#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
DVL1	1855	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	1273785	1273785	+	Silent	SNP	G	G	A	rs151161721		TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr1:1273785G>A	ENST00000378888.5	-	13	1655	c.1371C>T	c.(1369-1371)caC>caT	p.H457H	DVL1_ENST00000378891.5_Silent_p.H432H			O14640	DVL1_HUMAN	dishevelled segment polarity protein 1	457	DEP. {ECO:0000255|PROSITE- ProRule:PRU00066}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|cochlea morphogenesis (GO:0090103)|collateral sprouting (GO:0048668)|convergent extension (GO:0060026)|convergent extension involved in neural plate elongation (GO:0022007)|cytoplasmic microtubule organization (GO:0031122)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|negative regulation of protein binding (GO:0032091)|negative regulation of protein kinase activity (GO:0006469)|neural tube development (GO:0021915)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|prepulse inhibition (GO:0060134)|protein localization to microtubule (GO:0035372)|protein localization to nucleus (GO:0034504)|receptor clustering (GO:0043113)|regulation of neurotransmitter levels (GO:0001505)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|social behavior (GO:0035176)|synapse organization (GO:0050808)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	axon (GO:0030424)|cell cortex (GO:0005938)|clathrin-coated vesicle (GO:0030136)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|growth cone (GO:0030426)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	enzyme binding (GO:0019899)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|Rac GTPase binding (GO:0048365)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		AGCCCTCCACGTGTGTGTACA	0.682																																					p.H432H													.	.			0			c.C1296T							G		0,4404		0,0,2202	35.0	34.0	34.0		1296	-1.9	0.9	1	dbSNP_134	34	2,8586	2.2+/-6.3	0,2,4292	no	coding-synonymous	DVL1	NM_004421.2		0,2,6494	AA,AG,GG		0.0233,0.0,0.0154		432/671	1273785	2,12990	2202	4294	6496	SO:0001819	synonymous_variant	1855	exon13			CTCCACGTGTGTG	AF006011	CCDS22.1	1p36	2013-05-22	2013-05-22		ENSG00000107404	ENSG00000107404		"""Dishevelled homologs"""	3084	protein-coding gene	gene with protein product		601365	"""dishevelled 1 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 1 (Drosophila)"""			8817329	Standard	NM_004421		Approved		uc001aer.4	O14640	OTTHUMG00000003069	ENST00000378888.5:c.1371C>T	1.37:g.1273785G>A			Somatic	47	0	0		WXS	Illumina HiSeq	.	83	0.14	12	NM_004421	203	0.20	41	Q5TA33|Q5TA35	Silent	SNP	ENST00000378888.5	37																																																																																				0		0.682	DVL1-004	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000008490.1		NM_004421	
PRDM2	7799	broad.mit.edu	37	1	14105124	14105124	+	Missense_Mutation	SNP	A	A	T	rs556843220	byFrequency	TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr1:14105124A>T	ENST00000235372.7	+	8	1690	c.834A>T	c.(832-834)gaA>gaT	p.E278D	PRDM2_ENST00000343137.4_Missense_Mutation_p.E77D|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000311066.5_Missense_Mutation_p.E278D|PRDM2_ENST00000413440.1_Missense_Mutation_p.E77D|PRDM2_ENST00000503842.1_Intron	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	278	Asp/Glu-rich (acidic).			EDEEEEEDDDDDELEDEG -> VGGGGGVVVVVSWKARGE (in Ref. 6; AAA87023). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		aggaggatgaagaagaagaag	0.498													A|||	3	0.000599042	0.0	0.0	5008	,	,		19571	0.0		0.001	False		,,,				2504	0.002				p.E278D													PRDM2,caecum,carcinoma,0,2	PRDM2	147	2	0			c.A834T												56.0	57.0	57.0					1																	14105124		2203	4300	6503	SO:0001583	missense	7799	exon8			GGATGAAGAAGAA	U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.834A>T	1.37:g.14105124A>T	ENSP00000235372:p.Glu278Asp		Somatic	162	0.0061728395	1		WXS	Illumina HiSeq	Phase_I	166	0.03	5	NM_015866	10	0.00	0	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	ENST00000235372.7	37	CCDS150.1	.	.	.	.	.	.	.	.	.	.	A	0.001	-2.900977	0.00058	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137;ENST00000407521	T;T;T;T	0.01871	4.73;4.59;4.69;4.69	1.23	-2.46	0.06461	.	0.178267	0.19455	U	0.113847	T	0.00845	0.0028	N	0.08118	0	0.19775	N	0.999955	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.0;0.0;0.001	T	0.43702	-0.9375	10	0.07325	T	0.83	.	0.0761	0.00027	0.3091:0.2376:0.2157:0.2375	.	278;136;278;278	A8MW16;Q5THJ0;Q13029;Q13029-2	.;.;PRDM2_HUMAN;.	D	278;278;278;77;77;77	ENSP00000235372:E278D;ENSP00000312352:E278D;ENSP00000411103:E77D;ENSP00000341621:E77D	ENSP00000235372:E278D	E	+	3	2	PRDM2	13977711	0.979000	0.34478	0.186000	0.23195	0.093000	0.18481	-0.759000	0.04761	-1.632000	0.01541	-1.785000	0.00643	GAA			0.498	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000021792.2		NM_012231	
