#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
ACTRT2	140625	broad.mit.edu	37	1	2938392	2938392	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr1:2938392T>C	ENST00000378404.2	+	1	347	c.142T>C	c.(142-144)Tca>Cca	p.S48P		NM_080431.4	NP_536356.3	Q8TDY3	ACTT2_HUMAN	actin-related protein T2	48						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26	all_cancers(77;0.00205)|all_epithelial(69;0.0011)|Ovarian(185;0.0634)|Lung NSC(156;0.0893)|all_lung(157;0.0909)	all_epithelial(116;2.66e-20)|all_lung(118;1.56e-08)|Lung NSC(185;2.54e-06)|Breast(487;0.00156)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;7.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.15e-22)|GBM - Glioblastoma multiforme(42;1.1e-12)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000329)|BRCA - Breast invasive adenocarcinoma(365;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.125)		CCAGGCTCCCTCAGCAGAGGC	0.612																																					p.S48P													ACTRT2,NS,adenocarcinoma,0,1	ACTRT2	69	1	0			c.T142C												40.0	40.0	40.0					1																	2938392		2203	4300	6503	SO:0001583	missense	140625	exon1			GCTCCCTCAGCAG	AF440740, AB057364	CCDS45.1	1p36.3	2008-02-05	2005-11-22		ENSG00000169717	ENSG00000169717			24026	protein-coding gene	gene with protein product		608535				11750065, 12243744	Standard	NM_080431		Approved	Arp-T2, ARPM2, FLJ25424	uc001ajz.3	Q8TDY3	OTTHUMG00000000562	ENST00000378404.2:c.142T>C	1.37:g.2938392T>C	ENSP00000367658:p.Ser48Pro		Somatic	122	0.0081967213	1		WXS	Illumina HiSeq	Phase_I	127	0.02	3	NM_080431	0		0	B1AN52|Q8NHS6|Q8TDG1	Missense_Mutation	SNP	ENST00000378404.2	37	CCDS45.1	.	.	.	.	.	.	.	.	.	.	T	6.398	0.441595	0.12164	.	.	ENSG00000169717	ENST00000378404;ENST00000543312	D	0.94613	-3.47	5.03	-0.591	0.11675	.	0.856107	0.09608	N	0.779366	D	0.87759	0.6258	L	0.31845	0.965	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.77219	-0.2668	10	0.87932	D	0	.	1.0412	0.01559	0.214:0.1664:0.1195:0.5001	.	48	Q8TDY3	ACTT2_HUMAN	P	48	ENSP00000367658:S48P	ENSP00000367658:S48P	S	+	1	0	ACTRT2	2928252	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.540000	0.06106	0.290000	0.22444	0.459000	0.35465	TCA			0.612	ACTRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000001331.1		NM_080431	
MEGF6	1953	broad.mit.edu	37	1	3422702	3422702	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr1:3422702G>T	ENST00000356575.4	-	15	2114	c.1888C>A	c.(1888-1890)Cca>Aca	p.P630T	MEGF6_ENST00000294599.4_Missense_Mutation_p.P525T	NM_001409.3	NP_001400.3	O75095	MEGF6_HUMAN	multiple EGF-like-domains 6	630	EGF-like 11. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(2)|endometrium(3)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		TAGAGCCCTGGGTCGCAGAGG	0.637																																					p.P630T	Ovarian(73;978 3658)												.	MEGF6	91		0			c.C1888A												16.0	25.0	22.0					1																	3422702		2013	4145	6158	SO:0001583	missense	1953	exon15			GCCCTGGGTCGCA	AB011539	CCDS41237.1	1p36.3	2008-02-05	2006-03-31	2006-03-31	ENSG00000162591	ENSG00000162591			3232	protein-coding gene	gene with protein product		604266	"""EGF-like-domain, multiple 3"""	EGFL3		9693030	Standard	NM_001409		Approved		uc001akl.3	O75095	OTTHUMG00000000611	ENST00000356575.4:c.1888C>A	1.37:g.3422702G>T	ENSP00000348982:p.Pro630Thr		Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	132	0.03	4	NM_001409	12	0.00	0	Q4AC86|Q5VV39	Missense_Mutation	SNP	ENST00000356575.4	37	CCDS41237.1	.	.	.	.	.	.	.	.	.	.	g	14.94	2.685311	0.47991	.	.	ENSG00000162591	ENST00000294599;ENST00000356575	T;T	0.56444	0.46;0.46	3.77	2.82	0.32997	EGF-like, laminin (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	0.062566	0.64402	U	0.000004	T	0.70369	0.3216	M	0.85099	2.735	0.42968	D	0.994429	D;D	0.57899	0.968;0.981	D;P	0.65233	0.933;0.89	T	0.74651	-0.3594	10	0.48119	T	0.1	-15.5778	11.6893	0.51505	0.0964:0.0:0.9036:0.0	.	630;525	O75095;O75095-2	MEGF6_HUMAN;.	T	525;630	ENSP00000294599:P525T;ENSP00000348982:P630T	ENSP00000294599:P525T	P	-	1	0	MEGF6	3412562	1.000000	0.71417	0.928000	0.36995	0.720000	0.41350	3.812000	0.55628	1.815000	0.52974	0.401000	0.26515	CCA			0.637	MEGF6-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000354866.1		NM_001409	
AHDC1	27245	mdanderson.org	37	1	27875918	27875918	+	Silent	SNP	G	G	A			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr1:27875918G>A	ENST00000247087.5	-	5	3305	c.2709C>T	c.(2707-2709)agC>agT	p.S903S	AHDC1_ENST00000374011.2_Silent_p.S903S			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	903							DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		CCCCAGCCCCGCTGCTACCCA	0.697																																					p.S903S													.	.			0			c.C2709T												19.0	25.0	23.0					1																	27875918		2199	4287	6486	SO:0001819	synonymous_variant	27245	exon6			AGCCCCGCTGCTA	AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.2709C>T	1.37:g.27875918G>A			Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	56	0.05	3	NM_001029882	49	0.00	0	Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Silent	SNP	ENST00000247087.5	37	CCDS30652.1																																																																																					0.697	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000009523.3			
FPGT-TNNI3K	100526835	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	74835124	74835124	+	Silent	SNP	C	C	A	rs41289190		TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr1:74835124C>A	ENST00000370899.3	+	18	1862	c.1825C>A	c.(1825-1827)Cga>Aga	p.R609R	TNNI3K_ENST00000370891.2_Silent_p.R609R|TNNI3K_ENST00000326637.3_Silent_p.R508R|RP11-439H8.4_ENST00000415549.2_RNA|FPGT-TNNI3K_ENST00000557284.2_Silent_p.R622R|FPGT-TNNI3K_ENST00000370895.1_Silent_p.R609R	NM_001199327.1	NP_001186256			FPGT-TNNI3K readthrough									p.R508*(1)									TATGTTTTGCCGAGAGGTGTC	0.448																																					p.R609R													TNNI3K,NS,carcinoma,0,2	TNNI3K	0	2	1	Substitution - Nonsense(1)	kidney(1)	c.C1825A												199.0	174.0	182.0					1																	74835124		2203	4300	6503	SO:0001819	synonymous_variant	100526835	exon18			TTTTGCCGAGAGG			1p31.3	2014-03-14			ENSG00000259030	ENSG00000259030			42952	other	readthrough							Standard	NM_001112808		Approved		uc001dge.2		OTTHUMG00000166281	ENST00000370899.3:c.1825C>A	1.37:g.74835124C>A			Somatic	152	0	0		WXS	Illumina HiSeq	.	153	0.17	26	NM_001199327	7	0.14	1		Silent	SNP	ENST00000370899.3	37																																																																																						0.448	FPGT-TNNI3K-003	NOVEL	basic|appris_candidate|readthrough_transcript|exp_conf	protein_coding	protein_coding		OTTHUMT00000026438.3			
ATP1A1	476	broad.mit.edu	37	1	116946529	116946529	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr1:116946529T>C	ENST00000295598.5	+	22	3227	c.2975T>C	c.(2974-2976)tTc>tCc	p.F992S	ATP1A1_ENST00000369496.4_Missense_Mutation_p.F961S|ATP1A1OS_ENST00000369491.1_RNA|ATP1A1_ENST00000537345.1_Missense_Mutation_p.F992S|ATP1A1OS_ENST00000369492.4_RNA	NM_000701.7	NP_000692.2	P05023	AT1A1_HUMAN	ATPase, Na+/K+ transporting, alpha 1 polypeptide	992					ATP biosynthetic process (GO:0006754)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|membrane hyperpolarization (GO:0060081)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of glucocorticoid biosynthetic process (GO:0031947)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart contraction (GO:0045823)|positive regulation of striated muscle contraction (GO:0045989)|potassium ion import (GO:0010107)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of sodium ion transport (GO:0002028)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|chaperone binding (GO:0051087)|phosphatase activity (GO:0016791)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(2)|breast(2)|cervix(3)|endometrium(2)|kidney(5)|large_intestine(9)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Ciclopirox(DB01188)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Ethacrynic acid(DB00903)|Hydroflumethiazide(DB00774)|Ouabain(DB01092)|Trichlormethiazide(DB01021)	TTCTGTGCCTTCCCCTACTCT	0.443																																					p.F992S													.	ATP1A1	87		0			c.T2975C												226.0	222.0	223.0					1																	116946529		2203	4300	6503	SO:0001583	missense	476	exon22			GTGCCTTCCCCTA	D00099	CCDS887.1, CCDS53351.1, CCDS53352.1	1p13	2012-10-22			ENSG00000163399	ENSG00000163399	3.6.3.9	"""ATPases / P-type"""	799	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-1"", ""sodium pump subunit alpha-1"", ""sodium-potassium ATPase catalytic subunit alpha-1"""	182310					Standard	NM_000701		Approved		uc001ege.3	P05023	OTTHUMG00000012109	ENST00000295598.5:c.2975T>C	1.37:g.116946529T>C	ENSP00000295598:p.Phe992Ser		Somatic	124	0	0		WXS	Illumina HiSeq	Phase_I	149	0.02	3	NM_000701	845	0.00	0	B2RBR6|B7Z2T5|B7Z3U6|F5H3A1|Q16689|Q6LDM4|Q9UCN1|Q9UJ20|Q9UJ21	Missense_Mutation	SNP	ENST00000295598.5	37	CCDS887.1	.	.	.	.	.	.	.	.	.	.	T	18.50	3.637287	0.67130	.	.	ENSG00000163399	ENST00000295598;ENST00000537345;ENST00000369496	D;D;D	0.96073	-3.9;-3.9;-3.9	5.35	4.23	0.50019	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.93291	0.7862	M	0.73962	2.25	0.80722	D	1	B;B	0.32188	0.309;0.359	B;B	0.40534	0.223;0.332	D	0.92328	0.5871	10	0.72032	D	0.01	.	10.7256	0.46066	0.0:0.0756:0.0:0.9244	.	992;992	F5H3A1;P05023	.;AT1A1_HUMAN	S	992;992;961	ENSP00000295598:F992S;ENSP00000445306:F992S;ENSP00000358508:F961S	ENSP00000295598:F992S	F	+	2	0	ATP1A1	116748052	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.033000	0.88852	0.871000	0.35750	0.533000	0.62120	TTC			0.443	ATP1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000033481.5		NM_001160233	
TCHH	7062	mdanderson.org	37	1	152082647	152082647	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr1:152082647A>G	ENST00000368804.1	-	2	3045	c.3046T>C	c.(3046-3048)Tgg>Cgg	p.W1016R		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1016	10 X 30 AA tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)	p.W1016R(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			tgcctctcccactcctggcgc	0.582																																					p.W1016R													TCHH,extremity,malignant_melanoma,0,1	TCHH	0	1	1	Substitution - Missense(1)	skin(1)	c.T3046C												98.0	100.0	99.0					1																	152082647		1974	4149	6123	SO:0001583	missense	7062	exon3			TCTCCCACTCCTG	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.3046T>C	1.37:g.152082647A>G	ENSP00000357794:p.Trp1016Arg		Somatic	100	0.06	6		WXS	Illumina HiSeq	Phase_I	114	0.08	9	NM_007113	3	0.00	0	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	a	1.987	-0.432633	0.04669	.	.	ENSG00000159450	ENST00000368804	T	0.03745	3.82	1.9	-0.341	0.12639	.	.	.	.	.	T	0.00328	0.0010	N	0.01352	-0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38607	-0.9653	9	0.13108	T	0.6	.	2.7919	0.05390	0.17:0.0:0.3552:0.4748	.	1016	Q07283	TRHY_HUMAN	R	1016	ENSP00000357794:W1016R	ENSP00000357794:W1016R	W	-	1	0	TCHH	150349271	0.002000	0.14202	0.001000	0.08648	0.053000	0.15095	0.265000	0.18515	-0.507000	0.06549	-0.381000	0.06696	TGG			0.582	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000036671.2		NM_007113	
ASPM	259266	broad.mit.edu	37	1	197070295	197070295	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr1:197070295G>T	ENST00000367409.4	-	18	8342	c.8086C>A	c.(8086-8088)Cag>Aag	p.Q2696K	ASPM_ENST00000294732.7_Intron|ASPM_ENST00000367408.1_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	2696	IQ 29. {ECO:0000255|PROSITE- ProRule:PRU00116}.|IQ 30. {ECO:0000255|PROSITE- ProRule:PRU00116}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TAGAATGACTGAATTAGTGTG	0.363																																					p.Q2696K													.	ASPM	444		0			c.C8086A												51.0	50.0	50.0					1																	197070295		2203	4298	6501	SO:0001583	missense	259266	exon18			ATGACTGAATTAG	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.8086C>A	1.37:g.197070295G>T	ENSP00000356379:p.Gln2696Lys		Somatic	133	0.007518797	1		WXS	Illumina HiSeq	Phase_I	149	0.03	5	NM_018136	53	0.00	0	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	G	19.22	3.784962	0.70222	.	.	ENSG00000066279	ENST00000367409;ENST00000367406	D	0.86297	-2.1	4.73	2.79	0.32731	.	0.212131	0.33309	N	0.005058	D	0.93890	0.8045	M	0.92077	3.27	0.80722	D	1	D;D	0.89917	0.957;1.0	D;D	0.97110	0.981;1.0	D	0.93036	0.6453	10	0.87932	D	0	.	9.476	0.38871	0.0762:0.0:0.7811:0.1427	.	682;2696	E7EQ84;Q8IZT6	.;ASPM_HUMAN	K	2696;682	ENSP00000356379:Q2696K	ENSP00000356376:Q682K	Q	-	1	0	ASPM	195336918	1.000000	0.71417	0.153000	0.22517	0.861000	0.49209	2.396000	0.44468	0.489000	0.27749	0.557000	0.71058	CAG			0.363	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000088256.1		NM_018136	
PITRM1	10531	mdanderson.org	37	10	3214936	3214936	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr10:3214936A>G	ENST00000224949.4	-	1	63	c.29T>C	c.(28-30)cTg>cCg	p.L10P	PITRM1_ENST00000380989.2_Missense_Mutation_p.L10P|PITRM1_ENST00000451104.2_Silent_p.P12P			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1	10					positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						CAGCACACACAGGCCCTGCCG	0.756																																					p.L10P													.	.			0			c.T29C												4.0	7.0	6.0					10																	3214936		1868	3764	5632	SO:0001583	missense	10531	exon1			ACACACAGGCCCT	AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.29T>C	10.37:g.3214936A>G	ENSP00000224949:p.Leu10Pro		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	25	0.12	3	NM_001242307	24	0.00	0	B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	Missense_Mutation	SNP	ENST00000224949.4	37	CCDS59208.1	.	.	.	.	.	.	.	.	.	.	A	12.26	1.884187	0.33255	.	.	ENSG00000107959	ENST00000224949;ENST00000380989	T;T	0.04551	3.6;3.6	3.31	-6.36	0.01969	.	1.048000	0.07627	N	0.927996	T	0.03136	0.0092	.	.	.	0.09310	N	0.999996	P;P	0.44946	0.846;0.761	B;B	0.39258	0.295;0.154	T	0.37009	-0.9724	9	0.33940	T	0.23	.	6.9891	0.24745	0.2138:0.6312:0.155:0.0	.	10;10	Q5JRX3-2;Q5JRX3	.;PREP_HUMAN	P	10	ENSP00000224949:L10P;ENSP00000370377:L10P	ENSP00000224949:L10P	L	-	2	0	PITRM1	3204936	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.068000	0.11561	-0.836000	0.04229	0.260000	0.18958	CTG			0.756	PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000046469.2			
BTAF1	9044	broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	93784712	93784712	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr10:93784712C>G	ENST00000265990.6	+	35	5371	c.5063C>G	c.(5062-5064)tCc>tGc	p.S1688C	BTAF1_ENST00000544642.1_Missense_Mutation_p.S516C	NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	1688	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				CAGAGGCATTCCATTGTTTCC	0.378																																					p.S1688C													.	BTAF1	148		0			c.C5063G												116.0	110.0	112.0					10																	93784712		2203	4300	6503	SO:0001583	missense	9044	exon35			GGCATTCCATTGT	AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.5063C>G	10.37:g.93784712C>G	ENSP00000265990:p.Ser1688Cys		Somatic	141	0	0		WXS	Illumina HiSeq	Phase_I	142	0.04	5	NM_003972	78	0.04	3	B4E0W6|O43578	Missense_Mutation	SNP	ENST00000265990.6	37	CCDS7419.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.236224	0.79800	.	.	ENSG00000095564	ENST00000265990;ENST00000544642;ENST00000538688	T;T	0.75938	-0.98;-0.98	5.99	5.99	0.97316	Helicase, C-terminal (3);	0.167882	0.53938	D	0.000041	D	0.84651	0.5519	L	0.59967	1.855	0.80722	D	1	D	0.67145	0.996	D	0.67231	0.95	D	0.84190	0.0444	10	0.62326	D	0.03	-6.4126	20.4756	0.99175	0.0:1.0:0.0:0.0	.	1688	O14981	BTAF1_HUMAN	C	1688;516;538	ENSP00000265990:S1688C;ENSP00000439924:S516C	ENSP00000265990:S1688C	S	+	2	0	BTAF1	93774692	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.874000	0.63064	2.847000	0.97988	0.655000	0.94253	TCC			0.378	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049380.4		NM_003972	
TPP1	1200	mdanderson.org	37	11	6637242	6637242	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr11:6637242G>T	ENST00000299427.6	-	9	1199	c.1139C>A	c.(1138-1140)gCc>gAc	p.A380D	RP11-732A19.9_ENST00000545572.1_RNA|TPP1_ENST00000534644.1_5'Flank|TPP1_ENST00000533371.1_Missense_Mutation_p.A137D	NM_000391.3	NP_000382.3	P49638	TTPA_HUMAN	tripeptidyl peptidase I	0					embryonic placenta development (GO:0001892)|intermembrane transport (GO:0046909)|intracellular pH reduction (GO:0051452)|lipid metabolic process (GO:0006629)|negative regulation of cell death (GO:0060548)|negative regulation of establishment of blood-brain barrier (GO:0090212)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|response to toxic substance (GO:0009636)|transport (GO:0006810)|vitamin E metabolic process (GO:0042360)|vitamin transport (GO:0051180)	cytosol (GO:0005829)|late endosome (GO:0005770)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;3.45e-09)|BRCA - Breast invasive adenocarcinoma(625;0.131)	Vitamin E(DB00163)	TTACCTGGAGGCAGGGAAGGT	0.507																																					p.A380D													TPP1,NS,carcinoma,-1,1	TPP1	-1	1	0			c.C1139A												111.0	96.0	101.0					11																	6637242		2201	4296	6497	SO:0001583	missense	1200	exon9			CTGGAGGCAGGGA	AF017456	CCDS7770.1	11p15.4	2014-09-17	2004-12-09	2004-12-10	ENSG00000166340	ENSG00000166340			2073	protein-coding gene	gene with protein product	"""TPP I"""	607998	"""ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease)"", ""spinocerebellar ataxia, autosomal recessive 7"""	CLN2, SCAR7		9653647, 23418007	Standard	NM_000391		Approved		uc001mel.1	O14773	OTTHUMG00000133404	ENST00000299427.6:c.1139C>A	11.37:g.6637242G>T	ENSP00000299427:p.Ala380Asp		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_000391	154	0.00	0	Q71V64	Missense_Mutation	SNP	ENST00000299427.6	37	CCDS7770.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.345678	0.82022	.	.	ENSG00000166340	ENST00000299427;ENST00000533371	D;D	0.95518	-3.73;-3.73	5.56	5.56	0.83823	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	D	0.98261	0.9424	M	0.91140	3.18	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99139	1.0855	10	0.87932	D	0	-10.4616	18.5131	0.90925	0.0:0.0:1.0:0.0	.	380	O14773	TPP1_HUMAN	D	380;137	ENSP00000299427:A380D;ENSP00000437066:A137D	ENSP00000299427:A380D	A	-	2	0	TPP1	6593818	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	6.507000	0.73717	2.623000	0.88846	0.561000	0.74099	GCC			0.507	TPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257261.2			
CD6	923	ucsc.edu	37	11	60777289	60777289	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr11:60777289C>T	ENST00000313421.7	+	5	1213	c.1027C>T	c.(1027-1029)Cgg>Tgg	p.R343W	CD6_ENST00000352009.5_Missense_Mutation_p.R343W|CD6_ENST00000452451.2_Missense_Mutation_p.R343W|CD6_ENST00000346437.4_Missense_Mutation_p.R343W|CD6_ENST00000344028.5_Missense_Mutation_p.R343W|CD6_ENST00000545105.1_Intron	NM_006725.4	NP_006716.3	P30203	CD6_HUMAN	CD6 molecule	343	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.				cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	scavenger receptor activity (GO:0005044)			endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)	18						CTGCTCCTGGCGGTTCAACAA	0.602																																					p.R343W	Pancreas(169;904 2017 4767 38890 42505)												.	CD6	122		0			c.C1027T												60.0	58.0	59.0					11																	60777289		2203	4299	6502	SO:0001583	missense	923	exon5			TCCTGGCGGTTCA		CCDS7999.1, CCDS58137.1, CCDS58138.1	11q12.2	2006-03-28	2006-03-28		ENSG00000013725	ENSG00000013725		"""CD molecules"""	1691	protein-coding gene	gene with protein product		186720	"""CD6 antigen"""			9013954	Standard	NM_006725		Approved	Tp120	uc001nqq.3	P30203	OTTHUMG00000167823	ENST00000313421.7:c.1027C>T	11.37:g.60777289C>T	ENSP00000323280:p.Arg343Trp		Somatic	25	0	0		WXS	Illumina HiSeq		39	0.10	4	NM_006725	17	0.00	0	A4KAD4|A4KAD5|Q9UMF2|Q9Y4K7|Q9Y4K8|Q9Y4K9|Q9Y4L0	Missense_Mutation	SNP	ENST00000313421.7	37	CCDS7999.1	.	.	.	.	.	.	.	.	.	.	C	15.57	2.871314	0.51695	.	.	ENSG00000013725	ENST00000344028;ENST00000346437;ENST00000313421;ENST00000452451;ENST00000352009	T;T;T;T;T	0.36520	1.25;1.25;1.25;1.25;1.25	4.67	-2.53	0.06326	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.099482	0.41605	D	0.000846	T	0.52338	0.1728	M	0.81497	2.545	0.24477	N	0.994366	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.985;0.985;0.98;1.0	T	0.44697	-0.9311	10	0.49607	T	0.09	.	7.3641	0.26762	0.6052:0.2319:0.0991:0.0638	.	343;343;343;343	P30203-5;P30203-4;P30203;Q8N4Q7	.;.;CD6_HUMAN;.	W	343	ENSP00000344108:R343W;ENSP00000345566:R343W;ENSP00000323280:R343W;ENSP00000390676:R343W;ENSP00000340628:R343W	ENSP00000323280:R343W	R	+	1	2	CD6	60533865	0.000000	0.05858	0.910000	0.35882	0.689000	0.40095	-1.715000	0.01880	-0.572000	0.06006	-0.233000	0.12211	CGG			0.602	CD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000396449.1		NM_006725	
GANAB	23193	hgsc.bcm.edu	37	11	62400201	62400201	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr11:62400201G>T	ENST00000356638.3	-	9	848	c.832C>A	c.(832-834)Cgc>Agc	p.R278S	GANAB_ENST00000540933.1_Missense_Mutation_p.R181S|GANAB_ENST00000534779.1_Missense_Mutation_p.R186S|GANAB_ENST00000346178.4_Missense_Mutation_p.R300S|GANAB_ENST00000534422.1_5'Flank	NM_198334.1	NP_938148.1	Q14697	GANAB_HUMAN	glucosidase, alpha; neutral AB	278					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|glucosidase II complex (GO:0017177)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|glucan 1,3-alpha-glucosidase activity (GO:0033919)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|skin(2)|urinary_tract(3)	35					Miglitol(DB00491)	TTGTAGAGGCGATATGGCTCC	0.542																																					p.R300S	Melanoma(23;1005 1074 15747 18937)												GANAB,NS,carcinoma,+1,1	GANAB	1	1	0			c.C898A												166.0	156.0	160.0					11																	62400201		2202	4299	6501	SO:0001583	missense	23193	exon10			AGAGGCGATATGG	AF144074	CCDS8026.1, CCDS41656.1, CCDS60817.1, CCDS60818.1	11q12.3	2012-10-02			ENSG00000089597	ENSG00000089597	3.2.1.20		4138	protein-coding gene	gene with protein product		104160				10764838, 6342981	Standard	NM_198335		Approved	GluII, G2AN, KIAA0088	uc001nua.4	Q14697	OTTHUMG00000167696	ENST00000356638.3:c.832C>A	11.37:g.62400201G>T	ENSP00000349053:p.Arg278Ser		Somatic	59	0	0		WXS	Illumina HiSeq	.	56	0.05	3	NM_198335	313	0.00	0	A6NC20|Q8WTS9|Q9P0X0	Missense_Mutation	SNP	ENST00000356638.3	37	CCDS8026.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.464889	0.84425	.	.	ENSG00000089597	ENST00000346178;ENST00000356638;ENST00000534779;ENST00000540933	D;D;D;D	0.93247	-3.19;-3.19;-3.19;-3.19	5.19	5.19	0.71726	Glycoside hydrolase-type carbohydrate-binding (1);	0.000000	0.85682	D	0.000000	D	0.97807	0.9280	H	0.96111	3.77	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.994;0.975	D;D;D;D	0.97110	1.0;1.0;0.961;0.934	D	0.98727	1.0711	10	0.87932	D	0	-17.1059	16.2545	0.82505	0.0:0.0:1.0:0.0	.	164;186;278;300	B4DIW2;E9PKU7;Q14697;Q14697-2	.;.;GANAB_HUMAN;.	S	300;278;186;181	ENSP00000340466:R300S;ENSP00000349053:R278S;ENSP00000435306:R186S;ENSP00000442962:R181S	ENSP00000340466:R300S	R	-	1	0	GANAB	62156777	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.444000	0.80532	2.706000	0.92434	0.455000	0.32223	CGC			0.542	GANAB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000395689.1		NM_198334	
C11orf95	65998	mdanderson.org	37	11	63533328	63533328	+	lincRNA	SNP	C	C	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr11:63533328C>T	ENST00000546282.2	-	0	738				C11orf95_ENST00000433688.1_lincRNA																							cctcctcctcctcttcttcct	0.682																																					p.E196E													.	.			0			c.G588A												21.0	17.0	18.0					11																	63533328		692	1590	2282			65998	exon2			CTCCTCCTCTTCT																													11.37:g.63533328C>T			Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	20	0.15	3	NM_001144936	3	0.00	0		Silent	SNP	ENST00000546282.2	37																																																																																						0.682	RP11-466C23.4-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000396567.2			
KDM2A	22992	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	66948868	66948871	+	Splice_Site	DEL	AAGT	AAGT	-			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	AAGT	AAGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr11:66948868_66948871delAAGT	ENST00000529006.2	+	4	705_706	c.259_260delAAGT	c.(259-261)aag>g	p.K87fs	KDM2A_ENST00000398645.2_Splice_Site_p.K87fs	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	87					histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						ACTCGGAATAAAGTAAGTGTTTTC	0.397																																					p.86_87del													.	.			0			c.258_260del																																									SO:0001630	splice_region_variant	22992	exon4			GGAATAAAGTAAG	BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.260+1AAGT>-	11.37:g.66948872_66948875delAAGT			Somatic	83	0	0		WXS	Illumina HiSeq	.	96	0.23	22	NM_012308	11	0.00	0	D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	In_Frame_Del	DEL	ENST00000529006.2	37	CCDS44657.1																																																																																					0.397	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393140.2		NM_012308	Frame_Shift_Del
