#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
YRDC	79693	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	38270037	38270037	+	Missense_Mutation	SNP	C	C	T	rs138070077		TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr1:38270037C>T	ENST00000373044.2	-	4	708	c.704G>A	c.(703-705)cGc>cAc	p.R235H	C1orf122_ENST00000373043.1_5'Flank	NM_024640.3	NP_078916.3	Q86U90	YRDC_HUMAN	yrdC N(6)-threonylcarbamoyltransferase domain containing	235	YrdC-like. {ECO:0000255|PROSITE- ProRule:PRU00518}.				negative regulation of transport (GO:0051051)	membrane (GO:0016020)|mitochondrion (GO:0005739)	double-stranded RNA binding (GO:0003725)			lung(2)|upper_aerodigestive_tract(1)	3	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				TGAGCCAAGGCGACACTCGGG	0.517																																					p.R235H													YRDC,NS,carcinoma,0,1	YRDC	0	1	0			c.G704A							C	HIS/ARG	0,4406		0,0,2203	94.0	94.0	94.0		704	5.6	1.0	1	dbSNP_134	94	2,8598	2.2+/-6.3	0,2,4298	no	missense	YRDC	NM_024640.3	29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	235/280	38270037	2,13004	2203	4300	6503	SO:0001583	missense	79693	exon4			CCAAGGCGACACT		CCDS30675.1	1p34.3	2013-09-12	2013-09-12		ENSG00000196449	ENSG00000196449			28905	protein-coding gene	gene with protein product	"""ischemia/reperfusion inducible protein"""	612276	"""yrdC domain containing (E.coli)"", ""yrdC domain containing (E. coli)"""			12730717	Standard	NM_024640		Approved	FLJ23476, IRIP, SUA5	uc001cca.1	Q86U90	OTTHUMG00000004318	ENST00000373044.2:c.704G>A	1.37:g.38270037C>T	ENSP00000362135:p.Arg235His		Somatic	153	0	0		WXS	Illumina HiSeq	.	156	0.08	13	NM_024640	75	0.05	4	Q4W4X8|Q6NVW3|Q7L4E4|Q7Z2I4|Q9H5F8	Missense_Mutation	SNP	ENST00000373044.2	37	CCDS30675.1	.	.	.	.	.	.	.	.	.	.	C	36	5.744393	0.96882	0.0	2.33E-4	ENSG00000196449	ENST00000373044	.	.	.	5.6	5.6	0.85130	DHBP synthase RibB-like alpha/beta domain (2);Sua5/YciO/YrdC, N-terminal (2);Sua5/YciO/YrdC/YwlC (1);	0.000000	0.85682	D	0.000000	T	0.75324	0.3834	M	0.65975	2.015	0.80722	D	1	D	0.71674	0.998	P	0.56751	0.805	T	0.77752	-0.2470	9	0.87932	D	0	.	19.6223	0.95663	0.0:1.0:0.0:0.0	.	235	Q86U90	YRDC_HUMAN	H	235	.	ENSP00000362135:R235H	R	-	2	0	YRDC	38042624	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.657000	0.83745	2.635000	0.89317	0.650000	0.86243	CGC	0		0.517	YRDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000012470.1		NM_024640	
ACOT11	26027	mdanderson.org	37	1	55070882	55070882	+	Splice_Site	SNP	G	G	T	rs143707794		TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr1:55070882G>T	ENST00000371316.3	+	13	1452	c.1370G>T	c.(1369-1371)cGg>cTg	p.R457L	ACOT11_ENST00000481208.1_3'UTR|ACOT11_ENST00000343744.2_Splice_Site_p.R457L	NM_015547.3	NP_056362.1	Q8WXI4	ACO11_HUMAN	acyl-CoA thioesterase 11	457	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				fatty acid metabolic process (GO:0006631)|intracellular signal transduction (GO:0035556)|response to cold (GO:0009409)|response to temperature stimulus (GO:0009266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)			NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(3)|lung(5)|ovary(1)	17						AAGCACTACCGGTGAGGGGCC	0.627																																					p.R457L	Ovarian(148;1440 1861 22015 32453 51933)												.	.			0			c.G1370T												48.0	40.0	42.0					1																	55070882		2203	4300	6503	SO:0001630	splice_region_variant	26027	exon13			ACTACCGGTGAGG	AB014607	CCDS592.1, CCDS593.1	1p32.3	2011-09-13	2005-09-08	2005-09-08	ENSG00000162390	ENSG00000162390	3.1.2.-	"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	18156	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 14"""	606803	"""thioesterase, adipose associated"""	THEA		11696000, 16103133, 16940157	Standard	NM_015547		Approved	STARD14, BFIT, KIAA0707, BFIT1, THEM1	uc001cxl.2	Q8WXI4	OTTHUMG00000009891	ENST00000371316.3:c.1370+1G>T	1.37:g.55070882G>T			Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_015547	37	0.00	0	B1AQ22|D3DQ50|O75187|Q52LP1|Q53ER9|Q96DI1|Q9H883	Missense_Mutation	SNP	ENST00000371316.3	37	CCDS592.1	.	.	.	.	.	.	.	.	.	.	G	7.911	0.736392	0.15574	.	.	ENSG00000162390	ENST00000343744;ENST00000371316	T;T	0.78924	-1.22;-1.22	5.15	3.14	0.36123	Lipid-binding START (3);START-like domain (1);	0.396139	0.29266	N	0.012660	T	0.52853	0.1760	N	0.16567	0.415	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.51332	-0.8719	10	0.20519	T	0.43	-17.2617	0.7148	0.00930	0.1919:0.1616:0.3257:0.3209	.	457;457	Q8WXI4;Q8WXI4-2	ACO11_HUMAN;.	L	457	ENSP00000340260:R457L;ENSP00000360366:R457L	ENSP00000340260:R457L	R	+	2	0	ACOT11	54843470	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	1.362000	0.34148	2.572000	0.86782	0.491000	0.48974	CGG			0.627	ACOT11-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000027356.1		NM_015547	Missense_Mutation
LRRC8B	23507	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	90048812	90048812	+	Silent	SNP	C	C	T	rs116502828	byFrequency	TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr1:90048812C>T	ENST00000330947.2	+	5	963	c.603C>T	c.(601-603)tcC>tcT	p.S201S	RP5-1007M22.2_ENST00000443562.1_RNA|LRRC8B_ENST00000358200.4_Silent_p.S201S|LRRC8B_ENST00000439853.1_Silent_p.S201S	NM_001134476.1	NP_001127948.1	Q6P9F7	LRC8B_HUMAN	leucine rich repeat containing 8 family, member B	201					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	26		all_lung(203;0.17)		all cancers(265;0.00515)|Epithelial(280;0.0241)		ACATAGATTCCGGCAAACAGT	0.522													c|||	26	0.00519169	0.0197	0.0	5008	,	,		18915	0.0		0.0	False		,,,				2504	0.0				p.S201S													.	.			0			c.C603T							T	,	36,4370	39.2+/-71.8	1,34,2168	55.0	59.0	58.0		603,603	0.9	0.0	1	dbSNP_132	58	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	LRRC8B	NM_001134476.1,NM_015350.2	,	1,34,6468	TT,TC,CC		0.0,0.8171,0.2768	,	201/804,201/804	90048812	36,12970	2203	4300	6503	SO:0001819	synonymous_variant	23507	exon5			AGATTCCGGCAAA	AF385436	CCDS724.1	1p22.2	2008-02-05			ENSG00000197147	ENSG00000197147			30692	protein-coding gene	gene with protein product	"""T cell activation leucine repeat rich protein"""	612888				9039502	Standard	NM_015350		Approved	TA-LRRP, KIAA0231	uc001dni.3	Q6P9F7	OTTHUMG00000010129	ENST00000330947.2:c.603C>T	1.37:g.90048812C>T			Somatic	79	0	0		WXS	Illumina HiSeq	.	70	0.07	5	NM_015350	2	0.00	0	D3DT28|Q6UY21|Q8N106|Q92627	Silent	SNP	ENST00000330947.2	37	CCDS724.1																																																																																			0.003		0.522	LRRC8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000028008.1		NM_015350	
GFI1	2672	mdanderson.org	37	1	92948551	92948551	+	Silent	SNP	G	G	T	rs143913803	byFrequency	TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr1:92948551G>T	ENST00000370332.1	-	3	486	c.168C>A	c.(166-168)tcC>tcA	p.S56S	GFI1_ENST00000294702.5_Silent_p.S56S|GFI1_ENST00000483490.1_5'UTR|GFI1_ENST00000427103.1_Silent_p.S56S	NM_001127215.1	NP_001120687.1	Q99684	GFI1_HUMAN	growth factor independent 1 transcription repressor	56					auditory receptor cell differentiation (GO:0042491)|cell fate commitment (GO:0045165)|cellular response to lipopolysaccharide (GO:0071222)|inner ear morphogenesis (GO:0042472)|mechanosensory behavior (GO:0007638)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cell fate specification (GO:0009996)|negative regulation of neuron projection development (GO:0010977)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vitamin D biosynthetic process (GO:0010957)|positive regulation of cell fate specification (GO:0042660)|positive regulation of interleukin-6-mediated signaling pathway (GO:0070105)|regulation of toll-like receptor signaling pathway (GO:0034121)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|viral process (GO:0016032)	nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	15		all_lung(203;0.00292)|Lung NSC(277;0.0115)|all_neural(321;0.185)|Glioma(108;0.203)		OV - Ovarian serous cystadenocarcinoma(397;9.04e-07)|Epithelial(280;1.17e-05)|all cancers(265;5.61e-05)|GBM - Glioblastoma multiforme(16;0.0191)		GCGATTCGGGGGACAAACGGT	0.642																																					p.S56S													.	.			0			c.C168A												41.0	51.0	48.0					1																	92948551		2203	4299	6502	SO:0001819	synonymous_variant	2672	exon3			TTCGGGGGACAAA	U67369	CCDS30773.1	1p22	2014-09-17	2007-10-04		ENSG00000162676	ENSG00000162676		"""Zinc fingers, C2H2-type"""	4237	protein-coding gene	gene with protein product		600871	"""growth factor independent 1"""	ZNF163		7789186	Standard	NM_005263		Approved	GFI1A, GFI-1	uc001dov.4	Q99684	OTTHUMG00000010897	ENST00000370332.1:c.168C>A	1.37:g.92948551G>T			Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	17	0.12	2	NM_001127215	2	0.00	0	Q8N564	Silent	SNP	ENST00000370332.1	37	CCDS30773.1																																																																																					0.642	GFI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000030054.1		NM_005263	
NBPF8	728841	broad.mit.edu	37	1	144220816	144220816	+	Missense_Mutation	SNP	A	A	G	rs587673408	byFrequency	TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr1:144220816A>G	ENST00000369373.5	+	2	83	c.83A>G	c.(82-84)gAg>gGg	p.E28G				Q3BBV2	NBPF8_HUMAN	neuroblastoma breakpoint family, member 8	668						cytoplasm (GO:0005737)											GATGAGAAAGAGCCTGAAGTC	0.483													.|||	167	0.0333466	0.1097	0.0115	5008	,	,		50002	0.001		0.006	False		,,,				2504	0.0072				.													ENSG00000162825,bladder,carcinoma,0,2	.		2	0			.																																									SO:0001583	missense	728841	.			AGAAAGAGCCTGA	AY894572		1q21.1	2014-04-01	2013-04-24	2013-04-24	ENSG00000162825	ENSG00000162825		"""neuroblastoma breakpoint family"""	31990	protein-coding gene	gene with protein product		613998	"""neuroblastoma breakpoint family, member 8, pseudogene"""	NBPF8P		16079250	Standard	NM_001037501		Approved			Q3BBV2	OTTHUMG00000074805	ENST00000369373.5:c.83A>G	1.37:g.144220816A>G	ENSP00000358380:p.Glu28Gly		Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	72	0.04	3	.	1	0.00	0		Missense_Mutation	SNP	ENST00000369373.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	8.213|8.213	0.800676|0.800676	0.16397|0.16397	.|.	.|.	ENSG00000162825|ENSG00000162825	ENST00000369373|ENST00000369365	T|.	0.15603|.	2.41|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.39835|.	0.1093|.	.|.	.|.	.|.	.|.	.|.	.|.	B;B;.;B;B|.	0.23316|.	0.0;0.001;.;0.083;0.002|.	B;B;.;B;B|.	0.34038|.	0.0;0.003;.;0.174;0.011|.	T|.	0.29610|.	-1.0006|.	3|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	434;30;601;376;443|.	Q5VTG8;A8K9F1;B4DG53;Q8IX72;Q5TB04|.	.;.;.;.;.|.	G|G	28|3579	ENSP00000358380:E28G|.	.|.	E|S	+|+	2|1	0|0	RP3-377D14.1|RP3-377D14.1	142932173|142932173	0.724000|0.724000	0.28038|0.28038	.|.	.|.	.|.	.|.	0.868000|0.868000	0.27982|0.27982	.|.	.|.	.|.	.|.	GAG|AGC			0.483	NBPF8-204	KNOWN	basic|appris_candidate	protein_coding	protein_coding					
NBPF14	25832	broad.mit.edu	37	1	148009435	148009435	+	Silent	SNP	A	A	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr1:148009435A>T	ENST00000369219.1	-	16	1888	c.1872T>A	c.(1870-1872)ggT>ggA	p.G624G				Q5TI25	NBPFE_HUMAN	neuroblastoma breakpoint family, member 14	624	NBPF 7. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(23)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	42	all_hematologic(923;0.032)					GTTCAAGACAACCTGAAGGAG	0.493																																					p.G624G													.	NBPF14	107		0			c.T1872A												126.0	257.0	218.0					1																	148009435		1699	4065	5764	SO:0001819	synonymous_variant	25832	exon16			AAGACAACCTGAA	AK092351		1q21.1	2013-01-17			ENSG00000122497			"""neuroblastoma breakpoint family"""	25232	protein-coding gene	gene with protein product		614003				8619474, 9110174, 16079250	Standard	NM_015383		Approved	DJ328E19.C1.1	uc021owp.2	Q5TI25	OTTHUMG00000013900	ENST00000369219.1:c.1872T>A	1.37:g.148009435A>T			Somatic	516	0	0		WXS	Illumina HiSeq	Phase_I	355	0.02	7	NM_015383	51	0.02	1	Q5TI23|Q8IX76|Q9UJI9	Silent	SNP	ENST00000369219.1	37		.	.	.	.	.	.	.	.	.	.	a	3.605	-0.080765	0.07141	.	.	ENSG00000122497	ENST00000310701	.	.	.	.	.	.	.	.	.	.	.	T	0.14270	0.0345	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.28808	-1.0032	1	.	.	.	.	.	.	.	.	.	.	.	D	630	.	.	V	-	2	0	NBPF14	146476059	0.986000	0.35501	.	.	.	.	0.724000	0.25954	.	.	.	.	GTT			0.493	NBPF14-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_015383	
KCNJ10	3766	mdanderson.org	37	1	160011301	160011301	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr1:160011301C>T	ENST00000368089.3	-	2	1248	c.1022G>A	c.(1021-1023)gGc>gAc	p.G341D	KCNJ10_ENST00000509700.1_Intron	NM_002241.4	NP_002232.2	P78508	KCJ10_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 10	341					adult walking behavior (GO:0007628)|central nervous system myelination (GO:0022010)|inflammatory response (GO:0006954)|L-glutamate uptake involved in synaptic transmission (GO:0051935)|membrane hyperpolarization (GO:0060081)|optic nerve development (GO:0021554)|potassium ion homeostasis (GO:0055075)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of resting membrane potential (GO:0060075)|regulation of sensory perception of pain (GO:0051930)|response to blue light (GO:0009637)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|synaptic transmission (GO:0007268)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)	17	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)		Yohimbine(DB01392)	GTCACGGAGGCCACTAGGAGA	0.517																																					p.G341D	GBM(167;1368 2014 14817 36425 43215)												.	.			0			c.G1022A												111.0	91.0	98.0					1																	160011301		2203	4300	6503	SO:0001583	missense	3766	exon2			CGGAGGCCACTAG	U52155	CCDS1193.1	1q23.2	2011-07-05			ENSG00000177807	ENSG00000177807		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6256	protein-coding gene	gene with protein product		602208				9367690, 8995301, 16382105	Standard	NM_002241		Approved	Kir4.1, Kir1.2	uc001fuw.2	P78508	OTTHUMG00000024073	ENST00000368089.3:c.1022G>A	1.37:g.160011301C>T	ENSP00000357068:p.Gly341Asp		Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	118	0.04	5	NM_002241	0		0	A3KME7|Q5VUT9|Q8N4I7|Q92808	Missense_Mutation	SNP	ENST00000368089.3	37	CCDS1193.1	.	.	.	.	.	.	.	.	.	.	C	12.25	1.882838	0.33255	.	.	ENSG00000177807	ENST00000368089	D	0.88124	-2.34	5.09	5.09	0.68999	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);	0.550760	0.18065	N	0.152818	T	0.72534	0.3472	N	0.19112	0.55	0.37442	D	0.914455	B	0.15930	0.015	B	0.13407	0.009	T	0.71300	-0.4634	10	0.72032	D	0.01	.	16.0349	0.80617	0.0:1.0:0.0:0.0	.	341	P78508	IRK10_HUMAN	D	341	ENSP00000357068:G341D	ENSP00000357068:G341D	G	-	2	0	KCNJ10	158277925	0.358000	0.24947	0.998000	0.56505	0.997000	0.91878	1.636000	0.37144	2.662000	0.90505	0.655000	0.94253	GGC			0.517	KCNJ10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000060629.1		NM_002241	
CR1	1378	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	207787775	207787775	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr1:207787775G>A	ENST00000367049.4	+	40	6602	c.6602G>A	c.(6601-6603)aGt>aAt	p.S2201N	CR1_ENST00000400960.2_Missense_Mutation_p.S1751N|CR1_ENST00000367051.1_Missense_Mutation_p.S1751N|CR1_ENST00000367052.1_Missense_Mutation_p.S1751N|CR1_ENST00000367053.1_Missense_Mutation_p.S1751N	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1751					complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						AGGTCTGCTAGTCATTGTGTC	0.413																																					p.S2201N													.	.			0			c.G6602A												119.0	110.0	113.0					1																	207787775		1867	4104	5971	SO:0001583	missense	1378	exon40			CTGCTAGTCATTG	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.6602G>A	1.37:g.207787775G>A	ENSP00000356016:p.Ser2201Asn		Somatic	101	0	0		WXS	Illumina HiSeq	.	100	0.31	31	NM_000651	2	0.00	0	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	ENST00000367049.4	37	CCDS44308.1	.	.	.	.	.	.	.	.	.	.	G	16.66	3.184850	0.57909	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000367049	T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;-0.18	4.29	3.34	0.38264	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.78805	0.4341	M	0.90483	3.12	0.09310	N	0.999999	B;D	0.65815	0.152;0.995	B;D	0.65140	0.063;0.932	T	0.66901	-0.5806	9	0.51188	T	0.08	.	7.8847	0.29642	0.1278:0.0:0.8722:0.0	.	1751;2201	P17927;E9PDY4	CR1_HUMAN;.	N	1751;1751;1751;1751;2201	ENSP00000356019:S1751N;ENSP00000356018:S1751N;ENSP00000356020:S1751N;ENSP00000383744:S1751N;ENSP00000356016:S2201N	ENSP00000356016:S2201N	S	+	2	0	CR1	205854398	0.642000	0.27260	0.124000	0.21820	0.383000	0.30230	1.749000	0.38319	1.044000	0.40200	0.436000	0.28706	AGT			0.413	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382527.1		NM_000573	
CDC42BPA	8476	broad.mit.edu	37	1	227441766	227441766	+	Splice_Site	SNP	T	T	C			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr1:227441766T>C	ENST00000366769.3	-	2	1560	c.269A>G	c.(268-270)gAg>gGg	p.E90G	CDC42BPA_ENST00000366767.3_Splice_Site_p.E90G|CDC42BPA_ENST00000535525.1_Splice_Site_p.E90G|CDC42BPA_ENST00000366766.2_Splice_Site_p.E90G|CDC42BPA_ENST00000366764.2_Splice_Site_p.E90G|CDC42BPA_ENST00000366765.3_Splice_Site_p.E90G|CDC42BPA_ENST00000334218.5_Splice_Site_p.E90G	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)											NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				ATCTCTTACCTCCCCAAAAGC	0.328																																					p.E90G													.	CDC42BPA	528		0			c.A269G												150.0	149.0	149.0					1																	227441766		2203	4297	6500	SO:0001630	splice_region_variant	8476	exon2			CTTACCTCCCCAA	U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.270+1A>G	1.37:g.227441766T>C			Somatic	163	0	0		WXS	Illumina HiSeq	Phase_I	166	0.03	5	NM_003607	2	0.00	0		Splice_Site	SNP	ENST00000366769.3	37	CCDS1558.1	.	.	.	.	.	.	.	.	.	.	T	25.8	4.672004	0.88348	.	.	ENSG00000143776	ENST00000366769;ENST00000366767;ENST00000334218;ENST00000366766;ENST00000366764;ENST00000535525;ENST00000366765	T;T;T;T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25;-0.25;-0.25;-0.25	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	D	0.84647	0.5518	M	0.89968	3.075	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.989;0.999;0.989;0.994	D	0.88122	0.2832	10	0.87932	D	0	.	14.7923	0.69851	0.0:0.0:0.0:1.0	.	90;90;90;90	F5H5N0;Q5VT25-4;Q5VT25-3;Q5VT25-5	.;.;.;.	G	90	ENSP00000355731:E90G;ENSP00000355729:E90G;ENSP00000335341:E90G;ENSP00000355728:E90G;ENSP00000355726:E90G;ENSP00000443275:E90G;ENSP00000355727:E90G	ENSP00000335341:E90G	E	-	2	0	CDC42BPA	225508389	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.278000	0.78587	1.974000	0.57490	0.460000	0.39030	GAG			0.328	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000091696.1		NM_014826	Missense_Mutation
TRIM67	440730	mdanderson.org	37	1	231298836	231298836	+	Missense_Mutation	SNP	G	G	A	rs558077330		TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr1:231298836G>A	ENST00000366653.5	+	1	121	c.121G>A	c.(121-123)Ggt>Agt	p.G41S	TRIM67_ENST00000444294.3_Missense_Mutation_p.G41S|TRIM67_ENST00000366652.2_Missense_Mutation_p.G41S|TRIM67_ENST00000449018.3_Splice_Site_p.G41S			Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67	41					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				GACCCCGGACGGTGAGCAGCA	0.701													G|||	1	0.000199681	0.0	0.0	5008	,	,		11714	0.0		0.0	False		,,,				2504	0.001				p.G41S													TRIM67_ENST00000366653,colon,carcinoma,0,2	TRIM67_ENST00000366653	0	2	0			c.G121A												18.0	19.0	18.0					1																	231298836		2001	4169	6170	SO:0001583	missense	440730	exon1			CCGGACGGTGAGC	AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283		"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""				Standard	NM_001004342		Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958	ENST00000366653.5:c.121G>A	1.37:g.231298836G>A	ENSP00000355613:p.Gly41Ser		Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_001004342	0		0	Q5TER7|Q5TER8|Q7Z4K7	Missense_Mutation	SNP	ENST00000366653.5	37	CCDS44333.1	.	.	.	.	.	.	.	.	.	.	G	4.731	0.135868	0.09032	.	.	ENSG00000119283	ENST00000444294;ENST00000366652;ENST00000449018;ENST00000366653	T;T;T;T	0.70045	-0.44;-0.36;-0.26;-0.45	4.82	1.68	0.24146	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (1);	0.480670	0.20771	N	0.085991	T	0.47432	0.1445	L	0.39514	1.22	0.33787	D	0.624955	B	0.06786	0.001	B	0.11329	0.006	T	0.46331	-0.9199	10	0.02654	T	1	.	7.2477	0.26131	0.514:0.0:0.486:0.0	.	41	Q6ZTA4	TRI67_HUMAN	S	41	ENSP00000412124:G41S;ENSP00000355612:G41S;ENSP00000400163:G41S;ENSP00000355613:G41S	ENSP00000355612:G41S	G	+	1	0	TRIM67	229365459	0.609000	0.26975	0.968000	0.41197	0.882000	0.50991	0.216000	0.17585	0.477000	0.27464	0.313000	0.20887	GGT;GGT;GGC;GGT			0.701	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000092649.3		NM_001004342	
CHRM3	1131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	240071655	240071655	+	Missense_Mutation	SNP	C	C	T	rs200967479		TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr1:240071655C>T	ENST00000255380.4	+	5	1683	c.904C>T	c.(904-906)Cgc>Tgc	p.R302C		NM_000740.2	NP_000731.1	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	302					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of insulin secretion (GO:0050796)|regulation of vascular smooth muscle contraction (GO:0003056)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|smooth muscle contraction (GO:0006939)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)|receptor activity (GO:0004872)			breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(19)|ovary(4)|prostate(1)|skin(12)|upper_aerodigestive_tract(1)	51	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Fesoterodine(DB06702)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methacholine(DB06709)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tramadol(DB00193)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	AAGCATGAAACGCTCCAACAG	0.547																																					p.R302C													CHRM3,colon,carcinoma,0,1	CHRM3	0	1	0			c.C904T												42.0	45.0	44.0					1																	240071655		2203	4300	6503	SO:0001583	missense	1131	exon5			ATGAAACGCTCCA	U29589	CCDS1616.1	1q43	2012-09-20			ENSG00000133019	ENSG00000133019		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1952	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 3"""	118494					Standard	XM_005273032		Approved		uc001hyp.3	P20309	OTTHUMG00000039649	ENST00000255380.4:c.904C>T	1.37:g.240071655C>T	ENSP00000255380:p.Arg302Cys		Somatic	136	0	0		WXS	Illumina HiSeq	.	134	0.20	27	NM_000740	17	0.12	2	Q0VAJ8|Q4QRI3|Q5VXY2|Q9HB60	Missense_Mutation	SNP	ENST00000255380.4	37	CCDS1616.1	.	.	.	.	.	.	.	.	.	.	C	10.54	1.379309	0.24944	.	.	ENSG00000133019	ENST00000255380	T	0.60424	0.19	5.88	4.97	0.65823	GPCR, rhodopsin-like superfamily (1);	0.485395	0.21374	N	0.075600	T	0.47655	0.1457	N	0.12182	0.205	0.29576	N	0.849549	D	0.60575	0.988	P	0.51453	0.67	T	0.47045	-0.9147	10	0.41790	T	0.15	-4.1978	10.9653	0.47408	0.0:0.8578:0.0:0.1422	.	302	P20309	ACM3_HUMAN	C	302	ENSP00000255380:R302C	ENSP00000255380:R302C	R	+	1	0	CHRM3	238138278	0.341000	0.24801	0.017000	0.16124	0.906000	0.53458	2.580000	0.46068	1.489000	0.48450	0.591000	0.81541	CGC			0.547	CHRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000095644.2		NM_000740	
ANKRD16	54522	mdanderson.org	37	10	5920171	5920171	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr10:5920171G>T	ENST00000380094.5	-	7	1551	c.1008C>A	c.(1006-1008)gaC>gaA	p.D336E	ANKRD16_ENST00000191063.8_3'UTR|ANKRD16_ENST00000380092.4_Missense_Mutation_p.D336E	NM_019046.2	NP_061919.1	Q6P6B7	ANR16_HUMAN	ankyrin repeat domain 16	336										breast(1)|endometrium(1)|large_intestine(5)|lung(3)|stomach(2)	12						TGCCCGTGATGTCTTCAGAAT	0.557																																					p.D336E													.	.			0			c.C1008A												139.0	132.0	135.0					10																	5920171		2203	4300	6503	SO:0001583	missense	54522	exon7			CGTGATGTCTTCA	AL137614	CCDS31136.1, CCDS31137.1	10p15.1	2013-01-10			ENSG00000134461	ENSG00000134461		"""Ankyrin repeat domain containing"""	23471	protein-coding gene	gene with protein product							Standard	NM_019046		Approved	DKFZP434N1511	uc010qat.2	Q6P6B7	OTTHUMG00000017610	ENST00000380094.5:c.1008C>A	10.37:g.5920171G>T	ENSP00000369436:p.Asp336Glu		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	24	0.13	3	NM_001009941	26	0.00	0	A6NEF0|F8WEI4|Q9NT01	Missense_Mutation	SNP	ENST00000380094.5	37	CCDS31136.1	.	.	.	.	.	.	.	.	.	.	G	13.02	2.112543	0.37242	.	.	ENSG00000134461	ENST00000380094;ENST00000380092	T;T	0.68025	-0.3;-0.3	4.97	1.06	0.20224	.	0.000000	0.85682	D	0.000000	T	0.67785	0.2930	L	0.33485	1.01	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.62469	-0.6848	10	0.42905	T	0.14	-27.8211	8.4806	0.33040	0.3241:0.0:0.6759:0.0	.	336	Q6P6B7	ANR16_HUMAN	E	336	ENSP00000369436:D336E;ENSP00000369434:D336E	ENSP00000369434:D336E	D	-	3	2	ANKRD16	5960177	0.691000	0.27709	0.004000	0.12327	0.040000	0.13550	0.819000	0.27308	-0.066000	0.12998	0.305000	0.20034	GAC			0.557	ANKRD16-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046611.2		XM_166138	
