#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
CROCCP2	84809	broad.mit.edu	37	1	16946455	16946456	+	lincRNA	INS	-	-	GCTCACGCTGCA			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr1:16946455_16946456insGCTCACGCTGCA	ENST00000412962.1	-	0	1063_1064				RP5-1182A14.5_ENST00000607700.1_lincRNA			Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											CAGCTCCTCCTGCTCACGCTGC	0.678																																					.													.	.			0			.																																											0	.			TCCTCCTGCTCAC	AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16946455_16946456insGCTCACGCTGCA			Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	107	0.07	8	.	21	0.00	0	Q8NF65|Q96FR5|Q9BRE8	RNA	INS	ENST00000412962.1	37																																																																																						0.678	CROCCP2-003	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000092784.1		NR_026752.1	
PTP4A2	8073	mdanderson.org	37	1	32375675	32375675	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr1:32375675C>A	ENST00000602725.1	-	4	776	c.359G>T	c.(358-360)gGa>gTa	p.G120V	PTP4A2_ENST00000356536.3_Intron|PTP4A2_ENST00000470404.1_3'UTR|RP11-84A19.4_ENST00000602889.1_lincRNA|PTP4A2_ENST00000344035.6_Missense_Mutation_p.G120V|PTP4A2_ENST00000457805.2_Missense_Mutation_p.G89V			Q12974	TP4A2_HUMAN	protein tyrosine phosphatase type IVA, member 2	120	Tyrosine-protein phosphatase.				peptidyl-tyrosine dephosphorylation (GO:0035335)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	prenylated protein tyrosine phosphatase activity (GO:0004727)			kidney(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)				GTACTTCATTCCACATTCAAT	0.378																																					p.G120V													.	.			0			c.G359T												112.0	96.0	102.0					1																	32375675		2203	4300	6503	SO:0001583	missense	8073	exon5			TTCATTCCACATT	L48723	CCDS348.1, CCDS53292.1, CCDS59193.1	1p35	2011-06-09			ENSG00000184007	ENSG00000184007		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PRLs"""	9635	protein-coding gene	gene with protein product		601584		PTP4A		8661118, 9514946	Standard	NM_080391		Approved	HU-PP-1, PTPCAAX2, OV-1, ptp-IV1a, PRL-2	uc001bty.2	Q12974	OTTHUMG00000003801	ENST00000602725.1:c.359G>T	1.37:g.32375675C>A	ENSP00000473259:p.Gly120Val		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_080391	411	0.00	0	A8K9I8|B4DM39|D3DPP0|E9PGJ6|O00649|Q15197|Q15259|Q15260|Q15261|R4GN50	Missense_Mutation	SNP	ENST00000602725.1	37	CCDS348.1	.	.	.	.	.	.	.	.	.	.	C	35	5.423451	0.96111	.	.	ENSG00000184007	ENST00000344035;ENST00000457805	D;D	0.83250	-1.7;-1.7	5.53	5.53	0.82687	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.85682	D	0.000000	D	0.95532	0.8548	H	0.99156	4.45	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.987;0.999	D	0.97208	0.9869	10	0.87932	D	0	-0.4713	19.4216	0.94725	0.0:1.0:0.0:0.0	.	89;120	E9PGJ6;Q12974	.;TP4A2_HUMAN	V	120;89	ENSP00000344909:G120V;ENSP00000409260:G89V	ENSP00000344909:G120V	G	-	2	0	PTP4A2	32148262	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.814000	0.86154	2.769000	0.95229	0.650000	0.86243	GGA			0.378	PTP4A2-019	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000468092.1		NM_080391	
FNBP1L	54874	bcgsc.ca	37	1	93996313	93996313	+	Splice_Site	SNP	C	C	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr1:93996313C>T	ENST00000271234.7	+	7	663	c.512C>T	c.(511-513)gCc>gTc	p.A171V	FNBP1L_ENST00000604705.1_Splice_Site_p.A171V|FNBP1L_ENST00000370256.4_Splice_Site_p.A171V|FNBP1L_ENST00000260506.8_Splice_Site_p.A171V|FNBP1L_ENST00000370253.2_Splice_Site_p.A171V	NM_001164473.2	NP_001157945.1	Q5T0N5	FBP1L_HUMAN	formin binding protein 1-like	171	F-BAR domain. {ECO:0000250}.				autophagy (GO:0006914)|clathrin-mediated endocytosis (GO:0072583)|membrane budding (GO:0006900)|membrane invagination (GO:0010324)|membrane tubulation (GO:0097320)|positive regulation of filopodium assembly (GO:0051491)|vesicle organization (GO:0016050)|vesicle transport along actin filament (GO:0030050)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			breast(2)|kidney(2)|large_intestine(4)|lung(2)|urinary_tract(1)	11		all_lung(203;0.00206)|Lung NSC(277;0.00902)|Melanoma(281;0.155)		all cancers(265;0.00666)|GBM - Glioblastoma multiforme(16;0.0378)|Epithelial(280;0.111)		TGCCCCTAGGCCAAACAGCAG	0.318																																					p.A171V													.	FNBP1L	56		0			c.C512T												33.0	31.0	32.0					1																	93996313		1826	4092	5918	SO:0001630	splice_region_variant	54874	exon7			CCTAGGCCAAACA		CCDS53343.1, CCDS53344.1, CCDS60192.1	1p22.1	2008-02-05	2004-11-16	2004-11-17	ENSG00000137942	ENSG00000137942			20851	protein-coding gene	gene with protein product		608848	"""chromosome 1 open reading frame 39"""	C1orf39		14654988	Standard	NM_017737		Approved	TOCA1, FLJ20275	uc010otk.2	Q5T0N5	OTTHUMG00000010863	ENST00000271234.7:c.511-1C>T	1.37:g.93996313C>T			Somatic	591	0.0016920474	1		WXS	Illumina HiSeq	Phase_1	626	0.00	1	NM_001164473	31	0.00	0	J3QSS4|Q5T0N6|Q6B097|Q6P653|Q6R4Q4|Q9NXG1	Missense_Mutation	SNP	ENST00000271234.7	37	CCDS53343.1	.	.	.	.	.	.	.	.	.	.	C	17.81	3.480139	0.63849	.	.	ENSG00000137942	ENST00000370256;ENST00000271234;ENST00000260506;ENST00000370253;ENST00000424449	T;T;T;T	0.18810	2.19;2.19;2.19;2.19	5.07	5.07	0.68467	.	0.097197	0.64402	D	0.000001	T	0.12008	0.0292	L	0.51422	1.61	0.80722	D	1	B;P	0.44380	0.2;0.834	B;B	0.38020	0.026;0.263	T	0.06698	-1.0812	10	0.22706	T	0.39	-15.4086	18.7964	0.91995	0.0:1.0:0.0:0.0	.	171;171	Q5T0N5-4;Q5T0N5-3	.;.	V	171;171;171;171;38	ENSP00000359278:A171V;ENSP00000271234:A171V;ENSP00000260506:A171V;ENSP00000359275:A171V	ENSP00000260506:A171V	A	+	2	0	FNBP1L	93768901	1.000000	0.71417	0.993000	0.49108	0.660000	0.38997	7.487000	0.81328	2.527000	0.85204	0.655000	0.94253	GCC			0.318	FNBP1L-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding				NM_017737	Missense_Mutation
TRIM46	80128	broad.mit.edu	37	1	155148054	155148054	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr1:155148054A>C	ENST00000334634.4	+	2	256	c.256A>C	c.(256-258)Acc>Ccc	p.T86P	TRIM46_ENST00000543729.1_Missense_Mutation_p.T93P|TRIM46_ENST00000368383.3_Missense_Mutation_p.T86P|TRIM46_ENST00000392451.2_Missense_Mutation_p.T86P|RP11-201K10.3_ENST00000473363.2_Intron|TRIM46_ENST00000368385.4_Missense_Mutation_p.T86P|KRTCAP2_ENST00000295682.4_5'Flank|TRIM46_ENST00000468878.1_3'UTR|TRIM46_ENST00000368382.1_Missense_Mutation_p.T63P|KRTCAP2_ENST00000490672.1_5'Flank|TRIM46_ENST00000545012.1_Intron	NM_001256601.1|NM_001282378.1	NP_001243530.1|NP_001269307.1	Q7Z4K8	TRI46_HUMAN	tripartite motif containing 46	86						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	29	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CACCCCTTCCACCCGCAGCCC	0.687																																					p.T86P													.	TRIM46	79		0			c.A256C												38.0	40.0	40.0					1																	155148054		2203	4295	6498	SO:0001583	missense	80128	exon2			CCTTCCACCCGCA		CCDS1097.1, CCDS58033.1, CCDS60285.1, CCDS72932.1, CCDS72931.1	1q22	2013-01-09	2011-01-25		ENSG00000163462	ENSG00000163462		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19019	protein-coding gene	gene with protein product		600986	"""tripartite motif-containing 46"""				Standard	NM_025058		Approved	FLJ23229, TRIFIC	uc001fhs.2	Q7Z4K8	OTTHUMG00000035680	ENST00000334634.4:c.256A>C	1.37:g.155148054A>C	ENSP00000334657:p.Thr86Pro		Somatic	67	0.3134328358	21		WXS	Illumina HiSeq	Phase_I	128	0.34	44	NM_025058	1	0.00	0	A0AVI6|B1AVQ4|Q5VT60|Q5VT62|Q6NT17|Q6NT41|Q6ZRL7|Q9H5P2	Missense_Mutation	SNP	ENST00000334634.4	37	CCDS1097.1	.	.	.	.	.	.	.	.	.	.	A	16.54	3.150621	0.57151	.	.	ENSG00000163462	ENST00000543729;ENST00000430513;ENST00000368385;ENST00000392451;ENST00000368383;ENST00000368382;ENST00000334634	T;T;T;T;T;T	0.59502	0.79;0.54;0.73;0.48;0.26;0.3	4.53	4.53	0.55603	Zinc finger, RING-type (1);	0.366034	0.27280	N	0.020087	T	0.47746	0.1462	N	0.25647	0.755	0.80722	D	1	D;P;D;P;P;D	0.69078	0.962;0.937;0.997;0.937;0.937;0.987	P;P;D;P;P;P	0.63597	0.682;0.585;0.916;0.483;0.483;0.827	T	0.48937	-0.8990	10	0.34782	T	0.22	.	10.5646	0.45165	1.0:0.0:0.0:0.0	.	73;86;73;63;86;86	F5H5Z2;Q5VT61;B7Z3S2;B1AVQ4;Q7Z4K8;Q7Z4K8-2	.;.;.;.;TRI46_HUMAN;.	P	93;73;86;86;86;63;86	ENSP00000442719:T93P;ENSP00000357369:T86P;ENSP00000376245:T86P;ENSP00000357367:T86P;ENSP00000357366:T63P;ENSP00000334657:T86P	ENSP00000334657:T86P	T	+	1	0	TRIM46	153414678	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.948000	0.56660	1.805000	0.52779	0.528000	0.53228	ACC			0.687	TRIM46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000086728.1		NM_025058	
ASH1L	55870	hgsc.bcm.edu	37	1	155403978	155403978	+	Intron	SNP	C	C	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr1:155403978C>T	ENST00000368346.3	-	5	6468				ASH1L_ENST00000392403.3_Intron			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)						cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			CTGTACTCCTCGGTCCCTTTC	0.597																																					.													.	.			0			.																																									SO:0001627	intron_variant	645682	.			ACTCCTCGGTCCC	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.5828+4139G>A	1.37:g.155403978C>T			Somatic	264	0	0		WXS	Illumina HiSeq	.	314	0.22	69	.	481	0.00	0	Q59GP1|Q5T714|Q5T715|Q9P2C7	RNA	SNP	ENST00000368346.3	37																																																																																						0.597	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000039400.1		NM_018489	
DCAF8	50717	broad.mit.edu	37	1	160188742	160188742	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr1:160188742G>T	ENST00000368073.3	-	12	1891	c.1457C>A	c.(1456-1458)cCc>cAc	p.P486H	DCAF8_ENST00000556710.1_Missense_Mutation_p.P640H|DCAF8_ENST00000608310.1_Missense_Mutation_p.P640H|DCAF8_ENST00000368074.1_Missense_Mutation_p.P486H|DCAF8_ENST00000326837.2_Missense_Mutation_p.P486H			Q5TAQ9	DCAF8_HUMAN	DDB1 and CUL4 associated factor 8	486					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(16)|skin(3)|upper_aerodigestive_tract(1)	33						GTGAGGGTGGGGCTCAAGACA	0.507																																					p.P486H													.	DCAF8	64		0			c.C1457A												96.0	96.0	96.0					1																	160188742		2203	4300	6503	SO:0001583	missense	50717	exon12			GGGTGGGGCTCAA	AK093176	CCDS1200.1	1q22-q23	2013-01-09	2009-07-17	2009-07-17	ENSG00000132716	ENSG00000132716		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	24891	protein-coding gene	gene with protein product		615820	"""WD repeat domain 42A"""	WDR42A		11401431	Standard	NM_015726		Approved	H326, FLJ35857	uc010pjb.1	Q5TAQ9	OTTHUMG00000031604	ENST00000368073.3:c.1457C>A	1.37:g.160188742G>T	ENSP00000357052:p.Pro486His		Somatic	249	0.0040160643	1		WXS	Illumina HiSeq	Phase_I	334	0.02	6	NM_015726	143	0.00	0	D3DVE6|Q12839|Q4QQI6|Q53F14|Q66K50|Q68CS7|Q96E00	Missense_Mutation	SNP	ENST00000368073.3	37	CCDS1200.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.437716	0.83885	.	.	ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000258465	ENST00000368073;ENST00000326837;ENST00000368074;ENST00000555195;ENST00000540855;ENST00000556710	T;T;T;T;T	0.60040	0.22;0.22;0.22;0.22;0.22	5.01	5.01	0.66863	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.64402	U	0.000001	T	0.75443	0.3850	M	0.85099	2.735	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.995	T	0.79396	-0.1821	10	0.72032	D	0.01	-5.3133	17.2484	0.87034	0.0:0.0:1.0:0.0	.	640;486	G3V3G9;Q5TAQ9	.;DCAF8_HUMAN	H	486;486;486;640;467;640	ENSP00000357052:P486H;ENSP00000318227:P486H;ENSP00000357053:P486H;ENSP00000451989:P640H;ENSP00000451235:P640H	ENSP00000318227:P486H	P	-	2	0	RP11-574F21.3;DCAF8	158455366	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.694000	0.91293	2.588000	0.87417	0.563000	0.77884	CCC			0.507	DCAF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000077402.2		NM_015726	
ABL2	27	broad.mit.edu	37	1	179198478	179198478	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr1:179198478G>T	ENST00000502732.1	-	1	258	c.55C>A	c.(55-57)Ccc>Acc	p.P19T	ABL2_ENST00000511413.1_Missense_Mutation_p.P19T|ABL2_ENST00000367623.4_Missense_Mutation_p.P19T|ABL2_ENST00000392043.3_Missense_Mutation_p.P19T|ABL2_ENST00000507173.1_Missense_Mutation_p.P19T	NM_001168236.1|NM_001168237.1|NM_001168238.1|NM_007314.3	NP_001161708.1|NP_001161709.1|NP_001161710.1|NP_009298.1	P42684	ABL2_HUMAN	ABL proto-oncogene 2, non-receptor tyrosine kinase	19	CAP.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|cellular response to retinoic acid (GO:0071300)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phospholipase C activity (GO:0010863)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)			breast(8)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	65					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	ATCCCGCGGGGCTGAGGCTGC	0.736			T	ETV6	AML																																p.P19T				Dom	yes		1	1q24-q25	27	v-abl Abelson murine leukemia viral oncogene homolog 2		L	.	ABL2	307		0			c.C55A												5.0	7.0	6.0					1																	179198478		2097	4097	6194	SO:0001583	missense	27	exon1			CGCGGGGCTGAGG	M14904	CCDS30947.1, CCDS41441.1, CCDS44282.1, CCDS44283.1, CCDS41441.2, CCDS53435.1, CCDS53436.1, CCDS53437.1, CCDS53438.1	1q25.2	2014-06-26	2014-06-26		ENSG00000143322	ENSG00000143322		"""SH2 domain containing"""	77	protein-coding gene	gene with protein product	"""Abelson-related gene"""	164690	"""v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)"", ""v-abl Abelson murine leukemia viral oncogene homolog 2"", ""c-abl oncogene 2, non-receptor tyrosine kinase"""	ABLL		3787260	Standard	NM_001136001		Approved	ARG	uc001gmi.4	P42684	OTTHUMG00000035199	ENST00000502732.1:c.55C>A	1.37:g.179198478G>T	ENSP00000427562:p.Pro19Thr		Somatic	82	0.0243902439	2		WXS	Illumina HiSeq	Phase_I	112	0.07	8	NM_001168238	1	0.00	0	A0M8X0|B7UEF2|B7UEF3|B7UEF4|B7UEF5|Q5T0X6|Q5W0C5|Q6NZY6|Q7Z301	Missense_Mutation	SNP	ENST00000502732.1	37	CCDS30947.1	.	.	.	.	.	.	.	.	.	.	G	17.32	3.360684	0.61403	.	.	ENSG00000143322	ENST00000502732;ENST00000367623;ENST00000507173;ENST00000511413;ENST00000392043	T;T;T;T;T	0.74421	-0.82;-0.83;-0.79;-0.8;-0.84	3.96	1.76	0.24704	.	.	.	.	.	T	0.55784	0.1942	N	0.22421	0.69	0.80722	D	1	B;B;B;B;B	0.20780	0.048;0.048;0.048;0.009;0.028	B;B;B;B;B	0.19391	0.025;0.005;0.005;0.003;0.011	T	0.39881	-0.9592	9	0.14656	T	0.56	.	9.5389	0.39240	0.0:0.4218:0.5782:0.0	.	19;19;19;19;19	P42684-6;P42684-7;P42684-5;P42684-8;P42684	.;.;.;.;ABL2_HUMAN	T	19	ENSP00000427562:P19T;ENSP00000356595:P19T;ENSP00000423413:P19T;ENSP00000424697:P19T;ENSP00000375897:P19T	ENSP00000356595:P19T	P	-	1	0	ABL2	177465101	1.000000	0.71417	0.998000	0.56505	0.828000	0.46876	1.850000	0.39328	0.713000	0.32060	0.205000	0.17691	CCC			0.736	ABL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000085174.3		NM_005158	
ANK3	288	bcgsc.ca	37	10	61844468	61844468	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr10:61844468A>T	ENST00000280772.2	-	32	4157	c.3966T>A	c.(3964-3966)gaT>gaA	p.D1322E	ANK3_ENST00000355288.2_Missense_Mutation_p.D456E|ANK3_ENST00000373827.2_Missense_Mutation_p.D1316E|ANK3_ENST00000503366.1_Missense_Mutation_p.D1323E|Y_RNA_ENST00000365320.1_RNA	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	1322	UPA domain. {ECO:0000250}.				axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						ATTCTACGGGATCATTCATTT	0.393																																					p.D1323E													.	ANK3	703		0			c.T3969A												133.0	126.0	128.0					10																	61844468		2203	4300	6503	SO:0001583	missense	288	exon33			TACGGGATCATTC	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.3966T>A	10.37:g.61844468A>T	ENSP00000280772:p.Asp1322Glu		Somatic	135	0	0		WXS	Illumina HiSeq	Phase_1	105	0.00	0	NM_001204404	20	0.00	0	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	A	18.56	3.650751	0.67472	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000355288;ENST00000423532;ENST00000503366;ENST00000395299;ENST00000373817;ENST00000395293;ENST00000395304;ENST00000544789;ENST00000536348	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	6.04	2.46	0.29980	.	0.184955	0.26546	N	0.023775	T	0.43144	0.1234	L	0.52905	1.665	0.80722	D	1	D;D;D;D;B;P;B	0.71674	0.989;0.997;0.995;0.998;0.032;0.92;0.018	P;P;D;P;B;P;B	0.75020	0.766;0.817;0.985;0.846;0.023;0.754;0.009	T	0.23797	-1.0178	10	0.66056	D	0.02	.	5.012	0.14317	0.6499:0.0:0.2235:0.1266	.	1323;456;855;1316;1322;557;456	E9PE32;A8KA62;Q59G01;Q5CZH9;Q12955;F5GXK0;B1AQT2	.;.;.;.;ANK3_HUMAN;.;.	E	1322;1316;456;456;1323;1302;557;957;957;455;855	ENSP00000280772:D1322E;ENSP00000362933:D1316E;ENSP00000347436:D456E;ENSP00000425236:D1323E	ENSP00000280772:D1322E	D	-	3	2	ANK3	61514474	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	0.798000	0.27014	0.174000	0.19809	0.459000	0.35465	GAT			0.393	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000048201.4		NM_020987	
TET1	80312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	10	70332383	70332383	+	Silent	SNP	C	C	G			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr10:70332383C>G	ENST00000373644.4	+	2	497	c.288C>G	c.(286-288)tcC>tcG	p.S96S		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	96					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						ACCCAGAGTCCTTAACCTGCA	0.512																																					p.S96S													.	.			0			c.C288G												56.0	56.0	56.0					10																	70332383		2203	4300	6503	SO:0001819	synonymous_variant	80312	exon2			AGAGTCCTTAACC	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.288C>G	10.37:g.70332383C>G			Somatic	104	0	0		WXS	Illumina HiSeq	.	102	0.37	38	NM_030625	7	0.57	4	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Silent	SNP	ENST00000373644.4	37	CCDS7281.1																																																																																					0.512	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048354.1		NM_030625	
ASCC1	51008	mdanderson.org	37	10	73970549	73970549	+	Silent	SNP	C	C	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr10:73970549C>T	ENST00000342444.4	-	3	254	c.153G>A	c.(151-153)gaG>gaA	p.E51E	ASCC1_ENST00000394919.1_Silent_p.E51E|ASCC1_ENST00000545550.1_Silent_p.E73E|ASCC1_ENST00000317168.6_Silent_p.E51E|ASCC1_ENST00000394915.3_Silent_p.E51E|ASCC1_ENST00000317126.4_Silent_p.E51E|ASCC1_ENST00000492502.2_5'UTR	NM_001198799.2	NP_001185728.1	Q8N9N2	ASCC1_HUMAN	activating signal cointegrator 1 complex subunit 1	51					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|transcription factor complex (GO:0005667)	catalytic activity (GO:0003824)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(2)|skin(1)	7						TCTGCTCCACCTCGTAGGCAT	0.517																																					p.E51E													.	.			0			c.G153A												96.0	82.0	87.0					10																	73970549		2203	4300	6503	SO:0001819	synonymous_variant	51008	exon3			CTCCACCTCGTAG	AY013290	CCDS31219.1, CCDS55713.1	10q22.1	2012-09-20			ENSG00000138303	ENSG00000138303			24268	protein-coding gene	gene with protein product		614215				10810093, 12077347	Standard	NM_001198799		Approved	CGI-18, ASC1p50, Em:AC022392.3	uc001jst.2	Q8N9N2	OTTHUMG00000018434	ENST00000342444.4:c.153G>A	10.37:g.73970549C>T			Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	54	0.06	3	NM_001198798	43	0.00	0	Q5SW06|Q5SW07|Q96EI8|Q9Y307	Silent	SNP	ENST00000342444.4	37	CCDS55713.1																																																																																					0.517	ASCC1-004	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000048573.2		NM_015947	
STAMBPL1	57559	bcgsc.ca	37	10	90672864	90672864	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr10:90672864T>C	ENST00000371926.3	+	6	1385	c.427T>C	c.(427-429)Tat>Cat	p.Y143H	STAMBPL1_ENST00000371927.3_Missense_Mutation_p.Y143H|STAMBPL1_ENST00000371922.1_5'UTR|STAMBPL1_ENST00000371924.1_Missense_Mutation_p.Y143H	NM_020799.3	NP_065850.1	Q96FJ0	STALP_HUMAN	STAM binding protein-like 1	143						membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(2)|endometrium(1)|large_intestine(2)|liver(2)|lung(2)|ovary(1)|skin(1)	11		Colorectal(252;0.0381)		Colorectal(12;6.38e-05)|COAD - Colon adenocarcinoma(12;7.75e-05)		TTAGAACAAATATAAAGCTGA	0.413																																					p.Y143H													.	STAMBPL1	63		0			c.T427C												66.0	77.0	73.0					10																	90672864		2203	4299	6502	SO:0001583	missense	57559	exon6			AACAAATATAAAG	AB037794	CCDS7391.1	10q23.32	2006-11-08			ENSG00000138134	ENSG00000138134			24105	protein-coding gene	gene with protein product	"""associated molecule with the SH3 domain of STAM (AMSH) like protein"", ""associated molecule with the SH3 domain of STAM (AMSH) - Family Protein"""	612352				12810066, 12943674	Standard	NM_020799		Approved	AMSH-LP, KIAA1373, AMSH-FP, FLJ31524, ALMalpha, bA399O19.2	uc001kfk.4	Q96FJ0	OTTHUMG00000018702	ENST00000371926.3:c.427T>C	10.37:g.90672864T>C	ENSP00000360994:p.Tyr143His		Somatic	38	0	0		WXS	Illumina HiSeq	Phase_1	46	0.00	0	NM_020799	27	0.00	0	B3KPA7|Q5T9N4|Q5T9N9|Q7Z420|Q9P2H4	Missense_Mutation	SNP	ENST00000371926.3	37	CCDS7391.1	.	.	.	.	.	.	.	.	.	.	T	11.35	1.613028	0.28712	.	.	ENSG00000138134	ENST00000371926;ENST00000371927;ENST00000371924	T;T;T	0.21932	1.99;1.98;1.99	5.98	4.85	0.62838	.	0.335916	0.29579	N	0.011746	T	0.11324	0.0276	N	0.22421	0.69	0.80722	D	1	P;P	0.41748	0.56;0.761	B;B	0.31751	0.095;0.135	T	0.14172	-1.0482	10	0.28530	T	0.3	-3.6019	9.5956	0.39571	0.0:0.0798:0.0:0.9202	.	143;143	Q96FJ0-2;Q96FJ0	.;STALP_HUMAN	H	143	ENSP00000360994:Y143H;ENSP00000360995:Y143H;ENSP00000360992:Y143H	ENSP00000360992:Y143H	Y	+	1	0	STAMBPL1	90662844	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	1.393000	0.34497	1.076000	0.40961	0.533000	0.62120	TAT			0.413	STAMBPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049283.1		NM_020799	
CYP26A1	1592	broad.mit.edu;mdanderson.org	37	10	94834916	94834916	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr10:94834916C>A	ENST00000224356.4	+	4	761	c.716C>A	c.(715-717)gCg>gAg	p.A239E	CYP26A1_ENST00000394139.1_Missense_Mutation_p.A170E|CYP26A1_ENST00000371531.1_Missense_Mutation_p.A170E	NM_000783.3	NP_000774.2	O43174	CP26A_HUMAN	cytochrome P450, family 26, subfamily A, polypeptide 1	239					anterior/posterior pattern specification (GO:0009952)|cellular response to retinoic acid (GO:0071300)|central nervous system development (GO:0007417)|metabolic process (GO:0008152)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|neural crest cell development (GO:0014032)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			breast(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16		Colorectal(252;0.122)			Acitretin(DB00459)|Ketoconazole(DB01026)|Vitamin A(DB00162)	GGCATGAAGGCGCGGAACCTC	0.697																																					p.A239E													CYP26A1,NS,carcinoma,0,1	CYP26A1	59	1	0			c.C716A												28.0	30.0	29.0					10																	94834916		2201	4297	6498	SO:0001583	missense	0	exon4			TGAAGGCGCGGAA	AF005418	CCDS7426.1, CCDS7427.1	10q23-q24	2003-10-06	2003-01-14		ENSG00000095596	ENSG00000095596		"""Cytochrome P450s"""	2603	protein-coding gene	gene with protein product		602239	"""cytochrome P450, subfamily XXVIA, polypeptide 1"""			9228017, 9521883	Standard	NM_000783		Approved	P450RAI, CP26, CYP26, P450RAI1	uc001kil.2	O43174	OTTHUMG00000018765	ENST00000224356.4:c.716C>A	10.37:g.94834916C>A	ENSP00000224356:p.Ala239Glu		Somatic	126	0.0158730159	2		WXS	Illumina HiSeq	Phase_I	90	0.07	6	NM_000783	7	0.00	0	B3KNI4|Q5VXH9|Q5VXI0	Missense_Mutation	SNP	ENST00000224356.4	37	CCDS7426.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.687807	0.88639	.	.	ENSG00000095596	ENST00000371531;ENST00000224356;ENST00000394139	T;T;T	0.71817	-0.6;-0.6;-0.6	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	D	0.86070	0.5845	M	0.87971	2.92	0.80722	D	1	P;D	0.89917	0.768;1.0	P;D	0.79108	0.597;0.992	D	0.88270	0.2929	10	0.87932	D	0	-22.1793	16.9729	0.86305	0.0:1.0:0.0:0.0	.	170;239	B3KNI4;O43174	.;CP26A_HUMAN	E	170;239;170	ENSP00000360586:A170E;ENSP00000224356:A239E;ENSP00000377695:A170E	ENSP00000224356:A239E	A	+	2	0	CYP26A1	94824906	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	6.642000	0.74329	2.689000	0.91719	0.462000	0.41574	GCG			0.697	CYP26A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049408.3			
