#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
MAD2L2	10459	mdanderson.org	37	1	11740450	11740450	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr1:11740450C>T	ENST00000235310.3	-	5	1047	c.119G>A	c.(118-120)gGc>gAc	p.G40D	MAD2L2_ENST00000376667.3_Missense_Mutation_p.G40D|MAD2L2_ENST00000376669.5_Missense_Mutation_p.G40D|MAD2L2_ENST00000376692.4_Missense_Mutation_p.G40D|MAD2L2_ENST00000376672.1_Missense_Mutation_p.G40D			Q9UI95	MD2L2_HUMAN	MAD2 mitotic arrest deficient-like 2 (yeast)	40	HORMA. {ECO:0000255|PROSITE- ProRule:PRU00109}.|Mediates interaction with REV1 and REV3L and homodimerization.				actin filament organization (GO:0007015)|DNA damage response, signal transduction resulting in transcription (GO:0042772)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of mitotic anaphase-promoting complex activity (GO:0060564)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|zeta DNA polymerase complex (GO:0016035)	JUN kinase binding (GO:0008432)|RNA polymerase II activating transcription factor binding (GO:0001102)			kidney(1)|large_intestine(1)|lung(2)|ovary(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.04e-06)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|Kidney(185;0.000733)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CTGGAAGATGCCCACGGGGTA	0.577								DNA polymerases (catalytic subunits)																													p.G40D													.	.			0			c.G119A												117.0	119.0	118.0					1																	11740450		2203	4300	6503	SO:0001583	missense	10459	exon3			AAGATGCCCACGG	AF139365	CCDS134.1	1p36	2013-01-17	2001-11-28		ENSG00000116670	ENSG00000116670		"""DNA polymerases"""	6764	protein-coding gene	gene with protein product	"""mitotic arrest deficient homolog-like 2"", ""polymerase (DNA-directed), zeta 2, accessory subunit"""	604094	"""MAD2 (mitotic arrest deficient, yeast, homolog)-like 2"""			10366450	Standard	NM_006341		Approved	MAD2B, REV7, POLZ2	uc009vnc.3	Q9UI95	OTTHUMG00000002231	ENST00000235310.3:c.119G>A	1.37:g.11740450C>T	ENSP00000235310:p.Gly40Asp		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_006341	78	0.00	0	B3KNE3|Q5TGW7|Q9UNA7|Q9Y6I6	Missense_Mutation	SNP	ENST00000235310.3	37	CCDS134.1	.	.	.	.	.	.	.	.	.	.	C	36	5.614814	0.96649	.	.	ENSG00000116670	ENST00000376692;ENST00000235310;ENST00000376672;ENST00000376669;ENST00000376667;ENST00000376664;ENST00000445656;ENST00000456915;ENST00000376655	.	.	.	5.64	5.64	0.86602	DNA-binding HORMA (4);	0.000000	0.85682	D	0.000000	T	0.42359	0.1199	N	0.17082	0.46	0.80722	D	1	B	0.31931	0.347	B	0.30316	0.114	T	0.29822	-0.9999	9	0.17369	T	0.5	-38.0005	18.2734	0.90076	0.0:1.0:0.0:0.0	.	40	Q9UI95	MD2L2_HUMAN	D	40;40;40;40;40;40;70;40;40	.	ENSP00000235310:G40D	G	-	2	0	MAD2L2	11663037	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	6.783000	0.75078	2.647000	0.89833	0.655000	0.94253	GGC			0.577	MAD2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000006344.2		NM_006341	
CROCCP2	84809	broad.mit.edu	37	1	16957490	16957490	+	lincRNA	DEL	G	G	-			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr1:16957490delG	ENST00000412962.1	-	0	188							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											GAACGGCCTCGGCCCGGCGAG	0.726																																					.													.	.			0			.																																											0	.			GGCCTCGGCCCGG	AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16957490delG			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	8	0.00	0	Q8NF65|Q96FR5|Q9BRE8	RNA	DEL	ENST00000412962.1	37																																																																																						0.726	CROCCP2-003	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000092784.1		NR_026752.1	
FUCA1	2517	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	24194762	24194762	+	Silent	SNP	C	C	G			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr1:24194762C>G	ENST00000374479.3	-	1	22	c.15G>C	c.(13-15)ggG>ggC	p.G5G		NM_000147.4	NP_000138.2	P04066	FUCO_HUMAN	fucosidase, alpha-L- 1, tissue	5					fucose metabolic process (GO:0006004)|glycosaminoglycan catabolic process (GO:0006027)|glycoside catabolic process (GO:0016139)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-L-fucosidase activity (GO:0004560)|fucose binding (GO:0042806)			breast(1)|endometrium(1)|large_intestine(3)|lung(3)	8		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;5.69e-08)|COAD - Colon adenocarcinoma(152;3.15e-06)|GBM - Glioblastoma multiforme(114;9.04e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|KIRC - Kidney renal clear cell carcinoma(1967;0.00342)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.144)		GCGACCTCATCCCCGGAGCCC	0.731																																					p.G5G													.	.			0			c.G15C												3.0	5.0	4.0					1																	24194762		1712	3580	5292	SO:0001819	synonymous_variant	2517	exon1			CCTCATCCCCGGA	BC017338	CCDS244.2	1p34	2012-10-02			ENSG00000179163	ENSG00000179163	3.2.1.51		4006	protein-coding gene	gene with protein product		612280				2803312	Standard	NM_000147		Approved		uc001bie.3	P04066	OTTHUMG00000002965	ENST00000374479.3:c.15G>C	1.37:g.24194762C>G			Somatic	33	0	0		WXS	Illumina HiSeq	.	42	0.19	8	NM_000147	14	0.14	2	B2RBG3|Q14334|Q14335|Q3LID0|Q8NAC2	Silent	SNP	ENST00000374479.3	37	CCDS244.2																																																																																					0.731	FUCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000008259.2		NM_000147	
AHDC1	27245	broad.mit.edu;mdanderson.org	37	1	27877165	27877165	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr1:27877165G>A	ENST00000247087.5	-	5	2058	c.1462C>T	c.(1462-1464)Cgg>Tgg	p.R488W	AHDC1_ENST00000374011.2_Missense_Mutation_p.R488W			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	488							DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		GTCTTGTTCCGCCGCCCCAGC	0.642																																					p.R488W													.	AHDC1	98		0			c.C1462T												32.0	32.0	32.0					1																	27877165		2203	4300	6503	SO:0001583	missense	27245	exon6			TGTTCCGCCGCCC	AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.1462C>T	1.37:g.27877165G>A	ENSP00000247087:p.Arg488Trp		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	54	0.07	4	NM_001029882	40	0.00	0	Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Missense_Mutation	SNP	ENST00000247087.5	37	CCDS30652.1	.	.	.	.	.	.	.	.	.	.	G	14.45	2.539842	0.45176	.	.	ENSG00000126705	ENST00000247087;ENST00000374011	T;T	0.63580	-0.05;-0.05	5.54	4.61	0.57282	.	0.096816	0.38164	U	0.001791	T	0.65354	0.2683	N	0.19112	0.55	0.49130	D	0.999759	D	0.89917	1.0	D	0.91635	0.999	T	0.69727	-0.5067	10	0.87932	D	0	-13.0257	11.6574	0.51325	0.0:0.0:0.5476:0.4524	.	488	Q5TGY3	AHDC1_HUMAN	W	488	ENSP00000247087:R488W;ENSP00000363123:R488W	ENSP00000247087:R488W	R	-	1	2	AHDC1	27749752	1.000000	0.71417	0.998000	0.56505	0.598000	0.36846	3.421000	0.52742	1.514000	0.48869	0.655000	0.94253	CGG			0.642	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000009523.3			
CDC14A	8556	mdanderson.org	37	1	100856378	100856378	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr1:100856378G>T	ENST00000336454.3	+	4	662	c.307G>T	c.(307-309)Gca>Tca	p.A103S	CDC14A_ENST00000544534.1_Missense_Mutation_p.A103S|CDC14A_ENST00000542213.1_Missense_Mutation_p.A45S|CDC14A_ENST00000370125.2_Missense_Mutation_p.A103S|CDC14A_ENST00000361544.6_Missense_Mutation_p.A103S|CDC14A_ENST00000370124.3_Missense_Mutation_p.A103S	NM_003672.3	NP_003663.2	Q9UNH5	CC14A_HUMAN	cell division cycle 14A	103	A.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(5)|kidney(6)|large_intestine(6)|lung(10)|skin(2)|urinary_tract(1)	31		all_epithelial(167;3.71e-06)|all_lung(203;0.00097)|Lung NSC(277;0.001)		Epithelial(280;0.0676)|all cancers(265;0.127)|COAD - Colon adenocarcinoma(174;0.201)|Lung(183;0.227)|Colorectal(144;0.241)		AGGTGCCTATGCAGTAAGTAC	0.373																																					p.A103S													.	.			0			c.G307T												101.0	99.0	100.0					1																	100856378		2203	4300	6503	SO:0001583	missense	8556	exon4			GCCTATGCAGTAA	AF000367	CCDS769.1, CCDS770.1, CCDS771.1	1p21	2013-01-17	2013-01-17		ENSG00000079335	ENSG00000079335		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	1718	protein-coding gene	gene with protein product		603504	"""CDC10 (cell division cycle 10, S. cerevisiae, homolog)"", ""CDC14 cell division cycle 14 homolog A (S. cerevisiae)"""			9367992, 10409437	Standard	NM_033312		Approved	Cdc14A1, Cdc14A2, cdc14	uc001dtf.2	Q9UNH5	OTTHUMG00000010987	ENST00000336454.3:c.307G>T	1.37:g.100856378G>T	ENSP00000336739:p.Ala103Ser		Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_033313	9	0.00	0	A6MA65|B1AQ14|B1AQ15|O43171|O60727|O60728|Q52LH9|Q8IXX0	Missense_Mutation	SNP	ENST00000336454.3	37	CCDS769.1	.	.	.	.	.	.	.	.	.	.	G	15.51	2.855492	0.51376	.	.	ENSG00000079335	ENST00000542213;ENST00000455467;ENST00000370125;ENST00000361544;ENST00000370124;ENST00000336454;ENST00000544534	T;T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89;0.89	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.36468	0.0968	L	0.41415	1.275	0.80722	D	1	P;P;B;P;P;B	0.40931	0.725;0.614;0.071;0.614;0.733;0.042	B;B;B;B;P;B	0.47573	0.236;0.347;0.105;0.298;0.55;0.049	T	0.09596	-1.0667	10	0.45353	T	0.12	-11.467	18.4311	0.90625	0.0:0.0:1.0:0.0	.	45;103;103;103;103;103	F5H7B3;A6MA65;Q9UNH5-3;Q9UNH5;Q9UNH5-2;Q52LH9	.;.;.;CC14A_HUMAN;.;.	S	45;104;103;103;103;103;103	ENSP00000442640:A45S;ENSP00000388501:A104S;ENSP00000359143:A103S;ENSP00000354916:A103S;ENSP00000359142:A103S;ENSP00000336739:A103S;ENSP00000442543:A103S	ENSP00000336739:A103S	A	+	1	0	CDC14A	100628966	1.000000	0.71417	0.998000	0.56505	0.545000	0.35147	8.289000	0.89923	2.648000	0.89879	0.561000	0.74099	GCA			0.373	CDC14A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000030220.1		NM_033312	
VAV3	10451	mdanderson.org	37	1	108145093	108145093	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr1:108145093C>T	ENST00000370056.4	-	24	2420	c.2146G>A	c.(2146-2148)Gca>Aca	p.A716T	VAV3_ENST00000415432.2_Missense_Mutation_p.A156T|VAV3_ENST00000343258.4_5'UTR|VAV3_ENST00000527011.1_Missense_Mutation_p.A716T|VAV3_ENST00000544443.1_Missense_Mutation_p.A120T	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	716	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.|Sufficient for interaction with ROS1.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)			NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		ATGTGCTTTGCTTCATTATTG	0.289																																					p.A716T													.	.			0			c.G2146A												71.0	69.0	70.0					1																	108145093		2199	4290	6489	SO:0001583	missense	10451	exon24			GCTTTGCTTCATT	AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.2146G>A	1.37:g.108145093C>T	ENSP00000359073:p.Ala716Thr		Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_006113	32	0.00	0	B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Missense_Mutation	SNP	ENST00000370056.4	37	CCDS785.1	.	.	.	.	.	.	.	.	.	.	C	18.29	3.590817	0.66219	.	.	ENSG00000134215	ENST00000370056;ENST00000527011;ENST00000544443;ENST00000415432	D;D;D;D	0.88431	-2.38;-2.38;-2.38;-2.38	5.88	5.88	0.94601	SH2 motif (5);	0.051612	0.85682	D	0.000000	T	0.78935	0.4362	N	0.10629	0.01	0.80722	D	1	P;B;B;B	0.35575	0.51;0.007;0.008;0.337	B;B;B;B	0.40982	0.345;0.027;0.027;0.209	T	0.82878	-0.0239	10	0.72032	D	0.01	.	20.2314	0.98350	0.0:1.0:0.0:0.0	.	716;120;716;156	E9PQ97;B7Z3Z5;Q9UKW4;Q9UKW4-3	.;.;VAV3_HUMAN;.	T	716;716;120;156	ENSP00000359073:A716T;ENSP00000432540:A716T;ENSP00000446404:A120T;ENSP00000394897:A156T	ENSP00000359073:A716T	A	-	1	0	VAV3	107946616	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.789000	0.95967	0.591000	0.81541	GCA			0.289	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000030242.2		NM_006113	
ZNF697	90874	broad.mit.edu;mdanderson.org	37	1	120165430	120165430	+	Silent	SNP	G	G	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr1:120165430G>T	ENST00000421812.2	-	3	1655	c.1536C>A	c.(1534-1536)cgC>cgA	p.R512R		NM_001080470.1	NP_001073939.1	Q5TEC3	ZN697_HUMAN	zinc finger protein 697	512					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(2)	2	all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0266)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0577)		TGTGGATGCGGCGGTGGCGGA	0.632																																					p.R512R													ZNF697_ENST00000421812,right_upper_lobe,carcinoma,-1,2	ZNF697	26	2	0			c.C1536A												16.0	21.0	19.0					1																	120165430		2186	4289	6475	SO:0001819	synonymous_variant	90874	exon3			GATGCGGCGGTGG	AK027019, BC033126	CCDS44202.1	1p12	2013-01-08			ENSG00000143067	ENSG00000143067		"""Zinc fingers, C2H2-type"""	32034	protein-coding gene	gene with protein product							Standard	NM_001080470		Approved	MGC45731	uc001ehy.1	Q5TEC3	OTTHUMG00000012962	ENST00000421812.2:c.1536C>A	1.37:g.120165430G>T			Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_001080470	17	0.00	0	Q96IT2	Silent	SNP	ENST00000421812.2	37	CCDS44202.1																																																																																					0.632	ZNF697-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000036349.3		XM_371286	
ADAMTSL4	54507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	150526211	150526211	+	Silent	SNP	C	C	A	rs587616373		TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr1:150526211C>A	ENST00000369038.2	+	4	945	c.744C>A	c.(742-744)ccC>ccA	p.P248P	MIR4257_ENST00000581735.1_RNA|RP11-54A4.2_ENST00000442435.2_RNA|ADAMTSL4_ENST00000271643.4_Silent_p.P248P|ADAMTSL4_ENST00000369041.5_Silent_p.P248P|ADAMTSL4_ENST00000369039.5_Silent_p.P248P			Q6UY14	ATL4_HUMAN	ADAMTS-like 4	248					apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)			breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			GGCCTGCCCCCCTACGGCATC	0.637													C|||	1	0.000199681	0.0	0.0	5008	,	,		14951	0.0		0.0	False		,,,				2504	0.001				p.P248P													.	.			0			c.C744A												54.0	57.0	56.0					1																	150526211		2203	4300	6503	SO:0001819	synonymous_variant	54507	exon6			TGCCCCCCTACGG	BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000369038.2:c.744C>A	1.37:g.150526211C>A			Somatic	74	0	0		WXS	Illumina HiSeq	.	79	0.44	35	NM_019032	120	0.54	65	B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	Silent	SNP	ENST00000369038.2	37	CCDS955.1																																																																																					0.637	ADAMTSL4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000084395.4		NM_019032	
RYR2	6262	broad.mit.edu	37	1	237586494	237586494	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr1:237586494G>T	ENST00000366574.2	+	12	1268	c.951G>T	c.(949-951)atG>atT	p.M317I	RYR2_ENST00000542537.1_Missense_Mutation_p.M301I|RYR2_ENST00000360064.6_Missense_Mutation_p.M315I	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	317	MIR 4. {ECO:0000255|PROSITE- ProRule:PRU00131}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTCTACTCATGGACAAAGAGA	0.428																																					p.M317I													RYR2,NS,other,+1,1	RYR2	1273	1	0			c.G951T												116.0	111.0	113.0					1																	237586494		1888	4102	5990	SO:0001583	missense	6262	exon12			ACTCATGGACAAA	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.951G>T	1.37:g.237586494G>T	ENSP00000355533:p.Met317Ile		Somatic	410	0	0		WXS	Illumina HiSeq	Phase_I	340	0.01	5	NM_001035	0		0	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	12.63	1.995472	0.35226	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.86366	-2.11;-2.11;-2.11	5.52	5.52	0.82312	MIR motif (2);MIR (2);	0.159714	0.41938	D	0.000781	T	0.73845	0.3639	N	0.14661	0.345	0.80722	D	1	B	0.06786	0.001	B	0.14023	0.01	T	0.67945	-0.5539	10	0.39692	T	0.17	.	5.3365	0.15961	0.1505:0.0:0.6014:0.2481	.	317	Q92736	RYR2_HUMAN	I	317;315;301	ENSP00000355533:M317I;ENSP00000353174:M315I;ENSP00000443798:M301I	ENSP00000353174:M315I	M	+	3	0	RYR2	235653117	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.402000	0.44521	2.598000	0.87819	0.655000	0.94253	ATG			0.428	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000095402.2		NM_001035	
TLX1	3195	broad.mit.edu	37	10	102891433	102891433	+	Silent	SNP	C	C	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr10:102891433C>T	ENST00000370196.6	+	1	2177	c.135C>T	c.(133-135)taC>taT	p.Y45Y	TLX1NB_ENST00000445873.1_5'Flank|TLX1NB_ENST00000425505.1_5'Flank|TLX1_ENST00000467928.2_Silent_p.Y45Y			P31314	TLX1_HUMAN	T-cell leukemia homeobox 1	45					cell fate commitment (GO:0045165)|central nervous system development (GO:0007417)|neuron differentiation (GO:0030182)|organ formation (GO:0048645)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spleen development (GO:0048536)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|upper_aerodigestive_tract(1)	2				Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		ACGGAGAATACGGCCTTGGCT	0.692			T	"""TRB@, TRD@"""	T-ALL																																p.Y45Y				Dom	yes		10	10q24	3195	""" T-cell leukemia, homeobox 1 (HOX11)"""		L	.	TLX1	20		0			c.C135T												17.0	19.0	18.0					10																	102891433		2199	4297	6496	SO:0001819	synonymous_variant	3195	exon1			AGAATACGGCCTT	M62626	CCDS7510.1, CCDS55725.1	10q24.32	2011-06-20	2005-12-22	2002-05-31	ENSG00000107807	ENSG00000107807		"""Homeoboxes / ANTP class : NKL subclass"""	5056	protein-coding gene	gene with protein product	"""Homeo box-11 (T-cell leukemia-3 associated breakpoint, homologous to Drosophila Notch)"", ""homeo box 11 (T-cell lymphoma 3-associated breakpoint)"""	186770	"""homeo box 11 (T-cell lymphoma 3-associated breakpoint)"", ""T-cell leukemia, homeobox 1"""	TCL3, HOX11		1676542, 1973146	Standard	NM_005521		Approved		uc001ksw.3	P31314	OTTHUMG00000019341	ENST00000370196.6:c.135C>T	10.37:g.102891433C>T			Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	93	0.05	5	NM_005521	1	0.00	0	A1L4G3|O75699|Q5VXP2|Q9HCA0|Q9UD59	Silent	SNP	ENST00000370196.6	37	CCDS7510.1																																																																																					0.692	TLX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051193.3		NM_005521	
PNLIPRP2	5408	broad.mit.edu	37	10	118386476	118386476	+	RNA	SNP	G	G	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr10:118386476G>T	ENST00000298771.7	+	0	457				PNLIPRP2_ENST00000433618.4_RNA|PNLIPRP2_ENST00000537242.1_RNA	NR_103727.1		P54317	LIPR2_HUMAN	pancreatic lipase-related protein 2						galactolipid catabolic process (GO:0019376)|lipid digestion (GO:0044241)|phospholipid catabolic process (GO:0009395)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	acylglycerol lipase activity (GO:0047372)|calcium ion binding (GO:0005509)|galactolipase activity (GO:0047714)|phospholipase activity (GO:0004620)|triglyceride lipase activity (GO:0004806)			endometrium(1)|large_intestine(1)|lung(11)|prostate(3)	16				all cancers(201;0.015)		GGGTTGTTGGGGCGGAGACAG	0.567																																					.													.	PNLIPRP2	103		0			.												76.0	72.0	74.0					10																	118386476		1947	4195	6142			5408	.			TGTTGGGGCGGAG	M93284		10q26.12	2014-03-14				ENSG00000266200	3.1.1.3		9157	protein-coding gene	gene with protein product		604423				1379598	Standard	NM_005396		Approved	PLRP2	uc001lcq.3	P54317			10.37:g.118386476G>T			Somatic	137	0	0		WXS	Illumina HiSeq	Phase_I	174	0.02	4	.	2	0.00	0	A8K627|Q6IB55	RNA	SNP	ENST00000298771.7	37																																																																																						0.567	PNLIPRP2-004	KNOWN	basic	processed_transcript	polymorphic_pseudogene		OTTHUMT00000050546.6		NM_005396	