FOXE3	2301	broad.mit.edu	37	1	47882404	47882404	+	Silent	SNP	G	G	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr1:47882404G>T	ENST00000335071.2	+	1	661	c.417G>T	c.(415-417)ccG>ccT	p.P139P		NM_012186.2	NP_036318.1	Q13461	FOXE3_HUMAN	forkhead box E3	139					camera-type eye development (GO:0043010)|cell development (GO:0048468)|positive regulation of epithelial cell proliferation (GO:0050679)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|upper_aerodigestive_tract(1)	5				READ - Rectum adenocarcinoma(2;0.0908)		CGGGCAACCCGGGCAAGGGCA	0.672																																					p.P139P													.	FOXE3	8		0			c.G417T												45.0	47.0	46.0					1																	47882404		2203	4300	6503	SO:0001819	synonymous_variant	2301	exon1			CAACCCGGGCAAG	AF275722	CCDS550.1	1p32	2008-02-05			ENSG00000186790	ENSG00000186790		"""Forkhead boxes"""	3808	protein-coding gene	gene with protein product		601094		FKHL12		8825632	Standard	NM_012186		Approved	FREAC8	uc001crk.3	Q13461	OTTHUMG00000007954	ENST00000335071.2:c.417G>T	1.37:g.47882404G>T			Somatic	175	0	0		WXS	Illumina HiSeq	Phase_I	149	0.03	5	NM_012186	1	0.00	0	Q5SVY9|Q9NQV9	Silent	SNP	ENST00000335071.2	37	CCDS550.1																																																																																					0.672	FOXE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000021836.1		NM_012186	
GBP1P1	400759	broad.mit.edu	37	1	89888568	89888570	+	RNA	DEL	AGA	AGA	-			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	AGA	AGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr1:89888568_89888570delAGA	ENST00000513638.1	+	0	557					NR_003133.2				guanylate binding protein 1, interferon-inducible pseudogene 1																		TCAGTCCTCTAGAAGAAGAAGTG	0.438																																					.													.	.			0			.																																											0	.			TCCTCTAGAAGAA			1p22.2	2011-03-09			ENSG00000225492	ENSG00000225492			39561	pseudogene	pseudogene							Standard	NR_003133		Approved		uc009wcy.1		OTTHUMG00000010128		1.37:g.89888574_89888576delAGA			Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	102	0.17	17	.	19	0.00	0		RNA	DEL	ENST00000513638.1	37																																																																																						0.438	GBP1P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000360073.1		NR_003133	
SEMA6C	10500	bcgsc.ca	37	1	151110195	151110195	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr1:151110195G>T	ENST00000341697.3	-	10	2439	c.748C>A	c.(748-750)Ctg>Atg	p.L250M				Q9H3T2	SEM6C_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C	250	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	28	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			ACCCTCCCCAGCCGAGCATCC	0.572																																					p.L250M													.	SEMA6C	70		0			c.C748A												122.0	109.0	114.0					1																	151110195		2203	4300	6503	SO:0001583	missense	10500	exon10			TCCCCAGCCGAGC	AF339154	CCDS984.1, CCDS53363.1, CCDS53364.1	1q21.2	2008-02-05			ENSG00000143434	ENSG00000143434		"""Semaphorins"""	10740	protein-coding gene	gene with protein product	"""m-Sema Y2"""	609294				12110693	Standard	NM_030913		Approved	KIAA1869	uc001ewv.3	Q9H3T2	OTTHUMG00000012261	ENST00000341697.3:c.748C>A	1.37:g.151110195G>T	ENSP00000344148:p.Leu250Met		Somatic	90	0	0		WXS	Illumina HiSeq	Phase_1	131	0.05	6	NM_001178061	11	0.00	0	D3DV15|Q5JR71|Q5JR72|Q5JR73|Q8WXT8|Q8WXT9|Q8WXU0|Q96JF8	Missense_Mutation	SNP	ENST00000341697.3	37	CCDS984.1	.	.	.	.	.	.	.	.	.	.	G	15.89	2.967508	0.53507	.	.	ENSG00000143434	ENST00000368914;ENST00000368912;ENST00000368913;ENST00000341697;ENST00000392792	T;T;T;T	0.11385	2.78;2.78;2.78;2.78	4.48	3.55	0.40652	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.076634	0.53938	D	0.000050	T	0.12135	0.0295	L	0.58302	1.8	0.45662	D	0.99858	P;D;P;D	0.89917	0.875;0.999;0.849;1.0	P;D;P;D	0.91635	0.74;0.994;0.623;0.999	T	0.11542	-1.0583	10	0.23891	T	0.37	.	5.8698	0.18797	0.0995:0.0:0.7129:0.1876	.	250;210;250;250	B4DZD4;Q9H3T2-2;Q9H3T2-3;Q9H3T2	.;.;.;SEM6C_HUMAN	M	250;210;250;250;250	ENSP00000357910:L250M;ENSP00000357908:L210M;ENSP00000357909:L250M;ENSP00000344148:L250M	ENSP00000344148:L250M	L	-	1	2	SEMA6C	149376819	0.893000	0.30496	0.989000	0.46669	0.901000	0.52897	1.290000	0.33319	1.069000	0.40788	0.561000	0.74099	CTG			0.572	SEMA6C-004	KNOWN	alternative_5_UTR|mRNA_start_NF|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000034074.1		NM_030913	
TCHH	7062	broad.mit.edu	37	1	152081419	152081419	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr1:152081419C>A	ENST00000368804.1	-	2	4273	c.4274G>T	c.(4273-4275)cGc>cTc	p.R1425L		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1425	23 X 26 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ACGCTCTTGGCGGCTCAGCTG	0.592											OREG0031687	type=REGULATORY REGION|TFbs=RELA|Dataset=RELA (p65) ChIP-PET Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with paired-end diTag sequencing (ChIP-PET)																									p.R1425L													.	TCHH	275		0			c.G4274T												78.0	80.0	79.0					1																	152081419		1896	4106	6002	SO:0001583	missense	7062	exon3			TCTTGGCGGCTCA	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.4274G>T	1.37:g.152081419C>A	ENSP00000357794:p.Arg1425Leu		Somatic	135	0	0	1745	WXS	Illumina HiSeq	Phase_I	150	0.04	6	NM_007113	0		0	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	c	15.04	2.715319	0.48622	.	.	ENSG00000159450	ENST00000368804	T	0.06068	3.35	3.06	3.06	0.35304	.	.	.	.	.	T	0.09069	0.0224	M	0.65498	2.005	0.28935	N	0.891332	D	0.76494	0.999	D	0.69479	0.964	T	0.14035	-1.0487	9	0.26408	T	0.33	.	9.4142	0.38512	0.0:1.0:0.0:0.0	.	1425	Q07283	TRHY_HUMAN	L	1425	ENSP00000357794:R1425L	ENSP00000357794:R1425L	R	-	2	0	TCHH	150348043	0.000000	0.05858	0.990000	0.47175	0.630000	0.37929	0.292000	0.19011	1.553000	0.49476	0.514000	0.50259	CGC			0.592	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000036671.2		NM_007113	