POLR3A	11128	mdanderson.org	37	10	79742493	79742493	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr10:79742493G>T	ENST00000372371.3	-	27	3649	c.3512C>A	c.(3511-3513)gCt>gAt	p.A1171D		NM_007055.3	NP_008986.2	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide A, 155kDa	1171					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|ribonucleoside binding (GO:0032549)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			ACACACCACAGCCTCACCATG	0.537																																					p.A1171D													.	.			0			c.C3512A												120.0	99.0	106.0					10																	79742493		2203	4300	6503	SO:0001583	missense	11128	exon27			ACCACAGCCTCAC	AF021351	CCDS7354.1	10q22-q23	2013-01-21			ENSG00000148606	ENSG00000148606		"""RNA polymerase subunits"""	30074	protein-coding gene	gene with protein product		614258				9331371, 12391170	Standard	NM_007055		Approved	RPC1, RPC155, hRPC155	uc001jzn.3	O14802	OTTHUMG00000018550	ENST00000372371.3:c.3512C>A	10.37:g.79742493G>T	ENSP00000361446:p.Ala1171Asp		Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	58	0.07	4	NM_007055	32	0.00	0	Q8IW34|Q8TCW5	Missense_Mutation	SNP	ENST00000372371.3	37	CCDS7354.1	.	.	.	.	.	.	.	.	.	.	G	13.18	2.160801	0.38119	.	.	ENSG00000148606	ENST00000372371;ENST00000540842	T	0.62105	0.05	6.07	6.07	0.98685	RNA polymerase Rpb1, domain 5 (1);	0.000000	0.85682	D	0.000000	T	0.41119	0.1145	N	0.03000	-0.44	0.80722	D	1	B	0.10296	0.003	B	0.12156	0.007	T	0.36890	-0.9729	9	.	.	.	-19.7455	20.6439	0.99570	0.0:0.0:1.0:0.0	.	1171	O14802	RPC1_HUMAN	D	1171;1150	ENSP00000361446:A1171D	.	A	-	2	0	POLR3A	79412499	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	9.271000	0.95698	2.884000	0.98904	0.655000	0.94253	GCT			0.537	POLR3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048923.1		NM_007055	
TRIM5	85363	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	5699638	5699638	+	Silent	SNP	G	G	A	rs182373551		TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr11:5699638G>A	ENST00000380034.3	-	4	796	c.540C>T	c.(538-540)aaC>aaT	p.N180N	TRIM5_ENST00000305836.5_Silent_p.N180N|TRIM5_ENST00000380027.1_Silent_p.N180N|TRIM5_ENST00000483835.1_5'UTR|TRIM5_ENST00000396855.3_Silent_p.N180N|TRIM5_ENST00000396847.3_Silent_p.N180N|TRIM5_ENST00000396853.4_Silent_p.N180N	NM_033034.2|NM_033092.2	NP_149023.2|NP_149083.2	Q9C035	TRIM5_HUMAN	tripartite motif containing 5	180					activation of innate immune response (GO:0002218)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein K63-linked ubiquitination (GO:0070534)|protein trimerization (GO:0070206)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|signaling pattern recognition receptor activity (GO:0008329)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)|Lung NSC(207;0.138)|all_lung(207;0.221)		Epithelial(150;7.21e-09)|BRCA - Breast invasive adenocarcinoma(625;0.139)		CTGCCAAGACGTTGGTTTTGT	0.473													G|||	1	0.000199681	0.0	0.0	5008	,	,		19910	0.001		0.0	False		,,,				2504	0.0				p.N180N													TRIM5_ENST00000380034,extremity,malignant_melanoma,-1,2	TRIM5_ENST00000380034	-1	2	0			c.C540T												115.0	111.0	113.0					11																	5699638		2201	4297	6498	SO:0001819	synonymous_variant	85363	exon4			CAAGACGTTGGTT	AF220025	CCDS31392.1, CCDS31393.1, CCDS31394.1	11p15	2014-06-03	2011-01-25		ENSG00000132256	ENSG00000132256		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16276	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM5"", ""tripartite motif protein TRIM"""	608487	"""tripartite motif-containing 5"""			11331580	Standard	NM_033034		Approved	RNF88, TRIM5alpha	uc001mbm.2	Q9C035	OTTHUMG00000066893	ENST00000380034.3:c.540C>T	11.37:g.5699638G>A			Somatic	178	0	0		WXS	Illumina HiSeq	.	131	0.06	8	NM_033093	11	0.00	0	A6NGQ1|A8WFA8|D3DQS8|D3DQS9|G3GJY1|Q2MLV4|Q2MLV8|Q2MLV9|Q2MLW1|Q2MLW3|Q2MLW4|Q2MLW6|Q2MLW7|Q2MLX1|Q2MLX2|Q2MLX3|Q2MLX5|Q2MLY3|Q2MLY4|Q2V6Q6|Q6GX26|Q8WU46|Q96SR5|Q9C031|Q9C032|Q9C033|Q9C034	Silent	SNP	ENST00000380034.3	37	CCDS31393.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	3.528	-0.096421	0.07010	.	.	ENSG00000132256	ENST00000438025	.	.	.	4.74	1.11	0.20524	.	.	.	.	.	T	0.22742	0.0549	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.22487	-1.0215	4	.	.	.	.	2.6533	0.05004	0.5569:0.0:0.2459:0.1972	.	.	.	.	M	57	.	.	T	-	2	0	TRIM5	5656214	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.010000	0.13242	0.076000	0.16826	0.655000	0.94253	ACG	0		0.473	TRIM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000143360.3		NM_033034	
TRIM51	84767	broad.mit.edu	37	11	55657490	55657490	+	Silent	SNP	G	G	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr11:55657490G>T	ENST00000449290.2	+	6	926	c.834G>T	c.(832-834)ctG>ctT	p.L278L	TRIM51_ENST00000244891.3_Silent_p.L135L	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	278	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)										TCACTGGACTGCTGGACAGCC	0.502																																					p.L278L													.	.			0			c.G834T												51.0	47.0	48.0					11																	55657490		2201	4295	6496	SO:0001819	synonymous_variant	84767	exon6			TGGACTGCTGGAC	BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.834G>T	11.37:g.55657490G>T			Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_032681	0		0	A6NMG2	Silent	SNP	ENST00000449290.2	37																																																																																						0.502	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000391522.1		NM_032681	
PATL1	219988	mdanderson.org	37	11	59425075	59425075	+	Silent	SNP	G	G	A			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr11:59425075G>A	ENST00000300146.9	-	5	633	c.549C>T	c.(547-549)ggC>ggT	p.G183G		NM_152716.2	NP_689929.2	Q86TB9	PATL1_HUMAN	protein associated with topoisomerase II homolog 1 (yeast)	183	Involved in nuclear foci localization.|Pro-rich.|Region N; interaction with decapping machinery.				cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(2)|lung(5)|ovary(1)|prostate(2)	11						CAGGAGGACTGCCAATGATAG	0.532																																					p.G183G													.	.			0			c.C549T												126.0	120.0	122.0					11																	59425075		1918	4122	6040	SO:0001819	synonymous_variant	219988	exon5			AGGACTGCCAATG	AK094193	CCDS44613.1	11q12.1	2012-06-07	2007-10-18		ENSG00000166889	ENSG00000166889			26721	protein-coding gene	gene with protein product		614660				17936923	Standard	NM_152716		Approved	FLJ36874, Pat1b	uc001noe.4	Q86TB9	OTTHUMG00000167423	ENST00000300146.9:c.549C>T	11.37:g.59425075G>A			Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_152716	26	0.00	0	B3KXT9|Q2TA86|Q6P166|Q8N9M6|Q8NI63	Silent	SNP	ENST00000300146.9	37	CCDS44613.1																																																																																					0.532	PATL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394559.1		NM_152716	
EHBP1L1	254102	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	65350457	65350457	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr11:65350457G>A	ENST00000309295.4	+	9	2579	c.2314G>A	c.(2314-2316)Gcg>Acg	p.A772T		NM_001099409.1	NP_001092879.1	Q8N3D4	EH1L1_HUMAN	EH domain binding protein 1-like 1	772	Glu-rich.					membrane (GO:0016020)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						AGCAGAAGGTGCGATATTGGG	0.517																																					p.A772T													.	.			0			c.G2314A												39.0	39.0	39.0					11																	65350457		1880	4104	5984	SO:0001583	missense	254102	exon9			GAAGGTGCGATAT	AL834433	CCDS44649.1	11q13.1	2008-02-05			ENSG00000173442	ENSG00000173442			30682	protein-coding gene	gene with protein product							Standard	NM_001099409		Approved	DKFZp762C186, TANGERIN	uc001oeo.4	Q8N3D4	OTTHUMG00000166520	ENST00000309295.4:c.2314G>A	11.37:g.65350457G>A	ENSP00000312671:p.Ala772Thr		Somatic	88	0	0		WXS	Illumina HiSeq	.	80	0.21	17	NM_001099409	43	0.19	8	Q8TB89|Q9H7M7	Missense_Mutation	SNP	ENST00000309295.4	37	CCDS44649.1	.	.	.	.	.	.	.	.	.	.	G	12.29	1.893676	0.33442	.	.	ENSG00000173442	ENST00000309295	T	0.63417	-0.04	4.71	0.305	0.15801	.	.	.	.	.	T	0.34687	0.0906	N	0.08118	0	0.09310	N	1	B	0.29432	0.244	B	0.19666	0.026	T	0.17410	-1.0370	9	0.44086	T	0.13	.	5.4634	0.16630	0.2719:0.1475:0.5806:0.0	.	772	Q8N3D4	EH1L1_HUMAN	T	772	ENSP00000312671:A772T	ENSP00000312671:A772T	A	+	1	0	EHBP1L1	65107033	0.001000	0.12720	0.002000	0.10522	0.002000	0.02628	0.780000	0.26760	0.414000	0.25790	-0.150000	0.13652	GCG			0.517	EHBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390145.1		XM_170658	
CEP57	9702	mdanderson.org	37	11	95562419	95562419	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr11:95562419G>T	ENST00000325542.5	+	10	1434	c.1196G>T	c.(1195-1197)tGt>tTt	p.C399F	CEP57_ENST00000325486.5_Missense_Mutation_p.C373F|CEP57_ENST00000541150.1_Missense_Mutation_p.C390F|CEP57_ENST00000537677.1_Missense_Mutation_p.C372F	NM_001243776.1|NM_014679.4	NP_001230705.1|NP_055494.2	Q86XR8	CEP57_HUMAN	centrosomal protein 57kDa	399	Mediates interaction with microtubules. {ECO:0000250}.				fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|mitotic cell cycle (GO:0000278)|protein homooligomerization (GO:0051260)|protein import into nucleus, translocation (GO:0000060)|spermatid development (GO:0007286)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	fibroblast growth factor binding (GO:0017134)|protein homodimerization activity (GO:0042803)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	13		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				AAGTTGGAGTGTGAATTGGAG	0.418									Mosaic Variegated Aneuploidy Syndrome																												p.C399F													.	.			0			c.G1196T												209.0	210.0	210.0					11																	95562419		2201	4298	6499	SO:0001583	missense	9702	exon10	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	TGGAGTGTGAATT	D42054	CCDS8304.1, CCDS58166.1, CCDS58167.1	11q21	2014-09-17			ENSG00000166037	ENSG00000166037			30794	protein-coding gene	gene with protein product		607951				7788527	Standard	NM_014679		Approved	Translokin, TSP57, KIAA0092	uc001pfp.2	Q86XR8	OTTHUMG00000167740	ENST00000325542.5:c.1196G>T	11.37:g.95562419G>T	ENSP00000317902:p.Cys399Phe		Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_014679	100	0.00	0	A0PJH1|A8K5D0|B4DDP5|F5H5F7|Q14704|Q5JB46|Q8IXP0|Q9BVF9	Missense_Mutation	SNP	ENST00000325542.5	37	CCDS8304.1	.	.	.	.	.	.	.	.	.	.	G	17.12	3.307956	0.60305	.	.	ENSG00000166037	ENST00000537677;ENST00000325542;ENST00000325486;ENST00000541150	T;T;T;T	0.31510	1.51;1.5;1.49;1.5	5.54	2.61	0.31194	.	0.215927	0.40818	N	0.001019	T	0.30572	0.0769	L	0.32530	0.975	0.31891	N	0.617224	D;P;D	0.56287	0.969;0.554;0.975	P;B;P	0.51974	0.558;0.331;0.686	T	0.36841	-0.9731	10	0.87932	D	0	-18.4477	8.4224	0.32710	0.135:0.0:0.7399:0.1251	.	390;373;399	F5H5F7;Q86XR8-2;Q86XR8	.;.;CEP57_HUMAN	F	372;399;373;390	ENSP00000441392:C372F;ENSP00000317902:C399F;ENSP00000317487:C373F;ENSP00000443436:C390F	ENSP00000317487:C373F	C	+	2	0	CEP57	95202067	1.000000	0.71417	0.980000	0.43619	0.756000	0.42949	4.244000	0.58728	0.691000	0.31592	0.491000	0.48974	TGT			0.418	CEP57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000395983.1		NM_014679	
DSCAML1	57453	mdanderson.org	37	11	117301733	117301733	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr11:117301733G>T	ENST00000321322.6	-	32	5572	c.5571C>A	c.(5569-5571)agC>agA	p.S1857R	DSCAML1_ENST00000527706.1_Missense_Mutation_p.S1587R	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1797					axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		TGGACACCATGCTGTTCCTTC	0.582																																					p.S1857R													.	.			0			c.C5571A												103.0	95.0	98.0					11																	117301733		2201	4296	6497	SO:0001583	missense	57453	exon32			CACCATGCTGTTC		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.5571C>A	11.37:g.117301733G>T	ENSP00000315465:p.Ser1857Arg		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_020693	4	0.00	0	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	G	18.17	3.564900	0.65651	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.70164	-0.4;-0.46	5.04	5.04	0.67666	.	.	.	.	.	T	0.70806	0.3266	L	0.27053	0.805	0.58432	D	0.999995	D	0.76494	0.999	D	0.87578	0.998	T	0.73329	-0.4017	9	0.87932	D	0	.	11.9672	0.53042	0.0792:0.0:0.9208:0.0	.	1797	Q8TD84	DSCL1_HUMAN	R	1587;1857;1564	ENSP00000434335:S1587R;ENSP00000315465:S1857R	ENSP00000315465:S1857R	S	-	3	2	DSCAML1	116806943	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.785000	0.62418	2.628000	0.89032	0.591000	0.81541	AGC			0.582	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000392907.2		NM_020693	
FOXM1	2305	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	2983605	2983605	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr12:2983605G>A	ENST00000359843.3	-	2	108	c.40C>T	c.(40-42)Cgg>Tgg	p.R14W	RHNO1_ENST00000489288.2_5'Flank|FOXM1_ENST00000342628.2_Missense_Mutation_p.R14W|FOXM1_ENST00000361953.3_Missense_Mutation_p.R14W|FOXM1_ENST00000537018.1_5'Flank|RHNO1_ENST00000461997.2_5'Flank	NM_021953.3	NP_068772.2	Q08050	FOXM1_HUMAN	forkhead box M1	14					cell cycle (GO:0007049)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|liver development (GO:0001889)|mitotic cell cycle (GO:0000278)|negative regulation of cell aging (GO:0090344)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of cell cycle arrest (GO:0071156)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of Ras protein signal transduction (GO:0046578)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(3)	24			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			GGCAGCCTCCGTCTTTTGAGA	0.493																																					p.R14W													.	.			0			c.C40T												95.0	111.0	106.0					12																	2983605		2203	4300	6503	SO:0001583	missense	2305	exon2			GCCTCCGTCTTTT	Y12773	CCDS8515.1, CCDS8516.1, CCDS8517.1	12p13	2007-09-18			ENSG00000111206	ENSG00000111206		"""Forkhead boxes"""	3818	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 2"""	602341		FKHL16		9032290, 9441747	Standard	NM_202002		Approved	HFH-11, trident, HNF-3, INS-1, MPP2, MPHOSPH2, TGT3	uc001qlf.3	Q08050	OTTHUMG00000168118	ENST00000359843.3:c.40C>T	12.37:g.2983605G>A	ENSP00000352901:p.Arg14Trp		Somatic	55	0	0		WXS	Illumina HiSeq	.	100	0.06	6	NM_001243089	86	0.01	1	O43258|O43259|O43260|Q4ZGG7|Q9BRL2	Missense_Mutation	SNP	ENST00000359843.3	37	CCDS8515.1	.	.	.	.	.	.	.	.	.	.	G	15.28	2.787289	0.49997	.	.	ENSG00000111206	ENST00000342628;ENST00000361953;ENST00000359843	D;D;D	0.97352	-4.02;-4.35;-4.21	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	D	0.98112	0.9377	M	0.76002	2.32	0.51767	D	0.999936	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;1.0;0.999;1.0	D	0.98525	1.0625	10	0.87932	D	0	.	14.4026	0.67060	0.0:0.0:0.8523:0.1477	.	14;14;14;14;14	A8K591;Q53Y49;Q08050-2;Q08050;Q08050-3	.;.;.;FOXM1_HUMAN;.	W	14	ENSP00000342307:R14W;ENSP00000354492:R14W;ENSP00000352901:R14W	ENSP00000342307:R14W	R	-	1	2	FOXM1	2853866	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.845000	0.55880	2.674000	0.91012	0.655000	0.94253	CGG			0.493	FOXM1-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000398272.1		NM_021953	
TNFRSF1A	7132	broad.mit.edu	37	12	6438980	6438980	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr12:6438980A>C	ENST00000162749.2	-	9	1320	c.1021T>G	c.(1021-1023)Tgg>Ggg	p.W341G	TNFRSF1A_ENST00000540022.1_Missense_Mutation_p.W298G|TNFRSF1A_ENST00000437813.3_5'Flank	NM_001065.3	NP_001056.1	P19438	TNR1A_HUMAN	tumor necrosis factor receptor superfamily, member 1A	341	N-SMase activation domain (NSD).				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-6 production (GO:0032715)|positive regulation of angiogenesis (GO:0045766)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|prostaglandin metabolic process (GO:0006693)|protein heterooligomerization (GO:0051291)|response to alkaloid (GO:0043279)|response to amino acid (GO:0043200)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|response to wounding (GO:0009611)|tetrapyrrole metabolic process (GO:0033013)|viral process (GO:0016032)	axon (GO:0030424)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	tumor necrosis factor-activated receptor activity (GO:0005031)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	19						CTGTCCTCCCACTTCTGAAGG	0.697																																					p.W341G													.	TNFRSF1A	39		0			c.T1021G												9.0	10.0	10.0					12																	6438980		2192	4279	6471	SO:0001583	missense	7132	exon9			CCTCCCACTTCTG	M75866	CCDS8542.1	12p13.2	2014-09-17			ENSG00000067182	ENSG00000067182		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11916	protein-coding gene	gene with protein product		191190		TNFR1		1655358, 2158863	Standard	NM_001065		Approved	TNF-R, TNFAR, TNFR60, TNF-R-I, CD120a, TNF-R55	uc001qnu.3	P19438	OTTHUMG00000168267	ENST00000162749.2:c.1021T>G	12.37:g.6438980A>C	ENSP00000162749:p.Trp341Gly		Somatic	62	0.1612903226	10		WXS	Illumina HiSeq	Phase_I	130	0.13	17	NM_001065	533	0.02	13	A8K4X3|B2RDE4|B3KPQ1|B4DQB7|B4E309|B5M0B5|D3DUR1|Q9UCA4	Missense_Mutation	SNP	ENST00000162749.2	37	CCDS8542.1	.	.	.	.	.	.	.	.	.	.	A	9.814	1.183850	0.21870	.	.	ENSG00000067182	ENST00000162749;ENST00000540022	D;D	0.91945	-2.93;-2.94	4.09	-8.18	0.01053	DEATH-like (1);	5.493010	0.00166	N	0.000000	D	0.90628	0.7061	M	0.63843	1.955	0.09310	N	0.999998	D;B	0.56521	0.976;0.016	P;B	0.54140	0.743;0.005	D	0.83975	0.0329	10	0.45353	T	0.12	-0.0162	0.3549	0.00355	0.2611:0.2964:0.1992:0.2432	.	298;341	F5H061;P19438	.;TNR1A_HUMAN	G	341;298	ENSP00000162749:W341G;ENSP00000438343:W298G	ENSP00000162749:W341G	W	-	1	0	TNFRSF1A	6309241	0.000000	0.05858	0.000000	0.03702	0.049000	0.14656	-1.674000	0.01949	-1.468000	0.01892	-0.366000	0.07423	TGG			0.697	TNFRSF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000399038.1		NM_001065	
PLEKHA8P1	51054	broad.mit.edu	37	12	45566846	45566846	+	RNA	SNP	T	T	A			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr12:45566846T>A	ENST00000256692.5	-	0	1839					NR_037144.1		O95397	PKHA9_HUMAN	pleckstrin homology domain containing, family A member 8 pseudogene 1							cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						ttattttttttaattttattt	0.254																																					.													.	PLEKHA8P1	38		0			.																																											0	.			TTTTTTTAATTTT	AF103731		12q12	2010-11-24	2010-11-24	2010-11-24	ENSG00000134297	ENSG00000134297			30222	pseudogene	pseudogene	"""putative glycolipid transfer protein"""		"""pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 9"""	PLEKHA9		12477932	Standard	NR_037144		Approved	FLJ14156	uc001rom.2	O95397			12.37:g.45566846T>A			Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	13	0.38	5	.	3	0.33	1		RNA	SNP	ENST00000256692.5	37																																																																																						0.254	PLEKHA8P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000404814.1		NR_037144	
KRT81	3887	hgsc.bcm.edu;broad.mit.edu	37	12	52681795	52681795	+	Silent	SNP	G	G	T	rs200239075	byFrequency	TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr12:52681795G>T	ENST00000327741.5	-	5	941	c.873C>A	c.(871-873)gcC>gcA	p.A291A	KRT86_ENST00000423955.2_Intron|KRT86_ENST00000544024.1_Intron	NM_002281.3	NP_002272.2	Q14533	KRT81_HUMAN	keratin 81	291	Coil 2.|Rod.					extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(2)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|stomach(1)	16				BRCA - Breast invasive adenocarcinoma(357;0.189)		ACTCGGCCTCGGCCCGGCTGC	0.562																																					p.A291A													KRT81,NS,lymphoid_neoplasm,0,1	KRT81	0	1	0			c.C873A												97.0	83.0	88.0					12																	52681795		2203	4300	6503	SO:0001819	synonymous_variant	3887	exon5			GGCCTCGGCCCGG	X81420	CCDS31805.1	12q13	2013-01-16	2006-07-17	2006-07-17	ENSG00000205426	ENSG00000205426		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6458	protein-coding gene	gene with protein product	"""hard keratin type II 1"""	602153	"""keratin, hair, basic, 1"""	KRTHB1		7556444, 16831889	Standard	NM_002281		Approved	Hb-1	uc001sab.3	Q14533	OTTHUMG00000167574	ENST00000327741.5:c.873C>A	12.37:g.52681795G>T			Somatic	73	0	0		WXS	Illumina HiSeq	.	97	0.04	4	NM_002281	0		0	Q14846|Q16274|Q17R48|Q8WU52|Q9BR74	Silent	SNP	ENST00000327741.5	37	CCDS31805.1																																																																																					0.562	KRT81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000395128.2		NM_002281	
GOLGA3	2802	hgsc.bcm.edu	37	12	133353241	133353241	+	Silent	SNP	T	T	C	rs541227756	byFrequency	TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr12:133353241T>C	ENST00000450791.2	-	20	4140	c.3957A>G	c.(3955-3957)gaA>gaG	p.E1319E	GOLGA3_ENST00000204726.3_Silent_p.E1319E|GOLGA3_ENST00000456883.2_Silent_p.E1319E			Q08378	GOGA3_HUMAN	golgin A3	1319	Gln-rich.				intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		GCTGTAGCCCTTCCAGTTCCT	0.587													T|||	45	0.00898562	0.0212	0.0159	5008	,	,		20367	0.0		0.005	False		,,,				2504	0.001				p.E1319E													GOLGA3,right_upper_lobe,carcinoma,0,2	GOLGA3	0	2	0			c.A3957G												90.0	83.0	85.0					12																	133353241		2203	4300	6503	SO:0001819	synonymous_variant	2802	exon21			TAGCCCTTCCAGT	AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.3957A>G	12.37:g.133353241T>C			Somatic	82	0.0243902439	2		WXS	Illumina HiSeq	.	62	0.05	3	NM_005895	51	0.00	0	A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Silent	SNP	ENST00000450791.2	37	CCDS9281.1																																																																																					0.587	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000397569.2		NM_005895	
DOCK9	23348	broad.mit.edu;mdanderson.org	37	13	99449463	99449463	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr13:99449463C>T	ENST00000376460.1	-	55	6184	c.6104G>A	c.(6103-6105)cGt>cAt	p.R2035H	DOCK9_ENST00000339416.2_Missense_Mutation_p.R2022H	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	2036	DHR-2.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TTTAATCAGACGTTCGTTTAC	0.488																																					.													.	DOCK9	311		0			.												110.0	101.0	104.0					13																	99449463		1976	4150	6126	SO:0001583	missense	23348	.			ATCAGACGTTCGT	AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.6104G>A	13.37:g.99449463C>T	ENSP00000365643:p.Arg2035His		Somatic	175	0	0		WXS	Illumina HiSeq	Phase_I	116	0.06	7	.	45	0.00	0	B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Missense_Mutation	SNP	ENST00000376460.1	37	CCDS45062.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.011532	0.93346	.	.	ENSG00000088387	ENST00000376460;ENST00000357329;ENST00000376455;ENST00000400235;ENST00000428223;ENST00000400220;ENST00000339416;ENST00000376453	T;T	0.18174	2.23;2.23	5.53	5.53	0.82687	.	0.056540	0.64402	D	0.000001	T	0.48466	0.1501	M	0.83692	2.655	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;0.997;1.0;0.999;0.999;0.996	D;D;D;D;D;D	0.75484	0.986;0.96;0.983;0.953;0.946;0.933	T	0.52756	-0.8533	10	0.87932	D	0	.	19.4713	0.94963	0.0:1.0:0.0:0.0	.	741;654;2035;2036;691;653	B7Z6H5;B7Z2J2;Q9BZ29-5;Q9BZ29;B7Z6G9;F5H1Q4	.;.;.;DOCK9_HUMAN;.;.	H	2035;2036;2028;2013;2035;943;2022;653	ENSP00000365643:R2035H;ENSP00000341086:R2022H	ENSP00000341086:R2022H	R	-	2	0	DOCK9	98247464	1.000000	0.71417	0.940000	0.37924	0.735000	0.41995	7.487000	0.81328	2.587000	0.87381	0.563000	0.77884	CGT			0.488	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045566.1		NM_015296	
GAS6	2621	mdanderson.org	37	13	114538575	114538575	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr13:114538575C>A	ENST00000327773.6	-	7	769	c.623G>T	c.(622-624)gGg>gTg	p.G208V	GAS6-AS1_ENST00000458001.1_RNA|GAS6_ENST00000355761.4_Missense_Mutation_p.G154V|GAS6_ENST00000357389.3_Missense_Mutation_p.G208V|GAS6_ENST00000450766.1_5'UTR|GAS6_ENST00000418959.3_5'Flank	NM_000820.2	NP_000811.1	Q14393	GAS6_HUMAN	growth arrest-specific 6	208	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				activation of protein kinase B activity (GO:0032148)|apoptotic cell clearance (GO:0043277)|B cell chemotaxis (GO:0035754)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-substrate adhesion (GO:0031589)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to interferon-alpha (GO:0035457)|cellular response to starvation (GO:0009267)|cellular response to vitamin K (GO:0071307)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|extracellular matrix assembly (GO:0085029)|fusion of virus membrane with host plasma membrane (GO:0019064)|hematopoietic stem cell migration to bone marrow (GO:0097241)|leukocyte migration (GO:0050900)|macrophage cytokine production (GO:0010934)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-6 secretion (GO:1900165)|negative regulation of oligodendrocyte apoptotic process (GO:1900142)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of renal albumin absorption (GO:2000533)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|peptidyl-serine phosphorylation (GO:0018105)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phagocytosis (GO:0050766)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of TOR signaling (GO:0032008)|post-translational protein modification (GO:0043687)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|protein targeting to plasma membrane (GO:0072661)|proteolysis (GO:0006508)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|viral entry into host cell (GO:0046718)|viral genome replication (GO:0019079)	cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|platelet alpha granule lumen (GO:0031093)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|phosphatidylserine binding (GO:0001786)|protein tyrosine kinase activator activity (GO:0030296)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(4)|ovary(1)	5	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0176)|all_epithelial(44;0.0104)|all_lung(25;0.0249)|Lung NSC(25;0.0908)|Breast(118;0.188)				GCGCGCCTCCCCGCAGGCCTC	0.652																																					p.G208V													.	.			0			c.G623T												61.0	64.0	63.0					13																	114538575		2199	4292	6491	SO:0001583	missense	2621	exon7			GCCTCCCCGCAGG		CCDS45072.1	13q34	2008-07-18			ENSG00000183087	ENSG00000183087			4168	protein-coding gene	gene with protein product	"""AXL stimulatory factor"""	600441		AXLLG		8336730	Standard	NM_000820		Approved	AXSF, FLJ34709, DKFZp666G247	uc001vud.3	Q14393	OTTHUMG00000017395	ENST00000327773.6:c.623G>T	13.37:g.114538575C>A	ENSP00000331831:p.Gly208Val		Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_000820	115	0.00	0	B3KRQ7|B3KVL4|E9PBL7|Q6IMN1|Q7Z7N3	Missense_Mutation	SNP	ENST00000327773.6	37	CCDS45072.1	.	.	.	.	.	.	.	.	.	.	C	13.72	2.319990	0.41096	.	.	ENSG00000183087	ENST00000357389;ENST00000355761;ENST00000327773	D;D;D	0.91945	-2.94;-2.94;-2.94	4.71	4.71	0.59529	.	.	.	.	.	D	0.93275	0.7857	L	0.39085	1.19	0.43226	D	0.995111	D	0.76494	0.999	D	0.74023	0.982	D	0.93540	0.6877	9	0.52906	T	0.07	-24.1058	14.3777	0.66889	0.0:1.0:0.0:0.0	.	208	Q14393-2	.	V	208;154;208	ENSP00000349962:G208V;ENSP00000348003:G154V;ENSP00000331831:G208V	ENSP00000331831:G208V	G	-	2	0	GAS6	113575368	0.994000	0.37717	0.881000	0.34555	0.230000	0.25150	2.240000	0.43088	2.151000	0.67156	0.430000	0.28490	GGG			0.652	GAS6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000045946.2		NM_000820	