PITPNM1	9600	mdanderson.org	37	11	67261233	67261233	+	Missense_Mutation	SNP	G	G	T	rs370108604	byFrequency	TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr11:67261233G>T	ENST00000534749.1	-	20	3272	c.3084C>A	c.(3082-3084)gaC>gaA	p.D1028E	PITPNM1_ENST00000526450.1_5'UTR|PITPNM1_ENST00000436757.2_Missense_Mutation_p.D1027E|PITPNM1_ENST00000356404.3_Missense_Mutation_p.D1028E			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	1028					brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						TGAAGGAGCCGTCGATGCTGA	0.687																																					p.D1028E	GBM(28;144 709 4607 5525)												.	.			0			c.C3084A												22.0	20.0	21.0					11																	67261233		2081	4071	6152	SO:0001583	missense	9600	exon21			GGAGCCGTCGATG	X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.3084C>A	11.37:g.67261233G>T	ENSP00000437286:p.Asp1028Glu		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_004910	35	0.00	0	A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Missense_Mutation	SNP	ENST00000534749.1	37	CCDS31620.1	.	.	.	.	.	.	.	.	.	.	G	19.99	3.929501	0.73327	.	.	ENSG00000110697	ENST00000534749;ENST00000436757;ENST00000356404	D;D;D	0.92805	-3.11;-3.11;-3.11	4.2	-0.124	0.13523	HAD-like domain (2);LNS2, Lipin/Ned1/Smp2 (2);	0.000000	0.51477	D	0.000097	D	0.95720	0.8608	M	0.90977	3.165	0.48632	D	0.999687	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.93925	0.7209	10	0.87932	D	0	-33.2812	8.4307	0.32755	0.5319:0.0:0.4681:0.0	.	1027;1028	O00562-2;O00562	.;PITM1_HUMAN	E	1028;1027;1028	ENSP00000437286:D1028E;ENSP00000398787:D1027E;ENSP00000348772:D1028E	ENSP00000348772:D1028E	D	-	3	2	PITPNM1	67017809	0.861000	0.29849	0.999000	0.59377	0.991000	0.79684	-0.024000	0.12435	0.026000	0.15269	-0.339000	0.08088	GAC			0.687	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000395520.1		NM_004910	
DDX6	1656	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	118627002	118627002	+	Silent	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr11:118627002G>T	ENST00000526070.2	-	11	1501	c.1141C>A	c.(1141-1143)Cga>Aga	p.R381R	DDX6_ENST00000264018.4_Silent_p.R381R|DDX6_ENST00000534980.1_Silent_p.R381R	NM_001257191.1	NP_001244120.1	P26196	DDX6_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 6	381	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cytoplasmic mRNA processing body assembly (GO:0033962)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	13	all_hematologic(175;0.0839)	Renal(330;0.0183)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)|Hepatocellular(160;0.0893)|Breast(348;0.0979)|all_hematologic(192;0.103)		OV - Ovarian serous cystadenocarcinoma(223;3.39e-06)|BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Colorectal(284;0.0377)		AAGCCATTTCGGAAATCATGA	0.353			T	IGH@	B-NHL																																p.R381R				Dom	yes		11	11q23.3	1656	DEAD (Asp-Glu-Ala-Asp) box polypeptide 6		L	.	.			0			c.C1141A												76.0	71.0	73.0					11																	118627002		1834	4074	5908	SO:0001819	synonymous_variant	1656	exon11			CATTTCGGAAATC	D17532	CCDS44751.1	11q23.3	2012-02-23	2012-02-23		ENSG00000110367	ENSG00000110367		"""DEAD-boxes"""	2747	protein-coding gene	gene with protein product		600326	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 6 (RNA helicase, 54kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 6"""	HLR2		1579499, 11839790	Standard	NM_004397		Approved	RCK	uc001pub.2	P26196	OTTHUMG00000166411	ENST00000526070.2:c.1141C>A	11.37:g.118627002G>T			Somatic	39	0	0		WXS	Illumina HiSeq	.	42	0.29	12	NM_004397	107	0.49	52	Q5D048	Silent	SNP	ENST00000526070.2	37	CCDS44751.1																																																																																					0.353	DDX6-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000389647.2		NM_004397	
VPS26B	112936	mdanderson.org	37	11	134114845	134114845	+	Silent	SNP	G	G	T	rs541501826		TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr11:134114845G>T	ENST00000281187.5	+	5	1213	c.735G>T	c.(733-735)ccG>ccT	p.P245P	VPS26B_ENST00000525095.2_Silent_p.P245P	NM_052875.3	NP_443107.1	Q4G0F5	VP26B_HUMAN	vacuolar protein sorting 26 homolog B (S. pombe)	245					protein transport (GO:0015031)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)	14	all_hematologic(175;0.127)	all_cancers(12;1.1e-21)|all_epithelial(12;3.77e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;2.43e-10)|all cancers(11;2.94e-09)|BRCA - Breast invasive adenocarcinoma(10;9.57e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00164)|Lung(977;0.216)		AGTCCATCCCGATCCGGCTCT	0.587											OREG0021548	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P245P	Colon(171;1263 1952 15904 45703 47982)												VPS26B,NS,carcinoma,+1,1	VPS26B	1	1	0			c.G735T												64.0	60.0	61.0					11																	134114845		2201	4297	6498	SO:0001819	synonymous_variant	112936	exon5			CATCCCGATCCGG		CCDS8495.1	11q25	2008-02-05	2007-01-12		ENSG00000151502	ENSG00000151502			28119	protein-coding gene	gene with protein product		610027	"""vacuolar protein sorting 26 homolog B (yeast)"""			16190980	Standard	NM_052875		Approved	MGC10485, Pep8b	uc001qhe.3	Q4G0F5	OTTHUMG00000167175	ENST00000281187.5:c.735G>T	11.37:g.134114845G>T			Somatic	41	0	0	1608	WXS	Illumina HiSeq	Phase_I	31	0.10	3	NM_052875	75	0.00	0	Q96A55	Silent	SNP	ENST00000281187.5	37	CCDS8495.1																																																																																					0.587	VPS26B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393591.1		NM_052875	
PRB3	5544	broad.mit.edu	37	12	11420543	11420543	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr12:11420543G>T	ENST00000279573.7	-	3	775	c.640C>A	c.(640-642)Cag>Aag	p.Q214K	PRB3_ENST00000381842.3_Intron|PRB3_ENST00000538488.1_Missense_Mutation_p.Q193K|PRB3_ENST00000440870.3_Intron			Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	214	10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|Pro-rich.		Missing (in allele S).		defense response to Gram-negative bacterium (GO:0050829)	extracellular region (GO:0005576)		p.Q193K(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(5)	25			OV - Ovarian serous cystadenocarcinoma(49;0.201)			CCTTGGGACTGGTTTCCTCCT	0.622																																					p.Q214K													PRB3_ENST00000538488,NS,carcinoma,0,1	PRB3	84	1	1	Substitution - Missense(1)	endometrium(1)	c.C640A												82.0	96.0	92.0					12																	11420543		1630	3602	5232	SO:0001583	missense	5544	exon3			GGGACTGGTTTCC			12p13.2	2012-10-02				ENSG00000197870			9339	protein-coding gene	gene with protein product		168840				1894623	Standard	NM_006249		Approved	PRG	uc001qzs.3	Q04118		ENST00000279573.7:c.640C>A	12.37:g.11420543G>T	ENSP00000279573:p.Gln214Lys		Somatic	128	0.03125	4		WXS	Illumina HiSeq	Phase_I	282	0.03	9	NM_006249	1	0.00	0	Q15188|Q4VAY3|Q4VAY4|Q7M4M9|Q9UCT9	RNA	SNP	ENST00000279573.7	37		.	.	.	.	.	.	.	.	.	.	.	0.016	-1.536231	0.00942	.	.	ENSG00000197870	ENST00000538488	T	0.06068	3.35	1.25	0.286	0.15710	.	.	.	.	.	T	0.02380	0.0073	.	.	.	0.09310	N	1	B	0.16603	0.018	B	0.11329	0.006	T	0.46978	-0.9152	8	0.05959	T	0.93	.	5.8035	0.18428	0.0:0.0:0.46:0.54	.	214	Q04118	PRB3_HUMAN	K	193	ENSP00000442626:Q193K	ENSP00000279573:Q214K	Q	-	1	0	PRB3	11311810	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.468000	0.06656	0.064000	0.16427	-1.210000	0.01631	CAG			0.622	PRB3-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000402119.5		NM_006249	
KRAS	3845	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	25380271	25380271	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr12:25380271C>T	ENST00000256078.4	-	3	250	c.187G>A	c.(187-189)Gag>Aag	p.E63K	AC087239.1_ENST00000594112.1_5'Flank|KRAS_ENST00000311936.3_Missense_Mutation_p.E63K|KRAS_ENST00000557334.1_Intron	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	63					actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.E63K(2)|p.E63del(1)|p.E62_S65>D(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCACTGTACTCCTCTTGACCT	0.423		119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.E63K	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)			Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS_ENST00000256078,caecum,carcinoma,0,6	KRAS_ENST00000256078	0	6	4	Substitution - Missense(2)|Complex - deletion inframe(1)|Deletion - In frame(1)	large_intestine(2)|thyroid(1)|haematopoietic_and_lymphoid_tissue(1)	c.G187A												113.0	101.0	105.0					12																	25380271		2203	4300	6503	SO:0001583	missense	3845	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	TGTACTCCTCTTG	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.187G>A	12.37:g.25380271C>T	ENSP00000256078:p.Glu63Lys		Somatic	97	0.0103092784	1		WXS	Illumina HiSeq	.	218	0.19	42	NM_004985	127	0.26	33	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	35	5.552920	0.96501	.	.	ENSG00000133703	ENST00000311936;ENST00000256078	T;T	0.77489	-1.1;-1.1	5.63	5.63	0.86233	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84215	0.5423	L	0.47016	1.485	0.80722	D	1	D;D	0.64830	0.994;0.985	P;P	0.62298	0.9;0.77	D	0.85043	0.0924	10	0.87932	D	0	.	19.0279	0.92941	0.0:1.0:0.0:0.0	.	63;63	P01116-2;P01116	.;RASK_HUMAN	K	63	ENSP00000308495:E63K;ENSP00000256078:E63K	ENSP00000256078:E63K	E	-	1	0	KRAS	25271538	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.763000	0.85283	2.805000	0.96524	0.655000	0.94253	GAG			0.423	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000412232.1		NM_033360	
SPATS2	65244	broad.mit.edu	37	12	49908383	49908383	+	Silent	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr12:49908383G>T	ENST00000553127.1	+	11	1398	c.885G>T	c.(883-885)gtG>gtT	p.V295V	SPATS2_ENST00000552557.1_3'UTR|SPATS2_ENST00000552918.1_Silent_p.V295V|SPATS2_ENST00000321898.6_Silent_p.V295V			Q86XZ4	SPAS2_HUMAN	spermatogenesis associated, serine-rich 2	295						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(1)|prostate(1)|urinary_tract(4)	21						TGGACAAAGTGAAAGCTGAAG	0.328																																					p.V295V													.	SPATS2	43		0			c.G885T												100.0	101.0	101.0					12																	49908383		2203	4300	6503	SO:0001819	synonymous_variant	65244	exon10			CAAAGTGAAAGCT	AK023179	CCDS31794.1	12q13.12	2009-06-12							18650	protein-coding gene	gene with protein product		611667				11944913, 17989879	Standard	NM_023071		Approved	SPATA10, SCR59, FLJ13117	uc001rud.2	Q86XZ4		ENST00000553127.1:c.885G>T	12.37:g.49908383G>T			Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	99	0.04	4	NM_023071	111	0.00	0	A8K8G9|Q9H7D4|Q9H8Y7|Q9H8Z8	Silent	SNP	ENST00000553127.1	37	CCDS31794.1																																																																																					0.328	SPATS2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404023.1		NM_023071	
LETMD1	25875	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	51445948	51445948	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr12:51445948G>C	ENST00000262055.4	+	3	387	c.348G>C	c.(346-348)aaG>aaC	p.K116N	LETMD1_ENST00000418425.2_Missense_Mutation_p.K116N|LETMD1_ENST00000550929.1_Missense_Mutation_p.K60N|LETMD1_ENST00000547008.1_Missense_Mutation_p.K116N|LETMD1_ENST00000548516.1_Intron|LETMD1_ENST00000380123.2_Intron|LETMD1_ENST00000552739.1_Intron	NM_015416.4	NP_056231.3	Q6P1Q0	LTMD1_HUMAN	LETM1 domain containing 1	116	LETM1.					integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)				central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(3)	16						ACAATATAAAGTTTCATCAAC	0.413																																					p.K116N													.	.			0			c.G348C												98.0	100.0	99.0					12																	51445948		2203	4300	6503	SO:0001583	missense	25875	exon3			TATAAAGTTTCAT	AF195651	CCDS8806.1, CCDS58231.1, CCDS73469.1	12q13.13	2006-04-12				ENSG00000050426			24241	protein-coding gene	gene with protein product	"""cervical cancer 1 protooncogene"""					12879013, 12061725	Standard	NM_015416		Approved	HCCR1	uc009zlw.3	Q6P1Q0	OTTHUMG00000169538	ENST00000262055.4:c.348G>C	12.37:g.51445948G>C	ENSP00000262055:p.Lys116Asn		Somatic	63	0	0		WXS	Illumina HiSeq	.	75	0.12	9	NM_001243689	28	0.18	5	A6NER7|B3KXK7|Q6X2E4|Q6X2E5|Q7L2G9|Q7L690|Q8WXW6|Q96PK7|Q9BY59|Q9Y3X3	Missense_Mutation	SNP	ENST00000262055.4	37	CCDS8806.1	.	.	.	.	.	.	.	.	.	.	G	14.65	2.597421	0.46318	.	.	ENSG00000050426	ENST00000551477;ENST00000550755;ENST00000550929;ENST00000262055;ENST00000550442;ENST00000548401;ENST00000418425;ENST00000547008	T;T;T;T;T;T;T	0.50001	0.87;0.89;0.87;0.77;0.76;0.84;0.78	4.87	4.87	0.63330	LETM1-like (1);	0.483231	0.24100	N	0.041549	T	0.48484	0.1502	L	0.47716	1.5	0.80722	D	1	B;D;P	0.52996	0.175;0.957;0.642	B;P;B	0.48454	0.112;0.578;0.412	T	0.30060	-0.9991	10	0.16896	T	0.51	-10.6661	17.3239	0.87242	0.0:0.0:1.0:0.0	.	116;116;116	B3KXK7;F8W1Z2;Q6P1Q0	.;.;LTMD1_HUMAN	N	83;22;60;116;116;123;116;116	ENSP00000446862:K83N;ENSP00000450163:K60N;ENSP00000262055:K116N;ENSP00000448110:K116N;ENSP00000450082:K123N;ENSP00000389903:K116N;ENSP00000447419:K116N	ENSP00000262055:K116N	K	+	3	2	LETMD1	49732215	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.667000	0.37471	2.689000	0.91719	0.655000	0.94253	AAG			0.413	LETMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404710.1		NM_015416	
AMHR2	269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	53825148	53825148	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr12:53825148C>T	ENST00000257863.4	+	11	1693	c.1613C>T	c.(1612-1614)gCc>gTc	p.A538V	AMHR2_ENST00000379791.3_Missense_Mutation_p.A443V|AMHR2_ENST00000550311.1_3'UTR	NM_001164690.1|NM_020547.2	NP_001158162.1|NP_065434.1	Q16671	AMHR2_HUMAN	anti-Mullerian hormone receptor, type II	538					Mullerian duct regression (GO:0001880)|negative regulation of anti-Mullerian hormone signaling pathway (GO:1902613)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	integral component of plasma membrane (GO:0005887)	anti-Mullerian hormone receptor activity (GO:1990272)|ATP binding (GO:0005524)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta receptor activity, type II (GO:0005026)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|skin(2)	34					Adenosine triphosphate(DB00171)	TCAATTCCTGCCCCTACCATC	0.597																																					p.A538V													.	.			0			c.C1613T												123.0	104.0	110.0					12																	53825148		2203	4300	6503	SO:0001583	missense	269	exon11			TTCCTGCCCCTAC	AF172932	CCDS8858.1, CCDS53798.1, CCDS55829.1	12q13	2013-03-14							465	protein-coding gene	gene with protein product	"""Muellerian inhibiting substance type II receptor"""	600956				7493017	Standard	NM_001164690		Approved	MISR2, MISRII	uc001scx.2	Q16671	OTTHUMG00000170048	ENST00000257863.4:c.1613C>T	12.37:g.53825148C>T	ENSP00000257863:p.Ala538Val		Somatic	144	0	0		WXS	Illumina HiSeq	.	206	0.20	41	NM_020547	3	0.00	0	A0AVE1|B9EGB7|E9PGD2|F8W1D2|Q13762|Q647K2	Missense_Mutation	SNP	ENST00000257863.4	37	CCDS8858.1	.	.	.	.	.	.	.	.	.	.	C	11.83	1.756525	0.31137	.	.	ENSG00000135409	ENST00000257863;ENST00000379791	D;D	0.94092	-3.25;-3.35	4.86	2.99	0.34606	.	0.209202	0.24245	N	0.040237	D	0.84206	0.5421	N	0.19112	0.55	0.09310	N	0.999996	B	0.06786	0.001	B	0.04013	0.001	T	0.68503	-0.5391	10	0.17832	T	0.49	.	6.6195	0.22796	0.0:0.7225:0.1811:0.0963	.	538	Q16671	AMHR2_HUMAN	V	538;443	ENSP00000257863:A538V;ENSP00000369117:A443V	ENSP00000257863:A538V	A	+	2	0	AMHR2	52111415	0.000000	0.05858	0.055000	0.19348	0.580000	0.36256	-0.044000	0.12023	0.741000	0.32674	-0.251000	0.11542	GCC			0.597	AMHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000407048.1		NM_020547	
GNS	2799	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	65141505	65141505	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr12:65141505T>C	ENST00000258145.3	-	3	616	c.446A>G	c.(445-447)aAa>aGa	p.K149R	GNS_ENST00000542058.1_Missense_Mutation_p.K129R|GNS_ENST00000418919.2_Missense_Mutation_p.K93R|GNS_ENST00000543646.1_Missense_Mutation_p.K181R	NM_002076.3	NP_002067.1	P15586	GNS_HUMAN	glucosamine (N-acetyl)-6-sulfatase	149					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	metal ion binding (GO:0046872)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)|sulfuric ester hydrolase activity (GO:0008484)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(4)	15	Lung NSC(1;7.25e-14)|all_lung(1;1.25e-12)		LUAD - Lung adenocarcinoma(6;0.115)	GBM - Glioblastoma multiforme(28;0.0435)		ATTTAAATATTTCCCTGCAAA	0.308																																					p.K149R													.	.			0			c.A446G												105.0	101.0	102.0					12																	65141505		2203	4300	6503	SO:0001583	missense	2799	exon3			AAATATTTCCCTG		CCDS8970.1	12q14	2010-05-04	2008-08-01		ENSG00000135677	ENSG00000135677	3.1.6.14		4422	protein-coding gene	gene with protein product	"""Sanfilippo disease IIID"", ""N-acetylglucosamine-6-sulfatase"""	607664					Standard	NM_002076		Approved		uc001ssg.4	P15586	OTTHUMG00000168819	ENST00000258145.3:c.446A>G	12.37:g.65141505T>C	ENSP00000258145:p.Lys149Arg		Somatic	114	0	0		WXS	Illumina HiSeq	.	241	0.21	51	NM_002076	82	0.13	11	B4DYH8|Q53F05	Missense_Mutation	SNP	ENST00000258145.3	37	CCDS8970.1	.	.	.	.	.	.	.	.	.	.	T	16.77	3.215832	0.58452	.	.	ENSG00000135677	ENST00000418919;ENST00000258145;ENST00000543646;ENST00000542058;ENST00000539825;ENST00000545471;ENST00000545273	D;D;D;D;D	0.99961	-4.81;-4.81;-4.81;-4.81;-9.26	5.74	5.74	0.90152	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase, conserved site (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.99971	0.9990	H	0.98295	4.195	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;0.999	D	0.96928	0.9679	9	.	.	.	-23.1297	16.3501	0.83202	0.0:0.0:0.0:1.0	.	129;181;149;93	B4DYH8;F6S8M0;P15586;Q7Z3X3	.;.;GNS_HUMAN;.	R	93;149;181;129;66;86;73	ENSP00000413130:K93R;ENSP00000258145:K149R;ENSP00000438497:K181R;ENSP00000444819:K129R;ENSP00000445055:K73R	.	K	-	2	0	GNS	63427772	1.000000	0.71417	0.987000	0.45799	0.063000	0.16089	7.921000	0.87530	2.323000	0.78572	0.528000	0.53228	AAA			0.308	GNS-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000401195.2			
PLXNC1	10154	broad.mit.edu	37	12	94658982	94658982	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr12:94658982T>G	ENST00000258526.4	+	21	3827	c.3578T>G	c.(3577-3579)gTt>gGt	p.V1193G	PLXNC1_ENST00000547057.1_Missense_Mutation_p.V240G|PLXNC1_ENST00000545312.1_5'UTR	NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	1193					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						TTGTGGCAGGTTCCGGAATTC	0.463																																					p.V1193G													.	PLXNC1	135		0			c.T3578G												151.0	163.0	159.0					12																	94658982		2203	4300	6503	SO:0001583	missense	10154	exon21			GGCAGGTTCCGGA	AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.3578T>G	12.37:g.94658982T>G	ENSP00000258526:p.Val1193Gly		Somatic	131	0.1374045802	18		WXS	Illumina HiSeq	Phase_I	160	0.19	30	NM_005761	20	0.15	3	Q59H25	Missense_Mutation	SNP	ENST00000258526.4	37	CCDS9049.1	.	.	.	.	.	.	.	.	.	.	T	15.37	2.812222	0.50527	.	.	ENSG00000136040	ENST00000258526;ENST00000547057	T;T	0.11277	2.79;2.79	5.85	5.85	0.93711	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.108387	0.64402	D	0.000006	T	0.17874	0.0429	N	0.22421	0.69	0.80722	D	1	P;D	0.69078	0.901;0.997	P;D	0.69142	0.633;0.962	T	0.14090	-1.0485	10	0.10636	T	0.68	.	16.2271	0.82306	0.0:0.0:0.0:1.0	.	240;1193	B4DHQ7;O60486	.;PLXC1_HUMAN	G	1193;240	ENSP00000258526:V1193G;ENSP00000446720:V240G	ENSP00000258526:V1193G	V	+	2	0	PLXNC1	93183113	1.000000	0.71417	0.993000	0.49108	0.632000	0.37999	5.688000	0.68227	2.234000	0.73211	0.460000	0.39030	GTT			0.463	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000408126.2			
ULK1	8408	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	132404132	132404132	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr12:132404132C>A	ENST00000321867.4	+	25	3151	c.2800C>A	c.(2800-2802)Cag>Aag	p.Q934K	ULK1_ENST00000540647.1_Missense_Mutation_p.Q179K	NM_003565.2	NP_003556	O75385	ULK1_HUMAN	unc-51 like autophagy activating kinase 1	934					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|cellular response to nutrient levels (GO:0031669)|cerebellar granule cell differentiation (GO:0021707)|negative regulation of collateral sprouting (GO:0048671)|neuron projection development (GO:0031175)|neuron projection regeneration (GO:0031102)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|protein autophosphorylation (GO:0046777)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|radial glia guided migration of cerebellar granule cell (GO:0021933)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of autophagy (GO:0010506)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|response to starvation (GO:0042594)	ATG1/UKL1 signaling complex (GO:0034273)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extrinsic component of autophagic vacuole membrane (GO:0097635)|extrinsic component of omegasome membrane (GO:0097629)|extrinsic component of pre-autophagosomal structure membrane (GO:0097632)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)	ATP binding (GO:0005524)|protein complex binding (GO:0032403)|protein serine/threonine kinase activity (GO:0004674)|Rab GTPase binding (GO:0017137)	p.Q934*(1)		breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	29	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		CACTGTGAAGCAGGGTGAGGG	0.637																																					p.Q934K													ULK1,NS,carcinoma,0,1	ULK1	0	1	1	Substitution - Nonsense(1)	lung(1)	c.C2800A												62.0	66.0	65.0					12																	132404132		2203	4299	6502	SO:0001583	missense	8408	exon25			GTGAAGCAGGGTG	AF045458	CCDS9274.1	12q24.3	2014-02-12	2013-07-02		ENSG00000177169	ENSG00000177169			12558	protein-coding gene	gene with protein product	"""ATG1 autophagy related 1 homolog (S. cerevisiae)"""	603168	"""unc-51 (C. elegans)-like kinase 1"", ""unc-51-like kinase 1 (C. elegans)"""			9693035	Standard	NM_003565		Approved	ATG1, ATG1A	uc001uje.3	O75385	OTTHUMG00000168052	ENST00000321867.4:c.2800C>A	12.37:g.132404132C>A	ENSP00000324560:p.Gln934Lys		Somatic	51	0	0		WXS	Illumina HiSeq	.	57	0.18	10	NM_003565	153	0.19	29	Q9UQ28	Missense_Mutation	SNP	ENST00000321867.4	37	CCDS9274.1	.	.	.	.	.	.	.	.	.	.	C	30	5.057106	0.93846	.	.	ENSG00000177169	ENST00000321867;ENST00000540647	T;T	0.42513	0.97;0.97	4.84	4.84	0.62591	Serine/threonine-protein kinase, C-terminal (1);	0.138479	0.49305	D	0.000159	T	0.48333	0.1494	M	0.74881	2.28	0.80722	D	1	P	0.41131	0.739	B	0.38985	0.287	T	0.59369	-0.7467	10	0.72032	D	0.01	-13.9361	18.3252	0.90251	0.0:1.0:0.0:0.0	.	934	O75385	ULK1_HUMAN	K	934;179	ENSP00000324560:Q934K;ENSP00000441794:Q179K	ENSP00000324560:Q934K	Q	+	1	0	ULK1	130970085	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	7.452000	0.80683	2.404000	0.81709	0.561000	0.74099	CAG			0.637	ULK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000397769.3			
GOLGA3	2802	broad.mit.edu;mdanderson.org	37	12	133381349	133381349	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr12:133381349G>T	ENST00000450791.2	-	6	1733	c.1550C>A	c.(1549-1551)gCc>gAc	p.A517D	GOLGA3_ENST00000537452.1_Missense_Mutation_p.A517D|GOLGA3_ENST00000456883.2_Missense_Mutation_p.A517D|GOLGA3_ENST00000204726.3_Missense_Mutation_p.A517D|GOLGA3_ENST00000545875.1_Missense_Mutation_p.A517D			Q08378	GOGA3_HUMAN	golgin A3	517					intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		CTCTACCTTGGCCATAAGCCT	0.602																																					p.A517D													.	GOLGA3	234		0			c.C1550A												139.0	105.0	116.0					12																	133381349		2203	4300	6503	SO:0001583	missense	2802	exon7			ACCTTGGCCATAA	AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.1550C>A	12.37:g.133381349G>T	ENSP00000410378:p.Ala517Asp		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	93	0.04	4	NM_001172557	65	0.00	0	A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	ENST00000450791.2	37	CCDS9281.1	.	.	.	.	.	.	.	.	.	.	G	12.05	1.822953	0.32237	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883;ENST00000537452;ENST00000545875	T;T;T;T;T	0.78126	-1.15;-1.15;-1.15;-1.15;-1.15	5.52	4.61	0.57282	.	0.263966	0.40908	D	0.000994	T	0.60779	0.2295	N	0.08118	0	0.80722	D	1	D;D;D	0.57571	0.98;0.98;0.967	P;P;P	0.51229	0.663;0.663;0.587	T	0.58244	-0.7670	10	0.19590	T	0.45	.	4.2883	0.10865	0.0906:0.3366:0.4524:0.1204	.	517;517;517	Q08378-4;Q08378-2;Q08378	.;.;GOGA3_HUMAN	D	517	ENSP00000204726:A517D;ENSP00000410378:A517D;ENSP00000409303:A517D;ENSP00000442143:A517D;ENSP00000442603:A517D	ENSP00000204726:A517D	A	-	2	0	GOLGA3	131891422	1.000000	0.71417	1.000000	0.80357	0.012000	0.07955	2.409000	0.44583	2.586000	0.87340	0.561000	0.74099	GCC			0.602	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000397569.2		NM_005895	
