0.911;0.967	T	0.79276	-0.1870	10	0.66056	D	0.02	.	17.3213	0.87236	0.0:0.0:1.0:0.0	.	406;406;406	B7Z880;Q9NTI2-3;Q9NTI2	.;.;AT8A2_HUMAN	S	446;406;226	ENSP00000371070:A446S;ENSP00000255283:A406S	ENSP00000255283:A406S	A	+	1	0	ATP8A2	25031183	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	9.591000	0.98241	2.326000	0.78906	0.542000	0.68232	GCC			0.308	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044236.2		NM_016529	
RP11-597A11.6	0	broad.mit.edu	37	14	20146543	20146544	+	lincRNA	INS	-	-	GTCCC	rs60511353|rs536110028	byFrequency	TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr14:20146543_20146544insGTCCC	ENST00000555580.1	-	0	225				RP11-597A11.1_ENST00000548261.1_RNA																							CCAACTCAGCAGAACAGTGTCA	0.505														1248	0.249201	0.3147	0.3775	5008	,	,		16134	0.1438		0.2396	False		,,,				2504	0.1881				.													.	.			0			.																																											0	.			CTCAGCAGAACAG																													14.37:g.20146543_20146544insGTCCC			Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	71	0.11	8	.	0		0		RNA	INS	ENST00000555580.1	37																																																																																						0.505	RP11-597A11.6-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000409767.1			
CPNE6	9362	broad.mit.edu	37	14	24546820	24546820	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr14:24546820G>A	ENST00000397016.2	+	17	1866	c.1555G>A	c.(1555-1557)Gcc>Acc	p.A519T	CPNE6_ENST00000537691.1_Missense_Mutation_p.A574T|CPNE6_ENST00000216775.2_Missense_Mutation_p.A519T	NM_001280558.1	NP_001267487.1	O95741	CPNE6_HUMAN	copine VI (neuronal)	519	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				lipid metabolic process (GO:0006629)|nervous system development (GO:0007399)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)	p.A519T(1)		endometrium(4)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(265;0.0184)		CTCTGCACTCGCCAAGTGTGT	0.642																																					p.A519T													CPNE6,NS,carcinoma,0,1	CPNE6	40	1	1	Substitution - Missense(1)	endometrium(1)	c.G1555A												99.0	107.0	105.0					14																	24546820		2203	4300	6503	SO:0001583	missense	9362	exon16			GCACTCGCCAAGT	AB009288	CCDS9607.1, CCDS61413.1	14q11.2	2008-07-09			ENSG00000100884	ENSG00000100884			2319	protein-coding gene	gene with protein product		605688				9645480	Standard	NM_001280558		Approved		uc001wll.3	O95741	OTTHUMG00000028781	ENST00000397016.2:c.1555G>A	14.37:g.24546820G>A	ENSP00000380211:p.Ala519Thr		Somatic	107	0.0093457944	1		WXS	Illumina HiSeq	Phase_I	99	0.04	4	NM_006032	8	0.00	0	B2RAG6|B7Z1M3|D3DS55|F5GXN1|Q53HA6|Q8WVG1	Missense_Mutation	SNP	ENST00000397016.2	37	CCDS9607.1	.	.	.	.	.	.	.	.	.	.	G	19.23	3.787029	0.70337	.	.	ENSG00000100884	ENST00000537691;ENST00000397016;ENST00000216775	T;T;T	0.10960	2.82;2.86;2.86	4.63	3.74	0.42951	von Willebrand factor, type A (1);	0.000000	0.47455	D	0.000228	T	0.36386	0.0965	M	0.91406	3.205	0.46458	D	0.999058	D;D	0.69078	0.997;0.99	D;P	0.66497	0.944;0.779	T	0.38585	-0.9654	10	0.72032	D	0.01	-4.2944	10.4612	0.44581	0.0951:0.0:0.9049:0.0	.	574;519	F5GXN1;O95741	.;CPNE6_HUMAN	T	574;519;519	ENSP00000440077:A574T;ENSP00000380211:A519T;ENSP00000216775:A519T	ENSP00000216775:A519T	A	+	1	0	CPNE6	23616660	1.000000	0.71417	0.624000	0.29186	0.656000	0.38851	8.160000	0.89653	1.164000	0.42652	0.561000	0.74099	GCC			0.642	CPNE6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000071869.5			
RALGAPA1	253959	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	36194331	36194332	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr14:36194331_36194332delCT	ENST00000389698.3	-	14	2154_2155	c.1764_1765delAG	c.(1762-1767)agagtcfs	p.RV588fs	RALGAPA1_ENST00000554704.1_5'UTR|RALGAPA1_ENST00000258840.6_Frame_Shift_Del_p.RV588fs|RALGAPA1_ENST00000382366.3_Frame_Shift_Del_p.RV588fs|RALGAPA1_ENST00000307138.6_Frame_Shift_Del_p.RV588fs	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	588					activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GATTCCGTGACTCTGAGCAACA	0.381																																					p.589_589del													.	RALGAPA1	289		0			c.1765_1766del																																									SO:0001589	frameshift_variant	253959	exon14			CCGTGACTCTGAG	AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.1764_1765delAG	14.37:g.36194333_36194334delCT	ENSP00000374348:p.Arg588fs		Somatic	195	0	0		WXS	Illumina HiSeq	.	241	0.16	38	NM_014990	11	0.00	0	A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Frame_Shift_Del	DEL	ENST00000389698.3	37	CCDS32065.1																																																																																					0.381	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000409829.1		XM_210022	
ZFYVE19	84936	mdanderson.org	37	15	41104995	41104995	+	Silent	SNP	C	C	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr15:41104995C>T	ENST00000355341.4	+	7	1426	c.925C>T	c.(925-927)Ctg>Ttg	p.L309L	ZFYVE19_ENST00000564258.1_Silent_p.L134L|ZFYVE19_ENST00000299173.10_Intron|ZFYVE19_ENST00000570108.1_Silent_p.L286L|ZFYVE19_ENST00000336455.5_Silent_p.L299L	NM_001077268.1	NP_001070736.1	Q96K21	ANCHR_HUMAN	zinc finger, FYVE domain containing 19	309					abscission (GO:0009838)|cell division (GO:0051301)|cytokinesis checkpoint (GO:0031565)|negative regulation of cytokinesis (GO:0032466)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|midbody (GO:0030496)	phosphatidylinositol-3-phosphate binding (GO:0032266)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	9		all_cancers(109;3.31e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.76e-05)|COAD - Colon adenocarcinoma(120;0.151)|BRCA - Breast invasive adenocarcinoma(123;0.164)		GAGCAGACTGCTGGCTGAGGC	0.607																																					p.L309L													.	.			0			c.C925T												74.0	83.0	80.0					15																	41104995		2060	4194	6254	SO:0001819	synonymous_variant	84936	exon7			AGACTGCTGGCTG	AK027746	CCDS42025.1, CCDS58353.1, CCDS58354.1, CCDS58355.1	15q14	2008-05-02				ENSG00000166140		"""Zinc fingers, FYVE domain containing"""	20758	protein-coding gene	gene with protein product							Standard	NM_001077268		Approved	FLJ14840	uc031qrk.1	Q96K21		ENST00000355341.4:c.925C>T	15.37:g.41104995C>T			Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_001077268	43	0.00	0	B3KVB2|C9JNF4|H3BUF9|Q86WC2|Q8WU96	Silent	SNP	ENST00000355341.4	37	CCDS42025.1																																																																																					0.607	ZFYVE19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000418996.1		NM_032850	
ONECUT1	3175	broad.mit.edu	37	15	53082011	53082011	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr15:53082011delG	ENST00000305901.5	-	1	198	c.71delC	c.(70-72)cctfs	p.P24fs	ONECUT1_ENST00000561401.2_Intron	NM_004498.2	NP_004489.1	Q9UBC0	HNF6_HUMAN	one cut homeobox 1	24					B cell differentiation (GO:0030183)|cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|endoderm development (GO:0007492)|epithelial cell development (GO:0002064)|glucose metabolic process (GO:0006006)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription, DNA-templated (GO:0006355)|spleen development (GO:0048536)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	17				all cancers(107;0.0708)		CAGGTCGGCAGGGGCGGGCAC	0.751																																					p.P24fs													.	ONECUT1	48		0			c.71delC												7.0	8.0	8.0					15																	53082011		1634	3529	5163	SO:0001589	frameshift_variant	3175	exon1			TCGGCAGGGGCGG	U77975	CCDS10150.1	15q21.3	2012-03-09	2007-07-16		ENSG00000169856	ENSG00000169856		"""Homeoboxes / CUT class"""	8138	protein-coding gene	gene with protein product		604164	"""one cut domain, family member 1"""	HNF6, HNF6A		8887657, 8790352	Standard	NM_004498		Approved	HNF-6	uc002aci.2	Q9UBC0	OTTHUMG00000131899	ENST00000305901.5:c.71delC	15.37:g.53082011delG	ENSP00000302630:p.Pro24fs		Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	NM_004498	1	0.00	0	B2RTV4|Q99744|Q9UMR6	Frame_Shift_Del	DEL	ENST00000305901.5	37	CCDS10150.1																																																																																					0.751	ONECUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254849.2			
CSPG4P5	114817	broad.mit.edu	37	15	84957462	84957466	+	RNA	DEL	GTGGC	GTGGC	-	rs578077920|rs540048240|rs376565740|rs145189308	byFrequency	TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	GTGGC	GTGGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr15:84957462_84957466delGTGGC	ENST00000558801.1	-	0	7263_7267									DNM1 pseudogene 51																		CACTTGTAGGGTGGCATCTGTGTGC	0.571																																					.													.	.			0			.																																											0	.			TGTAGGGTGGCAT			15q25.2	2013-05-16			ENSG00000259297	ENSG00000235370			48500	pseudogene	pseudogene							Standard			Approved				OTTHUMG00000172438		15.37:g.84957462_84957466delGTGGC			Somatic	11	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	DEL	ENST00000558801.1	37																																																																																						0.571	DNM1P51-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000471721.1			
SLX4	84464	mdanderson.org	37	16	3639795	3639795	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr16:3639795G>T	ENST00000294008.3	-	12	4484	c.3844C>A	c.(3844-3846)Ctg>Atg	p.L1282M		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	1282	Interaction with PLK1 and TERF2-TERF2IP.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						TGCACGGCCAGCCCGCTCCTG	0.632								Direct reversal of damage																													p.L1282M													.	.			0			c.C3844A												111.0	106.0	108.0					16																	3639795		2197	4300	6497	SO:0001583	missense	84464	exon12			CGGCCAGCCCGCT	AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.3844C>A	16.37:g.3639795G>T	ENSP00000294008:p.Leu1282Met		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_032444	11	0.00	0	Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	ENST00000294008.3	37	CCDS10506.2	.	.	.	.	.	.	.	.	.	.	G	14.72	2.620577	0.46736	.	.	ENSG00000188827	ENST00000294008	T	0.01126	5.3	6.07	-10.9	0.00192	.	1.586400	0.03565	N	0.227682	T	0.00608	0.0020	N	0.08118	0	0.09310	N	1	P	0.35600	0.511	B	0.29353	0.101	T	0.49634	-0.8919	10	0.45353	T	0.12	.	6.5571	0.22466	0.1247:0.2098:0.539:0.1265	.	1282	Q8IY92	SLX4_HUMAN	M	1282	ENSP00000294008:L1282M	ENSP00000294008:L1282M	L	-	1	2	SLX4	3579796	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-0.831000	0.04405	-1.506000	0.01805	-0.262000	0.10625	CTG			0.632	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000157301.3		NM_032444	
ACSM3	6296	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	20796358	20796358	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr16:20796358C>T	ENST00000289416.5	+	8	1547	c.1072C>T	c.(1072-1074)Cct>Tct	p.P358S	ACSM3_ENST00000567387.1_3'UTR|RNU6-944P_ENST00000364023.1_RNA|ACSM3_ENST00000440284.2_Missense_Mutation_p.P358S|ERI2_ENST00000300005.3_Intron|ACSM3_ENST00000450120.2_Missense_Mutation_p.P350S	NM_005622.3	NP_005613.2	Q53FZ2	ACSM3_HUMAN	acyl-CoA synthetase medium-chain family member 3	358					cholesterol homeostasis (GO:0042632)|fatty acid biosynthetic process (GO:0006633)|regulation of blood pressure (GO:0008217)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty acid ligase activity (GO:0015645)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)	21						ACCAATTACCCCTGACGTGAC	0.423																																					p.P358S													.	.			0			c.C1072T												128.0	117.0	121.0					16																	20796358		2201	4300	6501	SO:0001583	missense	6296	exon8			ATTACCCCTGACG	D16350	CCDS10589.1, CCDS45435.1	16p13.11	2006-02-08	2005-09-08	2005-09-08	ENSG00000005187	ENSG00000005187		"""Acyl-CoA synthetase family"""	10522	protein-coding gene	gene with protein product		145505	"""SA (rat hypertension-associated) homolog"", ""SA hypertension-associated homolog (rat)"""	SAH		7843754, 7907320, 11470804	Standard	NM_005622		Approved	SA	uc002dhr.3	Q53FZ2	OTTHUMG00000131552	ENST00000289416.5:c.1072C>T	16.37:g.20796358C>T	ENSP00000289416:p.Pro358Ser		Somatic	99	0	0		WXS	Illumina HiSeq	.	80	0.09	7	NM_005622	19	0.11	2	O60363|Q13732|Q15425|Q7KYM6|Q9BUA2	Missense_Mutation	SNP	ENST00000289416.5	37	CCDS10589.1	.	.	.	.	.	.	.	.	.	.	C	13.06	2.124771	0.37533	.	.	ENSG00000005187	ENST00000289416;ENST00000440284;ENST00000450120	T;T;T	0.46063	0.88;0.88;0.88	5.34	3.38	0.38709	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.47948	0.1473	M	0.62209	1.925	0.80722	D	1	P;B;P	0.45474	0.809;0.339;0.859	P;B;B	0.48770	0.589;0.31;0.417	T	0.49457	-0.8938	10	0.72032	D	0.01	-8.0856	10.9041	0.47069	0.1299:0.8021:0.0:0.068	.	350;358;358	E7ETR5;Q53FZ2;Q53FZ2-2	.;ACSM3_HUMAN;.	S	358;358;350	ENSP00000289416:P358S;ENSP00000394565:P358S;ENSP00000395297:P350S	ENSP00000289416:P358S	P	+	1	0	ACSM3	20703859	1.000000	0.71417	0.657000	0.29651	0.241000	0.25554	2.301000	0.43628	0.744000	0.32741	-0.152000	0.13540	CCT			0.423	ACSM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254414.2		NM_005622	