RP11-597A11.1	0	bcgsc.ca	37	14	20137652	20137652	+	RNA	SNP	G	G	A			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr14:20137652G>A	ENST00000548261.1	+	0	391																											ACAGAATTACGGCAGTGGCAT	0.627																																					.													.	.			0			.																																											0	.			AATTACGGCAGTG																													14.37:g.20137652G>A			Somatic	22	0	0		WXS	Illumina HiSeq	Phase_1	12	0.33	4	.	2	0.00	0		RNA	SNP	ENST00000548261.1	37																																																																																						0.627	RP11-597A11.1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000409571.1			
SALL2	6297	mdanderson.org	37	14	21992828	21992828	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr14:21992828G>T	ENST00000327430.3	-	2	1328	c.1034C>A	c.(1033-1035)cCa>cAa	p.P345Q	SALL2_ENST00000538754.1_Intron|AE000658.22_ENST00000535893.1_RNA|SALL2_ENST00000317492.5_Intron|SALL2_ENST00000450879.2_Missense_Mutation_p.P208Q	NM_005407.1	NP_005398.1	Q9Y467	SALL2_HUMAN	spalt-like transcription factor 2	345					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(6)|urinary_tract(2)	43	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		CAGGAGCCCTGGGGAGGCAGT	0.597																																					p.P345Q													SALL2,NS,carcinoma,0,1	SALL2	0	1	0			c.C1034A												36.0	37.0	37.0					14																	21992828		2203	4300	6503	SO:0001583	missense	6297	exon2			AGCCCTGGGGAGG	AB002358	CCDS32045.1	14q11.1-q12.1	2013-10-17	2013-10-17		ENSG00000165821	ENSG00000165821		"""Zinc fingers, C2H2-type"""	10526	protein-coding gene	gene with protein product		602219	"""sal (Drosophila)-like 2"", ""sal-like 2 (Drosophila)"""			8975705	Standard	XM_005267983		Approved	KIAA0360, Hsal2, ZNF795	uc001wbe.3	Q9Y467	OTTHUMG00000168826	ENST00000327430.3:c.1034C>A	14.37:g.21992828G>T	ENSP00000333537:p.Pro345Gln		Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_005407	32	0.00	0	B2RMX6|B9EGK8|Q8N656|Q9Y4G1	Missense_Mutation	SNP	ENST00000327430.3	37	CCDS32045.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.87|12.87	2.067423|2.067423	0.36470|0.36470	.|.	.|.	ENSG00000165821|ENSG00000165821	ENST00000327430;ENST00000450879;ENST00000541876|ENST00000546363	T;T|.	0.05717|.	3.45;3.4|.	4.3|4.3	3.42|3.42	0.39159|0.39159	.|.	0.000000|.	0.37623|.	N|.	0.002017|.	T|T	0.28433|0.28433	0.0703|0.0703	N|N	0.08118|0.08118	0|0	0.34558|0.34558	D|D	0.712014|0.712014	D;D;D;D|.	0.89917|.	0.998;0.998;0.971;1.0|.	D;D;P;D|.	0.83275|.	0.991;0.991;0.543;0.996|.	T|T	0.35400|0.35400	-0.9790|-0.9790	10|5	0.07644|.	T|.	0.81|.	-21.1375|-21.1375	9.89|9.89	0.41285|0.41285	0.1005:0.0:0.8995:0.0|0.1005:0.0:0.8995:0.0	.|.	208;208;343;345|.	B4DK65;E7EW59;B4DFD9;Q9Y467|.	.;.;.;SALL2_HUMAN|.	Q|K	345;208;345|204	ENSP00000333537:P345Q;ENSP00000396773:P208Q|.	ENSP00000333537:P345Q|.	P|Q	-|-	2|1	0|0	SALL2|SALL2	21062668|21062668	0.992000|0.992000	0.36948|0.36948	0.994000|0.994000	0.49952|0.49952	0.979000|0.979000	0.70002|0.70002	2.285000|2.285000	0.43487|0.43487	1.031000|1.031000	0.39867|0.39867	-0.136000|-0.136000	0.14681|0.14681	CCA|CAG			0.597	SALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401242.1		NM_005407	
PLEKHH1	57475	mdanderson.org	37	14	68035891	68035891	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr14:68035891C>T	ENST00000329153.5	+	8	1432	c.1300C>T	c.(1300-1302)Cgg>Tgg	p.R434W		NM_020715.2	NP_065766.1	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1	434						cytoskeleton (GO:0005856)				endometrium(2)|kidney(4)|lung(12)|urinary_tract(1)	19				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		ATCGGGCATGCGGCTCTCAGA	0.592																																					p.R434W													.	.			0			c.C1300T												76.0	79.0	78.0					14																	68035891		1950	4151	6101	SO:0001583	missense	57475	exon8			GGCATGCGGCTCT	AB033026	CCDS45128.1	14q24.1	2013-01-10				ENSG00000054690		"""Pleckstrin homology (PH) domain containing"""	17733	protein-coding gene	gene with protein product						10574462	Standard	NM_020715		Approved	KIAA1200	uc001xjl.1	Q9ULM0		ENST00000329153.5:c.1300C>T	14.37:g.68035891C>T	ENSP00000330278:p.Arg434Trp		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_020715	7	0.00	0	A6H8X6|Q6PJL4|Q6ZWC7	Missense_Mutation	SNP	ENST00000329153.5	37	CCDS45128.1	.	.	.	.	.	.	.	.	.	.	C	16.08	3.021824	0.54576	.	.	ENSG00000054690	ENST00000329153	T	0.22743	1.94	4.45	3.56	0.40772	.	0.357198	0.27901	N	0.017398	T	0.31918	0.0812	M	0.67397	2.05	0.80722	D	1	D	0.65815	0.995	P	0.51701	0.677	T	0.09509	-1.0671	10	0.72032	D	0.01	.	10.3032	0.43665	0.4495:0.5504:0.0:0.0	.	434	Q9ULM0	PKHH1_HUMAN	W	434	ENSP00000330278:R434W	ENSP00000330278:R434W	R	+	1	2	PLEKHH1	67105644	1.000000	0.71417	0.996000	0.52242	0.636000	0.38137	1.006000	0.29847	1.051000	0.40369	0.561000	0.74099	CGG			0.592	PLEKHH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000412730.3		XM_031054	
RPAP1	26015	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	41819688	41819688	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr15:41819688G>A	ENST00000304330.4	-	12	1660	c.1544C>T	c.(1543-1545)gCa>gTa	p.A515V	RPAP1_ENST00000568413.1_5'Flank|RPAP1_ENST00000561603.1_Missense_Mutation_p.A515V	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	515						nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		TTTCCTTTTTGCTTTTCCTGC	0.537																																					p.A515V													.	.			0			c.C1544T												94.0	94.0	94.0					15																	41819688		2203	4300	6503	SO:0001583	missense	26015	exon12			CTTTTTGCTTTTC	BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.1544C>T	15.37:g.41819688G>A	ENSP00000306123:p.Ala515Val		Somatic	105	0	0		WXS	Illumina HiSeq	.	88	0.09	8	NM_015540	28	0.07	2	Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Missense_Mutation	SNP	ENST00000304330.4	37	CCDS10079.1	.	.	.	.	.	.	.	.	.	.	G	8.677	0.904213	0.17760	.	.	ENSG00000103932	ENST00000304330	T	0.12774	2.65	5.61	4.69	0.59074	.	0.444896	0.25222	N	0.032227	T	0.09730	0.0239	N	0.22421	0.69	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.19582	-1.0301	10	0.87932	D	0	-6.6459	8.6624	0.34101	0.078:0.0:0.7712:0.1508	.	515	Q9BWH6	RPAP1_HUMAN	V	515	ENSP00000306123:A515V	ENSP00000306123:A515V	A	-	2	0	RPAP1	39606980	0.380000	0.25131	0.022000	0.16811	0.054000	0.15201	2.855000	0.48333	1.484000	0.48361	0.655000	0.94253	GCA			0.537	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252694.2		NM_015540	
SLTM	79811	broad.mit.edu	37	15	59175946	59175946	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr15:59175946G>A	ENST00000380516.2	-	20	2962	c.2875C>T	c.(2875-2877)Cgg>Tgg	p.R959W	SLTM_ENST00000536328.1_Missense_Mutation_p.R528W	NM_001013843.1|NM_024755.2	NP_001013865.1|NP_079031.2	Q9NWH9	SLTM_HUMAN	SAFB-like, transcription modulator	959					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						CTTGTGTCCCGTCCATGGCGT	0.547																																					p.R959W													SLTM,colon,carcinoma,+1,1	SLTM	90	1	0			c.C2875T												160.0	132.0	141.0					15																	59175946		2192	4292	6484	SO:0001583	missense	79811	exon20			TGTCCCGTCCATG	BC046119	CCDS10168.2	15q21.3	2013-02-12			ENSG00000137776	ENSG00000137776		"""RNA binding motif (RRM) containing"""	20709	protein-coding gene	gene with protein product							Standard	XR_243128		Approved	Met, FLJ13213	uc002afp.3	Q9NWH9	OTTHUMG00000074033	ENST00000380516.2:c.2875C>T	15.37:g.59175946G>A	ENSP00000369887:p.Arg959Trp		Somatic	189	0	0		WXS	Illumina HiSeq	Phase_I	140	0.04	5	NM_024755	122	0.07	9	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000380516.2	37	CCDS10168.2	.	.	.	.	.	.	.	.	.	.	G	24.1	4.488240	0.84854	.	.	ENSG00000137776	ENST00000380516;ENST00000432750;ENST00000536328	T	0.17370	2.28	5.89	5.89	0.94794	.	0.000000	0.52532	D	0.000063	T	0.38108	0.1028	L	0.55481	1.735	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.03103	-1.1072	10	0.87932	D	0	.	15.022	0.71637	0.0:0.0:0.8578:0.1422	.	959;528	Q9NWH9;A8K5V8	SLTM_HUMAN;.	W	959;525;528	ENSP00000369887:R959W	ENSP00000369887:R959W	R	-	1	2	SLTM	56963238	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.809000	0.47971	2.788000	0.95919	0.557000	0.71058	CGG			0.547	SLTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000157124.1	rescued with RNA-seq	NM_024755	
PIF1	80119	mdanderson.org	37	15	65116191	65116191	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr15:65116191C>T	ENST00000268043.4	-	2	438	c.344G>A	c.(343-345)cGc>cAc	p.R115H	PIF1_ENST00000333425.6_Missense_Mutation_p.R115H|PIF1_ENST00000559239.1_Missense_Mutation_p.R115H					PIF1 5'-to-3' DNA helicase											kidney(1)|lung(1)	2						GCGCAGGAAGCGGCGCAGGCG	0.791																																					p.R115H													.	.			0			c.G344A																																									SO:0001583	missense	80119	exon2			AGGAAGCGGCGCA	AK026345	CCDS10195.2, CCDS66797.1	15q22.1	2013-05-13	2013-05-13	2006-11-24	ENSG00000140451	ENSG00000140451	3.6.4.12		26220	protein-coding gene	gene with protein product		610953	"""chromosome 15 open reading frame 20"", ""PIF1 5'-to-3' DNA helicase homolog (S. cerevisiae)"""	C15orf20		10926538, 16522649	Standard	NM_025049		Approved	FLJ22692	uc002ant.2	Q9H611	OTTHUMG00000132974	ENST00000268043.4:c.344G>A	15.37:g.65116191C>T	ENSP00000268043:p.Arg115His		Somatic	18	0	0		WXS	Illumina HiSeq	Phase_I	9	0.22	2	NM_025049	0		0		Missense_Mutation	SNP	ENST00000268043.4	37	CCDS10195.2	.	.	.	.	.	.	.	.	.	.	C	12.19	1.862634	0.32884	.	.	ENSG00000140451	ENST00000268043;ENST00000333425	T;T	0.77098	-0.04;-1.07	4.58	4.58	0.56647	.	0.183969	0.49305	D	0.000142	T	0.81437	0.4822	L	0.53249	1.67	0.43304	D	0.995302	D;B	0.89917	1.0;0.051	D;B	0.87578	0.998;0.008	T	0.76677	-0.2871	10	0.12103	T	0.63	-19.0255	8.9953	0.36048	0.0:0.8975:0.0:0.1025	.	115;115	Q9H611-2;Q9H611	.;PIF1_HUMAN	H	115	ENSP00000268043:R115H;ENSP00000328174:R115H	ENSP00000268043:R115H	R	-	2	0	PIF1	62903244	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	1.770000	0.38532	2.247000	0.74100	0.313000	0.20887	CGC			0.791	PIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256533.1		NM_025049	
DENND4A	10260	mdanderson.org	37	15	65962392	65962392	+	Silent	SNP	G	G	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr15:65962392G>T	ENST00000431932.2	-	25	4675	c.4467C>A	c.(4465-4467)ccC>ccA	p.P1489P	DENND4A_ENST00000443035.3_Silent_p.P1532P	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	1489					positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						TATTCAGAAAGGGTAAGAAGA	0.363																																					p.P1532P													.	.			0			c.C4596A												64.0	63.0	63.0					15																	65962392		1838	4095	5933	SO:0001819	synonymous_variant	10260	exon26			CAGAAAGGGTAAG	AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.4467C>A	15.37:g.65962392G>T			Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_001144823	9	0.00	0	E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Silent	SNP	ENST00000431932.2	37	CCDS45285.1																																																																																					0.363	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000419611.1		NM_005848	
LOC645752	645752	broad.mit.edu	37	15	78212706	78212711	+	lincRNA	DEL	AGGGCT	AGGGCT	-			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	AGGGCT	AGGGCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr15:78212706_78212711delAGGGCT	ENST00000565869.1	+	0	111				RP11-114H24.2_ENST00000567226.1_RNA																							gccccttaaaagggctagggctaggc	0.51																																					.													.	.			0			.																																											0	.			CTTAAAAGGGCTA																													15.37:g.78212712_78212717delAGGGCT			Somatic	7	0.1428571429	1		WXS	Illumina HiSeq	Phase_I	8	0.50	4	.	0		0		RNA	DEL	ENST00000565869.1	37																																																																																						0.510	RP11-114H24.7-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000421587.1			
PDXDC1	23042	hgsc.bcm.edu	37	16	15122751	15122751	+	Silent	SNP	C	C	T	rs117411702		TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr16:15122751C>T	ENST00000396410.4	+	15	1318	c.1221C>T	c.(1219-1221)gcC>gcT	p.A407A	PDXDC1_ENST00000450288.2_Silent_p.A379A|PDXDC1_ENST00000447912.2_Silent_p.A316A|PDXDC1_ENST00000569715.1_Silent_p.A380A|PDXDC1_ENST00000455313.2_Silent_p.A384A|PDXDC1_ENST00000563679.1_Silent_p.A425A|PDXDC1_ENST00000325823.7_Silent_p.A392A|PDXDC1_ENST00000535621.2_Silent_p.A407A	NM_015027.2	NP_055842.2	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1	407					carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)	p.A407A(2)		central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TGTTTAAAGCCGTCCCAGTGC	0.552																																					p.A407A													PDXDC1,NS,carcinoma,0,3	PDXDC1	0	3	2	Substitution - coding silent(2)	prostate(1)|skin(1)	c.C1221T												95.0	85.0	88.0					16																	15122751		2197	4300	6497	SO:0001819	synonymous_variant	23042	exon15			TAAAGCCGTCCCA	AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000396410.4:c.1221C>T	16.37:g.15122751C>T			Somatic	70	0.0142857143	1		WXS	Illumina HiSeq	.	98	0.10	10	NM_015027	332	0.08	28	B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	Silent	SNP	ENST00000396410.4	37	CCDS32393.1																																																																																			0.002		0.552	PDXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000389065.2		NM_015027	
ZDHHC1	29800	mdanderson.org	37	16	67428728	67428728	+	Silent	SNP	C	C	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr16:67428728C>T	ENST00000348579.2	-	11	1640	c.1299G>A	c.(1297-1299)ccG>ccA	p.P433P	TPPP3_ENST00000564104.1_5'Flank|TPPP3_ENST00000393957.2_5'Flank|TPPP3_ENST00000290942.5_5'Flank|TPPP3_ENST00000562206.1_5'Flank|ZDHHC1_ENST00000566075.1_5'UTR	NM_013304.2	NP_037436.1	Q8WTX9	ZDHC1_HUMAN	zinc finger, DHHC-type containing 1	433					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|urinary_tract(1)	10		Ovarian(137;0.223)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0178)|all cancers(182;5.71e-53)|Epithelial(162;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(108;1.53e-29)|Kidney(780;4.37e-05)|BRCA - Breast invasive adenocarcinoma(181;5.8e-05)|GBM - Glioblastoma multiforme(240;0.0022)		GCAGGGCCAGCGGCGTGCACA	0.741																																					p.P433P													.	.			0			c.G1299A												2.0	3.0	3.0					16																	67428728		1710	3505	5215	SO:0001819	synonymous_variant	29800	exon11			GGCCAGCGGCGTG	U90653	CCDS10836.1	16q22.1	2010-03-25	2003-01-27		ENSG00000159714	ENSG00000159714		"""Zinc fingers, DHHC-type"""	17916	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 1"""	C16orf1		10395086	Standard	NM_013304		Approved	HSU90653, ZNF377	uc010vjm.2	Q8WTX9	OTTHUMG00000137522	ENST00000348579.2:c.1299G>A	16.37:g.67428728C>T			Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	14	0.21	3	NM_013304	5	0.00	0	O15461	Silent	SNP	ENST00000348579.2	37	CCDS10836.1																																																																																					0.741	ZDHHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268845.1		NM_013304	
ALOX12	239	mdanderson.org	37	17	6900302	6900302	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr17:6900302G>A	ENST00000251535.6	+	2	346	c.293G>A	c.(292-294)cGc>cAc	p.R98H	RP11-589P10.7_ENST00000572547.1_RNA|AC027763.2_ENST00000399541.2_Intron|RP11-589P10.5_ENST00000573222.1_lincRNA	NM_000697.2	NP_000688.2	P18054	LOX12_HUMAN	arachidonate 12-lipoxygenase	98	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				aging (GO:0007568)|arachidonic acid metabolic process (GO:0019369)|cellular component movement (GO:0006928)|cellular response to lipid (GO:0071396)|establishment of skin barrier (GO:0061436)|fatty acid oxidation (GO:0019395)|hepoxilin biosynthetic process (GO:0051122)|hepoxilin metabolic process (GO:0051121)|leukotriene A4 metabolic process (GO:1901751)|linoleic acid metabolic process (GO:0043651)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxin B4 biosynthetic process (GO:2001306)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of gene expression (GO:0010628)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|superoxide anion generation (GO:0042554)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|sarcolemma (GO:0042383)	arachidonate 12-lipoxygenase activity (GO:0004052)|hepoxilin A3 synthase activity (GO:0051120)|hepoxilin-epoxide hydrolase activity (GO:0047977)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)|urinary_tract(1)	19						CCGTGCTACCGCTGGGTGCAG	0.706																																					p.R98H													.	.			0			c.G293A												22.0	17.0	19.0					17																	6900302		2194	4293	6487	SO:0001583	missense	239	exon2			GCTACCGCTGGGT	M35418	CCDS11084.1	17p13.1	2010-01-14			ENSG00000108839	ENSG00000108839	1.13.11.31	"""Arachidonate lipoxygenases"""	429	protein-coding gene	gene with protein product	"""platelet 12-LOX"""	152391				1570320	Standard	NM_000697		Approved	12S-LOX	uc002gdx.4	P18054	OTTHUMG00000102088	ENST00000251535.6:c.293G>A	17.37:g.6900302G>A	ENSP00000251535:p.Arg98His		Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_000697	8	0.00	0	O95569|Q6ISF8|Q9UQM4	Missense_Mutation	SNP	ENST00000251535.6	37	CCDS11084.1	.	.	.	.	.	.	.	.	.	.	G	15.92	2.975124	0.53720	.	.	ENSG00000108839	ENST00000251535	T	0.67345	-0.26	4.46	1.39	0.22231	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.387817	0.23440	N	0.048152	T	0.62245	0.2412	M	0.79011	2.435	0.31160	N	0.704431	B	0.27068	0.167	B	0.28709	0.093	T	0.64132	-0.6479	10	0.62326	D	0.03	-0.3085	5.9052	0.18992	0.3277:0.0:0.6723:0.0	.	98	P18054	LOX12_HUMAN	H	98	ENSP00000251535:R98H	ENSP00000251535:R98H	R	+	2	0	ALOX12	6841026	0.987000	0.35691	0.988000	0.46212	0.797000	0.45037	1.163000	0.31798	0.625000	0.30304	0.467000	0.42956	CGC			0.706	ALOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000219922.2			
NLGN2	57555	broad.mit.edu;mdanderson.org	37	17	7311754	7311754	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr17:7311754C>G	ENST00000302926.2	+	1	253	c.180C>G	c.(178-180)aaC>aaG	p.N60K	NLGN2_ENST00000575301.1_Missense_Mutation_p.N60K|NLGN2_ENST00000572893.1_Intron	NM_020795.2	NP_065846.1	Q8NFZ4	NLGN2_HUMAN	neuroligin 2	60					cell-cell junction maintenance (GO:0045217)|gephyrin clustering (GO:0097116)|locomotory exploration behavior (GO:0035641)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|sensory perception of pain (GO:0019233)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|prostate(2)|skin(3)	22		Prostate(122;0.157)				AGCTCAACAACGAGATCCTGG	0.761																																					p.N60K													.	NLGN2	61		0			c.C180G												8.0	8.0	8.0					17																	7311754		2024	4023	6047	SO:0001583	missense	57555	exon1			CAACAACGAGATC	AB037787	CCDS11103.1	17p13.2	2008-07-18			ENSG00000169992	ENSG00000169992			14290	protein-coding gene	gene with protein product		606479				10767552, 10819331	Standard	NM_020795		Approved	KIAA1366	uc002ggt.1	Q8NFZ4	OTTHUMG00000108138	ENST00000302926.2:c.180C>G	17.37:g.7311754C>G	ENSP00000305288:p.Asn60Lys		Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_020795	4	0.00	0	Q9P2I1	Missense_Mutation	SNP	ENST00000302926.2	37	CCDS11103.1	.	.	.	.	.	.	.	.	.	.	c	16.57	3.158871	0.57368	.	.	ENSG00000169992	ENST00000302926	T	0.66638	-0.22	3.34	3.34	0.38264	Carboxylesterase, type B (1);	0.000000	0.85682	D	0.000000	T	0.57814	0.2079	L	0.37507	1.11	0.46499	D	0.999073	P	0.36909	0.573	B	0.40101	0.319	T	0.58934	-0.7548	10	0.34782	T	0.22	.	13.0103	0.58727	0.0:1.0:0.0:0.0	.	60	Q8NFZ4	NLGN2_HUMAN	K	60	ENSP00000305288:N60K	ENSP00000305288:N60K	N	+	3	2	NLGN2	7252478	0.999000	0.42202	1.000000	0.80357	0.995000	0.86356	0.592000	0.23984	2.198000	0.70561	0.436000	0.28706	AAC			0.761	NLGN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000226941.2		NM_020795	
SENP3	26168	broad.mit.edu	37	17	7466636	7466636	+	Silent	SNP	G	G	A			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr17:7466636G>A	ENST00000429205.2	+	2	292	c.243G>A	c.(241-243)gaG>gaA	p.E81E	SENP3_ENST00000321337.7_Silent_p.E81E|SENP3-EIF4A1_ENST00000579777.1_RNA|SENP3_ENST00000578868.1_3'UTR			Q9H4L4	SENP3_HUMAN	SUMO1/sentrin/SMT3 specific peptidase 3	81	Glu-rich.					cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)	cysteine-type peptidase activity (GO:0008234)			central_nervous_system(1)|ovary(1)	2		Prostate(122;0.157)				aggaagaagaggaggaggagg	0.622																																					p.E81E													.	SENP3	18		0			c.G243A																																									SO:0001819	synonymous_variant	26168	exon2			AGAAGAGGAGGAG	AK000923	CCDS73958.1	17p13	2012-05-02	2005-08-17			ENSG00000161956			17862	protein-coding gene	gene with protein product		612844	"""SUMO1/sentrin/SMT3 specific protease 3"""			10806345, 11230166	Standard	NM_015670		Approved	DKFZP586K0919, SSP3, DKFZp762A152, SMT3IP1, Ulp1	uc002ghm.3	Q9H4L4		ENST00000429205.2:c.243G>A	17.37:g.7466636G>A			Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	91	0.04	4	NM_015670	76	0.00	0	Q66K15|Q86VS7|Q96PS4|Q9Y3W9	Silent	SNP	ENST00000429205.2	37																																																																																						0.622	SENP3-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				NM_015670	
KSR1	8844	mdanderson.org	37	17	25904572	25904572	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr17:25904572G>T	ENST00000319524.6	+	3	427	c.427G>T	c.(427-429)Gtg>Ttg	p.V143L	KSR1_ENST00000398988.3_Missense_Mutation_p.V6L|KSR1_ENST00000268763.6_Missense_Mutation_p.V6L|KSR1_ENST00000509603.2_Missense_Mutation_p.V143L			Q8IVT5	KSR1_HUMAN	kinase suppressor of ras 1	143					Ras protein signal transduction (GO:0007265)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	28	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		TGAGGCCAAGGTGAAGGAGAC	0.652																																					p.V6L	Esophageal Squamous(88;1120 1336 6324 10502 16832)												.	.			0			c.G16T												32.0	42.0	39.0					17																	25904572		2140	4231	6371	SO:0001583	missense	8844	exon4			GCCAAGGTGAAGG	U43586	CCDS58532.1	17q11.2	2012-05-23	2005-12-14	2005-12-14	ENSG00000141068	ENSG00000141068			6465	protein-coding gene	gene with protein product		601132	"""kinase suppressor of ras"""	KSR		8521512	Standard	XM_006722151		Approved	RSU2	uc031qzj.1	Q8IVT5	OTTHUMG00000132051	ENST00000319524.6:c.427G>T	17.37:g.25904572G>T	ENSP00000323178:p.Val143Leu		Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_014238	15	0.00	0	F8WEA9|H7BYU0|Q13476	Missense_Mutation	SNP	ENST00000319524.6	37		.	.	.	.	.	.	.	.	.	.	G	18.12	3.553411	0.65425	.	.	ENSG00000141068	ENST00000319524;ENST00000509603;ENST00000268763;ENST00000398982;ENST00000398985	T;T;T	0.00463	7.25;7.25;7.25	4.71	3.66	0.41972	.	0.194738	0.43747	D	0.000528	T	0.00468	0.0015	N	0.24115	0.695	0.38709	D	0.953187	B;D	0.52996	0.004;0.957	B;P	0.50490	0.013;0.642	D	0.91698	0.5371	10	0.34782	T	0.22	.	13.6963	0.62582	0.0:0.1553:0.8447:0.0	.	141;24	Q8IVT5;Q6ZNT2	KSR1_HUMAN;.	L	143;143;6;6;24	ENSP00000323178:V143L;ENSP00000438795:V143L;ENSP00000268763:V6L	ENSP00000268763:V6L	V	+	1	0	KSR1	22928699	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.892000	0.63193	2.316000	0.78162	0.591000	0.81541	GTG			0.652	KSR1-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				NM_014238	
NOS2	4843	mdanderson.org	37	17	26089845	26089845	+	Missense_Mutation	SNP	C	C	T	rs373770638		TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr17:26089845C>T	ENST00000313735.6	-	22	3012	c.2779G>A	c.(2779-2781)Gtg>Atg	p.V927M		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	927	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	TAGGTGACCACGGCCACAGTC	0.592													.|||	1	0.000199681	0.0008	0.0	5008	,	,		18130	0.0		0.0	False		,,,				2504	0.0				p.V927M													.	.			0			c.G2779A							C	MET/VAL	2,4326		0,2,2162	16.0	14.0	14.0		2779	4.9	1.0	17		14	0,8540		0,0,4270	no	missense	NOS2	NM_000625.4	21	0,2,6432	TT,TC,CC		0.0,0.0462,0.0155	probably-damaging	927/1154	26089845	2,12866	2164	4270	6434	SO:0001583	missense	4843	exon22			TGACCACGGCCAC	U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.2779G>A	17.37:g.26089845C>T	ENSP00000327251:p.Val927Met		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_000625	8	0.00	0	A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Missense_Mutation	SNP	ENST00000313735.6	37	CCDS11223.1	.	.	.	.	.	.	.	.	.	.	C	18.22	3.576725	0.65878	4.62E-4	0.0	ENSG00000007171	ENST00000313735;ENST00000379105	T	0.77620	-1.11	4.9	4.9	0.64082	Riboflavin synthase-like beta-barrel (1);FAD-binding, type 1 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.147815	0.44097	D	0.000499	D	0.90758	0.7099	M	0.93720	3.45	0.58432	D	0.999999	D	0.65815	0.995	D	0.68621	0.959	D	0.93241	0.6626	10	0.72032	D	0.01	.	17.1214	0.86702	0.0:1.0:0.0:0.0	.	927	P35228	NOS2_HUMAN	M	927;888	ENSP00000327251:V927M	ENSP00000327251:V927M	V	-	1	0	NOS2	23113972	1.000000	0.71417	0.996000	0.52242	0.239000	0.25481	4.837000	0.62796	2.289000	0.77006	0.456000	0.33151	GTG			0.592	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255597.1		NM_000625	