MMS19	64210	bcgsc.ca	37	10	99218609	99218609	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr10:99218609C>T	ENST00000438925.2	-	30	3348	c.3013G>A	c.(3013-3015)Gat>Aat	p.D1005N	MMS19_ENST00000327277.7_3'UTR|MMS19_ENST00000327238.10_Missense_Mutation_p.D907N|MMS19_ENST00000355839.6_Missense_Mutation_p.D962N|MMS19_ENST00000370782.2_Missense_Mutation_p.D1005N	NM_022362.4	NP_071757.4	Q96T76	MMS19_HUMAN	MMS19 nucleotide excision repair homolog (S. cerevisiae)	1005					cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|iron-sulfur cluster assembly (GO:0016226)|nucleotide-excision repair (GO:0006289)|phosphorelay signal transduction system (GO:0000160)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	CIA complex (GO:0097361)|cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|membrane (GO:0016020)|MMXD complex (GO:0071817)|nucleus (GO:0005634)|spindle (GO:0005819)	estrogen receptor binding (GO:0030331)|protein binding, bridging (GO:0030674)|receptor signaling complex scaffold activity (GO:0030159)|transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|stomach(1)	16		Colorectal(252;0.0846)		Epithelial(162;3.33e-10)|all cancers(201;2.74e-08)		TTCTTGTCATCCAGGGGTTTG	0.532								Direct reversal of damage																													p.D1005N													.	MMS19	36		0			c.G3013A												124.0	95.0	105.0					10																	99218609		2203	4300	6503	SO:0001583	missense	64210	exon30			TGTCATCCAGGGG	AF007151	CCDS7464.1, CCDS73177.1	10q24-q25	2007-08-15	2007-08-15	2007-08-15	ENSG00000155229	ENSG00000155229			13824	protein-coding gene	gene with protein product	"""MET18 homolog (S. cerevisiae)"""	614777		MMS19L		11071939	Standard	NM_022362		Approved	MET18, hMMS19	uc001kns.4	Q96T76	OTTHUMG00000018857	ENST00000438925.2:c.3013G>A	10.37:g.99218609C>T	ENSP00000412698:p.Asp1005Asn		Somatic	150	0	0		WXS	Illumina HiSeq	Phase_1	168	0.00	0	NM_022362	115	0.00	0	B0QZ75|B3KPE5|B4DQX2|B4E2I3|D3DR55|F8W9Y2|Q17RZ8|Q5T455|Q66K82|Q7L4W8|Q969Z1|Q96DF1|Q96MR1|Q96RK5|Q96SK1|Q9BUE2|Q9BYS9	Missense_Mutation	SNP	ENST00000438925.2	37	CCDS7464.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.147874|5.147874	0.94603|0.94603	.|.	.|.	ENSG00000155229|ENSG00000155229	ENST00000438925;ENST00000370782;ENST00000327238;ENST00000422291;ENST00000355839|ENST00000444411;ENST00000434538	T;T;T;T|.	0.67865|.	-0.1;-0.1;-0.29;-0.1|.	5.67|5.67	5.67|5.67	0.87782|0.87782	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.83986|.	0.5373|.	M|M	0.86420|0.86420	2.815|2.815	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;0.999;1.0|.	D;D;D;D;D|.	0.91635|.	0.983;0.999;0.999;0.961;0.983|.	D|.	0.85197|.	0.1013|.	10|.	0.48119|.	T|.	0.1|.	.|.	19.7572|19.7572	0.96298|0.96298	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1026;907;962;1005;962|.	B4DQX2;Q96T76-5;F8W9Y2;Q96T76;B4E2I3|.	.;.;.;MMS19_HUMAN;.|.	N|X	1005;1005;907;984;962|64;572	ENSP00000412698:D1005N;ENSP00000359818:D1005N;ENSP00000320059:D907N;ENSP00000348097:D962N|.	ENSP00000320059:D907N|.	D|W	-|-	1|3	0|0	MMS19|MMS19	99208599|99208599	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.987000|0.987000	0.75469|0.75469	5.439000|5.439000	0.66556|0.66556	2.667000|2.667000	0.90743|0.90743	0.650000|0.650000	0.86243|0.86243	GAT|TGG			0.532	MMS19-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049706.2			
SEC31B	25956	bcgsc.ca	37	10	102250017	102250017	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr10:102250017G>A	ENST00000370345.3	-	21	2810	c.2713C>T	c.(2713-2715)Cct>Tct	p.P905S		NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	905	Pro-rich.				protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)				NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		CATGTCCCAGGGAATCCCACC	0.542																																					p.P905S													.	SEC31B	84		0			c.C2713T												90.0	76.0	81.0					10																	102250017		2203	4300	6503	SO:0001583	missense	25956	exon21			TCCCAGGGAATCC	AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.2713C>T	10.37:g.102250017G>A	ENSP00000359370:p.Pro905Ser		Somatic	137	0	0		WXS	Illumina HiSeq	Phase_1	127	0.00	0	NM_015490	4	0.00	0	B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Missense_Mutation	SNP	ENST00000370345.3	37	CCDS7495.1	.	.	.	.	.	.	.	.	.	.	G	13.43	2.234124	0.39498	.	.	ENSG00000075826	ENST00000370345	T	0.56275	0.47	5.75	3.83	0.44106	.	0.363651	0.34802	N	0.003669	T	0.45236	0.1332	M	0.66939	2.045	0.80722	D	1	B;B	0.28636	0.218;0.013	B;B	0.22386	0.039;0.007	T	0.35101	-0.9802	10	0.38643	T	0.18	-0.0345	6.507	0.22200	0.0931:0.0:0.7274:0.1794	.	904;905	Q9NQW1-5;Q9NQW1	.;SC31B_HUMAN	S	905	ENSP00000359370:P905S	ENSP00000359370:P905S	P	-	1	0	SEC31B	102240007	0.998000	0.40836	0.286000	0.24833	0.917000	0.54804	1.025000	0.30090	0.707000	0.31934	0.561000	0.74099	CCT			0.542	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051198.1		NM_015490	
CFAP43	80217	mdanderson.org	37	10	105953723	105953723	+	Missense_Mutation	SNP	G	G	T	rs538157333		TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr10:105953723G>T	ENST00000278064.2	-	11	1461	c.1136C>A	c.(1135-1137)aCg>aAg	p.T379K	WDR96_ENST00000369720.1_Missense_Mutation_p.T379K|WDR96_ENST00000357060.3_Missense_Mutation_p.T448K|WDR96_ENST00000428666.1_Missense_Mutation_p.T449K																NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GCCATCCTCCGTGCCCACGGC	0.542																																					p.T448K													.	.			0			c.C1343A												121.0	102.0	108.0					10																	105953723		2203	4300	6503	SO:0001583	missense	80217	exon11			TCCTCCGTGCCCA																												ENST00000278064.2:c.1136C>A	10.37:g.105953723G>T	ENSP00000278064:p.Thr379Lys		Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_025145	1	0.00	0		Missense_Mutation	SNP	ENST00000278064.2	37		.	.	.	.	.	.	.	.	.	.	G	16.39	3.109127	0.56398	.	.	ENSG00000197748	ENST00000357060;ENST00000428666;ENST00000278064;ENST00000369720	T;T;T;T	0.32753	1.44;1.44;1.44;1.51	4.93	4.93	0.64822	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.38058	N	0.001837	T	0.53334	0.1790	M	0.74881	2.28	0.44890	D	0.997908	D;D	0.89917	1.0;1.0	D;D	0.79784	0.99;0.993	T	0.46898	-0.9158	10	0.29301	T	0.29	.	14.3675	0.66815	0.0:0.0:1.0:0.0	.	449;448	B4DHB6;Q8NDM7	.;WDR96_HUMAN	K	448;449;379;379	ENSP00000349568:T448K;ENSP00000400289:T449K;ENSP00000278064:T379K;ENSP00000358734:T379K	ENSP00000278064:T379K	T	-	2	0	WDR96	105943713	0.997000	0.39634	0.950000	0.38849	0.088000	0.18126	4.969000	0.63735	2.652000	0.90054	0.650000	0.86243	ACG			0.542	WDR96-003	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000050200.1			
NRAP	4892	broad.mit.edu	37	10	115383357	115383357	+	Silent	SNP	T	T	C			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr10:115383357T>C	ENST00000359988.3	-	23	2632	c.2388A>G	c.(2386-2388)aaA>aaG	p.K796K	NRAP_ENST00000369360.3_Silent_p.K769K|NRAP_ENST00000360478.3_Silent_p.K761K|NRAP_ENST00000369358.4_Silent_p.K804K	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein											autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		GCTCAAACCCTTTTGCTTTCT	0.512																																					p.K796K													.	NRAP	208		0			c.A2388G												161.0	150.0	153.0					10																	115383357		2203	4300	6503	SO:0001819	synonymous_variant	4892	exon23			AAACCCTTTTGCT		CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.2388A>G	10.37:g.115383357T>C			Somatic	177	0	0		WXS	Illumina HiSeq	Phase_I	133	0.03	4	NM_001261463	0		0		Silent	SNP	ENST00000359988.3	37	CCDS7579.1																																																																																					0.512	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050425.2		NM_006175	
CKAP5	9793	bcgsc.ca	37	11	46812057	46812057	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr11:46812057C>G	ENST00000529230.1	-	14	1773	c.1727G>C	c.(1726-1728)gGa>gCa	p.G576A	CKAP5_ENST00000354558.3_Missense_Mutation_p.G576A|CKAP5_ENST00000312055.5_Missense_Mutation_p.G576A|CKAP5_ENST00000415402.1_Missense_Mutation_p.G576A			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	576					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						AGTCTCCAGTCCTTTCTTGTT	0.448																																					p.G576A	Ovarian(4;85 273 2202 4844 13323)												.	CKAP5	134		0			c.G1727C												159.0	141.0	147.0					11																	46812057		2201	4299	6500	SO:0001583	missense	9793	exon14			TCCAGTCCTTTCT		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.1727G>C	11.37:g.46812057C>G	ENSP00000432768:p.Gly576Ala		Somatic	165	0	0		WXS	Illumina HiSeq	Phase_1	128	0.00	0	NM_014756	50	0.00	0	Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	ENST00000529230.1	37	CCDS31477.1	.	.	.	.	.	.	.	.	.	.	C	1.689	-0.504582	0.04261	.	.	ENSG00000175216	ENST00000529230;ENST00000415402;ENST00000312055;ENST00000354558	T;T;T;T	0.39997	1.06;1.05;1.05;1.05	5.96	-1.0	0.10196	.	0.614994	0.18119	N	0.151107	T	0.13927	0.0337	N	0.01493	-0.835	0.29881	N	0.826045	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.003;0.003;0.0	T	0.34950	-0.9808	10	0.02654	T	1	-7.6756	14.9236	0.70859	0.111:0.3033:0.5857:0.0	.	576;576;576	Q14008-3;Q14008-2;Q14008	.;.;CKAP5_HUMAN	A	576	ENSP00000432768:G576A;ENSP00000395302:G576A;ENSP00000310227:G576A;ENSP00000346566:G576A	ENSP00000310227:G576A	G	-	2	0	CKAP5	46768633	0.002000	0.14202	0.117000	0.21633	0.891000	0.51852	-0.035000	0.12205	-0.119000	0.11830	-0.315000	0.08773	GGA			0.448	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390679.1		NM_014756	
SLC15A3	51296	mdanderson.org	37	11	60718684	60718684	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr11:60718684C>T	ENST00000227880.3	-	1	573	c.340G>A	c.(340-342)Gcc>Acc	p.A114T		NM_016582.2	NP_057666.1	Q8IY34	S15A3_HUMAN	solute carrier family 15 (oligopeptide transporter), member 3	114					ion transport (GO:0006811)|peptide transport (GO:0015833)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	symporter activity (GO:0015293)			central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(9)|prostate(2)	17						AGGCCCGAGGCGGCCAGGTAG	0.771																																					p.A114T													.	.			0			c.G340A												3.0	3.0	3.0					11																	60718684		1496	2965	4461	SO:0001583	missense	51296	exon1			CCGAGGCGGCCAG	AB020598	CCDS7998.1	11q12.2	2013-07-18	2013-07-18		ENSG00000110446	ENSG00000110446		"""Solute carriers"""	18068	protein-coding gene	gene with protein product		610408	"""solute carrier family 15, member 3"""			11336635, 11741232	Standard	NM_016582		Approved	PHT2, hPTR3	uc001nqn.2	Q8IY34	OTTHUMG00000167804	ENST00000227880.3:c.340G>A	11.37:g.60718684C>T	ENSP00000227880:p.Ala114Thr		Somatic	18	0	0		WXS	Illumina HiSeq	Phase_I	12	0.17	2	NM_016582	8	0.00	0	Q9P2X9	Missense_Mutation	SNP	ENST00000227880.3	37	CCDS7998.1	.	.	.	.	.	.	.	.	.	.	C	15.28	2.786977	0.49997	.	.	ENSG00000110446	ENST00000227880;ENST00000442626	T	0.04502	3.61	3.4	1.46	0.22682	Major facilitator superfamily domain, general substrate transporter (1);	0.537282	0.15664	N	0.250735	T	0.04907	0.0132	L	0.51422	1.61	0.09310	N	1	B;B	0.26258	0.145;0.06	B;B	0.23018	0.043;0.009	T	0.34527	-0.9825	10	0.54805	T	0.06	-10.0792	4.5044	0.11879	0.1788:0.6158:0.0:0.2054	.	114;114	F5H1C8;Q8IY34	.;S15A3_HUMAN	T	114	ENSP00000227880:A114T	ENSP00000227880:A114T	A	-	1	0	SLC15A3	60475260	0.005000	0.15991	0.001000	0.08648	0.924000	0.55760	1.008000	0.29872	0.255000	0.21593	0.561000	0.74099	GCC			0.771	SLC15A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396366.1		NM_016582	
POU2F3	25833	mdanderson.org	37	11	120176445	120176445	+	Silent	SNP	G	G	A			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr11:120176445G>A	ENST00000543440.2	+	8	870	c.720G>A	c.(718-720)aaG>aaA	p.K240K	POU2F3_ENST00000260264.4_Silent_p.K242K	NM_014352.3	NP_055167.2	Q9UKI9	PO2F3_HUMAN	POU class 2 homeobox 3	240	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)|negative regulation by host of viral transcription (GO:0043922)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(1)	17		Breast(109;0.0011)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;6.85e-06)		TGAGCTTCAAGAACATGTGCA	0.572																																					p.K242K													.	.			0			c.G726A												142.0	119.0	127.0					11																	120176445		2203	4299	6502	SO:0001819	synonymous_variant	25833	exon8			CTTCAAGAACATG	AF133895	CCDS8431.1, CCDS58190.1	11q23.3	2011-06-20	2007-07-13		ENSG00000137709	ENSG00000137709		"""Homeoboxes / POU class"""	19864	protein-coding gene	gene with protein product		607394	"""POU domain class 2, transcription factor 3"""			10473598	Standard	NM_014352		Approved	OCT11, PLA-1, Skn-1a, Epoc-1	uc021qrk.1	Q9UKI9	OTTHUMG00000166140	ENST00000543440.2:c.720G>A	11.37:g.120176445G>A			Somatic	111	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_001244682	4	0.00	0	A8K7H8|B4DY07|F5GWW6|Q3MIY3|Q9UKR7|Q9Y504	Silent	SNP	ENST00000543440.2	37	CCDS8431.1																																																																																					0.572	POU2F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388039.2			
WNT5B	81029	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	1755317	1755317	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr12:1755317A>G	ENST00000397196.2	+	5	1211	c.979A>G	c.(979-981)Aag>Gag	p.K327E	WNT5B_ENST00000310594.3_Missense_Mutation_p.K327E|WNT5B_ENST00000537031.1_Missense_Mutation_p.K327E|WNT5B_ENST00000545747.1_3'UTR	NM_032642.2	NP_116031.1	Q9H1J7	WNT5B_HUMAN	wingless-type MMTV integration site family, member 5B	327					cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|fat cell differentiation (GO:0045444)|lens fiber cell development (GO:0070307)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuron differentiation (GO:0030182)|positive regulation of cell migration (GO:0030335)|positive regulation of fat cell differentiation (GO:0045600)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor binding (GO:0005102)			skin(1)	1	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00109)			CAACCAGTTCAAGAGCGTGCA	0.597																																					p.K327E													.	.			0			c.A979G												47.0	51.0	50.0					12																	1755317		2203	4300	6503	SO:0001583	missense	81029	exon5			CAGTTCAAGAGCG	AB060966	CCDS8510.1	12p13.3	2008-07-07			ENSG00000111186	ENSG00000111186		"""Wingless-type MMTV integration sites"""	16265	protein-coding gene	gene with protein product		606361				11445850	Standard	NM_030775		Approved		uc001qjk.3	Q9H1J7	OTTHUMG00000090375	ENST00000397196.2:c.979A>G	12.37:g.1755317A>G	ENSP00000380379:p.Lys327Glu		Somatic	61	0	0		WXS	Illumina HiSeq	.	133	0.41	55	NM_032642	56	0.43	24	A8K315|D3DUP9|Q96S49|Q9BV04	Missense_Mutation	SNP	ENST00000397196.2	37	CCDS8510.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.431233	0.83776	.	.	ENSG00000111186	ENST00000537031;ENST00000310594;ENST00000397196	T;T;T	0.75260	-0.92;-0.92;-0.92	5.15	5.15	0.70609	.	0.047856	0.85682	D	0.000000	T	0.75576	0.3868	L	0.31420	0.93	0.80722	D	1	P	0.49559	0.925	P	0.56648	0.803	T	0.76971	-0.2761	10	0.48119	T	0.1	.	15.1447	0.72641	1.0:0.0:0.0:0.0	.	327	Q9H1J7	WNT5B_HUMAN	E	327	ENSP00000439312:K327E;ENSP00000308887:K327E;ENSP00000380379:K327E	ENSP00000308887:K327E	K	+	1	0	WNT5B	1625578	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.202000	0.77856	2.159000	0.67721	0.533000	0.62120	AAG			0.597	WNT5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206747.2			
CLSTN3	9746	broad.mit.edu	37	12	7302201	7302201	+	Silent	SNP	C	C	A			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr12:7302201C>A	ENST00000266546.6	+	14	2607	c.2157C>A	c.(2155-2157)ccC>ccA	p.P719P	CLSTN3_ENST00000537408.1_Silent_p.P731P	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3	719					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						ACCTGGATCCCGAGCGGGAAA	0.577																																					p.P719P													.	CLSTN3	84		0			c.C2157A												83.0	75.0	78.0					12																	7302201		2203	4300	6503	SO:0001819	synonymous_variant	9746	exon14			GGATCCCGAGCGG	AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.2157C>A	12.37:g.7302201C>A			Somatic	120	0	0		WXS	Illumina HiSeq	Phase_I	321	0.01	4	NM_014718	221	0.00	0	D3DUT6|O94831|Q2T9J5|Q5UE57	Silent	SNP	ENST00000266546.6	37	CCDS8575.1																																																																																					0.577	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398560.2		NM_014718	
ESYT1	23344	mdanderson.org	37	12	56532268	56532268	+	Silent	SNP	G	G	A			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr12:56532268G>A	ENST00000394048.5	+	22	2682	c.2418G>A	c.(2416-2418)cgG>cgA	p.R806R	ESYT1_ENST00000541590.1_Silent_p.R816R|ESYT1_ENST00000267113.4_Silent_p.R816R|ESYT1_ENST00000550878.1_3'UTR	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	806	C2 4. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						ATATGGAGCGGGCAGAGGACC	0.582																																					p.R816R													ESYT1,caecum,carcinoma,+2,2	ESYT1	2	2	0			c.G2448A												29.0	30.0	30.0					12																	56532268		2203	4300	6503	SO:0001819	synonymous_variant	23344	exon22			GGAGCGGGCAGAG	AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.2418G>A	12.37:g.56532268G>A			Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	53	0.06	3	NM_001184796	109	0.00	0	A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Silent	SNP	ENST00000394048.5	37	CCDS8904.1																																																																																					0.582	ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000407906.1		NM_015292	
HECTD4	283450	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	112641514	112641514	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr12:112641514C>T	ENST00000430131.2	-	53	8211	c.7066G>A	c.(7066-7068)Gct>Act	p.A2356T	HECTD4_ENST00000550722.1_Missense_Mutation_p.A2632T|HECTD4_ENST00000377560.5_Missense_Mutation_p.A2606T			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	2356					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										TTTGGCAGAGCAGTTCCAACA	0.458																																					p.A2644T													.	.			0			c.G7930A												64.0	61.0	62.0					12																	112641514		1883	4113	5996	SO:0001583	missense	283450	exon54			GCAGAGCAGTTCC	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.7066G>A	12.37:g.112641514C>T	ENSP00000404379:p.Ala2356Thr		Somatic	175	0	0		WXS	Illumina HiSeq	.	202	0.33	66	NM_001109662	18	0.50	9	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	37		.	.	.	.	.	.	.	.	.	.	C	36	5.947589	0.97134	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.24723	1.84;1.84;1.84	6.17	6.17	0.99709	.	0.182643	0.36972	U	0.002303	T	0.40171	0.1106	N	0.19112	0.55	0.80722	D	1	D	0.63880	0.993	D	0.70935	0.971	T	0.25257	-1.0137	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	2356	Q9Y4D8	K0614_HUMAN	T	2606;2356;2632	ENSP00000366783:A2606T;ENSP00000404379:A2356T;ENSP00000449784:A2632T	ENSP00000366783:A2606T	A	-	1	0	C12orf51	111125897	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.478000	0.81082	2.941000	0.99782	0.655000	0.94253	GCT			0.458	HECTD4-202	KNOWN	basic	protein_coding	protein_coding				NM_173813	
TPTE2	93492	broad.mit.edu	37	13	20025336	20025336	+	Silent	SNP	A	A	G	rs545861513	byFrequency	TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr13:20025336A>G	ENST00000400230.2	-	11	815	c.771T>C	c.(769-771)caT>caC	p.H257H	TPTE2_ENST00000382978.1_Silent_p.H217H|TPTE2_ENST00000255310.6_Silent_p.H180H|TPTE2_ENST00000382977.4_Silent_p.H257H|TPTE2_ENST00000400103.2_Silent_p.H146H|TPTE2_ENST00000382975.4_Silent_p.H217H|TPTE2_ENST00000457266.2_Silent_p.H146H|TPTE2_ENST00000390680.2_Silent_p.H180H			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	257	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		AGTGGTTTCGATGTTTCTTAT	0.358													a|||	6	0.00119808	0.003	0.0014	5008	,	,		20859	0.0		0.001	False		,,,				2504	0.0				p.H257H													.	TPTE2	225		0			c.T771C												132.0	116.0	122.0					13																	20025336		2203	4299	6502	SO:0001819	synonymous_variant	93492	exon12			GTTTCGATGTTTC	AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.771T>C	13.37:g.20025336A>G			Somatic	86	0.011627907	1		WXS	Illumina HiSeq	Phase_I	93	0.05	5	NM_199254	0		0	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Silent	SNP	ENST00000400230.2	37	CCDS45014.1																																																																																					0.358	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_199254	
KLHDC2	23588	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	14	50249093	50249093	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr14:50249093G>C	ENST00000298307.5	+	11	1823	c.962G>C	c.(961-963)tGg>tCg	p.W321S	KLHDC2_ENST00000557247.1_Missense_Mutation_p.G297R|KLHDC2_ENST00000554589.1_Missense_Mutation_p.W321S|NEMF_ENST00000556925.1_5'Flank	NM_014315.2	NP_055130.1	Q9Y2U9	KLDC2_HUMAN	kelch domain containing 2	321						nucleus (GO:0005634)				endometrium(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	all_epithelial(31;0.000959)|Breast(41;0.0117)					TGCAGGTTATGGCACACAGCT	0.413																																					p.W321S													.	.			0			c.G962C												156.0	152.0	154.0					14																	50249093		2203	4300	6503	SO:0001583	missense	23588	exon11			GGTTATGGCACAC	AK001771	CCDS9693.1	14q21.3	2003-01-15			ENSG00000165516	ENSG00000165516			20231	protein-coding gene	gene with protein product		611280				11384994	Standard	NM_014315		Approved	HCLP-1, LCP	uc001wwx.3	Q9Y2U9	OTTHUMG00000140288	ENST00000298307.5:c.962G>C	14.37:g.50249093G>C	ENSP00000298307:p.Trp321Ser		Somatic	119	0	0		WXS	Illumina HiSeq	.	165	0.24	39	NM_014315	155	0.26	41	B3KPF9|Q6IAF0|Q86TY9	Missense_Mutation	SNP	ENST00000298307.5	37	CCDS9693.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.9|24.9	4.576928|4.576928	0.86645|0.86645	.|.	.|.	ENSG00000165516|ENSG00000165516	ENST00000557247|ENST00000298307;ENST00000554589	T|T;T	0.05319|0.61392	3.46|0.11;0.11	5.04|5.04	5.04|5.04	0.67666|0.67666	.|Kelch-type beta propeller (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.74397|0.74397	0.3711|0.3711	M|M	0.73962|0.73962	2.25|2.25	0.46241|0.46241	D|D	0.998943|0.998943	P|D;D	0.36144|0.76494	0.539|0.999;0.998	B|D;D	0.38755|0.85130	0.281|0.997;0.991	T|T	0.69698|0.69698	-0.5075|-0.5075	8|10	.|0.18710	.|T	.|0.47	-6.5579|-6.5579	17.5601|17.5601	0.87903|0.87903	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	297|321;321	G3V2H2|G3V3U8;Q9Y2U9	.|.;KLDC2_HUMAN	R|S	297|321	ENSP00000450658:G297R|ENSP00000298307:W321S;ENSP00000451439:W321S	.|ENSP00000298307:W321S	G|W	+|+	1|2	0|0	KLHDC2|KLHDC2	49318843|49318843	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.038000|9.038000	0.93771|0.93771	2.630000|2.630000	0.89119|0.89119	0.655000|0.655000	0.94253|0.94253	GGC|TGG			0.413	KLHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000276869.1			
ACOT6	641372	broad.mit.edu	37	14	74086410	74086410	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr14:74086410T>G	ENST00000381139.1	+	2	822	c.491T>G	c.(490-492)tTg>tGg	p.L164W	RP3-414A15.10_ENST00000555011.1_RNA|RP3-414A15.10_ENST00000555500.1_RNA	NM_001037162.1	NP_001032239.1	Q3I5F7	ACOT6_HUMAN	acyl-CoA thioesterase 6	164						cytosol (GO:0005829)	carboxylic ester hydrolase activity (GO:0052689)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|urinary_tract(1)	7				BRCA - Breast invasive adenocarcinoma(234;0.00331)		CACGCTGTTTTGGGTGAGGCA	0.448																																					p.L164W													.	ACOT6	12		0			c.T491G												55.0	51.0	52.0					14																	74086410		2203	4300	6503	SO:0001583	missense	641372	exon2			CTGTTTTGGGTGA	DQ082756, BF109853	CCDS32118.1	14q24.3	2011-02-16			ENSG00000205669	ENSG00000205669		"""Acyl CoA thioesterases"""	33159	protein-coding gene	gene with protein product		614267	"""chromosome 14 open reading frame 42"""	C14orf42		16940157	Standard	NM_001037162		Approved		uc001xop.3	Q3I5F7		ENST00000381139.1:c.491T>G	14.37:g.74086410T>G	ENSP00000370531:p.Leu164Trp		Somatic	98	0.0306122449	3		WXS	Illumina HiSeq	Phase_I	145	0.06	9	NM_001037162	1	0.00	0		Missense_Mutation	SNP	ENST00000381139.1	37	CCDS32118.1	.	.	.	.	.	.	.	.	.	.	T	11.47	1.647939	0.29336	.	.	ENSG00000205669	ENST00000554229;ENST00000381139	T;T	0.59772	1.37;0.24	5.62	5.62	0.85841	BAAT/Acyl-CoA thioester hydrolase C-terminal (1);	0.427611	0.20146	N	0.098261	T	0.76435	0.3987	M	0.78456	2.415	0.09310	N	1	D	0.89917	1.0	D	0.70487	0.969	T	0.71196	-0.4664	10	0.87932	D	0	-1.2034	15.8132	0.78581	0.0:0.0:0.0:1.0	.	164	Q3I5F7	ACOT6_HUMAN	W	164	ENSP00000451464:L164W;ENSP00000370531:L164W	ENSP00000370531:L164W	L	+	2	0	ACOT6	73156163	0.313000	0.24554	0.004000	0.12327	0.001000	0.01503	3.656000	0.54467	2.131000	0.65755	0.459000	0.35465	TTG			0.448	ACOT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000414437.1		NM_001037162	