TGFB1I1	7041	mdanderson.org	37	16	31484827	31484827	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr16:31484827C>T	ENST00000394863.3	+	2	209	c.79C>T	c.(79-81)Cgc>Tgc	p.R27C	TGFB1I1_ENST00000567607.1_Missense_Mutation_p.R10C|TGFB1I1_ENST00000361773.3_Missense_Mutation_p.R10C|TGFB1I1_ENST00000394858.2_Missense_Mutation_p.R10C	NM_001042454.2	NP_001035919.1	O43294	TGFI1_HUMAN	transforming growth factor beta 1 induced transcript 1	27	Interaction with PTK2B/PYK2.|Transcription activation. {ECO:0000250}.				androgen receptor signaling pathway (GO:0030521)|cell adhesion (GO:0007155)|cell fate commitment (GO:0045165)|epithelial cell differentiation (GO:0030855)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|response to heat (GO:0009408)|transcription from RNA polymerase II promoter (GO:0006366)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|I-SMAD binding (GO:0070411)|Roundabout binding (GO:0048495)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			lung(8)|upper_aerodigestive_tract(1)	9						TCCCAAAGAGCGCCCTGCGGA	0.647																																					p.R27C													TGFB1I1_ENST00000394863,NS,carcinoma,0,2	TGFB1I1_ENST00000394863	0	2	0			c.C79T												44.0	49.0	48.0					16																	31484827		2197	4300	6497	SO:0001583	missense	7041	exon2			AAAGAGCGCCCTG	AB007836	CCDS10713.1, CCDS42156.1	16p11	2008-02-05			ENSG00000140682	ENSG00000140682			11767	protein-coding gene	gene with protein product		602353				9422762, 10075738	Standard	NM_015927		Approved	Hic-5, TSC-5, ARA55, HIC-5	uc002ecd.2	O43294	OTTHUMG00000132467	ENST00000394863.3:c.79C>T	16.37:g.31484827C>T	ENSP00000378332:p.Arg27Cys		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_001042454	54	0.00	0	B2R8D5|Q9BPW3|Q9Y2V5	Missense_Mutation	SNP	ENST00000394863.3	37	CCDS42156.1	.	.	.	.	.	.	.	.	.	.	C	14.00	2.403637	0.42613	.	.	ENSG00000140682	ENST00000394863;ENST00000361773;ENST00000394858	T;T;T	0.56941	0.43;0.43;0.43	4.52	2.53	0.30540	.	0.225948	0.36200	N	0.002735	T	0.44561	0.1299	L	0.34521	1.04	0.33925	D	0.641342	P	0.52842	0.956	P	0.45946	0.498	T	0.59532	-0.7437	10	0.62326	D	0.03	.	11.2719	0.49144	0.3305:0.6695:0.0:0.0	.	27	O43294	TGFI1_HUMAN	C	27;10;10	ENSP00000378332:R27C;ENSP00000355117:R10C;ENSP00000378327:R10C	ENSP00000355117:R10C	R	+	1	0	TGFB1I1	31392328	0.971000	0.33674	0.942000	0.38095	0.370000	0.29829	3.391000	0.52530	0.507000	0.28148	0.555000	0.69702	CGC			0.647	TGFB1I1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000255630.3			
FUK	197258	hgsc.bcm.edu	37	16	70515315	70515315	+	IGR	SNP	G	G	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr16:70515315G>T	ENST00000288078.6	+	0	4081				COG4_ENST00000323786.5_Silent_p.R728R	NM_145059.2	NP_659496.2	Q8N0W3	FUK_HUMAN	fucokinase							cytoplasm (GO:0005737)	ATP binding (GO:0005524)|fucokinase activity (GO:0050201)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(11)|ovary(2)|prostate(2)	23		Ovarian(137;0.0694)				AACTTGTCTCGGATGGTCCAG	0.607																																					p.R728R													.	.			0			c.C2182A												100.0	97.0	98.0					16																	70515315		2198	4300	6498	SO:0001628	intergenic_variant	25839	exon18			TGTCTCGGATGGT		CCDS10891.2	16q22.1	2008-02-05			ENSG00000157353	ENSG00000157353	2.7.1.52		29500	protein-coding gene	gene with protein product	"""L-fucose kinase"""	608675				12056818	Standard	XM_006721161		Approved	FLJ39408	uc002eyy.3	Q8N0W3	OTTHUMG00000074085		16.37:g.70515315G>T			Somatic	89	0	0		WXS	Illumina HiSeq	.	74	0.05	4	NM_015386	162	0.00	0	Q5PSM3|Q5XKL6|Q6ZRA0|Q96MT9	Silent	SNP	ENST00000288078.6	37	CCDS10891.2																																																																																					0.607	FUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000157291.2		NM_145059	
ZZEF1	23140	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	4016010	4016010	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr17:4016010G>A	ENST00000381638.2	-	5	1083	c.959C>T	c.(958-960)gCt>gTt	p.A320V	snoU13_ENST00000459263.1_RNA|ZZEF1_ENST00000574474.1_5'UTR	NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	320	DOC. {ECO:0000255|PROSITE- ProRule:PRU00614}.						calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						CCTCCCTACAGCTACTGTCAC	0.512																																					p.A320V													.	.			0			c.C959T												99.0	69.0	79.0					17																	4016010		2203	4300	6503	SO:0001583	missense	23140	exon5			CCTACAGCTACTG	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.959C>T	17.37:g.4016010G>A	ENSP00000371051:p.Ala320Val		Somatic	121	0	0		WXS	Illumina HiSeq	.	118	0.07	8	NM_015113	8	0.00	0	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Missense_Mutation	SNP	ENST00000381638.2	37	CCDS11043.1	.	.	.	.	.	.	.	.	.	.	G	36	5.686714	0.96784	.	.	ENSG00000074755	ENST00000381638	T	0.62941	-0.01	5.6	5.6	0.85130	Anaphase-promoting complex, subunit 10/DOC domain (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.72112	0.3420	L	0.51422	1.61	0.80722	D	1	D;D	0.61080	0.989;0.985	P;P	0.56563	0.796;0.801	T	0.74022	-0.3798	10	0.72032	D	0.01	-13.2277	19.606	0.95582	0.0:0.0:1.0:0.0	.	320;320	O43149-3;O43149	.;ZZEF1_HUMAN	V	320	ENSP00000371051:A320V	ENSP00000371051:A320V	A	-	2	0	ZZEF1	3962759	1.000000	0.71417	0.984000	0.44739	0.965000	0.64279	9.441000	0.97557	2.643000	0.89663	0.655000	0.94253	GCT			0.512	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207480.1		NM_015113	
MRPL45	84311	broad.mit.edu	37	17	36453192	36453192	+	Missense_Mutation	SNP	T	T	G	rs139299251		TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr17:36453192T>G	ENST00000312513.5	+	1	204	c.43T>G	c.(43-45)Ttt>Gtt	p.F15V		NM_032351.4	NP_115727.4	Q9BRJ2	RM45_HUMAN	mitochondrial ribosomal protein L45	15						mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	13	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				TTTATCGAGGTTTTTGGGCTG	0.582																																					p.F15V													.	MRPL45	27		0			c.T43G												75.0	94.0	88.0					17																	36453192		692	1591	2283	SO:0001583	missense	84311	exon1			TCGAGGTTTTTGG	BC006235	CCDS11326.1, CCDS74047.1	17q21.2	2014-05-06			ENSG00000174100	ENSG00000278845		"""Mitochondrial ribosomal proteins / large subunits"""	16651	protein-coding gene	gene with protein product		611850				11551941, 12706105	Standard	XM_006725366		Approved	MGC11321	uc002hpy.3	Q9BRJ2	OTTHUMG00000188489	ENST00000312513.5:c.43T>G	17.37:g.36453192T>G	ENSP00000308901:p.Phe15Val		Somatic	69	0.0144927536	1		WXS	Illumina HiSeq	Phase_I	93	0.15	14	NM_032351	123	0.05	6	A1L436|Q6ZMJ5	Missense_Mutation	SNP	ENST00000312513.5	37	CCDS11326.1	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.932710	0.00488	.	.	ENSG00000174100	ENST00000312513	T	0.27256	1.68	4.28	2.13	0.27403	.	.	.	.	.	T	0.06690	0.0171	N	0.00707	-1.245	0.09310	N	0.999992	B	0.02656	0.0	B	0.01281	0.0	T	0.32693	-0.9897	9	0.31617	T	0.26	.	3.1875	0.06606	0.249:0.0:0.5488:0.2022	.	15	Q9BRJ2	RM45_HUMAN	V	15	ENSP00000308901:F15V	ENSP00000308901:F15V	F	+	1	0	MRPL45	.	0.230000	0.23740	0.745000	0.31077	0.088000	0.18126	0.728000	0.26013	0.123000	0.18342	-1.308000	0.01314	TTT			0.582	MRPL45-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256792.3		NM_032351	
MRC2	9902	broad.mit.edu	37	17	60769610	60769610	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr17:60769610C>T	ENST00000303375.5	+	30	4640	c.4238C>T	c.(4237-4239)gCg>gTg	p.A1413V	MRC2_ENST00000446119.2_Missense_Mutation_p.A279V	NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	1413					collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						GAGAACCCAGCGGCCCTGGTG	0.682																																					p.A1413V													.	MRC2	126		0			c.C4238T												31.0	27.0	29.0					17																	60769610		2203	4300	6503	SO:0001583	missense	9902	exon30			ACCCAGCGGCCCT	AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.4238C>T	17.37:g.60769610C>T	ENSP00000307513:p.Ala1413Val		Somatic	124	0.0161290323	2		WXS	Illumina HiSeq	Phase_I	155	0.03	4	NM_006039	244	0.00	0	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Missense_Mutation	SNP	ENST00000303375.5	37	CCDS11634.1	.	.	.	.	.	.	.	.	.	.	C	13.77	2.335451	0.41398	.	.	ENSG00000011028	ENST00000303375;ENST00000446119	T;T	0.05199	3.48;4.07	5.28	3.24	0.37175	.	0.246012	0.40818	N	0.001013	T	0.02727	0.0082	N	0.08118	0	0.09310	N	0.999997	B;B	0.15719	0.014;0.002	B;B	0.08055	0.003;0.001	T	0.47169	-0.9138	10	0.12766	T	0.61	-7.8202	5.8092	0.18457	0.143:0.6421:0.1382:0.0766	.	279;1413	E7EME3;Q9UBG0	.;MRC2_HUMAN	V	1413;279	ENSP00000307513:A1413V;ENSP00000400445:A279V	ENSP00000307513:A1413V	A	+	2	0	MRC2	58123342	0.050000	0.20438	0.485000	0.27403	0.717000	0.41224	1.450000	0.35134	0.579000	0.29504	0.561000	0.74099	GCG			0.682	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000445152.1			
CD79B	974	mdanderson.org	37	17	62007156	62007156	+	Missense_Mutation	SNP	C	C	A	rs148032848		TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr17:62007156C>A	ENST00000006750.3	-	4	615	c.523G>T	c.(523-525)Gtg>Ttg	p.V175L	CD79B_ENST00000349817.2_Missense_Mutation_p.V71L|CD79B_ENST00000392795.3_Missense_Mutation_p.V176L	NM_000626.2|NM_021602.2	NP_000617.1|NP_067613.1	P40259	CD79B_HUMAN	CD79b molecule, immunoglobulin-associated beta	175					B cell receptor signaling pathway (GO:0050853)|immune response (GO:0006955)|signal transduction (GO:0007165)	B cell receptor complex (GO:0019815)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)	15						AAGATAGGCACGATGATGAAG	0.582			"""Mis, O"""		DLBCL																																p.V176L				Dom	yes		17	17q23	974	"""CD79b molecule, immunoglobulin-associated beta"""		L	CD79B,colon,carcinoma,0,1	CD79B	0	1	0			c.G526T												120.0	88.0	99.0					17																	62007156		2203	4300	6503	SO:0001583	missense	974	exon4			TAGGCACGATGAT	L27587	CCDS11655.1, CCDS11656.1, CCDS42372.1	17q23	2014-09-17	2006-03-28			ENSG00000007312		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1699	protein-coding gene	gene with protein product		147245	"""CD79B antigen (immunoglobulin-associated beta)"""	IGB		9545642	Standard	XM_005257858		Approved	B29	uc002jdp.1	P40259		ENST00000006750.3:c.523G>T	17.37:g.62007156C>A	ENSP00000006750:p.Val175Leu		Somatic	19	0	0		WXS	Illumina HiSeq	Phase_I	26	0.08	2	NM_001039933	15	0.00	0	Q53FS2|Q9BU06	Missense_Mutation	SNP	ENST00000006750.3	37	CCDS11655.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.716799	0.89205	.	.	ENSG00000007312	ENST00000349817;ENST00000392795;ENST00000006750	T;T	0.81330	-1.48;-1.48	5.24	5.24	0.73138	.	0.067356	0.64402	D	0.000013	D	0.84142	0.5407	L	0.32530	0.975	0.48135	D	0.999596	D;D	0.76494	0.996;0.999	D;D	0.79108	0.992;0.99	D	0.85552	0.1222	10	0.66056	D	0.02	-39.6781	14.3142	0.66437	0.0:1.0:0.0:0.0	.	71;175	P40259-2;P40259	.;CD79B_HUMAN	L	71;176;175	ENSP00000376544:V176L;ENSP00000006750:V175L	ENSP00000006750:V175L	V	-	1	0	CD79B	59360888	0.990000	0.36364	0.999000	0.59377	0.962000	0.63368	2.422000	0.44696	2.456000	0.83038	0.491000	0.48974	GTG			0.582	CD79B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000417711.1			
IL9RP4	100132166	bcgsc.ca	37	18	80204	80204	+	IGR	SNP	A	A	C			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr18:80204A>C								RP11-683L23.1 (29964 upstream) : ROCK1P1 (28860 downstream)																							CGTGGGGGCCAAGTCCTCCTG	0.602																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	100132166	.			GGGGCCAAGTCCT																													18.37:g.80204A>C			Somatic	46	0.0434782609	2		WXS	Illumina HiSeq	Phase_1	41	0.15	6	.	1	0.00	0		RNA	SNP		37																																																																																					0	0.602										
AP3D1	8943	mdanderson.org	37	19	2121000	2121000	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr19:2121000C>T	ENST00000345016.5	-	14	1573	c.1342G>A	c.(1342-1344)Gtg>Atg	p.V448M	AP3D1_ENST00000355272.6_Missense_Mutation_p.V448M|AP3D1_ENST00000590683.1_5'Flank|AP3D1_ENST00000356926.4_Missense_Mutation_p.V357M|AP3D1_ENST00000350812.6_Missense_Mutation_p.V279M	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	448					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATGGCCTTCACGCGGATGGCC	0.652																																					p.V448M													.	.			0			c.G1342A												61.0	68.0	65.0					19																	2121000		2189	4278	6467	SO:0001583	missense	8943	exon14			CCTTCACGCGGAT	U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.1342G>A	19.37:g.2121000C>T	ENSP00000344055:p.Val448Met		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_001261826	160	0.00	0	O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Missense_Mutation	SNP	ENST00000345016.5	37	CCDS42459.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.810921	0.90707	.	.	ENSG00000065000	ENST00000356926;ENST00000345016;ENST00000355272;ENST00000343722;ENST00000350812	T;T;T;T	0.27557	1.66;1.66;1.66;1.66	4.57	4.57	0.56435	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69378	0.3104	H	0.96970	3.915	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.82018	-0.0665	10	0.87932	D	0	-31.2171	16.3169	0.82931	0.0:1.0:0.0:0.0	.	448;448;357	O14617-5;O14617;G5E988	.;AP3D1_HUMAN;.	M	357;448;448;448;279	ENSP00000349398:V357M;ENSP00000344055:V448M;ENSP00000347416:V448M;ENSP00000342321:V279M	ENSP00000341579:V448M	V	-	1	0	AP3D1	2072000	1.000000	0.71417	0.836000	0.33094	0.899000	0.52679	7.648000	0.83479	2.103000	0.63969	0.462000	0.41574	GTG			0.652	AP3D1-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000450912.1			