DBX1	120237	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	20180817	20180818	+	Missense_Mutation	DNP	TG	TG	CT			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr11:20180817_20180818TG>CT	ENST00000524983.2	-	2	676_677	c.388_389CA>AG	c.(388-390)CAg>AGg	p.Q130R	DBX1_ENST00000227256.3_Missense_Mutation_p.Q130R			A6NMT0	DBX1_HUMAN	developing brain homeobox 1	130					regulation of transcription from RNA polymerase II promoter (GO:0006357)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)	21						AGGGACGCTCTGGAGCAAGGCT	0.52																																					p.Q130R													.	.			0			c.C388A																																									SO:0001583	missense	120237	exon2			ACGCTCTGGAGCA			11p15.1	2011-06-20				ENSG00000109851		"""Homeoboxes / ANTP class : NKL subclass"""	33185	protein-coding gene	gene with protein product						11239429	Standard	NM_001029865		Approved		uc021qey.1	A6NMT0		ENST00000524983.2:c.388_389delinsCT	11.37:g.20180817_20180818delinsCT	ENSP00000436881:p.Gln130Arg		Somatic	94	0	0		WXS	Illumina HiSeq	.	77	0.13	10	NM_001029865	0		0		Missense_Mutation	DNP	ENST00000524983.2	37																																																																																						0.520	DBX1-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000387585.2		NM_001029865	
FNBP4	23360	mdanderson.org	37	11	47755578	47755578	+	Splice_Site	SNP	T	T	C			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr11:47755578T>C	ENST00000263773.5	-	10	1697	c.1685A>G	c.(1684-1686)gAg>gGg	p.E562G	FNBP4_ENST00000534003.1_5'UTR	NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	562						nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						AAGACTTACCTCAGTCTGTAA	0.348																																					p.E562G													FNBP4,NS,carcinoma,-1,1	FNBP4	-1	1	0			c.A1685G												75.0	72.0	73.0					11																	47755578		1822	4079	5901	SO:0001630	splice_region_variant	23360	exon10			CTTACCTCAGTCT	BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.1686+1A>G	11.37:g.47755578T>C			Somatic	45	0.1777777778	8		WXS	Illumina HiSeq	Phase_I	38	0.26	10	NM_015308	84	0.00	0	Q9H985|Q9NT81|Q9Y2L7	Missense_Mutation	SNP	ENST00000263773.5	37	CCDS41644.1	.	.	.	.	.	.	.	.	.	.	T	31	5.087025	0.94100	.	.	ENSG00000109920	ENST00000263773	T	0.10382	2.88	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.23492	0.0568	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.01140	-1.1439	10	0.87932	D	0	-17.5756	16.2644	0.82568	0.0:0.0:0.0:1.0	.	562	Q8N3X1	FNBP4_HUMAN	G	562	ENSP00000263773:E562G	ENSP00000263773:E562G	E	-	2	0	FNBP4	47712154	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.018000	0.88722	2.244000	0.73946	0.528000	0.53228	GAG			0.348	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390237.3			Missense_Mutation
RPLP0P2	113157	hgsc.bcm.edu	37	11	61405030	61405030	+	RNA	SNP	T	T	A			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr11:61405030T>A	ENST00000496593.1	+	0	1634					NR_002775.2				ribosomal protein, large, P0 pseudogene 2																		ctgctgctgctgcAGCCCCAG	0.552																																					.													.	.			0			.																																											113157	.			TGCTGCTGCAGCC	BC010523		11q12.2	2014-08-07			ENSG00000243742	ENSG00000243742		"""L ribosomal proteins"""	17960	pseudogene	pseudogene						19123937, 25089627	Standard	NR_002775		Approved		uc001nrz.1		OTTHUMG00000158396		11.37:g.61405030T>A			Somatic	113	0	0		WXS	Illumina HiSeq	.	104	0.05	5	.	6	0.00	0		RNA	SNP	ENST00000496593.1	37																																																																																						0.552	RPLP0P2-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000350911.1		NR_002775	
MEN1	4221	mdanderson.org	37	11	64577508	64577508	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr11:64577508G>A	ENST00000337652.1	-	2	577	c.74C>T	c.(73-75)gCc>gTc	p.A25V	MEN1_ENST00000377313.1_Missense_Mutation_p.A25V|MEN1_ENST00000394376.1_Missense_Mutation_p.A25V|MEN1_ENST00000315422.4_Missense_Mutation_p.A25V|MEN1_ENST00000377316.2_Missense_Mutation_p.A25V|MEN1_ENST00000312049.6_Missense_Mutation_p.A25V|MEN1_ENST00000394374.2_Missense_Mutation_p.A25V|MEN1_ENST00000377326.3_Missense_Mutation_p.A25V|MEN1_ENST00000443283.1_Missense_Mutation_p.A25V|MEN1_ENST00000377321.1_Missense_Mutation_p.A25V	NM_130803.2	NP_570715	O00255	MEN1_HUMAN	multiple endocrine neoplasia I	25					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)	p.L22_P59del(1)|p.M1fs*82(1)|p.L13fs*86(1)		NS(7)|adrenal_gland(5)|breast(2)|central_nervous_system(5)|endometrium(1)|gastrointestinal_tract_(site_indeterminate)(15)|large_intestine(2)|lung(21)|ovary(1)|pancreas(64)|parathyroid(181)|pituitary(7)|prostate(4)|retroperitoneum(1)|skin(1)|small_intestine(13)|soft_tissue(4)|stomach(1)|thymus(2)	337						GCCCAGCTCGGCAGCAAACAG	0.672			"""D, Mis, N, F, S"""		"""parathyroid tumors, Pancreatic neuroendocrine tumors"""	"""parathyroid adenoma, pituitary adenoma, pancreatic islet cell, carcinoid"""			Multiple Endocrine Neoplasia, type 1;Hyperparathyroidism, Familial Isolated																												p.A25V	Esophageal Squamous(1;83 158 15500 18603 18803 29295)		yes	Rec	yes	Multiple Endocrine Neoplasia Type 1	11	11q13	4221	multiple endocrine neoplasia type 1 gene		E	.	.			3	Deletion - Frameshift(2)|Deletion - In frame(1)	pancreas(2)|parathyroid(1)	c.C74T												30.0	32.0	31.0					11																	64577508		2185	4251	6436	SO:0001583	missense	4221	exon2	Familial Cancer Database	MEN1, Wermer disease;FIHP, FIHPT, HRPT1, Familial Isolated Primary Hyperparathyroidism	AGCTCGGCAGCAA	U93236	CCDS8083.1, CCDS31600.1	11q13	2014-09-17			ENSG00000133895	ENSG00000133895			7010	protein-coding gene	gene with protein product	"""menin"""	613733					Standard	NM_130799		Approved		uc001obn.3	O00255	OTTHUMG00000045366	ENST00000337652.1:c.74C>T	11.37:g.64577508G>A	ENSP00000337088:p.Ala25Val		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_130803	32	0.00	0	A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Missense_Mutation	SNP	ENST00000337652.1	37	CCDS8083.1	.	.	.	.	.	.	.	.	.	.	G	15.62	2.886184	0.51908	.	.	ENSG00000133895	ENST00000377316;ENST00000377321;ENST00000377326;ENST00000312049;ENST00000315422;ENST00000337652;ENST00000394376;ENST00000394374;ENST00000443283;ENST00000377313;ENST00000440873;ENST00000450708;ENST00000413626;ENST00000429702;ENST00000424912	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.99382	-5.8;-5.8;-5.8;-5.8;-5.8;-5.8;-5.8;-5.8;-5.8;-5.8;-5.8;-5.8;-5.8;-5.8;-5.8	4.89	4.89	0.63831	.	0.214010	0.38663	N	0.001614	D	0.97362	0.9137	N	0.22421	0.69	0.39122	D	0.961679	P;P;P	0.50819	0.667;0.939;0.714	B;P;B	0.47206	0.155;0.541;0.241	D	0.96766	0.9565	10	0.30078	T	0.28	-27.604	11.8044	0.52145	0.0:0.1773:0.8227:0.0	.	25;25;25	O00255-2;O00255-3;O00255	.;.;MEN1_HUMAN	V	25	ENSP00000366533:A25V;ENSP00000366538:A25V;ENSP00000366543:A25V;ENSP00000308975:A25V;ENSP00000323747:A25V;ENSP00000337088:A25V;ENSP00000377901:A25V;ENSP00000377899:A25V;ENSP00000396940:A25V;ENSP00000366530:A25V;ENSP00000413944:A25V;ENSP00000394933:A25V;ENSP00000411218:A25V;ENSP00000402752:A25V;ENSP00000388016:A25V	ENSP00000308975:A25V	A	-	2	0	MEN1	64334084	0.899000	0.30636	0.834000	0.33040	0.568000	0.35870	4.036000	0.57304	2.433000	0.82419	0.462000	0.41574	GCC			0.672	MEN1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000143881.1			
SIPA1	6494	mdanderson.org	37	11	65414526	65414526	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr11:65414526C>T	ENST00000394224.3	+	8	2317	c.2021C>T	c.(2020-2022)gCg>gTg	p.A674V	SIPA1_ENST00000394227.3_Missense_Mutation_p.A572V|MIR4489_ENST00000578869.1_RNA|SIPA1_ENST00000534313.1_Missense_Mutation_p.A674V|SIPA1_ENST00000527525.1_Missense_Mutation_p.A572V	NM_153253.29	NP_694985.29	Q96FS4	SIPA1_HUMAN	signal-induced proliferation-associated 1	674					cell proliferation (GO:0008283)|cellular response to water deprivation (GO:0042631)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|signal transduction (GO:0007165)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)|transport vesicle (GO:0030133)	GTPase activator activity (GO:0005096)|Rap GTPase activator activity (GO:0046582)			cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	10						GAGGTGGTGGCGCGCCTGCAG	0.721																																					p.A674V													.	.			0			c.C2021T												5.0	5.0	5.0					11																	65414526		2083	4023	6106	SO:0001583	missense	6494	exon8			TGGTGGCGCGCCT	AH006363, BC010492, BM677738	CCDS8108.1	11q13.3	2008-09-12	2008-09-12		ENSG00000213445	ENSG00000213445			10885	protein-coding gene	gene with protein product		602180				9027487	Standard	NM_006747		Approved	SPA1	uc001ofb.2	Q96FS4	OTTHUMG00000166541	ENST00000394224.3:c.2021C>T	11.37:g.65414526C>T	ENSP00000377771:p.Ala674Val		Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	8	0.25	2	NM_006747	13	0.00	0	O14518|O60484|O60618|Q2YD83	Missense_Mutation	SNP	ENST00000394224.3	37	CCDS8108.1	.	.	.	.	.	.	.	.	.	.	C	19.56	3.849673	0.71603	.	.	ENSG00000213445	ENST00000534313;ENST00000527525;ENST00000394224;ENST00000394227	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	3.28	2.33	0.28932	.	0.443443	0.18177	U	0.149245	T	0.24084	0.0583	N	0.24115	0.695	0.23572	N	0.997386	B;B	0.27971	0.157;0.196	B;B	0.19666	0.026;0.017	T	0.13045	-1.0524	10	0.49607	T	0.09	-6.0119	5.8875	0.18890	0.222:0.5618:0.2162:0.0	.	572;674	F6RY50;Q96FS4	.;SIPA1_HUMAN	V	674;572;674;572	ENSP00000436269:A674V;ENSP00000433686:A572V;ENSP00000377771:A674V;ENSP00000377774:A572V	ENSP00000377771:A674V	A	+	2	0	SIPA1	65171102	0.084000	0.21492	0.930000	0.37139	0.768000	0.43524	1.000000	0.29770	0.691000	0.31592	0.185000	0.17295	GCG			0.721	SIPA1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390356.1		NM_006747	
MYEOV	26579	broad.mit.edu	37	11	69063822	69063822	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr11:69063822T>A	ENST00000308946.3	+	3	1355	c.905T>A	c.(904-906)cTc>cAc	p.L302H	MYEOV_ENST00000441339.2_Missense_Mutation_p.L302H|MYEOV_ENST00000535407.1_Missense_Mutation_p.L244H	NM_138768.2	NP_620123.2	Q96EZ4	MYEOV_HUMAN	myeloma overexpressed	302										endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|urinary_tract(1)	24	all_lung(4;2.21e-19)|Lung NSC(4;6.13e-19)|Melanoma(5;0.00128)		LUSC - Lung squamous cell carcinoma(11;3.33e-11)|STAD - Stomach adenocarcinoma(18;0.00654)|LUAD - Lung adenocarcinoma(13;0.0713)	Kidney(183;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.00361)|LUSC - Lung squamous cell carcinoma(976;0.0153)		ctccaccacctcctcctcctc	0.577																																					p.L302H													.	MYEOV	42		0			c.T905A												39.0	35.0	36.0					11																	69063822		2198	4289	6487	SO:0001583	missense	26579	exon3			ACCACCTCCTCCT	AJ223366	CCDS8190.1, CCDS73340.1	11q13.2	2013-03-27	2013-03-27			ENSG00000172927			7563	protein-coding gene	gene with protein product		605625	"""myeloma overexpressed (in a subset of t(11;14) positive multiple myelomas)"""			10753852	Standard	XM_005273908		Approved	OCIM	uc001oov.3	Q96EZ4		ENST00000308946.3:c.905T>A	11.37:g.69063822T>A	ENSP00000308330:p.Leu302His		Somatic	103	0.0194174757	2		WXS	Illumina HiSeq	Phase_I	92	0.07	6	NM_138768	4	0.00	0	Q9UGN6|Q9UGN7	Missense_Mutation	SNP	ENST00000308946.3	37	CCDS8190.1	.	.	.	.	.	.	.	.	.	.	T	0.011	-1.704894	0.00719	.	.	ENSG00000172927	ENST00000441339;ENST00000308946;ENST00000535407	T;T;T	0.27402	1.68;1.68;1.67	1.23	-2.46	0.06461	.	.	.	.	.	T	0.10508	0.0257	N	0.08118	0	0.09310	N	1	P	0.43352	0.804	B	0.34489	0.184	T	0.15263	-1.0443	9	0.87932	D	0	.	0.7984	0.01070	0.1638:0.2594:0.1641:0.4128	.	302	Q96EZ4	MYEOV_HUMAN	H	302;302;244	ENSP00000412482:L302H;ENSP00000308330:L302H;ENSP00000438100:L244H	ENSP00000308330:L302H	L	+	2	0	MYEOV	68820398	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.679000	0.05203	-3.385000	0.00174	-2.750000	0.00124	CTC			0.577	MYEOV-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000396548.1			
TRAPPC4	51399	mdanderson.org	37	11	118897770	118897770	+	IGR	SNP	G	G	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr11:118897770G>T	ENST00000533632.1	+	0	1759				SLC37A4_ENST00000545985.1_Missense_Mutation_p.L221M|SLC37A4_ENST00000330775.7_Missense_Mutation_p.L220M|SLC37A4_ENST00000538950.1_Missense_Mutation_p.L148M|SLC37A4_ENST00000357590.5_Missense_Mutation_p.L221M|SLC37A4_ENST00000525102.1_5'UTR	NM_016146.4	NP_057230.1	Q9Y296	TPPC4_HUMAN	trafficking protein particle complex 4						dendrite development (GO:0016358)|ER to Golgi vesicle-mediated transport (GO:0006888)|extracellular matrix organization (GO:0030198)	cis-Golgi network (GO:0005801)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi stack (GO:0005795)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)|TRAPP complex (GO:0030008)				NS(1)|endometrium(1)|large_intestine(2)|lung(1)	5	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_neural(223;0.224)|all_hematologic(192;0.243)		BRCA - Breast invasive adenocarcinoma(274;7.58e-05)		GGGGACAGCAGCAGCTCCTGC	0.587																																					p.L221M													.	.			0			c.C661A												45.0	46.0	45.0					11																	118897770		1949	4152	6101	SO:0001628	intergenic_variant	2542	exon6			ACAGCAGCAGCTC	AF078862	CCDS8407.1	11q23.3	2011-10-10				ENSG00000196655		"""Trafficking protein particle complex"""	19943	protein-coding gene	gene with protein product		610971				10810093	Standard	NM_016146		Approved	TRS23, SBDN, PTD009	uc010ryo.2	Q9Y296			11.37:g.118897770G>T			Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	19	0.11	2	NM_001467	130	0.00	0	A8K3A5|B4DME1	Missense_Mutation	SNP	ENST00000533632.1	37	CCDS8407.1																																																																																					0.587	TRAPPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000389332.1		NM_016146	
ROBO3	64221	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	124740969	124740969	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr11:124740969G>A	ENST00000397801.1	+	7	1285	c.1093G>A	c.(1093-1095)Gct>Act	p.A365T	ROBO3_ENST00000538940.1_Missense_Mutation_p.A343T	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	365	Ig-like C2-type 4.				axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		AGAGAGCGTGGCTTTCCAGTG	0.607																																					p.A365T													.	.			0			c.G1093A												44.0	49.0	48.0					11																	124740969		1975	4152	6127	SO:0001583	missense	64221	exon7			AGCGTGGCTTTCC	AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.1093G>A	11.37:g.124740969G>A	ENSP00000380903:p.Ala365Thr		Somatic	85	0	0		WXS	Illumina HiSeq	.	86	0.41	35	NM_022370	0		0		Missense_Mutation	SNP	ENST00000397801.1	37	CCDS44755.1	.	.	.	.	.	.	.	.	.	.	G	2.293	-0.361968	0.05103	.	.	ENSG00000154134	ENST00000397801;ENST00000538940	T;T	0.72167	-0.63;-0.63	4.3	-3.28	0.05033	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.917269	0.08834	N	0.886905	T	0.24812	0.0602	N	0.00205	-1.85	0.80722	D	1	B	0.06786	0.001	B	0.12837	0.008	T	0.49679	-0.8914	10	0.02654	T	1	.	7.0373	0.25000	0.6883:0.0:0.1692:0.1425	.	365	Q96MS0	ROBO3_HUMAN	T	365;343	ENSP00000380903:A365T;ENSP00000441797:A343T	ENSP00000380903:A365T	A	+	1	0	ROBO3	124246179	1.000000	0.71417	0.221000	0.23827	0.658000	0.38924	1.401000	0.34589	-0.488000	0.06726	0.455000	0.32223	GCT			0.607	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387091.1		XM_370663	
WNT1	7471	broad.mit.edu	37	12	49375067	49375067	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr12:49375067G>T	ENST00000293549.3	+	4	793	c.757G>T	c.(757-759)Gcc>Tcc	p.A253S		NM_005430.3	NP_005421.1	P04628	WNT1_HUMAN	wingless-type MMTV integration site family, member 1	253					bone development (GO:0060348)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to peptide hormone stimulus (GO:0071375)|central nervous system morphogenesis (GO:0021551)|cerebellum formation (GO:0021588)|diencephalon development (GO:0021536)|embryonic axis specification (GO:0000578)|forebrain anterior/posterior pattern specification (GO:0021797)|hematopoietic stem cell proliferation (GO:0071425)|hepatocyte differentiation (GO:0070365)|inner ear morphogenesis (GO:0042472)|midbrain development (GO:0030901)|midbrain-hindbrain boundary maturation during brain development (GO:0022004)|myoblast fusion (GO:0007520)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell aging (GO:0090344)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron differentiation (GO:0030182)|neuron fate determination (GO:0048664)|organ regeneration (GO:0031100)|positive regulation of cell proliferation (GO:0008284)|positive regulation of dermatome development (GO:0061184)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to wounding (GO:0009611)|signal transduction in response to DNA damage (GO:0042770)|Spemann organizer formation (GO:0060061)|spinal cord association neuron differentiation (GO:0021527)|T cell differentiation in thymus (GO:0033077)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(357;0.244)		CTTCGACGGCGCCTCGCGCGT	0.741																																					p.A253S													.	WNT1	13		0			c.G757T												10.0	11.0	11.0					12																	49375067		2189	4220	6409	SO:0001583	missense	7471	exon4			GACGGCGCCTCGC	X03072	CCDS8776.1	12q13	2013-02-28				ENSG00000125084		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12774	protein-coding gene	gene with protein product		164820		INT1		2998762, 3281802	Standard	NM_005430		Approved		uc001rsu.3	P04628	OTTHUMG00000170403	ENST00000293549.3:c.757G>T	12.37:g.49375067G>T	ENSP00000293549:p.Ala253Ser		Somatic	76	0.0131578947	1		WXS	Illumina HiSeq	Phase_I	110	0.05	6	NM_005430	0		0	Q5U0N2	Missense_Mutation	SNP	ENST00000293549.3	37	CCDS8776.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.289192	0.80914	.	.	ENSG00000125084	ENST00000293549;ENST00000380414	D	0.82526	-1.62	4.3	3.37	0.38596	.	0.000000	0.85682	D	0.000000	D	0.84401	0.5464	M	0.76170	2.325	0.80722	D	1	P	0.42409	0.779	P	0.46339	0.513	D	0.84855	0.0816	10	0.56958	D	0.05	.	11.4187	0.49967	0.0:0.1837:0.8163:0.0	.	253	P04628	WNT1_HUMAN	S	253;89	ENSP00000293549:A253S	ENSP00000293549:A253S	A	+	1	0	WNT1	47661334	1.000000	0.71417	1.000000	0.80357	0.746000	0.42486	9.563000	0.98148	1.113000	0.41760	0.561000	0.74099	GCC			0.741	WNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000408937.1			
CIT	11113	mdanderson.org	37	12	120127985	120127985	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr12:120127985C>T	ENST00000261833.7	-	46	6083	c.6031G>A	c.(6031-6033)Gtg>Atg	p.V2011M	CIT_ENST00000537607.1_5'UTR|CIT_ENST00000392521.2_Missense_Mutation_p.V2053M	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	2011					cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		GGGGTCCTCACGGCTCCCGCA	0.677																																					p.V2053M													.	.			0			c.G6157A												14.0	15.0	15.0					12																	120127985		2073	4109	6182	SO:0001583	missense	11113	exon47			TCCTCACGGCTCC	AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.6031G>A	12.37:g.120127985C>T	ENSP00000261833:p.Val2011Met		Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	15	0.13	2	NM_001206999	8	0.00	0	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Missense_Mutation	SNP	ENST00000261833.7	37	CCDS9192.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.115379	0.77323	.	.	ENSG00000122966	ENST00000392521;ENST00000261833	T;T	0.68331	-0.29;-0.32	5.4	5.4	0.78164	.	0.150088	0.43919	D	0.000520	T	0.64571	0.2610	L	0.34521	1.04	0.46260	D	0.998955	P;P;P	0.49862	0.899;0.929;0.927	B;P;B	0.45971	0.271;0.499;0.42	T	0.69135	-0.5225	10	0.72032	D	0.01	.	19.5306	0.95228	0.0:1.0:0.0:0.0	.	2053;2011;1528	Q2M5E1;O14578;O14578-3	.;CTRO_HUMAN;.	M	2053;2011	ENSP00000376306:V2053M;ENSP00000261833:V2011M	ENSP00000261833:V2011M	V	-	1	0	CIT	118612368	1.000000	0.71417	0.981000	0.43875	0.987000	0.75469	5.313000	0.65798	2.665000	0.90641	0.655000	0.94253	GTG			0.677	CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000259410.4		NM_007174	