UBE3A	7337	broad.mit.edu	37	15	25584318	25584318	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr15:25584318G>T	ENST00000397954.2	-	11	2593	c.2594C>A	c.(2593-2595)gCc>gAc	p.A865D	UBE3A_ENST00000232165.3_Missense_Mutation_p.A862D|SNHG14_ENST00000554726.1_RNA|UBE3A_ENST00000438097.1_Missense_Mutation_p.A842D|UBE3A_ENST00000566215.1_Missense_Mutation_p.A842D|UBE3A_ENST00000428984.2_Missense_Mutation_p.A842D|SNHG14_ENST00000452731.1_RNA			Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A	865	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				androgen receptor signaling pathway (GO:0030521)|brain development (GO:0007420)|ovarian follicle development (GO:0001541)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland growth (GO:0060736)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|proteolysis (GO:0006508)|sperm entry (GO:0035037)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	38		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		ATACGTGATGGCCTTCAACAA	0.289																																					p.A865D													.	UBE3A	109		0			c.C2594A												94.0	86.0	89.0					15																	25584318		2203	4300	6503	SO:0001583	missense	7337	exon14			GTGATGGCCTTCA	AF002224	CCDS32177.1, CCDS45191.1, CCDS45192.1	15q11.2	2014-09-17	2008-07-31		ENSG00000114062	ENSG00000114062	6.3.2.19		12496	protein-coding gene	gene with protein product	"""Angelman syndrome"""	601623	"""human papilloma virus E6-associated protein"""	EPVE6AP, HPVE6A		8221889	Standard	NM_130838		Approved	AS, ANCR, E6-AP, FLJ26981	uc001zas.3	Q05086		ENST00000397954.2:c.2594C>A	15.37:g.25584318G>T	ENSP00000381045:p.Ala865Asp		Somatic	72	0.0138888889	1		WXS	Illumina HiSeq	Phase_I	57	0.05	3	NM_000462	43	0.00	0	A8K8Z9|P78355|Q93066|Q9UEP4|Q9UEP5|Q9UEP6|Q9UEP7|Q9UEP8|Q9UEP9	Missense_Mutation	SNP	ENST00000397954.2	37	CCDS45192.1	.	.	.	.	.	.	.	.	.	.	G	32	5.171605	0.94807	.	.	ENSG00000114062	ENST00000232165;ENST00000356465;ENST00000397954;ENST00000438097;ENST00000428984	D;D;D;D	0.94537	-3.45;-3.45;-3.45;-3.45	5.38	5.38	0.77491	HECT (4);	0.000000	0.85682	D	0.000000	D	0.98798	0.9595	H	0.99659	4.685	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99425	1.0934	10	0.87932	D	0	.	19.1347	0.93422	0.0:0.0:1.0:0.0	.	862;865	Q05086-3;Q05086	.;UBE3A_HUMAN	D	862;862;865;842;842	ENSP00000232165:A862D;ENSP00000381045:A865D;ENSP00000411258:A842D;ENSP00000401265:A842D	ENSP00000232165:A862D	A	-	2	0	UBE3A	23135411	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.522000	0.85027	0.460000	0.39030	GCC			0.289	UBE3A-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000434203.1		NM_000462	
SLCO3A1	28232	mdanderson.org	37	15	92647550	92647550	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr15:92647550G>T	ENST00000318445.6	+	4	1001	c.787G>T	c.(787-789)Gcc>Tcc	p.A263S	SLCO3A1_ENST00000424469.2_Missense_Mutation_p.A263S|SLCO3A1_ENST00000555549.1_3'UTR	NM_013272.3	NP_037404.2	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1	263					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	CTGGATCGGAGCCTGGTGGGG	0.567																																					p.A263S													.	.			0			c.G787T												222.0	206.0	211.0					15																	92647550		2198	4298	6496	SO:0001583	missense	28232	exon4			ATCGGAGCCTGGT	AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000318445.6:c.787G>T	15.37:g.92647550G>T	ENSP00000320634:p.Ala263Ser		Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_013272	6	0.00	0	A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	Missense_Mutation	SNP	ENST00000318445.6	37	CCDS10371.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.990288	0.74589	.	.	ENSG00000176463	ENST00000318445;ENST00000424469;ENST00000556649	T;T	0.59364	0.27;0.27	5.12	5.12	0.69794	Major facilitator superfamily domain, general substrate transporter (1);	0.109676	0.64402	D	0.000008	D	0.83741	0.5320	H	0.95079	3.62	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.996;0.998	D	0.88950	0.3386	10	0.72032	D	0.01	.	18.5528	0.91072	0.0:0.0:1.0:0.0	.	205;263;263	Q9UIG8-3;Q9UIG8-2;Q9UIG8	.;.;SO3A1_HUMAN	S	263;263;56	ENSP00000320634:A263S;ENSP00000387846:A263S	ENSP00000320634:A263S	A	+	1	0	SLCO3A1	90448554	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.093000	0.94163	2.353000	0.79882	0.655000	0.94253	GCC			0.567	SLCO3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313529.1		NM_013272	
MCTP2	55784	mdanderson.org	37	15	94841503	94841503	+	Silent	SNP	G	G	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr15:94841503G>T	ENST00000357742.4	+	1	9	c.9G>T	c.(7-9)ctG>ctT	p.L3L	MCTP2_ENST00000543482.1_Silent_p.L3L|MCTP2_ENST00000451018.3_Silent_p.L3L|MCTP2_ENST00000331706.4_5'UTR	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	3					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			CCATGGATCTGGATAAACCAT	0.428																																					p.L3L													.	.			0			c.G9T												83.0	85.0	84.0					15																	94841503		2197	4298	6495	SO:0001819	synonymous_variant	55784	exon1			GGATCTGGATAAA	AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.9G>T	15.37:g.94841503G>T			Somatic	49	0.0204081633	1		WXS	Illumina HiSeq	Phase_I	31	0.10	3	NM_018349	2	0.00	0	A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Silent	SNP	ENST00000357742.4	37	CCDS32338.1																																																																																					0.428	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000415060.3		NM_018349	
ADAMTS17	170691	broad.mit.edu	37	15	100672218	100672218	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr15:100672218T>G	ENST00000268070.4	-	12	1820	c.1715A>C	c.(1714-1716)aAc>aCc	p.N572T	RP11-90E5.1_ENST00000560128.1_RNA	NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	572	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		TTACGGGGGGTTGTCACATTT	0.627											OREG0023513	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N572T													.	ADAMTS17	127		0			c.A1715C												58.0	62.0	60.0					15																	100672218		2203	4300	6503	SO:0001583	missense	170691	exon12			GGGGGGTTGTCAC	AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.1715A>C	15.37:g.100672218T>G	ENSP00000268070:p.Asn572Thr		Somatic	83	0.1084337349	9	1353	WXS	Illumina HiSeq	Phase_I	86	0.29	25	NM_139057	0		0	Q2I7G4|Q6ZN75	Missense_Mutation	SNP	ENST00000268070.4	37	CCDS10383.1	.	.	.	.	.	.	.	.	.	.	T	17.51	3.407643	0.62399	.	.	ENSG00000140470	ENST00000268070;ENST00000378898	T	0.53640	0.61	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.51669	0.1688	L	0.46885	1.475	0.58432	D	0.999999	P;P	0.47484	0.59;0.896	B;P	0.48952	0.264;0.596	T	0.55786	-0.8086	10	0.66056	D	0.02	.	15.1255	0.72481	0.0:0.0:0.0:1.0	.	329;572	Q8TE56-2;Q8TE56	.;ATS17_HUMAN	T	572;329	ENSP00000268070:N572T	ENSP00000268070:N572T	N	-	2	0	ADAMTS17	98489741	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.666000	0.68059	1.961000	0.56991	0.459000	0.35465	AAC			0.627	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313595.1		NM_139057	
RHBDF1	64285	hgsc.bcm.edu	37	16	108513	108513	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr16:108513G>T	ENST00000262316.6	-	18	2536	c.2394C>A	c.(2392-2394)taC>taA	p.Y798*		NM_022450.3	NP_071895.3	Q96CC6	RHDF1_HUMAN	rhomboid 5 homolog 1 (Drosophila)	798					cell migration (GO:0016477)|cell proliferation (GO:0008283)|negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)|proteolysis (GO:0006508)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	18		all_cancers(16;2.56e-05)|all_epithelial(16;0.000116)|Hepatocellular(780;0.0068)|Lung NSC(18;0.0795)|all_lung(18;0.159)				AGCGTTTCCGGTACAGGTCGA	0.552																																					p.Y798X													.	.			0			c.C2394A												148.0	160.0	156.0					16																	108513		2203	4300	6503	SO:0001587	stop_gained	64285	exon18			TTTCCGGTACAGG	BC014425	CCDS32344.1	16p13.3	2008-02-05	2006-02-22		ENSG00000007384	ENSG00000007384			20561	protein-coding gene	gene with protein product		614403	"""chromosome 16 open reading frame 8"", ""rhomboid family 1 (Drosophila)"""	C16orf8		8318735, 15965977	Standard	NM_022450		Approved	EGFR-RS, FLJ2235, Dist1	uc002cfl.4	Q96CC6	OTTHUMG00000060719	ENST00000262316.6:c.2394C>A	16.37:g.108513G>T	ENSP00000262316:p.Tyr798*		Somatic	162	0	0		WXS	Illumina HiSeq	.	132	0.05	6	NM_022450	68	0.00	0	Q04842|Q1W6H2|Q4TT59|Q96S34|Q9H6E1	Nonsense_Mutation	SNP	ENST00000262316.6	37	CCDS32344.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	14.38|14.38	2.516723|2.516723	0.44763|0.44763	.|.	.|.	ENSG00000007384|ENSG00000007384	ENST00000448893|ENST00000262316	.|.	.|.	.|.	5.07|5.07	3.07|3.07	0.35406|0.35406	.|.	.|0.123361	.|0.56097	.|D	.|0.000024	T|.	0.29945|.	0.0749|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.13899|.	-1.0492|.	4|.	.|0.02654	.|T	.|1	-33.4656|-33.4656	9.1715|9.1715	0.37083|0.37083	0.2447:0.0:0.7553:0.0|0.2447:0.0:0.7553:0.0	.|.	.|.	.|.	.|.	N|X	175|798	.|.	.|ENSP00000262316:Y798X	T|Y	-|-	2|3	0|2	RHBDF1|RHBDF1	48513|48513	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.476000|0.476000	0.33039|0.33039	3.028000|3.028000	0.49705|0.49705	1.266000|1.266000	0.44231|0.44231	0.591000|0.591000	0.81541|0.81541	ACC|TAC			0.552	RHBDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000134178.2		NM_022450	
NPRL3	8131	bcgsc.ca	37	16	139811	139811	+	Missense_Mutation	SNP	G	G	T	rs534585670		TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr16:139811G>T	ENST00000399953.3	-	11	1653	c.1251C>A	c.(1249-1251)agC>agA	p.S417R	Z69720.2_ENST00000601483.1_RNA|NPRL3_ENST00000405960.3_5'UTR|NPRL3_ENST00000399951.3_Missense_Mutation_p.S238R	NM_001077350.2|NM_001243247.1|NM_001243248.1|NM_001243249.1	NP_001070818.1|NP_001230176.1|NP_001230177.1|NP_001230178.1	Q12980	NPRL3_HUMAN	nitrogen permease regulator-like 3 (S. cerevisiae)	417					aorta morphogenesis (GO:0035909)|cardiac muscle tissue development (GO:0048738)|palate development (GO:0060021)|ventricular septum development (GO:0003281)		GTPase activator activity (GO:0005096)			endometrium(1)|large_intestine(3)|ovary(2)	6						GCTCCTCCTCGCTGGGTGAGG	0.672																																					.													.	NPRL3	73		0			.												21.0	29.0	26.0					16																	139811		2177	4256	6433	SO:0001583	missense	8131	.			CTCCTCGCTGGGT		CCDS73794.1, CCDS73795.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000103148	ENSG00000103148			14124	protein-coding gene	gene with protein product	"""conserved gene telomeric to alpha globin cluster"""	600928	"""chromosome 16 open reading frame 35"""	C16orf35		8575760	Standard	NM_001243247		Approved	CGTHBA, RMD11, NPR3, MARE, HS-40	uc002cfr.3	Q12980	OTTHUMG00000047792	ENST00000399953.3:c.1251C>A	16.37:g.139811G>T	ENSP00000382834:p.Ser417Arg		Somatic	61	0	0		WXS	Illumina HiSeq	Phase_1	70	0.00	0	.	44	0.00	0	D3DU40|Q1W6H0|Q4TT56|Q92469	Missense_Mutation	SNP	ENST00000399953.3	37		.	.	.	.	.	.	.	.	.	.	G	10.61	1.397670	0.25205	.	.	ENSG00000103148	ENST00000399953;ENST00000262313;ENST00000399951	.	.	.	4.95	-9.91	0.00458	.	0.312876	0.44097	N	0.000486	T	0.34048	0.0884	.	.	.	0.31222	N	0.697371	B;B;B;B	0.15930	0.015;0.012;0.002;0.001	B;B;B;B	0.13407	0.009;0.006;0.005;0.002	T	0.02301	-1.1180	8	0.27785	T	0.31	-37.0968	17.2449	0.87025	0.1835:0.0831:0.7334:0.0	.	339;392;392;417	B7Z220;Q4TT55;B7Z6Q0;Q12980	.;.;.;NPRL3_HUMAN	R	417;392;238	.	ENSP00000262313:S392R	S	-	3	2	NPRL3	79811	0.000000	0.05858	0.100000	0.21137	0.926000	0.56050	-2.934000	0.00686	-2.890000	0.00315	-0.378000	0.06908	AGC			0.672	NPRL3-202	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_001039476	
PKD1	5310	mdanderson.org	37	16	2158642	2158642	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr16:2158642G>T	ENST00000262304.4	-	15	6734	c.6526C>A	c.(6526-6528)Cgc>Agc	p.R2176S	PKD1_ENST00000561991.1_5'Flank|PKD1_ENST00000423118.1_Missense_Mutation_p.R2176S	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	2176	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						ACGCAGTCGCGCAGGTCAACG	0.706																																					p.R2176S													.	.			0			c.C6526A												25.0	19.0	21.0					16																	2158642		2147	4247	6394	SO:0001583	missense	5310	exon15			AGTCGCGCAGGTC	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.6526C>A	16.37:g.2158642G>T	ENSP00000262304:p.Arg2176Ser		Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_001009944	7	0.00	0	Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	37	CCDS32369.1	.	.	.	.	.	.	.	.	.	.	g	18.31	3.596559	0.66332	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101;ENST00000382481	T;T	0.34667	1.35;1.35	5.49	5.49	0.81192	Egg jelly receptor, REJ-like (1);PKD/REJ-like protein (1);Polycystin cation channel (1);	0.138163	0.53938	D	0.000048	T	0.56543	0.1992	L	0.53249	1.67	0.39962	D	0.974677	D;D	0.76494	0.999;0.995	D;D	0.72075	0.976;0.951	T	0.51505	-0.8697	10	0.33940	T	0.23	.	19.4518	0.94871	0.0:0.0:1.0:0.0	.	2176;2176	P98161-3;P98161	.;PKD1_HUMAN	S	2176;2176;1527;455	ENSP00000262304:R2176S;ENSP00000399501:R2176S	ENSP00000262304:R2176S	R	-	1	0	PKD1	2098643	1.000000	0.71417	0.997000	0.53966	0.975000	0.68041	6.614000	0.74197	2.597000	0.87782	0.544000	0.68410	CGC			0.706	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000341688.1			
SMG1	23049	ucsc.edu;mdanderson.org	37	16	18846457	18846457	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr16:18846457G>T	ENST00000446231.2	-	49	8499	c.8087C>A	c.(8086-8088)cCc>cAc	p.P2696H	SMG1_ENST00000389467.3_Missense_Mutation_p.P2696H			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	2696					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						CACTGTTGGGGGTGGCTGGGG	0.423																																					p.P2696H													.	SMG1	401		0			c.C8087A												84.0	83.0	83.0					16																	18846457		1905	4123	6028	SO:0001583	missense	23049	exon49			GTTGGGGGTGGCT	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.8087C>A	16.37:g.18846457G>T	ENSP00000402515:p.Pro2696His		Somatic	74	0	0		WXS	Illumina HiSeq		54	0.09	5	NM_015092	26	0.00	0	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	37	CCDS45430.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.999947	0.74818	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.01126	5.3;5.3	5.59	5.59	0.84812	Armadillo-type fold (1);	0.000000	0.64402	D	0.000004	T	0.02083	0.0065	N	0.08118	0	0.48632	D	0.999685	D	0.69078	0.997	P	0.55545	0.778	T	0.72666	-0.4224	10	0.87932	D	0	.	19.9542	0.97213	0.0:0.0:1.0:0.0	.	2696	Q96Q15	SMG1_HUMAN	H	2696	ENSP00000402515:P2696H;ENSP00000374118:P2696H	ENSP00000374118:P2696H	P	-	2	0	SMG1	18753958	1.000000	0.71417	0.985000	0.45067	0.998000	0.95712	7.287000	0.78681	2.788000	0.95919	0.585000	0.79938	CCC			0.423	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000391817.1		NM_015092	
SRCAP	10847	hgsc.bcm.edu;mdanderson.org	37	16	30732775	30732775	+	Silent	SNP	C	C	A	rs368322185		TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr16:30732775C>A	ENST00000262518.4	+	21	3904	c.3519C>A	c.(3517-3519)ccC>ccA	p.P1173P	SRCAP_ENST00000395059.2_Silent_p.P1173P|SRCAP_ENST00000344771.4_Intron	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1173	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			TTCTATCTCCCGATATGCAGG	0.577																																					p.P1173P													SRCAP,NS,carcinoma,+2,1	SRCAP	2	1	0			c.C3519A												75.0	66.0	69.0					16																	30732775		2197	4300	6497	SO:0001819	synonymous_variant	10847	exon21			ATCTCCCGATATG	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.3519C>A	16.37:g.30732775C>A			Somatic	56	0	0		WXS	Illumina HiSeq	.	29	0.07	2	NM_006662	37	0.00	0	B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	ENST00000262518.4	37	CCDS10689.2																																																																																					0.577	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255523.1		NM_006662	
PELP1	27043	mdanderson.org	37	17	4594224	4594224	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr17:4594224G>T	ENST00000574876.1	-	3	396	c.379C>A	c.(379-381)Cac>Aac	p.H127N	PELP1_ENST00000572293.1_Missense_Mutation_p.H177N|PELP1_ENST00000570823.1_5'UTR|PELP1_ENST00000436683.2_5'UTR|AC091153.4_ENST00000441700.2_RNA|PELP1_ENST00000301396.4_Missense_Mutation_p.H127N|PELP1_ENST00000269230.7_Missense_Mutation_p.H127N			Q8IZL8	PELP1_HUMAN	proline, glutamate and leucine rich protein 1	127					cellular response to estrogen stimulus (GO:0071391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	15						GACACACAGTGCTGCTGGAAT	0.547																																					p.H127N													.	.			0			c.C379A												72.0	71.0	71.0					17																	4594224		1984	4157	6141	SO:0001583	missense	27043	exon3			CACAGTGCTGCTG		CCDS58503.1, CCDS58503.2, CCDS62038.1	17p13.2	2012-05-02	2008-02-21			ENSG00000141456			30134	protein-coding gene	gene with protein product		609455	"""proline, glutamic acid and leucine rich protein 1"""			11481323, 12682072	Standard	NM_014389		Approved	MNAR	uc002fyi.4	Q8IZL8		ENST00000574876.1:c.379C>A	17.37:g.4594224G>T	ENSP00000461625:p.His127Asn		Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	108	0.05	5	NM_014389	142	0.01	1	O15450|Q5EGN3|Q6NTE6|Q96FT1|Q9BU60	Missense_Mutation	SNP	ENST00000574876.1	37	CCDS58503.1	.	.	.	.	.	.	.	.	.	.	G	15.17	2.755304	0.49362	.	.	ENSG00000141456	ENST00000301396;ENST00000269230	T;T	0.68181	-0.31;-0.24	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.70666	0.3250	N	0.20986	0.625	0.80722	D	1	D	0.69078	0.997	D	0.83275	0.996	T	0.68648	-0.5353	10	0.31617	T	0.26	-16.0346	15.9204	0.79562	0.0:0.0:1.0:0.0	.	127	Q8IZL8	PELP1_HUMAN	N	127	ENSP00000301396:H127N;ENSP00000269230:H127N	ENSP00000269230:H127N	H	-	1	0	AC091153.1	4540973	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.168000	0.71908	2.609000	0.88269	0.563000	0.77884	CAC			0.547	PELP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000439140.2		NM_014389	
AIPL1	23746	mdanderson.org	37	17	6328803	6328803	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr17:6328803G>T	ENST00000381129.3	-	6	1212	c.1132C>A	c.(1132-1134)Cca>Aca	p.P378T	AIPL1_ENST00000575265.1_3'UTR|AIPL1_ENST00000250087.5_Missense_Mutation_p.P315T|AIPL1_ENST00000576776.1_Missense_Mutation_p.P354T|AIPL1_ENST00000576307.1_Missense_Mutation_p.P318T|AIPL1_ENST00000570466.1_Missense_Mutation_p.P356T|AIPL1_ENST00000574506.1_Missense_Mutation_p.P366T	NM_001033055.1|NM_014336.3	NP_001028227.1|NP_055151.3	Q9NZN9	AIPL1_HUMAN	aryl hydrocarbon receptor interacting protein-like 1	378					negative regulation of apoptotic process (GO:0043066)|phototransduction, visible light (GO:0007603)|protein farnesylation (GO:0018343)|protein folding (GO:0006457)|regulation of cGMP metabolic process (GO:0030823)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)	farnesylated protein binding (GO:0001918)|unfolded protein binding (GO:0051082)			NS(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|skin(1)	12				COAD - Colon adenocarcinoma(228;0.141)		GAGTGCCCTGGGGACGGgggt	0.662																																					p.P378T													.	.			0			c.C1132A												36.0	41.0	40.0					17																	6328803		2201	4292	6493	SO:0001583	missense	23746	exon6			GCCCTGGGGACGG	AF148864	CCDS11075.1, CCDS32539.1, CCDS32540.1, CCDS67130.1, CCDS67131.1, CCDS67132.1, CCDS67133.1	17p13.1	2013-01-08	2001-11-29		ENSG00000129221	ENSG00000129221			359	protein-coding gene	gene with protein product		604392	"""aryl hydrocarbon receptor-interacting protein-like 1"""	LCA4		10615133, 14555765, 15365173	Standard	NM_001285402		Approved		uc002gcp.3	Q9NZN9	OTTHUMG00000102043	ENST00000381129.3:c.1132C>A	17.37:g.6328803G>T	ENSP00000370521:p.Pro378Thr		Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	12	0.17	2	NM_014336	12	0.00	0	D3DTM4|Q659W3|Q659W4|Q6ZZB6|Q8N6A0|Q9H873|Q9NS10	Missense_Mutation	SNP	ENST00000381129.3	37	CCDS11075.1	.	.	.	.	.	.	.	.	.	.	G	9.423	1.083421	0.20309	.	.	ENSG00000129221	ENST00000381129;ENST00000381128;ENST00000250087	D;D	0.87179	-2.22;-2.09	2.92	-0.494	0.12034	.	1.113130	0.07513	U	0.909258	T	0.71676	0.3368	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.26775	0.099;0.099;0.159;0.159;0.099	B;B;B;B;B	0.27500	0.026;0.026;0.058;0.08;0.026	T	0.60747	-0.7202	10	0.52906	T	0.07	.	3.3333	0.07092	0.2507:0.235:0.5143:0.0	.	354;356;315;318;378	Q659W3;Q659W4;Q9NZN9-3;Q9NZN9-2;Q9NZN9	.;.;.;.;AIPL1_HUMAN	T	378;318;315	ENSP00000370521:P378T;ENSP00000250087:P315T	ENSP00000250087:P315T	P	-	1	0	AIPL1	6269527	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.155000	0.10115	-0.100000	0.12241	0.462000	0.41574	CCA			0.662	AIPL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000219828.3		NM_014336	
DRG2	1819	mdanderson.org	37	17	18002382	18002382	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr17:18002382G>A	ENST00000225729.3	+	4	505	c.367G>A	c.(367-369)Gca>Aca	p.A123T	DRG2_ENST00000395726.4_Missense_Mutation_p.A123T|DRG2_ENST00000583355.1_Intron	NM_001388.4	NP_001379.1	P55039	DRG2_HUMAN	developmentally regulated GTP binding protein 2	123	OBG-type G. {ECO:0000255|PROSITE- ProRule:PRU01047}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	14	all_neural(463;0.228)					CATTGAAGGCGCAGCCCAAGG	0.547																																					p.A123T													.	.			0			c.G367A												97.0	94.0	95.0					17																	18002382		2203	4300	6503	SO:0001583	missense	1819	exon4			GAAGGCGCAGCCC	X80754	CCDS11191.1	17p13-p12	2008-07-18	2001-11-28		ENSG00000108591	ENSG00000108591			3030	protein-coding gene	gene with protein product		602986	"""developmentally regulated GTP-binding protein 2"""			9605870, 7929244	Standard	NM_001388		Approved		uc002gsh.2	P55039	OTTHUMG00000059399	ENST00000225729.3:c.367G>A	17.37:g.18002382G>A	ENSP00000225729:p.Ala123Thr		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	93	0.05	5	NM_001388	76	0.00	0	B2R8G5|Q53Y50|Q9BWB2	Missense_Mutation	SNP	ENST00000225729.3	37	CCDS11191.1	.	.	.	.	.	.	.	.	.	.	G	18.48	3.633383	0.67015	.	.	ENSG00000108591	ENST00000395726;ENST00000225729	T;T	0.35048	1.33;1.33	5.05	5.05	0.67936	GTP1/OBG, conserved site (1);Small GTP-binding protein domain (1);GTP1/OBG (1);GTP-binding domain, HSR1-related (1);	0.000000	0.85682	D	0.000000	T	0.73353	0.3576	H	0.96547	3.84	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.993;1.0;1.0	D	0.83514	0.0082	10	0.87932	D	0	-43.3458	18.4054	0.90533	0.0:0.0:1.0:0.0	.	123;123;123	B4DIG2;A8MZF9;P55039	.;.;DRG2_HUMAN	T	123	ENSP00000379076:A123T;ENSP00000225729:A123T	ENSP00000225729:A123T	A	+	1	0	DRG2	17943107	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.713000	0.98740	2.344000	0.79699	0.563000	0.77884	GCA			0.547	DRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000132075.3		NM_001388	
MAPK7	5598	broad.mit.edu	37	17	19285118	19285118	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr17:19285118C>A	ENST00000308406.5	+	5	1888	c.1502C>A	c.(1501-1503)gCt>gAt	p.A501D	MAPK7_ENST00000571657.1_Intron|MFAP4_ENST00000574313.2_5'Flank|MAPK7_ENST00000395604.3_Missense_Mutation_p.A501D|MAPK7_ENST00000395602.4_Missense_Mutation_p.A501D|MAPK7_ENST00000299612.7_Missense_Mutation_p.A362D	NM_139033.2	NP_620602.2	Q13164	MK07_HUMAN	mitogen-activated protein kinase 7	501	May not be required for kinase activity; required to stimulate MEF2C activity. {ECO:0000250}.|Pro-rich.				cAMP-mediated signaling (GO:0019933)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to transforming growth factor beta stimulus (GO:0071560)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cAMP catabolic process (GO:0030821)|negative regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051344)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NFAT protein import into nucleus (GO:0051534)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of response to cytokine stimulus (GO:0060761)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|regulation of angiogenesis (GO:0045765)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|mitogen-activated protein kinase binding (GO:0051019)	p.A501D(1)		autonomic_ganglia(1)|central_nervous_system(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(9)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	30	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)					CCCCTGGAGGCTCCTGAGCCT	0.672																																					p.A501D													MAPK7,NS,carcinoma,0,2	MAPK7	72	2	1	Substitution - Missense(1)	endometrium(1)	c.C1502A												10.0	17.0	15.0					17																	19285118		2162	4232	6394	SO:0001583	missense	5598	exon5			TGGAGGCTCCTGA	U25278	CCDS11206.1, CCDS11207.1	17p11.2	2011-06-09			ENSG00000166484	ENSG00000166484	2.7.11.24	"""Mitogen-activated protein kinase cascade / Kinases"""	6880	protein-coding gene	gene with protein product	"""BMK1 kinase"", ""extracellular-signal-regulated kinase 5"""	602521		PRKM7		10072598, 7759517	Standard	NM_139032		Approved	BMK1, ERK5	uc002gvp.3	Q13164	OTTHUMG00000059587	ENST00000308406.5:c.1502C>A	17.37:g.19285118C>A	ENSP00000311005:p.Ala501Asp		Somatic	66	0.0151515152	1		WXS	Illumina HiSeq	Phase_I	72	0.08	6	NM_002749	68	0.18	12	Q16634|Q59F50|Q6QLU7|Q7L4P4|Q969G1|Q96G51	Missense_Mutation	SNP	ENST00000308406.5	37	CCDS11206.1	.	.	.	.	.	.	.	.	.	.	C	16.89	3.248312	0.59103	.	.	ENSG00000166484	ENST00000308406;ENST00000299612;ENST00000395604;ENST00000395602	T;T;T;T	0.74209	-0.57;-0.82;-0.57;-0.57	4.36	3.39	0.38822	.	0.278335	0.34291	N	0.004097	T	0.62792	0.2457	N	0.22421	0.69	0.33339	D	0.569546	P	0.50943	0.94	P	0.47299	0.543	T	0.71846	-0.4469	10	0.87932	D	0	-7.5638	6.6062	0.22726	0.0:0.7883:0.0:0.2117	.	501	Q13164	MK07_HUMAN	D	501;362;501;501	ENSP00000311005:A501D;ENSP00000299612:A362D;ENSP00000378968:A501D;ENSP00000378966:A501D	ENSP00000299612:A362D	A	+	2	0	MAPK7	19225711	0.988000	0.35896	0.980000	0.43619	0.970000	0.65996	1.704000	0.37857	1.055000	0.40461	0.561000	0.74099	GCT			0.672	MAPK7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000132506.1		NM_139033	