LINGO3	645191	mdanderson.org	37	19	2291166	2291166	+	Silent	SNP	G	G	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr19:2291166G>T	ENST00000585527.1	-	1	857	c.610C>A	c.(610-612)Cgg>Agg	p.R204R	LINGO3_ENST00000404279.1_Silent_p.R204R			P0C6S8	LIGO3_HUMAN	leucine rich repeat and Ig domain containing 3	204						integral component of membrane (GO:0016021)				lung(1)|urinary_tract(1)	2						TGGCGCAGCCGCAGGGCGCCC	0.711																																					p.R204R													.	.			0			c.C610A												7.0	9.0	8.0					19																	2291166		1915	4041	5956	SO:0001819	synonymous_variant	645191	exon2			GCAGCCGCAGGGC	AK091795	CCDS45905.1	19p13.3	2013-01-11	2007-02-01	2007-02-01		ENSG00000220008		"""Immunoglobulin superfamily / I-set domain containing"""	21206	protein-coding gene	gene with protein product		609792	"""leucine rich repeat neuronal 6B"""	LRRN6B		14686891	Standard	NM_001101391		Approved	LERN2	uc010dsx.1	P0C6S8		ENST00000585527.1:c.610C>A	19.37:g.2291166G>T			Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_001101391	1	0.00	0		Silent	SNP	ENST00000585527.1	37	CCDS45905.1																																																																																					0.711	LINGO3-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000451291.2		NM_001101391	
PNPLA6	10908	broad.mit.edu	37	19	7626396	7626396	+	Missense_Mutation	SNP	G	G	A	rs368661376		TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr19:7626396G>A	ENST00000221249.6	+	35	4363	c.3932G>A	c.(3931-3933)cGg>cAg	p.R1311Q	PNPLA6_ENST00000600737.1_Missense_Mutation_p.R1349Q|PNPLA6_ENST00000545201.2_Missense_Mutation_p.R1284Q|PNPLA6_ENST00000450331.3_Missense_Mutation_p.R1311Q|PNPLA6_ENST00000414982.3_Missense_Mutation_p.R1359Q	NM_006702.4	NP_006693.3	Q8IY17	PLPL6_HUMAN	patatin-like phospholipase domain containing 6	1350					angiogenesis (GO:0001525)|cell death (GO:0008219)|lipid catabolic process (GO:0016042)|organ morphogenesis (GO:0009887)|phosphatidylcholine metabolic process (GO:0046470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	35						TCGATTCTCCGGCAACGACGC	0.657																																					p.R1359Q													.	PNPLA6	163		0			c.G4076A							G	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	1,4405		0,1,2202	51.0	35.0	40.0		4076,3851,3932,4046,3932	3.4	0.3	19		40	2,8596		0,2,4297	no	missense,missense,missense,missense,missense	PNPLA6	NM_001166111.1,NM_001166112.1,NM_001166113.1,NM_001166114.1,NM_006702.4	43,43,43,43,43	0,3,6499	AA,AG,GG		0.0233,0.0227,0.0231	benign,benign,benign,benign,benign	1359/1376,1284/1301,1311/1328,1349/1366,1311/1328	7626396	3,13001	2203	4299	6502	SO:0001583	missense	10908	exon34			TTCTCCGGCAACG	AJ004832	CCDS32891.1, CCDS54206.1, CCDS54207.1, CCDS59343.1	19p13.2	2013-09-11						"""Patatin-like phospholipase domain containing"""	16268	protein-coding gene	gene with protein product	"""neuropathy target esterase"""	603197				9576844, 16799181, 19029121	Standard	NM_006702		Approved	NTE, sws, iPLA2delta, SPG39	uc010xjq.2	Q8IY17		ENST00000221249.6:c.3932G>A	19.37:g.7626396G>A	ENSP00000221249:p.Arg1311Gln		Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	82	0.06	5	NM_001166111	69	0.00	0	A6NGQ0|B4DFB9|B7Z7T2|F5H5K9|J3KQS3|O60859|Q86W58|Q9UG58	Missense_Mutation	SNP	ENST00000221249.6	37	CCDS32891.1	.	.	.	.	.	.	.	.	.	.	g	15.09	2.729323	0.48833	2.27E-4	2.33E-4	ENSG00000032444	ENST00000221249;ENST00000545201;ENST00000414982;ENST00000450331	T;T;T;T	0.04551	3.63;3.63;3.6;3.63	4.48	3.42	0.39159	.	0.245696	0.23296	N	0.049734	T	0.03095	0.0091	L	0.27053	0.805	0.19300	N	0.99997	B;B;B;B	0.30584	0.032;0.286;0.055;0.239	B;B;B;B	0.17722	0.005;0.019;0.01;0.014	T	0.43212	-0.9405	10	0.34782	T	0.22	-27.363	6.201	0.20575	0.1007:0.1907:0.7086:0.0	.	1350;1284;1349;1311	Q8IY17;F5H5K9;Q8IY17-3;Q8IY17-2	PLPL6_HUMAN;.;.;.	Q	1311;1284;1359;1311	ENSP00000221249:R1311Q;ENSP00000443323:R1284Q;ENSP00000407509:R1359Q;ENSP00000394348:R1311Q	ENSP00000221249:R1311Q	R	+	2	0	PNPLA6	7532396	0.003000	0.15002	0.281000	0.24762	0.225000	0.24961	1.089000	0.30890	1.074000	0.40909	0.561000	0.74099	CGG			0.657	PNPLA6-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000459275.1		NM_006702	
ASNA1	439	mdanderson.org	37	19	12856212	12856212	+	Missense_Mutation	SNP	G	G	T	rs373752704		TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr19:12856212G>T	ENST00000591090.1	+	4	433	c.331G>T	c.(331-333)Gtg>Ttg	p.V111L	ASNA1_ENST00000357332.3_Missense_Mutation_p.V111L					arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)											endometrium(1)|lung(6)|ovary(3)	10						CAGCCTGGGCGTGGCGGAGCT	0.622																																					p.V111L													.	.			0			c.G331T												54.0	49.0	51.0					19																	12856212		2203	4300	6503	SO:0001583	missense	439	exon3			CTGGGCGTGGCGG	U60276	CCDS32920.1	19p13.13	2010-08-05	2001-12-04			ENSG00000198356			752	protein-coding gene	gene with protein product	"""golgi to ER traffic 3 homolog (S. cerevisiae)"", ""transmembrane domain recognition complex, 40kDa"""	601913	"""arsA (bacterial) arsenite transporter, ATP-binding, homolog 1"""			8884272, 17382883	Standard	NM_004317		Approved	ARSA-I, GET3, TRC40	uc002muv.3	O43681		ENST00000591090.1:c.331G>T	19.37:g.12856212G>T	ENSP00000466379:p.Val111Leu		Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	30	0.10	3	NM_004317	430	0.00	0		Missense_Mutation	SNP	ENST00000591090.1	37	CCDS32920.1	.	.	.	.	.	.	.	.	.	.	G	9.992	1.231127	0.22626	.	.	ENSG00000198356	ENST00000357332	T	0.40225	1.04	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.17916	0.0430	N	0.01817	-0.705	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.002	T	0.20706	-1.0267	10	0.02654	T	1	-42.7621	17.6674	0.88207	0.0:0.0:1.0:0.0	.	93;111	E7EVN0;O43681	.;ASNA_HUMAN	L	111	ENSP00000349887:V111L	ENSP00000349887:V111L	V	+	1	0	ASNA1	12717212	1.000000	0.71417	0.965000	0.40720	0.987000	0.75469	9.030000	0.93725	2.466000	0.83321	0.655000	0.94253	GTG			0.622	ASNA1-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450921.1		NM_004317	
F2RL3	9002	mdanderson.org	37	19	17004142	17004142	+	IGR	SNP	G	G	A			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr19:17004142G>A	ENST00000248076.3	+	0	3473				CPAMD8_ENST00000597335.1_5'Flank|CPAMD8_ENST00000443236.1_Missense_Mutation_p.A1859V	NM_003950.2	NP_003941.2	Q96RI0	PAR4_HUMAN	coagulation factor II (thrombin) receptor-like 3						blood coagulation (GO:0007596)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thrombin receptor activity (GO:0015057)			cervix(1)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	7						CCGAGGCCCGGCTGTGACCCT	0.627																																					p.A1859V													.	.			0			c.C5576T												9.0	10.0	10.0					19																	17004142		1875	4036	5911	SO:0001628	intergenic_variant	27151	exon42			GGCCCGGCTGTGA	AF055917	CCDS12350.1	19p12	2012-08-08						"""GPCR / Class A : Protease activated receptors"""	3540	protein-coding gene	gene with protein product	"""proteinase-activated receptor-4"""	602779				9618465	Standard	XM_005260139		Approved	PAR4	uc002nfa.3	Q96RI0			19.37:g.17004142G>A			Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	15	0.13	2	NM_015692	3	0.00	0	O76067|Q6DK42	Missense_Mutation	SNP	ENST00000248076.3	37	CCDS12350.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.714|2.714	-0.268214|-0.268214	0.05716|0.05716	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000291440|ENST00000443236	.|.	.|.	.|.	1.61|1.61	-3.22|-3.22	0.05125|0.05125	.|.	.|.	.|.	.|.	.|.	T|T	0.13586|0.13586	0.0329|0.0329	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.17289|0.17289	-1.0374|-1.0374	8|5	0.02654|.	T|.	1|.	.|.	4.6496|4.6496	0.12589|0.12589	0.0:0.3804:0.3411:0.2785|0.0:0.3804:0.3411:0.2785	.|.	1812|.	Q8IZJ3|.	CPMD8_HUMAN|.	V|S	1859|1870	.|.	ENSP00000291440:A1859V|.	A|P	-|-	2|1	0|0	CPAMD8|CPAMD8	16865142|16865142	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-2.050000|-2.050000	0.01404|0.01404	-2.004000|-2.004000	0.00961|0.00961	-0.534000|-0.534000	0.04291|0.04291	GCC|CCG			0.627	F2RL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462875.1			
MAG	4099	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	35800891	35800891	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr19:35800891G>A	ENST00000392213.3	+	8	1505	c.1346G>A	c.(1345-1347)cGc>cAc	p.R449H	MAG_ENST00000593348.1_3'UTR|MAG_ENST00000537831.2_Missense_Mutation_p.R424H|MAG_ENST00000361922.4_Missense_Mutation_p.R449H	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	449	Ig-like C2-type 4.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CTGCCATCGCGCAATGTGACC	0.682																																					p.R449H													.	.			0			c.G1346A												77.0	71.0	73.0					19																	35800891		2203	4300	6503	SO:0001583	missense	4099	exon8			CATCGCGCAATGT	M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.1346G>A	19.37:g.35800891G>A	ENSP00000376048:p.Arg449His		Somatic	50	0	0		WXS	Illumina HiSeq	.	79	0.14	11	NM_080600	7	0.00	0	B7Z2E5|F5GYC0|Q567S4	Missense_Mutation	SNP	ENST00000392213.3	37	CCDS12455.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.110001	0.77210	.	.	ENSG00000105695	ENST00000262624;ENST00000361922;ENST00000392213;ENST00000537831	T;T;T	0.13657	2.57;2.57;2.57	4.8	4.8	0.61643	.	0.135266	0.50627	D	0.000109	T	0.19046	0.0457	N	0.24115	0.695	0.36035	D	0.839685	D;D;D	0.89917	1.0;0.999;1.0	D;P;P	0.63192	0.912;0.861;0.899	T	0.07195	-1.0785	10	0.41790	T	0.15	.	10.4373	0.44443	0.0:0.0:0.8056:0.1944	.	486;449;449	Q59GD9;P20916;Q567S4	.;MAG_HUMAN;.	H	486;449;449;424	ENSP00000355234:R449H;ENSP00000376048:R449H;ENSP00000440695:R424H	ENSP00000262624:R486H	R	+	2	0	MAG	40492731	0.995000	0.38212	1.000000	0.80357	0.971000	0.66376	2.984000	0.49353	2.497000	0.84241	0.462000	0.41574	CGC			0.682	MAG-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000466071.1		NM_080600	
DHDH	27294	mdanderson.org	37	19	49438356	49438356	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr19:49438356G>T	ENST00000221403.2	+	2	230	c.190G>T	c.(190-192)Gac>Tac	p.D64Y	DHDH_ENST00000522614.1_Missense_Mutation_p.D64Y|DHDH_ENST00000523250.1_Missense_Mutation_p.D64Y	NM_014475.3	NP_055290.1	Q9UQ10	DHDH_HUMAN	dihydrodiol dehydrogenase (dimeric)	64					carbohydrate metabolic process (GO:0005975)|D-xylose catabolic process (GO:0042843)		D-xylose 1-dehydrogenase (NADP+) activity (GO:0047837)|electron carrier activity (GO:0009055)|NAD(P)+ transhydrogenase activity (GO:0008746)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			central_nervous_system(1)|large_intestine(3)|lung(3)|ovary(1)|soft_tissue(1)	9		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000158)|all cancers(93;0.000258)|Epithelial(262;0.0173)|GBM - Glioblastoma multiforme(486;0.0179)		GCTGGCCAAGGACCCGAGCGT	0.697																																					p.D64Y													.	.			0			c.G190T																																									SO:0001583	missense	27294	exon2			GCCAAGGACCCGA	AB021933	CCDS12741.1	19q13.3	2008-02-05			ENSG00000104808	ENSG00000104808	1.3.1.20		17887	protein-coding gene	gene with protein product		606377				10477285	Standard	NM_014475		Approved	HUM2DD	uc002ple.1	Q9UQ10	OTTHUMG00000165029	ENST00000221403.2:c.190G>T	19.37:g.49438356G>T	ENSP00000221403:p.Asp64Tyr		Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_014475	0		0		Missense_Mutation	SNP	ENST00000221403.2	37	CCDS12741.1	.	.	.	.	.	.	.	.	.	.	G	19.78	3.891989	0.72524	.	.	ENSG00000104808	ENST00000221403;ENST00000523250;ENST00000522614	T;T;T	0.28895	1.59;1.59;1.59	4.75	4.75	0.60458	Oxidoreductase, N-terminal (1);NAD(P)-binding domain (1);	0.204155	0.49305	D	0.000156	T	0.68183	0.2973	H	0.96633	3.855	0.58432	D	0.999999	D	0.71674	0.998	D	0.70935	0.971	T	0.79662	-0.1710	10	0.72032	D	0.01	-30.2084	15.6293	0.76888	0.0:0.0:1.0:0.0	.	64	Q9UQ10	DHDH_HUMAN	Y	64	ENSP00000221403:D64Y;ENSP00000428935:D64Y;ENSP00000428672:D64Y	ENSP00000221403:D64Y	D	+	1	0	DHDH	54130168	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	5.275000	0.65575	2.626000	0.88956	0.455000	0.32223	GAC			0.697	DHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381477.1		NM_014475	
ZIM3	114026	broad.mit.edu	37	19	57649920	57649920	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr19:57649920T>C	ENST00000269834.1	-	3	447	c.62A>G	c.(61-63)gAg>gGg	p.E21G		NM_052882.1	NP_443114.1	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	21	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(27)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	52		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CCGCTGCCACTCCCCCTGGGT	0.517																																					p.E21G													.	ZIM3	107		0			c.A62G												99.0	89.0	92.0					19																	57649920		2203	4300	6503	SO:0001583	missense	0	exon3			TGCCACTCCCCCT	AF365931	CCDS33125.1	19q13.4	2013-01-08				ENSG00000141946		"""Zinc fingers, C2H2-type"", ""-"""	16366	protein-coding gene	gene with protein product							Standard	NM_052882		Approved	ZNF657	uc002qnz.1	Q96PE6		ENST00000269834.1:c.62A>G	19.37:g.57649920T>C	ENSP00000269834:p.Glu21Gly		Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	90	0.04	4	NM_052882	0		0	Q14CA6	Missense_Mutation	SNP	ENST00000269834.1	37	CCDS33125.1	.	.	.	.	.	.	.	.	.	.	T	16.10	3.026973	0.54683	.	.	ENSG00000141946	ENST00000269834	T	0.12255	2.7	2.42	2.42	0.29668	Krueppel-associated box (4);	.	.	.	.	T	0.26774	0.0655	H	0.96015	3.755	0.09310	N	1	P	0.45902	0.868	B	0.38921	0.285	T	0.38308	-0.9667	9	0.87932	D	0	.	8.0425	0.30529	0.0:0.0:0.0:1.0	.	21	Q96PE6	ZIM3_HUMAN	G	21	ENSP00000269834:E21G	ENSP00000269834:E21G	E	-	2	0	ZIM3	62341732	0.968000	0.33430	0.001000	0.08648	0.278000	0.26855	2.238000	0.43070	0.975000	0.38392	0.172000	0.16884	GAG			0.517	ZIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465078.1			