ACIN1	22985	broad.mit.edu	37	14	23528416	23528416	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr14:23528416G>A	ENST00000262710.1	-	19	4294	c.3967C>T	c.(3967-3969)Cgc>Tgc	p.R1323C	ACIN1_ENST00000605057.1_Missense_Mutation_p.R1265C|ACIN1_ENST00000457657.1_Missense_Mutation_p.R1283C|CDH24_ENST00000487137.2_5'Flank|ACIN1_ENST00000338631.6_Missense_Mutation_p.R596C|ACIN1_ENST00000555053.1_Missense_Mutation_p.R1310C|CDH24_ENST00000397359.3_5'Flank|ACIN1_ENST00000357481.2_Missense_Mutation_p.R565C|ACIN1_ENST00000557515.1_Missense_Mutation_p.R564C|ACIN1_ENST00000397341.3_Missense_Mutation_p.R565C	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	1323	Arg/Asp/Glu/Lys-rich.				apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		CTGCTGTGGCGCTTGGTGTCC	0.652											OREG0022595	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R1323C													ACIN1_ENST00000338631,NS,carcinoma,+1,2	ACIN1	147	2	0			c.C3967T												126.0	101.0	109.0					14																	23528416		2203	4300	6503	SO:0001583	missense	22985	exon19			TGTGGCGCTTGGT	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.3967C>T	14.37:g.23528416G>A	ENSP00000262710:p.Arg1323Cys		Somatic	159	0	0	764	WXS	Illumina HiSeq	Phase_I	111	0.04	4	NM_014977	300	0.09	27	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	ENST00000262710.1	37	CCDS9587.1	.	.	.	.	.	.	.	.	.	.	G	15.86	2.956516	0.53293	.	.	ENSG00000100813	ENST00000557515;ENST00000338631;ENST00000357481;ENST00000262710;ENST00000457657;ENST00000397341;ENST00000555053	T;T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95;0.95	4.45	3.47	0.39725	.	0.000000	0.41396	D	0.000891	T	0.39886	0.1095	N	0.14661	0.345	0.48762	D	0.999706	D;D;D;D;D	0.76494	0.999;0.999;0.997;0.989;0.989	P;P;P;B;B	0.60949	0.881;0.764;0.649;0.266;0.266	T	0.35968	-0.9767	10	0.87932	D	0	-5.0965	9.7553	0.40500	0.0:0.0:0.644:0.356	.	1310;1323;1283;596;565	G3V3M7;Q9UKV3;E7EQT4;Q9UKV3-2;Q9UKV3-3	.;ACINU_HUMAN;.;.;.	C	564;596;565;1323;1283;565;1310	ENSP00000451138:R564C;ENSP00000345541:R596C;ENSP00000350073:R565C;ENSP00000262710:R1323C;ENSP00000405677:R1283C;ENSP00000380502:R565C;ENSP00000451328:R1310C	ENSP00000262710:R1323C	R	-	1	0	ACIN1	22598256	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	1.237000	0.32695	2.456000	0.83038	0.563000	0.77884	CGC			0.652	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000071707.3	rescued with RNA-seq	NM_014977	
SRP54-AS1	100506157	broad.mit.edu	37	14	35409700	35409701	+	RNA	INS	-	-	T	rs528632775|rs712315	byFrequency	TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr14:35409700_35409701insT	ENST00000556355.1	-	0	257				RP11-85K15.2_ENST00000555015.1_RNA																							GATTAAAAAAAATTTTTTTTTC	0.396																																					.													.	.			0			.																																											0	.			AAAAAAAATTTTT																													14.37:g.35409700_35409701insT			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	INS	ENST00000556355.1	37																																																																																						0.396	RP11-85K15.2-004	KNOWN	basic	antisense	processed_transcript		OTTHUMT00000410682.2			
TRIM9	114088	mdanderson.org	37	14	51489585	51489585	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr14:51489585G>T	ENST00000298355.3	-	3	2130	c.1009C>A	c.(1009-1011)Cgc>Agc	p.R337S	TRIM9_ENST00000360392.4_Missense_Mutation_p.R337S|TRIM9_ENST00000338969.5_Missense_Mutation_p.R337S	NM_015163.5	NP_055978.4	Q9C026	TRIM9_HUMAN	tripartite motif containing 9	337					negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of SNARE complex assembly (GO:0035544)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|synaptic vesicle (GO:0008021)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_epithelial(31;0.00418)|Breast(41;0.148)					TTGTTGACGCGGGCCAGCAGC	0.557																																					p.R337S													TRIM9_ENST00000360392,NS,carcinoma,+2,5	TRIM9_ENST00000360392	2	5	0			c.C1009A												125.0	115.0	119.0					14																	51489585		2203	4300	6503	SO:0001583	missense	114088	exon3			TGACGCGGGCCAG	AF220036	CCDS9703.1, CCDS45105.1	14q21.3	2013-02-11	2011-01-25		ENSG00000100505	ENSG00000100505		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16288	protein-coding gene	gene with protein product		606555	"""tripartite motif-containing 9"""			11331580, 11524423	Standard	NM_015163		Approved	SPRING, RNF91	uc001wyx.4	Q9C026	OTTHUMG00000140291	ENST00000298355.3:c.1009C>A	14.37:g.51489585G>T	ENSP00000298355:p.Arg337Ser		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_052978	0		0	D3DSB7|D3DSB8|Q92557|Q96D24|Q96NI4|Q9C025|Q9C027	Missense_Mutation	SNP	ENST00000298355.3	37	CCDS9703.1	.	.	.	.	.	.	.	.	.	.	G	14.96	2.692369	0.48202	.	.	ENSG00000100505	ENST00000298355;ENST00000338969;ENST00000360392	T;T;T	0.69926	-0.32;-0.44;0.59	5.58	5.58	0.84498	B-box, C-terminal (1);	0.058088	0.64402	D	0.000001	T	0.59865	0.2225	L	0.29908	0.895	0.45261	D	0.998268	B;B;B	0.29531	0.163;0.247;0.025	B;B;B	0.35240	0.198;0.154;0.035	T	0.54470	-0.8289	10	0.22706	T	0.39	.	18.5617	0.91102	0.0:0.0:1.0:0.0	.	337;337;337	Q9C026-5;Q9C026-4;Q9C026	.;.;TRIM9_HUMAN	S	337	ENSP00000298355:R337S;ENSP00000342970:R337S;ENSP00000353561:R337S	ENSP00000298355:R337S	R	-	1	0	TRIM9	50559335	1.000000	0.71417	0.943000	0.38184	0.959000	0.62525	4.225000	0.58600	2.636000	0.89361	0.655000	0.94253	CGC			0.557	TRIM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000276874.1		NM_015163	
FOS	2353	mdanderson.org	37	14	75747810	75747810	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr14:75747810G>T	ENST00000303562.4	+	4	1035	c.826G>T	c.(826-828)Gca>Tca	p.A276S	FOS_ENST00000535987.1_Missense_Mutation_p.A240S|FOS_ENST00000555686.1_Missense_Mutation_p.A162S|FOS_ENST00000555347.1_Missense_Mutation_p.A128S	NM_005252.3	NP_005243.1	P01100	FOS_HUMAN	FBJ murine osteosarcoma viral oncogene homolog	276					aging (GO:0007568)|cellular response to calcium ion (GO:0071277)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hormone stimulus (GO:0032870)|cellular response to reactive oxygen species (GO:0034614)|conditioned taste aversion (GO:0001661)|DNA methylation (GO:0006306)|Fc-epsilon receptor signaling pathway (GO:0038095)|female pregnancy (GO:0007565)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nervous system development (GO:0007399)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to cold (GO:0009409)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to gravity (GO:0009629)|response to light stimulus (GO:0009416)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|skeletal muscle cell differentiation (GO:0035914)|sleep (GO:0030431)|SMAD protein signal transduction (GO:0060395)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	double-stranded DNA binding (GO:0003690)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		all_lung(585;0.0138)|all_epithelial(191;0.0263)|all_neural(303;0.112)		BRCA - Breast invasive adenocarcinoma(234;0.0117)	Nadroparin(DB08813)|Pseudoephedrine(DB00852)	CCTGTTCCCAGCATCATCCAG	0.582																																					p.A276S													.	.			0			c.G826T												63.0	59.0	60.0					14																	75747810		2203	4300	6503	SO:0001583	missense	2353	exon4			TTCCCAGCATCAT	K00650	CCDS9841.1	14q24.3	2013-01-10	2009-07-23			ENSG00000170345		"""basic leucine zipper proteins"""	3796	protein-coding gene	gene with protein product		164810	"""v-fos FBJ murine osteosarcoma viral oncogene homolog"""			16123044, 16055710, 15926923	Standard	NM_005252		Approved	c-fos, AP-1	uc001xrn.3	P01100		ENST00000303562.4:c.826G>T	14.37:g.75747810G>T	ENSP00000306245:p.Ala276Ser		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	22	0.09	2	NM_005252	582	0.00	0	A8K4E2|B4DQ65|P18849	Missense_Mutation	SNP	ENST00000303562.4	37	CCDS9841.1	.	.	.	.	.	.	.	.	.	.	G	0.111	-1.137990	0.01742	.	.	ENSG00000170345	ENST00000303562;ENST00000535987;ENST00000555686;ENST00000555672;ENST00000555347	T;T;T	0.62105	0.63;1.06;0.05	5.22	4.27	0.50696	.	0.444016	0.24864	N	0.034992	T	0.31295	0.0792	N	0.08118	0	0.31318	N	0.686368	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.36768	-0.9734	10	0.02654	T	1	-8.0344	5.2723	0.15632	0.0798:0.1444:0.6267:0.1491	.	240;276	B4DQ65;P01100	.;FOS_HUMAN	S	276;240;162;126;128	ENSP00000306245:A276S;ENSP00000442268:A240S;ENSP00000452590:A162S	ENSP00000306245:A276S	A	+	1	0	FOS	74817563	0.000000	0.05858	0.881000	0.34555	0.820000	0.46376	0.248000	0.18198	2.609000	0.88269	0.563000	0.77884	GCA			0.582	FOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000415044.1		NM_005252	
CHEK2P2	646096	broad.mit.edu	37	15	20488769	20488770	+	RNA	DNP	CA	CA	TG			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr15:20488769_20488770CA>TG	ENST00000555186.1	+	0	252_253					NR_038836.1				checkpoint kinase 2 pseudogene 2																		TTGGGCACTCCAAGATTTTGGG	0.406																																					.													.	.			0			.																																											0	.			GCACTCCAAGATT			15q11.1	2011-11-11			ENSG00000259156	ENSG00000259156			43578	pseudogene	pseudogene							Standard	NR_038836		Approved		uc001ytf.1		OTTHUMG00000171660	Exception_encountered	15.37:g.20488769_20488770delinsTG			Somatic	362	0.0055248619	2		WXS	Illumina HiSeq	Phase_I	331	0.03	10	.	0		0		RNA	DNP	ENST00000555186.1	37																																																																																						0.406	CHEK2P2-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000414654.1		NR_038836	
DISP2	85455	mdanderson.org	37	15	40660600	40660600	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr15:40660600C>T	ENST00000267889.3	+	8	2374	c.2287C>T	c.(2287-2289)Ccg>Tcg	p.P763S	RP11-64K12.4_ENST00000558421.1_RNA	NM_033510.1	NP_277045.1	A7MBM2	DISP2_HUMAN	dispatched homolog 2 (Drosophila)	763					smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)	30		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		CGAGCAGCTGCCGCAGGGCGA	0.701																																					p.P763S													.	.			0			c.C2287T												40.0	45.0	43.0					15																	40660600		2201	4296	6497	SO:0001583	missense	85455	exon8			CAGCTGCCGCAGG	AB051529	CCDS10056.1	15q14	2004-01-15			ENSG00000140323	ENSG00000140323			19712	protein-coding gene	gene with protein product		607503				11214970, 10619433	Standard	NM_033510		Approved	DISPB, KIAA1742, HsT16908	uc001zlk.1	A7MBM2	OTTHUMG00000129983	ENST00000267889.3:c.2287C>T	15.37:g.40660600C>T	ENSP00000267889:p.Pro763Ser		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_033510	0		0	Q6AHW3|Q9C0C1	Missense_Mutation	SNP	ENST00000267889.3	37	CCDS10056.1	.	.	.	.	.	.	.	.	.	.	c	0.003	-2.544819	0.00142	.	.	ENSG00000140323	ENST00000267889	T	0.10382	2.88	4.82	1.9	0.25705	.	0.742488	0.13450	N	0.386944	T	0.08088	0.0202	L	0.44542	1.39	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.44574	-0.9319	10	0.09084	T	0.74	-0.4572	7.5837	0.27980	0.0:0.3647:0.4656:0.1697	.	763	A7MBM2	DISP2_HUMAN	S	763	ENSP00000267889:P763S	ENSP00000267889:P763S	P	+	1	0	DISP2	38447892	0.778000	0.28640	0.132000	0.22025	0.010000	0.07245	1.369000	0.34227	0.248000	0.21435	-1.254000	0.01491	CCG			0.701	DISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252249.1		NM_033510	
FSD2	123722	hgsc.bcm.edu	37	15	83455275	83455275	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr15:83455275G>T	ENST00000334574.8	-	3	904	c.723C>A	c.(721-723)ttC>ttA	p.F241L	FSD2_ENST00000541889.1_Missense_Mutation_p.F241L			A1L4K1	FSD2_HUMAN	fibronectin type III and SPRY domain containing 2	241										breast(2)|central_nervous_system(1)|large_intestine(5)|lung(10)	18						CCACAGTGATGAAAACCTCCT	0.393																																					p.F241L													.	.			0			c.C723A												119.0	109.0	112.0					15																	83455275		1904	4124	6028	SO:0001583	missense	123722	exon3			AGTGATGAAAACC	AK122875	CCDS45332.1, CCDS61738.1	15q25.2	2013-02-11	2006-01-11	2006-01-11		ENSG00000186628		"""Fibronectin type III domain containing"""	18024	protein-coding gene	gene with protein product			"""SPRY domain containing 1"""	SPRYD1			Standard	NM_001007122		Approved	RP11-127F21	uc002bjd.2	A1L4K1		ENST00000334574.8:c.723C>A	15.37:g.83455275G>T	ENSP00000335651:p.Phe241Leu		Somatic	120	0	0		WXS	Illumina HiSeq	.	96	0.05	5	NM_001007122	0		0	B3KVG1|B7ZM02	Missense_Mutation	SNP	ENST00000334574.8	37	CCDS45332.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.348685	0.82132	.	.	ENSG00000186628	ENST00000334574;ENST00000541889	T;T	0.25912	1.77;1.77	5.39	3.52	0.40303	.	0.057709	0.64402	D	0.000001	T	0.42131	0.1189	M	0.64997	1.995	0.37369	D	0.911534	D;D	0.63880	0.99;0.993	D;P	0.63488	0.915;0.804	T	0.39333	-0.9619	10	0.35671	T	0.21	-21.8944	11.0846	0.48080	0.1489:0.0:0.8511:0.0	.	241;241	B7ZM02;A1L4K1	.;FSD2_HUMAN	L	241	ENSP00000335651:F241L;ENSP00000444078:F241L	ENSP00000335651:F241L	F	-	3	2	FSD2	81252329	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.809000	0.55606	0.663000	0.31027	0.655000	0.94253	TTC			0.393	FSD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000418385.1		NM_001007122	
KIF7	374654	mdanderson.org	37	15	90188603	90188603	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr15:90188603G>T	ENST00000394412.3	-	9	2078	c.2002C>A	c.(2002-2004)Ctt>Att	p.L668I		NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	668	Sufficient for interaction with NPHP1.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			AACTCCTCAAGGCAAAGCTCT	0.632																																					p.L668I													.	.			0			c.C2002A												102.0	84.0	90.0					15																	90188603		2200	4299	6499	SO:0001583	missense	374654	exon9			CCTCAAGGCAAAG	AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.2002C>A	15.37:g.90188603G>T	ENSP00000377934:p.Leu668Ile		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	55	0.05	3	NM_198525	22	0.00	0	Q3SXY0|Q6UXE9|Q8IW72	Missense_Mutation	SNP	ENST00000394412.3	37	CCDS32325.2	.	.	.	.	.	.	.	.	.	.	g	10.06	1.247752	0.22880	.	.	ENSG00000166813	ENST00000394412	T	0.70399	-0.48	4.38	4.38	0.52667	.	0.426995	0.24078	N	0.041745	T	0.59238	0.2179	L	0.47716	1.5	0.09310	N	1	B;B	0.30193	0.005;0.272	B;B	0.25884	0.008;0.064	T	0.52185	-0.8609	10	0.36615	T	0.2	.	8.7876	0.34830	0.108:0.0:0.892:0.0	.	155;668	B7ZKY4;Q2M1P5	.;KIF7_HUMAN	I	668	ENSP00000377934:L668I	ENSP00000377934:L668I	L	-	1	0	KIF7	87989607	0.006000	0.16342	0.008000	0.14137	0.074000	0.17049	1.352000	0.34033	2.147000	0.66899	0.454000	0.30748	CTT			0.632	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347782.1		NM_198525	
FAM169B	283777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	98982942	98982942	+	Missense_Mutation	SNP	T	T	A	rs34036460		TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr15:98982942T>A	ENST00000558256.1	-	7	746	c.497A>T	c.(496-498)gAt>gTt	p.D166V	FAM169B_ENST00000332908.4_Missense_Mutation_p.D166V	NM_182562.2	NP_872368.2	Q8N8A8	F169B_HUMAN	family with sequence similarity 169, member B	166										large_intestine(3)|lung(3)|urinary_tract(1)	7						CTCTGGATCATCCTTTGTGTC	0.542																																					p.D166V													.	.			0			c.A497T												98.0	96.0	96.0					15																	98982942		2010	4167	6177	SO:0001583	missense	283777	exon7			GGATCATCCTTTG		CCDS45360.1	15q26.3	2008-08-08			ENSG00000185087	ENSG00000185087			26835	protein-coding gene	gene with protein product							Standard	NM_182562		Approved	FLJ39743, KIAA0888L	uc002buk.1	Q8N8A8		ENST00000558256.1:c.497A>T	15.37:g.98982942T>A	ENSP00000453554:p.Asp166Val		Somatic	191	0	0		WXS	Illumina HiSeq	.	143	0.30	43	NM_182562	0		0	B5MDL8	Missense_Mutation	SNP	ENST00000558256.1	37	CCDS45360.1	.	.	.	.	.	.	.	.	.	.	T	11.53	1.667261	0.29604	.	.	ENSG00000185087	ENST00000332908	T	0.53206	0.63	5.01	-3.58	0.04597	.	1.678910	0.03766	N	0.258934	T	0.25044	0.0608	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.13407	0.009	T	0.10847	-1.0612	10	0.30078	T	0.28	.	5.4503	0.16560	0.0:0.3625:0.2941:0.3434	.	166	Q8N8A8	F169B_HUMAN	V	166	ENSP00000332615:D166V	ENSP00000332615:D166V	D	-	2	0	FAM169B	96800465	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.111000	0.10807	-1.075000	0.03129	0.529000	0.55759	GAT			0.542	FAM169B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000415488.1		NM_182562	
RAB11FIP3	9727	mdanderson.org	37	16	560707	560707	+	Missense_Mutation	SNP	G	G	T	rs190687913		TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr16:560707G>T	ENST00000262305.4	+	9	1935	c.1547G>T	c.(1546-1548)tGc>tTc	p.C516F	RAB11FIP3_ENST00000450428.1_Missense_Mutation_p.C220F|RAB11FIP3_ENST00000457159.1_Missense_Mutation_p.C561F	NM_014700.3	NP_055515.1	O75154	RFIP3_HUMAN	RAB11 family interacting protein 3 (class II)	516	ARF-binding domain (ABD).				cytokinesis (GO:0000910)|endocytic recycling (GO:0032456)|vesicle-mediated transport (GO:0016192)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|endosome (GO:0005768)|intercellular bridge (GO:0045171)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	ADP-ribosylation factor binding (GO:0030306)|calcium ion binding (GO:0005509)|protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|kidney(3)|lung(5)|upper_aerodigestive_tract(1)	12		Hepatocellular(16;0.0218)				CTGAGAGCCTGCGAGATGGTC	0.597																																					p.C516F	Melanoma(160;2366 2595 4474 8099)												.	.			0			c.G1547T												74.0	65.0	68.0					16																	560707		2201	4297	6498	SO:0001583	missense	9727	exon9			GAGCCTGCGAGAT	AB014565	CCDS32351.1, CCDS45364.1	16p13.3	2013-01-10			ENSG00000090565	ENSG00000090565		"""EF-hand domain containing"""	17224	protein-coding gene	gene with protein product		608738				9734811, 11481332	Standard	NM_014700		Approved	KIAA0665, Rab11-FIP3, eferin	uc002chf.3	O75154	OTTHUMG00000047843	ENST00000262305.4:c.1547G>T	16.37:g.560707G>T	ENSP00000262305:p.Cys516Phe		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_014700	64	0.00	0	B0QYI8|B0QYT8|B1AHQ0|B4DEI7|B4DZR6|Q4VXV7|Q7Z5E9|Q9H155|Q9H1G0|Q9NUI0	Missense_Mutation	SNP	ENST00000262305.4	37	CCDS32351.1	.	.	.	.	.	.	.	.	.	.	G	16.00	2.998005	0.54147	.	.	ENSG00000090565	ENST00000262305;ENST00000457159;ENST00000434585;ENST00000450428;ENST00000448401	.	.	.	5.21	1.64	0.23874	.	.	.	.	.	T	0.24699	0.0599	N	0.22421	0.69	0.26183	N	0.979705	P;B;B	0.44090	0.826;0.091;0.315	B;B;B	0.43103	0.408;0.087;0.062	T	0.09930	-1.0652	8	0.56958	D	0.05	-2.0231	5.5428	0.17047	0.5282:0.0:0.4718:0.0	.	561;220;516	O75154-3;O75154-2;O75154	.;.;RFIP3_HUMAN	F	516;561;437;220;220	.	ENSP00000262305:C516F	C	+	2	0	RAB11FIP3	500708	1.000000	0.71417	0.113000	0.21522	0.920000	0.55202	4.915000	0.63355	0.669000	0.31146	0.655000	0.94253	TGC			0.597	RAB11FIP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000109066.4		NM_014700	