FLT3	2322	ucsc.edu	37	13	28644724	28644724	+	Silent	SNP	C	C	A			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr13:28644724C>A	ENST00000241453.7	-	2	150	c.69G>T	c.(67-69)ggG>ggT	p.G23G	FLT3_ENST00000380982.4_Silent_p.G23G|FLT3_ENST00000537084.1_Silent_p.G23G	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	23					B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	TTGTAATAGTCCCAAATATCA	0.318			"""Mis, O"""		"""AML, ALL"""																																p.G23G				Dom	yes		13	13q12	2322	fms-related tyrosine kinase 3		L	.	FLT3	15525		0			c.G69T												68.0	62.0	64.0					13																	28644724		2203	4296	6499	SO:0001819	synonymous_variant	2322	exon2			AATAGTCCCAAAT	U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.69G>T	13.37:g.28644724C>A			Somatic	46	0	0		WXS	Illumina HiSeq		42	0.10	4	NM_004119	0		0	A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Silent	SNP	ENST00000241453.7	37	CCDS31953.1																																																																																					0.318	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000044319.2			
IPO5	3843	hgsc.bcm.edu	37	13	98658520	98658520	+	Missense_Mutation	SNP	C	C	T	rs566255473		TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr13:98658520C>T	ENST00000490680.1	+	14	1699	c.1634C>T	c.(1633-1635)gCg>gTg	p.A545V	IPO5_ENST00000261574.5_Missense_Mutation_p.A563V|IPO5_ENST00000539640.1_Missense_Mutation_p.A420V|IPO5_ENST00000493492.2_3'UTR			O00410	IPO5_HUMAN	importin 5	545					cellular response to amino acid stimulus (GO:0071230)|negative regulation of catalytic activity (GO:0043086)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|ribosomal protein import into nucleus (GO:0006610)|viral process (GO:0016032)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|Ran GTPase binding (GO:0008536)			breast(2)|endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	27						GTTGAGAATGCGGTTCAAAAA	0.378													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16537	0.0		0.0	False		,,,				2504	0.0				p.A563V													IPO5,NS,carcinoma,0,1	IPO5	0	1	0			c.C1688T												95.0	92.0	93.0					13																	98658520		2203	4300	6503	SO:0001583	missense	3843	exon17			AGAATGCGGTTCA	U72761	CCDS31999.1	13q32.2	2012-05-02	2008-04-15	2008-04-15	ENSG00000065150	ENSG00000065150		"""Importins"""	6402	protein-coding gene	gene with protein product		602008	"""karyopherin (importin) beta 3"", ""RAN binding protein 5"""	KPNB3, RANBP5		9114010, 9271386, 17005651	Standard	NM_002271		Approved	IMB3, MGC2068, Pse1	uc001vne.3	O00410	OTTHUMG00000017244	ENST00000490680.1:c.1634C>T	13.37:g.98658520C>T	ENSP00000418393:p.Ala545Val		Somatic	98	0	0		WXS	Illumina HiSeq	.	93	0.04	4	NM_002271	164	0.00	0	B4DZA0|O15257|Q5T578|Q86XC7	Missense_Mutation	SNP	ENST00000490680.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.423620|5.423620	0.96111|0.96111	.|.	.|.	ENSG00000065150|ENSG00000065150	ENST00000261574;ENST00000357602;ENST00000490680;ENST00000539640|ENST00000469360	T;T;T;T|.	0.24350|.	1.86;1.86;1.86;1.86|.	5.1|5.1	5.1|5.1	0.69264|0.69264	Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.76644|0.76644	0.4016|0.4016	M|M	0.73962|0.73962	2.25|2.25	0.80722|0.80722	D|D	1|1	P;D;D|.	0.69078|.	0.947;0.995;0.997|.	P;P;P|.	0.54664|.	0.59;0.578;0.758|.	T|T	0.76512|0.76512	-0.2932|-0.2932	10|5	0.72032|.	D|.	0.01|.	-10.5253|-10.5253	18.8688|18.8688	0.92305|0.92305	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	420;545;563|.	B4E0R6;O00410;O00410-3|.	.;IPO5_HUMAN;.|.	V|W	563;545;545;420|547	ENSP00000261574:A563V;ENSP00000350219:A545V;ENSP00000418393:A545V;ENSP00000445126:A420V|.	ENSP00000261574:A563V|.	A|R	+|+	2|1	0|2	IPO5|IPO5	97456521|97456521	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	5.928000|5.928000	0.70088|0.70088	2.525000|2.525000	0.85131|0.85131	0.460000|0.460000	0.39030|0.39030	GCG|CGG			0.378	IPO5-006	NOVEL	alternative_5_UTR|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000354655.1		NM_002271	
CCDC88C	440193	mdanderson.org	37	14	91804418	91804418	+	Silent	SNP	C	C	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr14:91804418C>T	ENST00000389857.6	-	10	1067	c.981G>A	c.(979-981)agG>agA	p.R327R		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	327					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				CCAGCTCCAGCCTCTCCACGC	0.637																																					p.R327R													.	.			0			c.G981A												45.0	51.0	49.0					14																	91804418		2122	4237	6359	SO:0001819	synonymous_variant	440193	exon10			CTCCAGCCTCTCC		CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.981G>A	14.37:g.91804418C>T			Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_001080414	8	0.00	0	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Silent	SNP	ENST00000389857.6	37	CCDS45151.1																																																																																					0.637	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000411650.1		XM_029353	
TRMT61A	115708	mdanderson.org	37	14	104001089	104001089	+	Silent	SNP	C	C	T	rs372778660	byFrequency	TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr14:104001089C>T	ENST00000389749.4	+	4	908	c.801C>T	c.(799-801)agC>agT	p.S267S		NM_152307.2	NP_689520.2	Q96FX7	TRM61_HUMAN	tRNA methyltransferase 61 homolog A (S. cerevisiae)	267						nucleus (GO:0005634)|tRNA (m1A) methyltransferase complex (GO:0031515)	tRNA (adenine-N1-)-methyltransferase activity (GO:0016429)			skin(1)	1						CCTTCCGCAGCGGCACGCCCA	0.706													C|||	2	0.000399361	0.0015	0.0	5008	,	,		15565	0.0		0.0	False		,,,				2504	0.0				p.S267S													.	.			0			c.C801T							C		1,4151		0,1,2075	9.0	14.0	13.0		801	-0.9	1.0	14		13	1,8395		0,1,4197	no	coding-synonymous	TRMT61A	NM_152307.2		0,2,6272	TT,TC,CC		0.0119,0.0241,0.0159		267/290	104001089	2,12546	2076	4198	6274	SO:0001819	synonymous_variant	115708	exon4			CCGCAGCGGCACG	AK097771	CCDS41994.1	14q32	2009-01-09	2009-01-09	2009-01-09		ENSG00000166166			23790	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 172"""	C14orf172		16043508	Standard	NM_152307		Approved	FLJ40452, GCD14, Gcd14p, hTRM61	uc010aws.3	Q96FX7		ENST00000389749.4:c.801C>T	14.37:g.104001089C>T			Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_152307	53	0.00	0	A6NN78|Q8N7Q9	Silent	SNP	ENST00000389749.4	37	CCDS41994.1	.	.	.	.	.	.	.	.	.	.	C	1.903	-0.452555	0.04540	2.41E-4	1.19E-4	ENSG00000166166	ENST00000299202	.	.	.	4.47	-0.946	0.10385	.	.	.	.	.	T	0.57621	0.2066	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53049	-0.8493	4	.	.	.	-24.1203	10.7734	0.46336	0.0:0.4321:0.0:0.5679	.	.	.	.	V	169	.	.	A	+	2	0	TRMT61A	103070842	0.001000	0.12720	0.996000	0.52242	0.089000	0.18198	-1.687000	0.01927	-0.242000	0.09667	-0.727000	0.03589	GCG			0.706	TRMT61A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000414988.1		NM_152307	
PACS2	23241	mdanderson.org	37	14	105834425	105834425	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr14:105834425G>T	ENST00000325438.8	+	6	1105	c.601G>T	c.(601-603)Gag>Tag	p.E201*	PACS2_ENST00000430725.2_Nonsense_Mutation_p.E134*|PACS2_ENST00000458164.2_Nonsense_Mutation_p.E201*|PACS2_ENST00000447393.1_Nonsense_Mutation_p.E201*|PACS2_ENST00000547217.1_Nonsense_Mutation_p.E171*			Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2	201					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to plasma membrane (GO:0072661)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)				endometrium(2)|kidney(2)|lung(7)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	21		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		CTACTCCGAGGAGGAGTATGA	0.642																																					p.E201X													.	.			0			c.G601T												50.0	51.0	51.0					14																	105834425		2202	4300	6502	SO:0001587	stop_gained	23241	exon6			TCCGAGGAGGAGT	AB011174	CCDS32168.1, CCDS45178.1, CCDS45178.2, CCDS58339.1	14q32	2005-02-15	2005-02-15	2005-02-15		ENSG00000179364			23794	protein-coding gene	gene with protein product		610423	"""phosphofurin acidic cluster sorting protein 1-like"""	PACS1L		15692567	Standard	NM_001100913		Approved	KIAA0602	uc001yqu.3	Q86VP3	OTTHUMG00000170450	ENST00000325438.8:c.601G>T	14.37:g.105834425G>T	ENSP00000321834:p.Glu201*		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_015197	20	0.00	0	A2VDJ9|G8JLK3|O60342|Q6P191|Q96FL7	Nonsense_Mutation	SNP	ENST00000325438.8	37	CCDS32168.1	.	.	.	.	.	.	.	.	.	.	G	40	8.262527	0.98732	.	.	ENSG00000179364	ENST00000430725;ENST00000325438;ENST00000458164;ENST00000447393;ENST00000547217	.	.	.	4.14	4.14	0.48551	.	0.055575	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-16.4158	14.9749	0.71264	0.0:0.0:1.0:0.0	.	.	.	.	X	134;201;201;201;171	.	ENSP00000321834:E201X	E	+	1	0	PACS2	104905470	1.000000	0.71417	0.976000	0.42696	0.797000	0.45037	9.483000	0.97937	1.845000	0.53610	0.491000	0.48974	GAG			0.642	PACS2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000409209.1		XM_377355	
GGA2	23062	mdanderson.org	37	16	23481479	23481479	+	Silent	SNP	C	C	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr16:23481479C>T	ENST00000309859.4	-	15	1540	c.1458G>A	c.(1456-1458)ctG>ctA	p.L486L	GGA2_ENST00000567468.1_Intron	NM_015044.4	NP_055859.1	Q9UJY4	GGA2_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 2	486	GAE. {ECO:0000255|PROSITE- ProRule:PRU00093}.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(48;0.0386)		TGAGAGGCGGCAGGCTGCCTG	0.547																																					p.L486L													.	.			0			c.G1458A												46.0	46.0	46.0					16																	23481479		2197	4300	6497	SO:0001819	synonymous_variant	23062	exon15			AGGCGGCAGGCTG	AF190863	CCDS10611.1	16p12	2010-02-12	2010-02-12		ENSG00000103365	ENSG00000103365			16064	protein-coding gene	gene with protein product		606005				10747088, 10749927	Standard	NM_015044		Approved	VEAR, KIAA1080	uc002dlq.3	Q9UJY4	OTTHUMG00000096957	ENST00000309859.4:c.1458G>A	16.37:g.23481479C>T			Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_015044	158	0.00	0	D3DWF0|O14564|Q9NYN2|Q9UPS2	Silent	SNP	ENST00000309859.4	37	CCDS10611.1																																																																																					0.547	GGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000214019.1			
UBFD1	56061	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	23569548	23569548	+	Silent	SNP	C	C	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr16:23569548C>T	ENST00000395878.3	+	2	684	c.303C>T	c.(301-303)ttC>ttT	p.F101F	EARS2_ENST00000449606.1_5'Flank|UBFD1_ENST00000219638.4_Silent_p.F325F|UBFD1_ENST00000571064.1_3'UTR|EARS2_ENST00000563459.1_5'Flank|UBFD1_ENST00000567264.1_Silent_p.F101F|EARS2_ENST00000563232.1_5'Flank|EARS2_ENST00000564501.1_5'Flank|UBFD1_ENST00000567212.1_Silent_p.F92F	NM_019116.2	NP_061989.2	O14562	UBFD1_HUMAN	ubiquitin family domain containing 1	101	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.						poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7				GBM - Glioblastoma multiforme(48;0.0331)		ACGTGAAGTTCCCCCTGGACA	0.602																																					p.F101F	Melanoma(22;290 1069 22358 48158)												UBFD1,colon,carcinoma,+2,1	UBFD1	2	1	0			c.C303T												47.0	54.0	52.0					16																	23569548		2065	4222	6287	SO:0001819	synonymous_variant	56061	exon2			GAAGTTCCCCCTG	AK124139	CCDS10613.2	16p12.1	2008-11-05			ENSG00000103353	ENSG00000103353			30565	protein-coding gene	gene with protein product	"""ubiquitin-binding protein homolog"""					10493829	Standard	XM_006721064		Approved	FLJ42145, FLJ38870, UBPH	uc002dlv.3	O14562	OTTHUMG00000128855	ENST00000395878.3:c.303C>T	16.37:g.23569548C>T			Somatic	83	0	0		WXS	Illumina HiSeq	.	70	0.13	9	NM_019116	111	0.23	25	A8MW58|D3DWF2	Silent	SNP	ENST00000395878.3	37	CCDS10613.2																																																																																					0.602	UBFD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250795.2		NM_019116	
MARVELD3	91862	mdanderson.org	37	16	71660181	71660181	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr16:71660181C>T	ENST00000268485.3	+	1	93	c.49C>T	c.(49-51)Cgg>Tgg	p.R17W	MARVELD3_ENST00000299952.4_Missense_Mutation_p.R17W|MARVELD3_ENST00000567566.1_Missense_Mutation_p.R17W|MARVELD3_ENST00000565261.1_Missense_Mutation_p.R17W|RP11-432I5.2_ENST00000562763.1_RNA|MARVELD3_ENST00000567501.1_5'Flank	NM_052858.4	NP_443090.4	Q96A59	MALD3_HUMAN	MARVEL domain containing 3	17	Arg-rich.				cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|tight junction (GO:0005923)				NS(1)|endometrium(3)|large_intestine(5)|lung(6)|skin(2)	17		Ovarian(137;0.125)				GCCGAGAGAGCGGGACCCGGG	0.741																																					p.R17W													.	.			0			c.C49T												4.0	9.0	7.0					16																	71660181		1680	3262	4942	SO:0001583	missense	91862	exon1			AGAGAGCGGGACC	BC013376	CCDS10904.1, CCDS32478.1, CCDS59270.1	16q22.2	2008-02-05	2004-07-12	2004-07-14	ENSG00000140832	ENSG00000140832			30525	protein-coding gene	gene with protein product		614094	"""MARVEL (membrane-associating) domain containing 3"""	MRVLDC3			Standard	NM_001017967		Approved		uc002fat.4	Q96A59	OTTHUMG00000137591	ENST00000268485.3:c.49C>T	16.37:g.71660181C>T	ENSP00000268485:p.Arg17Trp		Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	18	0.11	2	NM_052858	1	0.00	0	A8K820|H3BQM5|Q96MJ4	Missense_Mutation	SNP	ENST00000268485.3	37	CCDS10904.1	.	.	.	.	.	.	.	.	.	.	c	8.446	0.852046	0.17034	.	.	ENSG00000140832	ENST00000268485;ENST00000299952	T;T	0.53857	0.6;0.6	4.14	1.87	0.25490	.	0.000000	0.40064	N	0.001183	T	0.66703	0.2816	M	0.69823	2.125	0.36868	D	0.888744	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.992;0.999;0.998	T	0.72320	-0.4329	10	0.87932	D	0	-30.1372	9.0907	0.36610	0.5697:0.4303:0.0:0.0	.	17;17;40	Q96A59-2;Q96A59;Q9BSH2	.;MALD3_HUMAN;.	W	17	ENSP00000268485:R17W;ENSP00000299952:R17W	ENSP00000268485:R17W	R	+	1	2	MARVELD3	70217682	0.060000	0.20803	0.413000	0.26509	0.072000	0.16883	0.038000	0.13862	0.888000	0.36160	0.448000	0.29417	CGG			0.741	MARVELD3-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000268991.2		NM_052858	
PITPNA	5306	mdanderson.org	37	17	1451640	1451640	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr17:1451640G>A	ENST00000313486.7	-	4	494	c.239C>T	c.(238-240)gCc>gTc	p.A80V	PITPNA_ENST00000539476.1_Missense_Mutation_p.A80V	NM_006224.3	NP_006215.1	Q00169	PIPNA_HUMAN	phosphatidylinositol transfer protein, alpha	80					axon guidance (GO:0007411)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	lipid binding (GO:0008289)|phosphatidylcholine transporter activity (GO:0008525)|phosphatidylinositol transporter activity (GO:0008526)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)	7				UCEC - Uterine corpus endometrioid carcinoma (25;0.0845)		TATATTCAGGGCTCCCTCTGG	0.557																																					p.A80V													.	.			0			c.C239T												81.0	83.0	82.0					17																	1451640		1878	4108	5986	SO:0001583	missense	5306	exon4			TTCAGGGCTCCCT	M73704	CCDS45563.1	17p13.3	2012-06-29	2003-05-09	2004-09-03	ENSG00000174238	ENSG00000174238			9001	protein-coding gene	gene with protein product		600174	"""phosphotidylinositol transfer protein"""	PITPN		8255295	Standard	NM_006224		Approved	VIB1A	uc021tnf.1	Q00169	OTTHUMG00000177779	ENST00000313486.7:c.239C>T	17.37:g.1451640G>A	ENSP00000316809:p.Ala80Val		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_006224	77	0.00	0		Missense_Mutation	SNP	ENST00000313486.7	37	CCDS45563.1	.	.	.	.	.	.	.	.	.	.	G	36	5.692212	0.96793	.	.	ENSG00000174238	ENST00000539476;ENST00000313486;ENST00000539870	T;T	0.53857	0.6;0.6	5.75	5.75	0.90469	START-like domain (1);	0.000000	0.85682	D	0.000000	T	0.55513	0.1925	M	0.77313	2.365	0.80722	D	1	P	0.50066	0.931	B	0.37015	0.239	T	0.66866	-0.5815	10	0.87932	D	0	.	18.9446	0.92616	0.0:0.0:1.0:0.0	.	80	Q00169	PIPNA_HUMAN	V	80;80;7	ENSP00000441869:A80V;ENSP00000316809:A80V	ENSP00000316809:A80V	A	-	2	0	PITPNA	1398390	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.708000	0.92522	0.650000	0.86243	GCC			0.557	PITPNA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000438927.3			
CCDC144CP	348254	hgsc.bcm.edu	37	17	18446965	18446965	+	RNA	SNP	T	T	A			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr17:18446965T>A	ENST00000425211.1	-	0	0																											ATCAATTTAATTCATAAATTT	0.289																																					.													.	.			0			.																																											284047	.			ATTTAATTCATAA																													17.37:g.18446965T>A			Somatic	214	0	0		WXS	Illumina HiSeq	.	180	0.26	46	.	0		0		RNA	SNP	ENST00000425211.1	37																																																																																						0.289	CTD-2303H24.2-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript		OTTHUMT00000473021.1			
KRT18P55	284085	broad.mit.edu	37	17	26633347	26633348	+	RNA	INS	-	-	G	rs35679432|rs6505076	byFrequency	TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr17:26633347_26633348insG	ENST00000577198.1	-	0	407					NR_028334.1				keratin 18 pseudogene 55																		ttgttgttgttttttttttttt	0.262													|||unknown(HR)	1257	0.250998	0.1861	0.3343	5008	,	,		18973	0.0665		0.4294	False		,,,				2504	0.2863				.													.	.			0			.																																											0	.			TGTTGTTTTTTTT			17q11.2	2013-06-25			ENSG00000265480	ENSG00000265480			26874	pseudogene	pseudogene							Standard	NR_028334		Approved		uc002has.3		OTTHUMG00000179422		17.37:g.26633347_26633348insG			Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	12	0.33	4	.	0		0		RNA	INS	ENST00000577198.1	37																																																																																						0.262	KRT18P55-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000446194.1		NR_028334	
NEUROD2	4761	mdanderson.org	37	17	37761788	37761788	+	Silent	SNP	C	C	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr17:37761788C>T	ENST00000302584.4	-	2	1285	c.1065G>A	c.(1063-1065)tcG>tcA	p.S355S		NM_006160.3	NP_006151.3	Q15784	NDF2_HUMAN	neuronal differentiation 2	355					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|cellular response to calcium ion (GO:0071277)|cellular response to electrical stimulus (GO:0071257)|cerebellar cortex development (GO:0021695)|negative regulation of synapse maturation (GO:2000297)|nervous system development (GO:0007399)|neuron development (GO:0048666)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleus (GO:0005634)	E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)	8	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Lung(15;0.00549)|LUAD - Lung adenocarcinoma(14;0.0664)			AGAGATTCTCCGAGTGGACGC	0.617																																					p.S355S													.	.			0			c.G1065A												34.0	38.0	36.0					17																	37761788		2203	4299	6502	SO:0001819	synonymous_variant	4761	exon2			ATTCTCCGAGTGG	U58681	CCDS11338.1	17q12	2013-05-21	2012-02-22		ENSG00000171532	ENSG00000171532		"""Basic helix-loop-helix proteins"""	7763	protein-coding gene	gene with protein product		601725	"""neurogenic differentiation 2"""			9119405	Standard	XM_005257409		Approved	NDRF, bHLHa1	uc002hry.3	Q15784	OTTHUMG00000133211	ENST00000302584.4:c.1065G>A	17.37:g.37761788C>T			Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	64	0.05	3	NM_006160	1	0.00	0	Q8TBI7|Q9UQC6	Silent	SNP	ENST00000302584.4	37	CCDS11338.1																																																																																					0.617	NEUROD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256931.2		NM_006160	
HAP1	9001	mdanderson.org	37	17	39884463	39884463	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr17:39884463C>T	ENST00000310778.5	-	7	1199	c.1190G>A	c.(1189-1191)cGc>cAc	p.R397H	HAP1_ENST00000393939.2_Missense_Mutation_p.R397H|JUP_ENST00000540235.1_Intron|HAP1_ENST00000347901.4_Missense_Mutation_p.R397H|HAP1_ENST00000341193.5_Missense_Mutation_p.R405H|RN7SL399P_ENST00000471648.2_RNA			P54257	HAP1_HUMAN	huntingtin-associated protein 1	397	Glu-rich.|HAP1 N-terminal.				anterograde axon cargo transport (GO:0008089)|autophagy (GO:0006914)|brain development (GO:0007420)|cell projection organization (GO:0030030)|exocytosis (GO:0006887)|negative regulation of beta-amyloid formation (GO:1902430)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|positive regulation of neurotrophin production (GO:0032901)|positive regulation of nonmotile primary cilium assembly (GO:1902857)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|protein localization (GO:0008104)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of organelle transport along microtubule (GO:1902513)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)|vesicle transport along microtubule (GO:0047496)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|inclusion body (GO:0016234)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synapse (GO:0045202)	brain-derived neurotrophic factor binding (GO:0048403)|ion channel binding (GO:0044325)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(4)|skin(1)	21		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			CATCCGGCAGCGCTGCTGCAG	0.642																																					p.R405H													.	.			0			c.G1214A												42.0	41.0	41.0					17																	39884463		2203	4300	6503	SO:0001583	missense	9001	exon7			CGGCAGCGCTGCT	AF040723	CCDS11406.1, CCDS42338.1, CCDS42339.1	17q21.2-q21.3	2008-04-23	2008-04-23		ENSG00000173805	ENSG00000173805			4812	protein-coding gene	gene with protein product	"""neuroan 1"""	600947		HAP2		7477378, 9668110	Standard	NM_177977		Approved	HLP, hHLP1, HIP5	uc002hxn.1	P54257	OTTHUMG00000133498	ENST00000310778.5:c.1190G>A	17.37:g.39884463C>T	ENSP00000309392:p.Arg397His		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_001079870	4	0.00	0	A8MQB5|O75358|Q59GK4|Q9H4G3|Q9HA98|Q9NY90	Missense_Mutation	SNP	ENST00000310778.5	37		.	.	.	.	.	.	.	.	.	.	C	12.85	2.062456	0.36373	.	.	ENSG00000173805	ENST00000393939;ENST00000310778;ENST00000347901;ENST00000341193	T;T;T;T	0.22945	1.93;1.93;1.93;1.93	4.14	4.14	0.48551	.	0.180783	0.27315	N	0.019929	T	0.38268	0.1034	L	0.46741	1.465	0.23506	N	0.997539	D;D;D;D	0.76494	0.999;0.999;0.998;0.988	P;P;P;P	0.60682	0.878;0.878;0.83;0.828	T	0.10451	-1.0629	10	0.66056	D	0.02	-2.6988	11.9683	0.53049	0.0:1.0:0.0:0.0	.	397;405;397;397	P54257-3;P54257-4;P54257-2;P54257	.;.;.;HAP1_HUMAN	H	397;397;397;405	ENSP00000377513:R397H;ENSP00000309392:R397H;ENSP00000334002:R397H;ENSP00000343170:R405H	ENSP00000309392:R397H	R	-	2	0	HAP1	37137989	0.004000	0.15560	0.943000	0.38184	0.007000	0.05969	0.962000	0.29280	2.183000	0.69458	0.549000	0.68633	CGC			0.642	HAP1-006	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000389619.1		NM_003949	
HOXB4	3214	mdanderson.org	37	17	46655452	46655452	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr17:46655452G>T	ENST00000332503.5	-	1	2021	c.230C>A	c.(229-231)cCg>cAg	p.P77Q	HOXB3_ENST00000552000.2_Intron|HOXB3_ENST00000465120.3_Intron|MIR10A_ENST00000385043.1_RNA|HOXB3_ENST00000472863.1_Intron|HOXB3_ENST00000476342.1_Intron|HOXB3_ENST00000489475.1_Intron|HOXB3_ENST00000498678.1_Intron|HOXB3_ENST00000460160.1_Intron|HOXB-AS3_ENST00000465846.2_RNA	NM_024015.4	NP_076920.1	P17483	HXB4_HUMAN	homeobox B4	77	Poly-Pro.|Pro-rich (part of the transcriptional activation domain).				anterior/posterior pattern specification (GO:0009952)|bone marrow development (GO:0048539)|cell proliferation (GO:0008283)|definitive hemopoiesis (GO:0060216)|embryonic skeletal system morphogenesis (GO:0048704)|hematopoietic stem cell differentiation (GO:0060218)|morphogenesis of an epithelial sheet (GO:0002011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell division (GO:0048103)|spleen development (GO:0048536)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|urinary_tract(2)	9						gggtggtggcggaggcggcgg	0.826																																					p.P77Q													.	.			0			c.C230A												1.0	1.0	1.0					17																	46655452		304	900	1204	SO:0001583	missense	3214	exon1			GGTGGCGGAGGCG		CCDS11529.1	17q21.32	2011-06-20	2005-12-22		ENSG00000182742	ENSG00000182742		"""Homeoboxes / ANTP class : HOXL subclass"""	5115	protein-coding gene	gene with protein product		142965	"""homeo box B4"""	HOX2, HOX2F		1973146, 1358459	Standard	NM_024015		Approved		uc002inp.3	P17483	OTTHUMG00000159920	ENST00000332503.5:c.230C>A	17.37:g.46655452G>T	ENSP00000328928:p.Pro77Gln		Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	18	0.11	2	NM_024015	0		0	Q9NTA0	Missense_Mutation	SNP	ENST00000332503.5	37	CCDS11529.1	.	.	.	.	.	.	.	.	.	.	G	4.648	0.120450	0.08881	.	.	ENSG00000182742	ENST00000332503	D	0.87729	-2.29	3.65	2.62	0.31277	.	0.585904	0.14303	U	0.328192	T	0.76162	0.3949	L	0.46157	1.445	0.09310	N	1	B	0.30361	0.277	B	0.19148	0.024	T	0.58393	-0.7644	10	0.10902	T	0.67	.	4.2745	0.10802	0.1247:0.0:0.6464:0.2289	.	77	P17483	HXB4_HUMAN	Q	77	ENSP00000328928:P77Q	ENSP00000328928:P77Q	P	-	2	0	HOXB4	44010451	0.910000	0.30920	0.007000	0.13788	0.886000	0.51366	-0.105000	0.10907	0.469000	0.27268	0.313000	0.20887	CCG			0.826	HOXB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000358259.2			