KDM3A	55818	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	86707433	86707433	+	Silent	SNP	T	T	C			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr2:86707433T>C	ENST00000409556.1	+	17	2825	c.2460T>C	c.(2458-2460)ccT>ccC	p.P820P	KDM3A_ENST00000542128.1_Silent_p.P768P|KDM3A_ENST00000312912.5_Silent_p.P820P|KDM3A_ENST00000409064.1_Silent_p.P820P			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	820					androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						GCACATCTCCTCTAAACTGGC	0.532																																					p.P820P	NSCLC(96;1150 1523 6936 46253 49736)												.	.			0			c.T2460C												74.0	85.0	81.0					2																	86707433		2203	4300	6503	SO:0001819	synonymous_variant	55818	exon16			ATCTCCTCTAAAC	AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	ENST00000409556.1:c.2460T>C	2.37:g.86707433T>C			Somatic	75	0	0		WXS	Illumina HiSeq	.	79	0.08	6	NM_001146688	69	0.12	8	D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	Silent	SNP	ENST00000409556.1	37	CCDS1990.1																																																																																					0.532	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252522.2		NM_018433	
NCAPH	23397	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	2	97033084	97033084	+	Silent	SNP	G	G	T	rs149403246		TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr2:97033084G>T	ENST00000240423.4	+	15	2014	c.1971G>T	c.(1969-1971)gcG>gcT	p.A657A	NCAPH_ENST00000455200.1_Silent_p.A646A|NCAPH_ENST00000427946.1_Silent_p.A521A	NM_001281710.1|NM_001281711.1|NM_015341.3	NP_001268639.1|NP_001268640.1|NP_056156.2	Q15003	CND2_HUMAN	non-SMC condensin I complex, subunit H	657					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(717;0.0221)				TGCTGACAGCGCTCTCCGGAA	0.488																																					p.A657A													.	.			0			c.G1971T												86.0	83.0	84.0					2																	97033084		2203	4300	6503	SO:0001819	synonymous_variant	23397	exon15			GACAGCGCTCTCC	BC024211	CCDS2021.1, CCDS62960.1	2q11.2	2008-02-05	2006-09-04	2006-09-04	ENSG00000121152	ENSG00000121152			1112	protein-coding gene	gene with protein product		602332	"""barren (Drosophila) homolog"", ""barren homolog (Drosophila)"", ""barren homolog 1 (Drosophila)"""	BRRN1		9417923	Standard	NM_015341		Approved	CAP-H, hCAP-H	uc002svz.1	Q15003	OTTHUMG00000130451	ENST00000240423.4:c.1971G>T	2.37:g.97033084G>T			Somatic	94	0	0		WXS	Illumina HiSeq	.	121	0.04	5	NM_015341	121	0.00	0	B4E189|Q8TB87	Silent	SNP	ENST00000240423.4	37	CCDS2021.1	.	.	.	.	.	.	.	.	.	.	G	4.836	0.155344	0.09236	.	.	ENSG00000121152	ENST00000435349	T	0.41400	1.0	5.93	-3.66	0.04489	.	0.692617	0.16053	N	0.231891	T	0.15652	0.0377	.	.	.	0.09310	N	0.999993	.	.	.	.	.	.	T	0.21075	-1.0256	7	0.13853	T	0.58	-0.8197	1.893	0.03252	0.3647:0.3153:0.2028:0.1173	.	.	.	.	S	98	ENSP00000415162:A98S	ENSP00000415162:A98S	A	+	1	0	NCAPH	96396811	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-0.257000	0.08745	-0.323000	0.08602	-0.145000	0.13849	GCT			0.488	NCAPH-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000252842.2		NM_015341	
NPAS2	4862	mdanderson.org	37	2	101587513	101587513	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr2:101587513G>T	ENST00000335681.5	+	12	1402	c.1117G>T	c.(1117-1119)Gcc>Tcc	p.A373S	AC016738.3_ENST00000446644.1_RNA|AC016738.3_ENST00000439150.1_RNA|NPAS2_ENST00000542504.1_Missense_Mutation_p.A438S	NM_002518.3	NP_002509.2	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	373					cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|circadian sleep/wake cycle (GO:0042745)|locomotor rhythm (GO:0045475)|negative regulation of cell death (GO:0060548)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of response to DNA damage stimulus (GO:2001020)|response to redox state (GO:0051775)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|Hsp90 protein binding (GO:0051879)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GCCATCCGAGGCCCTCCACTC	0.552																																					p.A373S													.	.			0			c.G1117T												84.0	80.0	81.0					2																	101587513		2203	4300	6503	SO:0001583	missense	4862	exon12			TCCGAGGCCCTCC	U77970	CCDS2048.1	2q11.2	2013-05-21			ENSG00000170485	ENSG00000170485		"""Basic helix-loop-helix proteins"""	7895	protein-coding gene	gene with protein product		603347				9012850, 9079689	Standard	NM_002518		Approved	MOP4, PASD4, bHLHe9	uc002tap.1	Q99743	OTTHUMG00000130675	ENST00000335681.5:c.1117G>T	2.37:g.101587513G>T	ENSP00000338283:p.Ala373Ser		Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	130	0.04	5	NM_002518	5	0.00	0	Q4ZFV9|Q53SQ3|Q86V96|Q99629	Missense_Mutation	SNP	ENST00000335681.5	37	CCDS2048.1	.	.	.	.	.	.	.	.	.	.	G	7.459	0.644194	0.14451	.	.	ENSG00000170485	ENST00000335681;ENST00000542504	T;T	0.05081	3.51;3.5	5.85	1.98	0.26296	.	0.677560	0.15901	N	0.239067	T	0.05960	0.0155	L	0.47716	1.5	0.21020	N	0.999808	B;B	0.23249	0.082;0.015	B;B	0.22753	0.041;0.011	T	0.44997	-0.9291	10	0.11182	T	0.66	.	9.2325	0.37446	0.427:0.0:0.573:0.0	.	438;373	F5H027;Q99743	.;NPAS2_HUMAN	S	373;438	ENSP00000338283:A373S;ENSP00000438428:A438S	ENSP00000338283:A373S	A	+	1	0	NPAS2	100953945	0.943000	0.32029	0.241000	0.24154	0.816000	0.46133	1.008000	0.29872	0.083000	0.17047	0.655000	0.94253	GCC			0.552	NPAS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000253168.3			
SH3RF3	344558	broad.mit.edu	37	2	110065794	110065794	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr2:110065794T>C	ENST00000309415.6	+	8	1997	c.1997T>C	c.(1996-1998)aTc>aCc	p.I666T		NM_001099289.1	NP_001092759.1	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3	666							zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(5)|ovary(2)	18						CGGCCGGCCATCCCCCTCACA	0.677																																					p.I666T													.	SH3RF3	62		0			c.T1997C												29.0	38.0	35.0					2																	110065794		2144	4251	6395	SO:0001583	missense	344558	exon8			CGGCCATCCCCCT	AK074131	CCDS74557.1	2q13	2013-01-11	2008-05-14	2008-05-14	ENSG00000172985	ENSG00000172985		"""RING-type (C3HC4) zinc fingers"""	24699	protein-coding gene	gene with protein product			"""SH3 multiple domains 4"""	SH3MD4		16374509	Standard	XM_006712493		Approved	FLJ00204, POSH2	uc010ywt.1	Q8TEJ3	OTTHUMG00000153439	ENST00000309415.6:c.1997T>C	2.37:g.110065794T>C	ENSP00000309186:p.Ile666Thr		Somatic	265	0.0150943396	4		WXS	Illumina HiSeq	Phase_I	337	0.01	5	NM_001099289	3	0.00	0	A0SDZ7|A8MPR1|Q8NDU1	Missense_Mutation	SNP	ENST00000309415.6	37		.	.	.	.	.	.	.	.	.	.	T	13.52	2.262250	0.39995	.	.	ENSG00000172985	ENST00000418513;ENST00000309415	T;T	0.56941	0.43;2.22	4.9	4.9	0.64082	.	0.118369	0.56097	D	0.000023	T	0.38295	0.1035	.	.	.	0.47123	D	0.999328	P	0.34546	0.456	B	0.33521	0.165	T	0.19386	-1.0307	9	0.14252	T	0.57	-29.8916	14.6948	0.69113	0.0:0.0:0.0:1.0	.	666	Q8TEJ3	SH3R3_HUMAN	T	666	ENSP00000414997:I666T;ENSP00000309186:I666T	ENSP00000309186:I666T	I	+	2	0	SH3RF3	109432226	1.000000	0.71417	0.956000	0.39512	0.680000	0.39746	5.466000	0.66731	2.064000	0.61679	0.533000	0.62120	ATC			0.677	SH3RF3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_001099289	
TTN	7273	mdanderson.org	37	2	179490019	179490019	+	Silent	SNP	G	G	A	rs55973744	byFrequency	TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr2:179490019G>A	ENST00000591111.1	-	191	39830	c.39606C>T	c.(39604-39606)caC>caT	p.H13202H	TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Silent_p.H5903H|TTN_ENST00000460472.2_Silent_p.H5778H|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000342992.6_Silent_p.H12275H|TTN_ENST00000342175.6_Silent_p.H5970H|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Silent_p.H14843H			Q8WZ42	TITIN_HUMAN	titin	13202	Ig-like 87.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGAGGTTGGCGTGAGTTTTGA	0.373													G|||	44	0.00878594	0.0	0.0	5008	,	,		15620	0.0407		0.0	False		,,,				2504	0.0031				p.H14843H													.	.			0			c.C44529T							G	,,,	1,3683		0,1,1841	247.0	236.0	239.0		17334,36825,17709,17910	0.8	1.0	2	dbSNP_129	239	0,8168		0,0,4084	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	,,,	0,1,5925	AA,AG,GG		0.0,0.0271,0.0084	,,,	5778/26927,12275/33424,5903/27052,5970/27119	179490019	1,11851	1842	4084	5926	SO:0001819	synonymous_variant	7273	exon241			GTTGGCGTGAGTT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.39606C>T	2.37:g.179490019G>A			Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	54	0.06	3	NM_001267550	1	0.00	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																				0.01		0.373	TTN-019	PUTATIVE	basic	protein_coding	protein_coding		OTTHUMT00000460310.1		NM_133378	
DNAH7	56171	mdanderson.org	37	2	196682528	196682528	+	Missense_Mutation	SNP	G	G	T	rs570476938		TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr2:196682528G>T	ENST00000312428.6	-	50	9417	c.9317C>A	c.(9316-9318)aCc>aAc	p.T3106N		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3106	AAA 5. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TCCCTCAGGGGTTATCATGAA	0.348																																					p.T3106N													.	.			0			c.C9317A												74.0	66.0	68.0					2																	196682528		1827	4083	5910	SO:0001583	missense	56171	exon50			TCAGGGGTTATCA	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.9317C>A	2.37:g.196682528G>T	ENSP00000311273:p.Thr3106Asn		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	109	0.05	5	NM_018897	3	0.00	0	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	37	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.459244	0.84317	.	.	ENSG00000118997	ENST00000312428	T	0.29655	1.56	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	T	0.73337	0.3574	H	0.99026	4.405	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85483	0.1180	10	0.87932	D	0	.	17.8344	0.88692	0.0:0.0:1.0:0.0	.	3106	Q8WXX0	DYH7_HUMAN	N	3106	ENSP00000311273:T3106N	ENSP00000311273:T3106N	T	-	2	0	DNAH7	196390773	1.000000	0.71417	0.963000	0.40424	0.762000	0.43233	9.657000	0.98554	2.520000	0.84964	0.561000	0.74099	ACC			0.348	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000335202.3		NM_018897	
CATIP	375307	mdanderson.org	37	2	219227558	219227558	+	Missense_Mutation	SNP	G	G	T	rs201618489		TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr2:219227558G>T	ENST00000289388.3	+	6	592	c.563G>T	c.(562-564)cGg>cTg	p.R188L	C2orf62_ENST00000481940.1_Intron	NM_198559.1	NP_940961.1	Q7Z7H3	CATIP_HUMAN		188					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16		Renal(207;0.0915)		Epithelial(149;8.08e-07)|all cancers(144;0.000146)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCCTGGCGGCGGATGGTGCCC	0.582																																					p.R188L													C2orf62,NS,carcinoma,+1,1	C2orf62	1	1	0			c.G563T												66.0	61.0	62.0					2																	219227558		2203	4300	6503	SO:0001583	missense	375307	exon6			GGCGGCGGATGGT																												ENST00000289388.3:c.563G>T	2.37:g.219227558G>T	ENSP00000289388:p.Arg188Leu		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_198559	11	0.00	0		Missense_Mutation	SNP	ENST00000289388.3	37	CCDS2414.1	.	.	.	.	.	.	.	.	.	.	G	11.62	1.692595	0.30052	.	.	ENSG00000158428	ENST00000289388	.	.	.	4.7	-2.0	0.07433	.	0.437579	0.22676	N	0.057014	T	0.28665	0.0710	L	0.38175	1.15	0.09310	N	1	B	0.26195	0.144	B	0.23275	0.045	T	0.24297	-1.0164	9	0.59425	D	0.04	-13.8114	10.7024	0.45934	0.6317:0.0:0.3683:0.0	.	188	Q7Z7H3	CB062_HUMAN	L	188	.	ENSP00000289388:R188L	R	+	2	0	C2orf62	218935802	0.004000	0.15560	0.017000	0.16124	0.933000	0.57130	-0.259000	0.08721	-0.225000	0.09913	-0.812000	0.03155	CGG			0.582	C2orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256771.1			
TRIP12	9320	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	230668944	230668944	+	Splice_Site	SNP	C	C	G			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr2:230668944C>G	ENST00000283943.5	-	18	2604		c.e18-1		TRIP12_ENST00000389044.4_Splice_Site|TRIP12_ENST00000389045.3_Splice_Site|TRIP12_ENST00000543084.1_Intron	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12						cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		GAATATCCACCTATTACATTA	0.338																																					.													.	.			0			c.2426-1G>C												54.0	62.0	59.0					2																	230668944		2197	4299	6496	SO:0001630	splice_region_variant	9320	exon19			ATCCACCTATTAC	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.2426-1G>C	2.37:g.230668944C>G			Somatic	243	0	0		WXS	Illumina HiSeq	.	258	0.14	36	NM_004238	1	1.00	1	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Splice_Site	SNP	ENST00000283943.5	37	CCDS33391.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.945849	0.73672	.	.	ENSG00000153827	ENST00000283943;ENST00000389045;ENST00000389044	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1011	0.97876	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TRIP12	230377188	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	7.173000	0.77612	2.750000	0.94351	0.484000	0.47621	.			0.338	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000331861.3		NM_004238	Intron