GRB7	2886	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	37901196	37901196	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr17:37901196C>T	ENST00000309156.4	+	9	1227	c.970C>T	c.(970-972)Cag>Tag	p.Q324*	GRB7_ENST00000445327.2_Nonsense_Mutation_p.Q347*|GRB7_ENST00000394209.2_Nonsense_Mutation_p.Q324*|GRB7_ENST00000394204.1_Nonsense_Mutation_p.Q324*|GRB7_ENST00000394211.3_Nonsense_Mutation_p.Q324*|GRB7_ENST00000309185.3_Nonsense_Mutation_p.Q324*	NM_005310.3	NP_005301.2	Q14451	GRB7_HUMAN	growth factor receptor-bound protein 7	324	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|leukocyte migration (GO:0050900)|negative regulation of translation (GO:0017148)|positive regulation of cell migration (GO:0030335)|positive regulation of signal transduction (GO:0009967)|stress granule assembly (GO:0034063)	cell projection (GO:0042995)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;6.86e-60)|all cancers(3;1.65e-53)|BRCA - Breast invasive adenocarcinoma(8;2.03e-43)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			TGAAGATGAGCAGAGCCGCAC	0.602																																					p.Q347X													.	.			0			c.C1039T												44.0	47.0	46.0					17																	37901196		2202	4300	6502	SO:0001587	stop_gained	2886	exon9			GATGAGCAGAGCC	D43772	CCDS11345.1, CCDS56028.1	17q12	2013-02-14			ENSG00000141738	ENSG00000141738		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4567	protein-coding gene	gene with protein product		601522					Standard	NM_005310		Approved		uc021twu.1	Q14451	OTTHUMG00000133253	ENST00000309156.4:c.970C>T	17.37:g.37901196C>T	ENSP00000310771:p.Gln324*		Somatic	126	0	0		WXS	Illumina HiSeq	.	136	0.24	32	NM_001242442	62	0.11	7	B2RAV1|B3KNL0|B3KWP9|B7WP75|J3KQM4|Q53YD3|Q92568|Q96DF9|Q9Y220	Nonsense_Mutation	SNP	ENST00000309156.4	37	CCDS11345.1	.	.	.	.	.	.	.	.	.	.	C	36	5.733564	0.96865	.	.	ENSG00000141738	ENST00000309185;ENST00000309156;ENST00000394211;ENST00000394209;ENST00000445327;ENST00000394204	.	.	.	5.02	4.02	0.46733	.	0.161948	0.56097	D	0.000028	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-10.0316	14.9611	0.71158	0.0:0.8562:0.1438:0.0	.	.	.	.	X	324;324;324;324;347;324	.	ENSP00000310771:Q324X	Q	+	1	0	GRB7	35154722	1.000000	0.71417	1.000000	0.80357	0.638000	0.38207	3.769000	0.55303	1.266000	0.44231	0.561000	0.74099	CAG			0.602	GRB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257024.2		NM_005310	
HEXIM2	124790	broad.mit.edu	37	17	43246910	43246910	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr17:43246910C>G	ENST00000307275.3	+	4	1031	c.595C>G	c.(595-597)Cgc>Ggc	p.R199G	HEXIM2_ENST00000592695.1_Missense_Mutation_p.R199G|HEXIM2_ENST00000591576.1_Missense_Mutation_p.R199G|RP13-890H12.2_ENST00000589796.1_RNA|RP13-890H12.2_ENST00000589451.1_RNA	NM_144608.1	NP_653209.1	Q96MH2	HEXI2_HUMAN	hexamethylene bis-acetamide inducible 2	199					negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|snRNA binding (GO:0017069)			endometrium(1)|large_intestine(3)|lung(1)	5						GACTTACGAACGCTTCCACAC	0.652																																					p.R199G													.	HEXIM2	19		0			c.C595G												21.0	16.0	18.0					17																	43246910		2191	4288	6479	SO:0001583	missense	124790	exon4			TACGAACGCTTCC	AK056946	CCDS11496.1	17q21.31	2011-07-29	2011-07-29			ENSG00000168517			28591	protein-coding gene	gene with protein product		615695				12832472	Standard	NM_144608		Approved	FLJ32384	uc002iih.1	Q96MH2		ENST00000307275.3:c.595C>G	17.37:g.43246910C>G	ENSP00000302276:p.Arg199Gly		Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_144608	38	0.05	2	D3DX66	Missense_Mutation	SNP	ENST00000307275.3	37	CCDS11496.1	.	.	.	.	.	.	.	.	.	.	C	12.23	1.875122	0.33162	.	.	ENSG00000168517	ENST00000307275	.	.	.	4.64	3.64	0.41730	.	0.212991	0.44483	N	0.000446	T	0.60157	0.2247	M	0.75777	2.31	0.38185	D	0.939727	B	0.18013	0.025	B	0.20384	0.029	T	0.64622	-0.6364	9	0.87932	D	0	-16.1517	8.9629	0.35858	0.1683:0.6689:0.1627:0.0	.	199	Q96MH2	HEXI2_HUMAN	G	199	.	ENSP00000302276:R199G	R	+	1	0	HEXIM2	40602693	0.993000	0.37304	0.976000	0.42696	0.070000	0.16714	0.682000	0.25335	1.263000	0.44181	0.561000	0.74099	CGC			0.652	HEXIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450181.1		NM_144608	
OSBPL7	114881	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	45891018	45891018	+	Missense_Mutation	SNP	C	C	G	rs139618928		TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr17:45891018C>G	ENST00000007414.3	-	15	1725	c.1534G>C	c.(1534-1536)Gag>Cag	p.E512Q	OSBPL7_ENST00000392507.3_Missense_Mutation_p.E512Q	NM_145798.2	NP_665741.1	Q9BZF2	OSBL7_HUMAN	oxysterol binding protein-like 7	512					cellular response to cholesterol (GO:0071397)|lipid transport (GO:0006869)|positive regulation of proteasomal protein catabolic process (GO:1901800)	autophagic vacuole (GO:0005776)|cytosol (GO:0005829)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)			autonomic_ganglia(1)|endometrium(6)|kidney(2)|large_intestine(5)|liver(2)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32						TCCAGCTCCTCGCAGAGCCGC	0.627																																					p.E512Q													.	.			0			c.G1534C												47.0	48.0	48.0					17																	45891018		2203	4300	6503	SO:0001583	missense	114881	exon15			GCTCCTCGCAGAG	AF392446	CCDS11515.1	17q21	2013-01-10				ENSG00000006025		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16387	protein-coding gene	gene with protein product		606735				14593528, 11735225	Standard	NM_145798		Approved	ORP7, MGC71150	uc002ilx.1	Q9BZF2		ENST00000007414.3:c.1534G>C	17.37:g.45891018C>G	ENSP00000007414:p.Glu512Gln		Somatic	99	0	0		WXS	Illumina HiSeq	.	91	0.15	14	NM_145798	14	0.29	4	D3DTT6|Q6PIV6	Missense_Mutation	SNP	ENST00000007414.3	37	CCDS11515.1	.	.	.	.	.	.	.	.	.	.	C	33	5.207567	0.95033	.	.	ENSG00000006025	ENST00000007414;ENST00000392507	T;T	0.38077	1.16;1.16	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.69771	0.3148	M	0.92649	3.33	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.78671	-0.2113	10	0.87932	D	0	-29.0593	17.4067	0.87475	0.0:1.0:0.0:0.0	.	512	Q9BZF2	OSBL7_HUMAN	Q	512	ENSP00000007414:E512Q;ENSP00000376295:E512Q	ENSP00000007414:E512Q	E	-	1	0	OSBPL7	43246017	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.619000	0.83057	2.385000	0.81259	0.591000	0.81541	GAG			0.627	OSBPL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000441367.1		NM_017731	
MARCH10	162333	hgsc.bcm.edu	37	17	60879148	60879148	+	Intron	SNP	G	G	C			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr17:60879148G>C	ENST00000311269.5	-	2	258				MARCH10_ENST00000456609.2_Intron|MARCH10_ENST00000544856.2_Intron|MARCH10_ENST00000583600.1_Intron	NM_152598.2	NP_689811.2	Q8NA82	MARHA_HUMAN	membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase						protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|liver(1)|lung(15)	38						TGCTGTGTTAGAGTCCTTTGT	0.398																																					.													.	.			0			.												79.0	62.0	68.0					17																	60879148		1327	2309	3636	SO:0001627	intron_variant	100422923	.			GTGTTAGAGTCCT	AK093076	CCDS11635.1, CCDS74122.1, CCDS74123.1	17q23.3	2013-01-09	2012-02-23	2007-08-20		ENSG00000173838		"""RING-type (C3HC4) zinc fingers"", ""MARCH membrane-associated ring fingers"""	26655	protein-coding gene	gene with protein product		613337	"""ring finger protein 190"", ""membrane-associated ring finger (C3HC4) 10"""	RNF190		17604280	Standard	XM_005257103		Approved	FLJ35757, MARCH-X	uc002jag.4	Q8NA82		ENST00000311269.5:c.17-35C>G	17.37:g.60879148G>C			Somatic	61	0	0		WXS	Illumina HiSeq	.	56	0.29	16	.	0		0	D3DU09|Q8IYS7|Q8N7Z7	RNA	SNP	ENST00000311269.5	37	CCDS11635.1																																																																																					0.398	MARCH10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000445252.1		NM_152598	
CD300A	11314	broad.mit.edu	37	17	72469724	72469724	+	Silent	SNP	A	A	G			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr17:72469724A>G	ENST00000360141.3	+	2	378	c.90A>G	c.(88-90)ggA>ggG	p.G30G	CD300A_ENST00000361933.3_Intron|CD300A_ENST00000310828.5_Intron|CD300A_ENST00000392625.3_Intron|CD300A_ENST00000577511.1_5'UTR	NM_001256841.1|NM_007261.3	NP_001243770.1|NP_009192.2	Q9UGN4	CLM8_HUMAN	CD300a molecule	30	Ig-like V-type.				cell adhesion (GO:0007155)|immune system process (GO:0002376)|negative regulation of activation of JAK2 kinase activity (GO:1902569)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of eosinophil activation (GO:1902567)|negative regulation of eosinophil migration (GO:2000417)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mast cell activation involved in immune response (GO:0033007)|negative regulation of mast cell degranulation (GO:0043305)|negative regulation of neutrophil activation (GO:1902564)|negative regulation of NK T cell activation (GO:0051134)|negative regulation of phagocytosis, engulfment (GO:0060101)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|regulation of T cell receptor signaling pathway (GO:0050856)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidylethanolamine binding (GO:0008429)|phosphatidylserine binding (GO:0001786)|signaling receptor activity (GO:0038023)			breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|skin(4)|urinary_tract(1)	16						CCGTGGGGGGATCCCTGAGTG	0.542																																					p.G30G													.	CD300A	40		0			c.A90G												73.0	75.0	74.0					17																	72469724		2203	4300	6503	SO:0001819	synonymous_variant	11314	exon2			GGGGGGATCCCTG	BC032352	CCDS32720.1, CCDS58590.1	17q25.2	2013-01-11	2006-03-28		ENSG00000167851	ENSG00000167851		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	19319	protein-coding gene	gene with protein product		606790	"""CD300a antigen"""			9701027, 10746781	Standard	NM_007261		Approved	Irp60, CMRF35H, CMRF-35-H9, IRC1, IRC2, IGSF12	uc002jkv.4	Q9UGN4	OTTHUMG00000067612	ENST00000360141.3:c.90A>G	17.37:g.72469724A>G			Somatic	71	0.2112676056	15		WXS	Illumina HiSeq	Phase_I	62	0.31	19	NM_007261	14	0.21	3	A8MW96|O95100|Q9HD97|Q9P0F3|Q9UBK4|Q9UMS9|Q9UMT0	Silent	SNP	ENST00000360141.3	37	CCDS32720.1																																																																																					0.542	CD300A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000145091.1		NM_007261	
C17orf99	100141515	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	76162016	76162016	+	Silent	SNP	C	C	A			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr17:76162016C>A	ENST00000340363.5	+	5	742	c.687C>A	c.(685-687)ccC>ccA	p.P229P	SYNGR2_ENST00000588282.1_5'Flank|SYNGR2_ENST00000225777.3_5'Flank|SYNGR2_ENST00000589711.1_5'Flank|SYNGR2_ENST00000585591.1_5'Flank|C17orf99_ENST00000451352.3_3'UTR	NM_001163075.1	NP_001156547.1	Q6UX52	CQ099_HUMAN	chromosome 17 open reading frame 99	229						extracellular region (GO:0005576)											TGGAGAGCCCCATCCTTGCCT	0.607																																					p.P229P													.	.			0			c.C687A												35.0	40.0	39.0					17																	76162016		692	1591	2283	SO:0001819	synonymous_variant	100141515	exon5			GAGCCCCATCCTT	AY358510	CCDS54171.1	17q25.3	2012-10-23			ENSG00000187997	ENSG00000187997			34490	protein-coding gene	gene with protein product							Standard	NM_001163075		Approved	GLPG464, UNQ464	uc002jus.4	Q6UX52	OTTHUMG00000153871	ENST00000340363.5:c.687C>A	17.37:g.76162016C>A			Somatic	99	0	0		WXS	Illumina HiSeq	.	111	0.22	24	NM_001163075	5	0.20	1		Silent	SNP	ENST00000340363.5	37	CCDS54171.1																																																																																					0.607	C17orf99-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000332775.1		NM_001163075	
NARF	26502	mdanderson.org	37	17	80436760	80436760	+	Missense_Mutation	SNP	G	G	A	rs557074887		TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr17:80436760G>A	ENST00000309794.11	+	6	803	c.605G>A	c.(604-606)gGc>gAc	p.G202D	NARF_ENST00000581743.1_3'UTR|RP13-991F5.2_ENST00000582249.1_RNA|NARF_ENST00000345415.7_Missense_Mutation_p.G154D|NARF_ENST00000390006.4_Missense_Mutation_p.G143D|NARF_ENST00000457415.3_Missense_Mutation_p.G202D|NARF_ENST00000412079.2_Missense_Mutation_p.G74D	NM_012336.3|NM_031968.2	NP_036468.1|NP_114174.1	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor	202						lamin filament (GO:0005638)|nuclear lamina (GO:0005652)|nuclear lumen (GO:0031981)|nucleus (GO:0005634)	lamin binding (GO:0005521)			endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			CAGGTCATGGGCTCTTTGGTG	0.642																																					p.G202D													.	.			0			c.G605A												44.0	42.0	43.0					17																	80436760		2203	4300	6503	SO:0001583	missense	26502	exon6			TCATGGGCTCTTT	BC000438	CCDS32777.1, CCDS42403.1, CCDS42404.1	17q25.3	2011-12-19			ENSG00000141562	ENSG00000141562			29916	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 2"""	605349				10514485, 15667261	Standard	NM_031968		Approved	FLJ10067, DKFZp434G0420, IOP2	uc002kfg.4	Q9UHQ1		ENST00000309794.11:c.605G>A	17.37:g.80436760G>A	ENSP00000309899:p.Gly202Asp		Somatic	47	0.0212765957	1		WXS	Illumina HiSeq	Phase_I	24	0.13	3	NM_012336	82	0.00	0	A6NCJ3|B3KPX2|K4DI98|Q96AY9|Q9BWC6	Missense_Mutation	SNP	ENST00000309794.11	37	CCDS32777.1	.	.	.	.	.	.	.	.	.	.	G	17.09	3.299708	0.60195	.	.	ENSG00000141562	ENST00000390006;ENST00000374611;ENST00000309794;ENST00000345415;ENST00000412079;ENST00000457415	T;T;T;T;T	0.61392	0.11;0.11;0.11;0.11;0.11	5.57	5.57	0.84162	Iron hydrogenase, large subunit, C-terminal (1);Iron hydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.83880	0.5350	H	0.95645	3.7	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0;0.999	D;D;D;D;D;D	0.91635	0.999;0.998;0.991;0.984;0.998;0.99	D	0.88482	0.3069	10	0.87932	D	0	-24.0534	18.529	0.90984	0.0:0.0:1.0:0.0	.	74;157;202;154;202;202	B4DZZ6;B4DND8;Q9UHQ1-2;Q9UHQ1-3;E9PH27;Q9UHQ1	.;.;.;.;.;NARF_HUMAN	D	143;202;202;154;74;157	ENSP00000374656:G143D;ENSP00000363739:G202D;ENSP00000309899:G202D;ENSP00000283996:G154D;ENSP00000409710:G74D	ENSP00000309899:G202D	G	+	2	0	NARF	78030049	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.195000	0.94971	2.635000	0.89317	0.561000	0.74099	GGC			0.642	NARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000443573.2		NM_031968	
KCTD1	284252	mdanderson.org	37	18	24127920	24127920	+	Intron	SNP	G	G	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr18:24127920G>T	ENST00000408011.3	-	1	545				KCTD1_ENST00000317932.7_Intron|KCTD1_ENST00000580059.1_5'Flank|KCTD1_ENST00000417602.1_Missense_Mutation_p.P194Q|KCTD1_ENST00000579973.1_Intron	NM_001136205.2	NP_001129677.1	Q719H9	KCTD1_HUMAN	potassium channel tetramerization domain containing 1						negative regulation of transcription, DNA-templated (GO:0045892)|protein homooligomerization (GO:0051260)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(3)	12	all_cancers(21;0.00191)|Lung NSC(5;0.000698)|all_lung(6;0.0019)|Ovarian(20;0.0848)		Epithelial(2;7.8e-06)|OV - Ovarian serous cystadenocarcinoma(3;9.02e-06)|all cancers(3;3.37e-05)			CTCGAAGTCCGGGCTCTGCGC	0.692																																					p.P194Q													.	.			0			c.C581A												45.0	48.0	47.0					18																	24127920		692	1591	2283	SO:0001627	intron_variant	284252	exon1			AAGTCCGGGCTCT	AF542549	CCDS11888.1	18q11.2	2013-09-20	2013-06-20		ENSG00000134504	ENSG00000134504			18249	protein-coding gene	gene with protein product		613420	"""potassium channel tetramerisation domain containing 1"""	C18orf5			Standard	NM_001142730		Approved		uc010xbj.3	Q719H9	OTTHUMG00000131947	ENST00000408011.3:c.14+934C>A	18.37:g.24127920G>T			Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	21	0.14	3	NM_001142730	5	0.00	0	A8K1F5	Missense_Mutation	SNP	ENST00000408011.3	37	CCDS11888.1	.	.	.	.	.	.	.	.	.	.	G	17.13	3.310928	0.60414	.	.	ENSG00000134504	ENST00000417602	T	0.78003	-1.14	4.36	4.36	0.52297	.	.	.	.	.	D	0.84602	0.5508	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.86199	0.1617	6	0.54805	T	0.06	.	15.476	0.75481	0.0:0.0:1.0:0.0	.	.	.	.	Q	194	ENSP00000408405:P194Q	ENSP00000408405:P194Q	P	-	2	0	KCTD1	22381918	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.666000	0.91149	1.978000	0.57642	0.563000	0.77884	CCG			0.692	KCTD1-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000446265.1		XM_209091	
GALNT1	2589	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	33263468	33263468	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr18:33263468G>T	ENST00000269195.5	+	4	698	c.595G>T	c.(595-597)Gtg>Ttg	p.V199L	GALNT1_ENST00000537549.1_Missense_Mutation_p.V139L	NM_020474.3	NP_065207.2	Q10472	GALT1_HUMAN	polypeptide N-acetylgalactosaminyltransferase 1	199	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(4)|stomach(1)	21						AGGAGCTGCTGTGTCTAAAGG	0.438																																					p.V199L													.	.			0			c.G595T												115.0	106.0	109.0					18																	33263468		2203	4300	6503	SO:0001583	missense	2589	exon4			GCTGCTGTGTCTA		CCDS11915.1	18q12.1	2014-03-13	2014-03-13		ENSG00000141429	ENSG00000141429	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4123	protein-coding gene	gene with protein product	"""protein-UDP acetylgalactosaminyltransferase 1"", ""polypeptide GalNAc transferase 1"""	602273	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)"""			7592619, 12199709	Standard	NM_020474		Approved	GalNAc-T1	uc002kzb.3	Q10472	OTTHUMG00000132567	ENST00000269195.5:c.595G>T	18.37:g.33263468G>T	ENSP00000269195:p.Val199Leu		Somatic	102	0	0		WXS	Illumina HiSeq	.	64	0.33	21	NM_020474	99	0.40	40	Q86TJ7|Q9UM86	Missense_Mutation	SNP	ENST00000269195.5	37	CCDS11915.1	.	.	.	.	.	.	.	.	.	.	G	10.64	1.407203	0.25378	.	.	ENSG00000141429	ENST00000537748;ENST00000269195;ENST00000537549	T;T	0.59906	0.23;0.23	5.02	5.02	0.67125	Glycosyl transferase, family 2 (1);	0.308092	0.35708	N	0.003024	T	0.44456	0.1294	L	0.31578	0.945	0.35544	D	0.803269	B	0.02656	0.0	B	0.01281	0.0	T	0.47262	-0.9131	10	0.11485	T	0.65	.	16.1969	0.82036	0.0:0.0:1.0:0.0	.	199	Q10472	GALT1_HUMAN	L	199;199;139	ENSP00000269195:V199L;ENSP00000440910:V139L	ENSP00000269195:V199L	V	+	1	0	GALNT1	31517466	0.953000	0.32496	1.000000	0.80357	0.988000	0.76386	3.134000	0.50538	2.473000	0.83533	0.591000	0.81541	GTG			0.438	GALNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255771.2		NM_020474	
EPG5	57724	mdanderson.org	37	18	43481039	43481039	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr18:43481039G>T	ENST00000282041.5	-	26	4602	c.4568C>A	c.(4567-4569)tCc>tAc	p.S1523Y	EPG5_ENST00000585906.1_5'UTR	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	1523					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						CACAGCAGAGGAAATAACTGG	0.547																																					p.S1523Y													.	.			0			c.C4568A												70.0	76.0	74.0					18																	43481039		2077	4208	6285	SO:0001583	missense	57724	exon26			GCAGAGGAAATAA	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.4568C>A	18.37:g.43481039G>T	ENSP00000282041:p.Ser1523Tyr		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_020964	5	0.00	0	A2BDF3|Q9H8C8	Missense_Mutation	SNP	ENST00000282041.5	37	CCDS11926.2	.	.	.	.	.	.	.	.	.	.	G	13.66	2.304658	0.40795	.	.	ENSG00000152223	ENST00000282041;ENST00000308403	T	0.10763	2.84	5.59	3.75	0.43078	.	.	.	.	.	T	0.16257	0.0391	L	0.34521	1.04	0.26993	N	0.965094	P	0.52692	0.955	P	0.54312	0.748	T	0.05533	-1.0879	9	0.59425	D	0.04	-0.3782	10.8118	0.46551	0.0683:0.0:0.8006:0.1311	.	1523	Q9HCE0	EPG5_HUMAN	Y	1523;398	ENSP00000282041:S1523Y	ENSP00000282041:S1523Y	S	-	2	0	EPG5	41735037	1.000000	0.71417	0.023000	0.16930	0.013000	0.08279	4.811000	0.62606	0.666000	0.31087	0.563000	0.77884	TCC			0.547	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000445081.1		NM_020964	
ZCCHC2	54877	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	18	60191501	60191501	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr18:60191501G>A	ENST00000269499.5	+	1	1262	c.844G>A	c.(844-846)Gaa>Aaa	p.E282K		NM_017742.4	NP_060212.4	Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2	282						cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(10)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25						CACCCTGAGGGAACACTTGGA	0.701																																					p.E282K													.	.			0			c.G844A												9.0	12.0	11.0					18																	60191501		690	1591	2281	SO:0001583	missense	54877	exon1			CTGAGGGAACACT	AB051531	CCDS45880.1	18q21.33	2012-04-19			ENSG00000141664	ENSG00000141664		"""Zinc fingers, CCHC domain containing"""	22916	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 49"""	C18orf49		11214970	Standard	NM_017742		Approved	FLJ20281, KIAA1744, FLJ20222	uc002lip.4	Q9C0B9		ENST00000269499.5:c.844G>A	18.37:g.60191501G>A	ENSP00000269499:p.Glu282Lys		Somatic	53	0	0		WXS	Illumina HiSeq	.	41	0.41	17	NM_017742	5	0.40	2	B2RPG6|Q8N3S1|Q9NXF6	Missense_Mutation	SNP	ENST00000269499.5	37	CCDS45880.1	.	.	.	.	.	.	.	.	.	.	G	16.96	3.266508	0.59540	.	.	ENSG00000141664	ENST00000269499	T	0.03635	3.86	4.21	4.21	0.49690	.	0.000000	0.51477	D	0.000085	T	0.09158	0.0226	L	0.38531	1.155	0.80722	D	1	D	0.67145	0.996	P	0.57620	0.824	T	0.25745	-1.0123	10	0.45353	T	0.12	-13.9615	16.5805	0.84713	0.0:0.0:1.0:0.0	.	282	Q9C0B9	ZCHC2_HUMAN	K	282	ENSP00000269499:E282K	ENSP00000269499:E282K	E	+	1	0	ZCCHC2	58342481	1.000000	0.71417	0.999000	0.59377	0.109000	0.19521	5.305000	0.65750	1.875000	0.54330	0.555000	0.69702	GAA			0.701	ZCCHC2-005	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000450083.1		NM_017742	
HMHA1	23526	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	1073680	1073680	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr19:1073680G>A	ENST00000313093.2	+	5	889	c.658G>A	c.(658-660)Gag>Aag	p.E220K	HMHA1_ENST00000586866.1_Missense_Mutation_p.E224K|HMHA1_ENST00000543365.1_Missense_Mutation_p.E103K|HMHA1_ENST00000590214.1_Missense_Mutation_p.E247K|HMHA1_ENST00000539243.2_Missense_Mutation_p.E236K|HMHA1_ENST00000536472.1_Missense_Mutation_p.E60K	NM_012292.3	NP_036424.2	Q92619	HMHA1_HUMAN	histocompatibility (minor) HA-1	220					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(7)|ovary(1)|prostate(2)	16		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGAGTGTCCGAGTTCCTCAT	0.672																																					p.E236K													.	.			0			c.G706A												52.0	48.0	49.0					19																	1073680		2202	4300	6502	SO:0001583	missense	23526	exon5			GTGTCCGAGTTCC	D86976	CCDS32863.1, CCDS58637.1, CCDS74242.1, CCDS74243.1	19p13.3	2011-09-07				ENSG00000180448		"""Rho GTPase activating proteins"""	17102	protein-coding gene	gene with protein product		601155				9820596, 9039502	Standard	NM_012292		Approved	KIAA0223, HA-1, ARHGAP45	uc010xgd.2	Q92619		ENST00000313093.2:c.658G>A	19.37:g.1073680G>A	ENSP00000316772:p.Glu220Lys		Somatic	41	0	0		WXS	Illumina HiSeq	.	38	0.24	9	NM_001258328	27	0.00	0	B4DTS4|F6QP70|Q6P189|Q7LE26|Q86WS1|Q8HX84|Q9GJN9|Q9GJP0|Q9GJP1|Q9MY24	Missense_Mutation	SNP	ENST00000313093.2	37	CCDS32863.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.912541	0.92178	.	.	ENSG00000180448	ENST00000539243;ENST00000313093;ENST00000544746;ENST00000536472;ENST00000412039;ENST00000543365	T;T;T;T	0.32272	1.52;1.52;1.57;1.46	4.24	4.24	0.50183	.	0.000000	0.85682	D	0.000000	T	0.57548	0.2061	M	0.79926	2.475	0.53688	D	0.999973	D;D;D;D	0.89917	1.0;0.995;1.0;0.991	D;P;D;P	0.87578	0.998;0.807;0.997;0.646	T	0.64706	-0.6344	10	0.62326	D	0.03	-31.309	15.1871	0.73012	0.0:0.0:1.0:0.0	.	60;236;103;220	F5H4A3;F6QP70;F5H1R4;Q92619	.;.;.;HMHA1_HUMAN	K	236;220;220;60;214;103	ENSP00000439601:E236K;ENSP00000316772:E220K;ENSP00000445109:E60K;ENSP00000438979:E103K	ENSP00000316772:E220K	E	+	1	0	HMHA1	1024680	1.000000	0.71417	0.991000	0.47740	0.832000	0.47134	7.363000	0.79516	1.892000	0.54788	0.491000	0.48974	GAG			0.672	HMHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458026.1			
BTBD2	55643	mdanderson.org	37	19	1990038	1990038	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr19:1990038C>T	ENST00000255608.4	-	5	969	c.953G>A	c.(952-954)cGc>cAc	p.R318H	AC005306.3_ENST00000587498.1_RNA|AC005306.3_ENST00000588480.1_RNA	NM_017797.3	NP_060267.2	Q9BX70	BTBD2_HUMAN	BTB (POZ) domain containing 2	318						cytoplasmic mRNA processing body (GO:0000932)				endometrium(5)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|stomach(1)	12		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGCGGGAAGCGAATGAGGCC	0.647																																					p.R318H													.	.			0			c.G953A												54.0	49.0	51.0					19																	1990038		2203	4300	6503	SO:0001583	missense	55643	exon5			GGGAAGCGAATGA	AF355797	CCDS12078.1	19p13.3	2013-10-02			ENSG00000133243	ENSG00000133243		"""BTB/POZ domain containing"""	15504	protein-coding gene	gene with protein product		608531				11179693	Standard	XM_005259593		Approved		uc002lup.1	Q9BX70	OTTHUMG00000180017	ENST00000255608.4:c.953G>A	19.37:g.1990038C>T	ENSP00000255608:p.Arg318His		Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_017797	210	0.00	0	O60418|O75248|Q4VBZ1|Q6IAC5|Q7Z5W0|Q96SX8|Q9NPS1|Q9NX81	Missense_Mutation	SNP	ENST00000255608.4	37	CCDS12078.1	.	.	.	.	.	.	.	.	.	.	C	31	5.077701	0.94000	.	.	ENSG00000133243	ENST00000255608	T	0.80738	-1.41	4.34	4.34	0.51931	BTB/Kelch-associated (2);	0.053096	0.85682	D	0.000000	D	0.91486	0.7312	M	0.91717	3.235	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93577	0.6909	10	0.87932	D	0	-24.9994	16.0152	0.80434	0.0:1.0:0.0:0.0	.	318	Q9BX70	BTBD2_HUMAN	H	318	ENSP00000255608:R318H	ENSP00000255608:R318H	R	-	2	0	BTBD2	1941038	1.000000	0.71417	0.995000	0.50966	0.965000	0.64279	7.484000	0.81180	2.257000	0.74773	0.549000	0.68633	CGC			0.647	BTBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000449300.2			