RHBDL1	9028	mdanderson.org	37	16	727545	727545	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr16:727545G>T	ENST00000219551.2	+	5	997	c.970G>T	c.(970-972)Gcc>Tcc	p.A324S	LA16c-313D11.9_ENST00000571933.1_RNA|STUB1_ENST00000565677.1_5'Flank|STUB1_ENST00000219548.4_5'Flank|RHBDL1_ENST00000352681.3_Missense_Mutation_p.A259S|LA16c-313D11.9_ENST00000567091.1_RNA			O75783	RHBL1_HUMAN	rhomboid, veinlet-like 1 (Drosophila)	324					signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(1)|lung(4)|urinary_tract(3)	9		Hepatocellular(780;0.0218)				GGCACACCTGGCCAACGTTGT	0.677																																					p.A324S													.	.			0			c.G970T												26.0	28.0	27.0					16																	727545		2190	4295	6485	SO:0001583	missense	9028	exon5			CACCTGGCCAACG	Y17108	CCDS61779.1	16p13.3	2008-02-05	2001-11-28	2003-04-11	ENSG00000103269	ENSG00000103269			10007	protein-coding gene	gene with protein product		603264	"""rhomboid (veinlet, Drosophila)-like"""	RHBDL		9662444	Standard	NM_001278720		Approved	RRP	uc002cis.1	O75783	OTTHUMG00000121141	ENST00000219551.2:c.970G>T	16.37:g.727545G>T	ENSP00000219551:p.Ala324Ser		Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	13	0.15	2	NM_003961	2	0.00	0	A2IDC0|A2IDC1|Q0VAX4|Q9NQ85	Missense_Mutation	SNP	ENST00000219551.2	37	CCDS10418.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.300142	0.81136	.	.	ENSG00000103269	ENST00000352681;ENST00000450775;ENST00000219551	T;T	0.13538	2.58;2.58	4.31	4.31	0.51392	Peptidase S54, rhomboid domain (1);	0.000000	0.85682	D	0.000000	T	0.29620	0.0739	L	0.45285	1.41	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.999	D;D;D	0.87578	0.998;0.992;0.972	T	0.02371	-1.1169	10	0.52906	T	0.07	-17.7129	15.3543	0.74415	0.0:0.0:1.0:0.0	.	259;324;259	B4DFK3;O75783;O75783-2	.;RHBL1_HUMAN;.	S	259;259;324	ENSP00000344206:A259S;ENSP00000219551:A324S	ENSP00000219551:A324S	A	+	1	0	RHBDL1	667546	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.129000	0.77225	1.958000	0.56883	0.561000	0.74099	GCC			0.677	RHBDL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000241619.1		NM_003961	
ZNF598	90850	mdanderson.org	37	16	2049697	2049697	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr16:2049697G>A	ENST00000563630.1	-	9	1930	c.1688C>T	c.(1687-1689)cCg>cTg	p.P563L	ZNF598_ENST00000562103.1_Missense_Mutation_p.P563L|AC005606.15_ENST00000567515.1_lincRNA|ZNF598_ENST00000431526.1_Missense_Mutation_p.P618L			Q86UK7	ZN598_HUMAN	zinc finger protein 598	618							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						AGGAGCTTCCGGGGCCTGCAA	0.652																																					p.P618L													.	.			0			c.C1853T												13.0	17.0	16.0					16																	2049697		1778	3971	5749	SO:0001583	missense	90850	exon11			GCTTCCGGGGCCT	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000563630.1:c.1688C>T	16.37:g.2049697G>A	ENSP00000455882:p.Pro563Leu		Somatic	14	0	0		WXS	Illumina HiSeq	Phase_I	24	0.08	2	NM_178167	40	0.03	1	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	ENST00000563630.1	37		.	.	.	.	.	.	.	.	.	.	.	2.699	-0.271357	0.05716	.	.	ENSG00000167962	ENST00000431526	T	0.18338	2.22	4.17	2.15	0.27550	.	0.445621	0.25971	N	0.027130	T	0.11067	0.0270	L	0.28740	0.885	0.40930	D	0.984382	B	0.12630	0.006	B	0.08055	0.003	T	0.16041	-1.0416	10	0.25751	T	0.34	-0.99	9.0219	0.36204	0.2573:0.0:0.7427:0.0	.	618	Q86UK7	ZN598_HUMAN	L	618	ENSP00000411409:P618L	ENSP00000411409:P618L	P	-	2	0	ZNF598	1989698	0.300000	0.24435	0.074000	0.20217	0.055000	0.15305	0.881000	0.28173	0.406000	0.25560	0.650000	0.86243	CCG			0.652	ZNF598-001	NOVEL	basic	protein_coding	protein_coding		OTTHUMT00000434439.1		NM_178167	
SRCAP	10847	hgsc.bcm.edu;bcgsc.ca	37	16	30735366	30735367	+	Frame_Shift_Ins	INS	-	-	T	rs201407582	byFrequency	TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr16:30735366_30735367insT	ENST00000262518.4	+	25	5006_5007	c.4621_4622insT	c.(4621-4623)gtgfs	p.V1541fs	SRCAP_ENST00000344771.4_Frame_Shift_Ins_p.V1383fs|SRCAP_ENST00000395059.2_Frame_Shift_Ins_p.V1479fs	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1541	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			GAACTCAACCGTGGCCCCAGCA	0.579																																					p.V1541fs													.	SRCAP	298		0			c.4621_4622insT																																									SO:0001589	frameshift_variant	10847	exon25			TCAACCGTGGCCC	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.4622dupT	16.37:g.30735367_30735367dupT	ENSP00000262518:p.Val1541fs		Somatic	120	0	0		WXS	Illumina HiSeq	.	142	0.31	44	NM_006662	102	0.00	0	B0JZA6|O15026|Q7Z744|Q9Y5L9	Frame_Shift_Ins	INS	ENST00000262518.4	37	CCDS10689.2																																																																																					0.579	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255523.1		NM_006662	
C16orf78	123970	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	49430428	49430428	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr16:49430428G>C	ENST00000299191.3	+	4	606	c.489G>C	c.(487-489)gaG>gaC	p.E163D		NM_144602.2	NP_653203.1	Q8WTQ4	CP078_HUMAN	chromosome 16 open reading frame 78	163						nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|upper_aerodigestive_tract(1)	22						TGTTACAGGAGGGTACCTTTA	0.488																																					p.E163D													.	.			0			c.G489C												100.0	89.0	93.0					16																	49430428		2199	4300	6499	SO:0001583	missense	123970	exon4			ACAGGAGGGTACC	BC021181	CCDS10738.1	16q12.1	2008-02-05			ENSG00000166152	ENSG00000166152			28479	protein-coding gene	gene with protein product						12477932	Standard	NM_144602		Approved	MGC33367	uc002efr.3	Q8WTQ4	OTTHUMG00000133149	ENST00000299191.3:c.489G>C	16.37:g.49430428G>C	ENSP00000299191:p.Glu163Asp		Somatic	136	0	0		WXS	Illumina HiSeq	.	191	0.24	45	NM_144602	0		0		Missense_Mutation	SNP	ENST00000299191.3	37	CCDS10738.1	.	.	.	.	.	.	.	.	.	.	G	0.001	-2.981487	0.00046	.	.	ENSG00000166152	ENST00000299191	T	0.48522	0.81	5.29	-10.6	0.00265	.	1.180330	0.06120	N	0.668755	T	0.17916	0.0430	N	0.05230	-0.09	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.58487	-0.7628	9	.	.	.	-15.9094	2.2374	0.04011	0.13:0.3721:0.261:0.2369	.	163	Q8WTQ4	CP078_HUMAN	D	163	ENSP00000299191:E163D	.	E	+	3	2	C16orf78	47987929	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-9.221000	0.00013	-8.479000	0.00000	-3.672000	0.00025	GAG			0.488	C16orf78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256846.1		NM_144602	
RP11-252A24.2	0	broad.mit.edu	37	16	74372644	74372644	+	RNA	SNP	A	A	G			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr16:74372644A>G	ENST00000429810.2	-	0	1552																											TACCCTTGTCAGGGGGAACAA	0.443																																					.													.	.			0			.																																											0	.			CTTGTCAGGGGGA																													16.37:g.74372644A>G			Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	87	0.07	6	.	9	0.00	0		RNA	SNP	ENST00000429810.2	37																																																																																						0.443	RP11-252A24.2-003	KNOWN	basic	retained_intron	pseudogene		OTTHUMT00000434683.1			
TAF1C	9013	mdanderson.org	37	16	84212612	84212612	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr16:84212612G>T	ENST00000567759.1	-	14	2727	c.2545C>A	c.(2545-2547)Cag>Aag	p.Q849K	TAF1C_ENST00000566732.1_Missense_Mutation_p.Q823K|TAF1C_ENST00000541676.1_Missense_Mutation_p.Q756K|TAF1C_ENST00000341690.6_Missense_Mutation_p.Q755K|TAF1C_ENST00000378541.4_Missense_Mutation_p.Q849K|TAF1C_ENST00000570117.1_Missense_Mutation_p.Q517K	NM_005679.3	NP_005670	Q15572	TAF1C_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa	849					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	26						GTGTGCTGCTGGGAGCGAGTG	0.657																																					p.Q849K													.	.			0			c.C2545A												62.0	62.0	62.0					16																	84212612		2200	4300	6500	SO:0001583	missense	9013	exon14			GCTGCTGGGAGCG	L39059	CCDS32496.1, CCDS45535.1, CCDS58488.1, CCDS58489.1	16q24	2008-02-05	2002-08-29			ENSG00000103168			11534	protein-coding gene	gene with protein product		604905	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kD"""			7801123	Standard	NM_005679		Approved	TAFI110, TAFI95, SL1, MGC:39976	uc010vnx.2	Q15572		ENST00000567759.1:c.2545C>A	16.37:g.84212612G>T	ENSP00000455265:p.Gln849Lys		Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	20	0.15	3	NM_005679	194	0.00	0	B7Z5K5|B7Z5S4|B7Z908|B7Z9L7|Q59F67|Q8N6V3	Missense_Mutation	SNP	ENST00000567759.1	37	CCDS32496.1	.	.	.	.	.	.	.	.	.	.	G	7.933	0.741185	0.15642	.	.	ENSG00000103168	ENST00000378541;ENST00000541676;ENST00000341690;ENST00000544090	T;T;T	0.03889	3.86;3.77;3.77	4.62	-4.28	0.03732	.	1.111280	0.06983	N	0.820270	T	0.02380	0.0073	N	0.08118	0	0.09310	N	1	B;B;B;B	0.22146	0.038;0.065;0.038;0.038	B;B;B;B	0.16289	0.013;0.015;0.013;0.013	T	0.47169	-0.9138	10	0.38643	T	0.18	-5.3181	6.263	0.20912	0.2067:0.0:0.4478:0.3455	.	823;372;849;755	Q15572-6;F5H0H4;Q15572;Q15572-2	.;.;TAF1C_HUMAN;.	K	849;756;755;372	ENSP00000367802:Q849K;ENSP00000437900:Q756K;ENSP00000345305:Q755K	ENSP00000345305:Q755K	Q	-	1	0	TAF1C	82770113	0.000000	0.05858	0.128000	0.21923	0.047000	0.14425	-0.033000	0.12246	-0.594000	0.05836	-0.768000	0.03414	CAG			0.657	TAF1C-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000433045.2		NM_139353	
CDC27	996	mdanderson.org	37	17	45234397	45234397	+	Missense_Mutation	SNP	G	G	A	rs7350908		TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr17:45234397G>A	ENST00000066544.3	-	7	817	c.724C>T	c.(724-726)Cct>Tct	p.P242S	CDC27_ENST00000527547.1_Missense_Mutation_p.P242S|CDC27_ENST00000446365.2_Missense_Mutation_p.P181S|CDC27_ENST00000528748.1_5'Flank|CDC27_ENST00000531206.1_Missense_Mutation_p.P242S	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	242					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						ACAGTATCAGGTGAAATTACA	0.363																																					p.P242S													.	.			0			c.C724T												44.0	48.0	47.0					17																	45234397		2191	4293	6484	SO:0001583	missense	996	exon7			TATCAGGTGAAAT	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.724C>T	17.37:g.45234397G>A	ENSP00000066544:p.Pro242Ser		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	65	0.09	6	NM_001114091	46	0.00	0	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	G	14.01	2.407694	0.42715	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.67523	-0.26;-0.27;0.01;-0.27;0.49	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.51517	0.1679	L	0.29908	0.895	0.80722	D	1	B;B;B;B	0.26195	0.0;0.014;0.0;0.144	B;B;B;B	0.20955	0.001;0.008;0.001;0.032	T	0.50004	-0.8878	10	0.06099	T	0.92	-16.7932	16.7505	0.85484	0.0:0.0:1.0:0.0	rs7350908;rs52796638;rs7350908	181;242;242;242	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	S	242;242;181;242;242	ENSP00000066544:P242S;ENSP00000434614:P242S;ENSP00000392802:P181S;ENSP00000437339:P242S;ENSP00000432105:P242S	ENSP00000066544:P242S	P	-	1	0	CDC27	42589396	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.436000	0.80404	2.555000	0.86185	0.460000	0.39030	CCT			0.363	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000389742.2			
SAMD14	201191	broad.mit.edu;mdanderson.org	37	17	48190406	48190406	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr17:48190406C>A	ENST00000330175.4	-	10	1422	c.1105G>T	c.(1105-1107)Ggg>Tgg	p.G369W	SAMD14_ENST00000503734.1_5'Flank|SAMD14_ENST00000503131.1_Missense_Mutation_p.G397W	NM_001257359.1	NP_001244288.1	Q8IZD0	SAM14_HUMAN	sterile alpha motif domain containing 14	369	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.									breast(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	15						TTGCTGAGCCCCAGGCTCTGG	0.642																																					p.G397W													.	SAMD14	36		0			c.G1189T												40.0	37.0	38.0					17																	48190406		2203	4300	6503	SO:0001583	missense	201191	exon11			TGAGCCCCAGGCT		CCDS11560.1, CCDS58562.1	17q21.33	2013-01-10				ENSG00000167100		"""Sterile alpha motif (SAM) domain containing"""	27312	protein-coding gene	gene with protein product						8619474	Standard	NM_174920		Approved	FLJ36890	uc002iqg.4	Q8IZD0		ENST00000330175.4:c.1105G>T	17.37:g.48190406C>A	ENSP00000329144:p.Gly369Trp		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_174920	57	0.00	0	A5D8V1|Q8N2X0	Missense_Mutation	SNP	ENST00000330175.4	37	CCDS58562.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.283091	0.80803	.	.	ENSG00000167100	ENST00000330175;ENST00000285206;ENST00000503131	D;D;D	0.92249	-3.0;-3.0;-3.0	5.11	5.11	0.69529	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.64402	D	0.000001	D	0.97009	0.9023	M	0.93420	3.415	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97974	1.0345	10	0.87932	D	0	-24.3145	15.4389	0.75168	0.0:1.0:0.0:0.0	.	369;397	Q8IZD0;Q8IZD0-2	SAM14_HUMAN;.	W	369;381;397	ENSP00000329144:G369W;ENSP00000285206:G381W;ENSP00000424474:G397W	ENSP00000285206:G381W	G	-	1	0	SAMD14	45545405	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.625000	0.67770	2.382000	0.81193	0.462000	0.41574	GGG			0.642	SAMD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000366661.1		NM_174920	
SALL3	27164	mdanderson.org	37	18	76753052	76753052	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr18:76753052C>T	ENST00000537592.2	+	2	1061	c.1061C>T	c.(1060-1062)gCg>gTg	p.A354V	SALL3_ENST00000536229.3_Missense_Mutation_p.A221V|SALL3_ENST00000575389.2_Missense_Mutation_p.A354V	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	354					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CTGCTGGGTGCGGCGCCCGGC	0.751																																					p.A354V													SALL3,NS,carcinoma,-1,1	SALL3	-1	1	0			c.C1061T												8.0	10.0	9.0					18																	76753052		2140	4216	6356	SO:0001583	missense	27164	exon2			TGGGTGCGGCGCC	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1061C>T	18.37:g.76753052C>T	ENSP00000441823:p.Ala354Val		Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	12	0.17	2	NM_171999	0		0	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	CCDS12013.1	.	.	.	.	.	.	.	.	.	.	C	15.03	2.712415	0.48517	.	.	ENSG00000256463	ENST00000537592;ENST00000536229	T	0.09163	3.01	4.37	4.37	0.52481	.	0.274240	0.25671	N	0.029076	T	0.04227	0.0117	N	0.02916	-0.46	0.28697	N	0.904262	P	0.37158	0.585	B	0.25140	0.058	T	0.29274	-1.0017	10	0.20519	T	0.43	-6.7884	17.1219	0.86704	0.0:1.0:0.0:0.0	.	354	Q9BXA9	SALL3_HUMAN	V	354	ENSP00000441823:A354V	ENSP00000299466:A354V	A	+	2	0	SALL3	74854040	0.982000	0.34865	0.003000	0.11579	0.005000	0.04900	5.445000	0.66594	2.269000	0.75478	0.460000	0.39030	GCG			0.751	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256397.1		NM_171999	
AZU1	566	hgsc.bcm.edu;broad.mit.edu	37	19	831856	831857	+	In_Frame_Ins	INS	-	-	CCGGGA	rs558823414		TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr19:831856_831857insCCGGGA	ENST00000233997.2	+	5	756_757	c.735_736insCCGGGA	c.(736-738)ccg>CCGGGAccg	p.246_246P>PGP		NM_001700.3	NP_001691.1	P20160	CAP7_HUMAN	azurocidin 1	246					cellular extravasation (GO:0045123)|defense response to Gram-negative bacterium (GO:0050829)|glial cell migration (GO:0008347)|induction of positive chemotaxis (GO:0050930)|inflammatory response (GO:0006954)|macrophage chemotaxis (GO:0048246)|microglial cell activation (GO:0001774)|monocyte activation (GO:0042117)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell adhesion (GO:0045785)|positive regulation of fractalkine biosynthetic process (GO:0050754)|positive regulation of interleukin-1 beta biosynthetic process (GO:0050725)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of phagocytosis (GO:0050766)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of vascular permeability (GO:0043114)	azurophil granule (GO:0042582)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)|toxic substance binding (GO:0015643)			NS(1)|endometrium(1)|kidney(1)|lung(4)|pancreas(1)|upper_aerodigestive_tract(2)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTCTCAACAACCCGGGACCGGG	0.708																																					p.N245delinsNPG													.	AZU1	31		0			c.735_736insCCGGGA																																									SO:0001652	inframe_insertion	566	exon5			CAACAACCCGGGA	X58794	CCDS12044.1	19p13.3	2012-03-30	2008-08-01		ENSG00000172232	ENSG00000172232			913	protein-coding gene	gene with protein product	"""cationic antimicrobial protein 37"", ""heparin-binding protein"", ""neutrophil azurocidin"""	162815				1919011	Standard	NM_001700		Approved	AZU, CAP37, AZAMP, HBP, NAZC, HUMAZUR	uc002lpz.1	P20160		ENST00000233997.2:c.736_741dupCCGGGA	19.37:g.831857_831862dupCCGGGA	Exception_encountered		Somatic	156	0	0		WXS	Illumina HiSeq	.	125	0.30	38	NM_001700	2	0.00	0	P80014|Q52LG4|Q9UCM1|Q9UCT5	In_Frame_Ins	INS	ENST00000233997.2	37	CCDS12044.1																																																																																					0.708	AZU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000457472.2		NM_001700	
ASNA1	439	ucsc.edu;bcgsc.ca	37	19	12858375	12858375	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr19:12858375G>A	ENST00000591090.1	+	7	986	c.884G>A	c.(883-885)cGt>cAt	p.R295H	ASNA1_ENST00000357332.3_Missense_Mutation_p.R295H					arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)											endometrium(1)|lung(6)|ovary(3)	10						TGTGAGGCCCGTCACAAGATC	0.552																																					p.R295H													.	ASNA1	23		0			c.G884A												63.0	53.0	56.0					19																	12858375		2203	4300	6503	SO:0001583	missense	439	exon6			AGGCCCGTCACAA	U60276	CCDS32920.1	19p13.13	2010-08-05	2001-12-04			ENSG00000198356			752	protein-coding gene	gene with protein product	"""golgi to ER traffic 3 homolog (S. cerevisiae)"", ""transmembrane domain recognition complex, 40kDa"""	601913	"""arsA (bacterial) arsenite transporter, ATP-binding, homolog 1"""			8884272, 17382883	Standard	NM_004317		Approved	ARSA-I, GET3, TRC40	uc002muv.3	O43681		ENST00000591090.1:c.884G>A	19.37:g.12858375G>A	ENSP00000466379:p.Arg295His		Somatic	117	0.0170940171	2		WXS	Illumina HiSeq		80	0.41	33	NM_004317	237	0.44	105		Missense_Mutation	SNP	ENST00000591090.1	37	CCDS32920.1	.	.	.	.	.	.	.	.	.	.	G	32	5.138293	0.94560	.	.	ENSG00000198356	ENST00000357332	T	0.51325	0.71	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.77909	0.4201	H	0.94462	3.54	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	D	0.84946	0.0868	10	0.87932	D	0	-34.6891	17.2701	0.87098	0.0:0.0:1.0:0.0	.	277;295	E7EVN0;O43681	.;ASNA_HUMAN	H	295	ENSP00000349887:R295H	ENSP00000349887:R295H	R	+	2	0	ASNA1	12719375	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.111000	0.94308	2.363000	0.80096	0.655000	0.94253	CGT			0.552	ASNA1-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450921.1		NM_004317	
F2RL3	9002	mdanderson.org	37	19	17004138	17004138	+	IGR	SNP	C	C	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr19:17004138C>T	ENST00000248076.3	+	0	3473				CPAMD8_ENST00000443236.1_Silent_p.G1860G|CPAMD8_ENST00000597335.1_5'Flank	NM_003950.2	NP_003941.2	Q96RI0	PAR4_HUMAN	coagulation factor II (thrombin) receptor-like 3						blood coagulation (GO:0007596)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thrombin receptor activity (GO:0015057)			cervix(1)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	7						GAGGCCGAGGCCCGGCTGTGA	0.632																																					p.G1860G													.	.			0			c.G5580A												10.0	11.0	11.0					19																	17004138		1877	4041	5918	SO:0001628	intergenic_variant	27151	exon42			CCGAGGCCCGGCT	AF055917	CCDS12350.1	19p12	2012-08-08						"""GPCR / Class A : Protease activated receptors"""	3540	protein-coding gene	gene with protein product	"""proteinase-activated receptor-4"""	602779				9618465	Standard	XM_005260139		Approved	PAR4	uc002nfa.3	Q96RI0			19.37:g.17004138C>T			Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	26	0.12	3	NM_015692	1088	0.00	0	O76067|Q6DK42	Silent	SNP	ENST00000248076.3	37	CCDS12350.1	.	.	.	.	.	.	.	.	.	.	C	1.478	-0.558052	0.03967	.	.	ENSG00000160111	ENST00000443236	.	.	.	1.81	-3.63	0.04529	.	.	.	.	.	T	0.23094	0.0558	.	.	.	0.19300	N	0.999971	.	.	.	.	.	.	T	0.21827	-1.0234	5	0.32370	T	0.25	.	3.8439	0.08926	0.1804:0.278:0.0:0.5416	.	.	.	.	D	1871	.	ENSP00000402505:G1871D	G	-	2	0	CPAMD8	16865138	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.398000	0.07259	-1.576000	0.01652	-0.701000	0.03672	GGC			0.632	F2RL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462875.1			