PDYN	5173	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	1961480	1961480	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr20:1961480T>G	ENST00000217305.2	-	4	479	c.254A>C	c.(253-255)aAg>aCg	p.K85T	PDYN_ENST00000540134.1_Missense_Mutation_p.K85T|RP4-684O24.5_ENST00000446562.1_RNA|PDYN_ENST00000539905.1_Missense_Mutation_p.K85T	NM_001190892.1|NM_001190898.2|NM_024411.4	NP_001177821.1|NP_001177827.1|NP_077722.1	P01213	PDYN_HUMAN	prodynorphin	85					cell death (GO:0008219)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)				endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CCCAACCGACTTGCTCCCCAA	0.547																																					p.K85T													.	.			0			c.A254C												79.0	76.0	77.0					20																	1961480		2203	4300	6503	SO:0001583	missense	5173	exon4			ACCGACTTGCTCC		CCDS13023.1	20p13	2014-09-17			ENSG00000101327	ENSG00000101327		"""Endogenous ligands"""	8820	protein-coding gene	gene with protein product	"""preproenkephalin B"", ""rimorphin"", ""beta-neoendorphin"", ""dynorphin"", ""leu-enkephalin"", ""leumorphin"", ""neoendorphin-dynorphin-enkephalin prepropeptide"""	131340	"""spinocerebellar ataxia 23"""	SCA23		21035104	Standard	NM_001190892		Approved	PENKB, ADCA	uc021vzs.1	P01213	OTTHUMG00000031683	ENST00000217305.2:c.254A>C	20.37:g.1961480T>G	ENSP00000217305:p.Lys85Thr		Somatic	177	0	0		WXS	Illumina HiSeq	.	144	0.33	48	NM_001190898	0		0	A8K0Q3	Missense_Mutation	SNP	ENST00000217305.2	37	CCDS13023.1	.	.	.	.	.	.	.	.	.	.	T	6.805	0.517645	0.13005	.	.	ENSG00000101327	ENST00000539905;ENST00000540134;ENST00000217305	T;T;T	0.80653	-1.4;-1.4;-1.4	4.44	-1.04	0.10068	.	1.101910	0.06855	N	0.798087	T	0.63546	0.2520	L	0.34521	1.04	0.09310	N	1	B	0.28636	0.218	B	0.24006	0.05	T	0.45833	-0.9234	10	0.21014	T	0.42	-9.0308	0.807	0.01086	0.1777:0.3056:0.162:0.3546	.	85	P01213	PDYN_HUMAN	T	85	ENSP00000440185:K85T;ENSP00000442259:K85T;ENSP00000217305:K85T	ENSP00000217305:K85T	K	-	2	0	PDYN	1909480	0.000000	0.05858	0.000000	0.03702	0.199000	0.23934	-0.026000	0.12392	-0.034000	0.13713	0.402000	0.26972	AAG			0.547	PDYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077569.2			
PLCB1	23236	mdanderson.org	37	20	8705341	8705341	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr20:8705341G>T	ENST00000338037.6	+	16	1647	c.1620G>T	c.(1618-1620)atG>atT	p.M540I	PLCB1_ENST00000378637.2_Missense_Mutation_p.M540I|PLCB1_ENST00000494924.1_3'UTR|PLCB1_ENST00000378641.3_Missense_Mutation_p.M540I	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	540	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						CAGAAGAAATGTCTAATCTGG	0.368																																					p.G540G													.	.			0			c.C1620T												73.0	78.0	77.0					20																	8705341		2203	4300	6503	SO:0001583	missense	23236	exon16			AGAAATGTCTAAT	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.1620G>T	20.37:g.8705341G>T	ENSP00000338185:p.Met540Ile		Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	71	0.06	4	NM_015192	9	0.00	0	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Silent	SNP	ENST00000338037.6	37	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.025906	0.75390	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719	T;T;T	0.66460	-0.21;-0.21;-0.21	5.29	5.29	0.74685	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific, Y domain (3);	0.000000	0.85682	D	0.000000	T	0.75191	0.3816	L	0.33093	0.98	0.80722	D	1	P;D	0.64830	0.926;0.994	P;D	0.81914	0.816;0.995	T	0.74688	-0.3581	10	0.44086	T	0.13	.	19.2977	0.94129	0.0:0.0:1.0:0.0	.	540;540	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	I	540;540;540;460;460	ENSP00000367908:M540I;ENSP00000338185:M540I;ENSP00000367904:M540I	ENSP00000338185:M540I	M	+	3	0	PLCB1	8653341	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	9.869000	0.99810	2.627000	0.88993	0.563000	0.77884	ATG			0.368	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077938.3			
LINC01598	105379478	broad.mit.edu	37	20	29572324	29572325	+	RNA	DEL	AC	AC	-	rs373347504		TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	AC	AC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr20:29572324_29572325delAC	ENST00000445151.1	-	0	0				RP4-610C12.1_ENST00000432067.1_RNA																							acacacacaaacacacacacac	0.465																																					.													.	.			0			.																																											0	.			ACACAAACACACA																													20.37:g.29572334_29572335delAC			Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	9	0.33	3	.	0		0		RNA	DEL	ENST00000445151.1	37																																																																																						0.465	RP4-610C12.1-003	KNOWN	non_canonical_polymorphism|basic	antisense	antisense		OTTHUMT00000078491.2			
TOP1	7150	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	39751878	39751894	+	Frame_Shift_Del	DEL	ACCCAGCGGGAGAAGTT	ACCCAGCGGGAGAAGTT	-	rs56111014		TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	ACCCAGCGGGAGAAGTT	ACCCAGCGGGAGAAGTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr20:39751878_39751894delACCCAGCGGGAGAAGTT	ENST00000361337.2	+	21	2489_2505	c.2239_2255delACCCAGCGGGAGAAGTT	c.(2239-2256)acccagcgggagaagtttfs	p.TQREKF747fs	RP1-1J6.2_ENST00000454626.1_RNA	NM_003286.2	NP_003277.1	P11387	TOP1_HUMAN	topoisomerase (DNA) I	747					chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|DNA topological change (GO:0006265)|embryonic cleavage (GO:0040016)|phosphorylation (GO:0016310)|programmed cell death (GO:0012501)|response to drug (GO:0042493)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|replication fork protection complex (GO:0031298)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|poly(A) RNA binding (GO:0044822)	p.T747P(1)		breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	37		Myeloproliferative disorder(115;0.00878)			Irinotecan(DB00762)|Lucanthone(DB04967)|Sodium stibogluconate(DB05630)|Topotecan(DB01030)	TTACAACAAAACCCAGCGGGAGAAGTTTGCCTGGGCC	0.479			T	NUP98	AML*																																p.746_752del				Dom	yes		20	20q12-q13.1	7150	topoisomerase (DNA) I		L	.	TOP1	71		1	Substitution - Missense(1)	prostate(1)	c.2238_2254del																																									SO:0001589	frameshift_variant	7150	exon21			AACAAAACCCAGC		CCDS13312.1	20q12-q13.1	1990-06-22			ENSG00000198900	ENSG00000198900	5.99.1.2		11986	protein-coding gene	gene with protein product		126420					Standard	NM_003286		Approved		uc010ggd.1	P11387	OTTHUMG00000033057	ENST00000361337.2:c.2239_2255delACCCAGCGGGAGAAGTT	20.37:g.39751878_39751894delACCCAGCGGGAGAAGTT	ENSP00000354522:p.Thr747fs		Somatic	129	0	0		WXS	Illumina HiSeq	.	94	0.19	18	NM_003286	317	0.00	0	A8KA78|E1P5W3|O43256|Q12855|Q12856|Q15610|Q5TFY3|Q9UJN0	Frame_Shift_Del	DEL	ENST00000361337.2	37	CCDS13312.1																																																																																					0.479	TOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080397.2			
SLC17A9	63910	mdanderson.org	37	20	61584208	61584208	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr20:61584208G>A	ENST00000370351.4	+	1	157	c.26G>A	c.(25-27)cGc>cAc	p.R9H	SLC17A9_ENST00000370349.3_5'UTR|SLC17A9_ENST00000488738.1_3'UTR	NM_022082.3	NP_071365	Q9BYT1	S17A9_HUMAN	solute carrier family 17 (vesicular nucleotide transporter), member 9	9					exocytosis (GO:0006887)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	23						GACGAGGCCCGCAGGGACATG	0.736																																					p.R9H													.	.			0			c.G26A												7.0	13.0	11.0					20																	61584208		1391	2998	4389	SO:0001583	missense	63910	exon1			AGGCCCGCAGGGA	AK027065	CCDS42901.1	20q13.33	2013-07-18	2013-07-18	2009-01-22	ENSG00000101194	ENSG00000101194		"""Solute carriers"""	16192	protein-coding gene	gene with protein product		612107	"""chromosome 20 open reading frame 59"", ""solute carrier family 17, member 9"""	C20orf59		18375752	Standard	NM_022082		Approved	FLJ23412, VNUT	uc002yea.4	Q9BYT1	OTTHUMG00000032951	ENST00000370351.4:c.26G>A	20.37:g.61584208G>A	ENSP00000359376:p.Arg9His		Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	18	0.17	3	NM_022082	6	0.00	0	B3KTF2|Q5W198|Q8TB07|Q8TBP4|Q8TEL5|Q9BYT0|Q9BYT2	Missense_Mutation	SNP	ENST00000370351.4	37	CCDS42901.1	.	.	.	.	.	.	.	.	.	.	G	3.090	-0.187162	0.06299	.	.	ENSG00000101194	ENST00000370351	T	0.59502	0.26	3.05	-1.14	0.09741	Major facilitator superfamily domain, general substrate transporter (1);	0.326920	0.29438	N	0.012156	T	0.37404	0.1002	L	0.29908	0.895	0.24770	N	0.992872	B	0.02656	0.0	B	0.01281	0.0	T	0.15636	-1.0430	10	0.44086	T	0.13	.	6.1668	0.20394	0.5155:0.0:0.4845:0.0	.	9	Q9BYT1	S17A9_HUMAN	H	9	ENSP00000359376:R9H	ENSP00000359376:R9H	R	+	2	0	SLC17A9	61054653	0.000000	0.05858	0.012000	0.15200	0.009000	0.06853	-0.349000	0.07731	-0.215000	0.10063	-0.448000	0.05591	CGC			0.736	SLC17A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080100.1		NM_022082	
SLC7A4	6545	mdanderson.org	37	22	21383511	21383511	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr22:21383511C>T	ENST00000382932.2	-	5	1808	c.1741G>A	c.(1741-1743)Gtg>Atg	p.V581M	SLC7A4_ENST00000403586.1_Missense_Mutation_p.V581M|AC002472.11_ENST00000450652.1_RNA	NM_004173.2	NP_004164.2	O43246	CTR4_HUMAN	solute carrier family 7, member 4	581					basic amino acid transport (GO:0015802)|cellular amino acid metabolic process (GO:0006520)|transport (GO:0006810)	integral component of membrane (GO:0016021)	basic amino acid transmembrane transporter activity (GO:0015174)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|ovary(1)|prostate(2)	18	all_cancers(11;2.85e-22)|Lung NSC(8;4.21e-14)|all_lung(8;6.08e-13)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0968)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)		L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	CCGAAATACACTGCAAGTCCT	0.612																																					p.V581M													.	.			0			c.G1741A												63.0	61.0	61.0					22																	21383511		2203	4300	6503	SO:0001583	missense	6545	exon5			AATACACTGCAAG	AJ000730	CCDS33608.1	22q11.21	2013-07-19	2013-07-19		ENSG00000099960	ENSG00000099960		"""Solute carriers"""	11062	protein-coding gene	gene with protein product		603752	"""solute carrier family 7 (cationic amino acid transporter, y+ system), member 4"", ""solute carrier family 7 (orphan transporter), member 4"""			9598310, 11665818	Standard	NM_004173		Approved	HCAT3, CAT-4, VH	uc002zud.3	O43246	OTTHUMG00000150896	ENST00000382932.2:c.1741G>A	22.37:g.21383511C>T	ENSP00000372390:p.Val581Met		Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	29	0.10	3	NM_004173	29	0.00	0	Q0P5U2|Q3KNQ6|Q4VC45|Q6IBY8|Q96H88	Missense_Mutation	SNP	ENST00000382932.2	37	CCDS33608.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.097911	0.76870	.	.	ENSG00000099960	ENST00000403586;ENST00000382932	D;D	0.87029	-2.2;-2.2	5.23	5.23	0.72850	.	0.126462	0.52532	D	0.000071	D	0.94105	0.8110	M	0.87097	2.86	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.94541	0.7745	10	0.59425	D	0.04	.	16.6614	0.85241	0.0:1.0:0.0:0.0	.	581	O43246	CTR4_HUMAN	M	581	ENSP00000384278:V581M;ENSP00000372390:V581M	ENSP00000372390:V581M	V	-	1	0	SLC7A4	19713511	0.971000	0.33674	0.947000	0.38551	0.477000	0.33069	2.380000	0.44327	2.590000	0.87494	0.491000	0.48974	GTG			0.612	SLC7A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320467.1		NM_004173	