C17orf51	339263	broad.mit.edu	37	17	21477627	21477627	+	5'UTR	SNP	C	C	A			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr17:21477627C>A	ENST00000535846.1	-	0	95				RP11-822E23.6_ENST00000536958.2_RNA|RP11-822E23.8_ENST00000426261.2_RNA			A8MQB3	CQ051_HUMAN	chromosome 17 open reading frame 51											endometrium(1)	1						tcctgtggaccccgtggagaa	0.652																																					.													.	.			0			.																																									SO:0001623	5_prime_UTR_variant	0	.			GTGGACCCCGTGG	BC010612	CCDS45629.1	17p11.2	2012-10-11			ENSG00000212719	ENSG00000212719			27904	protein-coding gene	gene with protein product							Standard	XM_005256621		Approved	FLJ12977, FLJ31874, FLJ33618	uc002gyw.4	A8MQB3	OTTHUMG00000132832	ENST00000535846.1:c.-613G>T	17.37:g.21477627C>A			Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	.	0		0	B2RN29|B5MCL4	RNA	SNP	ENST00000535846.1	37																																																																																						0.652	C17orf51-003	KNOWN	basic|readthrough_transcript	processed_transcript	protein_coding		OTTHUMT00000395737.1		NM_001113434	
PIPOX	51268	broad.mit.edu	37	17	27380007	27380007	+	Silent	SNP	G	G	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr17:27380007G>T	ENST00000323372.4	+	3	659	c.333G>T	c.(331-333)tcG>tcT	p.S111S	PIPOX_ENST00000583215.1_3'UTR	NM_016518.2	NP_057602.2	Q9P0Z9	SOX_HUMAN	pipecolic acid oxidase	111					L-lysine catabolic process to acetyl-CoA via L-pipecolate (GO:0033514)|oxidation-reduction process (GO:0055114)|tetrahydrofolate metabolic process (GO:0046653)	peroxisome (GO:0005777)	L-pipecolate oxidase activity (GO:0050031)|receptor binding (GO:0005102)|sarcosine oxidase activity (GO:0008115)			endometrium(2)|large_intestine(4)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	10	Lung NSC(42;0.015)		Epithelial(11;9.87e-06)|BRCA - Breast invasive adenocarcinoma(11;3.92e-05)|all cancers(11;5.59e-05)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)		Glycine(DB00145)	CCAATCTGTCGAGGCAGAGGG	0.458																																					p.S111S													.	PIPOX	42		0			c.G333T												94.0	89.0	91.0					17																	27380007		2203	4300	6503	SO:0001819	synonymous_variant	51268	exon3			TCTGTCGAGGCAG	AF134593	CCDS11248.1	17p13.2	2008-07-18			ENSG00000179761	ENSG00000179761			17804	protein-coding gene	gene with protein product	"""L-pipecolic acid oxidase"""					10772957, 10642506	Standard	NM_016518		Approved	LPIPOX	uc002hdr.1	Q9P0Z9	OTTHUMG00000132679	ENST00000323372.4:c.333G>T	17.37:g.27380007G>T			Somatic	145	0	0		WXS	Illumina HiSeq	Phase_I	219	0.03	6	NM_016518	31	0.00	0	B3KNH0|Q96H28|Q9C070	Silent	SNP	ENST00000323372.4	37	CCDS11248.1																																																																																					0.458	PIPOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255954.1		NM_016518	
PLEKHM1	9842	bcgsc.ca	37	17	43522989	43522989	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr17:43522989G>A	ENST00000430334.3	-	9	2817	c.2684C>T	c.(2683-2685)gCc>gTc	p.A895V	PLEKHM1_ENST00000421073.2_Missense_Mutation_p.A806V|PLEKHM1_ENST00000580404.1_5'UTR	NM_014798.2	NP_055613.1	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1	895					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(6)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26	Renal(3;0.0405)					GAGGGGCTGGGCCCGGATCTG	0.597																																					p.A895V													.	PLEKHM1	69		0			c.C2684T												64.0	61.0	62.0					17																	43522989		2200	4300	6500	SO:0001583	missense	9842	exon9			GGCTGGGCCCGGA	X85792	CCDS32671.1	17q21.31	2013-01-11				ENSG00000225190		"""Pleckstrin homology (PH) domain containing"""	29017	protein-coding gene	gene with protein product		611466				9205841, 12820725	Standard	NM_014798		Approved	KIAA0356	uc002ija.3	Q9Y4G2		ENST00000430334.3:c.2684C>T	17.37:g.43522989G>A	ENSP00000389913:p.Ala895Val		Somatic	118	0	0		WXS	Illumina HiSeq	Phase_1	151	0.00	0	NM_014798	28	0.00	0	Q6P2R5|Q8TEL9|Q9NPP5|Q9NYA0	Missense_Mutation	SNP	ENST00000430334.3	37	CCDS32671.1	.	.	.	.	.	.	.	.	.	.	G	12.66	2.003887	0.35320	.	.	ENSG00000225190	ENST00000430334;ENST00000446609;ENST00000421073	T;T	0.64085	-0.08;-0.08	4.59	1.29	0.21616	.	0.606178	0.17478	N	0.172828	T	0.43722	0.1260	L	0.34521	1.04	0.25376	N	0.988656	B;B	0.02656	0.0;0.0	B;B	0.09377	0.002;0.004	T	0.23655	-1.0182	10	0.38643	T	0.18	.	4.2158	0.10533	0.1878:0.0:0.5629:0.2493	.	806;895	F8W648;Q9Y4G2	.;PKHM1_HUMAN	V	895;844;806	ENSP00000389913:A895V;ENSP00000414352:A806V	ENSP00000414352:A806V	A	-	2	0	PLEKHM1	40878772	0.413000	0.25400	1.000000	0.80357	0.987000	0.75469	2.116000	0.41930	0.654000	0.30846	-0.663000	0.03849	GCC			0.597	PLEKHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000444659.1		NM_014798	
RGS9	8787	mdanderson.org	37	17	63133690	63133690	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr17:63133690G>T	ENST00000262406.9	+	1	99	c.32G>T	c.(31-33)aGg>aTg	p.R11M	RGS9_ENST00000443584.3_Missense_Mutation_p.R11M|RGS9_ENST00000449996.3_Missense_Mutation_p.R11M	NM_003835.3	NP_003826.2	O75916	RGS9_HUMAN	regulator of G-protein signaling 9	11					dopamine receptor signaling pathway (GO:0007212)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to estrogen (GO:0043627)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(8)|liver(2)|lung(12)|ovary(2)|prostate(3)|skin(3)	41						CAGCAGTACAGGCCGAGGATG	0.617																																					p.R11M													.	.			0			c.G32T												54.0	58.0	57.0					17																	63133690		1956	4134	6090	SO:0001583	missense	8787	exon1			AGTACAGGCCGAG	AF071476	CCDS42373.1, CCDS45764.1	17q24	2008-07-18	2007-08-14			ENSG00000108370		"""Regulators of G-protein signaling"""	10004	protein-coding gene	gene with protein product	"""regulator of G protein signalling 9"", ""regulator of G protein signalling 9L"", ""regulator of G-protein signaling 9L"""	604067	"""regulator of G-protein signalling 9"""			9765512	Standard	NM_003835		Approved	PERRS, RGS9L, MGC26458, MGC111763	uc002jfe.3	O75916		ENST00000262406.9:c.32G>T	17.37:g.63133690G>T	ENSP00000262406:p.Arg11Met		Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	56	0.05	3	NM_001081955	8	0.13	1	A8K3C0|O75573|Q696R2|Q8TD64|Q8TD65|Q9HC32|Q9HC33	Missense_Mutation	SNP	ENST00000262406.9	37	CCDS42373.1	.	.	.	.	.	.	.	.	.	.	G	12.37	1.916450	0.33815	.	.	ENSG00000108370	ENST00000262406;ENST00000449996;ENST00000443584	T;T;T	0.36340	1.3;1.26;1.28	4.01	4.01	0.46588	.	0.055982	0.64402	D	0.000002	T	0.56470	0.1987	M	0.70275	2.135	0.39764	D	0.972072	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.991;0.982;0.992	T	0.62789	-0.6780	10	0.87932	D	0	.	11.8004	0.52124	0.0:0.0:1.0:0.0	.	11;11;11	A8K1G1;O75916;O75916-5	.;RGS9_HUMAN;.	M	11	ENSP00000262406:R11M;ENSP00000396329:R11M;ENSP00000405814:R11M	ENSP00000262406:R11M	R	+	2	0	RGS9	60564152	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	4.559000	0.60796	2.229000	0.72834	0.313000	0.20887	AGG			0.617	RGS9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000445885.1		NM_003835	
PRPSAP1	5635	mdanderson.org	37	17	74349755	74349755	+	Silent	SNP	C	C	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr17:74349755C>T	ENST00000446526.3	-	1	475	c.30G>A	c.(28-30)ccG>ccA	p.P10P	PRPSAP1_ENST00000324684.4_Intron	NM_002766.2	NP_002757.2	Q14558	KPRA_HUMAN	phosphoribosyl pyrophosphate synthetase-associated protein 1	0					negative regulation of kinase activity (GO:0033673)|nucleobase-containing compound metabolic process (GO:0006139)|nucleotide biosynthetic process (GO:0009165)	ribose phosphate diphosphokinase complex (GO:0002189)	enzyme inhibitor activity (GO:0004857)|magnesium ion binding (GO:0000287)|ribose phosphate diphosphokinase activity (GO:0004749)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	17						ACGCGGAGGGCGGGGGCAACA	0.736																																					p.P10P													.	.			0			c.G30A												4.0	8.0	7.0					17																	74349755		636	1523	2159	SO:0001819	synonymous_variant	5635	exon1			GGAGGGCGGGGGC	D61391	CCDS11743.2	17q24-q25	2008-07-18			ENSG00000161542	ENSG00000161542			9466	protein-coding gene	gene with protein product		601249				8660991	Standard	NM_002766		Approved	PAP39	uc010wta.1	Q14558	OTTHUMG00000155969	ENST00000446526.3:c.30G>A	17.37:g.74349755C>T			Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_002766	18	0.00	0	B2R6M4|Q96H06	Silent	SNP	ENST00000446526.3	37	CCDS11743.2																																																																																					0.736	PRPSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000342480.2		NM_002766	
DSG2	1829	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	18	29122743	29122743	+	Silent	SNP	C	C	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr18:29122743C>T	ENST00000261590.8	+	14	2471	c.2262C>T	c.(2260-2262)tcC>tcT	p.S754S	RP11-75N4.2_ENST00000583706.1_RNA	NM_001943.3	NP_001934.2	Q14126	DSG2_HUMAN	desmoglein 2	754					apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|regulation of heart rate by cardiac conduction (GO:0086091)|response to progesterone (GO:0032570)|ventricular cardiac muscle cell action potential (GO:0086005)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(2)|prostate(4)|skin(2)|urinary_tract(1)	49			OV - Ovarian serous cystadenocarcinoma(10;0.0068)			CAGGGGCTTCCAGAGACATGG	0.498																																					p.S754S													DSG2,NS,malignant_melanoma,+1,2	DSG2	1	2	0			c.C2262T												78.0	86.0	83.0					18																	29122743		2046	4201	6247	SO:0001819	synonymous_variant	1829	exon14			GGCTTCCAGAGAC	Z26317	CCDS42423.1	18q12.1	2014-09-17				ENSG00000046604		"""Cadherins / Major cadherins"""	3049	protein-coding gene	gene with protein product		125671				1612610	Standard	NM_001943		Approved	CDHF5	uc002kwu.4	Q14126		ENST00000261590.8:c.2262C>T	18.37:g.29122743C>T			Somatic	115	0	0		WXS	Illumina HiSeq	.	88	0.40	35	NM_001943	138	0.42	58	Q4KKU6	Silent	SNP	ENST00000261590.8	37	CCDS42423.1																																																																																					0.498	DSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000447506.1		NM_001943	
KIAA1468	57614	mdanderson.org	37	18	59854893	59854893	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr18:59854893C>T	ENST00000398130.2	+	1	387	c.155C>T	c.(154-156)gCg>gTg	p.A52V	KIAA1468_ENST00000256858.6_Missense_Mutation_p.A52V|PIGN_ENST00000400334.3_5'Flank|PIGN_ENST00000357637.5_5'Flank|PIGN_ENST00000593225.1_5'Flank	NM_020854.3	NP_065905.2	Q9P260	K1468_HUMAN	KIAA1468	52										autonomic_ganglia(1)|breast(4)|endometrium(4)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47		Colorectal(73;0.186)				CCTGGCTCTGCGGGCTCGCTG	0.682																																					p.A52V													.	.			0			c.C155T												51.0	62.0	58.0					18																	59854893		2002	4154	6156	SO:0001583	missense	57614	exon1			GCTCTGCGGGCTC	BC011992	CCDS11979.2	18q21.33	2005-11-03			ENSG00000134444	ENSG00000134444			29289	protein-coding gene	gene with protein product						11973628	Standard	NM_020854		Approved	HsT885, HsT3308, FLJ33841	uc002lil.3	Q9P260	OTTHUMG00000132780	ENST00000398130.2:c.155C>T	18.37:g.59854893C>T	ENSP00000381198:p.Ala52Val		Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_020854	6	0.00	0		Missense_Mutation	SNP	ENST00000398130.2	37	CCDS11979.2	.	.	.	.	.	.	.	.	.	.	C	15.79	2.938735	0.52972	.	.	ENSG00000134444	ENST00000398130;ENST00000256858	T;T	0.46063	0.88;0.88	4.98	3.0	0.34707	.	0.455677	0.19256	U	0.118803	T	0.23370	0.0565	N	0.14661	0.345	0.32910	D	0.514367	B;B	0.13145	0.007;0.006	B;B	0.12837	0.002;0.008	T	0.23368	-1.0190	9	.	.	.	-1.6773	10.0122	0.41992	0.0:0.7554:0.1507:0.0939	.	52;52	Q9P260-2;Q9P260	.;K1468_HUMAN	V	52	ENSP00000381198:A52V;ENSP00000256858:A52V	.	A	+	2	0	KIAA1468	58005873	0.951000	0.32395	0.999000	0.59377	0.830000	0.47004	1.919000	0.40015	1.228000	0.43614	0.655000	0.94253	GCG			0.682	KIAA1468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256187.1		NM_020854	
DIRAS1	148252	mdanderson.org	37	19	2717599	2717599	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr19:2717599G>A	ENST00000323469.4	-	2	389	c.206C>T	c.(205-207)cCg>cTg	p.P69L	DIRAS1_ENST00000585334.1_Missense_Mutation_p.P69L	NM_145173.3	NP_660156.1	O95057	DIRA1_HUMAN	DIRAS family, GTP-binding RAS-like 1	69					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			kidney(1)|lung(2)|ovary(2)|prostate(1)	6				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGCATGGCCGGGAACTGGTG	0.622																																					p.P69L													DIRAS1,bladder,carcinoma,0,1	DIRAS1	0	1	0			c.C206T												77.0	63.0	68.0					19																	2717599		2203	4299	6502	SO:0001583	missense	148252	exon2			ATGGCCGGGAACT	BC030660	CCDS12092.1	19p13.3	2014-05-09				ENSG00000176490			19127	protein-coding gene	gene with protein product		607862				12107278	Standard	NM_145173		Approved	Di-Ras1, GBTS1, RIG	uc002lwf.3	O95057		ENST00000323469.4:c.206C>T	19.37:g.2717599G>A	ENSP00000325836:p.Pro69Leu		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	64	0.05	3	NM_145173	12	0.00	0		Missense_Mutation	SNP	ENST00000323469.4	37	CCDS12092.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.459820	0.84317	.	.	ENSG00000176490	ENST00000323469	T	0.76316	-1.01	4.07	4.07	0.47477	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.80633	0.4660	L	0.28115	0.83	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.83206	-0.0076	10	0.72032	D	0.01	.	13.7485	0.62890	0.0:0.0:1.0:0.0	.	69	O95057	DIRA1_HUMAN	L	69	ENSP00000325836:P69L	ENSP00000325836:P69L	P	-	2	0	DIRAS1	2668599	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.502000	0.97981	1.813000	0.52934	0.549000	0.68633	CCG			0.622	DIRAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000451350.1			
DOHH	83475	broad.mit.edu	37	19	3496745	3496745	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr19:3496745G>T	ENST00000427575.1	-	2	519	c.68C>A	c.(67-69)gCc>gAc	p.A23D	DOHH_ENST00000250937.3_Missense_Mutation_p.A23D	NM_001145165.1	NP_001138637.1			deoxyhypusine hydroxylase/monooxygenase											central_nervous_system(1)|large_intestine(1)|lung(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGGAAGCGGGCCTGCAGGGG	0.672																																					p.A23D													.	DOHH	12		0			c.C68A												30.0	34.0	33.0					19																	3496745		2203	4299	6502	SO:0001583	missense	83475	exon2			AAGCGGGCCTGCA	BC002817	CCDS12108.1	19p13.3	2008-02-05	2006-05-22	2006-05-22		ENSG00000129932			28662	protein-coding gene	gene with protein product		611262	"""HEAT-like (PBS lyase) repeat containing 1"""	HLRC1		16371467, 16533814	Standard	NM_031304		Approved	MGC4293	uc002lxs.3	Q9BU89		ENST00000427575.1:c.68C>A	19.37:g.3496745G>T	ENSP00000398882:p.Ala23Asp		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	61	0.11	7	NM_001145165	50	0.06	3		Missense_Mutation	SNP	ENST00000427575.1	37	CCDS12108.1	.	.	.	.	.	.	.	.	.	.	G	6.366	0.435651	0.12104	.	.	ENSG00000129932	ENST00000427575;ENST00000250937	.	.	.	4.28	4.28	0.50868	Armadillo-like helical (1);	0.572614	0.17864	N	0.159432	T	0.30324	0.0761	L	0.45352	1.415	0.26414	N	0.97622	B	0.06786	0.001	B	0.08055	0.003	T	0.16364	-1.0405	9	0.12766	T	0.61	-7.5811	8.1479	0.31124	0.1119:0.0:0.8881:0.0	.	23	Q9BU89	DOHH_HUMAN	D	23	.	ENSP00000250937:A23D	A	-	2	0	DOHH	3447745	0.999000	0.42202	1.000000	0.80357	0.689000	0.40095	4.666000	0.61554	1.947000	0.56498	0.561000	0.74099	GCC			0.672	DOHH-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452932.1		NM_031304	
CACNA1A	773	mdanderson.org	37	19	13318657	13318657	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr19:13318657C>A	ENST00000360228.5	-	47	6990	c.6991G>T	c.(6991-6993)Ggc>Tgc	p.G2331C	CACNA1A_ENST00000573710.2_3'UTR	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	2330					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	GCCGCCCGGCCCGGCCTGGCC	0.766																																					p.G2331C													.	.			0			c.G6991T												1.0	1.0	1.0					19																	13318657		311	838	1149	SO:0001583	missense	773	exon47			CCCGGCCCGGCCT	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.6991G>T	19.37:g.13318657C>A	ENSP00000353362:p.Gly2331Cys		Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	13	0.31	4	NM_001127222	0		0	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	ENST00000360228.5	37	CCDS45998.1	.	.	.	.	.	.	.	.	.	.	c	3.620	-0.077761	0.07184	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018	D	0.95756	-3.8	2.95	0.278	0.15673	.	0.071793	0.08080	U	1.000000	D	0.86636	0.5980	N	0.08118	0	0.09310	N	0.999997	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.76490	-0.2940	10	0.48119	T	0.1	.	2.3369	0.04250	0.219:0.501:0.1454:0.1346	.	2337;2331;2320	E9PD31;Q9NS88;E7EVF2	.;.;.	C	2331;2337;2320	ENSP00000353362:G2331C	ENSP00000349520:G2320C	G	-	1	0	CACNA1A	13179657	0.008000	0.16893	0.212000	0.23672	0.933000	0.57130	0.128000	0.15810	0.222000	0.20900	0.281000	0.19383	GGC			0.766	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000104062.2		NM_000068	
LRP3	4037	mdanderson.org	37	19	33697230	33697230	+	Silent	SNP	C	C	T	rs139510018		TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr19:33697230C>T	ENST00000253193.7	+	5	1756	c.1554C>T	c.(1552-1554)tgC>tgT	p.C518C	CTD-2540B15.13_ENST00000609744.1_RNA	NM_002333.3	NP_002324.2	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein 3	518					receptor-mediated endocytosis (GO:0006898)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)	15	Esophageal squamous(110;0.137)					CGCTGGGCTGCGCCTTCAAGC	0.672													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16461	0.0		0.0	False		,,,				2504	0.0				p.C518C													.	.			0			c.C1554T							C		0,4404		0,0,2202	20.0	21.0	21.0		1554	-0.5	1.0	19	dbSNP_134	21	1,8593		0,1,4296	no	coding-synonymous	LRP3	NM_002333.3		0,1,6498	TT,TC,CC		0.0116,0.0,0.0077		518/771	33697230	1,12997	2202	4297	6499	SO:0001819	synonymous_variant	4037	exon5			GGGCTGCGCCTTC	AB009462	CCDS12430.1	19q13.11	2013-05-30			ENSG00000130881	ENSG00000130881		"""Low density lipoprotein receptors"""	6695	protein-coding gene	gene with protein product		603159				9693042, 7959795	Standard	NM_002333		Approved	LRP-3, hLRp105	uc010edh.3	O75074	OTTHUMG00000180343	ENST00000253193.7:c.1554C>T	19.37:g.33697230C>T			Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_002333	102	0.00	0	B3KQD6|B4DKF2	Silent	SNP	ENST00000253193.7	37	CCDS12430.1																																																																																			0.001		0.672	LRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450842.4			
U2AF1L4	199746	mdanderson.org	37	19	36233689	36233689	+	Missense_Mutation	SNP	G	G	T	rs187720109		TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr19:36233689G>T	ENST00000412391.2	-	8	607	c.594C>A	c.(592-594)ttC>ttA	p.F198L	PSENEN_ENST00000591949.1_5'Flank|IGFLR1_ENST00000588992.1_5'Flank|AD000671.6_ENST00000589807.1_Intron|AC002398.9_ENST00000591613.2_5'Flank|PSENEN_ENST00000587708.2_5'Flank|IGFLR1_ENST00000344990.3_5'Flank|IGFLR1_ENST00000592537.1_5'Flank|U2AF1L4_ENST00000292879.5_Missense_Mutation_p.S140Y|U2AF1L4_ENST00000378975.3_Missense_Mutation_p.F159L|IGFLR1_ENST00000587101.1_5'Flank|PSENEN_ENST00000222266.2_5'Flank|IGFLR1_ENST00000592889.1_5'Flank|U2AF1L4_ENST00000588100.1_5'Flank|IGFLR1_ENST00000246532.1_5'Flank			Q8WU68	U2AF4_HUMAN	U2 small nuclear RNA auxiliary factor 1-like 4	198					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	8	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GGCCAGTATGGAACCTCGGGG	0.607																																					p.F159L													.	.			0			c.C477A												67.0	74.0	72.0					19																	36233689		2203	4300	6503	SO:0001583	missense	199746	exon6			AGTATGGAACCTC	BC021186, AY569437	CCDS12473.1, CCDS42551.1	19q13.13	2013-02-12	2006-04-12	2006-04-12		ENSG00000161265		"""RNA binding motif (RRM) containing"""	23020	protein-coding gene	gene with protein product		601080	"""U2(RNU2) small nuclear RNA auxiliary factor 1-like 3"", ""U2 small nuclear RNA auxiliary factor 1-like 3"""	U2AF1L3		8586425, 11739736	Standard	NM_001040425		Approved	MGC33901, U2af26	uc002obf.3	Q8WU68		ENST00000412391.2:c.594C>A	19.37:g.36233689G>T	ENSP00000397645:p.Phe198Leu		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	21	0.14	3	NM_001040425	41	0.00	0	A6NKI8|Q56UU3	Missense_Mutation	SNP	ENST00000412391.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	1.009|1.009	-0.688508|-0.688508	0.03328|0.03328	.|.	.|.	ENSG00000161265|ENSG00000161265	ENST00000378975;ENST00000412391|ENST00000292879	.|.	.|.	.|.	4.71|4.71	-4.35|-4.35	0.03656|0.03656	.|.	.|1.434550	.|0.04238	.|N	.|0.336519	T|T	0.28366|0.28366	0.0701|0.0701	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	B|P	0.06786|0.36249	0.001|0.545	B|B	0.12156|0.38755	0.007|0.281	T|T	0.44877|0.44877	-0.9299|-0.9299	7|8	0.10902|0.72032	T|D	0.67|0.01	-0.2383|-0.2383	5.9639|5.9639	0.19315|0.19315	0.5366:0.1454:0.3181:0.0|0.5366:0.1454:0.3181:0.0	.|.	159|140	Q8WU68-3|Q8WU68-2	.|.	L|Y	159;198|140	.|.	ENSP00000368258:F159L|ENSP00000292879:S140Y	F|S	-|-	3|2	2|0	U2AF1L4|U2AF1L4	40925529|40925529	0.345000|0.345000	0.24835|0.24835	0.465000|0.465000	0.27155|0.27155	0.002000|0.002000	0.02628|0.02628	0.112000|0.112000	0.15479|0.15479	-0.228000|-0.228000	0.09869|0.09869	-0.251000|-0.251000	0.11542|0.11542	TTC|TCC			0.607	U2AF1L4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_144987	
RYR1	6261	bcgsc.ca	37	19	38948767	38948767	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr19:38948767G>T	ENST00000359596.3	+	18	2002	c.2002G>T	c.(2002-2004)Gac>Tac	p.D668Y	RYR1_ENST00000360985.3_Missense_Mutation_p.D668Y|RYR1_ENST00000355481.4_Missense_Mutation_p.D668Y			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	668	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GGTGATGGTGGACGAGGTGAC	0.632																																					p.D668Y													.	RYR1	708		0			c.G2002T												84.0	71.0	75.0					19																	38948767		2203	4300	6503	SO:0001583	missense	6261	exon18			ATGGTGGACGAGG	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.2002G>T	19.37:g.38948767G>T	ENSP00000352608:p.Asp668Tyr		Somatic	91	0	0		WXS	Illumina HiSeq	Phase_1	76	0.00	0	NM_001042723	0		0	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	G	17.85	3.489336	0.64074	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	T;T;T	0.70986	-0.53;-0.53;-0.53	4.85	4.85	0.62838	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.64402	U	0.000001	D	0.86351	0.5912	M	0.87547	2.89	0.58432	D	0.99999	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.88861	0.3326	10	0.87932	D	0	.	17.8062	0.88601	0.0:0.0:1.0:0.0	.	668;668	P21817-2;P21817	.;RYR1_HUMAN	Y	668	ENSP00000352608:D668Y;ENSP00000347667:D668Y;ENSP00000354254:D668Y	ENSP00000347667:D668Y	D	+	1	0	RYR1	43640607	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	9.657000	0.98554	2.540000	0.85666	0.549000	0.68633	GAC			0.632	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000462137.1			
PUM2	23369	broad.mit.edu	37	2	20454645	20454645	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr2:20454645A>G	ENST00000361078.2	-	18	2877	c.2855T>C	c.(2854-2856)cTg>cCg	p.L952P	PUM2_ENST00000403432.1_Missense_Mutation_p.L950P|PUM2_ENST00000338086.5_Missense_Mutation_p.L950P|PUM2_ENST00000319801.5_Missense_Mutation_p.L873P|PUM2_ENST00000536417.1_Missense_Mutation_p.L894P			Q8TB72	PUM2_HUMAN	pumilio RNA-binding family member 2	952	PUM-HD. {ECO:0000255|PROSITE- ProRule:PRU00318}.				regulation of translation (GO:0006417)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(7)|lung(13)|ovary(2)|prostate(4)|urinary_tract(3)	42	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTGTTGACTCAGGGCTAAAAC	0.363																																					p.L950P													.	PUM2	91		0			c.T2849C												74.0	72.0	73.0					2																	20454645		2203	4300	6503	SO:0001583	missense	23369	exon18			TGACTCAGGGCTA	AF315591	CCDS1698.1, CCDS74486.1, CCDS74487.1	2p22-p21	2013-09-02	2013-09-02		ENSG00000055917	ENSG00000055917			14958	protein-coding gene	gene with protein product		607205	"""pumilio (Drosphila) homolog 2"", ""pumilio homolog 2 (Drosophila)"""			9039502, 12459267, 12511597	Standard	XM_005262607		Approved	PUMH2, KIAA0235	uc002rds.1	Q8TB72	OTTHUMG00000122098	ENST00000361078.2:c.2855T>C	2.37:g.20454645A>G	ENSP00000354370:p.Leu952Pro		Somatic	229	0.0043668122	1		WXS	Illumina HiSeq	Phase_I	361	0.01	5	NM_015317	130	0.00	0	B3KSL0|B4E2B6|D6W527|O00234|Q53TV7|Q8WY43|Q9HAN2	Missense_Mutation	SNP	ENST00000361078.2	37		.	.	.	.	.	.	.	.	.	.	A	17.91	3.503870	0.64410	.	.	ENSG00000055917	ENST00000338086;ENST00000361078;ENST00000319801;ENST00000440577;ENST00000403432;ENST00000536417	T;T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92;1.92	5.62	5.62	0.85841	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	T	0.66127	0.2758	H	0.96861	3.895	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;1.0	T	0.79042	-0.1965	10	0.87932	D	0	-4.3484	15.837	0.78805	1.0:0.0:0.0:0.0	.	894;871;950;952	B4E2B6;B7ZL34;Q8TB72-3;Q8TB72	.;.;.;PUM2_HUMAN	P	950;952;873;762;950;894	ENSP00000338173:L950P;ENSP00000354370:L952P;ENSP00000326746:L873P;ENSP00000409905:L762P;ENSP00000385992:L950P;ENSP00000440093:L894P	ENSP00000326746:L873P	L	-	2	0	PUM2	20318126	1.000000	0.71417	0.999000	0.59377	0.310000	0.27922	9.339000	0.96797	2.140000	0.66376	0.460000	0.39030	CTG			0.363	PUM2-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				NM_015317	