OR10J3	441911	broad.mit.edu	37	1	159284389	159284389	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr1:159284389T>C	ENST00000332217.5	-	1	60	c.61A>G	c.(61-63)Agg>Ggg	p.R21G		NM_001004467.1	NP_001004467.1	Q5JRS4	O10J3_HUMAN	olfactory receptor, family 10, subfamily J, member 3	21						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(19)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	47	all_hematologic(112;0.0429)					TGCTGCCGCCTGAAGCTGGAG	0.453																																					p.R21G													OR10J3,right_upper_lobe,carcinoma,+1,1	OR10J3	86	1	0			c.A61G												176.0	184.0	182.0					1																	159284389		2203	4300	6503	SO:0001583	missense	441911	exon1			GCCGCCTGAAGCT		CCDS30909.1	1q23.2	2012-08-09		2004-03-10	ENSG00000196266	ENSG00000196266		"""GPCR / Class A : Olfactory receptors"""	14992	protein-coding gene	gene with protein product				OR10J3P			Standard	NM_001004467		Approved		uc010piu.2	Q5JRS4	OTTHUMG00000037233	ENST00000332217.5:c.61A>G	1.37:g.159284389T>C	ENSP00000331789:p.Arg21Gly		Somatic	216	0	0		WXS	Illumina HiSeq	Phase_I	205	0.01	3	NM_001004467	0		0		Missense_Mutation	SNP	ENST00000332217.5	37	CCDS30909.1	.	.	.	.	.	.	.	.	.	.	T	0.003	-2.389314	0.00200	.	.	ENSG00000196266	ENST00000332217	T	0.00573	6.48	5.13	0.819	0.18785	.	0.578052	0.12856	N	0.433501	T	0.00109	0.0003	N	0.04508	-0.205	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.08638	-1.0712	10	0.19147	T	0.46	.	4.0077	0.09608	0.0:0.3419:0.3465:0.3116	.	21	Q5JRS4	O10J3_HUMAN	G	21	ENSP00000331789:R21G	ENSP00000331789:R21G	R	-	1	2	OR10J3	157551013	0.000000	0.05858	0.902000	0.35471	0.014000	0.08584	-1.345000	0.02637	0.296000	0.22592	-0.366000	0.07423	AGG			0.453	OR10J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000090629.1			
IGSF9	57549	mdanderson.org	37	1	159901663	159901663	+	Missense_Mutation	SNP	C	C	T	rs376059608		TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr1:159901663C>T	ENST00000368094.1	-	11	1498	c.1301G>A	c.(1300-1302)cGg>cAg	p.R434Q	IGSF9_ENST00000493195.1_5'UTR|IGSF9_ENST00000361509.3_Missense_Mutation_p.R418Q	NM_001135050.1	NP_001128522.1	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9	434	Ig-like 5.				dendrite development (GO:0016358)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(17)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			GAGCAGCTCCCGCCCTACTTC	0.592																																					p.R434Q													.	.			0			c.G1301A							C	GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	56.0	65.0	62.0		1301,1253	4.4	1.0	1		62	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	IGSF9	NM_001135050.1,NM_020789.3	43,43	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging,probably-damaging	434/1180,418/1164	159901663	2,13004	2203	4300	6503	SO:0001583	missense	57549	exon11			AGCTCCCGCCCTA	AB037776	CCDS1190.1, CCDS44254.1	1q22-q23	2013-02-11			ENSG00000085552	ENSG00000085552		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	18132	protein-coding gene	gene with protein product		609738				11991715	Standard	NM_020789		Approved	KIAA1355, Nrt1, IGSF9A	uc001fur.2	Q9P2J2	OTTHUMG00000022794	ENST00000368094.1:c.1301G>A	1.37:g.159901663C>T	ENSP00000357073:p.Arg434Gln		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	53	0.06	3	NM_001135050	4	0.00	0		Missense_Mutation	SNP	ENST00000368094.1	37	CCDS44254.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.401258	0.83120	2.27E-4	1.16E-4	ENSG00000085552	ENST00000361509;ENST00000368094;ENST00000198587	T;T	0.77229	-1.08;-1.08	4.41	4.41	0.53225	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.35677	N	0.003043	T	0.69584	0.3127	N	0.25060	0.705	0.40030	D	0.975525	D;P	0.63046	0.992;0.898	P;B	0.59889	0.865;0.432	T	0.70626	-0.4820	9	.	.	.	-16.1096	14.5219	0.67856	0.0:1.0:0.0:0.0	.	434;434	Q9P2J2;C9JI81	TUTLA_HUMAN;.	Q	418;434;434	ENSP00000355049:R418Q;ENSP00000357073:R434Q	.	R	-	2	0	IGSF9	158168287	1.000000	0.71417	0.999000	0.59377	0.549000	0.35272	7.083000	0.76859	2.003000	0.58678	0.561000	0.74099	CGG			0.592	IGSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000059115.1		NM_020789	