RHPN2	85415	mdanderson.org	37	19	33517507	33517507	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr19:33517507C>T	ENST00000254260.3	-	3	252	c.217G>A	c.(217-219)Gtg>Atg	p.V73M	RHPN2_ENST00000400226.4_De_novo_Start_OutOfFrame	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	73					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)		p.V73M(2)		NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					TCCAGCCGCACTTGCTCCCGC	0.552																																					p.V73M													RHPN2,face,carcinoma,0,2	RHPN2	0	2	2	Substitution - Missense(2)	NS(1)|skin(1)	c.G217A												84.0	83.0	83.0					19																	33517507		2203	4300	6503	SO:0001583	missense	85415	exon3			GCCGCACTTGCTC	AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.217G>A	19.37:g.33517507C>T	ENSP00000254260:p.Val73Met		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	11	0.27	3	NM_033103	24	0.00	0	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Missense_Mutation	SNP	ENST00000254260.3	37	CCDS12427.1	.	.	.	.	.	.	.	.	.	.	C	18.08	3.542997	0.65198	.	.	ENSG00000131941	ENST00000254260	T	0.39787	1.06	3.88	3.88	0.44766	.	0.000000	0.85682	D	0.000000	T	0.64853	0.2636	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.71984	-0.4427	10	0.87932	D	0	11.9954	16.025	0.80536	0.0:1.0:0.0:0.0	.	73	Q8IUC4	RHPN2_HUMAN	M	73	ENSP00000254260:V73M	ENSP00000254260:V73M	V	-	1	0	RHPN2	38209347	1.000000	0.71417	1.000000	0.80357	0.343000	0.28985	7.267000	0.78462	2.167000	0.68274	0.557000	0.71058	GTG			0.552	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450828.2		NM_033103	
MED29	55588	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	39880019	39880019	+	5'Flank	SNP	G	G	A			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr19:39880019G>A	ENST00000599213.2	+	0	0				PAF1_ENST00000595564.1_Nonsense_Mutation_p.Q112*|PAF1_ENST00000221265.3_Nonsense_Mutation_p.Q122*|MED29_ENST00000594368.1_5'Flank|PAF1_ENST00000221266.7_Nonsense_Mutation_p.Q112*|MED29_ENST00000315588.5_5'Flank			Q9NX70	MED29_HUMAN	mediator complex subunit 29						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	mediator complex (GO:0016592)|nucleus (GO:0005634)				lung(2)|ovary(1)|pancreas(1)	4	all_cancers(60;7.82e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.88e-06)|Ovarian(47;0.0512)		Epithelial(26;1.04e-26)|all cancers(26;7.68e-24)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			GCGTGCTGCTGGGATCTGGGG	0.552																																					p.Q122X													.	.			0			c.C364T												81.0	76.0	77.0					19																	39880019		2203	4300	6503	SO:0001631	upstream_gene_variant	54623	exon6			GCTGCTGGGATCT	AL137304, AY729650	CCDS33021.1	19q13.2	2007-07-30	2007-07-30	2007-07-30		ENSG00000063322			23074	protein-coding gene	gene with protein product		612914	"""intersex-like (Drosophila)"""	IXL		15555573	Standard	NM_017592		Approved	DKFZp434H247	uc010xux.3	Q9NX70			19.37:g.39880019G>A	Exception_encountered		Somatic	128	0	0		WXS	Illumina HiSeq	.	80	0.38	30	NM_019088	136	0.04	5	B4DNQ6|M0R2E4|Q5XX09|Q9NTF4	Nonsense_Mutation	SNP	ENST00000599213.2	37		.	.	.	.	.	.	.	.	.	.	g	37	6.312925	0.97467	.	.	ENSG00000006712	ENST00000221265;ENST00000221266;ENST00000416728	.	.	.	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-26.6196	16.2011	0.82078	0.0:0.0:1.0:0.0	.	.	.	.	X	122;112;69	.	ENSP00000221265:Q122X	Q	-	1	0	PAF1	44571859	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	8.914000	0.92735	2.764000	0.94973	0.558000	0.71614	CAG			0.552	MED29-011	KNOWN	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000470870.1		XM_290829	
NKPD1	284353	bcgsc.ca	37	19	45655550	45655550	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr19:45655550G>T	ENST00000438936.2	-	3	1690	c.1479C>A	c.(1477-1479)gaC>gaA	p.D493E	NKPD1_ENST00000589776.1_Missense_Mutation_p.D493E|AC005757.7_ENST00000589594.1_lincRNA|NKPD1_ENST00000317951.4_Missense_Mutation_p.D715E|NKPD1_ENST00000429338.1_Intron			Q17RQ9	NKPD1_HUMAN	NTPase, KAP family P-loop domain containing 1	493						integral component of membrane (GO:0016021)				endometrium(1)|lung(4)|prostate(2)|urinary_tract(1)	8		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00863)|GBM - Glioblastoma multiforme(486;0.231)		CGGGGTCGCCGTCCAGGTCGA	0.697																																					p.D715E													.	NKPD1	46		0			c.C2145A												13.0	16.0	15.0					19																	45655550		2020	4150	6170	SO:0001583	missense	284353	exon4			GTCGCCGTCCAGG	AK090919		19q13.32	2012-07-02		2012-07-02	ENSG00000179846	ENSG00000179846			24739	protein-coding gene	gene with protein product						14702039	Standard	NM_198478		Approved	FLJ33600	uc010xxi.2	Q17RQ9	OTTHUMG00000160521	ENST00000438936.2:c.1479C>A	19.37:g.45655550G>T	ENSP00000401739:p.Asp493Glu		Somatic	79	0	0		WXS	Illumina HiSeq	Phase_1	67	0.06	4	NM_198478	0		0	B7ZLG6|D6RH15|Q8N2A2	Missense_Mutation	SNP	ENST00000438936.2	37		.	.	.	.	.	.	.	.	.	.	G	18.51	3.639882	0.67244	.	.	ENSG00000179846	ENST00000317951;ENST00000438936	D;D	0.84730	-1.59;-1.89	5.43	-0.436	0.12275	.	0.000000	0.42172	U	0.000750	D	0.87406	0.6169	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.83131	-0.0113	10	0.87932	D	0	-9.2461	4.2559	0.10717	0.4263:0.0:0.4205:0.1533	.	493	Q17RQ9	NKPD1_HUMAN	E	715;493	ENSP00000321976:D715E;ENSP00000401739:D493E	ENSP00000321976:D715E	D	-	3	2	NKPD1	50347390	0.987000	0.35691	0.987000	0.45799	0.980000	0.70556	0.109000	0.15417	-0.212000	0.10109	0.561000	0.74099	GAC			0.697	NKPD1-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000360950.2		NM_198478	
CCDC155	147872	mdanderson.org	37	19	49912498	49912498	+	Silent	SNP	G	G	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr19:49912498G>T	ENST00000447857.3	+	14	1309	c.1104G>T	c.(1102-1104)ctG>ctT	p.L368L		NM_144688.4	NP_653289.3	Q8N6L0	KASH5_HUMAN	coiled-coil domain containing 155	368						chromosome, telomeric region (GO:0000781)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.L368L(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(10)|ovary(1)|stomach(1)	22						GGACCGAGCTGCTACCCCCAT	0.612																																					p.L368L													CCDC155,rectum,carcinoma,0,1	CCDC155	0	1	1	Substitution - coding silent(1)	large_intestine(1)	c.G1104T												54.0	59.0	57.0					19																	49912498		2008	4175	6183	SO:0001819	synonymous_variant	147872	exon14			CGAGCTGCTACCC		CCDS46140.1	19q13.33	2014-01-21			ENSG00000161609	ENSG00000161609			26520	protein-coding gene	gene with protein product							Standard	NM_144688		Approved	FLJ32658, KASH5	uc002pnm.2	Q8N6L0	OTTHUMG00000183170	ENST00000447857.3:c.1104G>T	19.37:g.49912498G>T			Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_144688	0		0	Q96MC3	Silent	SNP	ENST00000447857.3	37	CCDS46140.1																																																																																					0.612	CCDC155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465436.2		NM_144688	
ZNF525	170958	broad.mit.edu	37	19	53879109	53879109	+	Silent	SNP	G	G	A			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr19:53879109G>A	ENST00000475179.1	+	3	216	c.102G>A	c.(100-102)agG>agA	p.R34R	ZNF525_ENST00000474037.1_Silent_p.R34R|ZNF525_ENST00000467003.1_5'UTR|ZNF525_ENST00000593918.1_Silent_p.R34R|ZNF525_ENST00000491101.1_Silent_p.R34R			Q8N782	ZN525_HUMAN	zinc finger protein 525	0					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R34R(6)		endometrium(3)|kidney(3)|lung(3)	9						CTCTATACAGGGACGTGATGC	0.473																																					.													.	ZNF525	35		6	Substitution - coding silent(6)	kidney(6)	.																																									SO:0001819	synonymous_variant	170958	.			ATACAGGGACGTG	AB075859		19q13.42	2013-01-16			ENSG00000203326	ENSG00000203326		"""Zinc fingers, C2H2-type"", ""-"""	29423	protein-coding gene	gene with protein product						11853319	Standard	NR_003699		Approved	KIAA1979	uc010eqn.3	Q8N782	OTTHUMG00000158277	ENST00000475179.1:c.102G>A	19.37:g.53879109G>A			Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	61	0.10	6	.	5	0.00	0	Q8TF23	Silent	SNP	ENST00000475179.1	37																																																																																						0.473	ZNF525-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000350553.1		NR_003699	
NBAS	51594	broad.mit.edu	37	2	15378674	15378674	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr2:15378674G>T	ENST00000281513.5	-	45	5886	c.5861C>A	c.(5860-5862)aCt>aAt	p.T1954N	NBAS_ENST00000441750.1_Missense_Mutation_p.T1834N	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	1954					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						ATGATTCAAAGTATCTGCATA	0.403																																					p.T1954N													.	NBAS	246		0			c.C5861A												119.0	120.0	120.0					2																	15378674		2203	4300	6503	SO:0001583	missense	51594	exon45			TTCAAAGTATCTG	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.5861C>A	2.37:g.15378674G>T	ENSP00000281513:p.Thr1954Asn		Somatic	190	0	0		WXS	Illumina HiSeq	Phase_I	148	0.03	4	NM_015909	120	0.00	0	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	ENST00000281513.5	37	CCDS1685.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.43|16.43	3.122145|3.122145	0.56613|0.56613	.|.	.|.	ENSG00000151779|ENSG00000151779	ENST00000442506|ENST00000441750;ENST00000281513;ENST00000417461	.|T;T;T	.|0.46451	.|2.92;3.1;0.87	5.97|5.97	3.19|3.19	0.36642|0.36642	.|.	.|0.760060	.|0.13372	.|N	.|0.392837	T|T	0.46541|0.46541	0.1398|0.1398	L|L	0.36672|0.36672	1.1|1.1	0.09310|0.09310	N|N	1|1	.|D;B	.|0.63880	.|0.993;0.357	.|P;B	.|0.55112	.|0.769;0.126	T|T	0.32188|0.32188	-0.9916|-0.9916	5|10	.|0.87932	.|D	.|0	.|.	11.329|11.329	0.49465|0.49465	0.198:0.0:0.802:0.0|0.198:0.0:0.802:0.0	.|.	.|1834;1954	.|A2RRP1-2;A2RRP1	.|.;NBAS_HUMAN	I|N	1002|1834;1954;46	.|ENSP00000413201:T1834N;ENSP00000281513:T1954N;ENSP00000392421:T46N	.|ENSP00000281513:T1954N	L|T	-|-	1|2	0|0	NBAS|NBAS	15296125|15296125	0.252000|0.252000	0.23972|0.23972	0.001000|0.001000	0.08648|0.08648	0.819000|0.819000	0.46315|0.46315	3.139000|3.139000	0.50577|0.50577	0.857000|0.857000	0.35407|0.35407	0.655000|0.655000	0.94253|0.94253	CTT|ACT			0.403	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000241638.1		NM_015909	
AAK1	22848	ucsc.edu;bcgsc.ca	37	2	69746110	69746110	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr2:69746110C>G	ENST00000409085.4	-	12	1849	c.1473G>C	c.(1471-1473)caG>caC	p.Q491H	RN7SL604P_ENST00000492589.2_RNA|AAK1_ENST00000406297.3_Missense_Mutation_p.Q491H|AAK1_ENST00000409068.1_Missense_Mutation_p.Q491H|SNORA36C_ENST00000384289.1_RNA	NM_014911.3	NP_055726	Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1	491	Gln-rich.				endocytosis (GO:0006897)|positive regulation of Notch signaling pathway (GO:0045747)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of clathrin-mediated endocytosis (GO:2000369)|regulation of protein localization (GO:0032880)	cell leading edge (GO:0031252)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extrinsic component of plasma membrane (GO:0019897)|terminal bouton (GO:0043195)	AP-2 adaptor complex binding (GO:0035612)|ATP binding (GO:0005524)|Notch binding (GO:0005112)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)	17						CCTGCTGCTGCTGGTAAAACG	0.582																																					p.Q491H													.	AAK1	121		0			c.G1473C												25.0	28.0	27.0					2																	69746110		1856	3489	5345	SO:0001583	missense	22848	exon12			CTGCTGCTGGTAA	AB028971	CCDS1893.2	2p13.3	2012-07-10			ENSG00000115977	ENSG00000115977			19679	protein-coding gene	gene with protein product						11877461, 12471243	Standard	NM_014911		Approved	KIAA1048, DKFZp686K16132	uc002sfp.2	Q2M2I8	OTTHUMG00000129648	ENST00000409085.4:c.1473G>C	2.37:g.69746110C>G	ENSP00000386456:p.Gln491His		Somatic	61	0	0		WXS	Illumina HiSeq		38	0.11	4	NM_014911	8	0.00	0	Q4ZFZ3|Q53RX6|Q9UPV4	Missense_Mutation	SNP	ENST00000409085.4	37	CCDS1893.2	.	.	.	.	.	.	.	.	.	.	C	14.29	2.490986	0.44249	.	.	ENSG00000115977	ENST00000409068;ENST00000409085;ENST00000406297	T;T;T	0.33438	1.41;1.41;1.41	4.99	4.09	0.47781	.	3.201010	0.00397	N	0.000059	T	0.32971	0.0847	N	0.24115	0.695	0.34744	D	0.731065	P;P;P	0.37276	0.454;0.589;0.454	B;B;B	0.44224	0.259;0.444;0.121	T	0.35325	-0.9793	10	0.66056	D	0.02	2.8076	9.4153	0.38517	0.0:0.9016:0.0:0.0984	.	491;491;491	B7ZLC4;Q2M2I8-2;Q2M2I8	.;.;AAK1_HUMAN	H	491	ENSP00000386342:Q491H;ENSP00000386456:Q491H;ENSP00000385181:Q491H	ENSP00000385181:Q491H	Q	-	3	2	AAK1	69599614	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.738000	0.55067	2.585000	0.87301	0.655000	0.94253	CAG			0.582	AAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251847.4		NM_014911	
ANKRD36BP2	645784	broad.mit.edu	37	2	89102234	89102234	+	RNA	SNP	C	C	G			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr2:89102234C>G	ENST00000393525.3	+	0	2708									ankyrin repeat domain 36B pseudogene 2																		CATCAGGTAGCTGTGAGACAG	0.313																																					.													.	.			0			.																																											0	.			AGGTAGCTGTGAG			2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89102234C>G			Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	25	0.20	5	.	0		0		RNA	SNP	ENST00000393525.3	37																																																																																						0.313	ANKRD36BP2-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000323523.1			
ANKRD36BP2	645784	broad.mit.edu	37	2	89104503	89104504	+	RNA	INS	-	-	C	rs149625899|rs67367050	byFrequency	TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr2:89104503_89104504insC	ENST00000393525.3	+	0	4868									ankyrin repeat domain 36B pseudogene 2																		gtagatttttttcagattttgg	0.307													-|-|C|insertion	512	0.102236	0.1067	0.0965	5008	,	,		29304	0.0694		0.1064	False		,,,				2504	0.1299				.													.	.			0			.																																											0	.			ATTTTTTTCAGAT			2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89104503_89104504insC			Somatic	16	0.0625	1		WXS	Illumina HiSeq	Phase_I	8	0.38	3	.	0		0		RNA	INS	ENST00000393525.3	37																																																																																						0.307	ANKRD36BP2-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000323523.1			
MIR1302-3	100302128	broad.mit.edu	37	2	114340538	114340538	+	RNA	SNP	A	A	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr2:114340538A>T	ENST00000408128.1	-	0	135					NR_031632.1				microRNA 1302-3																		ataaaatataaaatgcttaat	0.398																																					.													.	.			0			.												34.0	34.0	34.0					2																	114340538		1560	3540	5100			0	.			AATATAAAATGCT			2q13	2011-09-12		2008-12-18	ENSG00000221055	ENSG00000221055		"""ncRNAs / Micro RNAs"""	35295	non-coding RNA	RNA, micro				MIRN1302-3			Standard	NR_031632		Approved	hsa-mir-1302-3					2.37:g.114340538A>T			Somatic	473	0	0		WXS	Illumina HiSeq	Phase_I	370	0.05	17	.	0		0		RNA	SNP	ENST00000408128.1	37																																																																																						0.398	MIR1302-3-201	KNOWN	basic	miRNA	miRNA				NR_031632	
STRADB	55437	hgsc.bcm.edu;bcgsc.ca	37	2	202344880	202344880	+	Silent	SNP	C	C	T	rs568127362	byFrequency	TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr2:202344880C>T	ENST00000194530.3	+	12	1604	c.1239C>T	c.(1237-1239)gaC>gaT	p.D413D	STRADB_ENST00000392249.2_3'UTR	NM_001206864.1|NM_018571.5	NP_001193793.1|NP_061041.2	Q9C0K7	STRAB_HUMAN	STE20-related kinase adaptor beta	413					activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|cell morphogenesis (GO:0000902)|insulin receptor signaling pathway (GO:0008286)|JNK cascade (GO:0007254)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			breast(1)|large_intestine(2)|lung(5)|prostate(1)|skin(3)|stomach(1)	13						ATGAAAAAGACTCATACTGGG	0.393													C|||	61	0.0121805	0.0144	0.0144	5008	,	,		17652	0.004		0.0169	False		,,,				2504	0.0112				p.D413D													.	.			0			c.C1239T												139.0	139.0	139.0					2																	202344880		2203	4300	6503	SO:0001819	synonymous_variant	55437	exon12			AAAAGACTCATAC	AB038950	CCDS2348.1, CCDS56161.1	2q33.1	2010-09-30	2008-09-15	2008-09-15	ENSG00000082146	ENSG00000082146			13205	protein-coding gene	gene with protein product		607333	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 2"""	ALS2CR2		11161814, 14511394	Standard	NM_018571		Approved	CALS-21, PAPK, ILPIPA, ILPIP	uc002uyd.4	Q9C0K7	OTTHUMG00000132831	ENST00000194530.3:c.1239C>T	2.37:g.202344880C>T			Somatic	130	0	0		WXS	Illumina HiSeq	.	120	0.07	8	NM_018571	45	0.00	0	Q5BKY7|Q9P1L0	Silent	SNP	ENST00000194530.3	37	CCDS2348.1	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.510128	0.00984	.	.	ENSG00000082146	ENST00000415688	.	.	.	5.32	-3.37	0.04898	.	.	.	.	.	T	0.22044	0.0531	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.31420	-0.9944	4	.	.	.	.	5.6468	0.17594	0.2111:0.3213:0.0:0.4677	.	.	.	.	F	84	.	.	L	+	1	0	STRADB	202053125	0.000000	0.05858	0.000000	0.03702	0.191000	0.23601	-0.169000	0.09911	-0.631000	0.05560	-0.142000	0.14014	CTC			0.393	STRADB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256297.1		NM_018571	
NGEF	25791	mdanderson.org	37	2	233746912	233746912	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr2:233746912G>T	ENST00000264051.3	-	13	2099	c.1821C>A	c.(1819-1821)ttC>ttA	p.F607L	NGEF_ENST00000539537.1_Missense_Mutation_p.F330L|NGEF_ENST00000373552.4_Missense_Mutation_p.F515L	NM_019850.2	NP_062824.2	Q8N5V2	NGEF_HUMAN	neuronal guanine nucleotide exchange factor	607					apoptotic signaling pathway (GO:0097190)|ephrin receptor signaling pathway (GO:0048013)|negative regulation of dendritic spine morphogenesis (GO:0061002)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(4)|endometrium(8)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|skin(4)	35		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)		GCCGGGATGTGAACGAAACAA	0.617																																					p.F607L													.	.			0			c.C1821A												129.0	91.0	104.0					2																	233746912		2203	4300	6503	SO:0001583	missense	25791	exon13			GGATGTGAACGAA	AJ238899	CCDS2500.1, CCDS46544.1	2q37	2012-07-24			ENSG00000066248	ENSG00000066248		"""Rho guanine nucleotide exchange factors"""	7807	protein-coding gene	gene with protein product	"""ephexin"""	605991				10777665	Standard	NM_019850		Approved	ARHGEF27	uc002vts.2	Q8N5V2	OTTHUMG00000133272	ENST00000264051.3:c.1821C>A	2.37:g.233746912G>T	ENSP00000264051:p.Phe607Leu		Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_019850	33	0.00	0	B4DMB8|B9A045|E9PC42|Q53QQ4|Q53ST7|Q6GMQ5|Q9NQD6	Missense_Mutation	SNP	ENST00000264051.3	37	CCDS2500.1	.	.	.	.	.	.	.	.	.	.	G	12.98	2.101700	0.37048	.	.	ENSG00000066248	ENST00000264051;ENST00000373552;ENST00000541023;ENST00000539537	T;T;T	0.27256	1.68;1.68;1.68	5.39	4.52	0.55395	Src homology-3 domain (1);	0.183825	0.48767	D	0.000164	T	0.10208	0.0250	N	0.11560	0.145	0.36311	D	0.857629	B;B	0.30406	0.004;0.278	B;B	0.18871	0.004;0.023	T	0.22103	-1.0226	10	0.23302	T	0.38	-37.0097	5.0556	0.14531	0.2142:0.1663:0.6195:0.0	.	515;607	E9PC42;Q8N5V2	.;NGEF_HUMAN	L	607;515;497;330	ENSP00000264051:F607L;ENSP00000362653:F515L;ENSP00000439035:F330L	ENSP00000264051:F607L	F	-	3	2	NGEF	233455156	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	1.630000	0.37081	1.279000	0.44446	0.563000	0.77884	TTC			0.617	NGEF-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000257051.2		XM_044799	