ZFR2	23217	mdanderson.org	37	19	3831705	3831705	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr19:3831705G>T	ENST00000262961.4	-	4	561	c.551C>A	c.(550-552)aCc>aAc	p.T184N	ZFR2_ENST00000591965.1_5'UTR	NM_015174.1	NP_055989.1	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2	184							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		GGGGTAGGAGGTCACGATGGA	0.652																																					p.T184N													.	.			0			c.C551A												22.0	26.0	24.0					19																	3831705		2132	4232	6364	SO:0001583	missense	23217	exon4			TAGGAGGTCACGA	AB029009	CCDS45921.1, CCDS45922.1	19p13.3	2012-10-05	2008-03-25	2008-03-25	ENSG00000105278	ENSG00000105278			29189	protein-coding gene	gene with protein product			"""KIAA1086"""	KIAA1086		10470851	Standard	NM_015174		Approved		uc002lyw.2	Q9UPR6	OTTHUMG00000180918	ENST00000262961.4:c.551C>A	19.37:g.3831705G>T	ENSP00000262961:p.Thr184Asn		Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	21	0.14	3	NM_015174	0		0		Missense_Mutation	SNP	ENST00000262961.4	37	CCDS45921.1	.	.	.	.	.	.	.	.	.	.	G	13.71	2.319712	0.41096	.	.	ENSG00000105278	ENST00000262961;ENST00000438164	T;T	0.15139	3.21;2.45	2.75	2.75	0.32379	.	0.512562	0.18506	U	0.139201	T	0.11024	0.0269	L	0.29908	0.895	0.80722	D	1	P	0.49783	0.928	B	0.38880	0.284	T	0.08659	-1.0711	10	0.51188	T	0.08	1.0E-4	8.7581	0.34658	0.0:0.0:1.0:0.0	.	184	Q9UPR6	ZFR2_HUMAN	N	184	ENSP00000262961:T184N;ENSP00000388974:T184N	ENSP00000262961:T184N	T	-	2	0	ZFR2	3782705	0.300000	0.24435	0.003000	0.11579	0.065000	0.16274	3.969000	0.56816	1.388000	0.46506	0.555000	0.69702	ACC			0.652	ZFR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000453648.2		NM_015174	
FCGBP	8857	broad.mit.edu;mdanderson.org	37	19	40366368	40366368	+	Missense_Mutation	SNP	G	G	C	rs151261300	byFrequency	TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr19:40366368G>C	ENST00000221347.6	-	30	13873	c.13866C>G	c.(13864-13866)gaC>gaG	p.D4622E		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4622	VWFD 11. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CCTTGAGGTCGTCTGCGGGGT	0.692													G|||	2	0.000399361	0.0015	0.0	5008	,	,		12321	0.0		0.0	False		,,,				2504	0.0				p.D4622E													.	FCGBP	416		0			c.C13866G												37.0	45.0	42.0					19																	40366368		2201	4298	6499	SO:0001583	missense	8857	exon30			GAGGTCGTCTGCG	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.13866C>G	19.37:g.40366368G>C	ENSP00000221347:p.Asp4622Glu		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	40	0.10	4	NM_003890	57	0.19	11	O95784	Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	G	10.95	1.495648	0.26774	.	.	ENSG00000090920	ENST00000221347	T	0.65364	-0.15	4.32	-0.4	0.12411	von Willebrand factor, type D domain (3);	0.064020	0.64402	D	0.000017	T	0.80380	0.4612	H	0.94306	3.52	0.27141	N	0.961659	D	0.89917	1.0	D	0.77004	0.989	T	0.71500	-0.4574	10	0.72032	D	0.01	.	8.1816	0.31313	0.5805:0.0:0.4195:0.0	.	4622	Q9Y6R7	FCGBP_HUMAN	E	4622	ENSP00000221347:D4622E	ENSP00000221347:D4622E	D	-	3	2	FCGBP	45058208	0.758000	0.28405	0.906000	0.35671	0.056000	0.15407	-0.067000	0.11579	-0.049000	0.13379	-0.698000	0.03680	GAC			0.692	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462507.1		NM_003890	
SPTBN4	57731	broad.mit.edu;mdanderson.org	37	19	41081444	41081444	+	Missense_Mutation	SNP	G	G	A	rs372875932		TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr19:41081444G>A	ENST00000352632.3	+	36	7750	c.7664G>A	c.(7663-7665)gGa>gAa	p.G2555E	SPTBN4_ENST00000392025.1_Missense_Mutation_p.G1298E|SPTBN4_ENST00000598249.1_Missense_Mutation_p.G2555E|SHKBP1_ENST00000291842.5_5'Flank|SHKBP1_ENST00000600733.1_5'Flank|SPTBN4_ENST00000593816.1_3'UTR			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	2555					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGGGAAGGCGGAGATCGCAGG	0.607																																					p.G2555E													SPTBN4,colon,carcinoma,+1,1	SPTBN4	213	1	0			c.G7664A							G	GLU/GLY	0,4406		0,0,2203	46.0	35.0	39.0		7664	2.3	1.0	19		39	3,8597	3.0+/-9.4	0,3,4297	no	missense	SPTBN4	NM_020971.2	98	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	probably-damaging	2555/2565	41081444	3,13003	2203	4300	6503	SO:0001583	missense	57731	exon36			AAGGCGGAGATCG	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.7664G>A	19.37:g.41081444G>A	ENSP00000263373:p.Gly2555Glu		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	16	0.19	3	NM_020971	6	0.33	2	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	37	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	G	8.150	0.787258	0.16189	0.0	3.49E-4	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000392025	T;T	0.76709	-1.04;0.3	4.65	2.31	0.28768	.	0.423377	0.20877	U	0.084071	T	0.58779	0.2146	N	0.08118	0	0.80722	D	1	B;B	0.27498	0.18;0.079	B;B	0.27170	0.077;0.048	T	0.60924	-0.7166	10	0.72032	D	0.01	.	11.607	0.51037	0.0:0.3423:0.6577:0.0	.	1298;2555	C9JY79;Q9H254	.;SPTN4_HUMAN	E	2555;2555;1298	ENSP00000263373:G2555E;ENSP00000375879:G1298E	ENSP00000263373:G2555E	G	+	2	0	SPTBN4	45773284	0.998000	0.40836	0.951000	0.38953	0.124000	0.20399	1.024000	0.30077	1.059000	0.40554	0.462000	0.41574	GGA			0.607	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462559.2			
EML2	24139	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	46116800	46116800	+	Splice_Site	SNP	C	C	A			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr19:46116800C>A	ENST00000245925.3	-	18	1873	c.1823G>T	c.(1822-1824)cGa>cTa	p.R608L	EML2_ENST00000589876.1_Splice_Site_p.R608L|EML2_ENST00000587152.1_Splice_Site_p.R809L|EML2_ENST00000536630.1_Splice_Site_p.R755L	NM_012155.2	NP_036287.1	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like 2	608	Tandem atypical propeller in EMLs. {ECO:0000250}.				negative regulation of microtubule polymerization (GO:0031115)|regulation of microtubule nucleation (GO:0010968)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)	p.R608L(1)		NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|urinary_tract(1)	31		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		GGGACTCACTCGAGGCTGACA	0.572																																					p.R809L													EML2,NS,carcinoma,0,1	EML2	64	1	1	Substitution - Missense(1)	lung(1)	c.G2426T												95.0	83.0	87.0					19																	46116800		2203	4300	6503	SO:0001630	splice_region_variant	24139	exon21			CTCACTCGAGGCT	AF103939	CCDS12670.1, CCDS54280.1, CCDS59399.1	19q13.32	2013-01-10				ENSG00000125746		"""WD repeat domain containing"""	18035	protein-coding gene	gene with protein product	"""echinoderm MT-associated protein (EMAP)-like protein 70"", ""microtubule-associated protein like echinoderm EMAP"""					11694528, 10521658	Standard	NM_012155		Approved	EMAP2, ELP70, EMAP-2	uc010xxm.2	O95834		ENST00000245925.3:c.1824+1G>T	19.37:g.46116800C>A			Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	45	0.11	5	NM_001193268	99	0.07	7	B7Z3I2|B7Z3Q9|K7ERL7|Q59EN8|Q8N5A2|Q9UG50	Splice_Site	SNP	ENST00000245925.3	37	CCDS12670.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.793165	0.90453	.	.	ENSG00000125746	ENST00000536630;ENST00000245925;ENST00000448055	T;T	0.28255	1.62;2.89	4.75	4.75	0.60458	WD40/YVTN repeat-like-containing domain (1);Soluble quinoprotein glucose/sorbosone dehydrogenase (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.53932	0.1827	M	0.74467	2.265	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.997	D;D;D	0.81914	0.965;0.995;0.937	T	0.48281	-0.9049	10	0.28530	T	0.3	-8.8226	15.6448	0.77039	0.0:1.0:0.0:0.0	.	774;755;608	B7Z3Q9;B7Z3I2;O95834	.;.;EMAL2_HUMAN	L	755;608;766	ENSP00000442365:R755L;ENSP00000245925:R608L	ENSP00000245925:R608L	R	-	2	0	EML2	50808640	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.545000	0.67237	2.653000	0.90120	0.563000	0.77884	CGA			0.572	EML2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000459608.1		NM_012155	Missense_Mutation
SLC20A1	6574	mdanderson.org	37	2	113414819	113414819	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr2:113414819G>T	ENST00000272542.3	+	6	1317		c.e6+1		SLC20A1_ENST00000480984.1_Splice_Site	NM_005415.4	NP_005406.3	Q8WUM9	S20A1_HUMAN	solute carrier family 20 (phosphate transporter), member 1						ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	high-affinity inorganic phosphate:sodium symporter activity (GO:0005316)|inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|sodium:phosphate symporter activity (GO:0005436)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|skin(1)|urinary_tract(3)	28						AAAATTGAACGTAAGTAATAA	0.373																																					.													.	.			0			c.778+1G>T												110.0	110.0	110.0					2																	113414819		2203	4300	6503	SO:0001630	splice_region_variant	6574	exon6			TTGAACGTAAGTA		CCDS2099.1	2q13	2013-05-22			ENSG00000144136	ENSG00000144136		"""Solute carriers"""	10946	protein-coding gene	gene with protein product	"""gibbon ape leukemia virus receptor 1"""	137570		GLVR1		8041748	Standard	NM_005415		Approved	PiT-1, Glvr-1	uc002tib.3	Q8WUM9	OTTHUMG00000131317	ENST00000272542.3:c.778+1G>T	2.37:g.113414819G>T			Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	79	0.05	4	NM_005415	5	0.00	0	Q08344|Q6DHX8|Q9UQ82	Splice_Site	SNP	ENST00000272542.3	37	CCDS2099.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.626369	0.87560	.	.	ENSG00000144136	ENST00000272542;ENST00000433924;ENST00000409095	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.496	0.87717	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC20A1	113131290	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.631000	0.98424	2.738000	0.93877	0.655000	0.94253	.			0.373	SLC20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254086.2		NM_005415	Intron
POTEF	728378	broad.mit.edu	37	2	130877755	130877755	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr2:130877755T>C	ENST00000409914.2	-	3	733	c.334A>G	c.(334-336)Agc>Ggc	p.S112G	POTEF_ENST00000361163.4_Missense_Mutation_p.S112G|POTEF_ENST00000357462.5_Missense_Mutation_p.S112G|POTEF_ENST00000360967.5_Missense_Mutation_p.S112G	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	112					retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						CTCTTGCTGCTCCCCCTGCAG	0.592																																					p.S112G													.	POTEF	140		0			c.A334G												41.0	66.0	58.0					2																	130877755		2181	4285	6466	SO:0001583	missense	728378	exon3			TGCTGCTCCCCCT	EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.334A>G	2.37:g.130877755T>C	ENSP00000386786:p.Ser112Gly		Somatic	167	0	0		WXS	Illumina HiSeq	Phase_I	179	0.03	5	NM_001099771	1	0.00	0	A6NC34	Missense_Mutation	SNP	ENST00000409914.2	37	CCDS46409.1	.	.	.	.	.	.	.	.	.	.	.	10.35	1.325392	0.24080	.	.	ENSG00000196604	ENST00000357462;ENST00000409914;ENST00000360967;ENST00000361163	T;T;T;T	0.77877	-1.13;-1.13;1.69;1.7	0.351	0.351	0.16042	.	.	.	.	.	T	0.71221	0.3314	L	0.50333	1.59	0.09310	N	1	B	0.26041	0.14	B	0.32805	0.153	T	0.64892	-0.6300	8	0.87932	D	0	.	.	.	.	.	112	A5A3E0	POTEF_HUMAN	G	112	ENSP00000350052:S112G;ENSP00000386786:S112G;ENSP00000354232:S112G;ENSP00000355012:S112G	ENSP00000350052:S112G	S	-	1	0	POTEF	130594225	0.003000	0.15002	0.021000	0.16686	0.027000	0.11550	0.047000	0.14056	0.366000	0.24427	0.076000	0.15429	AGC			0.592	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000331889.2		NM_001099771	
C2orf54	79919	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	241835040	241835040	+	Silent	SNP	G	G	A			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr2:241835040G>A	ENST00000388934.4	-	1	533	c.375C>T	c.(373-375)acC>acT	p.T125T		NM_001085437.1	NP_001078906	Q08AI8	CB054_HUMAN	chromosome 2 open reading frame 54	125										haematopoietic_and_lymphoid_tissue(1)|lung(4)|prostate(1)	6		all_epithelial(40;3.99e-16)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)		AGGTATCCTCGGTGGTCCACC	0.617																																					p.T125T													.	.			0			c.C375T												37.0	42.0	40.0					2																	241835040		2105	4218	6323	SO:0001819	synonymous_variant	79919	exon1			ATCCTCGGTGGTC	AK026324, AK056601	CCDS42839.1, CCDS42840.1, CCDS63187.1	2q37.3	2011-02-23			ENSG00000172478	ENSG00000172478			26216	protein-coding gene	gene with protein product							Standard	NM_001282921		Approved	FLJ22671	uc002wae.4	Q08AI8	OTTHUMG00000151906	ENST00000388934.4:c.375C>T	2.37:g.241835040G>A			Somatic	114	0	0		WXS	Illumina HiSeq	.	108	0.09	10	NM_001085437	15	0.40	6	B3KPP9|H7BXM3|Q08AI9|Q53QU5|Q9H622	Silent	SNP	ENST00000388934.4	37	CCDS42839.1																																																																																					0.617	C2orf54-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000324353.1		NM_024861, NM_001085437	
GFRA4	64096	broad.mit.edu	37	20	3641387	3641400	+	Splice_Site	DEL	CCCGGCCGCGCGTA	CCCGGCCGCGCGTA	-	rs574854017|rs556556498	byFrequency	TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	CCCGGCCGCGCGTA	CCCGGCCGCGCGTA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr20:3641387_3641400delCCCGGCCGCGCGTA	ENST00000319242.3	-	2	581		c.e2+1		GFRA4_ENST00000290417.2_Splice_Site			Q9GZZ7	GFRA4_HUMAN	GDNF family receptor alpha 4						negative regulation of ossification (GO:0030279)	anchored component of membrane (GO:0031225)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)			large_intestine(1)|lung(2)	3						TCGCCCGGATCCCGGCCGCGCGTACCCACGAGGC	0.748																																					.													.	GFRA4	10		0			.																																									SO:0001630	splice_region_variant	64096	.			CCGGATCCCGGCC	AF253318	CCDS13055.1, CCDS13056.1	20p13-p12	2008-07-16			ENSG00000125861	ENSG00000125861			13821	protein-coding gene	gene with protein product	"""persephin receptor"""					10958791, 15225646	Standard	XM_005260793		Approved		uc002win.3	Q9GZZ7	OTTHUMG00000031748	ENST00000319242.3:c.581+1TACGCGCGGCCGGG>-	20.37:g.3641387_3641400delCCCGGCCGCGCGTA			Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	10	0.40	4	.	0		0	Q5JT74|Q9H191|Q9H192	Splice_Site	DEL	ENST00000319242.3	37	CCDS13056.1																																																																																					0.748	GFRA4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000077744.1		NM_145762	Intron
LOC101929413	101929413	broad.mit.edu	37	20	10869747	10869748	+	lincRNA	INS	-	-	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr20:10869747_10869748insT	ENST00000448859.1	-	0	1058				RP11-103J8.1_ENST00000605292.1_RNA																							CTCtttttttattttttttttt	0.436																																					.													.	.			0			.																																											0	.			TTTTTTATTTTTT																													20.37:g.10869758_10869758dupT			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	INS	ENST00000448859.1	37																																																																																						0.436	RP4-697P8.3-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000078011.1			
PFDN4	5203	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	52830954	52830954	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr20:52830954C>G	ENST00000371419.2	+	2	343	c.89C>G	c.(88-90)aCa>aGa	p.T30R	PFDN4_ENST00000487129.1_3'UTR	NM_002623.3	NP_002614.2	Q9NQP4	PFD4_HUMAN	prefoldin subunit 4	30					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	chaperone binding (GO:0051087)			endometrium(1)|kidney(2)	3	Lung NSC(4;1.08e-05)|all_lung(4;2.7e-05)		Colorectal(105;0.124)|STAD - Stomach adenocarcinoma(23;0.206)			GCACGGAATACAAGTAGAATC	0.269																																					p.T30R													.	.			0			c.C89G												34.0	32.0	33.0					20																	52830954		2203	4295	6498	SO:0001583	missense	5203	exon2			GGAATACAAGTAG	U41816	CCDS13445.1	20q13.2	2008-07-02	2006-02-24		ENSG00000101132	ENSG00000101132			8868	protein-coding gene	gene with protein product		604898	"""prefoldin 4"""			9630229, 8744932	Standard	NM_002623		Approved	PFD4, C-1, C1	uc002xwx.3	Q9NQP4	OTTHUMG00000032775	ENST00000371419.2:c.89C>G	20.37:g.52830954C>G	ENSP00000360473:p.Thr30Arg		Somatic	372	0	0		WXS	Illumina HiSeq	.	395	0.30	117	NM_002623	97	0.29	28	Q5TD11|Q92779	Missense_Mutation	SNP	ENST00000371419.2	37	CCDS13445.1	.	.	.	.	.	.	.	.	.	.	C	17.20	3.329918	0.60743	.	.	ENSG00000101132	ENST00000371419	T	0.40476	1.03	4.96	4.01	0.46588	Prefoldin beta-like (1);Prefoldin (1);	0.086809	0.85682	D	0.000000	T	0.38054	0.1026	L	0.54323	1.7	0.58432	D	0.999994	P	0.37594	0.601	B	0.35413	0.202	T	0.32666	-0.9898	10	0.52906	T	0.07	-13.4955	12.6856	0.56946	0.0:0.9193:0.0:0.0807	.	30	Q9NQP4	PFD4_HUMAN	R	30	ENSP00000360473:T30R	ENSP00000360473:T30R	T	+	2	0	PFDN4	52264361	1.000000	0.71417	0.989000	0.46669	0.993000	0.82548	4.611000	0.61162	1.211000	0.43351	0.655000	0.94253	ACA			0.269	PFDN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079771.2		NM_002623	
TUBB1	81027	hgsc.bcm.edu;bcgsc.ca	37	20	57599434	57599434	+	Missense_Mutation	SNP	C	C	T	rs121918555		TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr20:57599434C>T	ENST00000217133.1	+	4	1221	c.952C>T	c.(952-954)Cgg>Tgg	p.R318W		NM_030773.3	NP_110400.1	Q9H4B7	TBB1_HUMAN	tubulin, beta 1 class VI	318			R -> W (in MAD-TUBB1; dbSNP:rs121918555). {ECO:0000269|PubMed:18849486}.		'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|protein polymerization (GO:0051258)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|skin(2)	16	all_lung(29;0.00711)		Colorectal(105;0.109)		Cabazitaxel(DB06772)|Colchicine(DB01394)|Docetaxel(DB01248)|Paclitaxel(DB01229)|Vindesine(DB00309)	CTGCATTTTCCGGGGCAAGAT	0.597													C|||	1	0.000199681	0.0	0.0	5008	,	,		19575	0.001		0.0	False		,,,				2504	0.0				p.R318W													.	.			0			c.C952T	GRCh37	CM090175	TUBB1	M	rs121918555		C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	57.0	48.0	51.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	952	5.4	1.0	20	dbSNP_133	51	0,8600		0,0,4300	no	missense	TUBB1	NM_030773.3	101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	318/452	57599434	1,13005	2203	4300	6503	SO:0001583	missense	81027	exon4			ATTTTCCGGGGCA	AJ292757	CCDS13475.1	20q13.32	2014-09-17	2011-10-10		ENSG00000101162	ENSG00000101162		"""Tubulins"""	16257	protein-coding gene	gene with protein product	"""class VI beta-tubulin"""	612901	"""tubulin, beta 1"""				Standard	NM_030773		Approved	dJ543J19.4	uc002yak.3	Q9H4B7	OTTHUMG00000032860	ENST00000217133.1:c.952C>T	20.37:g.57599434C>T	ENSP00000217133:p.Arg318Trp		Somatic	43	0	0		WXS	Illumina HiSeq	.	69	0.06	4	NM_030773	0		0		Missense_Mutation	SNP	ENST00000217133.1	37	CCDS13475.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	20.8	4.055116	0.75960	2.27E-4	0.0	ENSG00000101162	ENST00000217133	D	0.84589	-1.87	5.41	5.41	0.78517	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.96549	0.8874	H	0.99977	5.165	0.80722	A	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97734	1.0204	9	0.87932	D	0	.	13.743	0.62860	0.1639:0.8361:0.0:0.0	.	318	Q9H4B7	TBB1_HUMAN	W	318	ENSP00000217133:R318W	ENSP00000217133:R318W	R	+	1	2	TUBB1	57032829	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.292000	0.51772	2.545000	0.85829	0.561000	0.74099	CGG	0		0.597	TUBB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079903.1		NM_030773	
ZNRF3	84133	mdanderson.org	37	22	29446834	29446834	+	Missense_Mutation	SNP	C	C	T	rs375016509	byFrequency	TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr22:29446834C>T	ENST00000544604.2	+	8	2840	c.2665C>T	c.(2665-2667)Cgg>Tgg	p.R889W	ZNRF3_ENST00000406323.3_Missense_Mutation_p.R789W|ZNRF3_ENST00000402174.1_Missense_Mutation_p.R789W|ZNRF3_ENST00000332811.4_Missense_Mutation_p.R789W	NM_001206998.1	NP_001193927.1	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3	889					canonical Wnt signaling pathway (GO:0060070)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|protein ubiquitination (GO:0016567)|stem cell proliferation (GO:0072089)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	integral component of plasma membrane (GO:0005887)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(4)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	28						GGCCCTACTGCGGCCTGGCTG	0.706													C|||	2	0.000399361	0.0015	0.0	5008	,	,		15339	0.0		0.0	False		,,,				2504	0.0				p.R889W													.	.			0			c.C2665T							C	TRP/ARG,TRP/ARG	2,3864		0,2,1931	10.0	12.0	11.0		2665,2365	-1.9	0.0	22		11	0,8224		0,0,4112	no	missense,missense	ZNRF3	NM_001206998.1,NM_032173.3	101,101	0,2,6043	TT,TC,CC		0.0,0.0517,0.0165	probably-damaging,probably-damaging	889/937,789/837	29446834	2,12088	1933	4112	6045	SO:0001583	missense	84133	exon8			CTACTGCGGCCTG	AB051436	CCDS42999.1, CCDS56225.1	22q12.1	2013-01-09			ENSG00000183579	ENSG00000183579		"""RING-type (C3HC4) zinc fingers"""	18126	protein-coding gene	gene with protein product		612062				10574461	Standard	NM_032173		Approved	KIAA1133, BK747E2.3, FLJ22057, RNF203	uc003aeg.3	Q9ULT6	OTTHUMG00000151009	ENST00000544604.2:c.2665C>T	22.37:g.29446834C>T	ENSP00000443824:p.Arg889Trp		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	23	0.09	2	NM_001206998	20	0.00	0	B3KU18|Q6ICH1|Q6NTF8|Q8WU18	Missense_Mutation	SNP	ENST00000544604.2	37	CCDS56225.1	.	.	.	.	.	.	.	.	.	.	C	5.380	0.255273	0.10185	5.17E-4	0.0	ENSG00000183579	ENST00000544604;ENST00000332811;ENST00000462485;ENST00000402174;ENST00000406323	T;T;T;T	0.09073	3.16;3.02;3.02;3.02	4.75	-1.93	0.07594	.	1.143190	0.06746	N	0.779226	T	0.06325	0.0163	N	0.22421	0.69	0.09310	N	1	D	0.69078	0.997	B	0.44315	0.446	T	0.33471	-0.9867	10	0.66056	D	0.02	4.7171	4.8074	0.13326	0.3229:0.4553:0.0:0.2217	.	889	Q9ULT6	ZNRF3_HUMAN	W	889;789;596;789;789	ENSP00000443824:R889W;ENSP00000328614:R789W;ENSP00000384456:R789W;ENSP00000384553:R789W	ENSP00000328614:R789W	R	+	1	2	ZNRF3	27776834	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.151000	0.10175	-0.246000	0.09611	-0.218000	0.12543	CGG			0.706	ZNRF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000320943.2		XM_290972	
SH3BP1	23616	mdanderson.org	37	22	38051389	38051389	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr22:38051389C>A	ENST00000357436.4	+	18	2117	c.1804C>A	c.(1804-1806)Ccc>Acc	p.P602T	SH3BP1_ENST00000599616.1_Intron|Z83844.1_ENST00000456099.1_RNA	NM_018957.3	NP_061830.3	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1	602					signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Melanoma(58;0.0574)					CCCTGGGACCCCCCAAGCCCT	0.766																																					p.P602T													.	.			0			c.C1804A												2.0	3.0	3.0					22																	38051389		1354	3008	4362	SO:0001583	missense	23616	exon18			GGGACCCCCCAAG		CCDS13952.2	22q13.1	2011-07-04			ENSG00000100092	ENSG00000100092		"""Rho GTPase activating proteins"""	10824	protein-coding gene	gene with protein product						10591208, 12029088	Standard	NM_018957		Approved	ARHGAP43	uc003ati.3	Q9Y3L3	OTTHUMG00000030996	ENST00000357436.4:c.1804C>A	22.37:g.38051389C>A	ENSP00000350018:p.Pro602Thr		Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	17	0.18	3	NM_018957	45	0.00	0	Q5R3N0|Q6IBZ2|Q6ZVL9|Q96HQ5|Q9NSQ9	Missense_Mutation	SNP	ENST00000357436.4	37	CCDS13952.2	.	.	.	.	.	.	.	.	.	.	C	18.37	3.610208	0.66558	.	.	ENSG00000100092	ENST00000357436	T	0.18657	2.2	3.96	3.96	0.45880	.	0.000000	0.44285	U	0.000470	T	0.34077	0.0885	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.05835	-1.0861	9	.	.	.	.	15.7893	0.78343	0.0:1.0:0.0:0.0	.	602	Q9Y3L3	3BP1_HUMAN	T	602	ENSP00000350018:P602T	.	P	+	1	0	SH3BP1	36381335	0.995000	0.38212	0.845000	0.33349	0.934000	0.57294	4.202000	0.58446	2.032000	0.59987	0.448000	0.29417	CCC			0.766	SH3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000075884.4		NM_018957	
POLDIP3	84271	hgsc.bcm.edu	37	22	42976780	42976780	+	IGR	SNP	A	A	C			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr22:42976780A>C	ENST00000252115.5	-	0	3441				RRP7B_ENST00000357802.2_RNA	NM_032311.3	NP_115687.2	Q9BY77	PDIP3_HUMAN	polymerase (DNA-directed), delta interacting protein 3						poly(A)+ mRNA export from nucleus (GO:0016973)|positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|upper_aerodigestive_tract(1)	16						ccagggcctcacacatgctgg	0.587																																					.	Ovarian(52;967 1128 5875 19997 42537)												.	.			0			.																																									SO:0001628	intergenic_variant	91695	.			GGCCTCACACATG		CCDS14038.1, CCDS14039.1, CCDS74873.1	22q13.31	2013-02-12			ENSG00000100227	ENSG00000100227		"""RNA binding motif (RRM) containing"""	23782	protein-coding gene	gene with protein product		611520				12522211	Standard	NM_032311		Approved	PDIP46, KIAA1649	uc003bcu.3	Q9BY77	OTTHUMG00000150887		22.37:g.42976780A>C			Somatic	347	0	0		WXS	Illumina HiSeq	.	266	0.26	70	.	0		0	A8K6F8|A8K6V9|Q009A7|Q5H972|Q6PGN6|Q7Z6Z0|Q9NSP5|Q9NSP6	RNA	SNP	ENST00000252115.5	37	CCDS14038.1																																																																																					0.587	POLDIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320433.1		NM_032311	
TTC38	55020	broad.mit.edu	37	22	46685729	46685729	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr22:46685729G>T	ENST00000381031.3	+	13	1325	c.1249G>T	c.(1249-1251)Gtc>Ttc	p.V417F	TTC38_ENST00000445282.2_Missense_Mutation_p.V359F	NM_017931.2	NP_060401	Q5R3I4	TTC38_HUMAN	tetratricopeptide repeat domain 38	417						extracellular vesicular exosome (GO:0070062)				endometrium(4)|large_intestine(3)|lung(4)|ovary(1)	12						TCAGAGAGACGTCTTCAACCA	0.627																																					p.V417F													TTC38,NS,carcinoma,0,1	TTC38	40	1	0			c.G1249T												112.0	125.0	121.0					22																	46685729		2107	4223	6330	SO:0001583	missense	55020	exon13			AGAGACGTCTTCA		CCDS43030.1	22q13	2013-01-11			ENSG00000075234	ENSG00000075234		"""Tetratricopeptide (TTC) repeat domain containing"""	26082	protein-coding gene	gene with protein product							Standard	NM_017931		Approved	FLJ20699	uc003bhi.3	Q5R3I4	OTTHUMG00000150494	ENST00000381031.3:c.1249G>T	22.37:g.46685729G>T	ENSP00000370419:p.Val417Phe		Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	58	0.05	3	NM_017931	83	0.00	0	Q8WV27|Q9NWP8	Missense_Mutation	SNP	ENST00000381031.3	37	CCDS43030.1	.	.	.	.	.	.	.	.	.	.	G	18.78	3.696174	0.68386	.	.	ENSG00000075234	ENST00000381031;ENST00000445282	T;T	0.61040	0.14;0.16	4.98	1.68	0.24146	.	0.428647	0.25361	N	0.031226	T	0.53514	0.1801	M	0.72894	2.215	0.54753	D	0.999985	P;D	0.56521	0.936;0.976	P;P	0.45167	0.472;0.472	T	0.54781	-0.8242	10	0.87932	D	0	6.2276	5.0499	0.14503	0.2661:0.1512:0.5827:0.0	.	359;417	E7ES35;Q5R3I4	.;TTC38_HUMAN	F	417;359	ENSP00000370419:V417F;ENSP00000393960:V359F	ENSP00000370419:V417F	V	+	1	0	TTC38	45064393	0.755000	0.28372	0.974000	0.42286	0.956000	0.61745	0.932000	0.28884	0.520000	0.28426	0.655000	0.94253	GTC			0.627	TTC38-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000318469.1		NM_017931	