ZBTB37	84614	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	173839947	173839947	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr1:173839947G>C	ENST00000367701.5	+	2	775	c.584G>C	c.(583-585)aGc>aCc	p.S195T	ZBTB37_ENST00000367702.1_Missense_Mutation_p.S195T|ZBTB37_ENST00000367704.1_Missense_Mutation_p.S195T|ZBTB37_ENST00000432989.1_Missense_Mutation_p.S195T|ZBTB37_ENST00000427304.1_Missense_Mutation_p.S195T			Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37	195					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(4)	13						GAGTCCACCAGCCCTCAGATC	0.547																																					p.S195T													.	.			0			c.G584C												53.0	54.0	54.0					1																	173839947		2203	4300	6503	SO:0001583	missense	84614	exon3			CCACCAGCCCTCA	AK057310	CCDS1312.1, CCDS44278.1	1q24.2	2013-01-08			ENSG00000185278	ENSG00000185278		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	28365	protein-coding gene	gene with protein product						12477932	Standard	NM_032522		Approved	MGC2629, ZNF908	uc009wwp.1	Q5TC79	OTTHUMG00000037274	ENST00000367701.5:c.584G>C	1.37:g.173839947G>C	ENSP00000356674:p.Ser195Thr		Somatic	139	0	0		WXS	Illumina HiSeq	.	144	0.22	31	NM_032522	5	0.00	0	Q5TC80|Q96M87|Q9BQ88	Missense_Mutation	SNP	ENST00000367701.5	37	CCDS44278.1	.	.	.	.	.	.	.	.	.	.	G	18.59	3.656450	0.67586	.	.	ENSG00000185278	ENST00000367704;ENST00000427304;ENST00000432989;ENST00000367702;ENST00000367703;ENST00000367701	T;T;T;T;T	0.76578	-1.01;2.59;-1.03;-1.03;2.59	5.9	4.99	0.66335	.	0.121406	0.85682	D	0.000000	T	0.56514	0.1990	L	0.29908	0.895	0.80722	D	1	B;P	0.46220	0.155;0.874	B;B	0.44163	0.028;0.443	T	0.58896	-0.7555	10	0.15066	T	0.55	.	15.2229	0.73327	0.0674:0.0:0.9326:0.0	.	195;195	Q5TC79;Q5TC79-2	ZBT37_HUMAN;.	T	195;195;195;195;103;195	ENSP00000356677:S195T;ENSP00000415293:S195T;ENSP00000409408:S195T;ENSP00000356675:S195T;ENSP00000356674:S195T	ENSP00000356674:S195T	S	+	2	0	ZBTB37	172106570	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	8.462000	0.90374	1.499000	0.48617	0.563000	0.77884	AGC			0.547	ZBTB37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000090729.2		NM_032522	
NMNAT2	23057	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	183259297	183259297	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr1:183259297C>T	ENST00000287713.6	-	4	621	c.287G>A	c.(286-288)tGc>tAc	p.C96Y	NMNAT2_ENST00000294868.4_Missense_Mutation_p.C91Y|NMNAT2_ENST00000473046.1_5'UTR	NM_015039.3	NP_055854.1	Q9BZQ4	NMNA2_HUMAN	nicotinamide nucleotide adenylyltransferase 2	96					NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|late endosome (GO:0005770)|synapse (GO:0045202)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|nicotinamide-nucleotide adenylyltransferase activity (GO:0000309)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(7)|skin(2)	18						CAACACGCTGCAGGTCGTCTG	0.562																																					p.C96Y													.	.			0			c.G287A												90.0	74.0	79.0					1																	183259297		2203	4299	6502	SO:0001583	missense	23057	exon4			ACGCTGCAGGTCG	AF288395	CCDS1353.1, CCDS1354.1	1q25	2008-02-05	2003-04-30	2003-05-02	ENSG00000157064	ENSG00000157064			16789	protein-coding gene	gene with protein product		608701	"""chromosome 1 open reading frame 15"""	C1orf15		11318611, 12359228	Standard	NM_015039		Approved	KIAA0479, PNAT2	uc001gqc.2	Q9BZQ4	OTTHUMG00000035519	ENST00000287713.6:c.287G>A	1.37:g.183259297C>T	ENSP00000287713:p.Cys96Tyr		Somatic	138	0	0		WXS	Illumina HiSeq	.	139	0.19	26	NM_015039	14	0.43	6	O75067|Q5T1Q3|Q8WU99|Q96QW1	Missense_Mutation	SNP	ENST00000287713.6	37	CCDS1353.1	.	.	.	.	.	.	.	.	.	.	C	19.32	3.804647	0.70682	.	.	ENSG00000157064	ENST00000287713;ENST00000294868	D;D	0.97232	-4.3;-4.16	5.21	5.21	0.72293	Cytidylyltransferase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.377657	0.36555	N	0.002532	D	0.95655	0.8587	N	0.13098	0.295	0.80722	D	1	B;D	0.59767	0.231;0.986	B;D	0.69654	0.097;0.965	D	0.92152	0.5729	10	0.02654	T	1	-9.7822	18.3635	0.90383	0.0:1.0:0.0:0.0	.	96;91	Q9BZQ4;Q9BZQ4-2	NMNA2_HUMAN;.	Y	96;91	ENSP00000287713:C96Y;ENSP00000294868:C91Y	ENSP00000287713:C96Y	C	-	2	0	NMNAT2	181525920	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.012000	0.76366	2.430000	0.82344	0.563000	0.77884	TGC			0.562	NMNAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000086255.1			
LINC00862	554279	broad.mit.edu	37	1	200342484	200342485	+	lincRNA	INS	-	-	A	rs199879341|rs11430765|rs11369486|rs201922541	byFrequency	TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr1:200342484_200342485insA	ENST00000367355.1	-	0	146					NR_040064.1		A6NCI5	SIM16_HUMAN	long intergenic non-protein coding RNA 862							integral component of membrane (GO:0016021)											ttttgtaaattaaaaaaaaaaa	0.327														2597	0.51857	0.643	0.6023	5008	,	,		14275	0.2431		0.6779	False		,,,				2504	0.411				.													.	.			0			.																																											0	.			GTAAATTAAAAAA	BC040731		1q32.1	2014-04-09	2013-02-22	2013-02-22	ENSG00000203721	ENSG00000203721		"""Long non-coding RNAs"""	21901	other	unknown			"""chromosome 1 open reading frame 98"", ""small integral membrane protein 16"""	C1orf98, SMIM16			Standard	NR_040064		Approved		uc001gvd.1	A6NCI5	OTTHUMG00000035722		1.37:g.200342495_200342495dupA			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	6	0.67	4	.	0		0		RNA	INS	ENST00000367355.1	37																																																																																						0.327	LINC00862-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000086877.1		NR_040064	