SUN2	25777	broad.mit.edu	37	22	39132280	39132280	+	Missense_Mutation	SNP	C	C	T	rs200715757		TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr22:39132280C>T	ENST00000405510.1	-	19	2504	c.2146G>A	c.(2146-2148)Gcc>Acc	p.A716T	SUN2_ENST00000406622.1_Missense_Mutation_p.A716T|SUN2_ENST00000411587.2_Missense_Mutation_p.A705T|RP3-508I15.14_ENST00000416406.1_RNA|RP3-508I15.20_ENST00000609428.1_RNA|RP3-508I15.18_ENST00000420118.1_RNA|SUN2_ENST00000216064.4_Missense_Mutation_p.A716T|RP3-508I15.19_ENST00000418803.1_RNA|SUN2_ENST00000405018.1_Missense_Mutation_p.A737T	NM_001199580.1	NP_001186509.1	Q9UH99	SUN2_HUMAN	Sad1 and UNC84 domain containing 2	716	SUN. {ECO:0000255|PROSITE- ProRule:PRU00802}.				centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|mitotic spindle organization (GO:0007052)|nuclear envelope organization (GO:0006998)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)	condensed nuclear chromosome (GO:0000794)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|SUN-KASH complex (GO:0034993)	identical protein binding (GO:0042802)|lamin binding (GO:0005521)|microtubule binding (GO:0008017)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|skin(2)|stomach(1)	15						GGCTAGTGGGCGGGCTCCCCA	0.642													C|||	1	0.000199681	0.0	0.0014	5008	,	,		16733	0.0		0.0	False		,,,				2504	0.0				p.A737T													.	SUN2	59		0			c.G2209A							C	THR/ALA,THR/ALA,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	84.0	74.0	78.0		2146,2146,2209	0.3	0.3	22		78	0,8600		0,0,4300	no	missense,missense,missense	SUN2	NM_015374.2,NM_001199580.1,NM_001199579.1	58,58,58	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign,benign	716/718,716/718,737/739	39132280	1,13005	2203	4300	6503	SO:0001583	missense	25777	exon18			AGTGGGCGGGCTC	AF202723	CCDS13978.1, CCDS56231.1	22q12-q13	2010-05-18	2010-05-18	2010-01-27	ENSG00000100242	ENSG00000100242			14210	protein-coding gene	gene with protein product		613569	"""unc-84 homolog B (C. elegans)"""	UNC84B		10508607, 10375507	Standard	NM_015374		Approved		uc010gxq.2	Q9UH99	OTTHUMG00000151031	ENST00000405510.1:c.2146G>A	22.37:g.39132280C>T	ENSP00000385740:p.Ala716Thr		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	64	0.08	5	NM_001199579	148	0.04	6	B0QY62|O75156|Q2NKN8|Q2T9F7|Q504T5|Q6B4H1|Q7Z3E3	Missense_Mutation	SNP	ENST00000405510.1	37	CCDS13978.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	8.657	0.899690	0.17686	2.27E-4	0.0	ENSG00000100242	ENST00000405510;ENST00000216064;ENST00000405018;ENST00000406622;ENST00000411587	T;T;T;T;T	0.13778	2.56;2.56;2.56;2.56;2.59	4.81	0.283	0.15696	Sad1/UNC-like, C-terminal (1);	0.558713	0.17576	N	0.169297	T	0.09247	0.0228	L	0.29908	0.895	0.25279	N	0.989455	B;B;B;B	0.16396	0.005;0.005;0.017;0.002	B;B;B;B	0.09377	0.0;0.0;0.004;0.0	T	0.24368	-1.0162	10	0.42905	T	0.14	-12.0788	9.1472	0.36939	0.0:0.6847:0.0:0.3153	.	705;751;737;716	B4DIU6;B4E2A6;B0QY62;Q9UH99	.;.;.;SUN2_HUMAN	T	716;716;737;716;705	ENSP00000385740:A716T;ENSP00000216064:A716T;ENSP00000385616:A737T;ENSP00000383992:A716T;ENSP00000395601:A705T	ENSP00000216064:A716T	A	-	1	0	SUN2	37462226	0.000000	0.05858	0.279000	0.24732	0.236000	0.25371	-0.191000	0.09601	-0.017000	0.14103	-0.254000	0.11334	GCC			0.642	SUN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000321057.1		XM_039332	
CAND2	23066	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	12856660	12856660	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr3:12856660G>A	ENST00000456430.2	+	8	1068	c.1027G>A	c.(1027-1029)Gat>Aat	p.D343N	CAND2_ENST00000295989.5_Missense_Mutation_p.D250N	NM_001162499.1	NP_001155971.1	O75155	CAND2_HUMAN	cullin-associated and neddylation-dissociated 2 (putative)	343	Poly-Asp.				positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(8)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						CGAGTACAGCGATGACGATGA	0.612																																					p.D343N	GBM(43;676 868 1633 6395 37496)												.	CAND2	138		0			c.G1027A												60.0	67.0	65.0					3																	12856660		2155	4253	6408	SO:0001583	missense	23066	exon8			TACAGCGATGACG		CCDS43053.1, CCDS54554.1	3p25.2	2008-02-05			ENSG00000144712	ENSG00000144712			30689	protein-coding gene	gene with protein product	"""TBP interacting protein"""	610403				9734811, 10441524	Standard	NM_012298		Approved	TIP120B, KIAA0667, Tp120b	uc003bxk.2	O75155	OTTHUMG00000155397	ENST00000456430.2:c.1027G>A	3.37:g.12856660G>A	ENSP00000387641:p.Asp343Asn		Somatic	73	0.0136986301	1		WXS	Illumina HiSeq	Phase_I	113	0.19	22	NM_001162499	22	0.05	1	B9EGM9|E9KL24	Missense_Mutation	SNP	ENST00000456430.2	37	CCDS54554.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.023634	0.75390	.	.	ENSG00000144712	ENST00000295989;ENST00000456430	T;T	0.35973	1.28;1.28	4.86	4.86	0.63082	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.70937	0.3281	H	0.95745	3.715	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.988	T	0.80605	-0.1308	10	0.62326	D	0.03	-14.0275	15.4782	0.75501	0.0:0.0:1.0:0.0	.	343;250	O75155;O75155-2	CAND2_HUMAN;.	N	250;343	ENSP00000295989:D250N;ENSP00000387641:D343N	ENSP00000295989:D250N	D	+	1	0	CAND2	12831660	1.000000	0.71417	0.091000	0.20842	0.320000	0.28249	9.744000	0.98853	2.231000	0.72958	0.561000	0.74099	GAT			0.612	CAND2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000339856.4		XM_371617	
EEF1A1P24	645715	bcgsc.ca	37	3	39401174	39401174	+	IGR	SNP	T	T	C			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr3:39401174T>C								CCR8 (26003 upstream) : SLC25A38 (23664 downstream)																							ATTGCCGTTCTGGTAAAAAGC	0.473																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	645715	.			CCGTTCTGGTAAA																													3.37:g.39401174T>C			Somatic	26	0	0		WXS	Illumina HiSeq	Phase_1	29	0.55	16	.	0		0		RNA	SNP		37																																																																																					0	0.473										
TEX264	51368	mdanderson.org	37	3	51737954	51737954	+	Silent	SNP	G	G	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr3:51737954G>T	ENST00000415259.1	+	5	1945	c.864G>T	c.(862-864)cgG>cgT	p.R288R	TEX264_ENST00000341333.5_Silent_p.R288R|TEX264_ENST00000463857.1_3'UTR|TEX264_ENST00000395057.1_Silent_p.R288R|TEX264_ENST00000457573.1_Silent_p.R288R|TEX264_ENST00000416589.1_Silent_p.R288R			Q9Y6I9	TX264_HUMAN	testis expressed 264	288						extracellular vesicular exosome (GO:0070062)				NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(193;8.53e-05)|Kidney(197;0.000594)|KIRC - Kidney renal clear cell carcinoma(197;0.000759)		GGGAGTCACGGCTGGACCCTG	0.657																																					p.R288R													.	.			0			c.G864T												18.0	21.0	20.0					3																	51737954		2203	4296	6499	SO:0001819	synonymous_variant	51368	exon5			GTCACGGCTGGAC	AF072733	CCDS2833.1, CCDS74945.1	3p21	2007-03-13	2007-03-13		ENSG00000164081	ENSG00000164081			30247	protein-coding gene	gene with protein product			"""testis expressed gene 264"", ""testis expressed sequence 264"""			12975309	Standard	NM_001243725		Approved	ZSIG11, FLJ13935	uc003dbm.4	Q9Y6I9	OTTHUMG00000156901	ENST00000415259.1:c.864G>T	3.37:g.51737954G>T			Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_015926	168	0.00	0	B3KN87|Q9UKD7	Silent	SNP	ENST00000415259.1	37	CCDS2833.1																																																																																					0.657	TEX264-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000346530.1		NM_015926	
ARMC8	25852	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	137942567	137942567	+	Silent	SNP	C	C	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr3:137942567C>T	ENST00000469044.1	+	5	698	c.427C>T	c.(427-429)Ctg>Ttg	p.L143L	ARMC8_ENST00000358441.2_Silent_p.L129L|ARMC8_ENST00000471453.1_Silent_p.L129L|ARMC8_ENST00000538260.1_Silent_p.L143L|ARMC8_ENST00000470821.1_Silent_p.L143L|ARMC8_ENST00000461822.1_Silent_p.L143L|ARMC8_ENST00000485396.1_Silent_p.L101L|ARMC8_ENST00000489213.1_Silent_p.L101L|ARMC8_ENST00000481646.1_Silent_p.L129L|ARMC8_ENST00000393058.3_Silent_p.L133L|ARMC8_ENST00000491704.1_Silent_p.L101L	NM_001267041.1|NM_001267042.1	NP_001253970.1|NP_001253971.1	Q8IUR7	ARMC8_HUMAN	armadillo repeat containing 8	143										endometrium(2)|kidney(1)|large_intestine(7)|lung(5)|upper_aerodigestive_tract(1)	16						AGAGGAGCTACTGTATACAGT	0.428																																					p.L143L													.	ARMC8	79		0			c.C427T												89.0	84.0	86.0					3																	137942567		2203	4300	6503	SO:0001819	synonymous_variant	25852	exon5			GAGCTACTGTATA		CCDS3098.1, CCDS54646.1, CCDS58853.1, CCDS58854.1, CCDS75020.1	3q22	2013-02-14			ENSG00000114098	ENSG00000114098		"""Armadillo repeat containing"""	24999	protein-coding gene	gene with protein product	"""GID complex subunit 5, VID28 homolog (S. cerevisiae)"""					11042152	Standard	NM_014154		Approved	HSPC056, DKFZP434A043, GID5, VID28	uc003esa.2	Q8IUR7	OTTHUMG00000159821	ENST00000469044.1:c.427C>T	3.37:g.137942567C>T			Somatic	83	0.0120481928	1		WXS	Illumina HiSeq	Phase_I	99	0.17	17	NM_001267041	55	0.29	16	A8K0L2|B7Z441|B7Z453|D3DNE6|F5GWK4|Q6PIL2|Q96D19|Q96HZ5|Q9NV02|Q9NV94|Q9Y4R9	Silent	SNP	ENST00000469044.1	37																																																																																						0.428	ARMC8-003	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000357560.1		NM_015396	
KCTD8	386617	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	44449883	44449883	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr4:44449883C>G	ENST00000360029.3	-	1	941	c.658G>C	c.(658-660)Gtg>Ctg	p.V220L	AC131951.1_ENST00000584757.1_RNA	NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	220					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)				central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						TTGTCGCGCACGGTGGTGTAG	0.726										HNSCC(17;0.042)																											p.V220L													.	.			0			c.G658C												10.0	10.0	10.0					4																	44449883		2188	4278	6466	SO:0001583	missense	386617	exon1			CGCGCACGGTGGT	AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.658G>C	4.37:g.44449883C>G	ENSP00000353129:p.Val220Leu		Somatic	29	0	0		WXS	Illumina HiSeq	.	29	0.31	9	NM_198353	0		0	A2RU39	Missense_Mutation	SNP	ENST00000360029.3	37	CCDS3467.1	.	.	.	.	.	.	.	.	.	.	C	17.12	3.308670	0.60305	.	.	ENSG00000183783	ENST00000360029	T	0.38401	1.14	3.99	3.99	0.46301	.	0.084250	0.46758	D	0.000271	T	0.26231	0.0640	N	0.22421	0.69	0.43304	D	0.995307	B	0.10296	0.003	B	0.11329	0.006	T	0.05241	-1.0897	10	0.31617	T	0.26	.	15.2444	0.73497	0.0:1.0:0.0:0.0	.	220	Q6ZWB6	KCTD8_HUMAN	L	220	ENSP00000353129:V220L	ENSP00000353129:V220L	V	-	1	0	KCTD8	44144640	0.995000	0.38212	0.964000	0.40570	0.990000	0.78478	3.711000	0.54868	2.068000	0.61886	0.585000	0.79938	GTG			0.726	KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000216868.1			
BANK1	55024	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	102839288	102839288	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr4:102839288C>A	ENST00000322953.4	+	7	1422	c.1148C>A	c.(1147-1149)gCa>gAa	p.A383E	BANK1_ENST00000504592.1_Missense_Mutation_p.A368E|BANK1_ENST00000444316.2_Missense_Mutation_p.A353E|BANK1_ENST00000428908.1_Missense_Mutation_p.A250E|BANK1_ENST00000508653.1_Missense_Mutation_p.A250E	NM_017935.4	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	383			A -> T (influences susceptibility to SLE; dbSNP:rs3733197). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:18204447}.		B cell activation (GO:0042113)					NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|liver(2)|lung(16)|ovary(2)|skin(2)|urinary_tract(1)	44		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		TCAGACCCCGCACATATTGCT	0.368																																					p.A383E													.	.			0			c.C1148A												62.0	65.0	64.0					4																	102839288		2202	4300	6502	SO:0001583	missense	55024	exon7			ACCCCGCACATAT	AB063170	CCDS34038.1, CCDS47115.1, CCDS47116.1	4q23	2013-01-11						"""Ankyrin repeat domain containing"""	18233	protein-coding gene	gene with protein product		610292				11782428, 21208380, 21480188	Standard	NM_017935		Approved	BANK, FLJ20706	uc003hvy.4	Q8NDB2		ENST00000322953.4:c.1148C>A	4.37:g.102839288C>A	ENSP00000320509:p.Ala383Glu		Somatic	247	0	0		WXS	Illumina HiSeq	.	195	0.05	9	NM_017935	0		0	A8K7W8|B0F3S2|Q8N5K8|Q8NB56|Q8WYN5|Q9NWP2	Missense_Mutation	SNP	ENST00000322953.4	37	CCDS34038.1	.	.	.	.	.	.	.	.	.	.	C	9.050	0.991796	0.18966	.	.	ENSG00000153064	ENST00000504592;ENST00000322953;ENST00000428908;ENST00000508653;ENST00000444316	T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.62	4.55	2.8	0.32819	Ankyrin repeat-containing domain (1);	0.537909	0.15287	N	0.270369	T	0.53158	0.1779	L	0.52573	1.65	0.09310	N	1	D;D;D	0.76494	0.999;0.996;0.996	D;P;P	0.64410	0.925;0.883;0.883	T	0.37663	-0.9696	10	0.42905	T	0.14	.	3.4311	0.07429	0.2017:0.5819:0.0:0.2164	.	250;383;368	Q8NDB2-4;Q8NDB2;Q8NDB2-2	.;BANK1_HUMAN;.	E	368;383;250;250;353	ENSP00000421443:A368E;ENSP00000320509:A383E;ENSP00000412748:A250E;ENSP00000422314:A250E;ENSP00000388817:A353E	ENSP00000320509:A383E	A	+	2	0	BANK1	103058311	0.032000	0.19561	0.056000	0.19401	0.152000	0.21847	0.806000	0.27126	0.518000	0.28383	0.655000	0.94253	GCA			0.368	BANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000363161.1		NM_017935	
JADE1	79960	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	129789057	129789057	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr4:129789057G>T	ENST00000226319.6	+	10	1830	c.1550G>T	c.(1549-1551)cGg>cTg	p.R517L	PHF17_ENST00000512960.1_Missense_Mutation_p.R517L|PHF17_ENST00000452328.2_Missense_Mutation_p.R505L	NM_199320.2	NP_955352.1														NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						AAGATTAAACGGTCTGTGTGC	0.393																																					p.R517L													.	.			0			c.G1550T												90.0	86.0	87.0					4																	129789057		2203	4300	6503	SO:0001583	missense	79960	exon10			TTAAACGGTCTGT																												ENST00000226319.6:c.1550G>T	4.37:g.129789057G>T	ENSP00000226319:p.Arg517Leu		Somatic	75	0	0		WXS	Illumina HiSeq	.	63	0.19	12	NM_199320	18	0.22	4		Missense_Mutation	SNP	ENST00000226319.6	37	CCDS34062.1	.	.	.	.	.	.	.	.	.	.	G	17.92	3.505914	0.64410	.	.	ENSG00000077684	ENST00000226319;ENST00000452328;ENST00000512960;ENST00000535321	T;T;T	0.46451	0.87;0.89;0.87	5.28	5.28	0.74379	.	0.057504	0.64402	N	0.000001	T	0.55369	0.1916	L	0.42529	1.33	0.80722	D	1	B;D	0.61080	0.327;0.989	B;P	0.62298	0.22;0.9	T	0.47156	-0.9139	9	.	.	.	.	19.1132	0.93326	0.0:0.0:1.0:0.0	.	505;517	Q6IE81-2;Q6IE81	.;JADE1_HUMAN	L	517;505;517;517	ENSP00000226319:R517L;ENSP00000388015:R505L;ENSP00000425730:R517L	.	R	+	2	0	PHF17	130008507	1.000000	0.71417	0.998000	0.56505	0.908000	0.53690	6.952000	0.75989	2.736000	0.93811	0.655000	0.94253	CGG			0.393	PHF17-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000364280.1			