CELSR1	9620	mdanderson.org	37	22	46860176	46860176	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr22:46860176G>T	ENST00000262738.3	-	2	3610	c.3611C>A	c.(3610-3612)aCc>aAc	p.T1204N	CELSR1_ENST00000395964.1_Missense_Mutation_p.T1204N	NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1204	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GATGCTGTTGGTCAGCATGTC	0.602																																					p.T1204N													.	.			0			c.C3611A												101.0	84.0	90.0					22																	46860176		2203	4300	6503	SO:0001583	missense	9620	exon2			CTGTTGGTCAGCA	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.3611C>A	22.37:g.46860176G>T	ENSP00000262738:p.Thr1204Asn		Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_014246	2	0.00	0	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	37	CCDS14076.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.63|19.63	3.862996|3.862996	0.71949|0.71949	.|.	.|.	ENSG00000075275|ENSG00000075275	ENST00000454637|ENST00000262738;ENST00000395964	.|T;T	.|0.67523	.|-0.27;0.03	4.68|4.68	4.68|4.68	0.58851|0.58851	.|Cadherin (1);	.|0.000000	.|0.64402	.|U	.|0.000001	T|T	0.66297|0.66297	0.2775|0.2775	L|L	0.34521|0.34521	1.04|1.04	0.47276|0.47276	D|D	0.999371|0.999371	.|P	.|0.51449	.|0.945	.|P	.|0.52343	.|0.696	T|T	0.63148|0.63148	-0.6702|-0.6702	5|10	.|0.23891	.|T	.|0.37	.|.	17.2226|17.2226	0.86961|0.86961	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1204	.|Q9NYQ6	.|CELR1_HUMAN	T|N	579|1204	.|ENSP00000262738:T1204N;ENSP00000379293:T1204N	.|ENSP00000262738:T1204N	P|T	-|-	1|2	0|0	CELSR1|CELSR1	45238840|45238840	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	9.057000|9.057000	0.93889|0.93889	2.146000|2.146000	0.66826|0.66826	0.655000|0.655000	0.94253|0.94253	CCA|ACC			0.602	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318037.1		NM_014246	
ITPR1	3708	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	4687295	4687295	+	Silent	SNP	G	G	A			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr3:4687295G>A	ENST00000443694.2	+	8	738	c.738G>A	c.(736-738)gaG>gaA	p.E246E	ITPR1_ENST00000456211.2_Silent_p.E246E|ITPR1_ENST00000354582.6_Silent_p.E246E|ITPR1_ENST00000423119.2_Silent_p.E246E|ITPR1_ENST00000302640.8_Silent_p.E246E|ITPR1_ENST00000544951.1_Silent_p.E246E|ITPR1_ENST00000357086.4_Silent_p.E246E			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	246	MIR 3. {ECO:0000255|PROSITE- ProRule:PRU00131}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	TTCATGCTGAGCAGGAGAAGT	0.488																																					p.E246E													.	.			0			c.G738A												43.0	43.0	43.0					3																	4687295		2051	4230	6281	SO:0001819	synonymous_variant	3708	exon10			TGCTGAGCAGGAG	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.738G>A	3.37:g.4687295G>A			Somatic	98	0	0		WXS	Illumina HiSeq	.	101	0.24	24	NM_001099952	2	0.00	0	E7EPX7|E9PDE9|Q14660|Q99897	Silent	SNP	ENST00000443694.2	37	CCDS54551.1																																																																																					0.488	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000337982.3		NM_002222	
NISCH	11188	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52492740	52492740	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr3:52492740C>G	ENST00000479054.1	+	4	312	c.240C>G	c.(238-240)aaC>aaG	p.N80K	NISCH_ENST00000420808.2_Missense_Mutation_p.N80K|NISCH_ENST00000488380.1_Missense_Mutation_p.N80K|NISCH_ENST00000345716.4_Missense_Mutation_p.N80K			Q9Y2I1	NISCH_HUMAN	nischarin	80	Necessary for binding to phosphoinositide-3-P; not sufficient for targeting to endosomes.|PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|glucose metabolic process (GO:0006006)|negative regulation of cell migration (GO:0030336)|norepinephrine secretion (GO:0048243)|Rac protein signal transduction (GO:0016601)|regulation of blood pressure (GO:0008217)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled amine receptor activity (GO:0008227)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	33				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	Tizanidine(DB00697)	TTGGGAAAAACTCAAGAAGCT	0.478																																					p.N80K													.	.			0			c.C240G												68.0	71.0	70.0					3																	52492740		2203	4300	6503	SO:0001583	missense	11188	exon3			GAAAAACTCAAGA	AF082516	CCDS33767.1, CCDS63651.1, CCDS63652.1	3p21.1	2008-07-18			ENSG00000010322	ENSG00000010322			18006	protein-coding gene	gene with protein product	"""imidazoline receptor candidate"", ""I-1 receptor candidate protein"", ""imidazoline receptor antisera selected"""	615507				11912194, 10882231	Standard	NM_007184		Approved	KIAA0975, I-1, IRAS	uc003ded.4	Q9Y2I1	OTTHUMG00000158571	ENST00000479054.1:c.240C>G	3.37:g.52492740C>G	ENSP00000418232:p.Asn80Lys		Somatic	97	0	0		WXS	Illumina HiSeq	.	110	0.21	23	NM_001276293	45	0.47	21	C9J245|Q6PGP3|Q6PIB4|Q7L8M3|Q7Z2X6|Q9UES6|Q9UEU4|Q9UFW3	Missense_Mutation	SNP	ENST00000479054.1	37	CCDS33767.1	.	.	.	.	.	.	.	.	.	.	C	10.61	1.399531	0.25291	.	.	ENSG00000010322	ENST00000479054;ENST00000345716;ENST00000433196;ENST00000488380;ENST00000420808	T;T;T;T	0.37058	1.22;1.22;1.22;1.22	5.7	3.68	0.42216	Phox homologous domain (5);	0.000000	0.85682	D	0.000000	T	0.40522	0.1120	L	0.37507	1.11	0.47584	D	0.999463	D;D	0.89917	1.0;0.994	D;P	0.91635	0.999;0.893	T	0.34850	-0.9812	10	0.10902	T	0.67	-37.735	6.3889	0.21576	0.0:0.6782:0.0:0.3218	.	80;80	Q9Y2I1;C9J715	NISCH_HUMAN;.	K	80	ENSP00000418232:N80K;ENSP00000339958:N80K;ENSP00000417812:N80K;ENSP00000392484:N80K	ENSP00000339958:N80K	N	+	3	2	NISCH	52467780	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.589000	0.36644	1.433000	0.47394	0.655000	0.94253	AAC			0.478	NISCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000351357.1		NM_007184	
PDZRN3	23024	mdanderson.org	37	3	73433414	73433414	+	Missense_Mutation	SNP	G	G	T	rs376105538		TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr3:73433414G>T	ENST00000263666.4	-	10	2417	c.2303C>A	c.(2302-2304)cCg>cAg	p.P768Q	PDZRN3_ENST00000479530.1_Missense_Mutation_p.P485Q|PDZRN3_ENST00000535920.1_Missense_Mutation_p.P490Q|PDZRN3_ENST00000466780.1_Missense_Mutation_p.P425Q|PDZRN3_ENST00000466348.1_5'Flank|PDZRN3_ENST00000462146.2_Missense_Mutation_p.P425Q	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	768					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		CAGGGTGAGCGGGGTGCTGCG	0.647																																					p.P768Q													.	.			0			c.C2303A												31.0	33.0	32.0					3																	73433414		2203	4300	6503	SO:0001583	missense	23024	exon10			GTGAGCGGGGTGC	AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.2303C>A	3.37:g.73433414G>T	ENSP00000263666:p.Pro768Gln		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	38	0.11	4	NM_015009	34	0.00	0	A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Missense_Mutation	SNP	ENST00000263666.4	37	CCDS33789.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.046270	0.75846	.	.	ENSG00000121440	ENST00000263666;ENST00000535920;ENST00000462146;ENST00000466780;ENST00000479530;ENST00000492909	T;T;T;T;T;T	0.22134	1.97;2.87;2.8;2.8;2.88;2.74	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.50769	0.1635	M	0.80616	2.505	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.998;1.0	D;D;P;D	0.97110	0.991;1.0;0.901;0.999	T	0.55127	-0.8189	10	0.56958	D	0.05	.	18.1478	0.89663	0.0:0.0:1.0:0.0	.	490;485;485;768	F5H8I9;B7ZAG0;B7Z5X9;Q9UPQ7	.;.;.;PZRN3_HUMAN	Q	768;490;425;425;485;466	ENSP00000263666:P768Q;ENSP00000442026:P490Q;ENSP00000418168:P425Q;ENSP00000418484:P425Q;ENSP00000418624:P485Q;ENSP00000419250:P466Q	ENSP00000263666:P768Q	P	-	2	0	PDZRN3	73516104	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.392000	0.97252	2.370000	0.80446	0.655000	0.94253	CCG			0.647	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000352460.1		XM_041363	
NPHP3	27031	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	132408024	132408024	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr3:132408024A>C	ENST00000337331.5	-	20	2863	c.2777T>G	c.(2776-2778)tTg>tGg	p.L926W	NPHP3_ENST00000326682.8_3'UTR	NM_153240.4	NP_694972.3	Q7Z494	NPHP3_HUMAN	nephronophthisis 3 (adolescent)	926					atrial septum development (GO:0003283)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|determination of intestine left/right asymmetry (GO:0071908)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|determination of stomach left/right asymmetry (GO:0071909)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|establishment or maintenance of cell polarity (GO:0007163)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|kidney development (GO:0001822)|kidney morphogenesis (GO:0060993)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|maintenance of organ identity (GO:0048496)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|photoreceptor cell maintenance (GO:0045494)|regulation of cAMP metabolic process (GO:0030814)|regulation of planar cell polarity pathway involved in neural tube closure (GO:2000167)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|ureter development (GO:0072189)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|primary cilium (GO:0072372)				NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(15)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						ATACTGCTTCAATGAATCGAA	0.428																																					p.L926W													.	.			0			c.T2777G												132.0	123.0	126.0					3																	132408024		2203	4300	6503	SO:0001583	missense	27031	exon20			TGCTTCAATGAAT	AB056657	CCDS3078.1	3q22	2014-07-18			ENSG00000113971	ENSG00000113971		"""Tetratricopeptide (TTC) repeat domain containing"""	7907	protein-coding gene	gene with protein product	"""nephrocystin-3"", ""Meckel syndrome, type 7"", ""cilia and flagella associated protein 31"""	608002				12872122, 15381417	Standard	NM_153240		Approved	NPH3, KIAA2000, FLJ30691, FLJ36696, MKS7, SLSN3, CFAP31	uc003epe.2	Q7Z494	OTTHUMG00000159713	ENST00000337331.5:c.2777T>G	3.37:g.132408024A>C	ENSP00000338766:p.Leu926Trp		Somatic	134	0	0		WXS	Illumina HiSeq	.	113	0.22	25	NM_153240	22	0.32	7	Q5JPE3|Q5JPE6|Q68D99|Q6NVH3|Q7Z492|Q7Z493|Q8N9R2|Q8NCM5|Q96N70|Q96NK2	Missense_Mutation	SNP	ENST00000337331.5	37	CCDS3078.1	.	.	.	.	.	.	.	.	.	.	A	27.4	4.831206	0.91036	.	.	ENSG00000113971	ENST00000393144;ENST00000337331	D	0.92858	-3.12	5.95	5.95	0.96441	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	D	0.93543	0.7939	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.93571	0.6904	10	0.45353	T	0.12	-12.7557	16.4237	0.83790	1.0:0.0:0.0:0.0	.	926	Q7Z494	NPHP3_HUMAN	W	206;926	ENSP00000338766:L926W	ENSP00000338766:L926W	L	-	2	0	NPHP3	133890714	1.000000	0.71417	0.934000	0.37439	0.977000	0.68977	8.730000	0.91510	2.279000	0.76181	0.533000	0.62120	TTG			0.428	NPHP3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000357020.2		NM_153240	
TFRC	7037	broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	195789794	195789794	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr3:195789794G>T	ENST00000360110.4	-	12	1504	c.1335C>A	c.(1333-1335)agC>agA	p.S445R	TFRC_ENST00000535031.1_Missense_Mutation_p.S163R|TFRC_ENST00000540528.1_3'UTR|TFRC_ENST00000392396.3_Missense_Mutation_p.S445R|TFRC_ENST00000420415.1_Missense_Mutation_p.S364R|TFRC_ENST00000465288.1_5'UTR	NM_001128148.1	NP_001121620.1	P02786	TFR1_HUMAN	transferrin receptor	445					cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|osteoclast differentiation (GO:0030316)|positive regulation of bone resorption (GO:0045780)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|vesicle (GO:0031982)	double-stranded RNA binding (GO:0003725)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transferrin receptor activity (GO:0004998)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_cancers(143;1.94e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.36e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.17e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00233)	Gallium nitrate(DB05260)	TAATGCTTCTGCTGGGCTGAA	0.438			T	BCL6	NHL																																p.S445R				Dom	yes		3	3q29	7037	"""transferrin receptor (p90, CD71)"""		L	.	TFRC	54		0			c.C1335A												75.0	74.0	75.0					3																	195789794		2203	4300	6503	SO:0001583	missense	7037	exon12			GCTTCTGCTGGGC	X01060	CCDS3312.1	3q29	2013-09-19	2013-09-19		ENSG00000072274	ENSG00000072274		"""CD molecules"""	11763	protein-coding gene	gene with protein product		190010	"""transferrin receptor (p90, CD71)"""				Standard	NM_003234		Approved	CD71, TFR1, p90	uc003fwa.4	P02786	OTTHUMG00000155714	ENST00000360110.4:c.1335C>A	3.37:g.195789794G>T	ENSP00000353224:p.Ser445Arg		Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	65	0.08	5	NM_001128148	34	0.00	0	D3DXB0|Q1HE24|Q59G55|Q9UCN0|Q9UCU5|Q9UDF9|Q9UK21	Missense_Mutation	SNP	ENST00000360110.4	37	CCDS3312.1	.	.	.	.	.	.	.	.	.	.	G	3.228	-0.158108	0.06544	.	.	ENSG00000072274	ENST00000360110;ENST00000420415;ENST00000392396;ENST00000535031	T;T;T;T	0.70516	1.23;1.23;1.23;-0.49	5.52	-5.36	0.02689	Peptidase M28 (1);	0.290090	0.49305	N	0.000154	T	0.22781	0.0550	N	0.00750	-1.22	0.80722	D	1	B	0.13145	0.007	B	0.16722	0.016	T	0.41161	-0.9524	10	0.02654	T	1	-0.239	1.362	0.02194	0.2024:0.3361:0.1462:0.3154	.	445	P02786	TFR1_HUMAN	R	445;364;445;163	ENSP00000353224:S445R;ENSP00000390133:S364R;ENSP00000376197:S445R;ENSP00000437753:S163R	ENSP00000353224:S445R	S	-	3	2	TFRC	197274191	0.995000	0.38212	0.820000	0.32676	0.844000	0.47949	0.348000	0.20031	-0.710000	0.05001	0.591000	0.81541	AGC			0.438	TFRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000341346.1			
SHROOM3	57619	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	77631363	77631363	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr4:77631363C>A	ENST00000296043.6	+	3	1331	c.378C>A	c.(376-378)agC>agA	p.S126R	SHROOM3_ENST00000473602.1_3'UTR	NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	126					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			ACTTCGTCAGCCCAGAACACC	0.537																																					p.S126R													.	.			0			c.C378A												107.0	96.0	100.0					4																	77631363		2203	4300	6503	SO:0001583	missense	57619	exon3			CGTCAGCCCAGAA	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.378C>A	4.37:g.77631363C>A	ENSP00000296043:p.Ser126Arg		Somatic	245	0	0		WXS	Illumina HiSeq	.	199	0.35	69	NM_020859	10	0.40	4	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Missense_Mutation	SNP	ENST00000296043.6	37	CCDS3579.2	.	.	.	.	.	.	.	.	.	.	C	11.98	1.800264	0.31869	.	.	ENSG00000138771	ENST00000296043	T	0.21734	1.99	4.7	2.97	0.34412	.	0.192102	0.25823	N	0.028061	T	0.14184	0.0343	L	0.40543	1.245	0.09310	N	0.999996	P	0.44578	0.838	B	0.36289	0.221	T	0.12604	-1.0541	10	0.52906	T	0.07	-0.4047	7.6736	0.28473	0.0:0.7999:0.0:0.2001	.	126	Q8TF72	SHRM3_HUMAN	R	126	ENSP00000296043:S126R	ENSP00000296043:S126R	S	+	3	2	SHROOM3	77850387	0.099000	0.21834	0.037000	0.18230	0.019000	0.09904	0.776000	0.26704	0.684000	0.31448	0.591000	0.81541	AGC			0.537	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252408.2		NM_020859	
OTUD4	54726	hgsc.bcm.edu	37	4	146059041	146059041	+	Silent	SNP	A	A	G			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr4:146059041A>G	ENST00000447906.2	-	21	3073	c.2886T>C	c.(2884-2886)caT>caC	p.H962H	OTUD4_ENST00000455611.2_Intron|OTUD4_ENST00000454497.2_Silent_p.H897H			Q01804	OTUD4_HUMAN	OTU deubiquitinase 4	962					protein K48-linked deubiquitination (GO:0071108)		poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)					GAGTGGGAGGATGAGCCTTTC	0.478																																					p.H897H													OTUD4,bladder,carcinoma,0,2	OTUD4	0	2	0			c.T2691C												118.0	118.0	118.0					4																	146059041		2203	4300	6503	SO:0001819	synonymous_variant	54726	exon21			GGGAGGATGAGCC		CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164		"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""			1475186, 12727813, 19996094	Standard	NM_001102653		Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.2886T>C	4.37:g.146059041A>G			Somatic	122	0	0		WXS	Illumina HiSeq	.	70	0.04	3	NM_001102653	18	0.00	0	B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	Silent	SNP	ENST00000447906.2	37																																																																																						0.478	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000365117.2		NM_017493	
ARHGAP10	79658	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	148993187	148993187	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr4:148993187C>G	ENST00000336498.3	+	23	2555	c.2316C>G	c.(2314-2316)aaC>aaG	p.N772K	ARHGAP10_ENST00000414545.2_Missense_Mutation_p.N370K|ARHGAP10_ENST00000510076.1_3'UTR	NM_024605.3	NP_078881.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 10	0					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			autonomic_ganglia(2)|endometrium(5)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		GGACTCTGAACGGCAAGAGGG	0.562																																					p.N772K													.	.			0			c.C2316G												88.0	89.0	89.0					4																	148993187		2203	4300	6503	SO:0001583	missense	79658	exon23			TCTGAACGGCAAG	BC047914	CCDS34075.1	4q31.23	2013-09-20			ENSG00000071205	ENSG00000071205		"""Rho GTPase activating proteins"""	26099	protein-coding gene	gene with protein product		609746				8288572	Standard	NM_024605		Approved	FLJ20896, FLJ41791, GRAF2	uc003ilf.3	A1A4S6	OTTHUMG00000161460	ENST00000336498.3:c.2316C>G	4.37:g.148993187C>G	ENSP00000336923:p.Asn772Lys		Somatic	53	0	0		WXS	Illumina HiSeq	.	59	0.20	12	NM_024605	22	0.00	0	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000336498.3	37	CCDS34075.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	14.37|14.37	2.514711|2.514711	0.44763|0.44763	.|.	.|.	ENSG00000071205|ENSG00000071205	ENST00000336498;ENST00000414545|ENST00000507661	T;T|.	0.44482|.	0.92;0.92|.	4.93|4.93	-7.12|-7.12	0.01537|0.01537	Src homology-3 domain (4);|.	0.181638|.	0.52532|.	D|.	0.000070|.	T|T	0.52917|0.52917	0.1764|0.1764	L|L	0.55481|0.55481	1.735|1.735	0.32175|0.32175	N|N	0.581127|0.581127	D;D;D;D|.	0.89917|.	1.0;0.994;0.999;1.0|.	D;D;D;D|.	0.91635|.	0.999;0.98;0.99;0.999|.	T|T	0.59279|0.59279	-0.7484|-0.7484	10|5	0.87932|.	D|.	0|.	.|.	15.92|15.92	0.79556|0.79556	0.0:0.3063:0.0:0.6937|0.0:0.3063:0.0:0.6937	.|.	205;353;370;772|.	Q9H7G7;Q86T21;E7EUW5;A1A4S6|.	.;.;.;RHG10_HUMAN|.	K|G	772;370|399	ENSP00000336923:N772K;ENSP00000406624:N370K|.	ENSP00000336923:N772K|.	N|R	+|+	3|1	2|2	ARHGAP10|ARHGAP10	149212637|149212637	0.016000|0.016000	0.18221|0.18221	0.747000|0.747000	0.31113|0.31113	0.789000|0.789000	0.44602|0.44602	-1.119000|-1.119000	0.03276|0.03276	-1.623000|-1.623000	0.01558|0.01558	-3.230000|-3.230000	0.00052|0.00052	AAC|CGG			0.562	ARHGAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000365005.1		NM_024605	
SLC12A7	10723	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	1093664	1093664	+	Missense_Mutation	SNP	C	C	A	rs567086957		TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr5:1093664C>A	ENST00000264930.5	-	3	369	c.326G>T	c.(325-327)cGg>cTg	p.R109L		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	109					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	CTCCCGCCGCCGGCTCTCCTC	0.667																																					p.R109L													.	.			0			c.G326T												76.0	53.0	61.0					5																	1093664		2190	4291	6481	SO:0001583	missense	10723	exon3			CGCCGCCGGCTCT	AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.326G>T	5.37:g.1093664C>A	ENSP00000264930:p.Arg109Leu		Somatic	36	0	0		WXS	Illumina HiSeq	.	50	0.32	16	NM_006598	26	0.46	12	A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Missense_Mutation	SNP	ENST00000264930.5	37	CCDS34129.1	.	.	.	.	.	.	.	.	.	.	C	7.283	0.609489	0.14066	.	.	ENSG00000113504	ENST00000264930;ENST00000343658	D	0.84873	-1.91	3.86	-1.09	0.09904	.	0.176114	0.47455	D	0.000239	T	0.74921	0.3780	L	0.43152	1.355	0.30154	N	0.802817	B	0.24651	0.108	B	0.20767	0.031	T	0.64976	-0.6280	10	0.40728	T	0.16	.	8.0142	0.30372	0.0:0.2602:0.0:0.7398	.	109	Q9Y666	S12A7_HUMAN	L	109	ENSP00000264930:R109L	ENSP00000264930:R109L	R	-	2	0	SLC12A7	1146664	0.013000	0.17824	0.162000	0.22713	0.229000	0.25112	0.443000	0.21644	-0.069000	0.12931	0.455000	0.32223	CGG			0.667	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000366446.2		NM_006598	
ADCY2	108	broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	7707008	7707008	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr5:7707008G>T	ENST00000338316.4	+	8	1350	c.1261G>T	c.(1261-1263)Gtc>Ttc	p.V421F	ADCY2_ENST00000537121.1_Missense_Mutation_p.V241F|RP11-711G10.1_ENST00000514105.2_RNA	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	421					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						AGCTGGAGGGGTCCCTGGGTA	0.478																																					p.V421F													ADCY2,NS,carcinoma,-2,1	ADCY2	337	1	0			c.G1261T												145.0	132.0	136.0					5																	7707008		2203	4300	6503	SO:0001583	missense	108	exon8			GGAGGGGTCCCTG	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.1261G>T	5.37:g.7707008G>T	ENSP00000342952:p.Val421Phe		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	64	0.08	5	NM_020546	1	1.00	1	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	ENST00000338316.4	37	CCDS3872.2	.	.	.	.	.	.	.	.	.	.	G	21.9	4.210960	0.79240	.	.	ENSG00000078295	ENST00000338316;ENST00000541993;ENST00000537121	D;D	0.81908	-1.55;-1.55	5.29	4.42	0.53409	Adenylyl cyclase class-3/4/guanylyl cyclase (4);	0.061993	0.64402	D	0.000004	D	0.90191	0.6934	M	0.75150	2.29	0.42704	D	0.99362	D;D	0.89917	1.0;0.993	D;D	0.97110	1.0;0.983	D	0.91275	0.5047	10	0.72032	D	0.01	.	14.0088	0.64483	0.0727:0.0:0.9273:0.0	.	241;421	B7Z2C1;Q08462	.;ADCY2_HUMAN	F	421;272;241	ENSP00000342952:V421F;ENSP00000444803:V241F	ENSP00000342952:V421F	V	+	1	0	ADCY2	7760008	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.444000	0.66587	1.239000	0.43787	0.655000	0.94253	GTC			0.478	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206930.2		NM_020546	
PRDM9	56979	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	23527778	23527778	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr5:23527778G>A	ENST00000296682.3	+	11	2763	c.2581G>A	c.(2581-2583)Gtc>Atc	p.V861I		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	861					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						GAAGCCCTACGTCTGCAGGGA	0.592										HNSCC(3;0.000094)																											p.V861I													.	.			0			c.G2581A												72.0	80.0	77.0					5																	23527778		2188	4299	6487	SO:0001583	missense	56979	exon11			CCCTACGTCTGCA	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.2581G>A	5.37:g.23527778G>A	ENSP00000296682:p.Val861Ile		Somatic	209	0	0		WXS	Illumina HiSeq	.	191	0.20	39	NM_020227	0		0	B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	G	3.787	-0.044546	0.07452	.	.	ENSG00000164256	ENST00000296682	T	0.18810	2.19	2.67	0.738	0.18319	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17874	0.0429	N	0.25201	0.72	0.09310	N	1	D	0.61080	0.989	P	0.52793	0.709	T	0.11494	-1.0585	9	0.41790	T	0.15	-0.2631	3.6387	0.08158	0.132:0.0:0.4389:0.4291	.	861	Q9NQV7	PRDM9_HUMAN	I	861	ENSP00000296682:V861I	ENSP00000296682:V861I	V	+	1	0	PRDM9	23563535	0.000000	0.05858	0.645000	0.29479	0.274000	0.26718	-5.107000	0.00151	0.196000	0.20367	0.472000	0.43445	GTC			0.592	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000366375.1		NM_020227	
EGFLAM	133584	hgsc.bcm.edu;broad.mit.edu	37	5	38448404	38448404	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr5:38448404G>T	ENST00000354891.3	+	19	2836	c.2490G>T	c.(2488-2490)acG>acT	p.T830T	EGFLAM_ENST00000397210.3_5'UTR|EGFLAM_ENST00000514476.1_5'UTR|EGFLAM_ENST00000322350.5_Splice_Site_p.A822A|EGFLAM_ENST00000336740.6_Splice_Site_p.A588A|EGFLAM_ENST00000397202.2_Splice_Site_p.A188A|EGFLAM_ENST00000506135.1_5'UTR	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	830					extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					CTGTCCCAGCGATCATAGAAG	0.478																																					p.T830T	Colon(62;485 1295 3347 17454)												.	.			0			c.G2490T												177.0	178.0	178.0					5																	38448404		2203	4300	6503	SO:0001630	splice_region_variant	133584	exon19			CCCAGCGATCATA	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.2489-1G>T	5.37:g.38448404G>T			Somatic	69	0	0		WXS	Illumina HiSeq	.	70	0.06	4	NM_001205301	24	0.00	0	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Silent	SNP	ENST00000354891.3	37	CCDS56363.1																																																																																					0.478	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000367323.1		NM_152403	Silent