DNAH14	127602	broad.mit.edu	37	1	225156548	225156548	+	Intron	SNP	C	C	T	rs374672388		TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr1:225156548C>T	ENST00000445597.2	+	7	1032				DNAH14_ENST00000439375.2_Missense_Mutation_p.R247W|DNAH14_ENST00000430092.1_Missense_Mutation_p.R247W|DNAH14_ENST00000400952.3_Missense_Mutation_p.R247W|DNAH14_ENST00000366849.1_Missense_Mutation_p.R224W			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14						microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						CTATTTATTACGGCAATTCAA	0.338													C|||	1	0.000199681	0.0	0.0	5008	,	,		15975	0.001		0.0	False		,,,				2504	0.0				p.R247W													.	DNAH14	300		0			c.C739T							C	TRP/ARG,TRP/ARG	0,1384		0,0,692	154.0	138.0	143.0		739,739	4.2	0.2	1		143	1,3179		0,1,1589	no	missense,missense	DNAH14	NM_001145154.1,NM_001373.1	101,101	0,1,2281	TT,TC,CC		0.0314,0.0,0.0219	probably-damaging,probably-damaging	247/454,247/4516	225156548	1,4563	692	1590	2282	SO:0001627	intron_variant	127602	exon7			TTATTACGGCAAT	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.1032+1263C>T	1.37:g.225156548C>T			Somatic	297	0	0		WXS	Illumina HiSeq	Phase_I	335	0.02	6	NM_001145154	7	0.00	0	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	ENST00000445597.2	37		.	.	.	.	.	.	.	.	.	.	C	12.84	2.059851	0.36373	0.0	3.14E-4	ENSG00000185842	ENST00000430092;ENST00000400952;ENST00000366849;ENST00000439375	T;T;T;T	0.34859	1.37;1.35;1.34;1.37	5.13	4.2	0.49525	.	0.413516	0.20761	N	0.086174	T	0.34424	0.0897	.	.	.	0.27279	N	0.958148	D;D	0.67145	0.996;0.996	P;P	0.46975	0.533;0.533	T	0.26018	-1.0115	9	0.54805	T	0.06	.	8.8826	0.35384	0.0:0.8987:0.0:0.1013	.	247;247	Q0VDD8-4;Q0VDD8-2	.;.	W	247;247;224;247	ENSP00000414402:R247W;ENSP00000383737:R247W;ENSP00000355814:R224W;ENSP00000392061:R247W	ENSP00000355814:R224W	R	+	1	2	DNAH14	223223171	0.833000	0.29383	0.240000	0.24138	0.345000	0.29048	2.309000	0.43699	2.558000	0.86282	0.511000	0.50034	CGG			0.338	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000331217.3		XM_059166	
HSD17B7P2	158160	broad.mit.edu	37	10	38666842	38666843	+	RNA	INS	-	-	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr10:38666842_38666843insT	ENST00000494540.1	+	0	880					NR_003086.1				hydroxysteroid (17-beta) dehydrogenase 7 pseudogene 2																		TATTGAATGCCTTTTTTTTATA	0.371																																					.													.	.			0			.																																											0	.			GAATGCCTTTTTT			10p11.1	2011-06-29			ENSG00000099251	ENSG00000099251			28120	pseudogene	pseudogene						10544267	Standard	NR_003086		Approved	HSD17B7, bA291L22.1	uc010qex.1		OTTHUMG00000017993		10.37:g.38666850_38666850dupT			Somatic	174	0	0		WXS	Illumina HiSeq	Phase_I	232	0.00	0	.	0		0		RNA	INS	ENST00000494540.1	37																																																																																						0.371	HSD17B7P2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000047631.2		NR_003086	
CYP17A1	1586	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	10	104593813	104593813	+	Nonsense_Mutation	SNP	T	T	A			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr10:104593813T>A	ENST00000369887.3	-	4	904	c.733A>T	c.(733-735)Aaa>Taa	p.K245*	CYP17A1_ENST00000489268.1_5'UTR|CYP17A1-AS1_ENST00000369884.4_RNA	NM_000102.3	NP_000093.1	P05093	CP17A_HUMAN	cytochrome P450, family 17, subfamily A, polypeptide 1	245					adrenal gland development (GO:0030325)|androgen biosynthetic process (GO:0006702)|biphenyl metabolic process (GO:0018879)|cellular response to antibiotic (GO:0071236)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to lipopolysaccharide (GO:0071222)|dibenzo-p-dioxin metabolic process (GO:0018894)|glucocorticoid biosynthetic process (GO:0006704)|hippocampus development (GO:0021766)|hormone biosynthetic process (GO:0042446)|Leydig cell differentiation (GO:0033327)|ovulation (GO:0030728)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|progesterone metabolic process (GO:0042448)|response to acetate (GO:0010034)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to fungicide (GO:0060992)|response to herbicide (GO:0009635)|response to insecticide (GO:0017085)|response to ionizing radiation (GO:0010212)|response to methylmercury (GO:0051597)|response to nutrient levels (GO:0031667)|response to retinoic acid (GO:0032526)|response to steroid hormone (GO:0048545)|sex differentiation (GO:0007548)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	axon (GO:0030424)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)	17-alpha-hydroxyprogesterone aldolase activity (GO:0047442)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|steroid 17-alpha-monooxygenase activity (GO:0004508)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)	Abiraterone(DB05812)|Aminophenazone(DB01424)|Dexamethasone(DB01234)|Metoclopramide(DB01233)|Progesterone(DB00396)	TCAAGTATTTTATTCAGCAGA	0.353																																					p.K245X													.	.			