PPM1E	22843	mdanderson.org	37	17	56833708	56833708	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr17:56833708C>T	ENST00000308249.2	+	1	479	c.350C>T	c.(349-351)cCg>cTg	p.P117L		NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	0	PP2C-like.				protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			GTgccgccgccgccgccccag	0.771																																					p.P117L													.	.			0			c.C350T												6.0	7.0	7.0					17																	56833708		1460	2617	4077	SO:0001583	missense	22843	exon1			CGCCGCCGCCGCC	AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.350C>T	17.37:g.56833708C>T	ENSP00000312411:p.Pro117Leu		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	30	0.07	2	NM_014906	0		0	Q8N8J9|Q96DB8	Missense_Mutation	SNP	ENST00000308249.2	37	CCDS11613.1	.	.	.	.	.	.	.	.	.	.	c	15.39	2.820276	0.50633	.	.	ENSG00000175175	ENST00000308249	T	0.19938	2.11	3.38	-2.19	0.07015	.	.	.	.	.	T	0.08088	0.0202	N	0.19112	0.55	0.30343	N	0.785553	B	0.02656	0.0	B	0.01281	0.0	T	0.42155	-0.9468	9	0.07175	T	0.84	-15.2457	1.257	0.01993	0.1693:0.4333:0.1668:0.2306	.	117	Q8WY54-2	.	L	117	ENSP00000312411:P117L	ENSP00000312411:P117L	P	+	2	0	PPM1E	54188707	1.000000	0.71417	0.972000	0.41901	0.850000	0.48378	0.487000	0.22356	-0.187000	0.10516	0.450000	0.29827	CCG			0.771	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000445458.1		NM_014906	
AATK	9625	mdanderson.org	37	17	79094597	79094597	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr17:79094597C>T	ENST00000326724.4	-	11	3163	c.3139G>A	c.(3139-3141)Gca>Aca	p.A1047T	AATK_ENST00000417379.1_Missense_Mutation_p.A944T	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	1047					brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			GAGCCTTGTGCCTCCCCGGAA	0.726																																					p.A1047T													.	.			0			c.G3139A												5.0	6.0	5.0					17																	79094597		1829	4010	5839	SO:0001583	missense	9625	exon11			CTTGTGCCTCCCC	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.3139G>A	17.37:g.79094597C>T	ENSP00000324196:p.Ala1047Thr		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	45	0.09	4	NM_001080395	1	0.00	0	O75136|Q6ZN31|Q86X28	Missense_Mutation	SNP	ENST00000326724.4	37	CCDS45807.1	.	.	.	.	.	.	.	.	.	.	C	13.66	2.304022	0.40795	.	.	ENSG00000181409	ENST00000326724	T	0.77620	-1.11	4.13	0.923	0.19413	.	0.566878	0.16021	N	0.233302	T	0.57021	0.2025	L	0.27053	0.805	0.09310	N	1	B	0.15141	0.012	B	0.11329	0.006	T	0.40232	-0.9574	10	0.02654	T	1	.	7.7574	0.28932	0.0:0.6486:0.0:0.3514	.	1047	Q6ZMQ8	LMTK1_HUMAN	T	1047	ENSP00000324196:A1047T	ENSP00000324196:A1047T	A	-	1	0	AATK	76709192	0.000000	0.05858	0.004000	0.12327	0.358000	0.29455	0.459000	0.21908	0.235000	0.21160	0.462000	0.41574	GCA			0.726	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256055.1		NM_004920	
NCLN	56926	mdanderson.org	37	19	3193320	3193320	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr19:3193320G>T	ENST00000246117.4	+	3	845	c.414G>T	c.(412-414)gaG>gaT	p.E138D	NCLN_ENST00000590671.1_Missense_Mutation_p.E64D	NM_020170.3	NP_064555.2	Q969V3	NCLN_HUMAN	nicalin	138					regulation of signal transduction (GO:0009966)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				kidney(1)|lung(3)|skin(1)	5		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.83e-113)|Epithelial(107;1.65e-111)|all cancers(105;1.53e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00139)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGCCATGGAGACCGCCGTCC	0.647																																					p.E138D													.	.			0			c.G414T												98.0	79.0	85.0					19																	3193320		2203	4300	6503	SO:0001583	missense	56926	exon3			CATGGAGACCGCC	BC025926	CCDS32869.1	19p13.3	2010-08-13	2010-08-13			ENSG00000125912			26923	protein-coding gene	gene with protein product	"""nicastrin-like protein"""	609156	"""nicalin homolog (zebrafish)"""			11230166	Standard	NM_020170		Approved	NICALIN, NET59	uc002lxi.3	Q969V3		ENST00000246117.4:c.414G>T	19.37:g.3193320G>T	ENSP00000246117:p.Glu138Asp		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	29	0.10	3	NM_020170	104	0.00	0	D6W613|O75252|Q6FI60|Q6ZMB7|Q8TAT7|Q96H48|Q96IS7|Q9BQH9|Q9BTX4|Q9NPP2	Missense_Mutation	SNP	ENST00000246117.4	37	CCDS32869.1	.	.	.	.	.	.	.	.	.	.	G	15.50	2.852504	0.51270	.	.	ENSG00000125912	ENST00000246117	T	0.34859	1.34	4.17	4.17	0.49024	.	0.113034	0.64402	D	0.000018	T	0.28433	0.0703	M	0.62266	1.93	0.58432	D	0.999991	P	0.43633	0.813	B	0.36378	0.223	T	0.05920	-1.0856	10	0.25751	T	0.34	-9.2614	6.6261	0.22830	0.2081:0.0:0.7919:0.0	.	138	Q969V3	NCLN_HUMAN	D	138	ENSP00000246117:E138D	ENSP00000246117:E138D	E	+	3	2	NCLN	3144320	1.000000	0.71417	0.996000	0.52242	0.962000	0.63368	4.078000	0.57606	1.878000	0.54408	0.505000	0.49811	GAG			0.647	NCLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452545.1		NM_020170	
ZNF490	57474	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	12692507	12692507	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr19:12692507T>C	ENST00000311437.6	-	5	504	c.382A>G	c.(382-384)Aaa>Gaa	p.K128E	ZNF490_ENST00000465656.1_5'Flank|CTD-2192J16.20_ENST00000593682.1_5'Flank	NM_020714.2	NP_065765.1	Q9ULM2	ZN490_HUMAN	zinc finger protein 490	128	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	18						CAATCTTCTTTATTTTCACAG	0.353																																					p.K128E													ZNF490,NS,carcinoma,+2,1	ZNF490	2	1	0			c.A382G												76.0	76.0	76.0					19																	12692507		2203	4300	6503	SO:0001583	missense	57474	exon5			CTTCTTTATTTTC	AB033024	CCDS12272.1	19p13.2	2013-01-08			ENSG00000188033	ENSG00000188033		"""Zinc fingers, C2H2-type"", ""-"""	23705	protein-coding gene	gene with protein product							Standard	NM_020714		Approved	KIAA1198	uc002mtz.2	Q9ULM2	OTTHUMG00000156398	ENST00000311437.6:c.382A>G	19.37:g.12692507T>C	ENSP00000311521:p.Lys128Glu		Somatic	70	0	0		WXS	Illumina HiSeq	.	108	0.16	17	NM_020714	45	0.44	20		Missense_Mutation	SNP	ENST00000311437.6	37	CCDS12272.1	.	.	.	.	.	.	.	.	.	.	T	7.616	0.675792	0.14841	.	.	ENSG00000188033	ENST00000311437;ENST00000440366	T;T	0.08102	3.13;3.48	0.996	-0.102	0.13613	Krueppel-associated box (1);	.	.	.	.	T	0.06645	0.0170	L	0.49778	1.585	0.22017	N	0.999413	B	0.16802	0.019	B	0.06405	0.002	T	0.46048	-0.9219	9	0.13108	T	0.6	.	4.7505	0.13057	0.0:0.3873:0.0:0.6127	.	128	Q9ULM2	ZN490_HUMAN	E	128;75	ENSP00000311521:K128E;ENSP00000404112:K75E	ENSP00000311521:K128E	K	-	1	0	ZNF490	12553507	0.000000	0.05858	0.239000	0.24122	0.154000	0.21943	-0.601000	0.05687	-0.097000	0.12307	0.402000	0.26972	AAA			0.353	ZNF490-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000344073.1		NM_020714	
FOSB	2354	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	45971880	45971880	+	Silent	SNP	C	C	A			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr19:45971880C>A	ENST00000353609.3	+	1	628	c.36C>A	c.(34-36)ggC>ggA	p.G12G	FOSB_ENST00000417353.2_Silent_p.G12G|ERCC1_ENST00000423698.2_Intron|FOSB_ENST00000586615.1_5'Flank|FOSB_ENST00000592436.1_Silent_p.G12G|FOSB_ENST00000591858.1_Silent_p.G12G|FOSB_ENST00000590335.1_Silent_p.G12G|FOSB_ENST00000592811.1_5'Flank|FOSB_ENST00000443841.2_Silent_p.G12G|FOSB_ENST00000585836.1_Silent_p.G12G	NM_006732.2	NP_006723.2	P53539	FOSB_HUMAN	FBJ murine osteosarcoma viral oncogene homolog B	12					cellular response to calcium ion (GO:0071277)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to progesterone (GO:0032570)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|pancreas(1)	13		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00814)|Epithelial(262;0.18)|GBM - Glioblastoma multiforme(486;0.242)		ACGACTCCGGCTCCCGGTGCA	0.637																																					p.G12G													.	FOSB	29		0			c.C36A												52.0	59.0	57.0					19																	45971880		2203	4300	6503	SO:0001819	synonymous_variant	2354	exon1			CTCCGGCTCCCGG		CCDS12664.1, CCDS46113.1	19q13.3	2013-01-10						"""basic leucine zipper proteins"""	3797	protein-coding gene	gene with protein product	"""oncogene FOS-B"", ""activator protein 1"""	164772				1301997	Standard	NM_006732		Approved	G0S3, GOSB, GOS3, AP-1, MGC42291, DKFZp686C0818	uc002pbx.4	P53539		ENST00000353609.3:c.36C>A	19.37:g.45971880C>A			Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	84	0.06	5	NM_001114171	2	0.00	0	A8K9K5|A8VJE1|A8VJE6|A8VJF0|A8VJF3|A8VJF7|A8VJG1|A8VJG5|A8VJG9|E7EPR6|E9PHJ3|K7EMJ6|Q49AD7	Silent	SNP	ENST00000353609.3	37	CCDS12664.1																																																																																					0.637	FOSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000459561.1		NM_006732	
SIX5	147912	mdanderson.org	37	19	46269313	46269313	+	Missense_Mutation	SNP	G	G	T	rs2014377	byFrequency	TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr19:46269313G>T	ENST00000317578.6	-	3	2047	c.1666C>A	c.(1666-1668)Ctg>Atg	p.L556M	AC074212.6_ENST00000590076.1_RNA|SIX5_ENST00000560168.1_3'UTR|AC074212.5_ENST00000559756.1_RNA|AC074212.5_ENST00000592217.2_RNA	NM_175875.4	NP_787071	Q8N196	SIX5_HUMAN	SIX homeobox 5	556			L -> V (in dbSNP:rs2014377).		lens development in camera-type eye (GO:0002088)|negative regulation of cell proliferation (GO:0008285)|regulation of transcription, DNA-templated (GO:0006355)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00783)|GBM - Glioblastoma multiforme(486;0.0802)|Epithelial(262;0.235)		CCCTGCTGCAGGGCCACACCC	0.677																																					p.L556M													.	.			0			c.C1666A												31.0	33.0	33.0					19																	46269313		2201	4299	6500	SO:0001583	missense	147912	exon3			GCTGCAGGGCCAC	L08835	CCDS12673.1	19q13.32	2011-06-20	2007-07-13			ENSG00000177045		"""Homeoboxes / SINE class"""	10891	protein-coding gene	gene with protein product		600963	"""sine oculis homeobox (Drosophila) homolog 5"", ""sine oculis homeobox homolog 5 (Drosophila)"""	DMAHP		8595416	Standard	NM_175875		Approved		uc002pdb.3	Q8N196		ENST00000317578.6:c.1666C>A	19.37:g.46269313G>T	ENSP00000316842:p.Leu556Met		Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	110	0.03	3	NM_175875	53	0.00	0		Missense_Mutation	SNP	ENST00000317578.6	37	CCDS12673.1	.	.	.	.	.	.	.	.	.	.	c	3.871	-0.027895	0.07589	.	.	ENSG00000177045	ENST00000317578	D	0.91996	-2.95	4.42	2.09	0.27110	.	0.905160	0.09086	N	0.850599	D	0.83105	0.5182	N	0.08118	0	0.09310	N	1	B	0.25169	0.119	B	0.28638	0.092	T	0.73933	-0.3826	10	0.72032	D	0.01	-5.3761	7.236	0.26070	0.1767:0.4364:0.3869:0.0	.	556	Q8N196	SIX5_HUMAN	M	556	ENSP00000316842:L556M	ENSP00000316842:L556M	L	-	1	2	SIX5	50961153	0.094000	0.21725	0.967000	0.41034	0.803000	0.45373	1.156000	0.31712	0.490000	0.27771	-0.216000	0.12614	CTG			0.677	SIX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000417341.3		NM_175875	
DMPK	1760	mdanderson.org	37	19	46274631	46274631	+	Silent	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr19:46274631G>T	ENST00000291270.4	-	13	1749	c.1624C>A	c.(1624-1626)Cgg>Agg	p.R542R	AC074212.6_ENST00000586498.1_RNA|DMPK_ENST00000343373.4_Silent_p.R552R|AC074212.6_ENST00000590076.1_RNA|DMPK_ENST00000447742.2_Silent_p.R537R|DMPK_ENST00000354227.5_Intron|SIX5_ENST00000560168.1_5'Flank|DMPK_ENST00000600757.1_Silent_p.R547R|AC074212.6_ENST00000591530.1_RNA|DMPK_ENST00000458663.2_Silent_p.R537R|AC074212.5_ENST00000559756.1_RNA|AC074212.5_ENST00000592217.2_RNA|SIX5_ENST00000317578.6_5'Flank|AC074212.6_ENST00000586251.1_RNA	NM_004409.3	NP_004400.4	Q09013	DMPK_HUMAN	dystrophia myotonica-protein kinase	542					cellular calcium ion homeostasis (GO:0006874)|muscle cell apoptotic process (GO:0010657)|nuclear envelope organization (GO:0006998)|protein phosphorylation (GO:0006468)|regulation of catalytic activity (GO:0050790)|regulation of excitatory postsynaptic membrane potential involved in skeletal muscle contraction (GO:0014853)|regulation of heart contraction (GO:0008016)|regulation of myotube differentiation (GO:0010830)|regulation of skeletal muscle contraction by calcium ion signaling (GO:0014722)|regulation of sodium ion transport (GO:0002028)|regulation of synapse structural plasticity (GO:0051823)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of mitochondrial outer membrane (GO:0031307)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|myosin phosphatase regulator activity (GO:0017020)|protein serine/threonine kinase activity (GO:0004674)			endometrium(5)|kidney(1)|large_intestine(1)|lung(6)|stomach(1)|urinary_tract(2)	16		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00616)|GBM - Glioblastoma multiforme(486;0.0825)|Epithelial(262;0.24)		TCCGTGGCCCGGGGACTGGGG	0.677																																					p.R552R	Esophageal Squamous(35;307 869 9153 24033 28903)												.	.			0			c.C1654A												63.0	73.0	70.0					19																	46274631		2203	4300	6503	SO:0001819	synonymous_variant	1760	exon12			TGGCCCGGGGACT	L19268	CCDS12674.1, CCDS46117.1, CCDS46118.1, CCDS46119.1, CCDS74400.1	19q13.3	2014-02-05					2.7.11.1		2933	protein-coding gene	gene with protein product	"""dystrophia myotonica 1"", ""DM protein kinase"", ""myotonin protein kinase A"", ""myotonic dystrophy associated protein kinase"", ""thymopoietin homolog"""	605377	"""dystrophia myotonica 1 (includes dystrophia myotonia protein kinase)"""	DM1, DM		1546325, 1546326	Standard	NM_001288765		Approved	DMK, DM1PK, MDPK, MT-PK	uc002pdf.1	Q09013		ENST00000291270.4:c.1624C>A	19.37:g.46274631G>T			Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_001081563	85	0.00	0	E5KR08|Q16205|Q6P5Z6	Silent	SNP	ENST00000291270.4	37	CCDS12674.1																																																																																					0.677	DMPK-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000460572.1		NM_004409	
SHANK1	50944	broad.mit.edu	37	19	51215270	51215270	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr19:51215270C>A	ENST00000293441.1	-	6	912	c.894G>T	c.(892-894)gaG>gaT	p.E298D	SHANK1_ENST00000359082.3_Missense_Mutation_p.E298D|SHANK1_ENST00000391814.1_Missense_Mutation_p.E298D	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	298					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		ACAGGAGCAGCTCGCAGCATC	0.637																																					p.E298D													.	SHANK1	210		0			c.G894T												69.0	73.0	72.0					19																	51215270		2203	4300	6503	SO:0001583	missense	50944	exon6			GAGCAGCTCGCAG	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.894G>T	19.37:g.51215270C>A	ENSP00000293441:p.Glu298Asp		Somatic	98	0.0102040816	1		WXS	Illumina HiSeq	Phase_I	104	0.06	6	NM_016148	3	0.00	0	A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	ENST00000293441.1	37	CCDS12799.1	.	.	.	.	.	.	.	.	.	.	C	13.42	2.232587	0.39498	.	.	ENSG00000161681	ENST00000293441;ENST00000359082;ENST00000391814	T;T;T	0.17528	2.27;2.27;2.27	4.68	3.65	0.41850	Ankyrin repeat-containing domain (3);	0.000000	0.56097	U	0.000022	T	0.25121	0.0610	L	0.31207	0.915	0.50813	D	0.999896	D	0.76494	0.999	D	0.80764	0.994	T	0.02417	-1.1162	10	0.87932	D	0	-19.8045	6.8766	0.24151	0.0:0.7227:0.0:0.2773	.	298	Q9Y566	SHAN1_HUMAN	D	298	ENSP00000293441:E298D;ENSP00000351984:E298D;ENSP00000375690:E298D	ENSP00000293441:E298D	E	-	3	2	SHANK1	55907082	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.660000	0.37397	1.116000	0.41820	0.555000	0.69702	GAG			0.637	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268071.1		NM_016148	
KLK10	5655	mdanderson.org	37	19	51519206	51519206	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr19:51519206G>T	ENST00000309958.3	-	4	694	c.476C>A	c.(475-477)cCc>cAc	p.P159H	KLK10_ENST00000358789.3_Missense_Mutation_p.P159H|CTC-518B2.12_ENST00000596286.1_RNA|KLK10_ENST00000391805.1_Missense_Mutation_p.P159H	NM_002776.4	NP_002767.2	O43240	KLK10_HUMAN	kallikrein-related peptidase 10	159	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell cycle (GO:0007049)	extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	13		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00885)		ACAGCGGTAGGGAAGCTGCAG	0.692																																					p.P159H													.	.			0			c.C476A												12.0	15.0	14.0					19																	51519206		2195	4289	6484	SO:0001583	missense	5655	exon4			CGGTAGGGAAGCT	AF024605	CCDS12817.1	19q13	2011-03-07	2006-10-27			ENSG00000129451		"""Kallikreins"""	6358	protein-coding gene	gene with protein product		602673	"""kallikrein 10"""	PRSSL1		8764136, 9533035, 16800724, 16800723, 10675891	Standard	NM_145888		Approved	NES1	uc002pva.3	O43240		ENST00000309958.3:c.476C>A	19.37:g.51519206G>T	ENSP00000311746:p.Pro159His		Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_145888	2	0.00	0	A6NC12|Q53YL3|Q99920|Q9GZW9	Missense_Mutation	SNP	ENST00000309958.3	37	CCDS12817.1	.	.	.	.	.	.	.	.	.	.	g	14.53	2.562156	0.45590	.	.	ENSG00000129451	ENST00000391805;ENST00000309958;ENST00000358789	D;D;D	0.95205	-3.64;-3.64;-3.64	4.46	4.46	0.54185	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.35378	N	0.003255	D	0.97832	0.9288	M	0.93328	3.405	0.36785	D	0.884529	D	0.89917	1.0	D	0.83275	0.996	D	0.99964	1.1791	10	0.87932	D	0	.	14.9746	0.71261	0.0:0.0:1.0:0.0	.	159	O43240	KLK10_HUMAN	H	159	ENSP00000375681:P159H;ENSP00000311746:P159H;ENSP00000351640:P159H	ENSP00000311746:P159H	P	-	2	0	KLK10	56211018	1.000000	0.71417	0.973000	0.42090	0.011000	0.07611	4.752000	0.62176	2.179000	0.69175	0.655000	0.94253	CCC			0.692	KLK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000464337.2		NM_002776	
ZNF480	147657	broad.mit.edu;mdanderson.org	37	19	52817472	52817472	+	Missense_Mutation	SNP	G	G	T	rs200373642		TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr19:52817472G>T	ENST00000595962.1	+	3	205	c.139G>T	c.(139-141)Gca>Tca	p.A47S	ZNF480_ENST00000334564.7_Missense_Mutation_p.A47S|CTD-2525I3.6_ENST00000594379.1_RNA|ZNF480_ENST00000335090.6_Intron|ZNF480_ENST00000490272.1_Intron	NM_144684.2	NP_653285.2	Q8WV37	ZN480_HUMAN	zinc finger protein 480	47	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	12				GBM - Glioblastoma multiforme(134;0.00212)|OV - Ovarian serous cystadenocarcinoma(262;0.00369)		CCTGGACCCTGCACAGAGGGC	0.507																																					p.A47S													.	ZNF480	123		0			c.G139T												153.0	132.0	139.0					19																	52817472		2203	4300	6503	SO:0001583	missense	147657	exon3			GACCCTGCACAGA	AY512662	CCDS12850.2, CCDS74437.1	19q13.41	2013-01-08			ENSG00000198464	ENSG00000198464		"""Zinc fingers, C2H2-type"", ""-"""	23305	protein-coding gene	gene with protein product		613910				15219843	Standard	XM_005258525		Approved	MGC32104	uc010ydl.2	Q8WV37	OTTHUMG00000157507	ENST00000595962.1:c.139G>T	19.37:g.52817472G>T	ENSP00000471754:p.Ala47Ser		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	92	0.04	4	NM_144684	87	0.00	0	Q5JPG9|Q6P0Q4|Q8N1M5	Missense_Mutation	SNP	ENST00000595962.1	37	CCDS12850.2	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.206490	0.00292	.	.	ENSG00000198464	ENST00000354515;ENST00000468240;ENST00000334564	T;T	0.02258	4.37;4.37	2.04	-0.39	0.12450	Krueppel-associated box (4);	.	.	.	.	T	0.01905	0.0060	L	0.60067	1.865	0.09310	N	1	P;B	0.44659	0.84;0.085	B;B	0.31869	0.137;0.092	T	0.46898	-0.9158	9	0.22109	T	0.4	.	4.0342	0.09722	0.1477:0.0:0.6231:0.2292	.	47;47	F8WEZ9;Q8WV37	.;ZN480_HUMAN	S	69;47;47	ENSP00000417424:A47S;ENSP00000334164:A47S	ENSP00000334164:A47S	A	+	1	0	ZNF480	57509284	0.000000	0.05858	0.094000	0.20943	0.016000	0.09150	0.452000	0.21795	-0.177000	0.10690	-1.248000	0.01517	GCA			0.507	ZNF480-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000349001.3		NM_144684	
RDH13	112724	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55559896	55559896	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr19:55559896C>G	ENST00000415061.3	-	5	602	c.459G>C	c.(457-459)ttG>ttC	p.L153F	CTC-550B14.6_ENST00000585492.1_RNA|RDH13_ENST00000396247.3_Missense_Mutation_p.L82F|CTC-550B14.7_ENST00000593060.1_RNA	NM_001145971.1	NP_001139443.1	Q8NBN7	RDH13_HUMAN	retinol dehydrogenase 13 (all-trans/9-cis)	153					eye photoreceptor cell development (GO:0042462)|response to high light intensity (GO:0009644)|retina layer formation (GO:0010842)	mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	12			BRCA - Breast invasive adenocarcinoma(297;0.199)	GBM - Glioblastoma multiforme(193;0.0504)	Vitamin A(DB00162)	GCAAGTTTGTCAAGAGAAAGT	0.512																																					p.L153F													RDH13_ENST00000415061,colon,carcinoma,-1,2	RDH13_ENST00000415061	-1	2	0			c.G459C												63.0	64.0	64.0					19																	55559896		2017	4167	6184	SO:0001583	missense	112724	exon5			GTTTGTCAAGAGA		CCDS42627.1, CCDS54320.1	19q13.42	2011-09-14	2006-05-09			ENSG00000160439	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	19978	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 3"""		"""retinol dehydrogenase 13 (all-trans and 9-cis)"""			12226107, 19027726	Standard	NM_138412		Approved	SDR7C3	uc002qio.3	Q8NBN7		ENST00000415061.3:c.459G>C	19.37:g.55559896C>G	ENSP00000391121:p.Leu153Phe		Somatic	69	0	0		WXS	Illumina HiSeq	.	92	0.23	21	NM_001145971	26	0.27	7	Q6UX79|Q96G88	Missense_Mutation	SNP	ENST00000415061.3	37	CCDS54320.1	.	.	.	.	.	.	.	.	.	.	C	18.07	3.541355	0.65085	.	.	ENSG00000160439	ENST00000415061;ENST00000396247;ENST00000291892	D;D;D	0.92149	-2.98;-2.98;-2.98	5.29	1.97	0.26223	NAD(P)-binding domain (1);	0.000000	0.64402	D	0.000002	D	0.93897	0.8047	M	0.76002	2.32	0.43300	D	0.995299	D	0.89917	1.0	D	0.91635	0.999	D	0.91493	0.5213	10	0.62326	D	0.03	.	3.9477	0.09355	0.1666:0.5687:0.0:0.2647	.	153	Q8NBN7	RDH13_HUMAN	F	153;82;153	ENSP00000391121:L153F;ENSP00000379547:L82F;ENSP00000291892:L153F	ENSP00000291892:L153F	L	-	3	2	RDH13	60251708	1.000000	0.71417	0.789000	0.31954	0.952000	0.60782	1.522000	0.35921	0.740000	0.32651	0.549000	0.68633	TTG			0.512	RDH13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000451470.1		NM_138412	
ZFP28	140612	mdanderson.org	37	19	57050578	57050578	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr19:57050578C>T	ENST00000301318.3	+	1	262	c.191C>T	c.(190-192)aCg>aTg	p.T64M	ZFP28_ENST00000591844.1_Missense_Mutation_p.T64M|ZFP28_ENST00000594386.1_3'UTR|AC005498.3_ENST00000593218.1_lincRNA	NM_020828.1	NP_065879.1	Q8NHY6	ZFP28_HUMAN	ZFP28 zinc finger protein	64					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(6)|ovary(1)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	35		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		GCGGCCCCTACGGGGCCTGGG	0.667																																					p.T64M	Ovarian(124;554 1662 19430 21141 52494)												.	.			0			c.C191T												6.0	7.0	7.0					19																	57050578		2014	3998	6012	SO:0001583	missense	140612	exon1			CCCCTACGGGGCC		CCDS12946.1	19q13.43	2013-01-08	2012-11-27			ENSG00000196867		"""Zinc fingers, C2H2-type"", ""-"""	17801	protein-coding gene	gene with protein product			"""zinc finger protein 28 homolog (mouse)"""				Standard	NM_020828		Approved	KIAA1431, mkr5	uc002qnj.3	Q8NHY6		ENST00000301318.3:c.191C>T	19.37:g.57050578C>T	ENSP00000301318:p.Thr64Met		Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	26	0.12	3	NM_020828	7	0.00	0	A0JNV6|K7ES88|Q8NHU8|Q9BY30|Q9P2B6	Missense_Mutation	SNP	ENST00000301318.3	37	CCDS12946.1	.	.	.	.	.	.	.	.	.	.	C	10.44	1.350944	0.24512	.	.	ENSG00000196867	ENST00000301318	T	0.05081	3.5	2.94	-0.616	0.11583	.	1.338300	0.05790	U	0.610220	T	0.02929	0.0087	N	0.03608	-0.345	0.09310	N	1	B;B	0.22211	0.017;0.066	B;B	0.09377	0.003;0.004	T	0.43360	-0.9396	10	0.46703	T	0.11	.	5.3577	0.16071	0.0:0.5487:0.0:0.4513	.	64;64	Q8NHY6;A8K0L8	ZFP28_HUMAN;.	M	64	ENSP00000301318:T64M	ENSP00000301318:T64M	T	+	2	0	ZFP28	61742390	0.015000	0.18098	0.006000	0.13384	0.056000	0.15407	-0.175000	0.09825	-0.043000	0.13513	0.462000	0.41574	ACG			0.667	ZFP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458409.1		NM_020828	