BMP6	654	mdanderson.org	37	6	7727541	7727541	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr6:7727541A>T	ENST00000283147.6	+	1	512	c.353A>T	c.(352-354)cAg>cTg	p.Q118L		NM_001718.4	NP_001709.1	P22004	BMP6_HUMAN	bone morphogenetic protein 6	118					BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular response to mechanical stimulus (GO:0071260)|endochondral ossification (GO:0001958)|eye development (GO:0001654)|growth (GO:0040007)|immune response (GO:0006955)|inflammatory response (GO:0006954)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|osteoblast differentiation (GO:0001649)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of bone mineralization (GO:0030501)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to activity (GO:0014823)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to retinoic acid (GO:0032526)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|type B pancreatic cell development (GO:0003323)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)|protein heterodimerization activity (GO:0046982)	p.Q118L(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	23	Ovarian(93;0.0721)					cagcagcagcagcTGCCTCGC	0.731																																					p.Q118L													BMP6,NS,carcinoma,0,1	BMP6	0	1	1	Substitution - Missense(1)	lung(1)	c.A353T																																									SO:0001583	missense	654	exon1			AGCAGCAGCTGCC	AF083030	CCDS4503.1	6p24-p23	2014-01-30	2003-10-06		ENSG00000153162	ENSG00000153162		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1073	protein-coding gene	gene with protein product		112266	"""vegetal related growth factor (TGFB-related)"""	VGR		1427904, 1453478	Standard	NM_001718		Approved	VGR1	uc003mxu.4	P22004	OTTHUMG00000014217	ENST00000283147.6:c.353A>T	6.37:g.7727541A>T	ENSP00000283147:p.Gln118Leu		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	25	0.12	3	NM_001718	2	0.00	0	Q5TCP3	Missense_Mutation	SNP	ENST00000283147.6	37	CCDS4503.1	.	.	.	.	.	.	.	.	.	.	A	5.648	0.304211	0.10678	.	.	ENSG00000153162	ENST00000537240;ENST00000283147;ENST00000540959	T	0.72725	-0.68	3.64	-7.28	0.01456	Transforming growth factor-beta, N-terminal (1);	0.609742	0.13235	N	0.403351	T	0.27134	0.0665	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.10382	-1.0632	10	0.41790	T	0.15	.	2.9855	0.05966	0.1788:0.4954:0.0931:0.2327	.	118	P22004	BMP6_HUMAN	L	40;118;81	ENSP00000283147:Q118L	ENSP00000283147:Q118L	Q	+	2	0	BMP6	7672540	0.177000	0.23109	0.002000	0.10522	0.071000	0.16799	-0.158000	0.10070	-1.400000	0.02061	-1.802000	0.00618	CAG			0.731	BMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039794.1		NM_001718	
VARS2	57176	broad.mit.edu	37	6	30882614	30882614	+	Start_Codon_SNP	SNP	A	A	G			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr6:30882614A>G	ENST00000321897.5	+	1	633	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	VARS2_ENST00000542001.1_Intron|VARS2_ENST00000541562.1_Missense_Mutation_p.M31V|VARS2_ENST00000416670.2_Start_Codon_SNP_p.M1V			Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial	1					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(3)|prostate(3)|skin(4)|urinary_tract(1)	46						AACACTCCTGATGCCTCATTT	0.552																																					p.M31V													.	VARS2	60		0			c.A91G												45.0	50.0	48.0					6																	30882614		1509	2707	4216	SO:0001582	initiator_codon_variant	57176	exon2			CTCCTGATGCCTC	AB067472	CCDS34387.1, CCDS54980.1	6p21.33	2012-10-26	2012-10-26	2007-02-23	ENSG00000137411	ENSG00000137411	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	21642	protein-coding gene	gene with protein product	"""valine tRNA ligase 2, mitochondrial"""	612802	"""valyl-tRNA synthetase 2-like"", ""valyl-tRNA synthetase like"", ""valyl-tRNA synthetase 2, mitochondrial (putative)"""	VARS2L, VARSL		1898367, 11572484, 18400783	Standard	NM_001167734		Approved	DKFZP434L1435, KIAA1885, G7a	uc011dmz.2	Q5ST30	OTTHUMG00000031263	ENST00000321897.5:c.1A>G	6.37:g.30882614A>G	ENSP00000316092:p.Met1Val		Somatic	131	0	0		WXS	Illumina HiSeq	Phase_I	158	0.03	4	NM_001167734	32	0.13	4	A2ABL7|B4DET4|B4E3P5|F5GXJ0|F5H323|Q2M2A0|Q59FI1|Q5SQ96|Q5SS98|Q6DKJ5|Q6ZV24|Q96GN2|Q96H77|Q96Q02|Q9H6R2|Q9UFH7	Missense_Mutation	SNP	ENST00000321897.5	37	CCDS34387.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.157841	0.78114	.	.	ENSG00000137411	ENST00000321897;ENST00000416670;ENST00000428017;ENST00000413959;ENST00000541562;ENST00000421263	T;T;T;T;T	0.33216	3.65;3.65;1.59;3.63;1.42	4.95	4.95	0.65309	.	0.000000	0.64402	D	0.000004	T	0.43122	0.1233	.	.	.	0.80722	D	1	P;P;P	0.43578	0.713;0.811;0.713	P;P;P	0.60789	0.761;0.879;0.761	T	0.43278	-0.9401	9	0.87932	D	0	-32.0524	11.1971	0.48719	1.0:0.0:0.0:0.0	.	1;31;1	B7ZL25;F5GXJ0;Q5ST30	.;.;SYVM_HUMAN	V	1;1;1;1;31;1	ENSP00000316092:M1V;ENSP00000394802:M1V;ENSP00000403749:M1V;ENSP00000441000:M31V;ENSP00000416390:M1V	ENSP00000316092:M1V	M	+	1	0	VARS2	30990593	1.000000	0.71417	0.996000	0.52242	0.884000	0.51177	3.862000	0.56009	2.204000	0.70986	0.528000	0.53228	ATG			0.552	VARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076566.2	rescued with RNA-seq	NM_020442	Missense_Mutation
MSH5	4439	mdanderson.org	37	6	31726391	31726391	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr6:31726391G>T	ENST00000375755.3	+	14	1496	c.1210G>T	c.(1210-1212)Gat>Tat	p.D404Y	RNU6-850P_ENST00000516934.1_RNA|MSH5-SAPCD1_ENST00000493662.2_Missense_Mutation_p.D421Y|MSH5_ENST00000375740.3_Missense_Mutation_p.D421Y|MSH5_ENST00000431848.2_Missense_Mutation_p.D103Y|MSH5_ENST00000375703.3_Missense_Mutation_p.D404Y|MSH5_ENST00000375742.3_Missense_Mutation_p.D421Y|MSH5_ENST00000395853.1_Missense_Mutation_p.D78Y|MSH5_ENST00000375750.3_Missense_Mutation_p.D404Y|MSH5_ENST00000534153.4_Missense_Mutation_p.D421Y	NM_002441.4	NP_002432.1	O43196	MSH5_HUMAN	mutS homolog 5	404					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)			breast(1)|ovary(2)|skin(2)	5						TCCTGAAATTGATGAGAGTGA	0.527								Direct reversal of damage;Mismatch excision repair (MMR)																													p.D421Y													.	.			0			c.G1261T												90.0	75.0	80.0					6																	31726391		1511	2709	4220	SO:0001583	missense	4439	exon14			GAAATTGATGAGA	AF070071	CCDS4720.1, CCDS34409.1, CCDS34410.1, CCDS34409.2	6p21.3	2013-09-12	2013-09-12		ENSG00000204410	ENSG00000204410			7328	protein-coding gene	gene with protein product		603382	"""mutS (E. coli) homolog 5"", ""mutS homolog 5 (E. coli)"""			9740671, 9787078, 17977839	Standard	NM_002441		Approved		uc011hbg.2	O43196	OTTHUMG00000167551	ENST00000375755.3:c.1210G>T	6.37:g.31726391G>T	ENSP00000364908:p.Asp404Tyr		Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	81	0.05	4	NM_025259	77	0.00	0	B0V033|B0V034|O60586|Q5BLU9|Q5SSR1|Q8IW44|Q9BQC7	Missense_Mutation	SNP	ENST00000375755.3	37	CCDS4720.1	.	.	.	.	.	.	.	.	.	.	G	31	5.100578	0.94245	.	.	ENSG00000204410	ENST00000375755;ENST00000375742;ENST00000375750;ENST00000534153;ENST00000375703;ENST00000375740;ENST00000450148;ENST00000431848;ENST00000395853	D;D;D;D;D;D;D;D;D	0.92699	-3.09;-3.09;-3.09;-3.09;-3.09;-3.09;-3.09;-3.09;-3.09	5.82	5.82	0.92795	DNA mismatch repair protein MutS, clamp (1);DNA mismatch repair protein MutS, core (3);	0.000000	0.85682	D	0.000000	D	0.96225	0.8769	M	0.85630	2.765	0.49051	D	0.999746	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;1.0	D	0.96364	0.9268	9	0.87932	D	0	-26.3795	17.5868	0.87983	0.0:0.0:1.0:0.0	.	89;421;404;404;421	Q59EC5;O43196-4;O43196;O43196-2;O43196-3	.;.;MSH5_HUMAN;.;.	Y	404;421;404;421;404;421;246;103;78	ENSP00000364908:D404Y;ENSP00000364894:D421Y;ENSP00000364903:D404Y;ENSP00000431693:D421Y;ENSP00000364855:D404Y;ENSP00000364892:D421Y;ENSP00000394971:D246Y;ENSP00000416784:D103Y;ENSP00000379194:D78Y	ENSP00000364855:D404Y	D	+	1	0	MSH5	31834370	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.354000	0.90080	2.756000	0.94617	0.561000	0.74099	GAT			0.527	MSH5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000076243.4			
IPCEF1	26034	mdanderson.org	37	6	154544307	154544307	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr6:154544307T>C	ENST00000265198.4	-	6	469	c.314A>G	c.(313-315)aAg>aGg	p.K105R	OPRM1_ENST00000337049.4_Intron|IPCEF1_ENST00000422970.2_Missense_Mutation_p.K106R|IPCEF1_ENST00000367220.4_Missense_Mutation_p.K106R|IPCEF1_ENST00000519344.1_Missense_Mutation_p.K77R	NM_001130700.1|NM_015553.2	NP_001124172.1|NP_056368.1	Q8WWN9	ICEF1_HUMAN	interaction protein for cytohesin exchange factors 1	105	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				oxidation-reduction process (GO:0055114)|oxygen transport (GO:0015671)|positive regulation of GTP catabolic process (GO:0033126)|response to oxidative stress (GO:0006979)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	oxygen transporter activity (GO:0005344)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	12						AACTTACTGCTTTTTCTTGCA	0.393																																					p.K106R													.	.			0			c.A317G												135.0	121.0	126.0					6																	154544307		2203	4300	6503	SO:0001583	missense	26034	exon7			TACTGCTTTTTCT	AB007863	CCDS5245.1, CCDS47509.1	6q25.2	2013-01-10			ENSG00000074706	ENSG00000074706		"""Pleckstrin homology (PH) domain containing"""	21204	protein-coding gene	gene with protein product	"""phosphoinositide binding protein PIP3-E"""					11804589, 19756519	Standard	NM_001130699		Approved	PIP3-E, KIAA0403	uc021zhc.1	Q8WWN9	OTTHUMG00000015872	ENST00000265198.4:c.314A>G	6.37:g.154544307T>C	ENSP00000265198:p.Lys105Arg		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_001130699	0		0	A8K1K2|B7ZL78|B7ZL80|O43153|Q5HYL8	Missense_Mutation	SNP	ENST00000265198.4	37	CCDS5245.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.552232	0.86127	.	.	ENSG00000074706	ENST00000265198;ENST00000422970;ENST00000367220;ENST00000519344;ENST00000517438;ENST00000519405;ENST00000519190	T;T;T;T;T;T;T	0.12672	2.66;2.66;2.66;2.66;2.66;2.66;2.66	5.82	5.82	0.92795	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.24586	0.0596	M	0.65677	2.01	0.36066	D	0.841762	P;D	0.89917	0.743;1.0	P;D	0.97110	0.838;1.0	T	0.03184	-1.1063	10	0.39692	T	0.17	.	13.7132	0.62680	0.0:0.0:0.0:1.0	.	105;106	Q8WWN9;Q8WWN9-2	ICEF1_HUMAN;.	R	105;106;106;77;77;77;77	ENSP00000265198:K105R;ENSP00000394751:K106R;ENSP00000356189:K106R;ENSP00000430287:K77R;ENSP00000431092:K77R;ENSP00000428767:K77R;ENSP00000429972:K77R	ENSP00000265198:K105R	K	-	2	0	IPCEF1	154585999	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	5.793000	0.69060	2.225000	0.72522	0.460000	0.39030	AAG			0.393	IPCEF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000042789.2		NM_001130699	
LPA	4018	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	160999712	160999712	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr6:160999712C>A	ENST00000316300.5	-	27	4358	c.4314G>T	c.(4312-4314)agG>agT	p.R1438S	LPA_ENST00000447678.1_Missense_Mutation_p.R1438S			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3946	Kringle 13. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	CATCTGGATTCCTGCAGTAGT	0.502																																					p.R1438S													.	.			0			c.G4314T												86.0	87.0	86.0					6																	160999712		2082	4245	6327	SO:0001583	missense	4018	exon28			TGGATTCCTGCAG	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.4314G>T	6.37:g.160999712C>A	ENSP00000321334:p.Arg1438Ser		Somatic	93	0	0		WXS	Illumina HiSeq	.	97	0.19	18	NM_005577	0		0	Q5VTD7|Q9UD88	Missense_Mutation	SNP	ENST00000316300.5	37	CCDS43523.1	.	.	.	.	.	.	.	.	.	.	c	13.09	2.134805	0.37728	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	D;D	0.93906	-3.31;-3.31	2.37	-2.14	0.07123	Kringle (4);Kringle-like fold (1);Kringle, conserved site (1);	.	.	.	.	D	0.96898	0.8987	H	0.98682	4.3	0.40094	D	0.976286	D	0.89917	1.0	D	0.97110	1.0	D	0.94786	0.7958	9	0.87932	D	0	.	9.5873	0.39524	0.0:0.6809:0.0:0.3191	.	3946	P08519	APOA_HUMAN	S	1438	ENSP00000321334:R1438S;ENSP00000395608:R1438S	ENSP00000321334:R1438S	R	-	3	2	LPA	160919702	0.037000	0.19845	0.286000	0.24833	0.145000	0.21501	-1.295000	0.02764	-0.950000	0.03659	-1.197000	0.01672	AGG			0.502	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042957.1		NM_005577	
TNS3	64759	mdanderson.org	37	7	47474985	47474985	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr7:47474985C>T	ENST00000398879.1	-	8	585	c.219G>A	c.(217-219)tgG>tgA	p.W73*	TNS3_ENST00000311160.9_Nonsense_Mutation_p.W73*|TNS3_ENST00000355730.3_Nonsense_Mutation_p.W73*|TNS3_ENST00000442536.2_Nonsense_Mutation_p.W73*|TNS3_ENST00000458317.2_Nonsense_Mutation_p.W73*			Q68CZ2	TENS3_HUMAN	tensin 3	73	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						GGAGCTCTGGCCAGCCCACAT	0.517																																					p.W73X													.	.			0			c.G219A												94.0	100.0	98.0					7																	47474985		2042	4198	6240	SO:0001587	stop_gained	64759	exon8			CTCTGGCCAGCCC	AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.219G>A	7.37:g.47474985C>T	ENSP00000381854:p.Trp73*		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_022748	19	0.00	0	B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Nonsense_Mutation	SNP	ENST00000398879.1	37	CCDS5506.2	.	.	.	.	.	.	.	.	.	.	C	38	7.211911	0.98139	.	.	ENSG00000136205	ENST00000311160;ENST00000538633;ENST00000398879;ENST00000355730;ENST00000457718;ENST00000450444;ENST00000442536;ENST00000458317;ENST00000415929;ENST00000413551	.	.	.	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.0366	16.4177	0.83748	0.0:1.0:0.0:0.0	.	.	.	.	X	73;183;73;73;176;162;73;73;73;73	.	ENSP00000312143:W73X	W	-	3	0	TNS3	47441510	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	7.608000	0.82898	2.534000	0.85438	0.650000	0.86243	TGG			0.517	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000157253.1		NM_022748	
POM121L12	285877	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	53103898	53103898	+	Silent	SNP	G	G	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr7:53103898G>T	ENST00000408890.4	+	1	550	c.534G>T	c.(532-534)ctG>ctT	p.L178L		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	178										endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						GGGAGACTCTGCTGGGGGCGC	0.706																																					p.L178L													.	.			0			c.G534T												23.0	28.0	26.0					7																	53103898		1889	4098	5987	SO:0001819	synonymous_variant	285877	exon1			GACTCTGCTGGGG		CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.534G>T	7.37:g.53103898G>T			Somatic	35	0	0		WXS	Illumina HiSeq	.	34	0.26	9	NM_182595	0		0	Q8NDI9	Silent	SNP	ENST00000408890.4	37	CCDS43584.1																																																																																					0.706	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000342656.1		NM_182595	
CCT6P3	643180	broad.mit.edu	37	7	64528813	64528814	+	RNA	INS	-	-	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr7:64528813_64528814insT	ENST00000426828.1	+	0	621				SNORA22_ENST00000384614.1_RNA|SNORA15_ENST00000384334.1_RNA	NR_033416.1				chaperonin containing TCP1, subunit 6 (zeta) pseudogene 3																		CTTTCTGTAACTTTTTTTTTTT	0.317																																					.													.	.			0			.																																											0	.			CTGTAACTTTTTT			7q11.21	2010-06-29			ENSG00000234585	ENSG00000234585			35137	pseudogene	pseudogene							Standard	NR_033416		Approved		uc010kzt.1		OTTHUMG00000156630		7.37:g.64528824_64528824dupT			Somatic	11	0	0		WXS	Illumina HiSeq	Phase_I	9	0.33	3	.	2	0.00	0		RNA	INS	ENST00000426828.1	37																																																																																						0.317	CCT6P3-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000344862.1			
GTF2IRD2P1	401375	broad.mit.edu	37	7	72663998	72663998	+	RNA	SNP	T	T	G			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr7:72663998T>G	ENST00000425256.1	-	0	902									GTF2I repeat domain containing 2 pseudogene 1																		ATAGCCGGGGTCCTTGAATAC	0.488																																					.													.	.			0			.																																											0	.			CCGGGGTCCTTGA	AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72663998T>G			Somatic	110	0.0090909091	1		WXS	Illumina HiSeq	Phase_I	134	0.02	3	.	0		0		RNA	SNP	ENST00000425256.1	37																																																																																						0.488	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000345921.1		NR_002164	
KMT2C	58508	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	151845608	151845608	+	Silent	SNP	C	C	T	rs563166492		TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr7:151845608C>T	ENST00000262189.6	-	52	13622	c.13404G>A	c.(13402-13404)acG>acA	p.T4468T	KMT2C_ENST00000355193.2_Silent_p.T4525T	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	4468					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.T4468T(2)|p.T4525T(2)									TAGTGGCACCCGTCTTGTGAC	0.458																																					p.T4468T													.	.			4	Substitution - coding silent(4)	lung(4)	c.G13404A												166.0	164.0	165.0					7																	151845608		2203	4300	6503	SO:0001819	synonymous_variant	58508	exon52			GGCACCCGTCTTG	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.13404G>A	7.37:g.151845608C>T			Somatic	86	0	0		WXS	Illumina HiSeq	.	108	0.06	6	NM_170606	24	0.00	0	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Silent	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	T	5.418	0.262368	0.10294	.	.	ENSG00000055609	ENST00000360104	.	.	.	5.24	0.856	0.19019	.	.	.	.	.	T	0.66025	0.2748	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60459	-0.7259	4	.	.	.	.	13.355	0.60623	0.0:0.7991:0.1134:0.0875	.	.	.	.	R	2029	.	.	G	-	1	0	MLL3	151476541	0.987000	0.35691	0.272000	0.24630	0.935000	0.57460	0.231000	0.17872	-0.294000	0.08973	-1.253000	0.01494	GGG			0.458	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000318887.3			
MFHAS1	9258	mdanderson.org	37	8	8748682	8748682	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr8:8748682G>T	ENST00000276282.6	-	1	2473	c.1887C>A	c.(1885-1887)tgC>tgA	p.C629*		NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	629	Roc. {ECO:0000255|PROSITE- ProRule:PRU00758}.									endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		GCGGGTCCCTGCAGCTAACAG	0.572																																					p.C629X	Melanoma(103;1201 2045 17515 28966)												.	.			0			c.C1887A												74.0	63.0	66.0					8																	8748682		2203	4300	6503	SO:0001587	stop_gained	9258	exon1			GTCCCTGCAGCTA	AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.1887C>A	8.37:g.8748682G>T	ENSP00000276282:p.Cys629*		Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	25	0.12	3	NM_004225	15	0.00	0	Q96CI0	Nonsense_Mutation	SNP	ENST00000276282.6	37	CCDS34844.1	.	.	.	.	.	.	.	.	.	.	G	44	10.924570	0.99489	.	.	ENSG00000147324	ENST00000276282	.	.	.	5.28	3.5	0.40072	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	8.025	0.30431	0.2416:0.0:0.7584:0.0	.	.	.	.	X	629	.	ENSP00000276282:C629X	C	-	3	2	MFHAS1	8786092	1.000000	0.71417	1.000000	0.80357	0.783000	0.44284	3.857000	0.55972	0.802000	0.34089	0.655000	0.94253	TGC			0.572	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000374724.2		NM_004225	
RP1L1	94137	hgsc.bcm.edu	37	8	10465934	10465934	+	Missense_Mutation	SNP	T	T	C	rs202056828		TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr8:10465934T>C	ENST00000382483.3	-	4	5897	c.5674A>G	c.(5674-5676)Acc>Gcc	p.T1892A		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1972					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GCCTCTGGGGTCTCTACATCT	0.607																																					p.T1892A													RP1L1,NS,carcinoma,+1,1	RP1L1	1	1	0			c.A5674G																																									SO:0001583	missense	94137	exon4			CTGGGGTCTCTAC	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.5674A>G	8.37:g.10465934T>C	ENSP00000371923:p.Thr1892Ala		Somatic	64	0.03125	2		WXS	Illumina HiSeq	.	56	0.18	10	NM_178857	0		0	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	c	0.006	-2.056342	0.00390	.	.	ENSG00000183638	ENST00000382483	T	0.07114	3.22	1.4	-2.8	0.05823	.	.	.	.	.	T	0.01976	0.0062	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33085	-0.9882	9	0.07644	T	0.81	.	0.9492	0.01372	0.1582:0.2711:0.3144:0.2564	.	1892	A6NKC6	.	A	1892	ENSP00000371923:T1892A	ENSP00000371923:T1892A	T	-	1	0	RP1L1	10503344	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.473000	0.00988	-2.494000	0.00514	-3.032000	0.00072	ACC			0.607	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000375673.1			
RP1L1	94137	bcgsc.ca	37	8	10466034	10466034	+	Silent	SNP	C	C	T	rs547703957	byFrequency	TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr8:10466034C>T	ENST00000382483.3	-	4	5797	c.5574G>A	c.(5572-5574)ggG>ggA	p.G1858G		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1938					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CCTGGGCATCCCCTTCTGCCT	0.622													C|||	18	0.00359425	0.0	0.0	5008	,	,		15574	0.001		0.0	False		,,,				2504	0.0174				p.G1858G													.	RP1L1	453		0			c.G5574A												161.0	173.0	169.0					8																	10466034		1912	4122	6034	SO:0001819	synonymous_variant	94137	exon4			GGCATCCCCTTCT	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.5574G>A	8.37:g.10466034C>T			Somatic	79	0	0		WXS	Illumina HiSeq	Phase_1	27	0.19	5	NM_178857	0		0	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Silent	SNP	ENST00000382483.3	37	CCDS43708.1																																																																																					0.622	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000375673.1			
ADAM28	10863	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	24151704	24151704	+	Silent	SNP	T	T	G	rs547338346		TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr8:24151704T>G	ENST00000265769.4	+	1	152	c.42T>G	c.(40-42)gtT>gtG	p.V14V	RP11-624C23.1_ENST00000523700.1_RNA|ADAM28_ENST00000540823.1_5'UTR|ADAM28_ENST00000397649.3_5'UTR|ADAM28_ENST00000437154.2_Silent_p.V14V|RP11-624C23.1_ENST00000518988.1_RNA	NM_014265.4	NP_055080.2	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28	14					spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(7)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		TCCTCTCTGTTGCAGGTACAT	0.438													T|||	1	0.000199681	0.0	0.0	5008	,	,		18806	0.0		0.0	False		,,,				2504	0.001				p.V14V	NSCLC(193;488 2149 22258 34798 40734)												.	.			0			c.T42G												225.0	204.0	211.0					8																	24151704		2203	4300	6503	SO:0001819	synonymous_variant	10863	exon1			CTCTGTTGCAGGT	AJ242015	CCDS34865.1, CCDS47830.1	8p21.2	2005-11-29	2005-08-18		ENSG00000042980	ENSG00000042980		"""ADAM metallopeptidase domain containing"""	206	protein-coding gene	gene with protein product		606188	"""a disintegrin and metalloproteinase domain 28"""				Standard	XM_005273378		Approved	eMDCII, MDC-Lm, MDC-Ls, ADAM23	uc003xdy.3	Q9UKQ2	OTTHUMG00000163780	ENST00000265769.4:c.42T>G	8.37:g.24151704T>G			Somatic	87	0	0		WXS	Illumina HiSeq	.	82	0.18	15	NM_014265	0		0	B2RMV5|Q9Y339|Q9Y3S0	Silent	SNP	ENST00000265769.4	37	CCDS34865.1																																																																																					0.438	ADAM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000375441.2		NM_021778	
ZC3H3	23144	broad.mit.edu	37	8	144522222	144522222	+	Missense_Mutation	SNP	G	G	C	rs112624965		TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr8:144522222G>C	ENST00000262577.5	-	11	2835	c.2804C>G	c.(2803-2805)aCc>aGc	p.T935S		NM_015117.2	NP_055932.2	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	935					mRNA polyadenylation (GO:0006378)|poly(A)+ mRNA export from nucleus (GO:0016973)|regulation of mRNA export from nucleus (GO:0010793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			TGAGTCCTTGGTGAGGGGGGC	0.706																																					p.T935S													.	ZC3H3	75		0			c.C2804G												6.0	7.0	7.0					8																	144522222		2141	4211	6352	SO:0001583	missense	23144	exon11			TCCTTGGTGAGGG	D63484	CCDS6402.1	8q24.3	2012-07-05	2005-06-02	2005-06-02	ENSG00000014164	ENSG00000014164		"""Zinc fingers, CCCH-type domain containing"""	28972	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 3"""	ZC3HDC3		8590280	Standard	NM_015117		Approved	KIAA0150	uc003yyd.2	Q8IXZ2	OTTHUMG00000165127	ENST00000262577.5:c.2804C>G	8.37:g.144522222G>C	ENSP00000262577:p.Thr935Ser		Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	44	0.11	5	NM_015117	83	0.00	0	Q14163|Q8N4E2|Q9BUS4	Missense_Mutation	SNP	ENST00000262577.5	37	CCDS6402.1	.	.	.	.	.	.	.	.	.	.	G	3.759	-0.049963	0.07407	.	.	ENSG00000014164	ENST00000262577	T	0.03035	4.07	4.32	-0.682	0.11339	.	1.961550	0.02619	N	0.102980	T	0.02610	0.0079	N	0.24115	0.695	0.09310	N	1	B	0.15141	0.012	B	0.08055	0.003	T	0.40098	-0.9581	10	0.07325	T	0.83	-0.8938	3.9574	0.09396	0.282:0.3704:0.3476:0.0	.	935	Q8IXZ2	ZC3H3_HUMAN	S	935	ENSP00000262577:T935S	ENSP00000262577:T935S	T	-	2	0	ZC3H3	144593365	0.000000	0.05858	0.049000	0.19019	0.295000	0.27426	-1.355000	0.02612	-0.130000	0.11599	0.453000	0.30009	ACC			0.706	ZC3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382011.2		NM_015117	