0			c.A733T												130.0	119.0	123.0					10																	104593813		2203	4298	6501	SO:0001587	stop_gained	1586	exon4			GTATTTTATTCAG	M19489	CCDS7541.1	10q24.3	2010-05-04	2003-02-14	2003-02-28	ENSG00000148795	ENSG00000148795	1.14.99.9	"""Cytochrome P450s"""	2593	protein-coding gene	gene with protein product	"""Steroid 17-alpha-monooxygenase"""	609300	"""cytochrome P450, subfamily XVII (steroid 17-alpha-hydroxylase), adrenal hyperplasia"""	CYP17		1347802	Standard	NM_000102		Approved	P450C17, CPT7, S17AH	uc001kwg.3	P05093	OTTHUMG00000018969	ENST00000369887.3:c.733A>T	10.37:g.104593813T>A	ENSP00000358903:p.Lys245*		Somatic	94	0	0		WXS	Illumina HiSeq	.	154	0.23	35	NM_000102	1	1.00	1	Q5TZV7	Nonsense_Mutation	SNP	ENST00000369887.3	37	CCDS7541.1	.	.	.	.	.	.	.	.	.	.	t	15.61	2.885368	0.51908	.	.	ENSG00000148795	ENST00000369887	.	.	.	4.85	-5.29	0.02747	.	1.364190	0.04280	N	0.343772	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.8446	0.29419	0.0:0.4691:0.2131:0.3178	.	.	.	.	X	245	.	ENSP00000358903:K245X	K	-	1	0	CYP17A1	104583803	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.167000	0.09940	-0.938000	0.03714	-0.473000	0.04963	AAA			0.353	CYP17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050101.1		NM_000102	
LUZP2	338645	mdanderson.org	37	11	24998198	24998198	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr11:24998198C>T	ENST00000336930.6	+	8	650	c.584C>T	c.(583-585)gCa>gTa	p.A195V	LUZP2_ENST00000533227.1_Missense_Mutation_p.A109V			Q86TE4	LUZP2_HUMAN	leucine zipper protein 2	195						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(11)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	32						CTGGAGAAAGCAGCTCTTGAC	0.323																																					p.A195V													.	.			0			c.C584T												57.0	61.0	60.0					11																	24998198		2203	4299	6502	SO:0001583	missense	338645	exon8			AGAAAGCAGCTCT	AL832641	CCDS31446.1, CCDS58128.1	11p14.3	2005-09-18			ENSG00000187398	ENSG00000187398			23206	protein-coding gene	gene with protein product		608178				12856284	Standard	NM_001009909		Approved		uc001mqs.3	Q86TE4	OTTHUMG00000166109	ENST00000336930.6:c.584C>T	11.37:g.24998198C>T	ENSP00000336817:p.Ala195Val		Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_001009909	0		0	A2RUB8|E9PN53|Q6UXE7|Q6ZS65	Missense_Mutation	SNP	ENST00000336930.6	37	CCDS31446.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.286397	0.80803	.	.	ENSG00000187398	ENST00000336930;ENST00000529015;ENST00000533227	T;T;T	0.26373	1.74;1.74;1.74	5.15	5.15	0.70609	.	0.063755	0.64402	D	0.000009	T	0.41305	0.1153	L	0.34521	1.04	0.41654	D	0.98914	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.996	T	0.24905	-1.0147	10	0.56958	D	0.05	-15.974	16.4555	0.84011	0.0:1.0:0.0:0.0	.	109;195	E9PN53;Q86TE4	.;LUZP2_HUMAN	V	195;153;109	ENSP00000336817:A195V;ENSP00000437032:A153V;ENSP00000432952:A109V	ENSP00000336817:A195V	A	+	2	0	LUZP2	24954774	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.756000	0.68757	2.540000	0.85666	0.650000	0.86243	GCA			0.323	LUZP2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387861.1		NM_001009909	
OR5J2	282775	broad.mit.edu;ucsc.edu	37	11	55944605	55944605	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr11:55944605T>C	ENST00000312298.1	+	1	512	c.512T>C	c.(511-513)cTa>cCa	p.L171P		NM_001005492.1	NP_001005492.1	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J, member 2	171						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	44	Esophageal squamous(21;0.00693)					TTTTGTAGGCTAAATGCTGTC	0.438																																					p.L171P													OR5J2,right_upper_lobe,carcinoma,+1,1	OR5J2	98	1	0			c.T512C												168.0	145.0	153.0					11																	55944605		2201	4296	6497	SO:0001583	missense	282775	exon1			GTAGGCTAAATGC	AB065595	CCDS31522.1	11q11	2012-08-09			ENSG00000174957	ENSG00000174957		"""GPCR / Class A : Olfactory receptors"""	19612	protein-coding gene	gene with protein product							Standard	NM_001005492		Approved		uc010rjb.2	Q8NH18	OTTHUMG00000166835	ENST00000312298.1:c.512T>C	11.37:g.55944605T>C	ENSP00000310788:p.Leu171Pro		Somatic	153	0.0130718954	2		WXS	Illumina HiSeq	Phase_I	141	0.13	19	NM_001005492	0		0	Q6IEU5	Missense_Mutation	SNP	ENST00000312298.1	37	CCDS31522.1	.	.	.	.	.	.	.	.	.	.	T	3.010	-0.204166	0.06180	.	.	ENSG00000174957	ENST00000312298	T	0.35789	1.29	4.73	-2.95	0.05564	GPCR, rhodopsin-like superfamily (1);	0.603575	0.15120	N	0.279458	T	0.05777	0.0151	N	0.00060	-2.34	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.43343	-0.9397	10	0.28530	T	0.3	.	6.2849	0.21027	0.1146:0.4209:0.0:0.4645	.	171	Q8NH18	OR5J2_HUMAN	P	171	ENSP00000310788:L171P	ENSP00000310788:L171P	L	+	2	0	OR5J2	55701181	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.153000	0.16323	-0.811000	0.04369	-1.359000	0.01217	CTA			0.438	OR5J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000391544.1		NM_001005492	