ESPNL	339768	mdanderson.org	37	2	239039508	239039508	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr2:239039508G>T	ENST00000343063.3	+	9	2416	c.2153G>T	c.(2152-2154)tGc>tTc	p.C718F	ESPNL_ENST00000409169.1_Missense_Mutation_p.C674F|ESPNL_ENST00000477241.1_3'UTR|ESPNL_ENST00000409506.1_Missense_Mutation_p.C350F	NM_194312.2	NP_919288.2	Q6ZVH7	ESPNL_HUMAN	espin-like	718										endometrium(1)|lung(8)|pancreas(2)|skin(2)	13		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		GGCATCAGCTGCGAGGAGGTG	0.682																																					p.C718F													.	.			0			c.G2153T												4.0	5.0	5.0					2																	239039508		1980	4020	6000	SO:0001583	missense	339768	exon9			TCAGCTGCGAGGA	AK124559	CCDS2525.1	2q37.3	2013-01-10			ENSG00000144488	ENSG00000144488		"""Ankyrin repeat domain containing"""	27937	protein-coding gene	gene with protein product						12975309	Standard	NM_194312		Approved	FLJ42568	uc002vxq.4	Q6ZVH7	OTTHUMG00000133335	ENST00000343063.3:c.2153G>T	2.37:g.239039508G>T	ENSP00000339115:p.Cys718Phe		Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	23	0.09	2	NM_194312	2	0.00	0	Q66K27|Q6ZVG1|Q8IVU2	Missense_Mutation	SNP	ENST00000343063.3	37	CCDS2525.1	.	.	.	.	.	.	.	.	.	.	G	6.480	0.456738	0.12283	.	.	ENSG00000144488	ENST00000343063;ENST00000409169;ENST00000409506	T;T;T	0.63744	-0.06;1.03;0.64	4.24	4.24	0.50183	.	0.075983	0.52532	D	0.000062	T	0.73877	0.3643	M	0.61703	1.905	0.37223	D	0.905344	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.997	T	0.77167	-0.2687	10	0.42905	T	0.14	-14.3674	11.4684	0.50252	0.0:0.1829:0.8171:0.0	.	674;718	Q6ZVH7-2;Q6ZVH7	.;ESPNL_HUMAN	F	718;674;350	ENSP00000339115:C718F;ENSP00000386577:C674F;ENSP00000386579:C350F	ENSP00000339115:C718F	C	+	2	0	ESPNL	238704247	0.992000	0.36948	0.990000	0.47175	0.148000	0.21650	1.423000	0.34837	1.907000	0.55213	0.313000	0.20887	TGC			0.682	ESPNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257164.2		NM_194312	
ANKRD60	140731	bcgsc.ca	37	20	56803358	56803358	+	Missense_Mutation	SNP	C	C	G	rs377420268		TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr20:56803358C>G	ENST00000457363.1	-	1	351	c.352G>C	c.(352-354)Gtg>Ctg	p.V118L				Q9BZ19	ANR60_HUMAN	ankyrin repeat domain 60	118	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.									kidney(1)	1						AGCTCCCGCACGGTCATGTCG	0.647																																					.													.	.			0			.												27.0	32.0	31.0					20																	56803358		692	1591	2283	SO:0001583	missense	140731	.			CCCGCACGGTCAT	AL354776		20q13.32	2013-01-10	2008-03-25	2008-03-25	ENSG00000124227	ENSG00000124227		"""Ankyrin repeat domain containing"""	16217	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 86"""	C20orf86			Standard	XM_006710087		Approved	bA196N14.3		Q9BZ19	OTTHUMG00000032837	ENST00000457363.1:c.352G>C	20.37:g.56803358C>G	ENSP00000396747:p.Val118Leu		Somatic	98	0	0		WXS	Illumina HiSeq	Phase_1	93	0.12	11	.	0		0	Q4VXE6	Missense_Mutation	SNP	ENST00000457363.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.78|13.78	2.338661|2.338661	0.41398|0.41398	.|.	.|.	ENSG00000124227|ENSG00000124227	ENST00000371167|ENST00000457363	.|T	.|0.76060	.|-0.99	3.5|3.5	3.5|3.5	0.40072|0.40072	.|.	.|0.183542	.|0.26193	.|N	.|0.025798	T|T	0.67116|0.67116	0.2859|0.2859	.|.	.|.	.|.	0.25457|0.25457	N|N	0.987957|0.987957	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.59584|0.59584	-0.7427|-0.7427	4|7	.|0.45353	.|T	.|0.12	-32.1051|-32.1051	5.182|5.182	0.15165|0.15165	0.0:0.6673:0.2142:0.1185|0.0:0.6673:0.2142:0.1185	.|.	.|.	.|.	.|.	P|L	113|118	.|ENSP00000396747:V118L	.|ENSP00000396747:V118L	R|V	-|-	2|1	0|0	ANKRD60|ANKRD60	56236764|56236764	0.072000|0.072000	0.21174|0.21174	0.972000|0.972000	0.41901|0.41901	0.918000|0.918000	0.54935|0.54935	0.160000|0.160000	0.16462|0.16462	1.942000|1.942000	0.56320|0.56320	0.491000|0.491000	0.48974|0.48974	CGT|GTG			0.647	ANKRD60-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				XM_001134442	
HELZ2	85441	mdanderson.org	37	20	62195952	62195952	+	Missense_Mutation	SNP	G	G	T	rs370784417	byFrequency	TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr20:62195952G>T	ENST00000467148.1	-	8	4292	c.4223C>A	c.(4222-4224)cCg>cAg	p.P1408Q	HELZ2_ENST00000427522.2_Missense_Mutation_p.P839Q	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	1408					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GAGGCTGGCCGGCAGCATGGG	0.701																																					p.P1408Q													.	.			0			c.C4223A												7.0	6.0	6.0					20																	62195952		2093	4166	6259	SO:0001583	missense	85441	exon9			CTGGCCGGCAGCA	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.4223C>A	20.37:g.62195952G>T	ENSP00000417401:p.Pro1408Gln		Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_001037335	10	0.00	0	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	ENST00000467148.1	37	CCDS33508.1	.	.	.	.	.	.	.	.	.	.	G	14.51	2.557314	0.45590	.	.	ENSG00000130589	ENST00000427522;ENST00000467148	T;T	0.72942	-0.7;-0.7	4.84	3.88	0.44766	Ribonuclease II/R (2);	0.116871	0.64402	D	0.000017	D	0.89733	0.6800	H	0.98048	4.135	0.53688	D	0.999979	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93280	0.6659	10	0.87932	D	0	-22.1615	15.0711	0.72037	0.0:0.1427:0.8572:0.0	.	1408;839	Q9BYK8;Q9BYK8-2	PR285_HUMAN;.	Q	839;1408	ENSP00000393257:P839Q;ENSP00000417401:P1408Q	ENSP00000393257:P839Q	P	-	2	0	RP4-697K14.7	61666396	1.000000	0.71417	0.418000	0.26571	0.003000	0.03518	7.482000	0.81143	1.029000	0.39812	0.491000	0.48974	CCG			0.701	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000354127.1		NM_001037335	
BTG3	10950	mdanderson.org	37	21	18981446	18981446	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr21:18981446G>T	ENST00000348354.6	-	2	273	c.17C>A	c.(16-18)gCt>gAt	p.A6D	BTG3_ENST00000464058.1_5'UTR|BTG3_ENST00000339775.6_Missense_Mutation_p.A6D	NM_006806.4	NP_006797.3	Q14201	BTG3_HUMAN	BTG family, member 3	6					negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)	cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)	8				Epithelial(23;0.000283)|all cancers(11;0.0012)|Lung(58;0.0191)|OV - Ovarian serous cystadenocarcinoma(11;0.0206)|COAD - Colon adenocarcinoma(22;0.0315)|LUSC - Lung squamous cell carcinoma(23;0.0703)|Colorectal(24;0.0971)		GACAACGGCAGCAATTTCATT	0.338																																					p.A6D													.	.			0			c.C17A												68.0	69.0	69.0					21																	18981446		2203	4300	6503	SO:0001583	missense	10950	exon2			ACGGCAGCAATTT	D64110	CCDS13569.1, CCDS46636.1	21q21.1	2006-12-16			ENSG00000154640	ENSG00000154640			1132	protein-coding gene	gene with protein product		605674				9632145	Standard	NM_006806		Approved	ANA, tob55	uc002ykk.3	Q14201	OTTHUMG00000074501	ENST00000348354.6:c.17C>A	21.37:g.18981446G>T	ENSP00000284879:p.Ala6Asp		Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	111	0.05	5	NM_006806	67	0.00	0	D3DSC4|Q53XV1|Q96ET7	Missense_Mutation	SNP	ENST00000348354.6	37	CCDS13569.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.066351	0.76187	.	.	ENSG00000154640	ENST00000339775;ENST00000348354;ENST00000457956	.	.	.	4.45	3.57	0.40892	Anti-proliferative protein (3);	0.000000	0.85682	D	0.000000	T	0.67420	0.2891	M	0.64567	1.98	0.44241	D	0.997088	D;D	0.62365	0.991;0.979	P;P	0.61592	0.891;0.826	T	0.68164	-0.5481	9	0.46703	T	0.11	-17.4629	10.9914	0.47551	0.0921:0.0:0.9079:0.0	.	6;6	Q14201-2;Q14201	.;BTG3_HUMAN	D	6	.	ENSP00000344609:A6D	A	-	2	0	BTG3	17903317	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.277000	0.89896	1.465000	0.48006	0.650000	0.86243	GCT			0.338	BTG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000158196.1		NM_006806	
KRTAP10-9	386676	mdanderson.org	37	21	46047200	46047200	+	Missense_Mutation	SNP	G	G	A	rs201090014		TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr21:46047200G>A	ENST00000397911.3	+	1	161	c.112G>A	c.(112-114)Gcc>Acc	p.A38T	TSPEAR_ENST00000323084.4_Intron|KRTAP10-9_ENST00000484861.1_3'UTR	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9	38	25 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						CAGCTGCTGCGCCCCGGCCCC	0.687																																					p.A38T													.	.			0			c.G112A							G	,THR/ALA	0,4352		0,0,2176	33.0	43.0	40.0		,112	-3.5	0.2	21		40	3,8535		0,3,4266	no	intron,missense	TSPEAR,KRTAP10-9	NM_144991.2,NM_198690.2	,58	0,3,6442	AA,AG,GG		0.0351,0.0,0.0233	,benign	,38/293	46047200	3,12887	2176	4269	6445	SO:0001583	missense	386676	exon1			TGCTGCGCCCCGG	AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.112G>A	21.37:g.46047200G>A	ENSP00000381009:p.Ala38Thr		Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_198690	0		0	A2RRG1|A6NIR9|Q70LJ1	Missense_Mutation	SNP	ENST00000397911.3	37	CCDS42961.1	.	.	.	.	.	.	.	.	.	.	g	0.280	-0.986763	0.02180	0.0	3.51E-4	ENSG00000221837	ENST00000397911	T	0.04654	3.58	3.63	-3.45	0.04781	.	.	.	.	.	T	0.03263	0.0095	L	0.49455	1.56	0.09310	N	1	B	0.28178	0.202	B	0.17433	0.018	T	0.47071	-0.9145	9	0.14252	T	0.57	.	1.361	0.02191	0.439:0.1847:0.2407:0.1355	.	38	P60411	KR109_HUMAN	T	38	ENSP00000381009:A38T	ENSP00000381009:A38T	A	+	1	0	KRTAP10-9	44871628	0.000000	0.05858	0.181000	0.23098	0.005000	0.04900	-0.912000	0.04046	-0.422000	0.07405	-0.768000	0.03414	GCC			0.687	KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000128040.1			
CRYBB2P1	1416	broad.mit.edu	37	22	25855682	25855683	+	RNA	INS	-	-	GTGT	rs61433517|rs71322752		TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr22:25855682_25855683insGTGT	ENST00000609084.1	+	0	0									crystallin, beta B2 pseudogene 1																		CCTGGCAGCTGgtgtgtgtgtg	0.53																																					.													.	.			0			.																																											0	.			GCAGCTGGTGTGT	M18441		22q11.2-q12.1	2012-02-29			ENSG00000100058	ENSG00000100058			2399	pseudogene	pseudogene				CRYB2B			Standard	NR_033733		Approved		uc003abu.4		OTTHUMG00000150874		22.37:g.25855687_25855690dupGTGT			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	9	0.44	4	.	2	0.00	0		RNA	INS	ENST00000609084.1	37																																																																																						0.530	CRYBB2P1-006	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000472347.1			
CCR3	1232	hgsc.bcm.edu	37	3	46307688	46307688	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr3:46307688G>A	ENST00000357422.2	+	4	1582	c.1039G>A	c.(1039-1041)Gca>Aca	p.A347T	CCR3_ENST00000545097.1_Missense_Mutation_p.A368T|CCR3_ENST00000395942.2_Missense_Mutation_p.A347T|CCR3_ENST00000541018.1_Missense_Mutation_p.A347T|CCR3_ENST00000395940.2_Missense_Mutation_p.A347T			P51677	CCR3_HUMAN	chemokine (C-C motif) receptor 3	347					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell proliferation (GO:0001938)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(3)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)		TCCATCCACAGCAGAGCCGGA	0.483																																					p.A368T													CCR3,NS,carcinoma,-2,1	CCR3	-2	1	0			c.G1102A												51.0	48.0	49.0					3																	46307688		2203	4300	6503	SO:0001583	missense	1232	exon3			TCCACAGCAGAGC	AF247361	CCDS2738.1, CCDS54574.1	3p21.3	2012-08-08			ENSG00000183625	ENSG00000183625		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1604	protein-coding gene	gene with protein product		601268		CMKBR3			Standard	NM_178328		Approved	CC-CKR-3, CKR3, CD193	uc003cpk.2	P51677	OTTHUMG00000133484	ENST00000357422.2:c.1039G>A	3.37:g.46307688G>A	ENSP00000350003:p.Ala347Thr		Somatic	68	0	0		WXS	Illumina HiSeq	.	64	0.05	3	NM_178328	1	0.00	0	B3KVQ1|F5GWL6|Q15748|Q2YDB9|Q86WD2|Q8TDP6|Q9ULY8	Missense_Mutation	SNP	ENST00000357422.2	37	CCDS2738.1	.	.	.	.	.	.	.	.	.	.	G	12.59	1.982448	0.34942	.	.	ENSG00000183625	ENST00000357422;ENST00000545097;ENST00000541018;ENST00000395940;ENST00000395942	T;T;T;T;T	0.68181	-0.28;-0.31;-0.28;-0.28;-0.28	5.66	4.77	0.60923	.	2.483420	0.03575	U	0.229278	T	0.62901	0.2466	L	0.34521	1.04	0.22975	N	0.998484	P;P	0.44429	0.835;0.594	B;B	0.39840	0.311;0.164	T	0.57866	-0.7737	10	0.59425	D	0.04	.	13.3736	0.60726	0.0:0.0:0.8425:0.1575	.	368;347	F5GWL6;P51677	.;CCR3_HUMAN	T	347;368;347;347;347	ENSP00000350003:A347T;ENSP00000441600:A368T;ENSP00000440097:A347T;ENSP00000379271:A347T;ENSP00000379273:A347T	ENSP00000350003:A347T	A	+	1	0	CCR3	46282692	0.503000	0.26115	0.750000	0.31169	0.022000	0.10575	3.657000	0.54474	1.355000	0.45865	0.655000	0.94253	GCA			0.483	CCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257380.2			
VPRBP	9730	broad.mit.edu	37	3	51458228	51458228	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr3:51458228G>T	ENST00000335891.5	-	7	858	c.849C>A	c.(847-849)aaC>aaA	p.N283K				Q9Y4B6	VPRBP_HUMAN	Vpr (HIV-1) binding protein	732	Protein kinase-like.				B cell differentiation (GO:0030183)|cell competition in a multicellular organism (GO:0035212)|histone H2A-T120 phosphorylation (GO:1990245)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H2A-T120 specific) (GO:1990244)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		TGATGCCGTTGTTGGACTGAA	0.522																																					p.N679K													.	VPRBP	107		0			c.C2037A												255.0	245.0	248.0					3																	51458228		2029	4201	6230	SO:0001583	missense	9730	exon14			GCCGTTGTTGGAC	AB018343	CCDS74943.1, CCDS74944.1	3p21.2	2011-06-17			ENSG00000145041	ENSG00000145041		"""DDB1 and CUL4 associated factors"""	30911	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 1"""					8195203, 11223251	Standard	NM_014703		Approved	KIAA0800, MGC102804, DCAF1	uc003dbe.2	Q9Y4B6	OTTHUMG00000156895	ENST00000335891.5:c.849C>A	3.37:g.51458228G>T	ENSP00000338857:p.Asn283Lys		Somatic	150	0.0066666667	1		WXS	Illumina HiSeq	Phase_I	125	0.03	4	NM_014703	15	0.00	0	Q2YD74|Q8TBD9|Q9HCA1|Q9UG37	Missense_Mutation	SNP	ENST00000335891.5	37		.	.	.	.	.	.	.	.	.	.	G	16.12	3.032803	0.54790	.	.	ENSG00000145041	ENST00000423656;ENST00000335891	T;T	0.65549	-0.16;-0.16	5.97	4.19	0.49359	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.76737	0.4029	M	0.81942	2.565	0.58432	D	0.999996	D	0.61080	0.989	D	0.72982	0.979	T	0.77180	-0.2682	10	0.72032	D	0.01	-18.414	8.5791	0.33617	0.2847:0.0:0.7153:0.0	.	732	Q9Y4B6	VPRBP_HUMAN	K	303;283	ENSP00000393183:N303K;ENSP00000338857:N283K	ENSP00000338857:N283K	N	-	3	2	VPRBP	51433268	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.147000	0.50639	0.860000	0.35481	0.655000	0.94253	AAC			0.522	VPRBP-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_014703	
RP11-572M11.4	0	broad.mit.edu	37	3	112798472	112798474	+	RNA	DEL	GCG	GCG	-	rs11712567	byFrequency	TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	GCG	GCG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr3:112798472_112798474delGCG	ENST00000460707.1	+	0	390				RP11-572M11.4_ENST00000467342.1_RNA|RP11-572M11.4_ENST00000470313.1_RNA|RP11-572M11.4_ENST00000496389.1_RNA																							agcggcagcagcggcagcagcag	0.384																																					.													.	.			0			.																																											0	.			GCAGCAGCGGCAG																													3.37:g.112798472_112798474delGCG			Somatic	10	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	DEL	ENST00000460707.1	37																																																																																						0.384	RP11-572M11.4-006	KNOWN	basic	antisense	antisense		OTTHUMT00000354897.1			
USP13	8975	hgsc.bcm.edu;bcgsc.ca	37	3	179472611	179472611	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr3:179472611delC	ENST00000263966.3	+	15	2361	c.1890delC	c.(1888-1890)agcfs	p.S630fs	USP13_ENST00000496897.1_Frame_Shift_Del_p.S565fs|USP13_ENST00000482333.1_3'UTR	NM_003940.2	NP_003931.2	Q92995	UBP13_HUMAN	ubiquitin specific peptidase 13 (isopeptidase T-3)	630	USP.				autophagy (GO:0006914)|cell proliferation (GO:0008283)|melanocyte differentiation (GO:0030318)|protein K63-linked deubiquitination (GO:0070536)|protein stabilization (GO:0050821)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	46	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			CAGACATCAGCCCCCCCATAG	0.483																																					p.S630fs													.	USP13	117		0			c.1889delG												131.0	124.0	127.0					3																	179472611		2203	4300	6503	SO:0001589	frameshift_variant	8975	exon15			CATCAGCCCCCCC	U75362	CCDS3235.1	3q26.2-q26.3	2008-04-11	2005-08-08		ENSG00000058056	ENSG00000058056		"""Ubiquitin-specific peptidases"""	12611	protein-coding gene	gene with protein product		603591	"""ubiquitin specific protease 13 (isopeptidase T-3)"""			12838346	Standard	NM_003940		Approved	IsoT-3	uc003fkh.3	Q92995	OTTHUMG00000157783	ENST00000263966.3:c.1890delC	3.37:g.179472611delC	ENSP00000263966:p.Ser630fs		Somatic	110	0	0		WXS	Illumina HiSeq	.	110	0.28	31	NM_003940	4	0.00	0	A8K2S3|B4DYF3|D3DNS2|Q96B25	Frame_Shift_Del	DEL	ENST00000263966.3	37	CCDS3235.1																																																																																					0.483	USP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000349617.1			
ANTXR2	118429	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	80940116	80940116	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr4:80940116G>A	ENST00000307333.7	-	11	883	c.881C>T	c.(880-882)tCa>tTa	p.S294L	ANTXR2_ENST00000403729.2_Missense_Mutation_p.S294L|ANTXR2_ENST00000404191.1_Missense_Mutation_p.S217L|ANTXR2_ENST00000346652.6_Intron	NM_001145794.1	NP_001139266.1	P58335	ANTR2_HUMAN	anthrax toxin receptor 2	294					reproductive process (GO:0022414)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	13						AAAGCTCACTGAAACATCAAG	0.289									Juvenile Hyaline Fibromatosis																												p.S294L													.	ANTXR2	97		0			c.C881T												53.0	44.0	46.0					4																	80940116		1777	4018	5795	SO:0001583	missense	118429	exon11	Familial Cancer Database	incl. Infantile Systemic Hyalinosis	CTCACTGAAACAT	AY040326	CCDS47085.1, CCDS47086.1, CCDS68733.1	4q21.3	2004-01-15			ENSG00000163297	ENSG00000163297			21732	protein-coding gene	gene with protein product	"""capillary morphogenesis protein 2"""	608041				11683410, 12700348	Standard	NM_058172		Approved	CMG2, CMG-2, FLJ31074	uc003hlz.4	P58335	OTTHUMG00000151982	ENST00000307333.7:c.881C>T	4.37:g.80940116G>A	ENSP00000306185:p.Ser294Leu		Somatic	272	0.0036764706	1		WXS	Illumina HiSeq	Phase_I	223	0.35	79	NM_001145794	136	0.49	66	Q4W5H6|Q59E98|Q5JPE9|Q86UI1|Q8N4J8|Q8NB13|Q96NC7	Missense_Mutation	SNP	ENST00000307333.7	37	CCDS47086.1	.	.	.	.	.	.	.	.	.	.	G	10.97	1.500964	0.26861	.	.	ENSG00000163297	ENST00000403729;ENST00000404191;ENST00000307333	D;D;D	0.85702	-2.02;-2.02;-2.02	5.81	5.81	0.92471	Anthrax toxin receptor, extracellular (1);	0.144833	0.52532	D	0.000079	T	0.70613	0.3244	N	0.19112	0.55	0.80722	D	1	B;B	0.09022	0.002;0.002	B;B	0.12156	0.007;0.004	T	0.63116	-0.6709	10	0.12103	T	0.63	-14.3382	6.8099	0.23799	0.111:0.1763:0.7128:0.0	.	294;294	P58335;P58335-4	ANTR2_HUMAN;.	L	294;217;294	ENSP00000385575:S294L;ENSP00000384028:S217L;ENSP00000306185:S294L	ENSP00000306185:S294L	S	-	2	0	ANTXR2	81159140	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	3.741000	0.55090	2.745000	0.94114	0.655000	0.94253	TCA			0.289	ANTXR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324663.1		NM_058172	