MDC1	9656	broad.mit.edu	37	6	30673315	30673315	+	Silent	SNP	G	G	T	rs149345627	byFrequency	TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr6:30673315G>T	ENST00000376406.3	-	10	4292	c.3645C>A	c.(3643-3645)acC>acA	p.T1215T	MDC1-AS1_ENST00000442150.1_RNA|MDC1_ENST00000376405.2_Silent_p.T951T	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1215	Interaction with the PRKDC complex.|Pro-rich.			Missing (in Ref. 2; CAH18685). {ECO:0000305}.	DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						CAGGTCGGTCGGTGGAGGTGG	0.542								Other conserved DNA damage response genes																													p.T1215T													.	MDC1	218		0			c.C3645A												152.0	169.0	163.0					6																	30673315		2203	4300	6503	SO:0001819	synonymous_variant	9656	exon10			TCGGTCGGTGGAG	D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.3645C>A	6.37:g.30673315G>T			Somatic	158	0.0063291139	1		WXS	Illumina HiSeq	Phase_I	147	0.03	4	NM_014641	79	0.00	0	A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Silent	SNP	ENST00000376406.3	37	CCDS34384.1																																																																																					0.542	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000076103.1		NM_014641	
MUC21	394263	broad.mit.edu	37	6	30954534	30954534	+	Silent	SNP	T	T	A			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr6:30954534T>A	ENST00000376296.3	+	2	823	c.582T>A	c.(580-582)acT>acA	p.T194T	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	194	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T194T(1)		NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						GGGCCAGCACTGCCACCAACT	0.612																																					p.T194T													MUC21,NS,carcinoma,0,3	MUC21	98	3	1	Substitution - coding silent(1)	endometrium(1)	c.T582A												178.0	168.0	171.0					6																	30954534		2203	4300	6503	SO:0001819	synonymous_variant	394263	exon2			CAGCACTGCCACC	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.582T>A	6.37:g.30954534T>A			Somatic	39	0.0256410256	1		WXS	Illumina HiSeq	Phase_I	48	0.10	5	NM_001010909	0		0	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Silent	SNP	ENST00000376296.3	37	CCDS34388.1																																																																																					0.612	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000128579.3		NM_001010909	
BRD2	6046	mdanderson.org	37	6	32942516	32942516	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr6:32942516G>T	ENST00000374825.4	+	3	2008	c.307G>T	c.(307-309)Gtg>Ttg	p.V103L	BRD2_ENST00000449085.2_Missense_Mutation_p.V56L|BRD2_ENST00000395289.2_Missense_Mutation_p.V103L|BRD2_ENST00000395287.1_Missense_Mutation_p.V103L|BRD2_ENST00000443797.2_5'UTR|BRD2_ENST00000374831.4_Missense_Mutation_p.V103L|XXbac-BPG181M17.6_ENST00000580587.1_RNA	NM_005104.3	NP_005095.1	P25440	BRD2_HUMAN	bromodomain containing 2	103	Bromo 1. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin modification (GO:0016568)|nucleosome assembly (GO:0006334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(3)|stomach(2)	5						CCGGCAGCCTGTGGATGCTGT	0.537																																					p.V103L													.	.			0			c.G307T												44.0	40.0	41.0					6																	32942516		2203	4300	6503	SO:0001583	missense	6046	exon3			CAGCCTGTGGATG	X96670	CCDS4762.1, CCDS56420.1, CCDS56421.1	6p21.3	2010-12-23	2002-01-14		ENSG00000204256	ENSG00000204256			1103	protein-coding gene	gene with protein product		601540	"""bromodomain-containing 2"""			1352711, 8781126	Standard	NM_005104		Approved	KIAA9001, RING3, D6S113E, NAT, FSRG1	uc021ywf.1	P25440	OTTHUMG00000031241	ENST00000374825.4:c.307G>T	6.37:g.32942516G>T	ENSP00000363958:p.Val103Leu		Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_001113182	206	0.00	0	A2AAU0|B0S7P0|B1AZT1|O00699|O00700|Q15310|Q5STC9|Q63HQ9|Q658Y7|Q6P3U2|Q969U4	Missense_Mutation	SNP	ENST00000374825.4	37	CCDS4762.1	.	.	.	.	.	.	.	.	.	.	G	34	5.339285	0.95783	.	.	ENSG00000204256	ENST00000374825;ENST00000374831;ENST00000395289;ENST00000395287;ENST00000449085	T;T;T;T;T	0.28069	1.63;1.63;1.63;1.63;1.63	5.36	5.36	0.76844	Bromodomain (6);Bromodomain, conserved site (1);	0.000000	0.43110	D	0.000612	T	0.66655	0.2811	H	0.97491	4.015	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.996	T	0.78565	-0.2155	10	0.87932	D	0	-15.7331	16.641	0.85127	0.0:0.0:1.0:0.0	.	103;103	A2AAU0;P25440	.;BRD2_HUMAN	L	103;103;103;103;56	ENSP00000363958:V103L;ENSP00000363964:V103L;ENSP00000378704:V103L;ENSP00000378702:V103L;ENSP00000409145:V56L	ENSP00000363958:V103L	V	+	1	0	BRD2	33050494	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.592000	0.98245	2.784000	0.95788	0.643000	0.83706	GTG			0.537	BRD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000076503.2			
MCM3	4172	mdanderson.org	37	6	52141940	52141940	+	Silent	SNP	G	G	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr6:52141940G>T	ENST00000229854.7	-	8	1166	c.1090C>A	c.(1090-1092)Cga>Aga	p.R364R	MCM3_ENST00000476448.1_5'UTR|MCM3_ENST00000596288.1_Silent_p.R409R|MCM3_ENST00000419835.2_Silent_p.R318R			P25205	MCM3_HUMAN	minichromosome maintenance complex component 3	364	MCM.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	alpha DNA polymerase:primase complex (GO:0005658)|centrosome (GO:0005813)|intracellular membrane-bounded organelle (GO:0043231)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Lung NSC(77;0.0931)					GGGATAGCTCGGGGTGCAGTG	0.597																																					p.R409R													.	.			0			c.C1225A												60.0	60.0	60.0					6																	52141940		2203	4300	6503	SO:0001819	synonymous_variant	4172	exon8			TAGCTCGGGGTGC	X62153	CCDS4940.1, CCDS4940.2, CCDS75468.1	6p12	2008-02-05	2007-04-04		ENSG00000112118	ENSG00000112118			6945	protein-coding gene	gene with protein product		602693	"""minichromosome maintenance deficient (S. cerevisiae) 3"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae)"""			1549468	Standard	NM_002388		Approved		uc011dwu.2	P25205	OTTHUMG00000014844	ENST00000229854.7:c.1090C>A	6.37:g.52141940G>T			Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	53	0.06	3	NM_002388	305	0.00	0	B4DWW4|Q92660|Q9BTR3|Q9NUE7	Silent	SNP	ENST00000229854.7	37																																																																																						0.597	MCM3-006	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000470784.1			
ULBP2	80328	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	150267564	150267564	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr6:150267564A>T	ENST00000367351.3	+	3	479	c.406A>T	c.(406-408)Agt>Tgt	p.S136C		NM_025217.2	NP_079493.1	Q9BZM5	N2DL2_HUMAN	UL16 binding protein 2	136	MHC class I alpha-2 like.				antigen processing and presentation (GO:0019882)|natural killer cell activation (GO:0030101)|natural killer cell mediated cytotoxicity (GO:0042267)	anchored component of plasma membrane (GO:0046658)|cell surface (GO:0009986)|extracellular space (GO:0005615)	natural killer cell lectin-like receptor binding (GO:0046703)			breast(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|skin(1)	10		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.58e-12)		AGGACACAGCAGTGGATCTTG	0.493																																					p.S136C													.	.			0			c.A406T												174.0	160.0	165.0					6																	150267564		2203	4300	6503	SO:0001583	missense	80328	exon3			CACAGCAGTGGAT	AF304378	CCDS5222.1	6q25	2008-04-11			ENSG00000131015	ENSG00000131015			14894	protein-coding gene	gene with protein product		605698				11239445	Standard	NM_025217		Approved	RAET1H	uc003qno.3	Q9BZM5	OTTHUMG00000015803	ENST00000367351.3:c.406A>T	6.37:g.150267564A>T	ENSP00000356320:p.Ser136Cys		Somatic	170	0	0		WXS	Illumina HiSeq	.	84	0.13	11	NM_025217	0		0	Q5VUN4	Missense_Mutation	SNP	ENST00000367351.3	37	CCDS5222.1	.	.	.	.	.	.	.	.	.	.	-	11.44	1.639822	0.29157	.	.	ENSG00000131015	ENST00000367351	T	0.07567	3.18	2.26	-3.86	0.04230	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	.	.	.	.	T	0.05686	0.0149	L	0.49778	1.585	0.09310	N	1	D;D	0.71674	0.998;0.998	D;D	0.64687	0.928;0.928	T	0.14896	-1.0456	9	0.87932	D	0	.	0.321	0.00303	0.4053:0.2246:0.1503:0.2198	.	136;136	B4DSS7;Q9BZM5	.;N2DL2_HUMAN	C	136	ENSP00000356320:S136C	ENSP00000356320:S136C	S	+	1	0	ULBP2	150309257	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-1.694000	0.01915	-0.843000	0.04189	-1.386000	0.01163	AGT			0.493	ULBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042669.1			
GDI2P1	2667	bcgsc.ca	37	7	48942827	48942827	+	IGR	SNP	T	T	C			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr7:48942827T>C								AC004899.1 (51606 upstream) : AC010971.1 (326905 downstream)																							AGGTATGGACTTTTGACGTAT	0.393																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	2667	.			ATGGACTTTTGAC																													7.37:g.48942827T>C			Somatic	79	0	0		WXS	Illumina HiSeq	Phase_1	119	0.07	8	.	0		0		RNA	SNP		37																																																																																					0	0.393										
GTF2IRD2P1	401375	broad.mit.edu	37	7	72663998	72663998	+	RNA	SNP	T	T	G			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr7:72663998T>G	ENST00000425256.1	-	0	902									GTF2I repeat domain containing 2 pseudogene 1																		ATAGCCGGGGTCCTTGAATAC	0.488																																					.													.	.			0			.																																											0	.			CCGGGGTCCTTGA	AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72663998T>G			Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	141	0.04	5	.	0		0		RNA	SNP	ENST00000425256.1	37																																																																																						0.488	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000345921.1		NR_002164	
KIAA1324L	222223	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	86577164	86577164	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr7:86577164A>C	ENST00000450689.2	-	3	570	c.385T>G	c.(385-387)Tcc>Gcc	p.S129A	KIAA1324L_ENST00000444627.1_Missense_Mutation_p.S129A|KIAA1324L_ENST00000416314.1_Intron	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	129						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					CTGCCCAAGGAATAGGTGCCT	0.478																																					p.S129A													.	.			0			c.T385G												170.0	137.0	147.0					7																	86577164		692	1591	2283	SO:0001583	missense	222223	exon3			CCAAGGAATAGGT	AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.385T>G	7.37:g.86577164A>C	ENSP00000413445:p.Ser129Ala		Somatic	140	0	0		WXS	Illumina HiSeq	.	151	0.27	41	NM_001142749	28	0.50	14	A4D1C9|B4DJV3|Q17RI6|Q96DP2	Missense_Mutation	SNP	ENST00000450689.2	37	CCDS47632.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	28.2|28.2	4.901813|4.901813	0.92035|0.92035	.|.	.|.	ENSG00000164659|ENSG00000164659	ENST00000423294|ENST00000450689;ENST00000444627;ENST00000398276;ENST00000425689	.|T;T;T;T	.|0.39056	.|1.1;1.1;1.1;1.1	5.93|5.93	5.93|5.93	0.95920|0.95920	.|.	.|0.000000	.|0.38111	.|U	.|0.001817	T|T	0.68915|0.68915	0.3053|0.3053	M|M	0.84585|0.84585	2.705|2.705	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	T|T	0.74456|0.74456	-0.3659|-0.3659	5|10	.|0.87932	.|D	.|0	.|.	15.5547|15.5547	0.76184|0.76184	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|129	.|A8MWY0	.|K132L_HUMAN	C|A	89|129;129;15;15	.|ENSP00000413445:S129A;ENSP00000397377:S129A;ENSP00000381325:S15A;ENSP00000410045:S15A	.|ENSP00000381325:S15A	F|S	-|-	2|1	0|0	KIAA1324L|KIAA1324L	86415100|86415100	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.980000|0.980000	0.70556|0.70556	9.339000|9.339000	0.96797|0.96797	2.273000|2.273000	0.75805|0.75805	0.482000|0.482000	0.46254|0.46254	TTC|TCC			0.478	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000333372.3		NM_152748	
MUC17	140453	ucsc.edu	37	7	100680100	100680100	+	Silent	SNP	G	G	A	rs142682652	byFrequency	TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr7:100680100G>A	ENST00000306151.4	+	3	5467	c.5403G>A	c.(5401-5403)tcG>tcA	p.S1801S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1801	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TACCAACCTCGACTCTTAGTG	0.507													-|||	22	0.00439297	0.0121	0.0	5008	,	,		27811	0.002		0.0	False		,,,				2504	0.0041				p.S1801S													.	MUC17	804		0			c.G5403A												257.0	261.0	260.0					7																	100680100		2203	4300	6503	SO:0001819	synonymous_variant	140453	exon3			AACCTCGACTCTT	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5403G>A	7.37:g.100680100G>A			Somatic	115	0.0347826087	4		WXS	Illumina HiSeq		162	0.14	22	NM_001040105	0		0	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	CCDS34711.1																																																																																					0.507	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347161.1		NM_001040105	