MYRF	745	mdanderson.org	37	11	61537733	61537733	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr11:61537733G>T	ENST00000278836.5	+	5	572	c.476G>T	c.(475-477)cGc>cTc	p.R159L	MYRF_ENST00000265460.5_Missense_Mutation_p.R150L|TMEM258_ENST00000535042.1_Intron	NM_001127392.1	NP_001120864.1	Q9Y2G1	MRF_HUMAN	myelin regulatory factor	159	Pro-rich.				central nervous system myelin maintenance (GO:0032286)|central nervous system myelination (GO:0022010)|oligodendrocyte development (GO:0014003)|oligodendrocyte differentiation (GO:0048709)|positive regulation of myelination (GO:0031643)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)										CACCTCCTGCGCACGATAACC	0.682																																					p.R159L													.	.			0			c.G476T												23.0	21.0	22.0					11																	61537733		2199	4299	6498	SO:0001583	missense	745	exon5			TCCTGCGCACGAT		CCDS31579.1, CCDS44622.1	11q12-q13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000124920	ENSG00000124920			1181	protein-coding gene	gene with protein product	"""myelin gene regulatory factor"""	608329	"""chromosome 11 open reading frame 9"""	C11orf9		10828591, 12384578	Standard	NM_001127392		Approved	Ndt80, pqn-47, MRF	uc001nsc.1	Q9Y2G1	OTTHUMG00000168161	ENST00000278836.5:c.476G>T	11.37:g.61537733G>T	ENSP00000278836:p.Arg159Leu		Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	62	0.05	3	NM_001127392	0		0	O43582|Q9P1Q6	Missense_Mutation	SNP	ENST00000278836.5	37	CCDS44622.1	.	.	.	.	.	.	.	.	.	.	G	17.71	3.456801	0.63401	.	.	ENSG00000124920	ENST00000278836;ENST00000265460	T;T	0.46819	0.86;0.87	4.55	4.55	0.56014	.	0.000000	0.85682	D	0.000000	T	0.57080	0.2029	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.81914	0.992;0.995	T	0.54084	-0.8346	10	0.30854	T	0.27	-37.2977	18.2123	0.89874	0.0:0.0:1.0:0.0	.	150;159	Q9Y2G1-2;Q9Y2G1	.;MRF_HUMAN	L	159;150	ENSP00000278836:R159L;ENSP00000265460:R150L	ENSP00000265460:R150L	R	+	2	0	C11orf9	61294309	1.000000	0.71417	1.000000	0.80357	0.483000	0.33249	8.528000	0.90598	2.469000	0.83416	0.549000	0.68633	CGC			0.682	MYRF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000398519.2		NM_013279	
NPAS4	266743	mdanderson.org	37	11	66188671	66188671	+	Silent	SNP	C	C	A			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr11:66188671C>A	ENST00000311034.2	+	1	197	c.21C>A	c.(19-21)ggC>ggA	p.G7G		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	7	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)	p.G7G(1)		breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						CCACCAAGGGCGCCTCCAAGG	0.711																																					p.G7G													NPAS4,NS,carcinoma,0,1	NPAS4	0	1	1	Substitution - coding silent(1)	prostate(1)	c.C21A												24.0	22.0	23.0					11																	66188671		2197	4295	6492	SO:0001819	synonymous_variant	266743	exon1			CAAGGGCGCCTCC	AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.21C>A	11.37:g.66188671C>A			Somatic	106	0.0754716981	8		WXS	Illumina HiSeq	Phase_I	137	0.14	19	NM_178864	0		0	B7ZL81|Q8N8S5|Q8N9Q9	Silent	SNP	ENST00000311034.2	37	CCDS8138.1																																																																																					0.711	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000392634.1		NM_178864	
FADD	8772	mdanderson.org	37	11	70049843	70049843	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr11:70049843G>T	ENST00000301838.4	+	1	575	c.278G>T	c.(277-279)gGg>gTg	p.G93V	RP11-805J14.5_ENST00000527232.1_RNA|RP11-805J14.5_ENST00000526174.1_RNA	NM_003824.3	NP_003815.1	Q13158	FADD_HUMAN	Fas (TNFRSF6)-associated via death domain	93					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|lymph node development (GO:0048535)|motor neuron apoptotic process (GO:0097049)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of activation-induced cell death of T cells (GO:0070236)|negative regulation of necroptotic process (GO:0060546)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of apoptotic process (GO:0043065)|positive regulation of CD8-positive, alpha-beta cytotoxic T cell extravasation (GO:2000454)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of proteolysis (GO:0045862)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|protein heterooligomerization (GO:0051291)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|ripoptosome (GO:0097342)	death effector domain binding (GO:0035877)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|tumor necrosis factor receptor superfamily binding (GO:0032813)			endometrium(1)|lung(4)|ovary(1)|pancreas(1)|urinary_tract(2)	9	Esophageal squamous(2;1.19e-45)		LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			gccgcgcctggggaagaaggt	0.791																																					p.G93V													.	.			0			c.G278T												4.0	5.0	5.0					11																	70049843		891	2003	2894	SO:0001583	missense	8772	exon1			CGCCTGGGGAAGA	U24231	CCDS8196.1	11q13.3	2014-09-17			ENSG00000168040	ENSG00000168040			3573	protein-coding gene	gene with protein product	"""Fas-associating protein with death domain"", ""Fas-associating death domain-containing protein"", ""mediator of receptor-induced toxicity"", ""growth-inhibiting gene 3 protein"""	602457				7536190, 7538907	Standard	NM_003824		Approved	MORT1, GIG3	uc001opm.2	Q13158	OTTHUMG00000167264	ENST00000301838.4:c.278G>T	11.37:g.70049843G>T	ENSP00000301838:p.Gly93Val		Somatic	17	0	0		WXS	Illumina HiSeq	Phase_I	16	0.13	2	NM_003824	53	0.00	0	Q14866|Q6IBR4	Missense_Mutation	SNP	ENST00000301838.4	37	CCDS8196.1	.	.	.	.	.	.	.	.	.	.	G	12.49	1.954503	0.34471	.	.	ENSG00000168040	ENST00000301838	D	0.82344	-1.6	3.62	-5.36	0.02689	Death (1);DEATH-like (2);	2.205680	0.01595	N	0.021778	T	0.74015	0.3661	L	0.48642	1.525	0.21984	N	0.999436	B	0.22003	0.063	B	0.12837	0.008	T	0.55398	-0.8147	10	0.30078	T	0.28	-7.7083	5.3597	0.16081	0.4533:0.2618:0.2849:0.0	.	93	Q13158	FADD_HUMAN	V	93	ENSP00000301838:G93V	ENSP00000301838:G93V	G	+	2	0	FADD	69727491	0.000000	0.05858	0.000000	0.03702	0.073000	0.16967	-2.076000	0.01373	-0.923000	0.03785	0.491000	0.48974	GGG			0.791	FADD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393902.1		NM_003824	