MATR3	9782	broad.mit.edu	37	5	138651822	138651822	+	Silent	SNP	T	T	C			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr5:138651822T>C	ENST00000394805.3	+	5	1409	c.1074T>C	c.(1072-1074)ccT>ccC	p.P358P	MATR3_ENST00000510056.1_Silent_p.P358P|MATR3_ENST00000502929.1_Silent_p.P358P|MATR3_ENST00000509990.1_Silent_p.P358P|MATR3_ENST00000504203.1_Silent_p.P20P|MATR3_ENST00000361059.2_Silent_p.P358P|MATR3_ENST00000503811.1_Silent_p.P70P|MATR3_ENST00000502499.1_Silent_p.P20P|MATR3_ENST00000394800.2_Silent_p.P358P	NM_001194955.1|NM_018834.5	NP_001181884.1|NP_061322.2	P43243	MATR3_HUMAN	matrin 3	358					cell death (GO:0008219)	membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TTCTGGGACCTCCACCTCCCT	0.413																																					p.P358P													.	MATR3	85		0			c.T1074C												103.0	107.0	106.0					5																	138651822		2203	4300	6503	SO:0001819	synonymous_variant	9782	exon5			GGGACCTCCACCT	M63483	CCDS4210.1, CCDS54908.1, CCDS75316.1	5q31.3	2010-08-12			ENSG00000015479	ENSG00000015479			6912	protein-coding gene	gene with protein product		164015	"""myopathy, distal 2"""	MPD2		2033075, 19344878	Standard	NM_018834		Approved	KIAA0723, MGC9105, VCPDM	uc003ldx.3	P43243	OTTHUMG00000129229	ENST00000394805.3:c.1074T>C	5.37:g.138651822T>C			Somatic	191	0	0		WXS	Illumina HiSeq	Phase_I	132	0.02	3	NM_018834	453	0.00	1	B7ZAV5|D3DQC3|Q9UHW0|Q9UQ27	Silent	SNP	ENST00000394805.3	37	CCDS4210.1	.	.	.	.	.	.	.	.	.	.	T	8.179	0.793361	0.16327	.	.	ENSG00000015479	ENST00000515833	.	.	.	5.83	-3.34	0.04943	.	.	.	.	.	T	0.37758	0.1015	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.32188	-0.9916	4	.	.	.	-9.6588	0.8767	0.01226	0.2177:0.1526:0.2406:0.389	.	.	.	.	P	118	.	.	L	+	2	0	MATR3	138679721	0.851000	0.29673	0.970000	0.41538	0.811000	0.45836	-0.317000	0.08060	-0.791000	0.04486	-3.429000	0.00037	CTC			0.413	MATR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251324.2		NM_018834	
ANKHD1	54882	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	139820640	139820640	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr5:139820640C>G	ENST00000360839.2	+	5	980	c.826C>G	c.(826-828)Ctg>Gtg	p.L276V	ANKHD1_ENST00000297183.6_Missense_Mutation_p.L276V|ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.L276V|ANKHD1_ENST00000394722.3_Missense_Mutation_p.L265V|ANKHD1_ENST00000394723.3_Missense_Mutation_p.L276V	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	276						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CATAACTCCCCTGATGGCAGC	0.373																																					p.L276V													.	.			0			c.C826G												133.0	126.0	129.0					5																	139820640		2203	4300	6503	SO:0001583	missense	54882	exon5			ACTCCCCTGATGG	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.826C>G	5.37:g.139820640C>G	ENSP00000354085:p.Leu276Val		Somatic	106	0	0		WXS	Illumina HiSeq	.	64	0.11	7	NM_024668	16	0.13	2	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	ENST00000360839.2	37	CCDS4225.1	.	.	.	.	.	.	.	.	.	.	C	17.82	3.482685	0.63962	.	.	ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996	ENST00000360839;ENST00000422011;ENST00000297183;ENST00000253810;ENST00000421134;ENST00000394723;ENST00000511151;ENST00000394722;ENST00000532219	D;D;T;T;T;T;D	0.86865	-2.18;-2.18;-1.17;-1.17;-0.55;-1.17;-2.18	5.53	0.606	0.17559	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000006	D	0.92535	0.7629	M	0.85630	2.765	0.54753	D	0.999987	D;D;D;D;D	0.89917	1.0;0.999;0.997;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.994;0.992;1.0;0.999	D	0.91055	0.4881	10	0.87932	D	0	.	10.4837	0.44708	0.0:0.5017:0.0:0.4983	.	276;276;276;265;276	Q8IWZ3-5;Q8IWZ2;Q8IWZ3;Q8IWZ3-3;Q8IWZ3-2	.;.;ANKH1_HUMAN;.;.	V	276;290;276;276;276;276;262;265;276	ENSP00000354085:L276V;ENSP00000297183:L276V;ENSP00000394489:L276V;ENSP00000378212:L276V;ENSP00000421069:L262V;ENSP00000378211:L265V;ENSP00000432016:L276V	ENSP00000432016:L276V	L	+	1	2	ANKHD1-EIF4EBP3;ANKHD1	139800824	0.655000	0.27376	0.988000	0.46212	0.989000	0.77384	0.697000	0.25556	-0.108000	0.12066	-0.225000	0.12378	CTG			0.373	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000251672.1		NM_017747	
APBB3	10307	broad.mit.edu	37	5	139938282	139938282	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr5:139938282A>G	ENST00000357560.4	-	13	1792	c.1349T>C	c.(1348-1350)cTc>cCc	p.L450P	APBB3_ENST00000412920.3_Missense_Mutation_p.L448P|SRA1_ENST00000520427.1_5'Flank|APBB3_ENST00000508496.2_Missense_Mutation_p.L227P|APBB3_ENST00000358580.5_3'UTR|APBB3_ENST00000354402.5_Missense_Mutation_p.L457P|SRA1_ENST00000336283.6_5'Flank|APBB3_ENST00000356738.2_Missense_Mutation_p.L455P	NM_006051.3|NM_133173.2	NP_006042.3|NP_573419.2	O95704	APBB3_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 3	450						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGCAGGGGGAGGGGCAGGGG	0.667																																					p.L457P													.	APBB3	34		0			c.T1370C												32.0	39.0	36.0					5																	139938282		2202	4293	6495	SO:0001583	missense	10307	exon12			AGGGGGAGGGGCA	AB018247	CCDS4227.1, CCDS4228.1, CCDS4229.1, CCDS47279.1	5q31	2008-02-05			ENSG00000113108	ENSG00000113108			20708	protein-coding gene	gene with protein product		602711				9407065	Standard	NM_133172		Approved	FE65L2	uc003lgd.1	O95704	OTTHUMG00000129504	ENST00000357560.4:c.1349T>C	5.37:g.139938282A>G	ENSP00000350171:p.Leu450Pro		Somatic	266	0.007518797	2		WXS	Illumina HiSeq	Phase_I	236	0.03	7	NM_006051	14	0.00	0	B3KQN9|Q08AG4|Q96Q18|Q9BYD4|Q9NYX6|Q9NYX7|Q9NYX8	Missense_Mutation	SNP	ENST00000357560.4	37	CCDS4229.1	.	.	.	.	.	.	.	.	.	.	A	8.048	0.765288	0.15914	.	.	ENSG00000113108	ENST00000356738;ENST00000354402;ENST00000357560;ENST00000508496;ENST00000412920	T;T;T;T;T	0.46451	1.87;1.87;1.87;0.87;1.87	4.76	1.07	0.20283	.	0.634983	0.13994	N	0.348616	T	0.17662	0.0424	N	0.08118	0	0.51233	D	0.999918	B;B	0.06786	0.001;0.0	B;B	0.04013	0.0;0.001	T	0.09729	-1.0661	9	.	.	.	0.0113	4.2081	0.10498	0.6125:0.1906:0.1969:0.0	.	448;455	O95704-2;O95704-3	.;.	P	455;457;450;227;448	ENSP00000349177:L455P;ENSP00000346378:L457P;ENSP00000350171:L450P;ENSP00000444013:L227P;ENSP00000402591:L448P	.	L	-	2	0	APBB3	139918466	0.959000	0.32827	0.075000	0.20258	0.973000	0.67179	1.354000	0.34056	-0.046000	0.13446	0.374000	0.22700	CTC			0.667	APBB3-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000251677.2		NM_006051	
BTN3A1	11119	broad.mit.edu	37	6	26411341	26411341	+	Silent	SNP	A	A	G			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr6:26411341A>G	ENST00000289361.6	+	8	1337	c.969A>G	c.(967-969)ggA>ggG	p.G323G	BTN3A1_ENST00000425234.2_Silent_p.G323G|BTN3A1_ENST00000414912.2_Silent_p.G271G|BTN3A1_ENST00000476549.2_Silent_p.G323G	NM_001145008.1|NM_001145009.1|NM_007048.5	NP_001138480.1|NP_001138481.1|NP_008979.3	O00481	BT3A1_HUMAN	butyrophilin, subfamily 3, member A1	323	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				activated T cell proliferation (GO:0050798)|cytokine secretion (GO:0050663)|interferon-gamma secretion (GO:0072643)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						TTGTAGGGGGAGAGAGACATT	0.408																																					p.G323G													.	BTN3A1	80		0			c.A969G												170.0	169.0	169.0					6																	26411341		2203	4300	6503	SO:0001819	synonymous_variant	0	exon8			AGGGGGAGAGAGA	U90552	CCDS4608.1, CCDS4609.1, CCDS47388.1, CCDS47389.1	6p22.1	2014-01-14			ENSG00000026950	ENSG00000026950		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1138	protein-coding gene	gene with protein product		613593				9149941	Standard	NM_007048		Approved	BT3.1, BTF5, CD277, BTN3.1	uc003nhv.3	O00481	OTTHUMG00000014449	ENST00000289361.6:c.969A>G	6.37:g.26411341A>G			Somatic	96	0.0104166667	1		WXS	Illumina HiSeq	Phase_I	96	0.03	3	NM_007048	12	0.00	0	A2A278|A8K2C8|B4DIQ1|B4DRM2|E9PGB4|E9PHG8|Q0P515|Q147X5|Q53F15|Q99420|Q9HCY1	Silent	SNP	ENST00000289361.6	37	CCDS4608.1																																																																																					0.408	BTN3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040112.3			
CYP21A2	1589	broad.mit.edu	37	6	32008457	32008457	+	Silent	SNP	C	C	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr6:32008457C>T	ENST00000418967.2	+	9	1289	c.1131C>T	c.(1129-1131)taC>taT	p.Y377Y	CYP21A2_ENST00000435122.2_Silent_p.Y347Y	NM_000500.7	NP_000491.4	P08686	CP21A_HUMAN	cytochrome P450, family 21, subfamily A, polypeptide 2	376					glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 21-monooxygenase activity (GO:0004509)|steroid binding (GO:0005496)|steroid hydroxylase activity (GO:0008395)			NS(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	11					Ketoconazole(DB01026)	TCTCCGGCTACGACATCCCTG	0.622																																					.	Melanoma(174;1669 1998 3915 34700 46447)												.	CYP21A2	42		0			.	GRCh37	CM031957	CYP21A2	M								9.0	11.0	10.0					6																	32008457		1389	2491	3880	SO:0001819	synonymous_variant	1589	.			CGGCTACGACATC	X58906	CCDS4735.1, CCDS47406.1	6p21.3	2014-09-17	2003-01-14		ENSG00000231852	ENSG00000231852	1.14.99.10	"""Cytochrome P450s"""	2600	protein-coding gene	gene with protein product	"""Steroid 21-monooxygenase"""	613815	"""cytochrome P450, subfamily XXIA (steroid 21-hydroxylase, congenital adrenal hyperplasia), polypeptide 2"""	CYP21, CYP21B			Standard	NM_000500		Approved	P450c21B, CA21H, CPS1, CAH1	uc021yvd.1	P08686	OTTHUMG00000031069	ENST00000418967.2:c.1131C>T	6.37:g.32008457C>T			Somatic	325	0	0		WXS	Illumina HiSeq	Phase_I	282	0.26	72	.	2	0.50	1	A2BHY6|P04033|Q01204|Q08AG8|Q16749|Q16806|Q5ST44|Q96NU8	Silent	SNP	ENST00000418967.2	37	CCDS4735.1																																																																																					0.622	CYP21A2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268768.2		NM_000500	
TNXB	7148	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	32037571	32037571	+	Silent	SNP	C	C	T	rs376818111		TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr6:32037571C>T	ENST00000375244.3	-	15	5547	c.5346G>A	c.(5344-5346)ctG>ctA	p.L1782L	TNXB_ENST00000375247.2_Silent_p.L1782L			P22105	TENX_HUMAN	tenascin XB	1864	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						TGGTCACCTGCAGCTCCTCCC	0.597																																					p.L1782L													.	.			0			c.G5346A							C		0,3940		0,0,1970	25.0	28.0	27.0		5346	1.5	1.0	6		27	1,8289		0,1,4144	no	coding-synonymous	TNXB	NM_019105.6		0,1,6114	TT,TC,CC		0.0121,0.0,0.0082		1782/4243	32037571	1,12229	1970	4145	6115	SO:0001819	synonymous_variant	7148	exon15			CACCTGCAGCTCC	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.5346G>A	6.37:g.32037571C>T			Somatic	110	0	0		WXS	Illumina HiSeq	.	74	0.32	24	NM_019105	51	0.33	17	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	ENST00000375244.3	37																																																																																						0.597	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000268927.2		NM_019105	
SYNGAP1	8831	mdanderson.org	37	6	33406612	33406612	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr6:33406612G>A	ENST00000418600.2	+	10	1693	c.1592G>A	c.(1591-1593)tGc>tAc	p.C531Y	SYNGAP1_ENST00000428982.2_Missense_Mutation_p.C472Y|SYNGAP1_ENST00000496374.1_3'UTR|SYNGAP1_ENST00000293748.5_Missense_Mutation_p.C531Y|MIR5004_ENST00000579078.1_RNA	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	531	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						CCTATCAAGTGCACAGCATCC	0.562																																					p.C531Y													.	.			0			c.G1592A												148.0	137.0	141.0					6																	33406612		2203	4300	6503	SO:0001583	missense	8831	exon10			TCAAGTGCACAGC	AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.1592G>A	6.37:g.33406612G>A	ENSP00000403636:p.Cys531Tyr		Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_006772	33	0.00	0	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Missense_Mutation	SNP	ENST00000418600.2	37	CCDS34434.2	.	.	.	.	.	.	.	.	.	.	G	14.81	2.645247	0.47258	.	.	ENSG00000197283	ENST00000293748;ENST00000418600;ENST00000449372;ENST00000428982	T;T;T	0.79141	-1.24;-1.24;-1.24	4.84	4.84	0.62591	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.591792	0.13334	U	0.395738	D	0.84456	0.5476	M	0.76328	2.33	0.40065	D	0.975949	D;D;D;D	0.63046	0.992;0.99;0.99;0.984	P;B;B;D	0.63283	0.48;0.348;0.348;0.913	D	0.85326	0.1087	10	0.87932	D	0	.	15.5505	0.76148	0.0:0.0:1.0:0.0	.	531;531;531;531	Q96PV0;Q96PV0-2;Q96PV0-4;B7ZCA0	SYGP1_HUMAN;.;.;.	Y	531;531;531;472	ENSP00000293748:C531Y;ENSP00000403636:C531Y;ENSP00000412475:C472Y	ENSP00000293748:C531Y	C	+	2	0	SYNGAP1	33514590	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.773000	0.55333	2.535000	0.85469	0.586000	0.80456	TGC			0.562	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076151.4		XM_166407	
AGR3	155465	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	16918209	16918209	+	Silent	SNP	A	A	G			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr7:16918209A>G	ENST00000310398.2	-	2	104	c.34T>C	c.(34-36)Tta>Cta	p.L12L	AGR3_ENST00000402239.3_Silent_p.L12L	NM_176813.3	NP_789783.1	Q8TD06	AGR3_HUMAN	anterior gradient 3	12						extracellular region (GO:0005576)	dystroglycan binding (GO:0002162)			central_nervous_system(1)|kidney(8)|lung(2)|skin(1)|stomach(1)	13	Lung NSC(10;0.0376)|all_lung(11;0.0721)|all_epithelial(12;0.202)			UCEC - Uterine corpus endometrioid carcinoma (126;0.184)		GTGACGAGTAAGAGGCAGAGA	0.418																																					p.L12L													AGR3,NS,carcinoma,+1,1	AGR3	1	1	0			c.T34C												114.0	118.0	116.0					7																	16918209		2203	4300	6503	SO:0001819	synonymous_variant	155465	exon2			CGAGTAAGAGGCA	AY069977	CCDS5365.1	7p21.1	2013-07-31	2013-07-31		ENSG00000173467	ENSG00000173467		"""Protein disulfide isomerases"""	24167	protein-coding gene	gene with protein product	"""breast cancer membrane protein 11"", ""protein disulfide isomerase family A, member 18"""	609482	"""anterior gradient 3 homolog (Xenopus laevis)"""			12592373, 12477722	Standard	NM_176813		Approved	HAG3, hAG-3, BCMP11, PDIA18	uc003sts.3	Q8TD06	OTTHUMG00000128411	ENST00000310398.2:c.34T>C	7.37:g.16918209A>G			Somatic	87	0	0		WXS	Illumina HiSeq	.	74	0.43	32	NM_176813	31	0.52	16	A4D120	Silent	SNP	ENST00000310398.2	37	CCDS5365.1																																																																																					0.418	AGR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250191.2		NM_176813	
CCT6P3	643180	broad.mit.edu	37	7	64528813	64528814	+	RNA	INS	-	-	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr7:64528813_64528814insT	ENST00000426828.1	+	0	621				SNORA15_ENST00000384334.1_RNA|SNORA22_ENST00000384614.1_RNA	NR_033416.1				chaperonin containing TCP1, subunit 6 (zeta) pseudogene 3																		CTTTCTGTAACTTTTTTTTTTT	0.317																																					.													.	.			0			.																																											0	.			CTGTAACTTTTTT			7q11.21	2010-06-29			ENSG00000234585	ENSG00000234585			35137	pseudogene	pseudogene							Standard	NR_033416		Approved		uc010kzt.1		OTTHUMG00000156630		7.37:g.64528824_64528824dupT			Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	7	0.43	3	.	1	0.00	0		RNA	INS	ENST00000426828.1	37																																																																																						0.317	CCT6P3-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000344862.1			
TFR2	7036	mdanderson.org	37	7	100231108	100231108	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr7:100231108G>A	ENST00000462107.1	-	5	832	c.545C>T	c.(544-546)gCg>gTg	p.A182V	TFR2_ENST00000544242.1_5'Flank|TFR2_ENST00000431692.1_Missense_Mutation_p.A182V|TFR2_ENST00000223051.3_Missense_Mutation_p.A182V			Q9UP52	TFR2_HUMAN	transferrin receptor 2	182					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transferrin receptor activity (GO:0004998)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)				Gallium nitrate(DB05260)	GCGGGAGAGCGCCGCGCGAAT	0.697																																					p.A182V													.	.			0			c.C545T												21.0	23.0	22.0					7																	100231108		2199	4298	6497	SO:0001583	missense	7036	exon4			GAGAGCGCCGCGC	AF053356	CCDS34707.1	7q22	2003-01-27			ENSG00000106327	ENSG00000106327			11762	protein-coding gene	gene with protein product		604720				9799793, 12130528	Standard	NM_003227		Approved	HFE3, TFRC2	uc003uvv.1	Q9UP52	OTTHUMG00000159598	ENST00000462107.1:c.545C>T	7.37:g.100231108G>A	ENSP00000420525:p.Ala182Val		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_003227	2	0.00	0	A6NGM7|O75422|Q1HE13|Q9HA99|Q9NX67	Missense_Mutation	SNP	ENST00000462107.1	37	CCDS34707.1	.	.	.	.	.	.	.	.	.	.	G	8.345	0.829652	0.16749	.	.	ENSG00000106327	ENST00000223051;ENST00000431692;ENST00000462107	T;T;T	0.53423	1.08;0.62;1.08	4.99	-2.17	0.07059	.	1.124030	0.06433	N	0.724479	T	0.27313	0.0670	N	0.19112	0.55	0.09310	N	1	B	0.26318	0.146	B	0.14578	0.011	T	0.19976	-1.0289	10	0.51188	T	0.08	-1.7422	3.8691	0.09029	0.2919:0.0:0.2184:0.4896	.	182	Q9UP52	TFR2_HUMAN	V	182	ENSP00000223051:A182V;ENSP00000413905:A182V;ENSP00000420525:A182V	ENSP00000223051:A182V	A	-	2	0	TFR2	100069044	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.815000	0.04481	-0.249000	0.09569	0.561000	0.74099	GCG			0.697	TFR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356392.3		NM_003227	
DOCK4	9732	mdanderson.org	37	7	111400315	111400315	+	Silent	SNP	G	G	A			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr7:111400315G>A	ENST00000437633.1	-	39	4313	c.4057C>T	c.(4057-4059)Ctg>Ttg	p.L1353L	DOCK4_ENST00000494651.2_Silent_p.L236L|DOCK4_ENST00000428084.1_Silent_p.L1362L	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1353	DHR-2.				cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				AACTCGTTCAGCATTCTCTGT	0.512																																					p.L1353L													.	.			0			c.C4057T												170.0	174.0	173.0					7																	111400315		2115	4243	6358	SO:0001819	synonymous_variant	9732	exon39			CGTTCAGCATTCT		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.4057C>T	7.37:g.111400315G>A			Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	58	0.09	5	NM_014705	12	0.00	0	O14584|O94824|Q8NB45	Silent	SNP	ENST00000437633.1	37	CCDS47688.1																																																																																					0.512	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000338369.4		NM_014705	
GPR37	2861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	124386667	124386667	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr7:124386667T>C	ENST00000303921.2	-	2	2404	c.1754A>G	c.(1753-1755)aAc>aGc	p.N585S		NM_005302.3	NP_005293.1	O15354	GPR37_HUMAN	G protein-coupled receptor 37 (endothelin receptor type B-like)	585					dopamine biosynthetic process (GO:0042416)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotion involved in locomotory behavior (GO:0031987)|positive regulation of dopamine metabolic process (GO:0045964)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ubiquitin ligase complex (GO:0000151)	G-protein coupled receptor activity (GO:0004930)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						GGTGTACTCGTTGTCATTGTC	0.498																																					p.N585S													GPR37,NS,carcinoma,+1,2	GPR37	1	2	0			c.A1754G												180.0	150.0	160.0					7																	124386667		2203	4300	6503	SO:0001583	missense	2861	exon2			TACTCGTTGTCAT		CCDS5792.1	7q31	2012-08-21			ENSG00000170775	ENSG00000170775		"""GPCR / Class A : Orphans"""	4494	protein-coding gene	gene with protein product		602583				9339362	Standard	NM_005302		Approved	EDNRBL, hET(B)R-LP, PAELR	uc003vli.4	O15354	OTTHUMG00000157197	ENST00000303921.2:c.1754A>G	7.37:g.124386667T>C	ENSP00000306449:p.Asn585Ser		Somatic	81	0	0		WXS	Illumina HiSeq	.	63	0.46	29	NM_005302	26	0.54	14	A4D0Y6|O00348|O14768|Q8TD39	Missense_Mutation	SNP	ENST00000303921.2	37	CCDS5792.1	.	.	.	.	.	.	.	.	.	.	T	11.72	1.724088	0.30593	.	.	ENSG00000170775	ENST00000303921	T	0.70869	-0.52	5.35	5.35	0.76521	.	0.087590	0.45867	D	0.000324	T	0.48519	0.1504	N	0.03608	-0.345	0.38098	D	0.93717	B	0.24721	0.11	B	0.25884	0.064	T	0.51568	-0.8689	10	0.25106	T	0.35	-26.6558	14.5182	0.67833	0.0:0.0:0.0:1.0	.	585	O15354	GPR37_HUMAN	S	585	ENSP00000306449:N585S	ENSP00000306449:N585S	N	-	2	0	GPR37	124173903	1.000000	0.71417	1.000000	0.80357	0.650000	0.38633	7.197000	0.77814	2.014000	0.59158	0.533000	0.62120	AAC			0.498	GPR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347873.1		NM_005302	