BIRC6	57448	bcgsc.ca	37	2	32626436	32626436	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr2:32626436G>C	ENST00000421745.2	+	7	1374	c.1240G>C	c.(1240-1242)Gtt>Ctt	p.V414L		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	414					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					CATATGGGATGTTTCCAAACT	0.378																																					p.V414L	Pancreas(94;175 1509 16028 18060 45422)												.	BIRC6	838		0			c.G1240C												156.0	162.0	160.0					2																	32626436		2203	4300	6503	SO:0001583	missense	57448	exon7			TGGGATGTTTCCA	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.1240G>C	2.37:g.32626436G>C	ENSP00000393596:p.Val414Leu		Somatic	131	0	0		WXS	Illumina HiSeq	Phase_1	184	0.00	0	NM_016252	13	0.00	0	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	G	17.75	3.466278	0.63625	.	.	ENSG00000115760	ENST00000421745	T	0.75821	-0.97	5.63	5.63	0.86233	WD40/YVTN repeat-like-containing domain (1);	0.079718	0.51477	D	0.000089	T	0.69797	0.3151	L	0.43152	1.355	0.54753	D	0.999988	B	0.32302	0.363	B	0.28232	0.087	T	0.70583	-0.4832	10	0.66056	D	0.02	.	19.6727	0.95916	0.0:0.0:1.0:0.0	.	414	Q9NR09	BIRC6_HUMAN	L	414	ENSP00000393596:V414L	ENSP00000393596:V414L	V	+	1	0	BIRC6	32479940	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.912000	0.87465	2.661000	0.90470	0.491000	0.48974	GTT			0.378	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318769.3		NM_016252	
AC016995.3	0	broad.mit.edu	37	2	38710046	38710047	+	lincRNA	DNP	TA	TA	AT	rs61417537|rs574017590|rs57355803		TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	TA	TA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr2:38710046_38710047TA>AT	ENST00000417039.1	-	0	696																											aaataaataataaataaataaa	0.272																																					.													.	.			0			.																																											0	.			AAATAATAAATAA																												Exception_encountered	2.37:g.38710046_38710047delinsAT			Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	59	0.31	18	.	0		0		RNA	DNP	ENST00000417039.1	37																																																																																						0.272	AC016995.3-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000331173.1			
HAAO	23498	broad.mit.edu	37	2	43015711	43015711	+	Silent	SNP	G	G	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr2:43015711G>T	ENST00000294973.6	-	2	172	c.117C>A	c.(115-117)ggC>ggA	p.G39G		NM_012205.2	NP_036337.2			3-hydroxyanthranilate 3,4-dioxygenase									p.G39G(1)		breast(2)|cervix(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|urinary_tract(2)	11						TGGTGTTGGGGCCTCCGATGA	0.572																																					p.G39G													HAAO,NS,carcinoma,0,1	HAAO	26	1	1	Substitution - coding silent(1)	prostate(1)	c.C117A												231.0	173.0	192.0					2																	43015711		2203	4300	6503	SO:0001819	synonymous_variant	23498	exon2			GTTGGGGCCTCCG	Z29481	CCDS33187.1	2p	2008-02-05			ENSG00000162882	ENSG00000162882	1.13.11.6		4796	protein-coding gene	gene with protein product		604521				7514594	Standard	NM_012205		Approved		uc002rst.4	P46952	OTTHUMG00000152348	ENST00000294973.6:c.117C>A	2.37:g.43015711G>T			Somatic	143	0.027972028	4		WXS	Illumina HiSeq	Phase_I	180	0.03	6	NM_012205	27	0.00	0		Silent	SNP	ENST00000294973.6	37	CCDS33187.1																																																																																					0.572	HAAO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000325948.2			
MSH6	2956	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	48026849	48026849	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr2:48026849A>C	ENST00000234420.5	+	4	1879	c.1727A>C	c.(1726-1728)gAt>gCt	p.D576A	FBXO11_ENST00000405808.1_Intron|MSH6_ENST00000540021.1_Missense_Mutation_p.D446A|MSH6_ENST00000538136.1_Missense_Mutation_p.D274A	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	576					ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TTTTCAGATGATCGCCATTGT	0.378			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.D576A			yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	mutS homolog 6 (E. coli)		E	.	.			2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)	c.A1727C												158.0	156.0	157.0					2																	48026849		2195	4299	6494	SO:0001583	missense	2956	exon4	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	CAGATGATCGCCA	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.1727A>C	2.37:g.48026849A>C	ENSP00000234420:p.Asp576Ala		Somatic	153	0	0		WXS	Illumina HiSeq	.	219	0.36	78	NM_000179	261	0.33	85	B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Missense_Mutation	SNP	ENST00000234420.5	37	CCDS1836.1	.	.	.	.	.	.	.	.	.	.	A	18.51	3.639486	0.67244	.	.	ENSG00000116062	ENST00000234420;ENST00000544857;ENST00000540021;ENST00000538136	D;D;D	0.89617	-2.26;-2.39;-2.54	5.04	5.04	0.67666	DNA mismatch repair protein MutS, connector (1);	0.095938	0.64402	D	0.000001	D	0.95294	0.8473	M	0.90542	3.125	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.997;0.999	D	0.96232	0.9169	10	0.87932	D	0	-16.0126	15.0848	0.72142	1.0:0.0:0.0:0.0	.	446;576;576	B4DF41;P52701;P52701-2	.;MSH6_HUMAN;.	A	576;574;446;274	ENSP00000234420:D576A;ENSP00000446475:D446A;ENSP00000438580:D274A	ENSP00000234420:D576A	D	+	2	0	MSH6	47880353	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.217000	0.95160	2.035000	0.60131	0.528000	0.53228	GAT			0.378	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251180.4		NM_000179	
FOXN2	3344	broad.mit.edu	37	2	48602092	48602092	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr2:48602092delA	ENST00000340553.3	+	7	1067	c.806delA	c.(805-807)caafs	p.Q269fs		NM_002158.3	NP_002149.2	P32314	FOXN2_HUMAN	forkhead box N2	269					transcription, DNA-templated (GO:0006351)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	13		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.0272)|LUSC - Lung squamous cell carcinoma(58;0.036)			ACAGCATTGCAAAAAAAGAGG	0.383																																					p.Q269fs													.	FOXN2	39		0			c.806delA												60.0	56.0	57.0					2																	48602092		2203	4300	6503	SO:0001589	frameshift_variant	3344	exon7			CATTGCAAAAAAA		CCDS1838.1	2p22-p16	2008-02-05	2006-10-02	2006-10-02	ENSG00000170802	ENSG00000170802		"""Forkhead boxes"""	5281	protein-coding gene	gene with protein product		143089	"""human T-cell leukemia virus enhancer factor"""	HTLF		1639393	Standard	NM_002158		Approved		uc002rwh.1	P32314	OTTHUMG00000129168	ENST00000340553.3:c.806delA	2.37:g.48602092delA	ENSP00000343633:p.Gln269fs		Somatic	471	0	0		WXS	Illumina HiSeq	Phase_I	533	0.02	8	NM_002158	7	0.00	0	Q15769|Q6P4Q2	Frame_Shift_Del	DEL	ENST00000340553.3	37	CCDS1838.1																																																																																					0.383	FOXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251240.3		NM_002158	
STON1	11037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	48809124	48809124	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr2:48809124A>G	ENST00000406226.1	+	3	1547	c.1352A>G	c.(1351-1353)aAc>aGc	p.N451S	STON1-GTF2A1L_ENST00000394751.3_Missense_Mutation_p.N451S|STON1-GTF2A1L_ENST00000405008.1_Missense_Mutation_p.N451S|STON1_ENST00000309835.3_Missense_Mutation_p.N451S|STON1_ENST00000404752.1_Missense_Mutation_p.N451S|STON1-GTF2A1L_ENST00000394754.1_Missense_Mutation_p.N451S|STON1-GTF2A1L_ENST00000309827.2_Missense_Mutation_p.N451S|STON1-GTF2A1L_ENST00000402114.2_Missense_Mutation_p.N451S	NM_001198595.1	NP_001185524.1	Q9Y6Q2	STON1_HUMAN	stonin 1	451	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)	clathrin adaptor complex (GO:0030131)				NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(19)|prostate(3)|skin(2)	37		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GTGAATGGGAACCTGGAATGC	0.378																																					p.N451S													.	.			0			c.A1352G												129.0	134.0	132.0					2																	48809124		2203	4300	6503	SO:0001583	missense	11037	exon3			ATGGGAACCTGGA	AF026169	CCDS1841.1	2p16.3	2008-02-05			ENSG00000243244	ENSG00000243244			17003	protein-coding gene	gene with protein product	"""stoned B homolog 1 (Drosophila)"""	605357				14504226, 10364255	Standard	NM_001198595		Approved	SBLF, stoned-b1		Q9Y6Q2	OTTHUMG00000129169	ENST00000406226.1:c.1352A>G	2.37:g.48809124A>G	ENSP00000384615:p.Asn451Ser		Somatic	148	0	0		WXS	Illumina HiSeq	.	187	0.24	44	NM_001198595	13	0.15	2	A8MXJ1|B5MCF5|B7ZL16|Q96JE3|Q9BYX3	Missense_Mutation	SNP	ENST00000406226.1	37	CCDS1841.1	.	.	.	.	.	.	.	.	.	.	A	6.690	0.496016	0.12762	.	.	ENSG00000243244;ENSG00000243244;ENSG00000243244;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781	ENST00000404752;ENST00000406226;ENST00000309835;ENST00000405008;ENST00000402114;ENST00000394754;ENST00000309827;ENST00000394751	T;T;T;T;T;T;T;T	0.18960	2.18;2.18;2.18;2.18;2.18;2.18;2.18;2.18	5.54	0.473	0.16763	Clathrin adaptor, mu subunit, C-terminal (3);	0.714838	0.15423	N	0.263123	T	0.09423	0.0232	N	0.19112	0.55	0.09310	N	1	P;B;P	0.35124	0.473;0.01;0.485	B;B;B	0.37047	0.191;0.022;0.24	T	0.21965	-1.0230	10	0.10377	T	0.69	.	1.572	0.02617	0.42:0.1457:0.3016:0.1327	.	451;451;451	A8MXJ1;Q53S48;Q9Y6Q2	.;.;STON1_HUMAN	S	451	ENSP00000385273:N451S;ENSP00000384615:N451S;ENSP00000310969:N451S;ENSP00000385499:N451S;ENSP00000385701:N451S;ENSP00000378236:N451S;ENSP00000311493:N451S;ENSP00000378234:N451S	ENSP00000310969:N451S	N	+	2	0	STON1-GTF2A1L;STON1	48662628	0.000000	0.05858	0.050000	0.19076	0.984000	0.73092	-0.111000	0.10807	-0.053000	0.13289	0.533000	0.62120	AAC			0.378	STON1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000323848.2		NM_006873	
PSME4	23198	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	54155274	54155274	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr2:54155274T>C	ENST00000404125.1	-	11	1538	c.1483A>G	c.(1483-1485)Aat>Gat	p.N495D	PSME4_ENST00000421748.2_Intron	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	495					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			CTAAAGTCATTTGGATCCACC	0.443																																					p.N495D													.	.			0			c.A1483G												118.0	101.0	107.0					2																	54155274		2203	4300	6503	SO:0001583	missense	23198	exon11			AGTCATTTGGATC	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.1483A>G	2.37:g.54155274T>C	ENSP00000384211:p.Asn495Asp		Somatic	169	0	0		WXS	Illumina HiSeq	.	168	0.26	44	NM_014614	20	0.35	7	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	ENST00000404125.1	37	CCDS33197.2	.	.	.	.	.	.	.	.	.	.	T	32	5.120552	0.94385	.	.	ENSG00000068878	ENST00000404125	T	0.04758	3.56	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.26231	0.0640	M	0.87097	2.86	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	T	0.03296	-1.1051	10	0.87932	D	0	.	15.9884	0.80179	0.0:0.0:0.0:1.0	.	495	Q14997	PSME4_HUMAN	D	495	ENSP00000384211:N495D	ENSP00000374643:N495D	N	-	1	0	PSME4	54008778	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.037000	0.88933	2.172000	0.68678	0.473000	0.43528	AAT			0.443	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000324163.1		XM_040158	
ZEB2	9839	mdanderson.org	37	2	145147444	145147444	+	Missense_Mutation	SNP	G	G	T	rs139944383	byFrequency	TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr2:145147444G>T	ENST00000558170.2	-	10	4403	c.3219C>A	c.(3217-3219)caC>caA	p.H1073Q	ZEB2_ENST00000539609.3_Missense_Mutation_p.H1049Q|ZEB2_ENST00000303660.4_Missense_Mutation_p.H1073Q|ZEB2_ENST00000409487.3_Missense_Mutation_p.H1073Q	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	1073					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		TGTGATTCATGTGCTGCGAGT	0.602																																					p.H1073Q	Melanoma(33;1235 1264 5755 16332)												.	.			0			c.C3219A												57.0	55.0	56.0					2																	145147444		2203	4300	6503	SO:0001583	missense	9839	exon10			ATTCATGTGCTGC	AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.3219C>A	2.37:g.145147444G>T	ENSP00000454157:p.His1073Gln		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_014795	54	0.00	0	A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	ENST00000558170.2	37	CCDS2186.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.418135	0.83449	.	.	ENSG00000169554	ENST00000539609;ENST00000303660;ENST00000409487	D;D;D	0.96168	-3.93;-3.93;-3.93	5.51	4.62	0.57501	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.97204	0.9086	M	0.69823	2.125	0.80722	D	1	D;D;D	0.89917	1.0;0.995;0.995	D;D;D	0.91635	0.999;0.979;0.979	D	0.97360	0.9969	10	0.87932	D	0	-12.6368	15.2518	0.73552	0.0707:0.0:0.9293:0.0	.	1049;1072;1073	F5H814;A0JP08;O60315	.;.;ZEB2_HUMAN	Q	1049;1073;1073	ENSP00000443792:H1049Q;ENSP00000302501:H1073Q;ENSP00000386854:H1073Q	ENSP00000302501:H1073Q	H	-	3	2	ZEB2	144863914	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.553000	0.73918	2.746000	0.94184	0.591000	0.81541	CAC			0.602	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254778.5		NM_014795	
NEB	4703	mdanderson.org	37	2	152359335	152359335	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr2:152359335A>G	ENST00000172853.10	-	139	18944	c.18797T>C	c.(18796-18798)gTc>gCc	p.V6266A	NEB_ENST00000498015.2_Intron|NEB_ENST00000509223.2_Intron|NEB_ENST00000427231.2_Missense_Mutation_p.V7967A|NEB_ENST00000397336.2_Missense_Mutation_p.V4A|NEB_ENST00000397345.3_Missense_Mutation_p.V7967A|NEB_ENST00000604864.1_Missense_Mutation_p.V7967A|NEB_ENST00000603639.1_Missense_Mutation_p.V7967A|NEB_ENST00000409198.1_Missense_Mutation_p.V6266A			P20929	NEBU_HUMAN	nebulin	6266					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		ATTGCGTTTGACTCTCTCCAT	0.348																																					p.V8002A													.	.			0			c.T24005C												73.0	64.0	67.0					2																	152359335		1806	4069	5875	SO:0001583	missense	4703	exon168			CGTTTGACTCTCT	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.18797T>C	2.37:g.152359335A>G	ENSP00000172853:p.Val6266Ala		Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	66	0.05	3	NM_001271208	0		0	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.97|11.97	1.796966|1.796966	0.31777|0.31777	.|.	.|.	ENSG00000183091|ENSG00000183091	ENST00000397337|ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853;ENST00000397336;ENST00000424585	.|T;T;T;T;T;T	.|0.22743	.|1.94;1.94;1.94;1.94;3.77;1.94	5.57|5.57	5.57|5.57	0.84162|0.84162	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.41373|0.41373	0.1156|0.1156	M|M	0.63428|0.63428	1.95|1.95	0.45415|0.45415	D|D	0.998396|0.998396	.|D;D	.|0.67145	.|0.996;0.995	.|D;D	.|0.85130	.|0.997;0.995	T|T	0.20505|0.20505	-1.0273|-1.0273	5|10	.|0.12103	.|T	.|0.63	.|.	15.7246|15.7246	0.77743|0.77743	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|6266;7967	.|P20929;F8WCL5	.|NEBU_HUMAN;.	P|A	163|6266;7967;7967;6266;4;194	.|ENSP00000386259:V6266A;ENSP00000380505:V7967A;ENSP00000416578:V7967A;ENSP00000172853:V6266A;ENSP00000380497:V4A;ENSP00000404876:V194A	.|ENSP00000172853:V6266A	S|V	-|-	1|2	0|0	NEB|NEB	152067581|152067581	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	6.800000|6.800000	0.75165|0.75165	2.113000|2.113000	0.64589|0.64589	0.528000|0.528000	0.53228|0.53228	TCA|GTC			0.348	NEB-201	KNOWN	basic	protein_coding	protein_coding				NM_004543	
LRRFIP1	9208	broad.mit.edu	37	2	238664755	238664756	+	Frame_Shift_Ins	INS	-	-	C			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr2:238664755_238664756insC	ENST00000392000.4	+	9	789_790	c.672_673insC	c.(673-675)cacfs	p.H225fs	LRRFIP1_ENST00000308482.9_Frame_Shift_Ins_p.H353fs|LRRFIP1_ENST00000244815.5_Frame_Shift_Ins_p.H201fs|LRRFIP1_ENST00000289175.6_Frame_Shift_Ins_p.H169fs	NM_001137552.1	NP_001131024.1	Q32MZ4	LRRF1_HUMAN	leucine rich repeat (in FLII) interacting protein 1	225					innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|protein homodimerization activity (GO:0042803)			NS(1)|breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	29		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;9.75e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.01e-10)|Kidney(56;4.85e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.31e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000151)|Lung(119;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0325)|COAD - Colon adenocarcinoma(134;0.228)		AAAGGGAAAAACACGCCCACAG	0.441																																					p.K352fs													.	LRRFIP1	171		0			c.1056_1057insC																																									SO:0001589	frameshift_variant	9208	exon16			GGAAAAACACGCC	AJ223075	CCDS2521.1, CCDS46551.1, CCDS46552.1, CCDS46553.1	2q37.3	2010-09-30			ENSG00000124831	ENSG00000124831			6702	protein-coding gene	gene with protein product	"""GC-binding factor 2"""	603256				9705290, 9525888, 16199883	Standard	NM_004735		Approved	FLAP-1, FLIIAP1, TRIP, GCF-2, HUFI-1	uc002vxe.3	Q32MZ4	OTTHUMG00000133339	ENST00000392000.4:c.673dupC	2.37:g.238664756_238664756dupC	ENSP00000375857:p.His225fs		Somatic	397	0	0		WXS	Illumina HiSeq	Phase_I	480	0.02	8	NM_001137550	95	0.00	0	E9PGZ2|O75766|O75799|Q32MZ5|Q53T49|Q6PKG2|Q9Y607	Frame_Shift_Ins	INS	ENST00000392000.4	37	CCDS46552.1																																																																																					0.441	LRRFIP1-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000317198.1		NM_004735	
ASXL1	171023	broad.mit.edu;mdanderson.org	37	20	31017716	31017716	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr20:31017716G>A	ENST00000375687.4	+	8	1002	c.578G>A	c.(577-579)tGc>tAc	p.C193Y	ASXL1_ENST00000470145.1_3'UTR|ASXL1_ENST00000306058.5_Missense_Mutation_p.C188Y	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	193	Interaction with KDM1A. {ECO:0000250}.				bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						TTCTCGGGCTGCCACGCCGAT	0.642			"""F, N, Mis"""		"""MDS, CMML"""																																p.C193Y				Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	.	ASXL1	1114		0			c.G578A												24.0	30.0	28.0					20																	31017716		2079	4106	6185	SO:0001583	missense	171023	exon7			CGGGCTGCCACGC	AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.578G>A	20.37:g.31017716G>A	ENSP00000364839:p.Cys193Tyr		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_015338	20	0.00	0	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Missense_Mutation	SNP	ENST00000375687.4	37	CCDS13201.1	.	.	.	.	.	.	.	.	.	.	G	13.22	2.172676	0.38413	.	.	ENSG00000171456	ENST00000358956;ENST00000375687;ENST00000421155;ENST00000306058	T;T	0.13778	2.56;2.56	4.89	3.92	0.45320	.	0.312987	0.25645	N	0.029254	T	0.06690	0.0171	N	0.08118	0	0.27210	N	0.959938	B	0.09022	0.002	B	0.01281	0.0	T	0.19877	-1.0292	10	0.45353	T	0.12	-5.4605	7.4887	0.27449	0.085:0.0:0.7473:0.1677	.	193	Q8IXJ9	ASXL1_HUMAN	Y	193;193;193;188	ENSP00000364839:C193Y;ENSP00000305119:C188Y	ENSP00000305119:C188Y	C	+	2	0	ASXL1	30481377	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.104000	0.57790	1.397000	0.46682	0.655000	0.94253	TGC			0.642	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000078624.2		NM_015338	
BAGE2	85319	broad.mit.edu	37	21	11096512	11096516	+	RNA	DEL	GTTTT	GTTTT	-	rs139100150|rs150200394|rs573901432|rs150216981	byFrequency	TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	GTTTT	GTTTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr21:11096512_11096516delGTTTT	ENST00000470054.1	-	0	324							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ccATTTTTAAgttttgttttgtttt	0.493																																					.													.	.			0			.																																											85319	.			TTTTAAGTTTTGT	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11096522_11096526delGTTTT			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	7	0.71	5	.	0		0	A8K925|Q08ER0	RNA	DEL	ENST00000470054.1	37																																																																																						0.493	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000157417.3		NM_182482	
UMODL1	89766	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	21	43531009	43531009	+	Missense_Mutation	SNP	G	G	A	rs200274014		TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr21:43531009G>A	ENST00000408910.2	+	11	1677	c.1677G>A	c.(1675-1677)atG>atA	p.M559I	C21orf128_ENST00000329015.2_5'Flank|UMODL1_ENST00000400427.1_Missense_Mutation_p.M487I|UMODL1_ENST00000400424.2_Missense_Mutation_p.M487I|UMODL1_ENST00000408989.2_Missense_Mutation_p.M559I	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	559			M -> T (in dbSNP:rs220126). {ECO:0000269|PubMed:15194491, ECO:0000269|PubMed:16026467}.		adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						TGAGCCCCATGGGCGGTGGAC	0.632																																					p.M559I	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)												.	.			0			c.G1677A																																									SO:0001583	missense	89766	exon11			CCCCATGGGCGGT		CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.1677G>A	21.37:g.43531009G>A	ENSP00000386147:p.Met559Ile		Somatic	182	0	0		WXS	Illumina HiSeq	.	307	0.24	74	NM_173568	0		0	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	ENST00000408910.2	37	CCDS42936.1	.	.	.	.	.	.	.	.	.	.	G	6.659	0.490150	0.12702	.	.	ENSG00000177398	ENST00000400427;ENST00000400424;ENST00000408989;ENST00000408910	T;T;T;T	0.70516	-0.48;-0.49;-0.48;-0.49	3.7	-7.41	0.01392	.	0.642001	0.12970	N	0.424186	T	0.43389	0.1245	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.15052	0.012;0.0	T	0.26643	-1.0097	10	0.66056	D	0.02	-0.9973	8.8428	0.35153	0.4946:0.3748:0.1306:0.0	.	559;559	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	I	487;487;559;559	ENSP00000383279:M487I;ENSP00000383276:M487I;ENSP00000386126:M559I;ENSP00000386147:M559I	ENSP00000383276:M487I	M	+	3	0	UMODL1	42404078	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.158000	0.01281	-3.017000	0.00271	-1.741000	0.00685	ATG			0.632	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000195292.2			
SLC37A1	54020	bcgsc.ca	37	21	43999906	43999906	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr21:43999906G>A	ENST00000352133.2	+	19	2564	c.1582G>A	c.(1582-1584)Gtt>Att	p.V528I	SLC37A1_ENST00000398341.3_Missense_Mutation_p.V528I			P57057	GLPT_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 1	528					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	transporter activity (GO:0005215)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(3)	15						GGGGGACCAAGTTCCGTAAGT	0.567																																					p.V528I													.	SLC37A1	48		0			c.G1582A												66.0	53.0	58.0					21																	43999906		2203	4300	6503	SO:0001583	missense	54020	exon20			GACCAAGTTCCGT	AJ269529	CCDS13689.1	21q22.3	2013-07-17	2013-07-17		ENSG00000160190	ENSG00000160190		"""Solute carriers"""	11024	protein-coding gene	gene with protein product		608094	"""solute carrier family 37 (glycerol-3-phosphate transporter), member 1"""			11112347	Standard	NM_018964		Approved		uc002zbi.3	P57057	OTTHUMG00000086803	ENST00000352133.2:c.1582G>A	21.37:g.43999906G>A	ENSP00000344648:p.Val528Ile		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_1	105	0.00	0	NM_018964	58	0.00	0	D3DSJ7|Q9HAQ1	Missense_Mutation	SNP	ENST00000352133.2	37	CCDS13689.1	.	.	.	.	.	.	.	.	.	.	G	10.73	1.432987	0.25813	.	.	ENSG00000160190	ENST00000398341;ENST00000352133	T;T	0.22743	1.94;1.94	4.86	2.89	0.33648	.	0.317898	0.27831	N	0.017672	T	0.16300	0.0392	L	0.40543	1.245	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.18524	-1.0334	10	0.21014	T	0.42	-5.5118	11.8725	0.52529	0.0:0.3353:0.6647:0.0	.	528	P57057	GLPT_HUMAN	I	528	ENSP00000381383:V528I;ENSP00000344648:V528I	ENSP00000344648:V528I	V	+	1	0	SLC37A1	42872975	0.910000	0.30920	0.485000	0.27403	0.677000	0.39632	1.350000	0.34010	1.154000	0.42482	0.462000	0.41574	GTT			0.567	SLC37A1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000195377.1			