IFT172	26160	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	27677283	27677283	+	Silent	SNP	A	A	G			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr2:27677283A>G	ENST00000260570.3	-	32	3571	c.3468T>C	c.(3466-3468)ggT>ggC	p.G1156G		NM_015662.1	NP_056477.1	Q9UG01	IF172_HUMAN	intraflagellar transport 172	1156					bone development (GO:0060348)|brain development (GO:0007420)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|epidermis development (GO:0008544)|heart looping (GO:0001947)|hindgut development (GO:0061525)|left/right axis specification (GO:0070986)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)	axoneme (GO:0005930)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(17)|lung(17)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	43	Acute lymphoblastic leukemia(172;0.155)					CTTCGAATTTACCCTACAGGG	0.517																																					p.G1156G													.	.			0			c.T3468C												112.0	110.0	111.0					2																	27677283		2203	4300	6503	SO:0001819	synonymous_variant	26160	exon32			GAATTTACCCTAC	AB033005	CCDS1755.1	2p23.3	2014-07-03	2014-07-03		ENSG00000138002	ENSG00000138002		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	30391	protein-coding gene	gene with protein product	"""wimple homolog"""	607386	"""intraflagellar transport 172 homolog (Chlamydomonas)"""			10788441, 10574461, 24140113	Standard	XM_005264254		Approved	SLB, wim, osm-1, NPHP17	uc002rku.3	Q9UG01	OTTHUMG00000128425	ENST00000260570.3:c.3468T>C	2.37:g.27677283A>G			Somatic	90	0	0		WXS	Illumina HiSeq	.	102	0.31	32	NM_015662	171	0.32	55	A5PKZ0|B2RNU5|Q86X44|Q96HW4|Q9UFJ9|Q9ULP1	Silent	SNP	ENST00000260570.3	37	CCDS1755.1	.	.	.	.	.	.	.	.	.	.	A	7.675	0.687717	0.14973	.	.	ENSG00000138002	ENST00000443889	.	.	.	5.6	-2.99	0.05497	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-13.2235	0.5484	0.00658	0.3233:0.2013:0.2676:0.2078	.	.	.	.	Q	25	.	.	X	-	1	0	IFT172	27530787	0.090000	0.21635	0.969000	0.41365	0.572000	0.35998	-0.704000	0.05058	-0.784000	0.04528	-2.293000	0.00265	TAA			0.517	IFT172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250213.2		NM_015662	
EPC2	26122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	149501290	149501290	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr2:149501290A>T	ENST00000258484.6	+	3	447	c.413A>T	c.(412-414)cAa>cTa	p.Q138L		NM_015630.3	NP_056445.3	Q52LR7	EPC2_HUMAN	enhancer of polycomb homolog 2 (Drosophila)	138					chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.0516)		AAGCCTTTGCAATTTGAAATT	0.333																																					p.Q138L													.	.			0			c.A413T												58.0	57.0	57.0					2																	149501290		1822	4080	5902	SO:0001583	missense	26122	exon3			CTTTGCAATTTGA	AF286904	CCDS46422.1	2q23	2008-02-05			ENSG00000135999	ENSG00000135999			24543	protein-coding gene	gene with protein product		611000					Standard	NM_015630		Approved	DKFZP566F2124	uc010zbt.2	Q52LR7	OTTHUMG00000153739	ENST00000258484.6:c.413A>T	2.37:g.149501290A>T	ENSP00000258484:p.Gln138Leu		Somatic	249	0	0		WXS	Illumina HiSeq	.	245	0.20	49	NM_015630	21	0.33	7	B3KWT7|D3DP89|Q7L9J1|Q96RR7|Q9NUT8|Q9NVR1|Q9UFM9	Missense_Mutation	SNP	ENST00000258484.6	37	CCDS46422.1	.	.	.	.	.	.	.	.	.	.	A	18.76	3.692194	0.68271	.	.	ENSG00000135999	ENST00000457184;ENST00000258484;ENST00000397424	T;T;T	0.44482	0.92;0.92;0.92	5.17	3.99	0.46301	Enhancer of polycomb-like, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.41858	0.1177	M	0.67700	2.07	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.37663	-0.9696	10	0.87932	D	0	-3.2874	11.5304	0.50607	0.8656:0.0:0.0:0.1344	.	138	Q52LR7	EPC2_HUMAN	L	114;138;67	ENSP00000415543:Q114L;ENSP00000258484:Q138L;ENSP00000380569:Q67L	ENSP00000258484:Q138L	Q	+	2	0	EPC2	149217760	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	8.870000	0.92336	0.896000	0.36366	-0.481000	0.04817	CAA			0.333	EPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000332278.1		NM_015630	
ATF2	1386	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	175979435	175979435	+	Silent	SNP	G	G	C			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr2:175979435G>C	ENST00000264110.2	-	8	907	c.609C>G	c.(607-609)tcC>tcG	p.S203S	ATF2_ENST00000409499.1_Intron|ATF2_ENST00000487334.2_Silent_p.S185S|ATF2_ENST00000345739.5_Silent_p.S145S|ATF2_ENST00000392544.1_Silent_p.S203S|ATF2_ENST00000409635.1_Silent_p.S145S|ATF2_ENST00000392543.2_Intron|ATF2_ENST00000409437.1_Intron|ATF2_ENST00000409833.1_Silent_p.S203S|ATF2_ENST00000538946.1_Silent_p.S185S|ATF2_ENST00000426833.3_Silent_p.S185S	NM_001256090.1|NM_001256091.1|NM_001880.3	NP_001243019.1|NP_001243020.1|NP_001871.2	P15336	ATF2_HUMAN	activating transcription factor 2	203					adipose tissue development (GO:0060612)|cellular response to DNA damage stimulus (GO:0006974)|chromatin organization (GO:0006325)|fat cell differentiation (GO:0045444)|histone acetylation (GO:0016573)|innate immune response (GO:0045087)|intra-S DNA damage checkpoint (GO:0031573)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|outflow tract morphogenesis (GO:0003151)|positive regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902110)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta2 production (GO:0032915)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to osmotic stress (GO:0006970)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	cAMP response element binding (GO:0035497)|cAMP response element binding protein binding (GO:0008140)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)	17			OV - Ovarian serous cystadenocarcinoma(117;0.125)		Pseudoephedrine(DB00852)	GCCTGTTAGAGGATGGTGCCT	0.383																																					p.S203S	Pancreas(17;87 705 4534 15538 30988)												.	.			0			c.C609G												247.0	222.0	231.0					2																	175979435		2203	4300	6503	SO:0001819	synonymous_variant	1386	exon8			GTTAGAGGATGGT	X15875	CCDS2262.1, CCDS58737.1, CCDS58738.1, CCDS58739.1	2q32	2013-01-10			ENSG00000115966	ENSG00000115966		"""basic leucine zipper proteins"""	784	protein-coding gene	gene with protein product		123811	"""cAMP responsive element binding protein 2"""	CREB2		1833307, 1838349	Standard	NM_001880		Approved	TREB7, CRE-BP1, HB16	uc002ujl.4	P15336	OTTHUMG00000132424	ENST00000264110.2:c.609C>G	2.37:g.175979435G>C			Somatic	162	0	0		WXS	Illumina HiSeq	.	127	0.05	6	NM_001880	36	0.03	1	A1L3Z2|A4D7U4|A4D7U5|A4D7V1|D3DPE9|G8JLM5|Q13000|Q3B7B7|Q4ZFU9|Q53RY2|Q8TAR1|Q96JT8	Silent	SNP	ENST00000264110.2	37	CCDS2262.1																																																																																					0.383	ATF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000255562.1		NM_001880	
HECW2	57520	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	197183390	197183390	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr2:197183390T>C	ENST00000260983.3	-	9	2406	c.2224A>G	c.(2224-2226)Agc>Ggc	p.S742G	HECW2_ENST00000409111.1_Missense_Mutation_p.S386G	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	742	Interaction with TP73.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						CCCTCCAGGCTCCCCCTCCGC	0.667																																					p.S742G													.	HECW2	239		0			c.A2224G												34.0	35.0	35.0					2																	197183390		2203	4300	6503	SO:0001583	missense	57520	exon9			CCAGGCTCCCCCT	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.2224A>G	2.37:g.197183390T>C	ENSP00000260983:p.Ser742Gly		Somatic	160	0.0125	2		WXS	Illumina HiSeq	Phase_I	146	0.04	6	NM_020760	0		0	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	37	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	T	10.64	1.407549	0.25378	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	T;T	0.36340	1.26;1.34	4.91	3.77	0.43336	.	2.196530	0.01266	N	0.009317	T	0.31199	0.0789	L	0.27053	0.805	0.33091	D	0.538002	B	0.02656	0.0	B	0.01281	0.0	T	0.19910	-1.0291	10	0.42905	T	0.14	.	8.795	0.34874	0.0:0.0863:0.0:0.9137	.	742	Q9P2P5	HECW2_HUMAN	G	386;742	ENSP00000386775:S386G;ENSP00000260983:S742G	ENSP00000260983:S742G	S	-	1	0	HECW2	196891635	0.987000	0.35691	0.949000	0.38748	0.623000	0.37688	2.171000	0.42453	0.917000	0.36895	0.379000	0.24179	AGC			0.667	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000335199.3		NM_020760	
SPHKAP	80309	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	228882457	228882457	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr2:228882457A>G	ENST00000392056.3	-	7	3159	c.3113T>C	c.(3112-3114)tTt>tCt	p.F1038S	SPHKAP_ENST00000344657.5_Missense_Mutation_p.F1038S	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1038						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TTCATTGGCAAAAAGATTGAC	0.502																																					p.F1038S													.	.			0			c.T3113C												93.0	85.0	88.0					2																	228882457		2203	4300	6503	SO:0001583	missense	80309	exon7			TTGGCAAAAAGAT		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.3113T>C	2.37:g.228882457A>G	ENSP00000375909:p.Phe1038Ser		Somatic	109	0	0		WXS	Illumina HiSeq	.	122	0.31	38	NM_030623	0		0	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	A	16.45	3.127465	0.56721	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.19394	2.17;2.15	6.08	4.94	0.65067	.	0.047582	0.85682	D	0.000000	T	0.27313	0.0670	N	0.19112	0.55	0.58432	D	0.999998	D;D;D	0.67145	0.985;0.959;0.996	P;P;D	0.64506	0.786;0.503;0.926	T	0.02676	-1.1125	10	0.54805	T	0.06	.	10.9655	0.47410	0.9279:0.0:0.0721:0.0	.	69;1038;1038	B3KR30;Q2M3C7;Q2M3C7-2	.;SPKAP_HUMAN;.	S	1038	ENSP00000375909:F1038S;ENSP00000339886:F1038S	ENSP00000339886:F1038S	F	-	2	0	SPHKAP	228590701	1.000000	0.71417	0.986000	0.45419	0.712000	0.41017	6.767000	0.74975	2.333000	0.79357	0.533000	0.62120	TTT			0.502	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000331750.1		NM_030623	
KIF1A	547	broad.mit.edu	37	2	241696935	241696935	+	Intron	SNP	A	A	G			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr2:241696935A>G	ENST00000320389.7	-	25	2714				KIF1A_ENST00000498729.2_Missense_Mutation_p.S887P	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A						anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		AAGGTGGGGGAGGGGGTGAGA	0.627																																					p.S887P													.	KIF1A	152		0			c.T2659C																																									SO:0001627	intron_variant	547	exon27			TGGGGGAGGGGGT	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2555+841T>C	2.37:g.241696935A>G			Somatic	120	0.1	12		WXS	Illumina HiSeq	Phase_I	133	0.15	20	NM_001244008	0		0	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	37	CCDS46561.1	.	.	.	.	.	.	.	.	.	.	a	22.9	4.348057	0.82132	.	.	ENSG00000130294	ENST00000498729;ENST00000373308;ENST00000404283	T;T	0.75589	-0.91;-0.95	4.69	4.69	0.59074	.	.	.	.	.	D	0.83866	0.5347	.	.	.	0.46749	D	0.999184	D;D	0.76494	0.999;0.981	D;D	0.91635	0.999;0.972	T	0.82512	-0.0420	8	0.28530	T	0.3	.	14.1222	0.65195	1.0:0.0:0.0:0.0	.	887;887	F5H045;Q12756-2	.;.	P	887	ENSP00000438388:S887P;ENSP00000384231:S887P	ENSP00000362405:S887P	S	-	1	0	KIF1A	241345608	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.581000	0.90788	1.754000	0.51921	0.375000	0.23000	TCC			0.627	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000324536.3		NM_138483	
THBD	7056	mdanderson.org	37	20	23028597	23028597	+	Silent	SNP	C	C	A			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr20:23028597C>A	ENST00000377103.2	-	1	1781	c.1545G>T	c.(1543-1545)tcG>tcT	p.S515S		NM_000361.2	NP_000352.1	P07204	TRBM_HUMAN	thrombomodulin	515					blood coagulation (GO:0007596)|female pregnancy (GO:0007565)|leukocyte migration (GO:0050900)|negative regulation of blood coagulation (GO:0030195)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|response to cAMP (GO:0051591)|response to lipopolysaccharide (GO:0032496)|response to X-ray (GO:0010165)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(2)|large_intestine(3)|ovary(1)|skin(1)	7	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)				Drotrecogin alfa(DB00055)|Ibuprofen(DB01050)	TGAGCAAGCCCGAATGCACGA	0.711																																					p.S515S													.	.			0			c.G1545T												20.0	23.0	22.0					20																	23028597		2200	4296	6496	SO:0001819	synonymous_variant	7056	exon1			CAAGCCCGAATGC		CCDS13148.1	20p11.21	2014-09-17			ENSG00000178726	ENSG00000178726		"""CD molecules"""	11784	protein-coding gene	gene with protein product		188040					Standard	NM_000361		Approved	CD141	uc002wss.3	P07204	OTTHUMG00000032053	ENST00000377103.2:c.1545G>T	20.37:g.23028597C>A			Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	56	0.07	4	NM_000361	3	0.00	0	Q8IV29|Q9UC32	Silent	SNP	ENST00000377103.2	37	CCDS13148.1																																																																																					0.711	THBD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078307.2			
RALY	22913	broad.mit.edu	37	20	32664877	32664877	+	Silent	SNP	C	C	T	rs539352667	byFrequency	TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr20:32664877C>T	ENST00000246194.3	+	8	1204	c.702C>T	c.(700-702)ggC>ggT	p.G234G	RALY_ENST00000375114.3_Silent_p.G218G	NM_016732.2	NP_057951.1	Q9UKM9	RALY_HUMAN	RALY heterogeneous nuclear ribonucleoprotein	234	Epitope (recognized by BKRF1 antibodies).|Poly-Gly.				mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12						gcggcggcggcggtggtggtg	0.667																																					p.G234G													.	RALY	44		0			c.C702T												5.0	7.0	7.0					20																	32664877		2080	4086	6166	SO:0001819	synonymous_variant	22913	exon8			CGGCGGCGGTGGT	AF148457	CCDS13229.1, CCDS13230.1	20q11.21-q11.23	2013-08-06	2013-08-06		ENSG00000125970	ENSG00000125970		"""RNA binding motif (RRM) containing"""	15921	protein-coding gene	gene with protein product		614663	"""RNA-binding protein (autoantigenic, hnRNP-associated with lethal yellow)"", ""RNA binding protein, autoantigenic (hnRNP-associated with lethal yellow homolog (mouse))"""			10500250, 23614458	Standard	NM_016732		Approved	P542, HNRPCL2	uc002xab.3	Q9UKM9	OTTHUMG00000032283	ENST00000246194.3:c.702C>T	20.37:g.32664877C>T			Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	85	0.06	5	NM_016732	231	0.00	0	Q14621|Q2M365|Q5QPL8|Q9BQX6|Q9UJE3	Silent	SNP	ENST00000246194.3	37	CCDS13230.1																																																																																					0.667	RALY-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000078753.1			
CSE1L	1434	mdanderson.org	37	20	47691377	47691377	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr20:47691377G>T	ENST00000262982.2	+	11	1245	c.1122G>T	c.(1120-1122)ttG>ttT	p.L374F	CSE1L_ENST00000542325.1_Missense_Mutation_p.L157F|CSE1L_ENST00000396192.3_Missense_Mutation_p.L318F	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)	374					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)			breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			GGAGAGATTTGGAAGGATCTG	0.388																																					p.L374F													.	.			0			c.G1122T												193.0	176.0	182.0					20																	47691377		2203	4300	6503	SO:0001583	missense	1434	exon11			AGATTTGGAAGGA	U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.1122G>T	20.37:g.47691377G>T	ENSP00000262982:p.Leu374Phe		Somatic	115	0.0086956522	1		WXS	Illumina HiSeq	Phase_I	113	0.04	5	NM_001316	315	0.00	0	A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	Missense_Mutation	SNP	ENST00000262982.2	37	CCDS13412.1	.	.	.	.	.	.	.	.	.	.	G	17.57	3.423645	0.62733	.	.	ENSG00000124207	ENST00000262982;ENST00000542325;ENST00000396192	T;T;T	0.69175	-0.38;-0.38;-0.38	5.54	3.61	0.41365	Armadillo-like helical (1);Armadillo-type fold (1);Exportin/Importin, Cse1-like (1);	0.000000	0.85682	D	0.000000	T	0.78220	0.4249	M	0.80982	2.52	0.80722	D	1	D;D;P;D;D	0.71674	0.991;0.998;0.944;0.976;0.996	D;D;P;P;D	0.71414	0.918;0.973;0.808;0.797;0.973	T	0.76116	-0.3077	10	0.24483	T	0.36	-9.8213	9.9498	0.41631	0.1553:0.0:0.8447:0.0	.	63;157;318;318;374	F5GX54;B4DUC5;A3RLL6;F8W904;P55060	.;.;.;.;XPO2_HUMAN	F	374;157;318	ENSP00000262982:L374F;ENSP00000446477:L157F;ENSP00000379495:L318F	ENSP00000262982:L374F	L	+	3	2	CSE1L	47124784	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.474000	0.35398	1.363000	0.46019	-0.136000	0.14681	TTG			0.388	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080345.2		NM_001316	
CTSZ	1522	mdanderson.org	37	20	57581505	57581505	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr20:57581505G>A	ENST00000217131.5	-	2	297	c.179C>T	c.(178-180)gCg>gTg	p.A60V		NM_001336.3	NP_001327.2	Q9UBR2	CATZ_HUMAN	cathepsin Z	60					angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	cysteine-type peptidase activity (GO:0008234)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)	10	all_lung(29;0.00711)		Colorectal(105;0.109)			GGGCAGATCCGCTGGGGACAG	0.637																																					p.A60V													.	.			0			c.C179T												85.0	72.0	76.0					20																	57581505		2203	4300	6503	SO:0001583	missense	1522	exon2			AGATCCGCTGGGG	AF032906	CCDS13474.1	20q13.32	2012-02-10			ENSG00000101160	ENSG00000101160		"""Cathepsins"""	2547	protein-coding gene	gene with protein product	"""cathepsin X"", ""carboxypeptidase LB"", ""cathepsin IV"", ""cathepsin B2"", ""cathepsin Y"", ""cathepsin Z1"", ""cysteine-type carboxypeptidase"", ""lysosomal carboxypeptidase B"""	603169				9642240	Standard	NM_001336		Approved	CTSX	uc002yai.2	Q9UBR2	OTTHUMG00000032858	ENST00000217131.5:c.179C>T	20.37:g.57581505G>A	ENSP00000217131:p.Ala60Val		Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_001336	1152	0.00	1	B2RC40|O75331|Q9UQV5|Q9UQV6	Missense_Mutation	SNP	ENST00000217131.5	37	CCDS13474.1	.	.	.	.	.	.	.	.	.	.	G	10.89	1.477995	0.26511	.	.	ENSG00000101160	ENST00000217131	T	0.41065	1.01	5.29	3.33	0.38152	.	0.909290	0.09563	N	0.785315	T	0.36386	0.0965	L	0.43152	1.355	0.09310	N	1	B;B	0.16166	0.016;0.008	B;B	0.04013	0.0;0.001	T	0.25082	-1.0142	10	0.37606	T	0.19	.	10.8201	0.46599	0.071:0.1314:0.7976:0.0	.	60;60	Q5U000;Q9UBR2	.;CATZ_HUMAN	V	60	ENSP00000217131:A60V	ENSP00000217131:A60V	A	-	2	0	CTSZ	57014900	0.013000	0.17824	0.017000	0.16124	0.276000	0.26787	1.859000	0.39418	0.608000	0.30000	-0.175000	0.13238	GCG			0.637	CTSZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079899.1		NM_001336	
PPP1R3D	5509	broad.mit.edu	37	20	58514308	58514308	+	Missense_Mutation	SNP	C	C	T	rs374884643		TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr20:58514308C>T	ENST00000370996.3	-	1	1044	c.679G>A	c.(679-681)Gca>Aca	p.A227T	FAM217B_ENST00000360816.3_5'Flank|FAM217B_ENST00000358293.3_Intron	NM_006242.3	NP_006233.1	O95685	PPR3D_HUMAN	protein phosphatase 1, regulatory subunit 3D	227	CBM21. {ECO:0000255|PROSITE- ProRule:PRU00491}.				dephosphorylation (GO:0016311)|glycogen metabolic process (GO:0005977)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of glycogen catabolic process (GO:0005981)	glycogen granule (GO:0042587)|intracellular membrane-bounded organelle (GO:0043231)	protein serine/threonine phosphatase activity (GO:0004722)	p.A227T(2)		endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|urinary_tract(1)	13	all_lung(29;0.00391)		BRCA - Breast invasive adenocarcinoma(7;5.12e-09)			TCGGGGCCTGCGGGCCCGCGC	0.692																																					p.A227T													PPP1R3D,NS,carcinoma,0,2	PPP1R3D	23	2	2	Substitution - Missense(2)	urinary_tract(1)|prostate(1)	c.G679A							C	,THR/ALA	0,4402		0,0,2201	33.0	35.0	34.0		,679	3.5	0.0	20		34	1,8597	1.2+/-3.3	0,1,4298	no	intron,missense	PPP1R3D,C20orf177	NM_001190826.1,NM_006242.3	,58	0,1,6499	TT,TC,CC		0.0116,0.0,0.0077	,possibly-damaging	,227/300	58514308	1,12999	2201	4299	6500	SO:0001583	missense	5509	exon1			GGCCTGCGGGCCC	Y18206	CCDS13483.1	20q13.3	2012-04-17	2011-10-04	2001-08-01	ENSG00000132825	ENSG00000132825		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9294	protein-coding gene	gene with protein product		603326	"""protein phosphatase 1, regulatory (inhibitor) subunit 3D"""	PPP1R6		9414128, 9275233	Standard	NM_006242		Approved		uc002ybb.3	O95685	OTTHUMG00000032876	ENST00000370996.3:c.679G>A	20.37:g.58514308C>T	ENSP00000360035:p.Ala227Thr		Somatic	83	0.0120481928	1		WXS	Illumina HiSeq	Phase_I	83	0.04	3	NM_006242	8	0.00	0	Q6DK02	Missense_Mutation	SNP	ENST00000370996.3	37	CCDS13483.1	.	.	.	.	.	.	.	.	.	.	C	12.80	2.045423	0.36085	0.0	1.16E-4	ENSG00000132825	ENST00000370996	T	0.63417	-0.04	3.49	3.49	0.39957	Putative phosphatase regulatory subunit (2);	0.943478	0.08678	N	0.909851	T	0.54143	0.1840	L	0.33624	1.015	0.09310	N	1	D	0.58620	0.983	P	0.47299	0.543	T	0.33777	-0.9855	10	0.15066	T	0.55	-4.3168	10.4722	0.44644	0.0:0.8904:0.0:0.1096	.	227	O95685	PPR3D_HUMAN	T	227	ENSP00000360035:A227T	ENSP00000360035:A227T	A	-	1	0	PPP1R3D	57947703	0.957000	0.32711	0.027000	0.17364	0.202000	0.24057	5.500000	0.66943	2.257000	0.74773	0.462000	0.41574	GCA			0.692	PPP1R3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079940.2		NM_006242	
TCEA2	6919	mdanderson.org	37	20	62701120	62701120	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr20:62701120G>T	ENST00000343484.5	+	6	632	c.463G>T	c.(463-465)Gac>Tac	p.D155Y	TCEA2_ENST00000395053.3_Missense_Mutation_p.D155Y|TCEA2_ENST00000361317.2_Missense_Mutation_p.D128Y|TCEA2_ENST00000465111.1_3'UTR	NM_003195.4	NP_003186.1	Q15560	TCEA2_HUMAN	transcription elongation factor A (SII), 2	155	TFIIS central. {ECO:0000255|PROSITE- ProRule:PRU00651}.				DNA-templated transcription, elongation (GO:0006354)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription, elongation (GO:0032784)	centrosome (GO:0005813)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)	12	all_cancers(38;3.45e-11)|all_epithelial(29;9.12e-13)|Lung NSC(23;2e-09)|all_lung(23;6.77e-09)					TCTTGCAGATGACCACGTGGC	0.607											OREG0026140	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D155Y													.	.			0			c.G463T												101.0	94.0	96.0					20																	62701120		2203	4300	6503	SO:0001583	missense	6919	exon6			GCAGATGACCACG	U86749	CCDS13553.1, CCDS13554.1	20q13.33	2011-01-25			ENSG00000171703	ENSG00000171703			11614	protein-coding gene	gene with protein product		604784				9441762, 8566795	Standard	NM_003195		Approved	TFIIS	uc021wgq.1	Q15560	OTTHUMG00000033026	ENST00000343484.5:c.463G>T	20.37:g.62701120G>T	ENSP00000343515:p.Asp155Tyr		Somatic	65	0	0	1063	WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_003195	27	0.00	0	B3KNM1|Q8TD37|Q8TD38	Missense_Mutation	SNP	ENST00000343484.5	37	CCDS13553.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.215826	0.79352	.	.	ENSG00000171703	ENST00000361317;ENST00000343484;ENST00000395053;ENST00000339217;ENST00000440819;ENST00000458442	T;T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84;0.84	4.41	4.41	0.53225	Transcription elongation factor S-IIM (1);Transcription elongation factor S-II, central domain (4);	0.116362	0.56097	D	0.000023	T	0.72447	0.3461	M	0.84773	2.715	0.58432	D	0.999998	D;D;D;D	0.89917	0.997;0.997;0.999;1.0	D;D;D;D	0.87578	0.972;0.972;0.991;0.998	T	0.78957	-0.1999	10	0.72032	D	0.01	-6.5384	17.3761	0.87392	0.0:0.0:1.0:0.0	.	155;155;128;155	Q15560;Q6IB64;B3KNM1;Q86VL0	TCEA2_HUMAN;.;.;.	Y	128;155;155;128;128;128	ENSP00000354552:D128Y;ENSP00000343515:D155Y;ENSP00000378493:D155Y;ENSP00000339432:D128Y;ENSP00000407085:D128Y;ENSP00000416026:D128Y	ENSP00000339432:D128Y	D	+	1	0	TCEA2	62171564	1.000000	0.71417	0.892000	0.35008	0.885000	0.51271	6.457000	0.73505	2.156000	0.67533	0.655000	0.94253	GAC			0.607	TCEA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080277.2		NM_198723	
TTC3	7267	broad.mit.edu	37	21	38507753	38507753	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr21:38507753G>T	ENST00000399017.2	+	18	4264	c.1517G>T	c.(1516-1518)tGc>tTc	p.C506F	TTC3_ENST00000354749.2_Missense_Mutation_p.C506F|TTC3_ENST00000540756.1_Missense_Mutation_p.C196F|TTC3_ENST00000479930.1_3'UTR|TTC3_ENST00000355666.1_Missense_Mutation_p.C506F	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	506					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				GAGCAGCGTTGCCGCAGCGCT	0.363																																					p.C506F	Ovarian(38;194 1649 35661)												.	TTC3	182		0			c.G1517T												59.0	60.0	60.0					21																	38507753		2203	4300	6503	SO:0001583	missense	7267	exon18			AGCGTTGCCGCAG	D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.1517G>T	21.37:g.38507753G>T	ENSP00000381981:p.Cys506Phe		Somatic	263	0.0038022814	1		WXS	Illumina HiSeq	Phase_I	333	0.01	4	NM_001001894	11	0.00	0	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Missense_Mutation	SNP	ENST00000399017.2	37	CCDS13651.1	.	.	.	.	.	.	.	.	.	.	G	13.77	2.335459	0.41398	.	.	ENSG00000182670	ENST00000418766;ENST00000450533;ENST00000438055;ENST00000355666;ENST00000540756;ENST00000399017;ENST00000354749	T;T;T;T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.8;-0.8;-0.8;-0.8	5.49	4.59	0.56863	Tetratricopeptide-like helical (1);	0.249770	0.34555	N	0.003872	T	0.74183	0.3683	L	0.27053	0.805	0.41676	D	0.989263	B;D	0.76494	0.053;0.999	B;D	0.80764	0.047;0.994	T	0.71374	-0.4612	9	.	.	.	-14.0827	7.9892	0.30231	0.0824:0.0:0.7571:0.1605	.	196;506	B4DSZ9;P53804	.;TTC3_HUMAN	F	506;506;488;506;196;506;506	ENSP00000403943:C506F;ENSP00000408456:C506F;ENSP00000391891:C488F;ENSP00000347889:C506F;ENSP00000442875:C196F;ENSP00000381981:C506F;ENSP00000346791:C506F	.	C	+	2	0	TTC3	37429623	1.000000	0.71417	0.996000	0.52242	0.728000	0.41692	1.484000	0.35508	2.728000	0.93425	0.655000	0.94253	TGC			0.363	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000194776.1			