SLC24A2	25769	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	19597247	19597247	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr9:19597247T>C	ENST00000341998.2	-	4	1170	c.1109A>G	c.(1108-1110)tAt>tGt	p.Y370C	SLC24A2_ENST00000286344.3_Intron	NM_001193288.2|NM_020344.3	NP_001180217.1|NP_065077.1	Q9UI40	NCKX2_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 2	370					cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	cadmium ion binding (GO:0046870)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium, potassium:sodium antiporter activity (GO:0008273)|manganese ion binding (GO:0030145)|nickel cation binding (GO:0016151)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|symporter activity (GO:0015293)			endometrium(3)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		CATTGTGTCATAATATTTTAG	0.303																																					p.Y370C													.	SLC24A2	93		0			c.A1109G												213.0	196.0	202.0					9																	19597247		2199	4300	6499	SO:0001583	missense	25769	exon4			GTGTCATAATATT	AF097366	CCDS6493.1, CCDS55297.1	9p22.1	2013-05-22			ENSG00000155886	ENSG00000155886		"""Solute carriers"""	10976	protein-coding gene	gene with protein product		609838				10662833	Standard	NM_020344		Approved	NCKX2	uc003zoa.2	Q9UI40	OTTHUMG00000019646	ENST00000341998.2:c.1109A>G	9.37:g.19597247T>C	ENSP00000344801:p.Tyr370Cys		Somatic	151	0.0066225166	1		WXS	Illumina HiSeq	Phase_I	134	0.28	38	NM_020344	0		0	B7ZLL8|Q9NTN5|Q9NZQ4	Missense_Mutation	SNP	ENST00000341998.2	37	CCDS6493.1	.	.	.	.	.	.	.	.	.	.	T	14.28	2.489553	0.44249	.	.	ENSG00000155886	ENST00000341998	T	0.75050	-0.9	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	T	0.71533	0.3351	L	0.57536	1.79	0.80722	D	1	B	0.24186	0.099	B	0.22601	0.04	T	0.66582	-0.5887	9	.	.	.	.	16.5932	0.84781	0.0:0.0:0.0:1.0	.	370	Q9UI40	NCKX2_HUMAN	C	370	ENSP00000344801:Y370C	.	Y	-	2	0	SLC24A2	19587247	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.474000	0.81024	2.320000	0.78422	0.528000	0.53228	TAT			0.303	SLC24A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051866.2		NM_020344	
UNC13B	10497	ucsc.edu;bcgsc.ca	37	9	35397638	35397638	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr9:35397638G>T	ENST00000378495.3	+	29	3658	c.3436G>T	c.(3436-3438)Ggg>Tgg	p.G1146W	UNC13B_ENST00000396787.1_Missense_Mutation_p.G1158W|UNC13B_ENST00000378496.4_Missense_Mutation_p.G1146W|UNC13B_ENST00000481299.1_3'UTR	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	1146	MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			tcAGACCATCGGGAAGGTGCT	0.478																																					p.G1146W													.	UNC13B	153		0			c.G3436T												57.0	49.0	51.0					9																	35397638		2203	4300	6503	SO:0001583	missense	10497	exon29			ACCATCGGGAAGG	AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.3436G>T	9.37:g.35397638G>T	ENSP00000367756:p.Gly1146Trp		Somatic	33	0	0		WXS	Illumina HiSeq		32	0.13	4	NM_006377	32	0.00	0	Q5VYM8	Missense_Mutation	SNP	ENST00000378495.3	37	CCDS6579.1	.	.	.	.	.	.	.	.	.	.	G	17.78	3.472727	0.63737	.	.	ENSG00000198722	ENST00000396787;ENST00000378495;ENST00000378496;ENST00000535471	T;T;T	0.14144	2.53;2.53;2.53	5.33	5.33	0.75918	Munc13 homology 1 (1);	0.304376	0.38663	N	0.001611	T	0.24661	0.0598	L	0.36672	1.1	0.44816	D	0.997821	D;D	0.76494	0.999;0.999	D;D	0.66602	0.94;0.945	T	0.00489	-1.1709	10	0.62326	D	0.03	-21.9044	11.4835	0.50339	0.0819:0.0:0.9181:0.0	.	1146;1146	F8W8M9;O14795	.;UN13B_HUMAN	W	1158;1146;1146;733	ENSP00000380006:G1158W;ENSP00000367756:G1146W;ENSP00000367757:G1146W	ENSP00000367756:G1146W	G	+	1	0	UNC13B	35387638	0.704000	0.27836	0.989000	0.46669	0.840000	0.47671	0.960000	0.29253	2.479000	0.83701	0.563000	0.77884	GGG			0.478	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000052296.1		NM_006377	
DAB2IP	153090	mdanderson.org	37	9	124528809	124528809	+	Silent	SNP	G	G	T	rs371966536		TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr9:124528809G>T	ENST00000408936.3	+	9	1679	c.1497G>T	c.(1495-1497)tcG>tcT	p.S499S	DAB2IP_ENST00000259371.2_Silent_p.S471S|DAB2IP_ENST00000309989.1_Silent_p.S375S			Q5VWQ8	DAB2P_HUMAN	DAB2 interacting protein	499	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|angiogenesis (GO:0001525)|cell cycle (GO:0007049)|cell motility involved in cerebral cortex radial glia guided migration (GO:0021814)|cellular protein catabolic process (GO:0044257)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|layer formation in cerebral cortex (GO:0021819)|negative regulation of angiogenesis (GO:0016525)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of GTPase activity (GO:0034260)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatidylinositol 3-kinase activity (GO:0043553)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuron projection morphogenesis (GO:0048812)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of dendrite development (GO:1900006)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of synapse maturation (GO:0090129)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of ARF GTPase activity (GO:0032312)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein complex assembly (GO:0043254)|response to unfolded protein (GO:0006986)|transformed cell apoptotic process (GO:0006927)|tube formation (GO:0035148)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	axon (GO:0030424)|cerebellar mossy fiber (GO:0044300)|climbing fiber (GO:0044301)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|neuronal cell body (GO:0043025)|neuronal cell body membrane (GO:0032809)|parallel fiber (GO:1990032)|plasma membrane (GO:0005886)	14-3-3 protein binding (GO:0071889)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|mitogen-activated protein kinase kinase binding (GO:0031434)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase 2A binding (GO:0051721)|Ras GTPase activator activity (GO:0005099)|SH3 domain binding (GO:0017124)|signaling adaptor activity (GO:0035591)|vascular endothelial growth factor receptor 2 binding (GO:0043184)	p.S375S(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(8)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	27						TGTTTGCCTCGTGGAGGCAGG	0.632																																					p.S471S													DAB2IP_ENST00000259371,rectum,carcinoma,0,3	DAB2IP_ENST00000259371	0	3	1	Substitution - coding silent(1)	central_nervous_system(1)	c.G1413T												56.0	52.0	54.0					9																	124528809		2203	4300	6503	SO:0001819	synonymous_variant	153090	exon9			TGCCTCGTGGAGG	AF367051	CCDS6832.1, CCDS6833.2	9q33.1-q33.3	2008-07-21			ENSG00000136848	ENSG00000136848			17294	protein-coding gene	gene with protein product	"""nGAP-like protein"", ""DOC-2/DAB2 interactive protein"", ""ASK-interacting protein"", ""ASK1-interacting protein 1"""	609205				11944990, 11812785	Standard	XM_005251721		Approved	AF9Q34, DIP1/2, KIAA1743, AIP1	uc004bln.3	Q5VWQ8	OTTHUMG00000020595	ENST00000408936.3:c.1497G>T	9.37:g.124528809G>T			Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	24	0.08	2	NM_032552	21	0.00	0	A6H8V2|A6NHI9|B0QZB1|G3XA90|Q8TDL2|Q96SE1|Q9C0C0	Silent	SNP	ENST00000408936.3	37																																																																																						0.632	DAB2IP-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000317857.1		NM_032552	
SURF4	6836	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	136234314	136234314	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr9:136234314C>T	ENST00000371989.3	-	2	185	c.56G>A	c.(55-57)cGt>cAt	p.R19H	SURF4_ENST00000545297.1_Missense_Mutation_p.R19H|SURF4_ENST00000485435.2_Missense_Mutation_p.R19H|SURF4_ENST00000467910.1_5'UTR|SURF4_ENST00000371991.3_Missense_Mutation_p.R19H	NM_001280788.1|NM_001280790.1|NM_001280791.1|NM_033161.2	NP_001267717.1|NP_001267719.1|NP_001267720.1|NP_149351.1	O15260	SURF4_HUMAN	surfeit 4	19					Golgi organization (GO:0007030)|positive regulation of organelle organization (GO:0010638)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(5)	8				OV - Ovarian serous cystadenocarcinoma(145;5.32e-07)|Epithelial(140;4.56e-06)|all cancers(34;4.25e-05)		CTTTGTGACACGGAGGAACTG	0.657																																					p.R19H													.	.			0			c.G56A												70.0	62.0	65.0					9																	136234314		2203	4300	6503	SO:0001583	missense	6836	exon2			GTGACACGGAGGA		CCDS6968.1, CCDS65177.1, CCDS65178.1, CCDS75929.1	9q33-q34	2008-07-21			ENSG00000148248	ENSG00000148248			11476	protein-coding gene	gene with protein product	"""surfeit locus protein 4"", ""surface 4 integral membrane protein"""	185660				8499913, 7540914	Standard	NM_033161		Approved	ERV29, FLJ22993, MGC102753	uc004cdj.3	O15260	OTTHUMG00000020868	ENST00000371989.3:c.56G>A	9.37:g.136234314C>T	ENSP00000361057:p.Arg19His		Somatic	49	0	0		WXS	Illumina HiSeq	.	41	0.12	5	NM_033161	186	0.25	47	B7Z6A4|O60923|Q5T8U6|Q9UNZ0|Q9UNZ1	Missense_Mutation	SNP	ENST00000371989.3	37	CCDS6968.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.031785	0.93575	.	.	ENSG00000148248	ENST00000371989;ENST00000485435;ENST00000545297;ENST00000541390;ENST00000371991	.	.	.	4.97	4.97	0.65823	.	0.062561	0.64402	D	0.000007	T	0.62073	0.2398	L	0.56280	1.765	0.80722	D	1	D;P;D;P	0.56968	0.978;0.899;0.973;0.899	P;P;P;P	0.48873	0.593;0.484;0.48;0.567	T	0.66376	-0.5939	9	0.54805	T	0.06	-1.4315	17.2458	0.87027	0.0:1.0:0.0:0.0	.	19;10;19;19	B7Z6A4;B7Z7A8;O15260-2;O15260	.;.;.;SURF4_HUMAN	H	19;19;19;10;19	.	ENSP00000361057:R19H	R	-	2	0	SURF4	135224135	1.000000	0.71417	0.847000	0.33407	0.989000	0.77384	7.601000	0.82783	2.290000	0.77057	0.655000	0.94253	CGT			0.657	SURF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054886.1		NM_033161	
SNAPC4	6621	mdanderson.org	37	9	139272510	139272510	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr9:139272510G>T	ENST00000298532.2	-	21	4137	c.3769C>A	c.(3769-3771)Ccg>Acg	p.P1257T		NM_003086.2	NP_003077.2			small nuclear RNA activating complex, polypeptide 4, 190kDa											biliary_tract(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	33		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		GGTAGGGGCGGCTTCTCCAGG	0.741																																					p.P1257T													.	.			0			c.C3769A												4.0	4.0	4.0					9																	139272510		1843	3742	5585	SO:0001583	missense	6621	exon21			GGGGCGGCTTCTC	AF032387	CCDS6998.1	9q34.3	2008-07-21	2002-08-29		ENSG00000165684	ENSG00000165684			11137	protein-coding gene	gene with protein product		602777	"""small nuclear RNA activating complex, polypeptide 4, 190kD"""			9418884	Standard	XM_005266096		Approved	SNAP190, PTFalpha, FLJ13451	uc004chh.3	Q5SXM2	OTTHUMG00000020929	ENST00000298532.2:c.3769C>A	9.37:g.139272510G>T	ENSP00000298532:p.Pro1257Thr		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	28	0.11	3	NM_003086	17	0.00	0		Missense_Mutation	SNP	ENST00000298532.2	37	CCDS6998.1	.	.	.	.	.	.	.	.	.	.	g	8.507	0.865587	0.17250	.	.	ENSG00000165684	ENST00000298532	T	0.32272	1.46	1.6	-3.2	0.05156	.	0.810672	0.10958	N	0.615271	T	0.23210	0.0561	L	0.54323	1.7	0.09310	N	1	P	0.35700	0.516	B	0.37267	0.245	T	0.17930	-1.0353	10	0.41790	T	0.15	-1.5917	3.5814	0.07955	0.3006:0.207:0.4923:0.0	.	1257	Q5SXM2	SNPC4_HUMAN	T	1257	ENSP00000298532:P1257T	ENSP00000298532:P1257T	P	-	1	0	SNAPC4	138392331	0.049000	0.20398	0.000000	0.03702	0.003000	0.03518	-0.287000	0.08388	-0.599000	0.05798	0.306000	0.20318	CCG			0.741	SNAPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055071.1		NM_003086	
TCEANC	170082	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	13681576	13681576	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chrX:13681576C>T	ENST00000380600.1	+	2	1036	c.949C>T	c.(949-951)Ctt>Ttt	p.L317F	TCEANC_ENST00000544987.1_Missense_Mutation_p.L317F|TCEANC_ENST00000545566.1_Missense_Mutation_p.L317F|TCEANC_ENST00000490617.1_3'UTR|TCEANC_ENST00000314720.4_Missense_Mutation_p.L347F			Q8N8B7	TEANC_HUMAN	transcription elongation factor A (SII) N-terminal and central domain containing	317					regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|large_intestine(5)|lung(2)|pancreas(1)	9						AACACTTTTCCTTCCCAGCTG	0.423																																					p.L347F													.	.			0			c.C1039T												48.0	40.0	42.0					X																	13681576		1913	4098	6011	SO:0001583	missense	170082	exon4			CTTTTCCTTCCCA		CCDS48081.1, CCDS75954.1	Xp22.2	2009-01-30			ENSG00000176896	ENSG00000176896			28277	protein-coding gene	gene with protein product						12477932	Standard	XM_005274454		Approved	MGC17403	uc010neg.1	Q8N8B7	OTTHUMG00000021154	ENST00000380600.1:c.949C>T	X.37:g.13681576C>T	ENSP00000369974:p.Leu317Phe		Somatic	108	0	0		WXS	Illumina HiSeq	.	123	0.10	12	NM_152634	3	0.00	0	A6NI06|B2RDM3	Missense_Mutation	SNP	ENST00000380600.1	37		.	.	.	.	.	.	.	.	.	.	C	18.63	3.666070	0.67700	.	.	ENSG00000176896	ENST00000545566;ENST00000544987;ENST00000314720;ENST00000380600	T;T;T;T	0.49720	0.8;0.8;0.77;0.8	5.41	4.54	0.55810	.	0.089400	0.43416	N	0.000580	T	0.60274	0.2256	M	0.68317	2.08	0.44562	D	0.997522	D;D	0.64830	0.994;0.99	P;P	0.56474	0.799;0.484	T	0.65417	-0.6173	10	0.72032	D	0.01	.	13.7411	0.62849	0.0:0.9225:0.0:0.0775	.	347;317	Q8N8B7-2;Q8N8B7	.;TEANC_HUMAN	F	317;317;347;317	ENSP00000438952:L317F;ENSP00000440038:L317F;ENSP00000313886:L347F;ENSP00000369974:L317F	ENSP00000313886:L347F	L	+	1	0	TCEANC	13591497	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.260000	0.43267	2.272000	0.75746	0.600000	0.82982	CTT			0.423	TCEANC-002	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000055796.1		NM_152634	
PHEX	5251	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	22208575	22208575	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chrX:22208575C>T	ENST00000379374.4	+	15	2166	c.1601C>T	c.(1600-1602)cCg>cTg	p.P534L	PHEX_ENST00000537599.1_Missense_Mutation_p.P534L|PHEX_ENST00000535894.1_Missense_Mutation_p.P437L|PHEX_ENST00000418858.3_Missense_Mutation_p.P237L	NM_000444.4	NP_000435.3	P78562	PHEX_HUMAN	phosphate regulating endopeptidase homolog, X-linked	534			P -> L (in XLHR). {ECO:0000269|PubMed:9097956, ECO:0000269|PubMed:9199930, ECO:0000269|PubMed:9768674}.		bone mineralization (GO:0030282)|cell-cell signaling (GO:0007267)|cellular protein modification process (GO:0006464)|organophosphate metabolic process (GO:0019637)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|cervix(2)|endometrium(2)|large_intestine(12)|liver(1)|lung(19)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	42						TTTACAAATCCGACGACTGTC	0.443																																					p.P534L													.	.			0			c.C1601T	GRCh37	CM971163	PHEX	M								183.0	154.0	164.0					X																	22208575		2203	4300	6503	SO:0001583	missense	5251	exon15			CAAATCCGACGAC	U82970	CCDS14204.1	Xp22.2-p22.1	2008-07-31	2008-07-31		ENSG00000102174	ENSG00000102174			8918	protein-coding gene	gene with protein product		300550	"""phosphate regulating gene with homologies to endopeptidases on the X chromosome (hypophosphatemia, vitamin D resistant rickets)"""	HYP, HPDR		7550339, 9070861	Standard	NM_000444		Approved	PEX, HPDR1, HYP1, XLH	uc004dah.3	P78562	OTTHUMG00000021241	ENST00000379374.4:c.1601C>T	X.37:g.22208575C>T	ENSP00000368682:p.Pro534Leu		Somatic	67	0	0		WXS	Illumina HiSeq	.	80	0.26	21	NM_000444	3	0.33	1	O00678|Q13646|Q2M325|Q93032|Q99827	Missense_Mutation	SNP	ENST00000379374.4	37	CCDS14204.1	.	.	.	.	.	.	.	.	.	.	c	18.24	3.581345	0.65992	.	.	ENSG00000102174	ENST00000379374;ENST00000537599;ENST00000535894;ENST00000418858	D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76	5.25	5.25	0.73442	Peptidase M13, neprilysin, C-terminal (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.91825	0.7413	M	0.87547	2.89	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.93055	0.6469	10	0.87932	D	0	.	14.6117	0.68519	0.0:1.0:0.0:0.0	.	534;534	F5GXU4;P78562	.;PHEX_HUMAN	L	534;534;437;237	ENSP00000368682:P534L;ENSP00000440362:P534L;ENSP00000439418:P437L;ENSP00000443531:P237L	ENSP00000368682:P534L	P	+	2	0	PHEX	22118496	1.000000	0.71417	0.977000	0.42913	0.516000	0.34256	5.672000	0.68102	2.427000	0.82271	0.540000	0.68198	CCG			0.443	PHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056035.1		NM_000444	
ZNF630	57232	broad.mit.edu	37	X	47919586	47919586	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chrX:47919586A>T	ENST00000409324.3	-	5	471	c.245T>A	c.(244-246)gTg>gAg	p.V82E	ZNF630-AS1_ENST00000436124.1_RNA|ZNF630_ENST00000442455.3_Missense_Mutation_p.V68E|ZNF630_ENST00000276054.4_5'UTR	NM_001037735.2	NP_001032824.2	Q2M218	ZN630_HUMAN	zinc finger protein 630	82					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(6)|lung(11)|ovary(1)	19						AAGGCCTTTCACTCTGTCTGA	0.408																																					p.V82E													.	ZNF630	71		0			c.T245A												36.0	23.0	27.0					X																	47919586		690	1585	2275	SO:0001583	missense	57232	exon5			CCTTTCACTCTGT	AK000580	CCDS35237.2, CCDS75971.1	Xp11.3-p11.1	2013-01-08			ENSG00000221994	ENSG00000221994		"""Zinc fingers, C2H2-type"", ""-"""	28855	protein-coding gene	gene with protein product		300819					Standard	NM_001037735		Approved	BC037316, dJ54B20.2, FLJ20573, MGC138344	uc004div.4	Q2M218	OTTHUMG00000021463	ENST00000409324.3:c.245T>A	X.37:g.47919586A>T	ENSP00000386393:p.Val82Glu		Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	66	0.17	11	NM_001037735	3	0.00	0	F8WAG4|Q5H8Z5	Missense_Mutation	SNP	ENST00000409324.3	37	CCDS35237.2	.	.	.	.	.	.	.	.	.	.	.	0.013	-1.626471	0.00813	.	.	ENSG00000221994	ENST00000442455;ENST00000409324;ENST00000428686	T;T;T	0.05258	3.47;3.53;5.53	1.93	0.647	0.17796	.	.	.	.	.	T	0.01765	0.0056	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46261	-0.9204	9	0.02654	T	1	.	3.744	0.08541	0.3488:0.0:0.0:0.6512	.	82	Q2M218	ZN630_HUMAN	E	68;82;82	ENSP00000393163:V68E;ENSP00000386393:V82E;ENSP00000407278:V82E	ENSP00000386393:V82E	V	-	2	0	ZNF630	47804530	0.000000	0.05858	0.003000	0.11579	0.424000	0.31475	-0.107000	0.10873	0.113000	0.18004	-0.946000	0.02672	GTG			0.408	ZNF630-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000327254.1		NM_001037735	
SSX9	280660	hgsc.bcm.edu	37	X	48161015	48161015	+	RNA	SNP	A	A	C			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chrX:48161015A>C	ENST00000608568.1	-	0	549					NR_073393.1		Q7RTT3	SSX9_HUMAN	synovial sarcoma, X breakpoint 9						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(2)|lung(2)|prostate(1)|stomach(1)	8						TGTTGGTGCTACATCAGGTGT	0.408																																					.													.	.			0			.																																											280660	.			GGTGCTACATCAG	BK000689		Xp11.23	2013-01-16			ENSG00000204648	ENSG00000204648			19655	other	unknown		300544				12216073	Standard	NR_073393		Approved		uc031tjk.1	Q7RTT3	OTTHUMG00000021490		X.37:g.48161015A>C			Somatic	152	0	0		WXS	Illumina HiSeq	.	167	0.32	54	.	0		0		RNA	SNP	ENST00000608568.1	37																																																																																						0.408	SSX9-002	KNOWN	basic	retained_intron	pseudogene		OTTHUMT00000472372.1		NR_073393	
GATA1	2623	broad.mit.edu	37	X	48652265	48652265	+	Silent	SNP	A	A	G			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chrX:48652265A>G	ENST00000376670.3	+	6	1047	c.936A>G	c.(934-936)aaA>aaG	p.K312K	GATA1_ENST00000376665.3_Intron	NM_002049.3	NP_002040.1	P15976	GATA1_HUMAN	GATA binding protein 1 (globin transcription factor 1)	312					basophil differentiation (GO:0030221)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cellular response to thyroid hormone stimulus (GO:0097067)|dendritic cell differentiation (GO:0097028)|embryonic hemopoiesis (GO:0035162)|eosinophil differentiation (GO:0030222)|eosinophil fate commitment (GO:0035854)|erythrocyte development (GO:0048821)|erythrocyte differentiation (GO:0030218)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|megakaryocyte differentiation (GO:0030219)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of definitive erythrocyte differentiation (GO:0010724)|regulation of glycoprotein biosynthetic process (GO:0010559)|transcription from RNA polymerase II promoter (GO:0006366)|transcriptional activation by promoter-enhancer looping (GO:0071733)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	C2H2 zinc finger domain binding (GO:0070742)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(259)|large_intestine(8)|lung(9)|prostate(1)	283						CATCTGGAAAAGGGAAAAAGA	0.592			"""Mis, F"""		megakaryoblastic leukemia of Downs Syndrome																																p.K312K	Pancreas(9;429 505 11287 29617)			Dom	yes		X	Xp11.23	2623	GATA binding protein 1 (globin transcription factor 1)		L	.	GATA1	342		0			c.A936G												33.0	30.0	31.0					X																	48652265		2203	4299	6502	SO:0001819	synonymous_variant	2623	exon6			TGGAAAAGGGAAA	X17254	CCDS14305.1	Xp11.23	2014-09-17	2001-11-28		ENSG00000102145	ENSG00000102145		"""GATA zinc finger domain containing"""	4170	protein-coding gene	gene with protein product	"""nuclear factor, erythroid 1"""	305371	"""GATA-binding protein 1 (globin transcription factor 1)"""	GF1		1999341	Standard	NM_002049		Approved	ERYF1, NFE1, GATA-1, NF-E1	uc004dkq.4	P15976	OTTHUMG00000021504	ENST00000376670.3:c.936A>G	X.37:g.48652265A>G			Somatic	105	0.0095238095	1		WXS	Illumina HiSeq	Phase_I	134	0.02	3	NM_002049	1	0.00	0	Q96GB8	Silent	SNP	ENST00000376670.3	37	CCDS14305.1	.	.	.	.	.	.	.	.	.	.	a	9.200	1.028202	0.19512	.	.	ENSG00000102145	ENST00000447551	D	0.99557	-6.16	3.94	2.73	0.32206	.	0.073027	0.52532	U	0.000069	D	0.98349	0.9452	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.96805	0.9592	7	0.21540	T	0.41	-7.1876	5.0415	0.14462	0.7489:0.0:0.2511:0.0	.	.	.	.	R	77	ENSP00000404985:K77R	ENSP00000404985:K77R	K	+	2	0	GATA1	48537209	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	2.019000	0.41001	1.459000	0.47892	0.299000	0.19835	AAG			0.592	GATA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056517.1		NM_002049	
SLC25A14	9016	broad.mit.edu	37	X	129474305	129474305	+	Missense_Mutation	SNP	C	C	T	rs371552768		TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chrX:129474305C>T	ENST00000218197.5	+	1	280	c.53C>T	c.(52-54)aCg>aTg	p.T18M	SLC25A14_ENST00000545805.1_Missense_Mutation_p.T18M|SLC25A14_ENST00000467496.1_3'UTR|SLC25A14_ENST00000361980.5_Missense_Mutation_p.T18M|SLC25A14_ENST00000339231.3_Missense_Mutation_p.T18M|SLC25A14_ENST00000543953.1_Intron	NM_001282195.1|NM_001282196.1|NM_001282198.1	NP_001269124.1|NP_001269125.1|NP_001269127.1	O95258	UCP5_HUMAN	solute carrier family 25 (mitochondrial carrier, brain), member 14	18					aerobic respiration (GO:0009060)|mitochondrial transport (GO:0006839)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)	22						AAGTTTGCAACGGCGGCCGTG	0.488																																					p.T18M													.	SLC25A14	49		0			c.C53T							C	MET/THR,MET/THR	0,3835		0,0,1632,571	82.0	86.0	85.0		53,53	4.3	1.0	X		85	1,6727		0,1,2427,1872	no	missense,missense	SLC25A14	NM_003951.2,NM_022810.1	81,81	0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095	possibly-damaging,possibly-damaging	18/326,18/323	129474305	1,10562	2203	4300	6503	SO:0001583	missense	9016	exon1			TTGCAACGGCGGC	AF078544	CCDS14623.1, CCDS14624.1, CCDS76020.1, CCDS76021.1	Xq24	2013-05-22			ENSG00000102078	ENSG00000102078		"""Solute carriers"""	10984	protein-coding gene	gene with protein product		300242				9852133	Standard	XM_005262485		Approved	BMCP1, UCP5	uc004evp.1	O95258	OTTHUMG00000022394	ENST00000218197.5:c.53C>T	X.37:g.129474305C>T	ENSP00000218197:p.Thr18Met		Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	91	0.03	3	NM_022810	1	0.00	0	D3DTG2|Q0VDH7|Q9HC60|Q9HC61	Missense_Mutation	SNP	ENST00000218197.5	37	CCDS14623.1	.	.	.	.	.	.	.	.	.	.	C	17.25	3.342508	0.61073	0.0	1.49E-4	ENSG00000102078	ENST00000424447;ENST00000545805;ENST00000218197;ENST00000361980;ENST00000339231	T;T;T;D;T	0.82081	-1.24;-1.49;-1.47;-1.57;-1.38	4.31	4.31	0.51392	.	1.035400	0.07592	N	0.922174	D	0.82582	0.5068	N	0.08118	0	0.80722	D	1	D;D;D	0.71674	0.998;0.993;0.988	D;P;P	0.75020	0.985;0.706;0.512	T	0.78280	-0.2265	10	0.87932	D	0	-1.1638	11.0968	0.48150	0.0:1.0:0.0:0.0	.	18;18;18	O95258-3;O95258-2;O95258	.;.;UCP5_HUMAN	M	18	ENSP00000402578:T18M;ENSP00000444642:T18M;ENSP00000218197:T18M;ENSP00000354455:T18M;ENSP00000342797:T18M	ENSP00000218197:T18M	T	+	2	0	SLC25A14	129301986	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.014000	0.49590	2.387000	0.81309	0.594000	0.82650	ACG			0.488	SLC25A14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000058253.1		NM_022810, NM_003951	
PCMTD1P1	100874520	bcgsc.ca	37	Y	10011766	10011766	+	IGR	SNP	C	C	T	rs369967535		TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chrY:10011766C>T								RNA5SP519 (81164 upstream) : AC010970.1 (22214 downstream)																							CATGAAACTGCCCCTCCCTGA	0.353																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	100874520	.			AAACTGCCCCTCC																													Y.37:g.10011766C>T			Somatic	48	0	0		WXS	Illumina HiSeq	Phase_1	51	0.18	9	.	0		0		RNA	SNP		37																																																																																					0	0.353										
PRKDC	5591	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	48749779	48749779	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAGG-01A-11D-A42Y-10	TCGA-2G-AAGG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e9e9eff-4302-47e1-85c1-a85d559e034e	81975a2c-c83e-4008-8209-835296eeeac4	g.chr8:48749779T>A	ENST00000314191.2	-	58	7808	c.7752A>T	c.(7750-7752)gaA>gaT	p.E2584D	PRKDC_ENST00000523565.1_5'UTR|PRKDC_ENST00000338368.3_Missense_Mutation_p.E2584D	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	2585	KIP-binding.				B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	TTACCTGAAATTCGCATTCTG	0.393								Non-homologous end-joining																													.	Esophageal Squamous(79;1091 1253 12329 31680 40677)												.	.			0			.												68.0	66.0	67.0					8																	48749779		1862	4102	5964	SO:0001583	missense	5591	.			CTGAAATTCGCAT		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.7752A>T	8.37:g.48749779T>A	ENSP00000313420:p.Glu2584Asp		Somatic	54	0	0		WXS	Illumina HiSeq	.	46	0.22	10	.	55	0.15	8	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	ENST00000314191.2	37		.	.	.	.	.	.	.	.	.	.	T	10.57	1.386209	0.25031	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.02656	4.28;4.21	5.79	2.13	0.27403	.	0.768051	0.12631	N	0.452181	T	0.03348	0.0097	L	0.44542	1.39	0.24966	N	0.991698	B;B	0.26002	0.139;0.013	B;B	0.27076	0.076;0.02	T	0.44574	-0.9319	10	0.27082	T	0.32	.	8.515	0.33239	0.0:0.2283:0.0:0.7717	.	2584;2585	E7EUY0;P78527	.;PRKDC_HUMAN	D	2584	ENSP00000313420:E2584D;ENSP00000345182:E2584D	ENSP00000313420:E2584D	E	-	3	2	PRKDC	48912332	1.000000	0.71417	0.289000	0.24876	0.515000	0.34225	0.924000	0.28777	0.129000	0.18514	0.482000	0.46254	GAA			0.393	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_001081640	