LRP5L	91355	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	22	25755835	25755835	+	Silent	SNP	G	G	A			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr22:25755835G>A	ENST00000402785.2	-	1	321	c.225C>T	c.(223-225)gaC>gaT	p.D75D	LRP5L_ENST00000444995.3_Silent_p.D75D|LRP5L_ENST00000402859.2_Silent_p.D75D			A4QPB2	LRP5L_HUMAN	low density lipoprotein receptor-related protein 5-like	75					canonical Wnt signaling pathway (GO:0060070)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)		Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(2)	6						GCTCGTCCATGTCCTCTGACA	0.622																																					p.D75D													.	.			0			c.C225T												170.0	143.0	152.0					22																	25755835		2200	4300	6500	SO:0001819	synonymous_variant	91355	exon3			GTCCATGTCCTCT	AL137651	CCDS33626.1	22q11.23	2013-05-30			ENSG00000100068	ENSG00000100068			25323	protein-coding gene	gene with protein product							Standard	NM_182492		Approved	DKFZp434O0213	uc011ajz.2	A4QPB2	OTTHUMG00000150900	ENST00000402785.2:c.225C>T	22.37:g.25755835G>A			Somatic	163	0	0		WXS	Illumina HiSeq	.	122	0.58	71	NM_001135772	11	0.91	10	B0QYF3|B0QYF4|B2RPI5	Silent	SNP	ENST00000402785.2	37	CCDS33626.1																																																																																					0.622	LRP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320477.2		NM_182492	
SYN3	8224	mdanderson.org	37	22	33265025	33265025	+	Silent	SNP	G	G	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr22:33265025G>T	ENST00000358763.2	-	5	791	c.549C>A	c.(547-549)ggC>ggA	p.G183G	SYN3_ENST00000332840.5_Silent_p.G183G	NM_001135774.1	NP_001129246.1	O14994	SYN3_HUMAN	synapsin III	183	C; actin-binding and synaptic-vesicle binding.				neurotransmitter secretion (GO:0007269)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						CATACTGCAGGCCGATGACCA	0.592																																					p.G183G													.	.			0			c.C549A												74.0	58.0	64.0					22																	33265025		2203	4300	6503	SO:0001819	synonymous_variant	8224	exon4			CTGCAGGCCGATG	AF046873	CCDS13908.1	22q12.3	2008-05-14			ENSG00000185666	ENSG00000185666			11496	protein-coding gene	gene with protein product		602705				9539796	Standard	NM_003490		Approved		uc003amx.3	O14994	OTTHUMG00000031004	ENST00000358763.2:c.549C>A	22.37:g.33265025G>T			Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_003490	2	0.00	0	B1B1F9	Silent	SNP	ENST00000358763.2	37	CCDS13908.1																																																																																					0.592	SYN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000075892.4			
KCTD17	79734	mdanderson.org	37	22	37456899	37456899	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr22:37456899G>C	ENST00000403888.3	+	6	671	c.670G>C	c.(670-672)Gag>Cag	p.E224Q	KCTD17_ENST00000402077.3_Missense_Mutation_p.E224Q	NM_001282684.1	NP_001269613.1	Q8N5Z5	KCD17_HUMAN	potassium channel tetramerization domain containing 17	224					protein homooligomerization (GO:0051260)		identical protein binding (GO:0042802)			NS(1)|breast(1)|endometrium(1)|lung(1)|prostate(1)	5						gcagcagcaggaggaggaggt	0.612																																					p.E224Q													.	.			0			c.G670C												160.0	136.0	145.0					22																	37456899		1327	2309	3636	SO:0001583	missense	79734	exon6			CAGCAGGAGGAGG	BC025403	CCDS13940.2, CCDS74854.1, CCDS74855.1	22q12.3	2013-06-20	2013-06-20		ENSG00000100379	ENSG00000100379			25705	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 17"""			12477932	Standard	XM_005261741		Approved	FLJ12242	uc011amv.2	Q8N5Z5	OTTHUMG00000150532	ENST00000403888.3:c.670G>C	22.37:g.37456899G>C	ENSP00000385096:p.Glu224Gln		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	54	0.06	3	NM_024681	1	1.00	1	B0QYA9|B0QYB0|O95517	Missense_Mutation	SNP	ENST00000403888.3	37		.	.	.	.	.	.	.	.	.	.	G	11.84	1.759761	0.31137	.	.	ENSG00000100379	ENST00000402077;ENST00000403888	T;T	0.48522	0.91;0.81	2.94	2.94	0.34122	.	2.803690	0.01969	U	0.043922	T	0.34890	0.0913	N	0.12182	0.205	0.22401	N	0.999139	B;B	0.12630	0.006;0.003	B;B	0.06405	0.001;0.002	T	0.25745	-1.0123	10	0.52906	T	0.07	.	9.6457	0.39865	0.0:0.0:1.0:0.0	.	224;224	Q8N5Z5-2;Q8N5Z5	.;KCD17_HUMAN	Q	224	ENSP00000384391:E224Q;ENSP00000385096:E224Q	ENSP00000384391:E224Q	E	+	1	0	KCTD17	35786845	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.921000	0.28718	1.344000	0.45657	0.455000	0.32223	GAG			0.612	KCTD17-002	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000318781.1		NM_024681	
TTC38	55020	mdanderson.org	37	22	46664423	46664423	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr22:46664423G>T	ENST00000381031.3	+	2	122	c.46G>T	c.(46-48)Gcg>Tcg	p.A16S	TTC38_ENST00000445282.2_Missense_Mutation_p.A16S	NM_017931.2	NP_060401	Q5R3I4	TTC38_HUMAN	tetratricopeptide repeat domain 38	16						extracellular vesicular exosome (GO:0070062)				endometrium(4)|large_intestine(3)|lung(4)|ovary(1)	12						CTGGAAGGATGCGAGGCTCCC	0.607																																					p.A16S													.	.			0			c.G46T												40.0	50.0	47.0					22																	46664423		2187	4286	6473	SO:0001583	missense	55020	exon2			AAGGATGCGAGGC		CCDS43030.1	22q13	2013-01-11			ENSG00000075234	ENSG00000075234		"""Tetratricopeptide (TTC) repeat domain containing"""	26082	protein-coding gene	gene with protein product							Standard	NM_017931		Approved	FLJ20699	uc003bhi.3	Q5R3I4	OTTHUMG00000150494	ENST00000381031.3:c.46G>T	22.37:g.46664423G>T	ENSP00000370419:p.Ala16Ser		Somatic	82	0.012195122	1		WXS	Illumina HiSeq	Phase_I	66	0.06	4	NM_017931	30	0.00	0	Q8WV27|Q9NWP8	Missense_Mutation	SNP	ENST00000381031.3	37	CCDS43030.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.004997	0.74932	.	.	ENSG00000075234	ENST00000381031;ENST00000445282;ENST00000421359	D;D;D	0.82893	-1.66;-1.66;-1.66	5.13	5.13	0.70059	.	0.163700	0.53938	D	0.000060	D	0.83445	0.5256	M	0.72894	2.215	0.51012	D	0.999904	B;B	0.32918	0.39;0.11	B;B	0.38755	0.281;0.108	T	0.79862	-0.1624	10	0.12766	T	0.61	-4.1522	17.9252	0.88982	0.0:0.0:1.0:0.0	.	16;16	E7ES35;Q5R3I4	.;TTC38_HUMAN	S	16	ENSP00000370419:A16S;ENSP00000393960:A16S;ENSP00000410095:A16S	ENSP00000370419:A16S	A	+	1	0	TTC38	45043087	1.000000	0.71417	0.990000	0.47175	0.900000	0.52787	5.691000	0.68249	2.532000	0.85374	0.561000	0.74099	GCG			0.607	TTC38-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000318469.1		NM_017931	
ITPR1	3708	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	4747945	4747945	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr3:4747945G>T	ENST00000443694.2	+	34	4707	c.4707G>T	c.(4705-4707)atG>atT	p.M1569I	ITPR1_ENST00000423119.2_Missense_Mutation_p.M1575I|ITPR1_ENST00000456211.2_Missense_Mutation_p.M1560I|ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000357086.4_Missense_Mutation_p.M1575I|ITPR1_ENST00000302640.8_Missense_Mutation_p.M1569I|ITPR1_ENST00000354582.6_Missense_Mutation_p.M1584I			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	1584				AIAIPVDLDSQVNNLFLKSHSIVQK -> HCHSRGPGQPSQ QPLSQVPQHCAE (in Ref. 6; AAD14386). {ECO:0000305}.	activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	AAACAGCCATGAACTGGCGGC	0.557																																					p.M1575I													.	.			0			c.G4725T												51.0	55.0	54.0					3																	4747945		1999	4169	6168	SO:0001583	missense	3708	exon37			AGCCATGAACTGG	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.4707G>T	3.37:g.4747945G>T	ENSP00000401671:p.Met1569Ile		Somatic	73	0	0		WXS	Illumina HiSeq	.	108	0.24	26	NM_001099952	14	0.21	3	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	37	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	G	8.333	0.827011	0.16749	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000426160;ENST00000357086;ENST00000456211;ENST00000443694	T;T;T;T;T;T	0.62788	0.0;0.0;0.0;0.0;0.0;0.0	5.26	4.36	0.52297	.	0.208186	0.50627	D	0.000104	T	0.51176	0.1659	L	0.34521	1.04	0.80722	D	1	B;B	0.22909	0.01;0.077	B;B	0.21917	0.013;0.037	T	0.43032	-0.9416	10	0.21014	T	0.42	.	15.8935	0.79318	0.0:0.1359:0.8641:0.0	.	1584;1575	Q14643;G5E9P1	ITPR1_HUMAN;.	I	1584;1569;1584;1575;30;1575;1560;1569	ENSP00000306253:M1569I;ENSP00000346595:M1584I;ENSP00000405934:M1575I;ENSP00000349597:M1575I;ENSP00000397885:M1560I;ENSP00000401671:M1569I	ENSP00000306253:M1569I	M	+	3	0	ITPR1	4722945	1.000000	0.71417	1.000000	0.80357	0.309000	0.27889	2.790000	0.47821	1.291000	0.44653	0.655000	0.94253	ATG			0.557	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000337982.3		NM_002222	
CMTM8	152189	broad.mit.edu	37	3	32280541	32280541	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr3:32280541G>C	ENST00000307526.3	+	1	371	c.77G>C	c.(76-78)aGc>aCc	p.S26T	RP11-384L8.1_ENST00000565519.1_RNA|CMTM8_ENST00000458535.2_Missense_Mutation_p.S26T	NM_178868.3	NP_849199.2	Q8IZV2	CKLF8_HUMAN	CKLF-like MARVEL transmembrane domain containing 8	26					chemotaxis (GO:0006935)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(1)|lung(1)	4						TTCTCCACCAGCAGCAGCAGC	0.706																																					p.S26T													.	CMTM8	9		0			c.G77C												29.0	28.0	28.0					3																	32280541		2195	4297	6492	SO:0001583	missense	152189	exon1			CCACCAGCAGCAG	AF474370	CCDS2652.1	3p22.2	2005-11-08	2005-11-08	2005-11-08	ENSG00000170293	ENSG00000170293			19179	protein-coding gene	gene with protein product		607891	"""chemokine-like factor super family 8"", ""chemokine-like factor superfamily 8"""	CKLFSF8			Standard	NM_178868		Approved		uc003cex.3	Q8IZV2	OTTHUMG00000130753	ENST00000307526.3:c.77G>C	3.37:g.32280541G>C	ENSP00000307741:p.Ser26Thr		Somatic	283	0.0070671378	2		WXS	Illumina HiSeq	Phase_I	301	0.02	6	NM_178868	19	0.00	0	A5D6I7|Q8IW01	Missense_Mutation	SNP	ENST00000307526.3	37	CCDS2652.1	.	.	.	.	.	.	.	.	.	.	G	10.89	1.479469	0.26511	.	.	ENSG00000170293	ENST00000458535;ENST00000307526	T	0.31769	1.48	4.68	-1.37	0.09056	.	0.707951	0.12993	N	0.422322	T	0.16257	0.0391	N	0.08118	0	0.23681	N	0.997128	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.17531	-1.0366	10	0.14252	T	0.57	-14.9292	18.726	0.91714	0.0:0.6653:0.3347:0.0	.	26;26	A5D6I7;Q8IZV2	.;CKLF8_HUMAN	T	26	ENSP00000307741:S26T	ENSP00000307741:S26T	S	+	2	0	CMTM8	32255545	1.000000	0.71417	0.937000	0.37676	0.953000	0.61014	0.649000	0.24843	0.045000	0.15804	0.462000	0.41574	AGC			0.706	CMTM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253253.1		NM_178868	
ANKRD18DP	348840	broad.mit.edu	37	3	197792303	197792304	+	RNA	INS	-	-	A			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr3:197792303_197792304insA	ENST00000435620.2	-	0	995					NR_003291.1				ankyrin repeat domain 18D, pseudogene																		ccagcaacattaaaaaaaaaat	0.515																																					.													.	.			0			.																																											0	.			CAACATTAAAAAA	BC042518		3q29	2011-11-23			ENSG00000226435	ENSG00000226435			28016	pseudogene	pseudogene							Standard	NR_003291		Approved		uc003fyx.3		OTTHUMG00000150228		3.37:g.197792313_197792313dupA			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	INS	ENST00000435620.2	37																																																																																						0.515	ANKRD18DP-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000316910.2		NR_003291	
SEPSECS	51091	mdanderson.org	37	4	25125839	25125839	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr4:25125839G>T	ENST00000382103.2	-	11	1292	c.1220C>A	c.(1219-1221)cCt>cAt	p.P407H	SEPSECS_ENST00000302922.3_Missense_Mutation_p.P328H|SEPSECS_ENST00000515272.1_5'Flank	NM_016955.3	NP_058651.3	Q9HD40	SPCS_HUMAN	Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase	407					selenocysteine incorporation (GO:0001514)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	pyridoxal phosphate binding (GO:0030170)|transferase activity, transferring selenium-containing groups (GO:0016785)|tRNA binding (GO:0000049)			endometrium(1)|large_intestine(4)|lung(2)|stomach(1)	8		Breast(46;0.173)				GGACCCAAGAGGCACAACCCT	0.388																																					p.P407H													.	.			0			c.C1220A												73.0	69.0	70.0					4																	25125839		2203	4300	6503	SO:0001583	missense	51091	exon11			CCAAGAGGCACAA	AJ238617	CCDS3432.1, CCDS3432.2	4p15.2	2008-10-27			ENSG00000109618	ENSG00000109618			30605	protein-coding gene	gene with protein product	"""soluble liver antigen/liver pancreas antigen"""	613009				16230358, 10931155, 17142313, 17194211	Standard	NM_016955		Approved	SLA/LP, SLA	uc003grg.3	Q9HD40	OTTHUMG00000128563	ENST00000382103.2:c.1220C>A	4.37:g.25125839G>T	ENSP00000371535:p.Pro407His		Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_016955	2	0.00	0	A8K8W1|Q0D2P3|Q17RT1|Q9NXZ5|Q9UGM9|Q9Y353	Missense_Mutation	SNP	ENST00000382103.2	37	CCDS3432.2	.	.	.	.	.	.	.	.	.	.	G	21.0	4.085269	0.76642	.	.	ENSG00000109618	ENST00000302922;ENST00000382103	D;D	0.82803	-1.65;-1.65	5.32	4.48	0.54585	Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.88149	0.6359	M	0.79475	2.455	0.58432	D	0.999999	D;P;D	0.65815	0.995;0.835;0.971	P;P;P	0.55112	0.769;0.692;0.618	D	0.88911	0.3359	10	0.56958	D	0.05	-25.261	13.8827	0.63691	0.074:0.0:0.926:0.0	.	406;347;407	Q9HD40-3;A1A4F3;Q9HD40	.;.;SPCS_HUMAN	H	328;407	ENSP00000305956:P328H;ENSP00000371535:P407H	ENSP00000305956:P328H	P	-	2	0	SEPSECS	24734937	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.181000	0.77682	1.233000	0.43693	0.591000	0.81541	CCT			0.388	SEPSECS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250414.2		NM_016955	
KIT	3815	bcgsc.ca	37	4	55599338	55599338	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr4:55599338A>T	ENST00000288135.5	+	17	2561	c.2464A>T	c.(2464-2466)Aat>Tat	p.N822Y		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	822	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		N -> K (in a germ cell tumor of the testis; somatic mutation). {ECO:0000269|PubMed:16175573, ECO:0000269|PubMed:17344846}.		actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.N822Y(5)|p.N822H(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GAATGATTCTAATTATGTGGT	0.378		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.N822Y			yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,NS,malignant_melanoma,0,44	KIT	7396	44	6	Substitution - Missense(6)	genital_tract(2)|testis(1)|haematopoietic_and_lymphoid_tissue(1)|soft_tissue(1)|skin(1)	c.A2464T	GRCh37	CM087050	KIT	M								146.0	149.0	148.0					4																	55599338		2203	4300	6503	SO:0001583	missense	3815	exon17	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	GATTCTAATTATG	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2464A>T	4.37:g.55599338A>T	ENSP00000288135:p.Asn822Tyr		Somatic	90	0	0		WXS	Illumina HiSeq	Phase_1	88	0.00	0	NM_000222	11	0.00	0	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.416486	0.83449	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.82255	-1.59;-1.59	5.47	5.47	0.80525	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000009	D	0.85080	0.5615	N	0.20445	0.575	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.92;1.0	D	0.87693	0.2555	10	0.87932	D	0	.	15.5485	0.76129	1.0:0.0:0.0:0.0	.	818;822	P10721-2;P10721	.;KIT_HUMAN	Y	822;818	ENSP00000288135:N822Y;ENSP00000390987:N818Y	ENSP00000288135:N822Y	N	+	1	0	KIT	55294095	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.138000	0.94501	2.084000	0.62774	0.477000	0.44152	AAT			0.378	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250618.1			
YTHDC1	91746	broad.mit.edu	37	4	69202911	69202911	+	Silent	SNP	T	T	C	rs568654350|rs548927284	byFrequency	TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr4:69202911T>C	ENST00000344157.4	-	4	1052	c.717A>G	c.(715-717)gaA>gaG	p.E239E	YTHDC1_ENST00000355665.3_Silent_p.E239E|YTHDC1_ENST00000579690.1_Silent_p.E239E	NM_001031732.2	NP_001026902.1	Q96MU7	YTDC1_HUMAN	YTH domain containing 1	239	Glu-rich.				mRNA splice site selection (GO:0006376)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	30						cctcctcctcttcctcctcct	0.473																																					p.E239E													.	YTHDC1	81		0			c.A717G												133.0	94.0	107.0					4																	69202911		2203	4300	6503	SO:0001819	synonymous_variant	91746	exon4			CTCCTCTTCCTCC	AK098515	CCDS3522.2, CCDS33992.1	4q13.3	2009-01-14			ENSG00000083896	ENSG00000083896			30626	protein-coding gene	gene with protein product						12368078, 10564280	Standard	XM_005265706		Approved	YT521, KIAA1966, YT521-B	uc003hdx.3	Q96MU7	OTTHUMG00000129306	ENST00000344157.4:c.717A>G	4.37:g.69202911T>C			Somatic	107	0.0560747664	6		WXS	Illumina HiSeq	Phase_I	80	0.05	4	NM_001031732	5	0.00	0	Q4W5Q3|Q7Z622|Q8TF35	Silent	SNP	ENST00000344157.4	37	CCDS33992.1																																																																																					0.473	YTHDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000251437.1		NM_133370	
YTHDC1	91746	broad.mit.edu	37	4	69202914	69202914	+	Silent	SNP	C	C	T	rs568654350	byFrequency	TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr4:69202914C>T	ENST00000344157.4	-	4	1049	c.714G>A	c.(712-714)gaG>gaA	p.E238E	YTHDC1_ENST00000355665.3_Silent_p.E238E|YTHDC1_ENST00000579690.1_Silent_p.E238E	NM_001031732.2	NP_001026902.1	Q96MU7	YTDC1_HUMAN	YTH domain containing 1	238	Glu-rich.				mRNA splice site selection (GO:0006376)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	30						cctcctcttcctcctcctcct	0.478																																					p.E238E													.	YTHDC1	81		0			c.G714A												129.0	92.0	104.0					4																	69202914		2203	4300	6503	SO:0001819	synonymous_variant	91746	exon4			CTCTTCCTCCTCC	AK098515	CCDS3522.2, CCDS33992.1	4q13.3	2009-01-14			ENSG00000083896	ENSG00000083896			30626	protein-coding gene	gene with protein product						12368078, 10564280	Standard	XM_005265706		Approved	YT521, KIAA1966, YT521-B	uc003hdx.3	Q96MU7	OTTHUMG00000129306	ENST00000344157.4:c.714G>A	4.37:g.69202914C>T			Somatic	110	0.0181818182	2		WXS	Illumina HiSeq	Phase_I	85	0.04	3	NM_001031732	4	0.25	1	Q4W5Q3|Q7Z622|Q8TF35	Silent	SNP	ENST00000344157.4	37	CCDS33992.1																																																																																					0.478	YTHDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000251437.1	rescued with RNA-seq	NM_133370	
SLC9A3	6550	mdanderson.org	37	5	476743	476743	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr5:476743T>C	ENST00000264938.3	-	12	1814	c.1805A>G	c.(1804-1806)gAg>gGg	p.E602G	CTD-2228K2.7_ENST00000606319.1_RNA|CTD-2228K2.7_ENST00000606288.1_RNA|CTD-2228K2.7_ENST00000607005.1_RNA|CTD-2228K2.7_ENST00000607286.1_RNA|SLC9A3_ENST00000514375.1_Missense_Mutation_p.E593G	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3	602	Interaction with PDZD3. {ECO:0000250}.				ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)			NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			CCGTCGCTGCTCCAGAGACTG	0.652																																					p.E602G													.	.			0			c.A1805G												61.0	51.0	54.0					5																	476743		2203	4300	6503	SO:0001583	missense	6550	exon12			CGCTGCTCCAGAG		CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.1805A>G	5.37:g.476743T>C	ENSP00000264938:p.Glu602Gly		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	28	0.11	3	NM_004174	9	0.00	0	B7ZKR2|E9PF67|Q3MIW3	Missense_Mutation	SNP	ENST00000264938.3	37	CCDS3855.1	.	.	.	.	.	.	.	.	.	.	T	11.73	1.725719	0.30593	.	.	ENSG00000066230	ENST00000264938;ENST00000514375	T;T	0.80033	-1.33;-1.33	4.56	4.56	0.56223	.	0.577815	0.18377	N	0.143079	T	0.77512	0.4141	L	0.58302	1.8	0.37945	D	0.932444	B;B	0.26318	0.146;0.022	B;B	0.21708	0.036;0.011	T	0.79315	-0.1854	10	0.72032	D	0.01	.	13.5764	0.61877	0.0:0.0:0.0:1.0	.	593;602	E9PF67;P48764	.;SL9A3_HUMAN	G	602;593	ENSP00000264938:E602G;ENSP00000422983:E593G	ENSP00000264938:E602G	E	-	2	0	SLC9A3	529743	1.000000	0.71417	0.994000	0.49952	0.395000	0.30598	7.036000	0.76524	1.706000	0.51276	0.459000	0.35465	GAG			0.652	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206677.2		NM_004174	
FBXO4	26272	mdanderson.org	37	5	41925427	41925427	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr5:41925427C>T	ENST00000281623.3	+	1	72	c.16C>T	c.(16-18)Ccg>Tcg	p.P6S	FBXO4_ENST00000296812.2_Missense_Mutation_p.P6S|FBXO4_ENST00000509134.1_Missense_Mutation_p.P6S	NM_012176.2	NP_036308.1	Q9UKT5	FBX4_HUMAN	F-box protein 4	6					positive regulation of protein ubiquitination (GO:0031398)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|telomere maintenance (GO:0000723)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(11)|prostate(1)|stomach(1)|urinary_tract(2)	27		Lung NSC(810;4.15e-05)|Breast(839;0.00093)|Ovarian(839;0.00965)|Myeloproliferative disorder(839;0.0255)|all_neural(839;0.0604)				GGGAAGCGAGCCGCGCAGCGG	0.716																																					p.P6S													.	.			0			c.C16T												3.0	5.0	4.0					5																	41925427		1440	2787	4227	SO:0001583	missense	26272	exon1			AGCGAGCCGCGCA	AF129534	CCDS3938.1, CCDS3939.1, CCDS75238.1	5p12	2008-02-05	2004-06-15		ENSG00000151876	ENSG00000151876		"""F-boxes /  ""other"""""	13583	protein-coding gene	gene with protein product		609090	"""F-box only protein 4"""			10531035, 10531037	Standard	NM_033484		Approved	FBX4	uc003jmq.3	Q9UKT5	OTTHUMG00000094799	ENST00000281623.3:c.16C>T	5.37:g.41925427C>T	ENSP00000281623:p.Pro6Ser		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_033484	9	0.00	0	Q68CU8|Q86VT8|Q9UK98	Missense_Mutation	SNP	ENST00000281623.3	37	CCDS3938.1	.	.	.	.	.	.	.	.	.	.	C	15.58	2.875627	0.51695	.	.	ENSG00000151876	ENST00000296812;ENST00000281623;ENST00000509134	T;T;T	0.71222	-0.55;-0.55;-0.55	4.37	3.46	0.39613	.	0.664997	0.14865	N	0.293880	T	0.53932	0.1827	N	0.19112	0.55	0.27070	N	0.963335	B;B;B	0.20671	0.028;0.028;0.047	B;B;B	0.16289	0.007;0.003;0.015	T	0.50709	-0.8796	10	0.59425	D	0.04	-6.1035	8.9439	0.35747	0.0:0.8882:0.0:0.1118	.	6;6;6	D6RAJ6;Q9UKT5;Q9UKT5-2	.;FBX4_HUMAN;.	S	6	ENSP00000296812:P6S;ENSP00000281623:P6S;ENSP00000421749:P6S	ENSP00000281623:P6S	P	+	1	0	FBXO4	41961184	0.052000	0.20516	0.667000	0.29798	0.810000	0.45777	0.217000	0.17603	1.120000	0.41904	0.563000	0.77884	CCG			0.716	FBXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000211614.1			
NLN	57486	mdanderson.org	37	5	65108215	65108215	+	Silent	SNP	A	A	T	rs2254485	byFrequency	TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr5:65108215A>T	ENST00000380985.5	+	12	2155	c.1977A>T	c.(1975-1977)ccA>ccT	p.P659P	NLN_ENST00000502464.1_Silent_p.P555P	NM_020726.4	NP_065777.1	Q9BYT8	NEUL_HUMAN	neurolysin (metallopeptidase M3 family)	659						mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	26		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0743)|Lung(70;0.00616)		TAATGAATCCAGAGGTATAGT	0.333																																					p.P659P													.	.			0			c.A1977T												75.0	82.0	79.0					5																	65108215		2203	4300	6503	SO:0001819	synonymous_variant	57486	exon12			GAATCCAGAGGTA	AJ300837	CCDS3989.1	5q12.3	2008-02-05	2005-03-31		ENSG00000123213	ENSG00000123213	3.4.24.16		16058	protein-coding gene	gene with protein product		611530	"""angiotensin binding protein"""	AGTBP		10574462	Standard	NM_020726		Approved	KIAA1226	uc003juf.3	Q9BYT8	OTTHUMG00000097803	ENST00000380985.5:c.1977A>T	5.37:g.65108215A>T			Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	55	0.05	3	NM_020726	42	0.00	0	Q9ULJ4	Silent	SNP	ENST00000380985.5	37	CCDS3989.1	.	.	.	.	.	.	.	.	.	.	N	8.287	0.816830	0.16607	.	.	ENSG00000123213	ENST00000509935	.	.	.	5.37	2.96	0.34315	.	.	.	.	.	.	.	.	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	.	.	.	.	.	.	.	-12.087	6.3845	0.21554	0.6947:0.0:0.1929:0.1124	.	.	.	.	X	256	.	.	R	+	1	2	NLN	65143971	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	1.334000	0.33827	0.141000	0.18875	-1.195000	0.01675	AGA			0.333	NLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000215060.1			