CARD10	29775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	37891566	37891566	+	Silent	SNP	C	C	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr22:37891566C>T	ENST00000403299.1	-	16	2547	c.2331G>A	c.(2329-2331)gaG>gaA	p.E777E	CARD10_ENST00000406271.3_Silent_p.E491E|CARD10_ENST00000251973.5_Silent_p.E777E			Q9BWT7	CAR10_HUMAN	caspase recruitment domain family, member 10	777					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein complex assembly (GO:0006461)|regulation of apoptotic process (GO:0042981)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)	receptor signaling complex scaffold activity (GO:0030159)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	17	Melanoma(58;0.0574)					GCAGGCATTTCTCCTGAACTT	0.617																																					p.E777E													.	.			0			c.G2331A												39.0	39.0	39.0					22																	37891566		2203	4299	6502	SO:0001819	synonymous_variant	29775	exon15			GCATTTCTCCTGA	AF086324	CCDS13948.1	22q13.1	2008-05-22			ENSG00000100065	ENSG00000100065			16422	protein-coding gene	gene with protein product		607209				11259443, 11356195	Standard	NM_014550		Approved	CARMA3, BIMP1	uc003asu.1	Q9BWT7	OTTHUMG00000150592	ENST00000403299.1:c.2331G>A	22.37:g.37891566C>T			Somatic	59	0	0		WXS	Illumina HiSeq	.	62	0.26	16	NM_014550	48	0.31	15	Q14CQ8|Q5TFG6|Q8NC81|Q9UGR5|Q9UGR6|Q9Y3H0	Silent	SNP	ENST00000403299.1	37	CCDS13948.1																																																																																					0.617	CARD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318997.1		NM_014550	
SREBF2	6721	mdanderson.org	37	22	42296983	42296983	+	Intron	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr22:42296983G>T	ENST00000361204.4	+	16	3073				SREBF2_ENST00000491541.1_Intron|MIR33A_ENST00000385197.1_RNA	NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2						cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						ATGTTCTGGTGGTACCCATGC	0.592																																					.													.	.			0			.												59.0	55.0	56.0					22																	42296983		1568	3582	5150	SO:0001627	intron_variant	407039	.			TCTGGTGGTACCC	U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.2907+481G>T	22.37:g.42296983G>T			Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	.	0		0	Q05BD5|Q6GTH7|Q86V36|Q9UH04	RNA	SNP	ENST00000361204.4	37	CCDS14023.1																																																																																					0.592	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000321956.1		NM_004599	
EFCAB6	64800	mdanderson.org	37	22	44079680	44079680	+	Missense_Mutation	SNP	G	G	T	rs137794	byFrequency	TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr22:44079680G>T	ENST00000262726.7	-	12	1451	c.1198C>A	c.(1198-1200)Cac>Aac	p.H400N	EFCAB6_ENST00000396231.2_Missense_Mutation_p.H248N|EFCAB6_ENST00000358439.4_Intron	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	400			H -> Y (in dbSNP:rs137794). {ECO:0000269|PubMed:14702039}.		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				TCTTCAGTGTGTCTAAATAAC	0.353																																					p.H400N													.	.			0			c.C1198A												301.0	271.0	281.0					22																	44079680		2203	4300	6503	SO:0001583	missense	64800	exon12			CAGTGTGTCTAAA	Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.1198C>A	22.37:g.44079680G>T	ENSP00000262726:p.His400Asn		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	69	0.06	4	NM_022785	0		0	A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Missense_Mutation	SNP	ENST00000262726.7	37	CCDS14049.1	.	.	.	.	.	.	.	.	.	.	G	9.636	1.137711	0.21123	.	.	ENSG00000186976	ENST00000396231;ENST00000262726	T;T	0.15718	2.4;2.4	4.74	-0.573	0.11742	.	1.161790	0.06660	N	0.764303	T	0.17066	0.0410	L	0.50333	1.59	0.80722	P	0.0	D;P	0.54964	0.969;0.911	P;P	0.48400	0.576;0.575	T	0.27331	-1.0077	9	0.13108	T	0.6	-0.4667	3.4673	0.07554	0.3564:0.0:0.4715:0.1721	.	400;400	Q5THR3-6;Q5THR3	.;EFCB6_HUMAN	N	248;400	ENSP00000379533:H248N;ENSP00000262726:H400N	ENSP00000262726:H400N	H	-	1	0	EFCAB6	42411013	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.950000	0.29122	-0.083000	0.12618	-1.119000	0.02030	CAC			0.353	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000353176.1		NM_022785	
CELSR1	9620	broad.mit.edu	37	22	46804955	46804955	+	Silent	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr22:46804955G>T	ENST00000262738.3	-	9	5163	c.5164C>A	c.(5164-5166)Cgg>Agg	p.R1722R		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1722	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		TCCTCCTTCCGGGTCCGGAAC	0.637																																					p.R1722R													.	CELSR1	242		0			c.C5164A												72.0	63.0	66.0					22																	46804955		2203	4300	6503	SO:0001819	synonymous_variant	9620	exon9			CCTTCCGGGTCCG	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.5164C>A	22.37:g.46804955G>T			Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	126	0.03	4	NM_014246	5	0.00	0	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Silent	SNP	ENST00000262738.3	37	CCDS14076.1																																																																																					0.637	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318037.1		NM_014246	
OSBPL10	114884	broad.mit.edu;mdanderson.org	37	3	32022633	32022633	+	Silent	SNP	A	A	C			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr3:32022633A>C	ENST00000396556.2	-	1	161	c.39T>G	c.(37-39)ggT>ggG	p.G13G	ZNF860_ENST00000360311.4_5'Flank|OSBPL10_ENST00000438237.2_Silent_p.G13G	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	13					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		tgctgttgctACCCCCGCCGC	0.786																																					p.G13G													.	OSBPL10	160		0			c.T39G												2.0	3.0	2.0					3																	32022633		779	1678	2457	SO:0001819	synonymous_variant	114884	exon1			GTTGCTACCCCCG	AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.39T>G	3.37:g.32022633A>C			Somatic	21	0.1904761905	4		WXS	Illumina HiSeq	Phase_I	13	0.46	6	NM_017784	0		0	B4E212|Q9BTU5	Silent	SNP	ENST00000396556.2	37	CCDS2651.1																																																																																					0.786	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000253165.2			
VIPR1	7433	broad.mit.edu;mdanderson.org	37	3	42560718	42560718	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr3:42560718G>T	ENST00000325123.4	+	3	301	c.188G>T	c.(187-189)tGc>tTc	p.C63F	VIPR1_ENST00000473575.1_3'UTR|VIPR1-AS1_ENST00000452639.3_RNA|VIPR1-AS1_ENST00000602176.1_RNA|VIPR1-AS1_ENST00000596630.1_RNA|VIPR1-AS1_ENST00000601312.1_RNA|VIPR1-AS1_ENST00000598837.1_RNA|VIPR1-AS1_ENST00000600342.1_RNA|VIPR1_ENST00000543411.1_Missense_Mutation_p.C16F|VIPR1-AS1_ENST00000593611.1_RNA|VIPR1_ENST00000438259.2_5'UTR|VIPR1-AS1_ENST00000593621.1_RNA|VIPR1_ENST00000433647.1_Missense_Mutation_p.C22F	NM_001251885.1|NM_004624.3	NP_001238814.1|NP_004615.2	P32241	VIPR1_HUMAN	vasoactive intestinal peptide receptor 1	63					digestion (GO:0007586)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|muscle contraction (GO:0006936)|positive regulation of cell proliferation (GO:0008284)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	vasoactive intestinal polypeptide receptor activity (GO:0004999)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|ovary(2)|skin(1)|urinary_tract(3)	18				KIRC - Kidney renal clear cell carcinoma(284;0.241)		CCCATAGGCTGCAGCAAGATG	0.607																																					p.C63F													.	VIPR1	45		0			c.G188T												99.0	83.0	88.0					3																	42560718		2203	4300	6503	SO:0001583	missense	7433	exon3			TAGGCTGCAGCAA	AH005329	CCDS2698.1, CCDS58827.1, CCDS58828.1, CCDS58829.1	3p22	2012-08-10			ENSG00000114812	ENSG00000114812		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	12694	protein-coding gene	gene with protein product	"""VIP and PACAP receptor 1"""	192321				7708752	Standard	NM_004624		Approved	VPAC1, RDC1, HVR1, VPAC1R	uc003clf.2	P32241	OTTHUMG00000131792	ENST00000325123.4:c.188G>T	3.37:g.42560718G>T	ENSP00000327246:p.Cys63Phe		Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	65	0.06	4	NM_004624	0		0	A5JUT9|B3KPV1|B4DEB5|B4DGI4|F5H1F5|G3V0I1|Q15871|Q6P2M6	Missense_Mutation	SNP	ENST00000325123.4	37	CCDS2698.1	.	.	.	.	.	.	.	.	.	.	G	13.81	2.347814	0.41599	.	.	ENSG00000114812	ENST00000433647;ENST00000450274;ENST00000543411;ENST00000439731;ENST00000325123	D;D;D;D;D	0.97114	-4.25;-4.25;-4.25;-4.25;-4.25	3.65	3.65	0.41850	GPCR, family 2, secretin-like, conserved site (1);GPCR, family 2, extracellular hormone receptor domain (3);	0.000000	0.85682	D	0.000000	D	0.98704	0.9565	H	0.95328	3.655	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;1.0	D	0.98552	1.0637	10	0.87932	D	0	.	11.2116	0.48802	0.0:0.0:1.0:0.0	.	36;16;63	B4DNY6;F5H1F5;P32241	.;.;VIPR1_HUMAN	F	22;22;16;63;63	ENSP00000394950:C22F;ENSP00000415013:C22F;ENSP00000445701:C16F;ENSP00000403478:C63F;ENSP00000327246:C63F	ENSP00000327246:C63F	C	+	2	0	VIPR1	42535722	1.000000	0.71417	0.994000	0.49952	0.913000	0.54294	6.601000	0.74136	2.350000	0.79820	0.650000	0.86243	TGC			0.607	VIPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254728.4		NM_004624	
PTPN23	25930	mdanderson.org	37	3	47447256	47447256	+	Silent	SNP	C	C	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr3:47447256C>T	ENST00000265562.4	+	5	459	c.382C>T	c.(382-384)Ctg>Ttg	p.L128L	PTPN23_ENST00000431726.1_Silent_p.L2L	NM_015466.2	NP_056281.1	Q9H3S7	PTN23_HUMAN	protein tyrosine phosphatase, non-receptor type 23	128	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				cilium morphogenesis (GO:0060271)|negative regulation of epithelial cell migration (GO:0010633)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of adherens junction organization (GO:1903393)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of homophilic cell adhesion (GO:1903387)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|central_nervous_system(1)|large_intestine(5)|lung(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GCACTCCATGCTGGGGGCCAT	0.617																																					p.L128L													.	.			0			c.C382T												44.0	45.0	45.0					3																	47447256		2202	4300	6502	SO:0001819	synonymous_variant	25930	exon5			TCCATGCTGGGGG	AB025194	CCDS2754.1	3p21.3	2011-06-09			ENSG00000076201	ENSG00000076201		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	14406	protein-coding gene	gene with protein product		606584				11095967	Standard	NM_015466		Approved	DKFZP564F0923, KIAA1471, HD-PTP	uc003crf.1	Q9H3S7	OTTHUMG00000133520	ENST00000265562.4:c.382C>T	3.37:g.47447256C>T			Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_015466	30	0.00	0	A8K0D7|Q7KZF8|Q8N6Z5|Q9BSR5|Q9P257|Q9UG03|Q9UMZ4	Silent	SNP	ENST00000265562.4	37	CCDS2754.1																																																																																					0.617	PTPN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257492.2		NM_015466	
PTPN23	25930	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	47450550	47450550	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr3:47450550G>C	ENST00000265562.4	+	16	1692	c.1615G>C	c.(1615-1617)Gcc>Ccc	p.A539P	PTPN23_ENST00000431726.1_Missense_Mutation_p.A413P	NM_015466.2	NP_056281.1	Q9H3S7	PTN23_HUMAN	protein tyrosine phosphatase, non-receptor type 23	539					cilium morphogenesis (GO:0060271)|negative regulation of epithelial cell migration (GO:0010633)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of adherens junction organization (GO:1903393)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of homophilic cell adhesion (GO:1903387)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|central_nervous_system(1)|large_intestine(5)|lung(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GGTCCGGGCTGCCCTGCCCAC	0.667																																					p.A539P													.	.			0			c.G1615C												63.0	64.0	64.0					3																	47450550		2203	4300	6503	SO:0001583	missense	25930	exon16			CGGGCTGCCCTGC	AB025194	CCDS2754.1	3p21.3	2011-06-09			ENSG00000076201	ENSG00000076201		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	14406	protein-coding gene	gene with protein product		606584				11095967	Standard	NM_015466		Approved	DKFZP564F0923, KIAA1471, HD-PTP	uc003crf.1	Q9H3S7	OTTHUMG00000133520	ENST00000265562.4:c.1615G>C	3.37:g.47450550G>C	ENSP00000265562:p.Ala539Pro		Somatic	59	0	0		WXS	Illumina HiSeq	.	45	0.33	15	NM_015466	39	0.44	17	A8K0D7|Q7KZF8|Q8N6Z5|Q9BSR5|Q9P257|Q9UG03|Q9UMZ4	Missense_Mutation	SNP	ENST00000265562.4	37	CCDS2754.1	.	.	.	.	.	.	.	.	.	.	G	18.25	3.582906	0.65992	.	.	ENSG00000076201	ENST00000456408;ENST00000265562	T	0.32988	1.43	4.29	3.42	0.39159	.	0.209202	0.39909	N	0.001238	T	0.40791	0.1131	L	0.46157	1.445	0.50039	D	0.999843	D;D	0.63880	0.966;0.993	D;P	0.63877	0.919;0.867	T	0.20009	-1.0288	10	0.56958	D	0.05	-15.9176	6.9383	0.24478	0.0972:0.1775:0.7252:0.0	.	413;539	B4DST5;Q9H3S7	.;PTN23_HUMAN	P	504;539	ENSP00000265562:A539P	ENSP00000265562:A539P	A	+	1	0	PTPN23	47425554	1.000000	0.71417	0.996000	0.52242	0.949000	0.60115	5.077000	0.64419	1.022000	0.39626	0.557000	0.71058	GCC			0.667	PTPN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257492.2		NM_015466	
P4HTM	54681	mdanderson.org	37	3	49042540	49042540	+	Intron	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr3:49042540G>T	ENST00000383729.4	+	6	1444				WDR6_ENST00000448293.1_5'Flank|WDR6_ENST00000415265.2_5'Flank|P4HTM_ENST00000343546.4_Missense_Mutation_p.Q378H|WDR6_ENST00000608424.1_5'Flank|WDR6_ENST00000395474.3_5'Flank	NM_177939.2	NP_808808.1	Q9NXG6	P4HTM_HUMAN	prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)			NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	21					Vitamin C(DB00126)	CCATGACACAGGCACAGCCCT	0.587																																					p.Q378H													.	.			0			c.G1134T												76.0	65.0	69.0					3																	49042540		2203	4300	6503	SO:0001627	intron_variant	54681	exon6			GACACAGGCACAG		CCDS2781.2, CCDS43089.1	3p21.31	2009-01-14			ENSG00000178467	ENSG00000178467			28858	protein-coding gene	gene with protein product	"""Prolyl hydroxlase domain-containing 4"", ""hypoxia inducible factor prolyl 4 hydroxylase"""	614584				12163023, 17726031	Standard	XR_245139		Approved	P4H-TM, PHD4, PH4, HIFPH4, FLJ20262, EGLN4, PH-4	uc003cvh.3	Q9NXG6	OTTHUMG00000074057	ENST00000383729.4:c.1073+61G>T	3.37:g.49042540G>T			Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_177938	4	0.00	0	Q6PAG6|Q8TCJ9|Q8WV55|Q96F22|Q9BW77	Missense_Mutation	SNP	ENST00000383729.4	37	CCDS43089.1	.	.	.	.	.	.	.	.	.	.	G	8.553	0.875871	0.17395	.	.	ENSG00000178467	ENST00000343546	.	.	.	3.28	-2.47	0.06442	.	1.514400	0.04971	N	0.463862	T	0.28599	0.0708	.	.	.	0.09310	N	1	B	0.25955	0.138	B	0.34931	0.192	T	0.26815	-1.0092	7	.	.	.	.	3.861	0.08996	0.5709:0.0:0.2415:0.1875	.	378	Q9NXG6-3	.	H	378	.	.	Q	+	3	2	P4HTM	49017544	0.001000	0.12720	0.000000	0.03702	0.012000	0.07955	0.669000	0.25142	-0.594000	0.05836	-0.768000	0.03414	CAG			0.587	P4HTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000157211.1		NM_177938	
APEH	327	hgsc.bcm.edu;broad.mit.edu	37	3	49723603	49723603	+	IGR	SNP	G	G	A	rs199969873	byFrequency	TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr3:49723603G>A	ENST00000296456.5	+	0	3220				MST1_ENST00000449682.2_Missense_Mutation_p.R347W|MST1_ENST00000383728.3_3'UTR|AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000494828.2_5'Flank	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase						beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)	p.R333W(5)		endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TCGGGGTTCCGGCAGAAGTTC	0.662													G|||	4	0.000798722	0.0008	0.0	5008	,	,		14102	0.001		0.001	False		,,,				2504	0.001				p.R347W													MST1,NS,carcinoma,0,5	MST1	0	5	5	Substitution - Missense(5)	endometrium(4)|skin(1)	c.C1039T																																									SO:0001628	intergenic_variant	4485	exon9			GGTTCCGGCAGAA	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882		3.37:g.49723603G>A			Somatic	51	0.0392156863	2		WXS	Illumina HiSeq	.	37	0.16	6	NM_020998	19	0.00	0	Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	ENST00000296456.5	37	CCDS2801.1	11	0.005036630036630037	4	0.008130081300813009	3	0.008287292817679558	0	0.0	4	0.005277044854881266	G	28.4	4.921307	0.92249	.	.	ENSG00000173531	ENST00000449682	D	0.93953	-3.32	5.47	2.53	0.30540	.	0.000000	0.38005	N	0.001857	D	0.96321	0.8800	H	0.97186	3.955	0.80722	D	1	D	0.56521	0.976	P	0.60609	0.877	D	0.95291	0.8395	10	0.66056	D	0.02	.	13.6859	0.62515	0.0:0.0:0.4634:0.5366	.	347	G3XAK1	.	W	347	ENSP00000414287:R347W	ENSP00000414287:R347W	R	-	1	2	MST1	49698607	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	3.194000	0.51005	0.213000	0.20722	0.655000	0.94253	CGG	0.005		0.662	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000346415.2			
CLSTN2	64084	mdanderson.org	37	3	140282817	140282817	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr3:140282817G>T	ENST00000458420.3	+	16	2687	c.2497G>T	c.(2497-2499)Gcc>Tcc	p.A833S		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	833					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						CCCAAGCATTGCCACAGTGGT	0.522										HNSCC(16;0.037)																											p.A833S	GBM(45;858 913 3709 36904 37282)												.	.			0			c.G2497T												311.0	273.0	286.0					3																	140282817		2203	4300	6503	SO:0001583	missense	64084	exon16			AGCATTGCCACAG	AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.2497G>T	3.37:g.140282817G>T	ENSP00000402460:p.Ala833Ser		Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	78	0.06	5	NM_022131	0		0	B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	ENST00000458420.3	37	CCDS3112.1	.	.	.	.	.	.	.	.	.	.	G	17.58	3.423795	0.62733	.	.	ENSG00000158258	ENST00000458420	T	0.38240	1.15	5.62	5.62	0.85841	.	0.048813	0.85682	D	0.000000	T	0.37865	0.1019	M	0.71581	2.175	0.58432	D	0.999999	P	0.48503	0.911	B	0.36766	0.232	T	0.39099	-0.9630	9	.	.	.	-8.0607	17.1533	0.86783	0.0:0.0:1.0:0.0	.	833	Q9H4D0	CSTN2_HUMAN	S	833	ENSP00000402460:A833S	.	A	+	1	0	CLSTN2	141765507	1.000000	0.71417	0.998000	0.56505	0.007000	0.05969	8.061000	0.89467	2.647000	0.89833	0.650000	0.86243	GCC			0.522	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000359393.3		NM_022131	
NSG1	27065	broad.mit.edu	37	4	4393208	4393208	+	Missense_Mutation	SNP	G	G	A	rs149457560	byFrequency	TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr4:4393208G>A	ENST00000421177.2	+	7	2127	c.136G>A	c.(136-138)Gtg>Atg	p.V46M	NSG1_ENST00000504171.1_Intron|NSG1_ENST00000513555.1_Missense_Mutation_p.V46M|NSG1_ENST00000433139.2_Missense_Mutation_p.V46M|NSG1_ENST00000506380.1_Missense_Mutation_p.V46M|NSG1_ENST00000505246.1_Missense_Mutation_p.V46M|NSG1_ENST00000397958.1_Missense_Mutation_p.V46M			P42857	NSG1_HUMAN		46					clathrin coat assembly (GO:0048268)|dopamine receptor signaling pathway (GO:0007212)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)											TAAGGTGGTCGTGAAAACTAA	0.493													G|||	2	0.000399361	0.0	0.0	5008	,	,		21632	0.0		0.002	False		,,,				2504	0.0				p.V46M													.	.			0			c.G136A							G	MET/VAL,MET/VAL	0,4406		0,0,2203	133.0	116.0	122.0		136,136	4.8	0.9	4	dbSNP_134	122	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense	D4S234E	NM_001040101.1,NM_014392.3	21,21	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging	46/186,46/186	4393208	2,13004	2203	4300	6503	SO:0001583	missense	0	exon3			GTGGTCGTGAAAA																												ENST00000421177.2:c.136G>A	4.37:g.4393208G>A	ENSP00000388823:p.Val46Met		Somatic	109	0	0		WXS	Illumina HiSeq	Phase_I	69	0.04	3	NM_014392	65	0.00	0	B4DXC5|Q49AQ1	Missense_Mutation	SNP	ENST00000421177.2	37	CCDS3376.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	26.0	4.694235	0.88735	0.0	2.33E-4	ENSG00000168824	ENST00000421177;ENST00000513555;ENST00000505246;ENST00000506380;ENST00000397958;ENST00000433139	.	.	.	4.8	4.8	0.61643	.	0.000000	0.64402	D	0.000003	T	0.78419	0.4280	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81267	-0.1010	9	0.87932	D	0	-13.4932	18.2363	0.89950	0.0:0.0:1.0:0.0	.	46	P42857	NSG1_HUMAN	M	46	.	ENSP00000381049:V46M	V	+	1	0	AC110814.1	4444109	1.000000	0.71417	0.933000	0.37362	0.938000	0.57974	8.283000	0.89909	2.372000	0.80975	0.563000	0.77884	GTG			0.493	NSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000246799.1			
KIT	3815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	55599321	55599321	+	Missense_Mutation	SNP	A	A	T	rs121913507		TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr4:55599321A>T	ENST00000288135.5	+	17	2544	c.2447A>T	c.(2446-2448)gAc>gTc	p.D816V		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	816	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		D -> F (in mastocytosis; requires 2 nucleotide substitutions; somatic mutation; constitutively activated and is much more rapidly autophosphorylated than wild type). {ECO:0000269|PubMed:9990072}.|D -> H (in a testicular tumor; seminoma; somatic mutation; constitutively activated; dbSNP:rs28933969). {ECO:0000269|PubMed:10362788}.|D -> V (in mast cell leukemia and mastocytosis; somatic mutation; constitutively activated; loss of interaction with MPDZ). {ECO:0000269|PubMed:7691885, ECO:0000269|PubMed:9990072}.|D -> Y (in acute myeloid leukemia, mastocytosis and a germ cell tumor of the testis; somatic mutation; constitutively activated). {ECO:0000269|PubMed:16175573, ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:9657776, ECO:0000269|PubMed:9990072}.		actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.D816V(758)|p.D816F(6)|p.D816I(2)|p.D816G(2)|p.D816>VVA(1)|p.D816A(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTAGCCAGAGACATCAAGAAT	0.393		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.D816V			yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,colon,carcinoma,+1,932	KIT	1	932	770	Substitution - Missense(769)|Complex - insertion inframe(1)	haematopoietic_and_lymphoid_tissue(745)|testis(16)|ovary(5)|skin(2)|soft_tissue(1)|genital_tract(1)	c.A2447T	GRCh37	CM952169	KIT	M	rs121913507							145.0	146.0	145.0					4																	55599321		2203	4300	6503	SO:0001583	missense	3815	exon17	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	CCAGAGACATCAA	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2447A>T	4.37:g.55599321A>T	ENSP00000288135:p.Asp816Val		Somatic	93	0	0		WXS	Illumina HiSeq	.	65	0.15	10	NM_000222	103	0.51	53	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	A	27.4	4.831107	0.91036	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.83591	-1.74;-1.74	5.62	5.62	0.85841	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000011	D	0.85093	0.5618	N	0.21097	0.63	0.80722	A	1	D;D	0.71674	0.998;0.991	D;D	0.68943	0.961;0.933	D	0.88419	0.3027	9	0.87932	D	0	.	15.8126	0.78576	1.0:0.0:0.0:0.0	.	812;816	P10721-2;P10721	.;KIT_HUMAN	V	816;812	ENSP00000288135:D816V;ENSP00000390987:D812V	ENSP00000288135:D816V	D	+	2	0	KIT	55294078	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.181000	0.94874	2.148000	0.66965	0.477000	0.44152	GAC			0.393	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250618.1			
CLPTM1L	81037	hgsc.bcm.edu;mdanderson.org	37	5	1341803	1341803	+	Missense_Mutation	SNP	C	C	T	rs200467747		TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr5:1341803C>T	ENST00000320895.5	-	3	693	c.436G>A	c.(436-438)Ggg>Agg	p.G146R	CLPTM1L_ENST00000320927.6_Missense_Mutation_p.G146R|CLPTM1L_ENST00000507807.1_Missense_Mutation_p.G13R	NM_030782.3	NP_110409.2	Q96KA5	CLP1L_HUMAN	CLPTM1-like	146					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		TCAGACTCCCCGGTGAGCAGG	0.582																																					p.G146R													.	.			0			c.G436A							C	ARG/GLY	0,4406		0,0,2203	114.0	104.0	107.0		436	4.2	0.0	5		107	3,8597	3.0+/-9.4	0,3,4297	yes	missense	CLPTM1L	NM_030782.3	125	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	probably-damaging	146/539	1341803	3,13003	2203	4300	6503	SO:0001583	missense	81037	exon3			ACTCCCCGGTGAG	AK027306	CCDS3862.1	5p15.33	2008-02-05			ENSG00000049656	ENSG00000049656			24308	protein-coding gene	gene with protein product	"""cisplatin resistance related protein"""	612585				11162647	Standard	NM_030782		Approved	FLJ14400, CRR9	uc003jch.3	Q96KA5	OTTHUMG00000131015	ENST00000320895.5:c.436G>A	5.37:g.1341803C>T	ENSP00000313854:p.Gly146Arg		Somatic	101	0	0		WXS	Illumina HiSeq	.	77	0.05	4	NM_030782	203	0.00	0	D3DTC1|Q658W6|Q7LG29|Q96AZ0|Q9H3N4	Missense_Mutation	SNP	ENST00000320895.5	37	CCDS3862.1	.	.	.	.	.	.	.	.	.	.	C	12.35	1.910609	0.33721	0.0	3.49E-4	ENSG00000049656	ENST00000320895;ENST00000507807;ENST00000320927	T;T;T	0.49720	0.85;0.84;0.77	5.03	4.15	0.48705	.	0.205211	0.52532	D	0.000070	T	0.42314	0.1197	L	0.52011	1.625	0.53005	D	0.999961	B;B	0.32425	0.371;0.143	B;B	0.28553	0.091;0.017	T	0.38714	-0.9648	10	0.46703	T	0.11	-22.5501	15.0542	0.71901	0.1433:0.8567:0.0:0.0	.	146;13	Q96KA5;G5E9Z2	CLP1L_HUMAN;.	R	146;13;146	ENSP00000313854:G146R;ENSP00000423321:G13R;ENSP00000315196:G146R	ENSP00000313854:G146R	G	-	1	0	CLPTM1L	1394803	0.998000	0.40836	0.003000	0.11579	0.012000	0.07955	4.372000	0.59530	1.220000	0.43490	-0.181000	0.13052	GGG			0.582	CLPTM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253649.2		NM_030782	