NOS3	4846	mdanderson.org	37	7	150706579	150706579	+	Silent	SNP	G	G	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr7:150706579G>T	ENST00000297494.3	+	20	2775	c.2418G>T	c.(2416-2418)cgG>cgT	p.R806R	ATG9B_ENST00000494791.1_5'Flank|NOS3_ENST00000461406.1_Silent_p.R600R	NM_000603.4	NP_000594.2	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CGCCCAACCGGCCCGGCCTTG	0.726																																					p.R806R													.	.			0			c.G2418T												5.0	8.0	7.0					7																	150706579		1951	3793	5744	SO:0001819	synonymous_variant	4846	exon20			CAACCGGCCCGGC		CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000297494.3:c.2418G>T	7.37:g.150706579G>T			Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	21	0.14	3	NM_000603	13	0.00	0	Q495E5	Silent	SNP	ENST00000297494.3	37	CCDS5912.1	.	.	.	.	.	.	.	.	.	.	G	12.65	2.002740	0.35320	.	.	ENSG00000164867	ENST00000475017	.	.	.	5.52	0.155	0.14906	.	.	.	.	.	T	0.40791	0.1131	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.24835	-1.0149	4	.	.	.	-0.5364	1.3741	0.02216	0.3156:0.1371:0.4065:0.1408	.	.	.	.	V	100	.	.	G	+	2	0	NOS3	150337512	0.020000	0.18652	0.997000	0.53966	0.995000	0.86356	-0.335000	0.07873	0.277000	0.22141	0.555000	0.69702	GGC			0.726	NOS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350750.2		NM_000603	
KAT6A	7994	mdanderson.org	37	8	41839445	41839445	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr8:41839445G>A	ENST00000396930.3	-	5	1280	c.737C>T	c.(736-738)cCt>cTt	p.P246L	KAT6A_ENST00000485568.1_Missense_Mutation_p.P246L|KAT6A_ENST00000265713.2_Missense_Mutation_p.P246L|KAT6A_ENST00000406337.1_Missense_Mutation_p.P246L	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	246	Interaction with PML.				aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										CGTTAGTTCAGGGGAAAACTT	0.413																																					p.P246L													.	.			0			c.C737T												91.0	71.0	77.0					8																	41839445		2203	4300	6503	SO:0001583	missense	7994	exon5			AGTTCAGGGGAAA	U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.737C>T	8.37:g.41839445G>A	ENSP00000380136:p.Pro246Leu		Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_001099412	11	0.00	0	Q76L81	Missense_Mutation	SNP	ENST00000396930.3	37	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	G	17.80	3.477956	0.63849	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930;ENST00000485568	D;D;D;D	0.85411	-1.98;-1.98;-1.98;-1.98	6.06	6.06	0.98353	.	0.153034	0.46145	D	0.000303	D	0.89969	0.6869	L	0.38531	1.155	0.80722	D	1	D;P	0.89917	1.0;0.468	D;P	0.97110	1.0;0.447	D	0.90059	0.4155	10	0.87932	D	0	-10.0804	20.6397	0.99537	0.0:0.0:1.0:0.0	.	246;246	A5PLL3;Q92794	.;KAT6A_HUMAN	L	246	ENSP00000265713:P246L;ENSP00000385888:P246L;ENSP00000380136:P246L;ENSP00000430606:P246L	ENSP00000265713:P246L	P	-	2	0	KAT6A	41958602	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	9.476000	0.97823	2.880000	0.98712	0.650000	0.86243	CCT			0.413	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000318163.1		NM_006766	
PREX2	80243	broad.mit.edu	37	8	68956766	68956766	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr8:68956766T>C	ENST00000288368.4	+	8	1161	c.884T>C	c.(883-885)cTt>cCt	p.L295P	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	295	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						CATCGGTACCTTTTTCGTGGC	0.403																																					p.L295P													.	PREX2	614		0			c.T884C												158.0	147.0	151.0					8																	68956766		2203	4300	6503	SO:0001583	missense	80243	exon8			GGTACCTTTTTCG	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.884T>C	8.37:g.68956766T>C	ENSP00000288368:p.Leu295Pro		Somatic	150	0	0		WXS	Illumina HiSeq	Phase_I	173	0.02	3	NM_025170	7	0.00	0	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	37	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	T	25.3	4.623271	0.87460	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	D	0.88046	-2.33	5.98	5.98	0.97165	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.072732	0.56097	D	0.000026	D	0.90373	0.6987	L	0.38175	1.15	0.80722	D	1	D;P;P	0.69078	0.997;0.485;0.935	D;B;P	0.72075	0.976;0.206;0.709	D	0.91267	0.5041	10	0.66056	D	0.02	.	16.4696	0.84102	0.0:0.0:0.0:1.0	.	295;295;295	Q70Z35-2;Q70Z35;Q70Z35-3	.;PREX2_HUMAN;.	P	295	ENSP00000288368:L295P	ENSP00000288368:L295P	L	+	2	0	PREX2	69119320	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	4.932000	0.63476	2.289000	0.77006	0.482000	0.46254	CTT			0.403	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378620.1		NM_025170	
AGO2	27161	mdanderson.org	37	8	141554337	141554337	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr8:141554337T>C	ENST00000220592.5	-	14	1926	c.1814A>G	c.(1813-1815)gAt>gGt	p.D605G	AGO2_ENST00000519980.1_Missense_Mutation_p.D605G	NM_012154.3	NP_036286.2	Q9UKV8	AGO2_HUMAN	argonaute RISC catalytic component 2	605	Piwi. {ECO:0000255|HAMAP-Rule:MF_03031}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|mRNA cap binding complex (GO:0005845)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|RISC complex (GO:0016442)	endoribonuclease activity (GO:0004521)|endoribonuclease activity, cleaving siRNA-paired mRNA (GO:0070551)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|siRNA binding (GO:0035197)|translation initiation factor activity (GO:0003743)										CTTCTTCCCATCCCCGGCGGG	0.647																																					p.D605G													.	.			0			c.A1814G												99.0	109.0	106.0					8																	141554337		2203	4300	6503	SO:0001583	missense	27161	exon14			TTCCCATCCCCGG	AF121255	CCDS6380.1, CCDS55279.1	8q24.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000123908	ENSG00000123908		"""Argonaute/PIWI family"""	3263	protein-coding gene	gene with protein product	"""argonaute 2"""	606229	"""eukaryotic translation initiation factor 2C, 2"""	EIF2C2		10534406, 12906857	Standard	NM_012154		Approved	hAGO2, Q10	uc003yvn.3	Q9UKV8	OTTHUMG00000164232	ENST00000220592.5:c.1814A>G	8.37:g.141554337T>C	ENSP00000220592:p.Asp605Gly		Somatic	86	0.023255814	2		WXS	Illumina HiSeq	Phase_I	77	0.06	5	NM_012154	10	0.00	0	Q8TCZ5|Q8WV58|Q96ID1	Missense_Mutation	SNP	ENST00000220592.5	37	CCDS6380.1	.	.	.	.	.	.	.	.	.	.	T	28.2	4.900613	0.92035	.	.	ENSG00000123908	ENST00000220592;ENST00000519980	T;T	0.28255	1.62;1.62	5.35	5.35	0.76521	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.60586	0.2280	M	0.86573	2.825	0.80722	D	1	D;D	0.71674	0.998;0.982	D;D	0.69824	0.966;0.964	T	0.67632	-0.5621	10	0.59425	D	0.04	-6.1325	15.6315	0.76912	0.0:0.0:0.0:1.0	.	605;605	Q9UKV8-2;Q9UKV8	.;AGO2_HUMAN	G	605	ENSP00000220592:D605G;ENSP00000430176:D605G	ENSP00000220592:D605G	D	-	2	0	EIF2C2	141623519	1.000000	0.71417	0.854000	0.33618	0.897000	0.52465	7.942000	0.87708	2.151000	0.67156	0.528000	0.53228	GAT			0.647	AGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000377866.4			
RP11-764K9.1	0	broad.mit.edu	37	9	68405044	68405045	+	lincRNA	INS	-	-	C			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr9:68405044_68405045insC	ENST00000417843.2	-	0	224																											atcatcctgataccaaagcctg	0.406																																					.													.	.			0			.																																											0	.			TCCTGATACCAAA																													9.37:g.68405044_68405045insC			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	INS	ENST00000417843.2	37																																																																																						0.406	RP11-764K9.1-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000129817.2			
LRSAM1	90678	mdanderson.org	37	9	130249959	130249959	+	Missense_Mutation	SNP	G	G	T	rs372452916		TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr9:130249959G>T	ENST00000323301.4	+	17	1868	c.1264G>T	c.(1264-1266)Gcc>Tcc	p.A422S	LRSAM1_ENST00000300417.6_Missense_Mutation_p.A422S|LRSAM1_ENST00000373324.4_Missense_Mutation_p.A422S|LRSAM1_ENST00000373322.1_Missense_Mutation_p.A422S|LRSAM1_ENST00000483302.1_3'UTR	NM_138361.5	NP_612370.3	Q6UWE0	LRSM1_HUMAN	leucine rich repeat and sterile alpha motif containing 1	422					cell death (GO:0008219)|negative regulation of endocytosis (GO:0045806)|protein autoubiquitination (GO:0051865)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent endocytosis (GO:0070086)|viral budding (GO:0046755)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(2)	16						TGGCAGCATGGCCGAAATGGA	0.512																																					p.A422S													.	.			0			c.G1264T												76.0	67.0	70.0					9																	130249959		2203	4300	6503	SO:0001583	missense	90678	exon18			AGCATGGCCGAAA	AK056203	CCDS6873.1, CCDS55347.1	9q34.13	2014-09-17			ENSG00000148356	ENSG00000148356		"""Sterile alpha motif (SAM) domain containing"""	25135	protein-coding gene	gene with protein product		610933				12975309	Standard	NM_001005373		Approved	FLJ31641	uc004brd.2	Q6UWE0	OTTHUMG00000020701	ENST00000323301.4:c.1264G>T	9.37:g.130249959G>T	ENSP00000322937:p.Ala422Ser		Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_001190723	62	0.00	0	Q5VVV0|Q8NB40|Q96GT5|Q96MX5|Q96MZ7	Missense_Mutation	SNP	ENST00000323301.4	37	CCDS6873.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.173014	0.78452	.	.	ENSG00000148356	ENST00000300417;ENST00000373324;ENST00000323301;ENST00000373322	T;T;T;T	0.74737	1.32;-0.87;1.32;1.32	5.34	5.34	0.76211	.	0.101533	0.64402	D	0.000002	T	0.80949	0.4722	L	0.39898	1.24	0.49687	D	0.999814	D;D	0.89917	1.0;0.997	D;D	0.85130	0.997;0.985	T	0.78695	-0.2104	10	0.33141	T	0.24	-9.6544	16.5219	0.84319	0.0:0.0:1.0:0.0	.	422;422	Q6UWE0-2;Q6UWE0	.;LRSM1_HUMAN	S	422	ENSP00000300417:A422S;ENSP00000362421:A422S;ENSP00000322937:A422S;ENSP00000362419:A422S	ENSP00000300417:A422S	A	+	1	0	LRSAM1	129289780	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	7.887000	0.87295	2.501000	0.84356	0.655000	0.94253	GCC			0.512	LRSAM1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054164.1		NM_138361	
LRRC8A	56262	broad.mit.edu	37	9	131670156	131670156	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chr9:131670156A>G	ENST00000259324.5	+	3	1236	c.713A>G	c.(712-714)gAg>gGg	p.E238G	LRRC8A_ENST00000372600.4_Missense_Mutation_p.E238G|LRRC8A_ENST00000372599.3_Missense_Mutation_p.E238G	NM_001127244.1	NP_001120716.1	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member A	238					anion transport (GO:0006820)|cell volume homeostasis (GO:0006884)|pre-B cell differentiation (GO:0002329)|response to osmotic stress (GO:0006970)	cell surface (GO:0009986)|ion channel complex (GO:0034702)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(3)	28						AAGGAGGGGGAGCAAGCCAAG	0.607																																					p.E238G													.	LRRC8A	69		0			c.A713G												120.0	115.0	117.0					9																	131670156		2203	4300	6503	SO:0001583	missense	56262	exon3			AGGGGGAGCAAGC	AB037858	CCDS35155.1	9q34.2	2014-09-17	2005-06-29	2005-06-29	ENSG00000136802	ENSG00000136802			19027	protein-coding gene	gene with protein product		608360	"""leucine rich repeat containing 8"""	LRRC8			Standard	NM_001127244		Approved	KIAA1437, FLJ10337	uc010myp.3	Q8IWT6	OTTHUMG00000020766	ENST00000259324.5:c.713A>G	9.37:g.131670156A>G	ENSP00000259324:p.Glu238Gly		Somatic	107	0.0186915888	2		WXS	Illumina HiSeq	Phase_I	78	0.06	5	NM_001127244	99	0.01	1	Q6UXM2|Q8NCI0|Q9P2B1	Missense_Mutation	SNP	ENST00000259324.5	37	CCDS35155.1	.	.	.	.	.	.	.	.	.	.	A	16.57	3.159927	0.57368	.	.	ENSG00000136802	ENST00000372600;ENST00000372599;ENST00000259324	T;T;T	0.35789	1.29;1.29;1.29	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.61602	0.2360	M	0.79123	2.44	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.66822	-0.5826	10	0.87932	D	0	.	14.6237	0.68605	1.0:0.0:0.0:0.0	.	238	Q8IWT6	LRC8A_HUMAN	G	238	ENSP00000361682:E238G;ENSP00000361680:E238G;ENSP00000259324:E238G	ENSP00000259324:E238G	E	+	2	0	LRRC8A	130709977	1.000000	0.71417	1.000000	0.80357	0.680000	0.39746	9.339000	0.96797	2.052000	0.61016	0.460000	0.39030	GAG			0.607	LRRC8A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054516.2		NM_019594	
CSF2RA	1438	broad.mit.edu	37	X	1422911	1422911	+	Splice_Site	SNP	A	A	G			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chrX:1422911A>G	ENST00000381524.3	+	11	1228	c.1042A>G	c.(1042-1044)Agg>Ggg	p.R348G	CSF2RA_ENST00000494969.2_Intron|CSF2RA_ENST00000432318.2_Splice_Site_p.R348G|CSF2RA_ENST00000381500.1_Intron|CSF2RA_ENST00000355805.2_Intron|CSF2RA_ENST00000361536.3_Intron|CSF2RA_ENST00000417535.2_Splice_Site_p.R382G|CSF2RA_ENST00000355432.3_Intron|CSF2RA_ENST00000381529.3_Splice_Site_p.R348G|CSF2RA_ENST00000381509.3_Splice_Site_p.R348G|CSF2RA_ENST00000498153.1_3'UTR|CSF2RA_ENST00000501036.2_Splice_Site_p.R215G			P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)	348					response to ethanol (GO:0045471)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(6)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	45		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	CCTCTTTAAAAGGTAACCTGT	0.527																																					p.R382G	Esophageal Squamous(131;723 1707 25334 40494 41806)												.	CSF2RA	153		0			c.A1144G												306.0	281.0	290.0					X																	1422911		2203	4296	6499	SO:0001630	splice_region_variant	0	exon10			TTTAAAAGGTAAC	M64445	CCDS35190.1, CCDS35191.1, CCDS35192.1, CCDS35193.1, CCDS55359.1, CCDS55360.1, CCDS55361.1	Xp22.32 and Yp11.3	2014-09-17			ENSG00000198223	ENSG00000198223		"""CD molecules"", ""Pseudoautosomal regions / PAR1"""	2435	protein-coding gene	gene with protein product		306250, 425000		CSF2R		1702217	Standard	NM_006140		Approved	CD116	uc010ncv.2	P15509	OTTHUMG00000012533	ENST00000381524.3:c.1043+1A>G	X.37:g.1422911A>G			Somatic	680	0	0		WXS	Illumina HiSeq	Phase_I	521	0.01	6	NM_001161530	23	0.00	0	A7J003|A8KAM1|B4DW68|J3JS76|J3JS77|O00207|Q14429|Q14430|Q14431|Q16564	Splice_Site	SNP	ENST00000381524.3	37	CCDS35191.1	.	.	.	.	.	.	.	.	.	.	.	10.69	1.420514	0.25639	.	.	ENSG00000198223	ENST00000381529;ENST00000432318;ENST00000501036;ENST00000381524;ENST00000381509;ENST00000417535	T;T;T;T;T;T	0.38887	1.11;1.11;1.11;1.11;1.11;1.11	0.806	0.806	0.18708	.	0.350616	0.20762	U	0.086146	T	0.45677	0.1354	.	.	.	0.09310	N	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.997;0.996	T	0.32561	-0.9902	9	0.16896	T	0.51	.	3.8235	0.08845	1.0:0.0:0.0:0.0	.	348;382;348	P15509-2;A7J003;P15509	.;.;CSF2R_HUMAN	G	348;348;215;348;348;382	ENSP00000370940:R348G;ENSP00000416437:R348G;ENSP00000440491:R215G;ENSP00000370935:R348G;ENSP00000370920:R348G;ENSP00000394227:R382G	ENSP00000370920:R348G	R	+	1	2	CSF2RA	1382911	0.746000	0.28272	0.037000	0.18230	0.125000	0.20455	1.194000	0.32174	0.608000	0.30000	0.084000	0.15446	AGG			0.527	CSF2RA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000035013.2			Missense_Mutation
MXRA5	25878	broad.mit.edu	37	X	3229354	3229354	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chrX:3229354C>T	ENST00000217939.6	-	7	7044	c.6890G>A	c.(6889-6891)cGc>cAc	p.R2297H		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2297	Ig-like C2-type 7.					extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GCGCTTGGTGCGTCCACCGCT	0.557																																					p.R2297H													.	MXRA5	815		0			c.G6890A												143.0	108.0	120.0					X																	3229354		2203	4300	6503	SO:0001583	missense	25878	exon7			TTGGTGCGTCCAC	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.6890G>A	X.37:g.3229354C>T	ENSP00000217939:p.Arg2297His		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_015419	432	0.00	0	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	C	13.26	2.185191	0.38609	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.27720	1.65	4.28	4.28	0.50868	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.208446	0.23748	U	0.044956	T	0.53786	0.1818	M	0.67569	2.06	0.24457	N	0.994451	D	0.89917	1.0	D	0.87578	0.998	T	0.49771	-0.8904	10	0.45353	T	0.12	.	16.3313	0.83015	0.0:1.0:0.0:0.0	.	2297	Q9NR99	MXRA5_HUMAN	H	2297	ENSP00000217939:R2297H	ENSP00000217939:R2297H	R	-	2	0	MXRA5	3239354	1.000000	0.71417	0.012000	0.15200	0.038000	0.13279	6.625000	0.74248	1.760000	0.52011	0.509000	0.49947	CGC			0.557	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055655.2		NM_015419	
G6PD	2539	hgsc.bcm.edu	37	X	153764200	153764200	+	Silent	SNP	G	G	T			TCGA-2G-AAG5-01A-11D-A42Y-10	TCGA-2G-AAG5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d27065dd-9387-4607-90e4-352b020179ff	02827416-0bd6-4593-95a9-0a8b5ee9b4f6	g.chrX:153764200G>T	ENST00000393564.2	-	4	331	c.219C>A	c.(217-219)tcC>tcA	p.S73S	G6PD_ENST00000497281.1_5'UTR|G6PD_ENST00000393562.2_Silent_p.S103S|G6PD_ENST00000369620.2_Silent_p.S73S	NM_001042351.1	NP_001035810.1	P11413	G6PD_HUMAN	glucose-6-phosphate dehydrogenase	73					carbohydrate metabolic process (GO:0005975)|cellular response to oxidative stress (GO:0034599)|cholesterol biosynthetic process (GO:0006695)|cytokine production (GO:0001816)|erythrocyte maturation (GO:0043249)|glucose 6-phosphate metabolic process (GO:0051156)|glutathione metabolic process (GO:0006749)|lipid metabolic process (GO:0006629)|NADP metabolic process (GO:0006739)|NADPH regeneration (GO:0006740)|negative regulation of protein glutathionylation (GO:0010734)|oxidation-reduction process (GO:0055114)|pentose biosynthetic process (GO:0019322)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|regulation of neuron apoptotic process (GO:0043523)|response to ethanol (GO:0045471)|response to food (GO:0032094)|response to organic cyclic compound (GO:0014070)|ribose phosphate biosynthetic process (GO:0046390)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	glucose binding (GO:0005536)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(3)|ovary(4)	18	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTGTGAGGCGGGAACGGGCAT	0.632																																					p.S103S													.	.			0			c.C309A												73.0	50.0	58.0					X																	153764200		2203	4300	6503	SO:0001819	synonymous_variant	2539	exon4			GAGGCGGGAACGG	X03674	CCDS14756.2, CCDS44023.1	Xq28	2014-09-17			ENSG00000160211	ENSG00000160211	1.1.1.49		4057	protein-coding gene	gene with protein product		305900				3012556, 2428611	Standard	NM_000402		Approved	G6PD1	uc004flx.1	P11413	OTTHUMG00000024237	ENST00000393564.2:c.219C>A	X.37:g.153764200G>T			Somatic	123	0	0		WXS	Illumina HiSeq	.	90	0.06	5	NM_000402	118	0.00	0	D3DWX9|Q16000|Q16765|Q8IU70|Q8IU88|Q8IUA6|Q96PQ2	Silent	SNP	ENST00000393564.2	37	CCDS44023.1																																																																																					0.632	G6PD-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000061170.3		NM_000402	