HMGCR	3156	broad.mit.edu;mdanderson.org	37	5	74651007	74651007	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr5:74651007G>A	ENST00000287936.4	+	13	1846	c.1690G>A	c.(1690-1692)Gcc>Acc	p.A564T	HMGCR_ENST00000511206.1_Missense_Mutation_p.A564T|HMGCR_ENST00000343975.5_Intron	NM_000859.2	NP_000850.1	P04035	HMDH_HUMAN	3-hydroxy-3-methylglutaryl-CoA reductase	564	Catalytic.				aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|coenzyme A metabolic process (GO:0015936)|isoprenoid biosynthetic process (GO:0008299)|myoblast differentiation (GO:0045445)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of vasodilation (GO:0045908)|negative regulation of wound healing (GO:0061045)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein tetramerization (GO:0051262)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|ubiquinone metabolic process (GO:0006743)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)	coenzyme binding (GO:0050662)|hydroxymethylglutaryl-CoA reductase (NADPH) activity (GO:0004420)|hydroxymethylglutaryl-CoA reductase activity (GO:0042282)|NADPH binding (GO:0070402)			breast(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	20		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;2.24e-54)	Atorvastatin(DB01076)|Fluvastatin(DB01095)|Lovastatin(DB00227)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)	TTGTCTTGTGGCCAGCACCAA	0.403																																					p.A564T													.	HMGCR	53		0			c.G1690A												64.0	61.0	62.0					5																	74651007		2203	4300	6503	SO:0001583	missense	3156	exon13			CTTGTGGCCAGCA		CCDS4027.1, CCDS47234.1	5q13.3-q14	2012-10-02	2010-04-30		ENSG00000113161	ENSG00000113161	1.1.1.88, 1.1.1.34		5006	protein-coding gene	gene with protein product	"""hydroxymethylglutaryl-CoA reductase"", ""3-hydroxy-3-methylglutaryl CoA reductase (NADPH)"""	142910	"""3-hydroxy-3-methylglutaryl-Coenzyme A reductase"""				Standard	NM_000859		Approved		uc003kdp.3	P04035	OTTHUMG00000102069	ENST00000287936.4:c.1690G>A	5.37:g.74651007G>A	ENSP00000287936:p.Ala564Thr		Somatic	162	0	0		WXS	Illumina HiSeq	Phase_I	160	0.04	6	NM_000859	38	0.00	0	B7Z3Y9|Q8N190	Missense_Mutation	SNP	ENST00000287936.4	37	CCDS4027.1	.	.	.	.	.	.	.	.	.	.	G	36	5.837007	0.97009	.	.	ENSG00000113161	ENST00000511206;ENST00000544469;ENST00000287936	T;T	0.68765	-0.35;-0.35	6.05	6.05	0.98169	Hydroxymethylglutaryl-CoA reductase, class I/II, catalytic domain (1);Hydroxymethylglutaryl-CoA reductase, class I/II, substrate-binding (1);	0.000000	0.85682	D	0.000000	D	0.88724	0.6514	H	0.96142	3.775	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.91070	0.4892	10	0.87932	D	0	-16.1311	20.6087	0.99469	0.0:0.0:1.0:0.0	.	564;564	B2R649;P04035	.;HMDH_HUMAN	T	564;495;564	ENSP00000426745:A564T;ENSP00000287936:A564T	ENSP00000287936:A564T	A	+	1	0	HMGCR	74686763	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.828000	0.99408	2.866000	0.98385	0.650000	0.86243	GCC			0.403	HMGCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000219877.2			
RANBP17	64901	bcgsc.ca	37	5	170669748	170669748	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr5:170669748G>T	ENST00000523189.1	+	24	2864	c.2700G>T	c.(2698-2700)atG>atT	p.M900I	RANBP17_ENST00000521759.1_3'UTR	NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	900					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			AGGACCATATGAGCTTCATCA	0.428			T	TRD@	ALL																																p.M900I				Dom	yes		5	5q34	64901	RAN binding protein 17		L	.	RANBP17	108		0			c.G2700T												200.0	177.0	185.0					5																	170669748		2203	4300	6503	SO:0001583	missense	64901	exon24			CCATATGAGCTTC	AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.2700G>T	5.37:g.170669748G>T	ENSP00000427975:p.Met900Ile		Somatic	152	0	0		WXS	Illumina HiSeq	Phase_1	147	0.01	1	NM_022897	10	0.00	0	Q8IU74	Missense_Mutation	SNP	ENST00000523189.1	37	CCDS34287.1	.	.	.	.	.	.	.	.	.	.	G	17.04	3.287880	0.59976	.	.	ENSG00000204764	ENST00000523189;ENST00000534916	T	0.66280	-0.2	5.39	5.39	0.77823	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.52996	0.1769	L	0.31157	0.91	0.58432	D	0.999998	B;B	0.13145	0.007;0.007	B;B	0.19148	0.024;0.024	T	0.44112	-0.9349	10	0.22109	T	0.4	-18.2485	19.5244	0.95197	0.0:0.0:1.0:0.0	.	900;900	Q546R4;Q9H2T7	.;RBP17_HUMAN	I	900;330	ENSP00000427975:M900I	ENSP00000427975:M900I	M	+	3	0	RANBP17	170602353	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.813000	0.99286	2.683000	0.91414	0.655000	0.94253	ATG			0.428	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000372036.1		NM_022897	
MDGA1	266727	broad.mit.edu	37	6	37615066	37615066	+	Silent	SNP	G	G	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr6:37615066G>T	ENST00000434837.3	-	10	3107	c.1929C>A	c.(1927-1929)acC>acA	p.T643T	MDGA1_ENST00000510077.1_Intron|MDGA1_ENST00000505425.1_Silent_p.T643T|MDGA1_ENST00000297153.7_Silent_p.T646T	NM_153487.3	NP_705691.1	Q8NFP4	MDGA1_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 1	643	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				brain development (GO:0007420)|cerebral cortex radially oriented cell migration (GO:0021799)|neuron migration (GO:0001764)|spinal cord association neuron differentiation (GO:0021527)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)				central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	38						TGGGGTTGGGGGTGTCGAAGT	0.617																																					p.T643T													.	MDGA1	104		0			c.C1929A												19.0	20.0	20.0					6																	37615066		1898	4068	5966	SO:0001819	synonymous_variant	266727	exon10			GTTGGGGGTGTCG	AF478693	CCDS47417.1	6p21	2013-01-29			ENSG00000112139	ENSG00000112139		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19267	protein-coding gene	gene with protein product		609626				15922729, 15019943	Standard	NM_153487		Approved	GPIM, MAMDC3	uc003onu.1	Q8NFP4	OTTHUMG00000014626	ENST00000434837.3:c.1929C>A	6.37:g.37615066G>T			Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	114	0.06	7	NM_153487	3	0.00	0	A6NHG0|Q8NBE3	Silent	SNP	ENST00000434837.3	37	CCDS47417.1																																																																																					0.617	MDGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040419.3			
TMEM151B	441151	mdanderson.org	37	6	44243528	44243528	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr6:44243528C>T	ENST00000451188.2	+	3	1242	c.965C>T	c.(964-966)aCg>aTg	p.T322M	TMEM151B_ENST00000438774.2_Intron|RP11-444E17.6_ENST00000505802.1_Intron	NM_001137560.1	NP_001131032.1	Q8IW70	T151B_HUMAN	transmembrane protein 151B	322						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)	6						GAGTACCGCACGGCCTACGCG	0.731																																					p.T322M													.	.			0			c.C965T												22.0	27.0	25.0					6																	44243528		692	1591	2283	SO:0001583	missense	441151	exon3			ACCGCACGGCCTA	AK126839	CCDS47437.1	6p21.1	2009-04-17	2007-10-25	2007-10-25	ENSG00000178233	ENSG00000178233			21315	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 137"", ""transmembrane protein 193"""	C6orf137, TMEM193			Standard	NM_001137560		Approved	bA444E17.5	uc003oxh.2	Q8IW70	OTTHUMG00000014765	ENST00000451188.2:c.965C>T	6.37:g.44243528C>T	ENSP00000393161:p.Thr322Met		Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	24	0.08	2	NM_001137560	0		0	Q5T9V7	Missense_Mutation	SNP	ENST00000451188.2	37	CCDS47437.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.281767	0.80692	.	.	ENSG00000178233	ENST00000451188	.	.	.	4.57	4.57	0.56435	.	0.000000	0.85682	D	0.000000	T	0.80904	0.4713	M	0.83483	2.645	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.83535	0.0093	9	0.66056	D	0.02	.	17.8723	0.88813	0.0:1.0:0.0:0.0	.	322	Q8IW70	T151B_HUMAN	M	322	.	ENSP00000393161:T322M	T	+	2	0	TMEM151B	44351506	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	7.529000	0.81952	2.511000	0.84671	0.462000	0.41574	ACG			0.731	TMEM151B-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000040740.2		NM_001039704	
TMEM242	729515	broad.mit.edu	37	6	157739925	157739925	+	Silent	SNP	C	C	T	rs376664299		TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr6:157739925C>T	ENST00000400788.4	-	3	317	c.216G>A	c.(214-216)ccG>ccA	p.P72P	TMEM242_ENST00000367144.4_Silent_p.P72P	NM_018452.4	NP_060922.2	Q9NWH2	TM242_HUMAN	transmembrane protein 242	72						integral component of membrane (GO:0016021)											ACCCGCTTTCCGGTAATGCAG	0.498																																					p.P72P													.	.			0			c.G216A							C		0,3852		0,0,1926	83.0	90.0	88.0		216	-8.3	0.8	6		88	1,8237		0,1,4118	no	coding-synonymous	C6orf35	NM_018452.4		0,1,6044	TT,TC,CC		0.0121,0.0,0.0083		72/142	157739925	1,12089	1926	4119	6045	SO:0001819	synonymous_variant	729515	exon3			GCTTTCCGGTAAT	AF217510	CCDS43519.1	6q25.3	2011-11-25	2011-11-25	2011-11-25	ENSG00000215712	ENSG00000215712			17206	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 35"""	C6orf35			Standard	NM_018452		Approved	BM033	uc003sih.4	Q9NWH2	OTTHUMG00000015893	ENST00000400788.4:c.216G>A	6.37:g.157739925C>T			Somatic	258	0	0		WXS	Illumina HiSeq	Phase_I	208	0.02	4	NM_018452	36	0.00	0	B9EJD0|Q9NZ88|Q9P094	Silent	SNP	ENST00000400788.4	37	CCDS43519.1																																																																																					0.498	TMEM242-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042837.2			
SDK1	221935	bcgsc.ca	37	7	4304811	4304811	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr7:4304811A>G	ENST00000404826.2	+	45	6576	c.6437A>G	c.(6436-6438)tAc>tGc	p.Y2146C	SDK1_ENST00000389531.3_Missense_Mutation_p.Y2126C|SDK1_ENST00000466611.1_3'UTR	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	2146					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GTGAACCACTACATGAGCGAC	0.687																																					p.Y2146C													.	SDK1	361		0			c.A6437G												66.0	68.0	68.0					7																	4304811		2203	4300	6503	SO:0001583	missense	221935	exon45			ACCACTACATGAG	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.6437A>G	7.37:g.4304811A>G	ENSP00000385899:p.Tyr2146Cys		Somatic	82	0	0		WXS	Illumina HiSeq	Phase_1	134	0.00	0	NM_152744	16	0.00	0	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.024556	0.75390	.	.	ENSG00000146555	ENST00000404826;ENST00000446104;ENST00000389531	T;T	0.72725	-0.66;-0.68	4.57	4.57	0.56435	.	0.000000	0.64402	D	0.000007	D	0.83862	0.5346	M	0.83953	2.67	0.58432	D	0.999997	D;D;D;D	0.89917	1.0;0.998;0.999;0.999	D;D;D;P	0.80764	0.994;0.911;0.98;0.903	D	0.86348	0.1709	10	0.87932	D	0	.	12.5626	0.56291	1.0:0.0:0.0:0.0	.	2126;206;633;2146	F8W6X9;Q7Z5N4-2;F2Z3E9;Q7Z5N4	.;.;.;SDK1_HUMAN	C	2146;394;2126	ENSP00000385899:Y2146C;ENSP00000374182:Y2126C	ENSP00000374182:Y2126C	Y	+	2	0	SDK1	4271337	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	8.706000	0.91362	1.698000	0.51180	0.454000	0.30748	TAC			0.687	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000323702.1		NM_152744	
SLC29A4	222962	broad.mit.edu	37	7	5340085	5340085	+	Silent	SNP	C	C	G			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr7:5340085C>G	ENST00000396872.3	+	10	1403	c.1242C>G	c.(1240-1242)ggC>ggG	p.G414G	SLC29A4_ENST00000406453.3_Silent_p.G400G|SLC29A4_ENST00000297195.4_Silent_p.G414G|SLC29A4_ENST00000439491.2_3'UTR			Q7RTT9	S29A4_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 4	414					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)			breast(1)|cervix(2)|kidney(7)|large_intestine(1)|liver(1)|lung(7)|urinary_tract(1)	20		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)	Metformin(DB00331)	ACTGGCGGGGCACCCACCTGC	0.706																																					p.G414G													SLC29A4,NS,carcinoma,+2,1	SLC29A4	52	1	0			c.C1242G												53.0	52.0	52.0					7																	5340085		2203	4293	6496	SO:0001819	synonymous_variant	222962	exon10			GCGGGGCACCCAC	AK075422	CCDS5340.1, CCDS75561.1	7p22.2	2013-07-17	2013-07-17		ENSG00000164638	ENSG00000164638		"""Solute carriers"""	23097	protein-coding gene	gene with protein product		609149	"""solute carrier family 29 (nucleoside transporters), member 4"""			12838422	Standard	NM_153247		Approved	FLJ34923, ENT4	uc003soc.3	Q7RTT9	OTTHUMG00000023797	ENST00000396872.3:c.1242C>G	7.37:g.5340085C>G			Somatic	85	0.0588235294	5		WXS	Illumina HiSeq	Phase_I	139	0.08	11	NM_153247	32	0.03	1	Q6PJ08|Q86WY8|Q8NAR3|Q8NBM2	Silent	SNP	ENST00000396872.3	37	CCDS5340.1																																																																																					0.706	SLC29A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000060118.6		NM_153247	
GRID2IP	392862	broad.mit.edu	37	7	6547896	6547901	+	In_Frame_Del	DEL	CTGAGC	CTGAGC	-			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	CTGAGC	CTGAGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr7:6547896_6547901delCTGAGC	ENST00000457091.2	-	13	2258_2263	c.2259_2264delGCTCAG	c.(2257-2265)ccgctcagc>ccc	p.LS754del	GRID2IP_ENST00000452113.1_In_Frame_Del_p.LS563del|GRID2IP_ENST00000435185.1_In_Frame_Del_p.LS570del	NM_001145118.1	NP_001138590.1	A4D2P6	GRD2I_HUMAN	glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein	754	Pro-rich.				long term synaptic depression (GO:0060292)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				endometrium(4)	4						TGGTGGGGGGCTGAGCGGGGGTGGGG	0.66																																					p.753_755del													.	GRID2IP	82		0			c.2259_2264del																																									SO:0001651	inframe_deletion	392862	exon13			GGGGGGCTGAGCG		CCDS47537.1	7p22	2007-10-05	2006-03-01		ENSG00000215045	ENSG00000215045			18464	protein-coding gene	gene with protein product		610639	"""glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1"""			14612983	Standard	NM_001145118		Approved		uc011jwx.2	A4D2P6	OTTHUMG00000155531	ENST00000457091.2:c.2259_2264delGCTCAG	7.37:g.6547896_6547901delCTGAGC	ENSP00000397351:p.Leu754_Ser755del		Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	62	0.00	0	NM_001145118	1	0.00	0		In_Frame_Del	DEL	ENST00000457091.2	37	CCDS47537.1																																																																																					0.660	GRID2IP-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000340534.1		XM_294249	
AQP1	358	mdanderson.org	37	7	30951907	30951907	+	Splice_Site	SNP	A	A	G			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr7:30951907A>G	ENST00000311813.4	+	1	438	c.383A>G	c.(382-384)gAc>gGc	p.D128G	AQP1_ENST00000509504.1_Splice_Site_p.D305G|AQP1_ENST00000434909.2_Splice_Site_p.D188G	NM_198098.2	NP_932766.1	P29972	AQP1_HUMAN	aquaporin 1 (Colton blood group)	128					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|bicarbonate transport (GO:0015701)|camera-type eye morphogenesis (GO:0048593)|carbon dioxide transmembrane transport (GO:0035378)|carbon dioxide transport (GO:0015670)|cation transmembrane transport (GO:0098655)|cell volume homeostasis (GO:0006884)|cellular homeostasis (GO:0019725)|cellular hyperosmotic response (GO:0071474)|cellular response to cAMP (GO:0071320)|cellular response to copper ion (GO:0071280)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to inorganic substance (GO:0071241)|cellular response to mechanical stimulus (GO:0071260)|cellular response to mercury ion (GO:0071288)|cellular response to nitric oxide (GO:0071732)|cellular response to retinoic acid (GO:0071300)|cellular response to salt stress (GO:0071472)|cellular response to stress (GO:0033554)|cellular response to UV (GO:0034644)|cerebrospinal fluid secretion (GO:0033326)|cGMP biosynthetic process (GO:0006182)|corticotropin secretion (GO:0051458)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|glomerular filtration (GO:0003094)|glycerol transport (GO:0015793)|hyperosmotic salinity response (GO:0042538)|lateral ventricle development (GO:0021670)|lipid digestion (GO:0044241)|maintenance of symbiont-containing vacuole by host (GO:0085018)|metanephric descending thin limb development (GO:0072220)|metanephric glomerulus vasculature development (GO:0072239)|metanephric proximal convoluted tubule segment 2 development (GO:0072232)|metanephric proximal straight tubule development (GO:0072230)|multicellular organismal water homeostasis (GO:0050891)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|nitric oxide transport (GO:0030185)|odontogenesis (GO:0042476)|pancreatic juice secretion (GO:0030157)|positive regulation of angiogenesis (GO:0045766)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of saliva secretion (GO:0046878)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|renal water absorption (GO:0070295)|renal water transport (GO:0003097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|secretory granule organization (GO:0033363)|sensory perception of pain (GO:0019233)|small molecule metabolic process (GO:0044281)|transepithelial water transport (GO:0035377)|transmembrane transport (GO:0055085)|water transport (GO:0006833)|wound healing (GO:0042060)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|axon terminus (GO:0043679)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|symbiont-containing vacuole (GO:0020003)	ammonium transmembrane transporter activity (GO:0008519)|carbon dioxide transmembrane transporter activity (GO:0035379)|glycerol transmembrane transporter activity (GO:0015168)|intracellular cGMP activated cation channel activity (GO:0005223)|nitric oxide transmembrane transporter activity (GO:0030184)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)|transmembrane transporter activity (GO:0022857)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)			kidney(1)|large_intestine(2)|lung(9)	12		Melanoma(862;0.16)			Acetazolamide(DB00819)	GGCCGCAATGACGTGAGTGGG	0.602																																					p.D128G													.	.			0			c.A383G												59.0	61.0	60.0					7																	30951907		2203	4300	6503	SO:0001630	splice_region_variant	358	exon1			GCAATGACGTGAG	M77829	CCDS5431.1, CCDS55096.1, CCDS55097.1, CCDS55098.1	7p14	2014-07-19	2014-01-02		ENSG00000240583	ENSG00000240583		"""Ion channels / Aquaporins"", ""Blood group antigens"""	633	protein-coding gene	gene with protein product		107776	"""Colton blood group"", ""aquaporin 1 (channel-forming integral protein, 28kDa)"", ""aquaporin 1 (channel-forming integral protein, 28kDa, CO blood group)"", ""aquaporin 1"""	CO		1722319, 3166547	Standard	NM_198098		Approved	CHIP28		P29972	OTTHUMG00000023944	ENST00000311813.4:c.384+1A>G	7.37:g.30951907A>G			Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_198098	64	0.00	0	B5BU39|E7EM69|E9PC21|F5GY19|Q8TBI5|Q8TDC1	Missense_Mutation	SNP	ENST00000311813.4	37	CCDS5431.1	.	.	.	.	.	.	.	.	.	.	A	5.549	0.286185	0.10513	.	.	ENSG00000240583;ENSG00000240583;ENSG00000240583;ENSG00000240583;ENSG00000250424	ENST00000434909;ENST00000265298;ENST00000311813;ENST00000413400;ENST00000509504	D;D;D	0.92595	-3.07;-3.07;-3.07	4.61	0.294	0.15747	Aquaporin-like (2);	0.922143	0.09435	N	0.802583	T	0.70911	0.3278	N	0.00453	-1.485	0.19945	N	0.999944	B;B	0.09022	0.002;0.0	B;B	0.10450	0.005;0.001	T	0.64118	-0.6482	10	0.27785	T	0.31	.	4.9291	0.13909	0.2943:0.4527:0.2531:0.0	.	188;128	B4E220;P29972	.;AQP1_HUMAN	G	188;33;128;113;305	ENSP00000395059:D188G;ENSP00000311165:D128G;ENSP00000421315:D305G	ENSP00000265298:D33G	D	+	2	0	RP5-877J2.1;AQP1	30918432	0.001000	0.12720	0.440000	0.26846	0.268000	0.26511	0.057000	0.14279	0.098000	0.17522	0.459000	0.35465	GAC			0.602	AQP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000215002.3		NM_000385	Missense_Mutation
CCT6P1	643253	broad.mit.edu	37	7	65222986	65222986	+	RNA	SNP	G	G	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr7:65222986G>T	ENST00000442266.1	+	0	578				SNORA15_ENST00000384058.1_RNA|SNORA22_ENST00000383907.1_RNA					chaperonin containing TCP1, subunit 6 (zeta) pseudogene 1																		GAATTCTGGCGTTTTTTACAA	0.289																																					.													.	.			0			.																																											0	.			TCTGGCGTTTTTT	BC052238, BC073761		7q11.21	2010-06-29	2008-09-22	2008-09-22	ENSG00000228409	ENSG00000228409			33094	pseudogene	pseudogene			"""chaperonin containing TCP1, subunit 6A (zeta 1) pseudogene 1"""	CCT6AP1			Standard	NR_003110		Approved		uc003tug.3		OTTHUMG00000156733		7.37:g.65222986G>T			Somatic	19	0	0		WXS	Illumina HiSeq	Phase_I	37	0.11	4	.	24	0.00	0		RNA	SNP	ENST00000442266.1	37																																																																																						0.289	CCT6P1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000345507.1		NR_003110	
KMT2E	55904	bcgsc.ca	37	7	104703808	104703808	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr7:104703808A>G	ENST00000311117.3	+	5	742	c.197A>G	c.(196-198)tAt>tGt	p.Y66C	KMT2E_ENST00000334877.4_Missense_Mutation_p.Y66C|KMT2E_ENST00000257745.4_Missense_Mutation_p.Y66C|KMT2E_ENST00000476671.1_Missense_Mutation_p.Y66C|KMT2E_ENST00000334914.7_5'UTR	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	66					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										GACCATAATTATGGTGCTCGT	0.343																																					p.Y66C													.	MLL5	173		0			c.A197G												75.0	77.0	77.0					7																	104703808		2203	4299	6502	SO:0001583	missense	55904	exon4			ATAATTATGGTGC	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.197A>G	7.37:g.104703808A>G	ENSP00000312379:p.Tyr66Cys		Somatic	134	0	0		WXS	Illumina HiSeq	Phase_1	173	0.00	0	NM_018682	23	0.00	0	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	ENST00000311117.3	37	CCDS34723.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.3|21.3	4.129288|4.129288	0.77549|0.77549	.|.	.|.	ENSG00000005483|ENSG00000005483	ENST00000537308|ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745;ENST00000495267;ENST00000476671;ENST00000474203	.|D;D;D;T;D	.|0.94897	.|-3.23;-2.77;-3.23;1.29;-3.55	5.46|5.46	5.46|5.46	0.80206|0.80206	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.96027|0.96027	0.8706|0.8706	L|L	0.48642|0.48642	1.525|1.525	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.85130	.|0.997;0.997	D|D	0.96655|0.96655	0.9484|0.9484	6|10	0.87932|0.87932	D|D	0|0	.|.	15.8148|15.8148	0.78592|0.78592	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|66;66	.|Q8IZD2;Q8IZD2-3	.|MLL5_HUMAN;.	V|C	1|66	.|ENSP00000312379:Y66C;ENSP00000335599:Y66C;ENSP00000257745:Y66C;ENSP00000420415:Y66C;ENSP00000417888:Y66C	ENSP00000439074:M1V|ENSP00000257745:Y66C	M|Y	+|+	1|2	0|0	MLL5|MLL5	104491044|104491044	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.043000|9.043000	0.93799|0.93799	2.200000|2.200000	0.70718|0.70718	0.477000|0.477000	0.44152|0.44152	ATG|TAT			0.343	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348697.1			
HYAL4	23553	bcgsc.ca	37	7	123508991	123508991	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr7:123508991G>A	ENST00000223026.4	+	3	1302	c.664G>A	c.(664-666)Gat>Aat	p.D222N	HYAL4_ENST00000476325.1_Missense_Mutation_p.D222N	NM_012269.2	NP_036401.2	Q2M3T9	HYAL4_HUMAN	hyaluronoglucosaminidase 4	222					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|glycosaminoglycan catabolic process (GO:0006027)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)	hyalurononglucosaminidase activity (GO:0004415)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	23						TTTATATCCTGATTGCCACAA	0.433																																					p.D222N													.	HYAL4	65		0			c.G664A												73.0	75.0	75.0					7																	123508991		2203	4300	6503	SO:0001583	missense	23553	exon3			TATCCTGATTGCC	AF009010	CCDS5789.1	7q31.3	2010-01-14			ENSG00000106302	ENSG00000106302			5323	protein-coding gene	gene with protein product	"""hyaluronidase 4"""	604510				10493834	Standard	NM_012269		Approved		uc003vlc.3	Q2M3T9	OTTHUMG00000157349	ENST00000223026.4:c.664G>A	7.37:g.123508991G>A	ENSP00000223026:p.Asp222Asn		Somatic	103	0	0		WXS	Illumina HiSeq	Phase_1	105	0.00	0	NM_012269	22	0.00	0	D0VXG1|Q9UL99|Q9Y6T9	Missense_Mutation	SNP	ENST00000223026.4	37	CCDS5789.1	.	.	.	.	.	.	.	.	.	.	G	15.25	2.777274	0.49786	.	.	ENSG00000106302	ENST00000223026;ENST00000476325	T;T	0.25912	1.77;1.77	6.03	5.16	0.70880	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.26557	0.0649	M	0.72624	2.21	0.41888	D	0.990353	B;P	0.42357	0.117;0.777	B;B	0.35931	0.084;0.214	T	0.08186	-1.0734	9	.	.	.	-23.7794	11.322	0.49428	0.1379:0.0:0.8621:0.0	.	222;222	F8WDH9;Q2M3T9	.;HYAL4_HUMAN	N	222	ENSP00000223026:D222N;ENSP00000417186:D222N	.	D	+	1	0	HYAL4	123296227	1.000000	0.71417	0.984000	0.44739	0.034000	0.12701	5.694000	0.68272	1.561000	0.49584	-0.136000	0.14681	GAT			0.433	HYAL4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348545.1		NM_012269	
SLC37A3	84255	bcgsc.ca	37	7	140064288	140064288	+	Silent	SNP	G	G	A			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr7:140064288G>A	ENST00000326232.9	-	5	498	c.295C>T	c.(295-297)Cta>Tta	p.L99L	SLC37A3_ENST00000461089.1_5'UTR|SLC37A3_ENST00000429996.2_Silent_p.L99L|SLC37A3_ENST00000447932.2_Silent_p.L99L|SLC37A3_ENST00000340308.3_Silent_p.L99L	NM_207113.1	NP_996996.1	Q8NCC5	SPX3_HUMAN	solute carrier family 37, member 3	99					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|stomach(3)	24	Melanoma(164;0.0142)					CTGATGAATAGGCCCTAAAAA	0.368																																					p.L99L	Esophageal Squamous(133;211 1716 4665 11387 37873)												.	SLC37A3	80		0			c.C295T												98.0	83.0	88.0					7																	140064288		2203	4300	6503	SO:0001819	synonymous_variant	84255	exon5			TGAATAGGCCCTA	AK074823	CCDS5858.1, CCDS5859.1, CCDS75669.1	7q34	2013-07-17	2013-07-17		ENSG00000157800	ENSG00000157800		"""Solute carriers"""	20651	protein-coding gene	gene with protein product							Standard	NM_001287498		Approved	DKFZp761N0624	uc003vvo.3	Q8NCC5	OTTHUMG00000157343	ENST00000326232.9:c.295C>T	7.37:g.140064288G>A			Somatic	110	0	0		WXS	Illumina HiSeq	Phase_1	145	0.00	0	NM_207113	59	0.00	0	Q6PIU7|Q86SS4|Q9BQG7	Silent	SNP	ENST00000326232.9	37	CCDS5859.1																																																																																					0.368	SLC37A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348492.1		NM_032295	