DNAJC18	202052	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	138755762	138755762	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr5:138755762C>T	ENST00000302060.5	-	7	1012	c.932G>A	c.(931-933)tGt>tAt	p.C311Y		NM_152686.3	NP_689899.1	Q9H819	DJC18_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 18	311						integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CTCCTTCCAACAACTAGTCTG	0.453																																					p.C311Y													.	.			0			c.G932A												146.0	136.0	139.0					5																	138755762		2203	4300	6503	SO:0001583	missense	202052	exon7			TTCCAACAACTAG	AK024054	CCDS4214.1	5q31.2	2011-09-02		2005-08-09	ENSG00000170464	ENSG00000170464		"""Heat shock proteins / DNAJ (HSP40)"""	28429	protein-coding gene	gene with protein product							Standard	NM_152686		Approved	MGC29463	uc003len.3	Q9H819	OTTHUMG00000129225	ENST00000302060.5:c.932G>A	5.37:g.138755762C>T	ENSP00000302843:p.Cys311Tyr		Somatic	151	0	0		WXS	Illumina HiSeq	.	176	0.19	34	NM_152686	40	0.30	12		Missense_Mutation	SNP	ENST00000302060.5	37	CCDS4214.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.10|16.10	3.027203|3.027203	0.54683|0.54683	.|.	.|.	ENSG00000170464|ENSG00000170464	ENST00000302060;ENST00000508445|ENST00000514052	T;T|.	0.68765|.	-0.35;-0.35|.	5.57|5.57	5.57|5.57	0.84162|0.84162	Domain of unknown function DUF1977, DnaJ-like (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.84790|0.84790	0.5550|0.5550	M|M	0.89715|0.89715	3.055|3.055	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.87578|.	0.998|.	D|D	0.87150|0.87150	0.2208|0.2208	10|5	0.87932|.	D|.	0|.	-12.702|-12.702	18.1041|18.1041	0.89515|0.89515	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	311|.	Q9H819|.	DJC18_HUMAN|.	Y|I	311;144|103	ENSP00000302843:C311Y;ENSP00000426338:C144Y|.	ENSP00000302843:C311Y|.	C|V	-|-	2|1	0|0	DNAJC18|DNAJC18	138783661|138783661	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.100000|0.100000	0.18952|0.18952	7.429000|7.429000	0.80309|0.80309	2.623000|2.623000	0.88846|0.88846	0.561000|0.561000	0.74099|0.74099	TGT|GTT			0.453	DNAJC18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000374191.1		NM_152686	
PCDHB7	56129	hgsc.bcm.edu;broad.mit.edu	37	5	140553994	140553994	+	Silent	SNP	G	G	T	rs374392843		TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr5:140553994G>T	ENST00000231137.3	+	1	1752	c.1578G>T	c.(1576-1578)gcG>gcT	p.A526A		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	526	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A526A(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCCTGCAGGCGTTCGAGTTCC	0.706													g|||	1	0.000199681	0.0	0.0	5008	,	,		16269	0.0		0.001	False		,,,				2504	0.0				p.A526A													PCDHB7,NS,carcinoma,0,4	PCDHB7	0	4	1	Substitution - coding silent(1)	lung(1)	c.G1578T												62.0	68.0	66.0					5																	140553994		2203	4300	6503	SO:0001819	synonymous_variant	56129	exon1			GCAGGCGTTCGAG	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1578G>T	5.37:g.140553994G>T			Somatic	52	0.0192307692	1		WXS	Illumina HiSeq	.	71	0.04	3	NM_018940	0		0	A1L3Y8	Silent	SNP	ENST00000231137.3	37	CCDS4249.1																																																																																					0.706	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251803.2		NM_018940	
PCDHGA12	26025	broad.mit.edu	37	5	140811892	140811892	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr5:140811892C>A	ENST00000252085.3	+	1	1708	c.1566C>A	c.(1564-1566)taC>taA	p.Y522*	PCDHGA9_ENST00000573521.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12	522	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTTCGACTACGAGCAGTTCC	0.582																																					p.Y522X													.	PCDHGA12	271		0			c.C1566A												131.0	143.0	139.0					5																	140811892		2203	4300	6503	SO:0001587	stop_gained	0	exon1			CGACTACGAGCAG	AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.1566C>A	5.37:g.140811892C>A	ENSP00000252085:p.Tyr522*		Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	89	0.03	3	NM_032094	1	0.00	0	O15100|Q6UW70|Q9Y5D7	Nonsense_Mutation	SNP	ENST00000252085.3	37	CCDS4260.1	.	.	.	.	.	.	.	.	.	.	c	16.68	3.189423	0.57909	.	.	ENSG00000253159	ENST00000252085	.	.	.	5.23	-6.7	0.01766	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.6254	0.68616	0.0:0.4189:0.0:0.5811	.	.	.	.	X	522	.	ENSP00000252085:Y522X	Y	+	3	2	PCDHGA12	140792076	0.006000	0.16342	0.712000	0.30502	0.087000	0.18053	-1.309000	0.02728	-1.552000	0.01704	-0.215000	0.12644	TAC			0.582	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251806.2		NM_003735	
NHP2	55651	broad.mit.edu	37	5	177576723	177576723	+	Silent	SNP	T	T	G			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr5:177576723T>G	ENST00000274606.3	-	4	602	c.453A>C	c.(451-453)ctA>ctC	p.L151L	RMND5B_ENST00000515098.1_3'UTR|NHP2_ENST00000314397.4_3'UTR	NM_017838.3	NP_060308.1	Q9NX24	NHP2_HUMAN	NHP2 ribonucleoprotein	151					rRNA pseudouridine synthesis (GO:0031118)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			endometrium(1)|kidney(1)|ovary(2)	4						CTCATAGGGGTAGGGGCAGGG	0.637																																					p.L151L													.	NHP2	12		0			c.A453C												36.0	38.0	37.0					5																	177576723		2203	4300	6503	SO:0001819	synonymous_variant	55651	exon4			TAGGGGTAGGGGC	AF161404	CCDS4432.1, CCDS34308.1	5q35.3	2014-09-17	2012-12-10	2008-10-13	ENSG00000145912	ENSG00000145912			14377	protein-coding gene	gene with protein product		606470	"""nucleolar protein family A, member 2 (H/ACA small nucleolar RNPs)"", ""NHP2 ribonucleoprotein homolog (yeast)"""	NOLA2		11074001	Standard	NM_017838		Approved	FLJ20479	uc003mir.2	Q9NX24	OTTHUMG00000130886	ENST00000274606.3:c.453A>C	5.37:g.177576723T>G			Somatic	267	0.0861423221	23		WXS	Illumina HiSeq	Phase_I	273	0.08	23	NM_017838	488	0.02	10	A6NKY8|Q9P095	Silent	SNP	ENST00000274606.3	37	CCDS4432.1																																																																																					0.637	NHP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253471.1		NM_017838	
BTN2A3P	54718	hgsc.bcm.edu	37	6	26422353	26422353	+	RNA	SNP	C	C	T	rs571530750	byFrequency	TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr6:26422353C>T	ENST00000466808.2	+	0	7							Q96KV6	BT2A3_HUMAN	butyrophilin, subfamily 2, member A3, pseudogene							integral component of membrane (GO:0016021)		p.P3S(2)									GCTCATGGAACCAGCTGCTGC	0.622													C|||	7	0.00139776	0.0023	0.0	5008	,	,		16376	0.001		0.0	False		,,,				2504	0.0031				.													BTN2A3,NS,carcinoma,0,9	BTN2A3	0	9	2	Substitution - Missense(2)	endometrium(1)|kidney(1)	.																																											54718	.			ATGGAACCAGCTG	AL021917		6p22.1	2014-01-14	2011-09-06	2011-09-06	ENSG00000124549	ENSG00000124549		"""Butyrophilins"""	13229	pseudogene	pseudogene		613592	"""butyrophilin, subfamily 2, member A3"""	BTN2A3			Standard	NR_027795		Approved	BTN2.3	uc011dkl.1	Q96KV6	OTTHUMG00000014453		6.37:g.26422353C>T			Somatic	93	0.0107526882	1		WXS	Illumina HiSeq	.	103	0.06	6	.	2	0.00	0	A6NEF4	RNA	SNP	ENST00000466808.2	37																																																																																						0.622	BTN2A3P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000040118.4		NR_027795	
ICK	22858	broad.mit.edu	37	6	52876923	52876923	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr6:52876923C>T	ENST00000350082.5	-	10	1601	c.1255G>A	c.(1255-1257)Gct>Act	p.A419T	ICK_ENST00000356971.3_Missense_Mutation_p.A419T	NM_014920.3	NP_055735.1	Q9UPZ9	ICK_HUMAN	intestinal cell (MAK-like) kinase	419					intracellular signal transduction (GO:0035556)|multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(3)|stomach(1)	31	Lung NSC(77;0.103)					TCCAAGTCAGCCCAATCATCT	0.463																																					p.A419T													.	ICK	62		0			c.G1255A												170.0	139.0	150.0					6																	52876923		2203	4300	6503	SO:0001583	missense	22858	exon11			AGTCAGCCCAATC	AB023153	CCDS4949.1	6p12.3-p11.2	2008-02-05			ENSG00000112144	ENSG00000112144			21219	protein-coding gene	gene with protein product		612325				12103360	Standard	NM_014920		Approved	MRK, LCK2, KIAA0936, MGC46090	uc003pbi.2	Q9UPZ9	OTTHUMG00000014870	ENST00000350082.5:c.1255G>A	6.37:g.52876923C>T	ENSP00000263043:p.Ala419Thr		Somatic	94	0.0106382979	1		WXS	Illumina HiSeq	Phase_I	86	0.03	3	NM_016513	11	0.00	0	A7MD41|O75985|Q5THL2|Q8IYH8|Q9BX17|Q9NYX3	Missense_Mutation	SNP	ENST00000350082.5	37	CCDS4949.1	.	.	.	.	.	.	.	.	.	.	C	17.62	3.434060	0.62955	.	.	ENSG00000112144	ENST00000350082;ENST00000356971	T;T	0.72051	-0.62;-0.62	5.66	3.89	0.44902	.	0.106801	0.64402	N	0.000008	T	0.46288	0.1385	L	0.40543	1.245	0.40746	D	0.982871	B	0.02656	0.0	B	0.04013	0.001	T	0.48328	-0.9045	10	0.59425	D	0.04	-17.744	12.1128	0.53848	0.0:0.8616:0.0:0.1384	.	419	Q9UPZ9	ICK_HUMAN	T	419	ENSP00000263043:A419T;ENSP00000349458:A419T	ENSP00000263043:A419T	A	-	1	0	ICK	52984882	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	4.249000	0.58766	0.751000	0.32900	0.561000	0.74099	GCT			0.463	ICK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040952.1		NM_016513	
RIMS1	22999	mdanderson.org	37	6	72975733	72975733	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr6:72975733C>T	ENST00000521978.1	+	22	3379	c.3379C>T	c.(3379-3381)Cat>Tat	p.H1127Y	RIMS1_ENST00000264839.7_Missense_Mutation_p.H1089Y|RIMS1_ENST00000491071.2_Missense_Mutation_p.H1063Y|RIMS1_ENST00000518273.1_Missense_Mutation_p.H1063Y|RIMS1_ENST00000520567.1_Missense_Mutation_p.H1062Y|RIMS1_ENST00000523963.1_Missense_Mutation_p.H537Y|RIMS1_ENST00000522291.1_Intron|RIMS1_ENST00000425662.2_Missense_Mutation_p.H456Y|RIMS1_ENST00000401910.3_Missense_Mutation_p.H536Y|RIMS1_ENST00000538414.1_Intron|RIMS1_ENST00000517827.1_Missense_Mutation_p.H522Y|RIMS1_ENST00000348717.5_Intron|RIMS1_ENST00000517960.1_Intron	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1127					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				TACTAGTTTGCATTCACCAGA	0.398																																					p.H1127Y													.	.			0			c.C3379T												51.0	46.0	48.0					6																	72975733		1854	4093	5947	SO:0001583	missense	22999	exon22			AGTTTGCATTCAC	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.3379C>T	6.37:g.72975733C>T	ENSP00000428417:p.His1127Tyr		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_014989	0		0	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	ENST00000521978.1	37	CCDS47449.1	.	.	.	.	.	.	.	.	.	.	C	4.558	0.103633	0.08731	.	.	ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000349908;ENST00000264839;ENST00000518273;ENST00000520567;ENST00000521978;ENST00000401910;ENST00000523963;ENST00000425662;ENST00000517827;ENST00000370420	T;T;T;T;T;T;T;T;T;T	0.18338	2.49;2.49;2.6;2.58;2.48;2.65;2.56;2.57;2.57;2.22	5.8	5.8	0.92144	.	0.000000	0.64402	D	0.000017	T	0.16342	0.0393	L	0.32530	0.975	0.80722	D	1	B;P;B;P;B;B;D;P;D	0.57257	0.006;0.666;0.026;0.828;0.015;0.118;0.979;0.936;0.958	B;B;B;B;B;B;P;P;D	0.66351	0.004;0.196;0.027;0.216;0.002;0.082;0.627;0.885;0.943	T	0.00870	-1.1533	10	0.02654	T	1	-21.9917	20.0558	0.97650	0.0:1.0:0.0:0.0	.	522;537;522;536;315;1063;316;1063;1127	B7Z3S3;E9PHF5;B7Z9Z3;E9PF48;Q5JY22;E7ERQ1;Q5JY21;C9JNW6;Q86UR5	.;.;.;.;.;.;.;.;RIMS1_HUMAN	Y	1063;1089;1063;1063;1089;1063;1062;1127;536;537;456;522;288	ENSP00000430101:H1063Y;ENSP00000264839:H1089Y;ENSP00000430408:H1063Y;ENSP00000430502:H1062Y;ENSP00000428417:H1127Y;ENSP00000385649:H536Y;ENSP00000428328:H537Y;ENSP00000411235:H456Y;ENSP00000428367:H522Y;ENSP00000359448:H288Y	ENSP00000264839:H1089Y	H	+	1	0	RIMS1	73032454	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.272000	0.58908	2.742000	0.94016	0.637000	0.83480	CAT			0.398	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000374968.1			
HSF2	3298	mdanderson.org	37	6	122720904	122720904	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr6:122720904C>T	ENST00000368455.4	+	1	214	c.22C>T	c.(22-24)Ccg>Tcg	p.P8S	HSF2_ENST00000452194.1_Missense_Mutation_p.P8S	NM_004506.3	NP_004497.1	Q03933	HSF2_HUMAN	heat shock transcription factor 2	8					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to stress (GO:0006950)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			large_intestine(4)|lung(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(136;0.00371)|all cancers(137;0.0299)|GBM - Glioblastoma multiforme(226;0.0586)		TTCGAACGTGCCGGCTTTCCT	0.607																																					p.P8S													.	.			0			c.C22T												66.0	64.0	65.0					6																	122720904		2203	4300	6503	SO:0001583	missense	3298	exon1			AACGTGCCGGCTT	M65217	CCDS5124.1, CCDS47470.1	6q22	2008-08-29			ENSG00000025156	ENSG00000025156			5225	protein-coding gene	gene with protein product		140581				1871106	Standard	NM_004506		Approved		uc003pyu.2	Q03933	OTTHUMG00000016216	ENST00000368455.4:c.22C>T	6.37:g.122720904C>T	ENSP00000357440:p.Pro8Ser		Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_001135564	35	0.00	0	B4DGJ4|Q0VAH9|Q2M1K4|Q9H445	Missense_Mutation	SNP	ENST00000368455.4	37	CCDS5124.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.705343	0.89018	.	.	ENSG00000025156	ENST00000368455;ENST00000452194	D;D	0.90197	-2.63;-2.63	4.18	4.18	0.49190	Winged helix-turn-helix transcription repressor DNA-binding (1);Heat shock factor (HSF)-type, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.93752	0.8003	M	0.76002	2.32	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.77004	0.989;0.975;0.942	D	0.94307	0.7542	10	0.72032	D	0.01	-5.4693	14.3443	0.66649	0.0:1.0:0.0:0.0	.	8;8;8	Q03933-2;Q03933;Q9BS48	.;HSF2_HUMAN;.	S	8	ENSP00000357440:P8S;ENSP00000400380:P8S	ENSP00000357440:P8S	P	+	1	0	HSF2	122762603	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	5.281000	0.65609	2.288000	0.76882	0.561000	0.74099	CCG			0.607	HSF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000043520.1		NM_004506	
FSCN1	6624	broad.mit.edu	37	7	5645080	5645080	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr7:5645080A>C	ENST00000382361.3	+	5	1571	c.1457A>C	c.(1456-1458)gAc>gCc	p.D486A	FSCN1_ENST00000340250.6_Missense_Mutation_p.D465A	NM_003088.3	NP_003079.1	Q16658	FSCN1_HUMAN	fascin actin-bundling protein 1	486					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|cell motility (GO:0048870)|cell proliferation (GO:0008283)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|invadopodium (GO:0071437)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|drug binding (GO:0008144)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;1.21e-13)		GAAACCGTGGACCCCGCCTCG	0.672																																					p.D486A													FSCN1,NS,carcinoma,+1,1	FSCN1	29	1	0			c.A1457C												30.0	28.0	29.0					7																	5645080		2193	4297	6490	SO:0001583	missense	6624	exon5			CCGTGGACCCCGC	U03057	CCDS5342.1	7p22	2014-02-03	2014-02-03	2002-09-20	ENSG00000075618	ENSG00000075618		"""Fascins"""	11148	protein-coding gene	gene with protein product	"""Singed, drosophila, homolog-like"", ""actin bundling protein"""	602689	"""singed (Drosophila)-like (sea urchin fascin homolog like)"", ""fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)"""	SNL		8068206, 10783262	Standard	NM_003088		Approved	p55, FLJ38511	uc003sou.3	Q16658	OTTHUMG00000090599	ENST00000382361.3:c.1457A>C	7.37:g.5645080A>C	ENSP00000371798:p.Asp486Ala		Somatic	81	0.2098765432	17		WXS	Illumina HiSeq	Phase_I	100	0.25	25	NM_003088	252	0.00	0	A6NI89|B2RE97|Q96IC5|Q96IH1|Q9BRF1	Missense_Mutation	SNP	ENST00000382361.3	37	CCDS5342.1	.	.	.	.	.	.	.	.	.	.	A	7.606	0.673772	0.14841	.	.	ENSG00000075618	ENST00000340250;ENST00000382361;ENST00000535097	T;T	0.44083	0.93;0.93	3.83	3.83	0.44106	Fascin domain (1);Actin cross-linking (1);	0.190166	0.44285	D	0.000475	T	0.29783	0.0744	N	0.21282	0.65	0.80722	D	1	B	0.02656	0.0	B	0.08055	0.003	T	0.14448	-1.0472	10	0.87932	D	0	-2.5801	12.0646	0.53580	1.0:0.0:0.0:0.0	.	486	Q16658	FSCN1_HUMAN	A	465;486;208	ENSP00000339729:D465A;ENSP00000371798:D486A	ENSP00000339729:D465A	D	+	2	0	FSCN1	5611606	1.000000	0.71417	0.914000	0.36105	0.400000	0.30750	5.696000	0.68287	1.495000	0.48549	0.454000	0.30748	GAC			0.672	FSCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207153.3		NM_003088	
ISPD	729920	hgsc.bcm.edu	37	7	16415788	16415788	+	Missense_Mutation	SNP	G	G	T	rs376411072		TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr7:16415788G>T	ENST00000407010.2	-	3	612	c.613C>A	c.(613-615)Cgt>Agt	p.R205S	ISPD_ENST00000399310.3_Intron	NM_001101426.3	NP_001094896.1	A4D126	ISPD_HUMAN	isoprenoid synthase domain containing	205		Positions substrate for the nucleophilic attack. {ECO:0000250}.			axon guidance (GO:0007411)|isoprenoid biosynthetic process (GO:0008299)|protein O-linked mannosylation (GO:0035269)		nucleotidyltransferase activity (GO:0016779)	p.R205C(2)		endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)	9						TGTCTGGCACGTTCTAGCGAG	0.443										Multiple Myeloma(15;0.18)																											p.R205S													ISPD_ENST00000407010,NS,carcinoma,0,2	ISPD_ENST00000407010	0	2	2	Substitution - Missense(2)	large_intestine(2)	c.C613A												71.0	69.0	70.0					7																	16415788		1940	4137	6077	SO:0001583	missense	729920	exon3			TGGCACGTTCTAG	AK124805		7p21.2	2010-03-19			ENSG00000214960	ENSG00000214960			37276	protein-coding gene	gene with protein product	"""notch1-induced protein"", ""4-diphosphocytidyl-2C-methyl-D-erythritol synthase homolog (Arabidopsis)"""	614631				11181995	Standard	NM_001101417		Approved	hCG_1745121, IspD, Nip	uc010ktx.2	A4D126	OTTHUMG00000152447	ENST00000407010.2:c.613C>A	7.37:g.16415788G>T	ENSP00000385478:p.Arg205Ser		Somatic	83	0	0		WXS	Illumina HiSeq	.	113	0.04	5	NM_001101426	13	0.00	0	A8MU35|H9KVB2	Missense_Mutation	SNP	ENST00000407010.2	37		.	.	.	.	.	.	.	.	.	.	G	22.3	4.276050	0.80580	.	.	ENSG00000214960	ENST00000407010	D	0.93076	-3.16	5.38	4.44	0.53790	4-diphosphocytidyl-2C-methyl-D-erythritol synthase (1);	0.000000	0.64402	U	0.000001	D	0.96200	0.8761	M	0.73753	2.245	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96356	0.9262	10	0.87932	D	0	-18.2665	15.2	0.73130	0.0:0.0:0.8586:0.1414	.	205	A4D126	ISPD_HUMAN	S	205	ENSP00000385478:R205S	ENSP00000385478:R205S	R	-	1	0	ISPD	16382313	1.000000	0.71417	0.993000	0.49108	0.995000	0.86356	3.504000	0.53347	2.669000	0.90835	0.650000	0.86243	CGT			0.443	ISPD-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000326252.4		NM_001101426	
FZD9	8326	broad.mit.edu	37	7	72849813	72849813	+	Silent	SNP	A	A	G	rs200330017		TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr7:72849813A>G	ENST00000344575.3	+	1	1705	c.1476A>G	c.(1474-1476)ggA>ggG	p.G492G		NM_003508.2	NP_003499.1	O00144	FZD9_HUMAN	frizzled class receptor 9	492					B cell differentiation (GO:0030183)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|gonad development (GO:0008406)|learning or memory (GO:0007611)|nervous system development (GO:0007399)|neuroblast proliferation (GO:0007405)|vasculature development (GO:0001944)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)|skin(1)	14		Lung NSC(55;0.0659)|all_lung(88;0.152)				CGGGGCCCGGAGGCCGGAGGG	0.652																																					p.G492G	Pancreas(144;909 1878 36867 38226 39554)												FZD9,NS,carcinoma,+2,1	FZD9	51	1	0			c.A1476G												28.0	32.0	31.0					7																	72849813		2199	4298	6497	SO:0001819	synonymous_variant	8326	exon1			GCCCGGAGGCCGG	U82169	CCDS5548.1	7q11.23	2014-01-29	2014-01-29		ENSG00000188763	ENSG00000188763		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4047	protein-coding gene	gene with protein product		601766	"""frizzled (Drosophila) homolog 9"", ""frizzled homolog 9 (Drosophila)"", ""frizzled 9, seven transmembrane spanning receptor"", ""frizzled family receptor 9"""			9147651, 10198163	Standard	NM_003508		Approved	FZD3, CD349	uc003tyb.3	O00144	OTTHUMG00000023051	ENST00000344575.3:c.1476A>G	7.37:g.72849813A>G			Somatic	74	0.0675675676	5		WXS	Illumina HiSeq	Phase_I	108	0.14	15	NM_003508	3	0.00	0		Silent	SNP	ENST00000344575.3	37	CCDS5548.1																																																																																					0.652	FZD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252120.1			
KRBA1	84626	broad.mit.edu	37	7	149430561	149430561	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr7:149430561A>G	ENST00000485033.2	+	15	2335	c.2335A>G	c.(2335-2337)Agg>Ggg	p.R779G	KRBA1_ENST00000319551.8_Missense_Mutation_p.R779G|KRBA1_ENST00000255992.10_Missense_Mutation_p.R839G|KRBA1_ENST00000479560.1_3'UTR			A5PL33	KRBA1_HUMAN	KRAB-A domain containing 1	840	Pro-rich.									breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(17)|ovary(1)|prostate(1)	27	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TCGGCTGGGGAGGCGCCCCCA	0.682																																					.													.	KRBA1	68		0			.												6.0	8.0	7.0					7																	149430561		1959	4113	6072	SO:0001583	missense	84626	.			CTGGGGAGGCGCC	AB058765	CCDS75674.1	7q36	2014-02-12	2006-08-15		ENSG00000133619	ENSG00000133619		"""-"""	22228	protein-coding gene	gene with protein product			"""KRAB A domain containing 1"""				Standard	NM_001290187		Approved	KIAA1862	uc003wfz.3	A5PL33	OTTHUMG00000157886	ENST00000485033.2:c.2335A>G	7.37:g.149430561A>G	ENSP00000420112:p.Arg779Gly		Somatic	47	0.0425531915	2		WXS	Illumina HiSeq	Phase_I	61	0.16	10	.	37	0.03	1	A7E2F5|E7ENE9|Q8N4X0|Q96JG5	Missense_Mutation	SNP	ENST00000485033.2	37		.	.	.	.	.	.	.	.	.	.	A	12.36	1.914005	0.33815	.	.	ENSG00000133619	ENST00000255992;ENST00000319551;ENST00000485033	T;T;T	0.43688	0.96;0.94;0.94	5.13	1.68	0.24146	.	0.152767	0.30901	N	0.008643	T	0.57755	0.2075	.	.	.	0.09310	N	0.999999	D;D	0.63046	0.992;0.992	P;P	0.62740	0.906;0.906	T	0.54417	-0.8297	9	0.59425	D	0.04	-19.7927	12.4425	0.55634	0.2897:0.7103:0.0:0.0	.	779;840	E7ENE9;A5PL33	.;KRBA1_HUMAN	G	839;779;779	ENSP00000255992:R839G;ENSP00000317165:R779G;ENSP00000420112:R779G	ENSP00000255992:R839G	R	+	1	2	KRBA1	149061494	0.993000	0.37304	0.106000	0.21319	0.300000	0.27592	0.270000	0.18607	-0.010000	0.14271	0.383000	0.25322	AGG			0.682	KRBA1-004	PUTATIVE	basic	protein_coding	protein_coding		OTTHUMT00000349841.3		NM_032534	
USP17L2	377630	broad.mit.edu	37	8	11994626	11994627	+	IGR	DEL	GT	GT	-	rs576201574		TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	GT	GT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr8:11994626_11994627delGT	ENST00000333796.3	-	0	1910				FAM66D_ENST00000434078.2_RNA	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	Q6R6M4	U17L2_HUMAN	ubiquitin specific peptidase 17-like family member 2						apoptotic process (GO:0006915)|CAAX-box protein processing (GO:0071586)|cell cycle checkpoint (GO:0000075)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of protein processing (GO:0010955)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of Ras GTPase activity (GO:0034261)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of RIG-I signaling pathway (GO:1900246)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of apoptotic process (GO:0042981)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of defense response to virus by host (GO:0050691)|regulation of ruffle assembly (GO:1900027)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(1)|kidney(1)|large_intestine(11)|liver(1)|lung(8)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	29						gtatttgtgcgtgtgtgtgtgt	0.51																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			TTGTGCGTGTGTG	BC156290	CCDS43713.1	8p23.1	2012-10-09	2012-10-09		ENSG00000223443	ENSG00000223443			34434	protein-coding gene	gene with protein product	"""deubiquitinating enzyme 3"""	610186	"""ubiquitin specific peptidase 17-like 2"""				Standard	NM_201402		Approved	DUB3	uc003wvc.1	Q6R6M4	OTTHUMG00000165295		8.37:g.11994636_11994637delGT			Somatic	121	0	0		WXS	Illumina HiSeq	Phase_I	192	0.04	7	.	1	0.00	0		RNA	DEL	ENST00000333796.3	37	CCDS43713.1																																																																																					0.510	USP17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000383303.2		NM_201402	