MUC17	140453	ucsc.edu;bcgsc.ca	37	7	100680117	100680117	+	Missense_Mutation	SNP	T	T	C	rs147353603	byFrequency	TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr7:100680117T>C	ENST00000306151.4	+	3	5484	c.5420T>C	c.(5419-5421)aTg>aCg	p.M1807T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1807	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AGTGAAGGAATGACTCCATTA	0.507													-|||	4	0.000798722	0.0008	0.0	5008	,	,		27011	0.003		0.0	False		,,,				2504	0.0				p.M1807T													.	MUC17	804		0			c.T5420C												250.0	253.0	252.0					7																	100680117		2203	4300	6503	SO:0001583	missense	140453	exon3			AAGGAATGACTCC	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5420T>C	7.37:g.100680117T>C	ENSP00000302716:p.Met1807Thr		Somatic	112	0.0267857143	3		WXS	Illumina HiSeq		169	0.18	31	NM_001040105	0		0	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	N	0.005	-2.166907	0.00318	.	.	ENSG00000169876	ENST00000306151	T	0.01854	4.6	0.373	-0.746	0.11095	.	.	.	.	.	T	0.00998	0.0033	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48670	-0.9015	8	0.09338	T	0.73	.	.	.	.	.	1807	Q685J3	MUC17_HUMAN	T	1807	ENSP00000302716:M1807T	ENSP00000302716:M1807T	M	+	2	0	MUC17	100466837	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.274000	0.00531	-4.523000	0.00044	-3.958000	0.00015	ATG			0.507	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347161.1		NM_001040105	
MUC17	140453	mdanderson.org	37	7	100681345	100681345	+	Missense_Mutation	SNP	T	T	G	rs142097516		TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr7:100681345T>G	ENST00000306151.4	+	3	6712	c.6648T>G	c.(6646-6648)agT>agG	p.S2216R		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2216	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CAACTCCTAGTGAAGGAAGCA	0.507																																					p.S2216R													.	.			0			c.T6648G												343.0	338.0	340.0					7																	100681345		2203	4300	6503	SO:0001583	missense	140453	exon3			TCCTAGTGAAGGA	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.6648T>G	7.37:g.100681345T>G	ENSP00000302716:p.Ser2216Arg		Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	154	0.05	8	NM_001040105	0		0	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	T	2.901	-0.227411	0.06022	.	.	ENSG00000169876	ENST00000306151	T	0.02606	4.23	1.11	-2.01	0.07410	.	.	.	.	.	T	0.01489	0.0048	N	0.14661	0.345	0.09310	N	1	B	0.24963	0.115	B	0.13407	0.009	T	0.49351	-0.8949	9	0.18710	T	0.47	.	4.0824	0.09932	0.3049:0.0:0.0:0.695	.	2216	Q685J3	MUC17_HUMAN	R	2216	ENSP00000302716:S2216R	ENSP00000302716:S2216R	S	+	3	2	MUC17	100468065	0.013000	0.17824	0.006000	0.13384	0.003000	0.03518	-0.741000	0.04855	0.459000	0.27016	0.113000	0.15668	AGT			0.507	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347161.1		NM_001040105	
COL26A1	136227	broad.mit.edu	37	7	101194114	101194115	+	RNA	INS	-	-	C	rs34442683|rs397726013	byFrequency	TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr7:101194114_101194115insC	ENST00000397927.3	+	0	1206				COL26A1_ENST00000528707.1_RNA|COL26A1_ENST00000313669.7_RNA	NM_001278563.1	NP_001265492.1	Q96A83	COQA1_HUMAN	collagen, type XXVI, alpha 1						collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)											GACCACCTGCTCCCCTTCTCTG	0.609													CCCC|CCCC|CCCCC|insertion	1455	0.290535	0.4047	0.2896	5008	,	,		14197	0.0565		0.3887	False		,,,				2504	0.2771				.													.	.			0			.																																											136227	.			ACCTGCTCCCCTT	AJ416091	CCDS64739.1	7q22.1	2013-01-16	2013-01-16	2013-01-16	ENSG00000160963	ENSG00000160963		"""Collagens"", ""EMI domain containing"""	18038	protein-coding gene	gene with protein product	"""Emu2 gene"""	608927	"""EMI domain containing 2"""	EMID2		12221002, 12145293	Standard	NM_001278563		Approved	Emu2, EMI6	uc003uyo.1	Q96A83	OTTHUMG00000150033		7.37:g.101194118_101194118dupC			Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	21	0.76	16	.	0		0	Q32M90	RNA	INS	ENST00000397927.3	37																																																																																						0.609	COL26A1-002	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene		OTTHUMT00000315898.2		NM_133457	
CUX1	1523	mdanderson.org	37	7	101891810	101891810	+	Missense_Mutation	SNP	G	G	T	rs571342866	byFrequency	TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr7:101891810G>T	ENST00000292535.7	+	24	4044	c.4006G>T	c.(4006-4008)Gac>Tac	p.D1336Y	CUX1_ENST00000393824.3_Intron|CUX1_ENST00000550008.2_Missense_Mutation_p.D1280Y|CUX1_ENST00000437600.4_Intron|CUX1_ENST00000546411.2_Missense_Mutation_p.D1234Y|CUX1_ENST00000360264.3_Missense_Mutation_p.D1347Y|CUX1_ENST00000560541.1_Intron|CUX1_ENST00000547394.2_Intron|CUX1_ENST00000556210.1_Missense_Mutation_p.D1178Y|CUX1_ENST00000292538.4_Intron|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000549414.2_Missense_Mutation_p.D1314Y	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	1336					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						CTCGGAGGGCGACAGCTGCGA	0.736																																					p.D1347Y													.	.			0			c.G4039T												4.0	5.0	5.0					7																	101891810		1822	3512	5334	SO:0001583	missense	1523	exon24			GAGGGCGACAGCT	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.4006G>T	7.37:g.101891810G>T	ENSP00000292535:p.Asp1336Tyr		Somatic	19	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_001202543	2	0.00	0	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	ENST00000292535.7	37	CCDS5721.1	.	.	.	.	.	.	.	.	.	.	G	19.55	3.847981	0.71603	.	.	ENSG00000257923	ENST00000360264;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	T;T;T;T;T;T	0.61392	0.13;0.13;0.12;0.11;0.12;0.11	3.87	3.87	0.44632	.	0.315087	0.32386	N	0.006169	T	0.70334	0.3212	L	0.50333	1.59	0.80722	D	1	D;D	0.89917	1.0;0.985	D;P	0.85130	0.997;0.867	T	0.73196	-0.4059	10	0.52906	T	0.07	-17.4663	15.9719	0.80027	0.0:0.0:1.0:0.0	.	1336;1347	P39880;P39880-3	CUX1_HUMAN;.	Y	1347;1336;1314;1280;1234;1178	ENSP00000353401:D1347Y;ENSP00000292535:D1336Y;ENSP00000446630:D1314Y;ENSP00000447373:D1280Y;ENSP00000450125:D1234Y;ENSP00000451558:D1178Y	ENSP00000292535:D1336Y	D	+	1	0	CUX1	101678530	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	7.992000	0.88273	1.971000	0.57363	0.491000	0.48974	GAC			0.736	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000347535.1		NM_001913	
PPP2R2A	5520	mdanderson.org	37	8	26217714	26217714	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr8:26217714G>T	ENST00000380737.3	+	5	705	c.376G>T	c.(376-378)Gaa>Taa	p.E126*	PPP2R2A_ENST00000315985.7_Nonsense_Mutation_p.E136*	NM_002717.3	NP_002708.1	P63151	2ABA_HUMAN	protein phosphatase 2, regulatory subunit B, alpha	126					G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|response to morphine (GO:0043278)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			kidney(1)|large_intestine(2)|ovary(1)	4		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)		GAAAATCAGTGAAAGGGACAA	0.313																																					p.E136X													.	.			0			c.G406T												83.0	86.0	85.0					8																	26217714		2203	4299	6502	SO:0001587	stop_gained	5520	exon5			ATCAGTGAAAGGG	M64929	CCDS34867.1, CCDS55213.1	8p21.2	2013-01-10	2010-04-14		ENSG00000221914	ENSG00000221914	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9304	protein-coding gene	gene with protein product	"""PP2A subunit B isoform alpha"""	604941	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, alpha isoform"""			1849734	Standard	NM_001177591		Approved	PR52A, PR55A, B55A		P63151	OTTHUMG00000163850	ENST00000380737.3:c.376G>T	8.37:g.26217714G>T	ENSP00000370113:p.Glu126*		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_001177591	120	0.00	0	B2RBU8|B4E1T7|P50409|Q00007	Nonsense_Mutation	SNP	ENST00000380737.3	37	CCDS34867.1	.	.	.	.	.	.	.	.	.	.	G	38	7.193284	0.98125	.	.	ENSG00000221914	ENST00000380737;ENST00000315985	.	.	.	5.18	5.18	0.71444	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-17.8353	19.0947	0.93246	0.0:0.0:1.0:0.0	.	.	.	.	X	126;136	.	ENSP00000325074:E136X	E	+	1	0	PPP2R2A	26273631	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.623000	0.98386	2.593000	0.87608	0.585000	0.79938	GAA			0.313	PPP2R2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000375954.2		NM_002717	
ARFGEF1	10565	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	68208839	68208839	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chr8:68208839G>A	ENST00000262215.3	-	5	855	c.466C>T	c.(466-468)Ctt>Ttt	p.L156F		NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	156	DCB; DCB:DCB domain and DCB:HUS domain interaction.				endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			ACTGCAGTAAGTAAAGCCTTT	0.353																																					p.L156F													ARFGEF1,NS,carcinoma,+1,1	ARFGEF1	1	1	0			c.C466T												112.0	100.0	104.0					8																	68208839		2203	4300	6503	SO:0001583	missense	10565	exon5			CAGTAAGTAAAGC	AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.466C>T	8.37:g.68208839G>A	ENSP00000262215:p.Leu156Phe		Somatic	97	0	0		WXS	Illumina HiSeq	.	97	0.21	20	NM_006421	10	0.30	3	Q9NV46|Q9UFV2|Q9UNL0	Missense_Mutation	SNP	ENST00000262215.3	37	CCDS6199.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.081909	0.76528	.	.	ENSG00000066777	ENST00000262215	T	0.32023	1.47	4.66	4.66	0.58398	Armadillo-type fold (1);	0.074221	0.56097	D	0.000034	T	0.69233	0.3088	H	0.96048	3.76	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.81709	-0.0809	10	0.87932	D	0	.	17.5616	0.87909	0.0:0.0:1.0:0.0	.	156	Q9Y6D6	BIG1_HUMAN	F	156	ENSP00000262215:L156F	ENSP00000262215:L156F	L	-	1	0	ARFGEF1	68371393	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.347000	0.73004	2.143000	0.66587	0.585000	0.79938	CTT			0.353	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000379441.4		NM_006421	
ERCC6L	54821	broad.mit.edu	37	X	71425589	71425589	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chrX:71425589G>T	ENST00000334463.3	-	2	3163	c.3028C>A	c.(3028-3030)Cca>Aca	p.P1010T	ERCC6L_ENST00000373657.1_Missense_Mutation_p.P887T|PIN4_ENST00000423432.2_Intron	NM_017669.2	NP_060139.2	Q2NKX8	ERC6L_HUMAN	excision repair cross-complementation group 6-like	1010					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			breast(2)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(9)|lung(9)|ovary(3)|skin(1)	38	Renal(35;0.156)					ACTTCTTCTGGTTCATCGTCT	0.388																																					p.P1010T													.	ERCC6L	98		0			c.C3028A												144.0	130.0	135.0					X																	71425589		2203	4300	6503	SO:0001583	missense	54821	exon2			CTTCTGGTTCATC	AK000112	CCDS35329.1	Xq13.1	2014-03-07	2014-03-07		ENSG00000186871	ENSG00000186871			20794	protein-coding gene	gene with protein product	"""PLK1-interacting checkpoint helicase"""	300687	"""excision repair cross-complementing rodent repair deficiency, complementation group 6-like"""			17218258	Standard	NM_017669		Approved	FLJ20105, PICH, RAD26L	uc004eaq.1	Q2NKX8	OTTHUMG00000021810	ENST00000334463.3:c.3028C>A	X.37:g.71425589G>T	ENSP00000334675:p.Pro1010Thr		Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	107	0.05	5	NM_017669	50	0.00	0	Q8NCI1|Q96H93|Q9NXQ8	Missense_Mutation	SNP	ENST00000334463.3	37	CCDS35329.1	.	.	.	.	.	.	.	.	.	.	G	5.427	0.263927	0.10294	.	.	ENSG00000186871	ENST00000373657;ENST00000334463	D;D	0.90385	-2.63;-2.66	5.58	-5.12	0.02893	.	.	.	.	.	T	0.80803	0.4693	L	0.36672	1.1	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.63690	-0.6580	9	0.16420	T	0.52	1.3182	6.188	0.20508	0.1415:0.5559:0.1235:0.1792	.	1010	Q2NKX8	ERC6L_HUMAN	T	887;1010	ENSP00000362761:P887T;ENSP00000334675:P1010T	ENSP00000334675:P1010T	P	-	1	0	ERCC6L	71342314	0.000000	0.05858	0.000000	0.03702	0.619000	0.37552	-0.380000	0.07427	-1.350000	0.02199	-1.181000	0.01715	CCA			0.388	ERCC6L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057174.2		NM_017669	
CTAG2	30848	broad.mit.edu	37	X	153881676	153881676	+	Silent	SNP	A	A	C	rs370709312		TCGA-2G-AAFV-01A-11D-A42Y-10	TCGA-2G-AAFV-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af03ea8a-e355-49cc-bc41-4ff2e2920c39	db466af1-f94e-426c-96ca-b7273aa85239	g.chrX:153881676A>C	ENST00000247306.4	-	1	177	c.114T>G	c.(112-114)ggT>ggG	p.G38G	CTAG2_ENST00000369585.3_Silent_p.G38G	NM_020994.3	NP_066274.2	O75638	CTAG2_HUMAN	cancer/testis antigen 2	38	Gly-rich.					centrosome (GO:0005813)				central_nervous_system(1)|endometrium(1)|lung(6)|ovary(1)|pancreas(1)	10	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CGCCCGTGGCACCCGCCTCTC	0.761																																					p.G38G													.	CTAG2	88		0			c.T114G												2.0	3.0	3.0					X																	153881676		1206	2709	3915	SO:0001819	synonymous_variant	30848	exon1			CGTGGCACCCGCC	AJ012833	CCDS14759.1, CCDS35455.1	Xq28	2009-08-18			ENSG00000126890	ENSG00000126890			2492	protein-coding gene	gene with protein product	"""CTL-recognized antigen on melanoma"", ""LAGE-1a protein"", ""cancer/testis antigen family 6, member 2a"", ""cancer/testis antigen family 6, member 2b"""	300396				9626360, 10399963	Standard	NM_020994		Approved	LAGE-1, CAMEL, LAGE1, ESO2, MGC3803, MGC138724, CT6.2a, CT6.2b, LAGE-1a, LAGE-1b	uc004fmi.2	O75638	OTTHUMG00000024239	ENST00000247306.4:c.114T>G	X.37:g.153881676A>C			Somatic	40	0.475	19		WXS	Illumina HiSeq	Phase_I	92	0.38	35	NM_020994	0		0	O75637|Q0VIL6|Q14CD6|Q2Z1N4|Q9BU80|Q9UJ89|Q9Y479	Silent	SNP	ENST00000247306.4	37	CCDS14759.1																																																																																					0.761	CTAG2-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000061176.1		NM_020994	