EPHB6	2051	bcgsc.ca;mdanderson.org	37	7	142562074	142562074	+	Silent	SNP	C	C	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr7:142562074C>T	ENST00000392957.2	+	7	1303	c.516C>T	c.(514-516)tcC>tcT	p.S172S	EPHB6_ENST00000411471.2_Intron|EPHB6_ENST00000442129.1_Silent_p.S172S	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	172	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.|Poly-Ser.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					cctcctcctcctcttcttcct	0.622																																					p.S172S													.	EPHB6	168		0			c.C516T												83.0	98.0	93.0					7																	142562074		2200	4299	6499	SO:0001819	synonymous_variant	2051	exon7			CTCCTCCTCTTCT	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.516C>T	7.37:g.142562074C>T			Somatic	95	0.0105263158	1		WXS	Illumina HiSeq	Phase_1	103	0.06	6	NM_004445	6	0.00	0	A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Silent	SNP	ENST00000392957.2	37	CCDS5873.2																																																																																					0.622	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000341329.1			
C8orf58	541565	broad.mit.edu	37	8	22458529	22458529	+	Missense_Mutation	SNP	G	G	A	rs374180743		TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr8:22458529G>A	ENST00000289989.5	+	2	249	c.175G>A	c.(175-177)Gca>Aca	p.A59T	C8orf58_ENST00000453427.2_3'UTR|C8orf58_ENST00000409586.3_Missense_Mutation_p.A59T			Q8NAV2	CH058_HUMAN	chromosome 8 open reading frame 58	59										endometrium(1)|lung(1)|ovary(1)|skin(1)	4		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00563)|Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)		CGGCAGGGAGGCACTCTTTCT	0.632																																					p.A59T													.	C8orf58	17		0			c.G175A												39.0	45.0	43.0					8																	22458529		2201	4299	6500	SO:0001583	missense	541565	exon2			AGGGAGGCACTCT	BC012750	CCDS34862.1, CCDS56527.1, CCDS75708.1	8p21.3	2010-08-17			ENSG00000241852	ENSG00000241852			32233	protein-coding gene	gene with protein product							Standard	NM_001013842		Approved	FLJ34715	uc003xce.3	Q8NAV2	OTTHUMG00000154160	ENST00000289989.5:c.175G>A	8.37:g.22458529G>A	ENSP00000289989:p.Ala59Thr		Somatic	168	0.005952381	1		WXS	Illumina HiSeq	Phase_I	192	0.03	6	NM_001013842	25	0.00	0	B4DI44	Missense_Mutation	SNP	ENST00000289989.5	37	CCDS34862.1	.	.	.	.	.	.	.	.	.	.	g	10.91	1.483295	0.26598	.	.	ENSG00000248235;ENSG00000241852;ENSG00000241852	ENST00000450780;ENST00000409586;ENST00000289989	.	.	.	4.2	1.21	0.21127	.	1.469060	0.04596	N	0.397716	T	0.23727	0.0574	N	0.22421	0.69	0.09310	N	1	B;B	0.27732	0.187;0.187	B;B	0.24155	0.051;0.051	T	0.19516	-1.0303	9	0.35671	T	0.21	-0.1832	4.3479	0.11141	0.2278:0.1892:0.583:0.0	.	59;59	Q8NAV2-2;Q8NAV2	.;CH058_HUMAN	T	128;59;59	.	ENSP00000399696:A128T	A	+	1	0	AC037459.4;C8orf58	22514474	0.002000	0.14202	0.001000	0.08648	0.001000	0.01503	0.276000	0.18716	0.099000	0.17552	0.448000	0.29417	GCA			0.632	C8orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000334183.1		NM_001013842	
ZFHX4	79776	mdanderson.org	37	8	77775451	77775451	+	Silent	SNP	T	T	A	rs199874527		TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr8:77775451T>A	ENST00000521891.2	+	11	9949	c.9501T>A	c.(9499-9501)ccT>ccA	p.P3167P	ZFHX4_ENST00000518282.1_Silent_p.P3141P|ZFHX4_ENST00000050961.6_Silent_p.P3118P|ZFHX4_ENST00000455469.2_Silent_p.P3122P	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3118					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ctccaccacctcctcctcctc	0.522										HNSCC(33;0.089)																											p.P3167P													ZFHX4,colon,carcinoma,0,3	ZFHX4	0	3	0			c.T9501A												52.0	53.0	53.0					8																	77775451		2064	4225	6289	SO:0001819	synonymous_variant	79776	exon11			ACCACCTCCTCCT		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.9501T>A	8.37:g.77775451T>A			Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	86	0.06	5	NM_024721	9	0.11	1	G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	37	CCDS47878.2																																																																																					0.522	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000379197.2		NM_024721	
LRP12	29967	bcgsc.ca	37	8	105509852	105509852	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr8:105509852C>A	ENST00000276654.5	-	5	1036	c.928G>T	c.(928-930)Ggt>Tgt	p.G310C	LRP12_ENST00000518375.1_5'Flank|LRP12_ENST00000424843.2_Missense_Mutation_p.G291C	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	310	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			TCACCATAACCAGTACCATCA	0.393																																					p.G310C													.	LRP12	124		0			c.G928T												61.0	60.0	60.0					8																	105509852		2203	4300	6503	SO:0001583	missense	29967	exon5			CATAACCAGTACC	AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.928G>T	8.37:g.105509852C>A	ENSP00000276654:p.Gly310Cys		Somatic	255	0	0		WXS	Illumina HiSeq	Phase_1	264	0.00	1	NM_013437	21	0.00	0	A8K137|B4DRQ2	Missense_Mutation	SNP	ENST00000276654.5	37	CCDS6303.1	.	.	.	.	.	.	.	.	.	.	C	18.54	3.645452	0.67358	.	.	ENSG00000147650	ENST00000424843;ENST00000276654	T;T	0.09073	3.02;3.02	5.65	5.65	0.86999	CUB (5);	0.000000	0.85682	D	0.000000	T	0.14098	0.0341	N	0.04275	-0.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.47222	-0.9134	10	0.54805	T	0.06	-26.2997	19.7343	0.96195	0.0:1.0:0.0:0.0	.	291;310	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	C	291;310	ENSP00000399148:G291C;ENSP00000276654:G310C	ENSP00000276654:G310C	G	-	1	0	LRP12	105579028	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	7.294000	0.78760	2.660000	0.90430	0.467000	0.42956	GGT			0.393	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000380821.1		NM_013437	
Unknown	0	bcgsc.ca	37	9	40500069	40500069	+	IGR	SNP	A	A	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr9:40500069A>T								AL353791.1 (467652 upstream) : RN7SL422P (16736 downstream)																							TTCAAACCCAACTTTTTTTTT	0.353																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			AACCCAACTTTTT																													9.37:g.40500069A>T			Somatic	189	0.0158730159	3		WXS	Illumina HiSeq	Phase_1	165	0.04	7	.	0		0		RNA	SNP		37																																																																																					0	0.353										
Unknown	0	bcgsc.ca	37	9	40500132	40500132	+	IGR	SNP	C	C	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr9:40500132C>T								AL353791.1 (467715 upstream) : RN7SL422P (16673 downstream)																							TGTTTTTCCCCTTTTCTCATG	0.408																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			TTTCCCCTTTTCT																													9.37:g.40500132C>T			Somatic	368	0.0108695652	4		WXS	Illumina HiSeq	Phase_1	322	0.01	2	.	1	0.00	0		RNA	SNP		37																																																																																					0	0.408										
PTBP3	9991	hgsc.bcm.edu	37	9	115060046	115060046	+	Intron	SNP	G	G	C			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr9:115060046G>C	ENST00000374255.2	-	3	266				PTBP3_ENST00000487997.1_Intron|PTBP3_ENST00000334318.6_Intron|PTBP3_ENST00000374257.1_Intron|PTBP3_ENST00000458258.1_Intron|PTBP3_ENST00000343327.2_Intron			O95758	PTBP3_HUMAN	polypyrimidine tract binding protein 3						anatomical structure morphogenesis (GO:0009653)|erythrocyte maturation (GO:0043249)|mRNA processing (GO:0006397)|negative regulation of RNA splicing (GO:0033119)|regulation of cell differentiation (GO:0045595)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										AGCAAAATAAGAGCATTGTAA	0.289																																					.													.	.			0			.																																									SO:0001627	intron_variant	100422990	.			AAATAAGAGCATT	AB023967	CCDS6784.1, CCDS55332.1, CCDS55333.1, CCDS59140.1, CCDS59141.1	9q32	2013-07-16	2011-11-16	2011-11-16	ENSG00000119314	ENSG00000119314		"""RNA binding motif (RRM) containing"""	10253	protein-coding gene	gene with protein product		607527	"""regulator of differentiation (in S. pombe) 1"", ""ROD1 regulator of differentiation 1 (S. pombe)"""	ROD1		10207106	Standard	NM_005156		Approved	DKFZp781I1117	uc004bfx.3	O95758	OTTHUMG00000020503	ENST00000374255.2:c.118+74C>G	9.37:g.115060046G>C			Somatic	22	0	0		WXS	Illumina HiSeq	.	24	0.83	20	.	0		0	B1ALY2|B1ALY3|B1ALY5|B1ALY6|B3KME7|Q68DB9|Q86YB3|Q86YH9	RNA	SNP	ENST00000374255.2	37	CCDS6784.1																																																																																					0.289	PTBP3-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000053679.1			
CIZ1	25792	mdanderson.org	37	9	130941375	130941375	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr9:130941375G>A	ENST00000393608.1	-	8	1313	c.1111C>T	c.(1111-1113)Cca>Tca	p.P371S	CIZ1_ENST00000325721.8_Missense_Mutation_p.P342S|CIZ1_ENST00000538431.1_Missense_Mutation_p.P371S|CIZ1_ENST00000372938.5_Missense_Mutation_p.P371S|CIZ1_ENST00000357558.5_Missense_Mutation_p.P371S|CIZ1_ENST00000372948.3_Missense_Mutation_p.P371S|CIZ1_ENST00000372954.1_Missense_Mutation_p.P347S|CIZ1_ENST00000541172.1_Missense_Mutation_p.P270S|CIZ1_ENST00000277465.4_Missense_Mutation_p.P371S|CIZ1_ENST00000476727.2_Intron	NM_012127.2	NP_036259.2	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1	371	Gln-rich.				maintenance of protein location in nucleus (GO:0051457)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|liver(1)|lung(9)|ovary(3)|prostate(2)|urinary_tract(2)	35						tgcttctgtggctctgcctcc	0.612																																					p.P401S													.	.			0			c.C1201T												39.0	34.0	36.0					9																	130941375		2203	4298	6501	SO:0001583	missense	25792	exon8			TCTGTGGCTCTGC	AB030835	CCDS6894.1, CCDS48033.1, CCDS48034.1, CCDS75910.1	9q34.1	2012-10-05			ENSG00000148337	ENSG00000148337			16744	protein-coding gene	gene with protein product		611420				10529385	Standard	NM_001131015		Approved	LSFR1, ZNF356	uc011mas.2	Q9ULV3	OTTHUMG00000020735	ENST00000393608.1:c.1111C>T	9.37:g.130941375G>A	ENSP00000377232:p.Pro371Ser		Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	87	0.05	4	NM_001257975	117	0.00	0	A8K9J8|B4E131|B7ZAS8|Q5SYW3|Q5SYW5|Q8WU72|Q9H868|Q9NYM8|Q9UHK4|Q9Y3F9|Q9Y3G0	Missense_Mutation	SNP	ENST00000393608.1	37	CCDS6894.1	.	.	.	.	.	.	.	.	.	.	G	17.80	3.479034	0.63849	.	.	ENSG00000148337	ENST00000372954;ENST00000393608;ENST00000538431;ENST00000357558;ENST00000325721;ENST00000537314;ENST00000541172;ENST00000277465;ENST00000372941;ENST00000372948;ENST00000372938;ENST00000415526	T;T;T;T;T;T;T;T;T;T	0.38560	1.16;1.45;1.38;1.68;1.41;1.81;1.68;1.13;1.45;2.06	2.89	2.89	0.33648	.	0.129093	0.36200	N	0.002731	T	0.44222	0.1283	N	0.20986	0.625	0.27389	N	0.955199	D;D;P;D;D;D;P;D	0.76494	0.993;0.998;0.782;0.999;0.999;0.993;0.728;0.998	D;P;P;D;D;D;B;P	0.72982	0.979;0.852;0.506;0.93;0.93;0.968;0.349;0.852	T	0.12785	-1.0534	10	0.54805	T	0.06	-2.5144	8.0446	0.30542	0.0:0.2521:0.7479:0.0	.	371;366;371;371;347;371;342;371	B7Z3U7;B4E0A3;F5H2X7;Q9ULV3-4;Q9ULV3-3;Q9ULV3;Q9ULV3-2;Q5SYW2	.;.;.;.;.;CIZ1_HUMAN;.;.	S	347;371;371;371;342;338;270;371;347;371;371;293	ENSP00000362045:P347S;ENSP00000377232:P371S;ENSP00000439244:P371S;ENSP00000350169:P371S;ENSP00000320374:P342S;ENSP00000445057:P270S;ENSP00000277465:P371S;ENSP00000362039:P371S;ENSP00000362029:P371S;ENSP00000398011:P293S	ENSP00000277465:P371S	P	-	1	0	CIZ1	129981196	0.031000	0.19500	0.865000	0.33974	0.487000	0.33371	0.013000	0.13310	1.930000	0.55929	0.549000	0.68633	CCA			0.612	CIZ1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000054399.1		NM_012127	
ADAMTSL2	9719	mdanderson.org	37	9	136404996	136404996	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr9:136404996G>T	ENST00000354484.4	+	5	969		c.e5+1		ADAMTSL2_ENST00000393061.3_Splice_Site|ADAMTSL2_ENST00000393060.1_Splice_Site	NM_001145320.1	NP_001138792.1	Q86TH1	ATL2_HUMAN	ADAMTS-like 2						negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			kidney(2)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(145;9.31e-08)|Epithelial(140;6.62e-07)|all cancers(34;7.74e-06)		CTGTACCCGGGTACCTGCCGC	0.672																																					.													ADAMTSL2,colon,carcinoma,0,1	ADAMTSL2	0	1	0			c.412+1G>T												26.0	23.0	24.0					9																	136404996		1915	3703	5618	SO:0001630	splice_region_variant	9719	exon5			ACCCGGGTACCTG	AB011177	CCDS6976.1	9q34.3	2005-01-12			ENSG00000197859	ENSG00000197859			14631	protein-coding gene	gene with protein product		612277				9628581, 14667842	Standard	NM_014694		Approved	KIAA0605	uc004cei.3	Q86TH1	OTTHUMG00000131706	ENST00000354484.4:c.412+1G>T	9.37:g.136404996G>T			Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_001145320	0		0	B1B0D5|O60345	Splice_Site	SNP	ENST00000354484.4	37	CCDS6976.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.507631	0.85282	.	.	ENSG00000197859	ENST00000354484;ENST00000393061;ENST00000393060	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2939	0.94114	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ADAMTSL2	135394817	1.000000	0.71417	0.993000	0.49108	0.834000	0.47266	9.134000	0.94467	2.572000	0.86782	0.650000	0.86243	.			0.672	ADAMTSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254619.1		NM_014694	Intron
CNKSR2	22866	broad.mit.edu	37	X	21450746	21450746	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chrX:21450746C>A	ENST00000379510.3	+	3	281	c.245C>A	c.(244-246)aCa>aAa	p.T82K	CNKSR2_ENST00000279451.4_Missense_Mutation_p.T82K|CNKSR2_ENST00000425654.2_Missense_Mutation_p.T82K|CNKSR2_ENST00000543067.1_Missense_Mutation_p.T82K	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	82					regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						GGCTTGGAAACAGAAAATCTA	0.313																																					p.T82K													.	CNKSR2	158		0			c.C245A												46.0	53.0	51.0					X																	21450746		2202	4300	6502	SO:0001583	missense	22866	exon3			TGGAAACAGAAAA	AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.245C>A	X.37:g.21450746C>A	ENSP00000368824:p.Thr82Lys		Somatic	189	0.0158730159	3		WXS	Illumina HiSeq	Phase_I	355	0.03	11	NM_001168647	0		0	B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Missense_Mutation	SNP	ENST00000379510.3	37	CCDS14198.1	.	.	.	.	.	.	.	.	.	.	C	15.63	2.890134	0.52014	.	.	ENSG00000149970	ENST00000425654;ENST00000543067;ENST00000279451;ENST00000379510	T;T;T;T	0.20200	2.44;2.19;2.09;2.4	4.65	4.65	0.58169	Sterile alpha motif/pointed domain (1);	0.113958	0.64402	D	0.000017	T	0.37461	0.1004	L	0.41573	1.285	0.80722	D	1	D;P;B	0.89917	1.0;0.768;0.125	D;P;B	0.91635	0.999;0.517;0.118	T	0.06935	-1.0799	10	0.30854	T	0.27	-3.8699	16.8676	0.86033	0.0:1.0:0.0:0.0	.	82;82;82	B7ZLJ1;B4DGR4;Q8WXI2	.;.;CNKR2_HUMAN	K	82	ENSP00000397906:T82K;ENSP00000444633:T82K;ENSP00000279451:T82K;ENSP00000368824:T82K	ENSP00000279451:T82K	T	+	2	0	CNKSR2	21360667	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.341000	0.79300	1.898000	0.54952	0.363000	0.22086	ACA			0.313	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056019.1		NM_014927	
POLA1	5422	broad.mit.edu	37	X	24759594	24759594	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chrX:24759594G>T	ENST00000379059.3	+	21	2316	c.2301G>T	c.(2299-2301)caG>caT	p.Q767H	POLA1_ENST00000379068.3_Missense_Mutation_p.Q773H|SCARNA23_ENST00000516060.1_RNA	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	767					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	TAGCATTGCAGATCACTAACA	0.383																																					p.Q767H													.	POLA1	117		0			c.G2301T												129.0	105.0	113.0					X																	24759594		2203	4300	6503	SO:0001583	missense	5422	exon21			ATTGCAGATCACT		CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.2301G>T	X.37:g.24759594G>T	ENSP00000368349:p.Gln767His		Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	184	0.03	5	NM_016937	27	0.00	0	Q86UQ7	Missense_Mutation	SNP	ENST00000379059.3	37	CCDS14214.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.035666	0.75617	.	.	ENSG00000101868	ENST00000379068;ENST00000379059	T;T	0.46819	0.86;0.86	5.24	5.24	0.73138	Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.77585	0.4152	M	0.94063	3.49	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84173	0.0435	10	0.87932	D	0	-9.0274	17.9679	0.89105	0.0:0.0:1.0:0.0	.	767	P09884	DPOLA_HUMAN	H	773;767	ENSP00000368358:Q773H;ENSP00000368349:Q767H	ENSP00000368349:Q767H	Q	+	3	2	POLA1	24669515	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.063000	0.71162	2.433000	0.82419	0.600000	0.82982	CAG			0.383	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000056111.1		NM_016937	
RBM10	8241	bcgsc.ca	37	X	47039331	47039331	+	Silent	SNP	G	G	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chrX:47039331G>T	ENST00000377604.3	+	10	1696	c.954G>T	c.(952-954)ggG>ggT	p.G318G	RBM10_ENST00000329236.7_Silent_p.G241G|RBM10_ENST00000345781.6_Silent_p.G241G|RBM10_ENST00000478410.1_3'UTR	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	318	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						CCATCCTGGGGGCCCTGGCAC	0.592																																					p.G383G	Melanoma(171;120 2705 19495 39241)												.	RBM10	117		0			c.G1149T												46.0	28.0	34.0					X																	47039331		2203	4300	6503	SO:0001819	synonymous_variant	8241	exon10			CCTGGGGGCCCTG	U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.954G>T	X.37:g.47039331G>T			Somatic	134	0	0		WXS	Illumina HiSeq	Phase_1	237	0.00	0	NM_001204468	71	0.00	0	C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Silent	SNP	ENST00000377604.3	37	CCDS14274.1																																																																																					0.592	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056381.1		NM_005676	
SYN1	6853	broad.mit.edu	37	X	47478985	47478985	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chrX:47478985G>A	ENST00000295987.7	-	1	267	c.143C>T	c.(142-144)aCc>aTc	p.T48I	SYN1_ENST00000340666.4_Missense_Mutation_p.T48I	NM_006950.3	NP_008881.2	P17600	SYN1_HUMAN	synapsin I	48	B; linker.				neurotransmitter secretion (GO:0007269)|regulation of neurotransmitter secretion (GO:0046928)|regulation of synaptic vesicle exocytosis (GO:2000300)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|protein kinase binding (GO:0019901)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(6)|lung(6)|ovary(1)	21						GGCAGTGGCGGTCCCGGGACC	0.751																																					p.T48I													.	SYN1	84		0			c.C143T												2.0	3.0	3.0					X																	47478985		1449	2922	4371	SO:0001583	missense	6853	exon1			GTGGCGGTCCCGG		CCDS14280.1, CCDS35233.1	Xp11.2	2012-10-02			ENSG00000008056	ENSG00000008056			11494	protein-coding gene	gene with protein product		313440					Standard	NM_133499		Approved		uc004die.3	P17600	OTTHUMG00000021454	ENST00000295987.7:c.143C>T	X.37:g.47478985G>A	ENSP00000295987:p.Thr48Ile		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	56	0.05	3	NM_006950	2	0.00	0	B1AJQ1|O75825|Q5H9A9	Missense_Mutation	SNP	ENST00000295987.7	37	CCDS14280.1	.	.	.	.	.	.	.	.	.	.	G	7.146	0.582738	0.13749	.	.	ENSG00000008056	ENST00000295987;ENST00000340666	T;T	0.31769	1.9;1.48	4.03	2.06	0.26882	.	0.599767	0.14300	U	0.328343	T	0.13372	0.0324	N	0.08118	0	0.09310	N	1	B;B	0.28636	0.139;0.218	B;B	0.22386	0.017;0.039	T	0.16808	-1.0390	10	0.41790	T	0.15	.	5.963	0.19310	0.1193:0.1917:0.689:0.0	.	48;48	P17600;P17600-2	SYN1_HUMAN;.	I	48	ENSP00000295987:T48I;ENSP00000343206:T48I	ENSP00000295987:T48I	T	-	2	0	SYN1	47363929	0.016000	0.18221	0.226000	0.23910	0.303000	0.27691	1.581000	0.36558	0.524000	0.28502	0.458000	0.33432	ACC			0.751	SYN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000056445.1		NM_006950	
TAF1	6872	broad.mit.edu;mdanderson.org	37	X	70679068	70679068	+	Intron	SNP	G	G	T			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chrX:70679068G>T	ENST00000373790.4	+	36	5112				TAF1_ENST00000449580.1_Missense_Mutation_p.E1710D|TAF1_ENST00000423759.1_Intron|TAF1_ENST00000461764.1_3'UTR|TAF1_ENST00000276072.3_Intron	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa						cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				ATGATGATGAGGAGGAGGATG	0.473																																					.													.	.			0			.												124.0	112.0	116.0					X																	70679068		876	1991	2867	SO:0001627	intron_variant	6872	.			TGATGAGGAGGAG		CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.5062-334G>T	X.37:g.70679068G>T			Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	65	0.06	4	.	17	0.00	0	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	ENST00000373790.4	37	CCDS35325.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.82|15.82	2.945695|2.945695	0.53079|0.53079	.|.	.|.	ENSG00000147133|ENSG00000147133	ENST00000449580;ENST00000395779|ENST00000437147	T|.	0.09350|.	2.99|.	4.15|4.15	2.26|2.26	0.28386|0.28386	.|.	.|.	.|.	.|.	.|.	T|T	0.54303|0.54303	0.1850|0.1850	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	B|.	0.02656|.	0.0|.	B|.	0.04013|.	0.001|.	T|T	0.42481|0.42481	-0.9449|-0.9449	8|4	0.25106|.	T|.	0.35|.	.|.	6.3717|6.3717	0.21485|0.21485	0.097:0.0:0.3125:0.5905|0.097:0.0:0.3125:0.5905	.|.	1710|.	P21675-4|.	.|.	D|M	1710;418|365	ENSP00000389000:E1710D|.	ENSP00000379125:E418D|.	E|R	+|+	3|2	2|0	TAF1|TAF1	70595793|70595793	0.997000|0.997000	0.39634|0.39634	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	0.173000|0.173000	0.16724|0.16724	0.215000|0.215000	0.20761|0.20761	0.511000|0.511000	0.50034|0.50034	GAG|AGG			0.473	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000058995.2		NM_004606	
MAGEC1	9947	broad.mit.edu	37	X	140993906	140993908	+	In_Frame_Del	DEL	CCT	CCT	-	rs146816736|rs140572967	byFrequency	TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	CCT	CCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chrX:140993906_140993908delCCT	ENST00000285879.4	+	4	1002_1004	c.716_718delCCT	c.(715-720)ccctcc>ccc	p.S243del	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	243										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					CCTGTGAGCCCCTCCTCCTCCTC	0.473										HNSCC(15;0.026)																											p.239_240del													.	MAGEC1	317		0			c.716_718del																																									SO:0001651	inframe_deletion	9947	exon4			TGAGCCCCTCCTC	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.716_718delCCT	X.37:g.140993915_140993917delCCT	ENSP00000285879:p.Ser243del		Somatic	1002	0	0		WXS	Illumina HiSeq	Phase_I	1569	0.01	8	NM_005462	0		0	A0PK03|O75451|Q8TCV4	In_Frame_Del	DEL	ENST00000285879.4	37	CCDS35417.1																																																																																					0.473	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000058604.1		NM_005462	
PLXNB3	5365	broad.mit.edu	37	X	153039474	153039474	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAGI-01A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30f7d68d-4e46-4877-aecf-41abb5337d40	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chrX:153039474A>C	ENST00000361971.5	+	20	3554	c.3440A>C	c.(3439-3441)aAc>aCc	p.N1147T	PLXNB3_ENST00000538776.1_Missense_Mutation_p.N800T|PLXNB3_ENST00000538282.1_Missense_Mutation_p.N757T|PLXNB3_ENST00000538966.1_Missense_Mutation_p.N1170T|SRPK3_ENST00000489426.1_5'Flank	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	1147					axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					TACCAGCCCAACCCCCGCCTG	0.677																																					p.N1170T													.	PLXNB3	208		0			c.A3509C												23.0	24.0	24.0					X																	153039474		2194	4281	6475	SO:0001583	missense	5365	exon21			AGCCCAACCCCCG	AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.3440A>C	X.37:g.153039474A>C	ENSP00000355378:p.Asn1147Thr		Somatic	39	0.1282051282	5		WXS	Illumina HiSeq	Phase_I	58	0.22	13	NM_001163257	1	0.00	0	B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	ENST00000361971.5	37	CCDS14729.1	.	.	.	.	.	.	.	.	.	.	a	17.87	3.493823	0.64186	.	.	ENSG00000198753	ENST00000538966;ENST00000361971;ENST00000538776;ENST00000538282	T;T;T;T	0.62788	-0.0;-0.0;-0.0;-0.0	5.28	4.11	0.48088	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.091066	0.64402	N	0.000001	T	0.77110	0.4082	M	0.84683	2.71	0.45777	D	0.998663	P;D;P	0.63880	0.556;0.993;0.556	B;D;B	0.63283	0.285;0.913;0.403	T	0.78132	-0.2323	10	0.87932	D	0	.	9.5112	0.39078	0.8243:0.1757:0.0:0.0	.	800;1170;1147	B7Z3H9;F5H773;Q9ULL4	.;.;PLXB3_HUMAN	T	1170;1147;800;757	ENSP00000442736:N1170T;ENSP00000355378:N1147T;ENSP00000445569:N800T;ENSP00000441919:N757T	ENSP00000355378:N1147T	N	+	2	0	PLXNB3	152692668	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	4.749000	0.62155	0.665000	0.31066	-0.408000	0.06270	AAC			0.677	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000061063.1			