WRN	7486	broad.mit.edu	37	8	30945390	30945390	+	Missense_Mutation	SNP	A	A	T	rs149565907	byFrequency	TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr8:30945390A>T	ENST00000298139.5	+	12	1779	c.1530A>T	c.(1528-1530)gaA>gaT	p.E510D		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	510	Poly-Glu.				aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)			central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		aagaagaagaagatgatgaaa	0.373			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome				A|||	19	0.00379393	0.0	0.0	5008	,	,		18765	0.0169		0.0	False		,,,				2504	0.002				p.E510D	Ovarian(18;161 598 2706 14834 27543)		yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	WRN,NS,carcinoma,0,1	WRN	116	1	0			c.A1530T							A	ASP/GLU	0,4406		0,0,2203	76.0	72.0	73.0		1530		0.9	8	dbSNP_134	73	1,8599	1.2+/-3.3	0,1,4299	yes	missense	WRN	NM_000553.4	45	0,1,6502	TT,TA,AA		0.0116,0.0,0.0077	benign	510/1433	30945390	1,13005	2203	4300	6503	SO:0001583	missense	7486	exon12	Familial Cancer Database	WS, Adult Progeria	AGAAGAAGATGAT		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.1530A>T	8.37:g.30945390A>T	ENSP00000298139:p.Glu510Asp		Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	70	0.04	3	NM_000553	12	0.00	0	A1KYY9	Missense_Mutation	SNP	ENST00000298139.5	37	CCDS6082.1	5	0.0022893772893772895	0	0.0	0	0.0	5	0.008741258741258742	0	0.0	A	0.001	-3.733300	0.00005	0.0	1.16E-4	ENSG00000165392	ENST00000298139	T	0.43688	0.94	.	.	.	.	0.540108	0.15136	N	0.278577	T	0.05044	0.0135	N	0.00621	-1.32	0.09310	N	0.999991	B	0.02656	0.0	B	0.01281	0.0	T	0.13282	-1.0515	8	0.02654	T	1	-5.6664	.	.	.	.	510	Q14191	WRN_HUMAN	D	510	ENSP00000298139:E510D	ENSP00000298139:E510D	E	+	3	2	WRN	31064932	0.898000	0.30612	0.889000	0.34880	0.359000	0.29487	-0.189000	0.09629	-1.869000	0.01141	-1.957000	0.00481	GAA			0.373	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000376248.1			
ATAD2	29028	bcgsc.ca	37	8	124382188	124382188	+	Silent	SNP	A	A	G	rs539981908|rs112492316	byFrequency	TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr8:124382188A>G	ENST00000287394.5	-	7	911	c.804T>C	c.(802-804)gaT>gaC	p.D268D	ATAD2_ENST00000521903.1_5'UTR|ATAD2_ENST00000534257.1_5'Flank	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	268	Asp-rich.				ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			catcatcgtcatcatcatcat	0.368													-|||	107	0.0213658	0.0719	0.0144	5008	,	,		18275	0.0		0.002	False		,,,				2504	0.0				p.D268D													.	ATAD2	160		0			c.T804C												236.0	181.0	199.0					8																	124382188		2203	4300	6503	SO:0001819	synonymous_variant	29028	exon7			ATCGTCATCATCA	BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.804T>C	8.37:g.124382188A>G			Somatic	99	0.0101010101	1		WXS	Illumina HiSeq	Phase_1	161	0.04	7	NM_014109	36	0.00	0	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Silent	SNP	ENST00000287394.5	37	CCDS6343.1																																																																																					0.368	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381766.2		NM_014109	
TMEM65	157378	bcgsc.ca	37	8	125384234	125384234	+	Silent	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr8:125384234G>T	ENST00000297632.6	-	1	699	c.165C>A	c.(163-165)ggC>ggA	p.G55G		NM_194291.2	NP_919267.2	Q6PI78	TMM65_HUMAN	transmembrane protein 65	55						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				cervix(1)|endometrium(1)|large_intestine(2)|lung(1)|prostate(1)	6	Lung NSC(37;1.18e-11)|Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			TGGGGTGCGTGCCCAGCCGCC	0.771																																					p.G55G													.	TMEM65	14		0			c.C165A												3.0	3.0	3.0					8																	125384234		2001	3921	5922	SO:0001819	synonymous_variant	157378	exon1			GTGCGTGCCCAGC	BC032396	CCDS6348.1	8q24.13	2006-11-24			ENSG00000164983	ENSG00000164983			25203	protein-coding gene	gene with protein product						12477932	Standard	NM_194291		Approved		uc010mdl.3	Q6PI78	OTTHUMG00000165021	ENST00000297632.6:c.165C>A	8.37:g.125384234G>T			Somatic	26	0	0		WXS	Illumina HiSeq	Phase_1	27	0.15	4	NM_194291	4	0.00	0	Q8N5G8|Q8WVK5	Silent	SNP	ENST00000297632.6	37	CCDS6348.1																																																																																					0.771	TMEM65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381464.1		NM_194291	
RANBP6	26953	mdanderson.org	37	9	6014327	6014327	+	Silent	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr9:6014327G>T	ENST00000259569.5	-	1	1291	c.1281C>A	c.(1279-1281)gcC>gcA	p.A427A	RANBP6_ENST00000485372.1_5'UTR	NM_001243202.1|NM_001243203.1|NM_012416.3	NP_001230131.1|NP_001230132.1|NP_036548.1	O60518	RNBP6_HUMAN	RAN binding protein 6	427					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(5)|large_intestine(8)|lung(9)|ovary(7)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		GTGTAGTACAGGCTGCAGCCC	0.413																																					p.L56M													.	.			0			c.C166A												68.0	69.0	69.0					9																	6014327		2203	4300	6503	SO:0001819	synonymous_variant	26953	exon2			AGTACAGGCTGCA	AF039023	CCDS6467.1	9p24.1	2008-03-26			ENSG00000137040	ENSG00000137040			9851	protein-coding gene	gene with protein product							Standard	NM_001243202		Approved		uc003zjr.3	O60518	OTTHUMG00000019512	ENST00000259569.5:c.1281C>A	9.37:g.6014327G>T			Somatic	106	0	0		WXS	Illumina HiSeq	Phase_I	58	0.05	3	NM_001243203	12	0.00	0	Q5T7X4|Q7Z3V2|Q96E78	Missense_Mutation	SNP	ENST00000259569.5	37	CCDS6467.1																																																																																					0.413	RANBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051650.1		NM_012416	
LINC01410	103352539	broad.mit.edu	37	9	66466138	66466139	+	lincRNA	DEL	AG	AG	-			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr9:66466138_66466139delAG	ENST00000424345.1	+	0	771_772																											GCAATAAGAAAGAGAGTTGAAG	0.381																																					.													.	.			0			.																																											0	.			TAAGAAAGAGAGT																													9.37:g.66466142_66466143delAG			Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	8	0.25	2	.	7	0.00	0		RNA	DEL	ENST00000424345.1	37																																																																																						0.381	RP11-262H14.1-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000128851.1			
LOC100132077	100132077	broad.mit.edu	37	9	97108415	97108416	+	lincRNA	INS	-	-	A			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr9:97108415_97108416insA	ENST00000454869.1	+	0	698					NR_033937.1																						aaaacaaaaacaaaaaaaaaac	0.441																																					.													.	.			0			.																																											0	.			CAAAAACAAAAAA																													9.37:g.97108425_97108425dupA			Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	8	0.38	3	.	2	0.00	0		RNA	INS	ENST00000454869.1	37																																																																																						0.441	RP11-307E17.8-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000053177.1			
FBP2	8789	mdanderson.org	37	9	97349666	97349666	+	Missense_Mutation	SNP	C	C	T	rs573212	byFrequency	TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr9:97349666C>T	ENST00000375337.3	-	2	322	c.256G>A	c.(256-258)Gtc>Atc	p.V86I		NM_003837.2	NP_003828.2	O00757	F16P2_HUMAN	fructose-1,6-bisphosphatase 2	86			V -> L (in dbSNP:rs573212). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:9678974}.		carbohydrate metabolic process (GO:0005975)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|small molecule metabolic process (GO:0044281)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	fructose 1,6-bisphosphate 1-phosphatase activity (GO:0042132)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(3)|lung(5)	9		Acute lymphoblastic leukemia(62;0.136)				GAGGATTGGACCATGTTGATC	0.527																																					p.V86I													.	.			0			c.G256A												153.0	151.0	152.0					9																	97349666		2203	4300	6503	SO:0001583	missense	8789	exon2			ATTGGACCATGTT	Y10812	CCDS6711.1	9q22.3	2012-08-13			ENSG00000130957	ENSG00000130957	3.1.3.11		3607	protein-coding gene	gene with protein product		603027				9678974	Standard	NM_003837		Approved		uc004auv.3	O00757	OTTHUMG00000020269	ENST00000375337.3:c.256G>A	9.37:g.97349666C>T	ENSP00000364486:p.Val86Ile		Somatic	122	0	0		WXS	Illumina HiSeq	Phase_I	95	0.03	3	NM_003837	0		0	Q17R39|Q6FI53	Missense_Mutation	SNP	ENST00000375337.3	37	CCDS6711.1	.	.	.	.	.	.	.	.	.	.	G	35	5.447241	0.96205	.	.	ENSG00000130957	ENST00000375337	T	0.71341	-0.56	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.52693	0.1750	N	0.04162	-0.26	0.39020	P	0.04027000000000003	B	0.02656	0.0	B	0.04013	0.001	T	0.54912	-0.8222	9	0.51188	T	0.08	6.9776	17.1633	0.86809	0.0:0.1263:0.8737:0.0	.	86	O00757	F16P2_HUMAN	I	86	ENSP00000364486:V86I	ENSP00000364486:V86I	V	-	1	0	FBP2	96389487	1.000000	0.71417	1.000000	0.80357	0.628000	0.37860	5.465000	0.66725	1.481000	0.48307	-0.120000	0.15030	GTC			0.527	FBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053189.1		NM_003837	
STKLD1	169436	mdanderson.org	37	9	136265602	136265602	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chr9:136265602G>T	ENST00000371957.3	+	12	1250	c.1143G>T	c.(1141-1143)agG>agT	p.R381S	C9orf96_ENST00000371955.1_Missense_Mutation_p.R6S	NM_153710.3	NP_714921.4	Q8NE28	STKL1_HUMAN		381							ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|stomach(2)	25				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		TACATGACAGGGTCCTCGATG	0.672																																					p.R381S													C9orf96_ENST00000371957,NS,carcinoma,+1,2	C9orf96_ENST00000371957	1	2	0			c.G1143T												158.0	107.0	124.0					9																	136265602		2203	4300	6503	SO:0001583	missense	169436	exon12			TGACAGGGTCCTC																												ENST00000371957.3:c.1143G>T	9.37:g.136265602G>T	ENSP00000361025:p.Arg381Ser		Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	21	0.10	2	NM_153710	0		0	Q5T8U8|Q6ZMP6|Q6ZMQ5	Missense_Mutation	SNP	ENST00000371957.3	37	CCDS35169.1	.	.	.	.	.	.	.	.	.	.	G	6.231	0.410788	0.11812	.	.	ENSG00000198870	ENST00000371957;ENST00000371955	T;T	0.44482	0.92;0.92	4.48	1.47	0.22746	Armadillo-like helical (1);Armadillo-type fold (1);	0.519236	0.19078	N	0.123302	T	0.28001	0.0690	L	0.60455	1.87	0.09310	N	1	B	0.13145	0.007	B	0.11329	0.006	T	0.18524	-1.0334	10	0.07325	T	0.83	-27.7195	2.6773	0.05084	0.1051:0.1811:0.5274:0.1864	.	381	Q8NE28	SGK71_HUMAN	S	381;6	ENSP00000361025:R381S;ENSP00000361023:R6S	ENSP00000361023:R6S	R	+	3	2	C9orf96	135255423	0.004000	0.15560	0.006000	0.13384	0.003000	0.03518	0.670000	0.25157	1.082000	0.41137	0.561000	0.74099	AGG			0.672	C9orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054855.1			
PPP2R3B	28227	mdanderson.org	37	X	306965	306965	+	Silent	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chrX:306965G>T	ENST00000390665.3	-	6	841	c.823C>A	c.(823-825)Cgg>Agg	p.R275R		NM_013239.4	NP_037371.2	Q9Y5P8	P2R3B_HUMAN	protein phosphatase 2, regulatory subunit B'', beta	275					cell cycle arrest (GO:0007050)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|phosphoprotein phosphatase activity (GO:0004721)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(5)|lung(5)|skin(1)	11		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GACCAGGACCGGTTCACGGCG	0.716																																					p.R275R													.	.			0			c.C823A												18.0	27.0	24.0					X																	306965		1971	4114	6085	SO:0001819	synonymous_variant	28227	exon6			AGGACCGGTTCAC	AF215840	CCDS14104.1	Xp22.3 and Yp11.3	2013-01-10	2010-06-18		ENSG00000167393	ENSG00000167393		"""Pseudoautosomal regions / PAR1"", ""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	13417	protein-coding gene	gene with protein product		300339	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta"""	PPP2R3L		11173861	Standard	NM_013239		Approved	PPP2R3LY, PR48	uc004cpg.3	Q9Y5P8	OTTHUMG00000021052	ENST00000390665.3:c.823C>A	X.37:g.306965G>T			Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_013239	54	0.00	0	Q6P4G9|Q7RTT1|Q96H01	Silent	SNP	ENST00000390665.3	37	CCDS14104.1																																																																																					0.716	PPP2R3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055577.2		NM_013239	
NHS	4810	broad.mit.edu	37	X	17745674	17745674	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chrX:17745674G>T	ENST00000380060.3	+	6	3723	c.3385G>T	c.(3385-3387)Gaa>Taa	p.E1129*	NHS_ENST00000398097.3_Nonsense_Mutation_p.E973*	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	1150					cell differentiation (GO:0030154)|lens development in camera-type eye (GO:0002088)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)					CAACAAGTCTGAAGAAGTTAA	0.438																																					p.E1129X													.	NHS	302		0			c.G3385T												101.0	100.0	100.0					X																	17745674		2203	4300	6503	SO:0001587	stop_gained	4810	exon6			AAGTCTGAAGAAG		CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158			7820	protein-coding gene	gene with protein product		300457					Standard	NM_001136024		Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.3385G>T	X.37:g.17745674G>T	ENSP00000369400:p.Glu1129*		Somatic	149	0	0		WXS	Illumina HiSeq	Phase_I	197	0.03	6	NM_198270	1	0.00	0	B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	Nonsense_Mutation	SNP	ENST00000380060.3	37	CCDS14181.1	.	.	.	.	.	.	.	.	.	.	G	44	10.883283	0.99483	.	.	ENSG00000188158	ENST00000380060;ENST00000398097;ENST00000380057	.	.	.	5.79	5.79	0.91817	.	0.602886	0.19979	N	0.101818	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	-9.1014	12.4229	0.55529	0.0784:0.0:0.9216:0.0	.	.	.	.	X	1129;973;971	.	ENSP00000369397:E971X	E	+	1	0	NHS	17655595	1.000000	0.71417	0.895000	0.35142	0.834000	0.47266	3.883000	0.56168	2.444000	0.82710	0.544000	0.68410	GAA			0.438	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000059120.1		NM_198270	
LANCL3	347404	broad.mit.edu	37	X	37431145	37431145	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chrX:37431145G>A	ENST00000378619.3	+	1	241	c.22G>A	c.(22-24)Gcc>Acc	p.A8T	LANCL3_ENST00000378621.3_Missense_Mutation_p.A8T|TM4SF2_ENST00000465127.1_Intron	NM_001170331.1	NP_001163802.1	Q6ZV70	LANC3_HUMAN	LanC lantibiotic synthetase component C-like 3 (bacterial)	8							catalytic activity (GO:0003824)			lung(4)|pancreas(1)	5						GCGCTGCTTCGCCAATCGCTT	0.672																																					p.A8T													.	LANCL3	42		0			c.G22A												11.0	9.0	10.0					X																	37431145		2113	4103	6216	SO:0001583	missense	347404	exon1			TGCTTCGCCAATC	AK124915	CCDS14240.1, CCDS55398.1	Xp21.1	2008-02-05			ENSG00000147036	ENSG00000147036			24767	protein-coding gene	gene with protein product							Standard	NM_198511		Approved	FLJ42925	uc011mkd.2	Q6ZV70	OTTHUMG00000033177	ENST00000378619.3:c.22G>A	X.37:g.37431145G>A	ENSP00000367882:p.Ala8Thr		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	62	0.05	3	NM_001170331	4	0.00	0	A6NHE3	Missense_Mutation	SNP	ENST00000378619.3	37	CCDS55398.1	.	.	.	.	.	.	.	.	.	.	G	10.79	1.449308	0.26074	.	.	ENSG00000147036	ENST00000378621;ENST00000378619	.	.	.	4.3	2.43	0.29744	.	0.133886	0.48767	D	0.000162	T	0.28067	0.0692	N	0.11560	0.145	0.49483	D	0.999791	B;B	0.12630	0.003;0.006	B;B	0.09377	0.001;0.004	T	0.04333	-1.0959	9	0.21540	T	0.41	-5.9716	8.2212	0.31543	0.0896:0.2875:0.6229:0.0	.	8;8	Q6ZV70;Q6ZV70-2	LANC3_HUMAN;.	T	8	.	ENSP00000367882:A8T	A	+	1	0	LANCL3	37316064	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	2.021000	0.41020	0.797000	0.33971	0.476000	0.43555	GCC			0.672	LANCL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080885.1		NM_198511	
USP11	8237	broad.mit.edu	37	X	47092516	47092516	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chrX:47092516G>T	ENST00000218348.3	+	1	203	c.203G>T	c.(202-204)aGa>aTa	p.R68I	USP11_ENST00000377107.2_Missense_Mutation_p.R25I	NM_004651.3	NP_004642.2	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	68					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|ovary(3)|pancreas(1)|stomach(1)	40						acTGAGGATAGAGAGCCACAG	0.662																																					p.R68I													.	USP11	93		0			c.G203T												10.0	10.0	10.0					X																	47092516		2174	4265	6439	SO:0001583	missense	8237	exon1			AGGATAGAGAGCC	U44839	CCDS14277.1	Xp11.23	2008-02-05	2005-08-08		ENSG00000102226	ENSG00000102226		"""Ubiquitin-specific peptidases"""	12609	protein-coding gene	gene with protein product		300050	"""ubiquitin specific protease 11"""			12838346	Standard	XM_005272674		Approved	UHX1	uc004dhp.3	P51784	OTTHUMG00000021437	ENST00000218348.3:c.203G>T	X.37:g.47092516G>T	ENSP00000218348:p.Arg68Ile		Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	72	0.04	3	NM_004651	12	0.00	0	B2RTX1|Q8IUG6|Q9BWE1	Missense_Mutation	SNP	ENST00000218348.3	37	CCDS14277.1	.	.	.	.	.	.	.	.	.	.	G	12.82	2.051470	0.36181	.	.	ENSG00000102226	ENST00000377107;ENST00000218348	T;T	0.21191	2.02;2.02	4.25	1.5	0.22942	.	1.710450	0.04139	N	0.319256	T	0.16041	0.0386	N	0.24115	0.695	0.09310	N	1	B	0.17268	0.021	B	0.17433	0.018	T	0.30238	-0.9985	10	0.44086	T	0.13	1.399	6.6759	0.23093	0.3373:0.0:0.6627:0.0	.	68	P51784	UBP11_HUMAN	I	25;68	ENSP00000366311:R25I;ENSP00000218348:R68I	ENSP00000218348:R68I	R	+	2	0	USP11	46977460	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-0.140000	0.10342	0.050000	0.15949	-0.281000	0.10026	AGA			0.662	USP11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				NM_004651	
PIM2	11040	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	48772441	48772441	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chrX:48772441T>G	ENST00000376509.4	-	4	640	c.451A>C	c.(451-453)Atc>Ctc	p.I151L	PIM2_ENST00000485431.1_5'Flank	NM_006875.3	NP_006866.2	Q9P1W9	PIM2_HUMAN	Pim-2 proto-oncogene, serine/threonine kinase	151	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic mitochondrial changes (GO:0008637)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|positive regulation of autophagy (GO:0010508)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|response to virus (GO:0009615)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			lung(3)|stomach(1)	4						CAGTGCTGGATGGCTGCCACT	0.552																																					p.I151L													.	.			0			c.A451C												60.0	49.0	53.0					X																	48772441		2203	4300	6503	SO:0001583	missense	11040	exon4			GCTGGATGGCTGC	U77735	CCDS14312.1	Xp11.23	2014-06-25	2014-06-25		ENSG00000102096	ENSG00000102096			8987	protein-coding gene	gene with protein product		300295	"""pim-2 oncogene"""			9804974	Standard	NM_006875		Approved		uc004dls.3	Q9P1W9	OTTHUMG00000024132	ENST00000376509.4:c.451A>C	X.37:g.48772441T>G	ENSP00000365692:p.Ile151Leu		Somatic	128	0	0		WXS	Illumina HiSeq	.	173	0.36	62	NM_006875	1386	0.50	691	A8K4G6|Q99739	Missense_Mutation	SNP	ENST00000376509.4	37	CCDS14312.1	.	.	.	.	.	.	.	.	.	.	T	11.38	1.621400	0.28889	.	.	ENSG00000102096	ENST00000376509;ENST00000442430	T;T	0.06218	3.33;3.33	5.72	4.77	0.60923	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.170283	0.37906	N	0.001882	T	0.03434	0.0099	N	0.03177	-0.4	0.35939	D	0.83306	B	0.02656	0.0	B	0.12837	0.008	T	0.40608	-0.9554	10	0.37606	T	0.19	.	11.4137	0.49939	0.0:0.9025:0.0:0.0975	.	151	Q9P1W9	PIM2_HUMAN	L	151;39	ENSP00000365692:I151L;ENSP00000410960:I39L	ENSP00000365692:I151L	I	-	1	0	PIM2	48657385	0.991000	0.36638	0.265000	0.24526	0.471000	0.32888	2.891000	0.48617	1.054000	0.40438	-0.438000	0.05819	ATC			0.552	PIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000060805.1			
HEPH	9843	mdanderson.org	37	X	65428068	65428068	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chrX:65428068G>T	ENST00000343002.2	+	14	3207	c.2543G>T	c.(2542-2544)tGg>tTg	p.W848L	HEPH_ENST00000419594.1_Missense_Mutation_p.W659L|HEPH_ENST00000519389.1_Missense_Mutation_p.W902L|HEPH_ENST00000441993.2_Missense_Mutation_p.W851L|HEPH_ENST00000336279.5_Missense_Mutation_p.W581L|HEPH_ENST00000374727.3_Missense_Mutation_p.W851L			Q9BQS7	HEPH_HUMAN	hephaestin	848	Plastocyanin-like 5.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						ACTACTGTCTGGCCACTGGCT	0.468																																					p.W902L													.	.			0			c.G2705T												92.0	70.0	77.0					X																	65428068		2203	4300	6503	SO:0001583	missense	9843	exon15			CTGTCTGGCCACT	AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.2543G>T	X.37:g.65428068G>T	ENSP00000343939:p.Trp848Leu		Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_138737	20	0.00	0	B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Missense_Mutation	SNP	ENST00000343002.2	37		.	.	.	.	.	.	.	.	.	.	g	0.017	-1.498071	0.01001	.	.	ENSG00000089472	ENST00000519389;ENST00000374727;ENST00000336279;ENST00000441993;ENST00000419594;ENST00000343002;ENST00000425114	D;D;D;D;D;D;D	0.99167	-5.17;-5.17;-5.17;-5.17;-5.17;-5.17;-5.51	4.83	1.52	0.23074	Cupredoxin (2);	1.188320	0.06171	N	0.677726	D	0.94866	0.8341	N	0.13235	0.315	0.09310	N	1	B;B;B;B	0.17465	0.0;0.0;0.022;0.002	B;B;B;B	0.14578	0.0;0.001;0.011;0.002	D	0.90638	0.4572	10	0.13470	T	0.59	.	2.0382	0.03544	0.2214:0.1603:0.4738:0.1445	.	902;248;659;848	E9PHN8;B4DFV3;E7ES21;Q9BQS7	.;.;.;HEPH_HUMAN	L	902;851;581;851;659;848;805	ENSP00000430620:W902L;ENSP00000363859:W851L;ENSP00000337418:W581L;ENSP00000411687:W851L;ENSP00000413211:W659L;ENSP00000343939:W848L;ENSP00000398078:W805L	ENSP00000337418:W581L	W	+	2	0	HEPH	65344793	0.004000	0.15560	0.066000	0.19879	0.186000	0.23388	1.080000	0.30779	0.328000	0.23435	0.540000	0.68198	TGG			0.468	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000056995.1		NM_138737	
GPC3	2719	broad.mit.edu;bcgsc.ca	37	X	133119396	133119396	+	Silent	SNP	C	C	G			TCGA-2G-AAG9-01A-11D-A42Y-10	TCGA-2G-AAG9-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59db811a-0bfd-4074-a5a3-e9f33402c6cd	6ef662e1-31f7-4636-9d21-a5409c9d46b3	g.chrX:133119396C>G	ENST00000370818.3	-	1	526	c.81G>C	c.(79-81)ccG>ccC	p.P27P	GPC3_ENST00000543339.1_Silent_p.P27P|GPC3_ENST00000394299.2_Silent_p.P27P	NM_001164618.1|NM_004484.3	NP_001158090.1|NP_004475.1	P51654	GPC3_HUMAN	glypican 3	27					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|body morphogenesis (GO:0010171)|bone mineralization (GO:0030282)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cell proliferation involved in metanephros development (GO:0072203)|chondroitin sulfate metabolic process (GO:0030204)|coronary vasculature development (GO:0060976)|embryonic hindlimb morphogenesis (GO:0035116)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lung development (GO:0030324)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesonephric duct morphogenesis (GO:0072180)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of growth (GO:0045926)|negative regulation of smoothened signaling pathway (GO:0045879)|osteoclast differentiation (GO:0030316)|phototransduction, visible light (GO:0007603)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endocytosis (GO:0045807)|positive regulation of glucose import (GO:0046326)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	peptidyl-dipeptidase inhibitor activity (GO:0060422)			breast(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|prostate(1)|skin(2)	36	Acute lymphoblastic leukemia(192;0.000127)					GCGGCGGCGGCGGGGGCTGCG	0.687			"""T, D, Mis, N, F, S"""			Wilms tumour			Simpson-Golabi-Behmel syndrome																												p.P27P			yes	Rec/X		Simpson-Golabi-Behmel syndrome	X	Xq26.1	2719	glypican 3		O	.	GPC3	88		0			c.G81C												14.0	14.0	14.0					X																	133119396		2189	4277	6466	SO:0001819	synonymous_variant	2719	exon1	Familial Cancer Database	SGBS	CGGCGGCGGGGGC	L47125	CCDS14638.1, CCDS55496.1	Xq26	2014-09-17			ENSG00000147257	ENSG00000147257		"""Proteoglycans / Cell Surface : Glypicans"""	4451	protein-coding gene	gene with protein product	"""glypican proteoglycan 3"""	300037		SDYS		8589713, 9787072	Standard	NM_004484		Approved	OCI-5, SGBS, SGBS1, SGB, DGSX	uc010nrn.2	P51654	OTTHUMG00000022448	ENST00000370818.3:c.81G>C	X.37:g.133119396C>G			Somatic	125	0.008	1		WXS	Illumina HiSeq	Phase_I	124	0.05	6	NM_001164617	1	0.00	0	C9JLE3|G3V1R0|Q2L880|Q2L882	Silent	SNP	ENST00000370818.3	37	CCDS14638.1																																																																																					0.687	GPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058356.1		NM_004484	