KRTAP5-7	440050	mdanderson.org	37	11	71238639	71238639	+	Missense_Mutation	SNP	A	A	G	rs199903176	byFrequency	TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr11:71238639A>G	ENST00000398536.4	+	1	327	c.293A>G	c.(292-294)tAt>tGt	p.Y98C		NM_001012503.1	NP_001012521.1	Q6L8G8	KRA57_HUMAN	keratin associated protein 5-7	98	7 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				breast(1)|endometrium(1)|kidney(3)|lung(6)|ovary(1)	12						tgcagctgctataagccctgc	0.642																																					p.Y98C													.	.			0			c.A293G												67.0	88.0	81.0					11																	71238639		2199	4293	6492	SO:0001583	missense	440050	exon1			GCTGCTATAAGCC	AB126076	CCDS41682.1	11q13.4	2008-02-05			ENSG00000244411	ENSG00000244411		"""Keratin associated proteins"""	23602	protein-coding gene	gene with protein product						15144888	Standard	NM_001012503		Approved	KRTAP5.7, KRTAP5-3	uc001oqq.1	Q6L8G8	OTTHUMG00000057570	ENST00000398536.4:c.293A>G	11.37:g.71238639A>G	ENSP00000417330:p.Tyr98Cys		Somatic	116	0.0086206897	1		WXS	Illumina HiSeq	Phase_I	113	0.07	8	NM_001012503	0		0	B2RNM3|Q701N5	Missense_Mutation	SNP	ENST00000398536.4	37	CCDS41682.1	.	.	.	.	.	.	.	.	.	.	N	3.606	-0.080537	0.07141	.	.	ENSG00000244411	ENST00000398536	T	0.01240	5.12	1.15	0.173	0.15036	.	.	.	.	.	T	0.00271	0.0008	N	0.00003	-3.455	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.49588	-0.8924	9	0.34782	T	0.22	.	3.866	0.09016	0.466:0.0:0.534:0.0	.	98	Q6L8G8	KRA57_HUMAN	C	98	ENSP00000417330:Y98C	ENSP00000417330:Y98C	Y	+	2	0	KRTAP5-7	70916287	0.370000	0.25047	0.304000	0.25085	0.015000	0.08874	1.681000	0.37618	0.082000	0.17018	-0.813000	0.03139	TAT	0.005		0.642	KRTAP5-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000127953.1			
ARHGEF17	9828	mdanderson.org	37	11	73073275	73073275	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr11:73073275G>A	ENST00000263674.3	+	13	5035	c.4685G>A	c.(4684-4686)cGc>cAc	p.R1562H		NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	1562					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						CTGCAGCCTCGCTGCCACCGG	0.751																																					p.R1562H													.	.			0			c.G4685A												6.0	6.0	6.0					11																	73073275		1988	3842	5830	SO:0001583	missense	9828	exon13			AGCCTCGCTGCCA	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.4685G>A	11.37:g.73073275G>A	ENSP00000263674:p.Arg1562His		Somatic	19	0	0		WXS	Illumina HiSeq	Phase_I	20	0.10	2	NM_014786	8	0.00	0	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	ENST00000263674.3	37	CCDS8221.1	.	.	.	.	.	.	.	.	.	.	G	15.63	2.890986	0.52014	.	.	ENSG00000110237	ENST00000263674	T	0.58652	0.32	5.21	0.0954	0.14485	.	1.458560	0.03810	N	0.265812	T	0.43809	0.1264	N	0.22421	0.69	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.35798	-0.9774	10	0.66056	D	0.02	-0.1195	6.0987	0.20035	0.4662:0.1391:0.3947:0.0	.	1562	Q96PE2	ARHGH_HUMAN	H	1562	ENSP00000263674:R1562H	ENSP00000263674:R1562H	R	+	2	0	ARHGEF17	72750923	0.993000	0.37304	0.000000	0.03702	0.144000	0.21451	0.923000	0.28757	-0.165000	0.10908	-0.140000	0.14226	CGC			0.751	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000397365.1		NM_014786	
WNK1	65125	broad.mit.edu	37	12	1017711	1017711	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr12:1017711G>T	ENST00000315939.6	+	28	7545	c.6902G>T	c.(6901-6903)gGc>gTc	p.G2301V	WNK1_ENST00000340908.4_Missense_Mutation_p.G1894V|WNK1_ENST00000535572.1_Missense_Mutation_p.G2053V|WNK1_ENST00000537687.1_Missense_Mutation_p.G2561V|WNK1_ENST00000530271.2_Missense_Mutation_p.G2799V	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	2301					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			AACCTGGGTGGCTCTGCCCCC	0.552																																					p.G2561V	Colon(19;451 567 6672 12618 28860)												.	WNK1	403		0			c.G7682T												95.0	81.0	86.0					12																	1017711		2203	4300	6503	SO:0001583	missense	65125	exon28			TGGGTGGCTCTGC	AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.6902G>T	12.37:g.1017711G>T	ENSP00000313059:p.Gly2301Val		Somatic	222	0.0225225225	5		WXS	Illumina HiSeq	Phase_I	406	0.03	11	NM_001184985	258	0.00	0	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Missense_Mutation	SNP	ENST00000315939.6	37	CCDS8506.1	.	.	.	.	.	.	.	.	.	.	G	15.52	2.857001	0.51376	.	.	ENSG00000060237	ENST00000535572;ENST00000315939;ENST00000537687;ENST00000252477;ENST00000530271;ENST00000537501;ENST00000340908	D;D;D;D;T	0.82984	-1.63;-1.63;-1.56;-1.67;-0.45	5.46	5.46	0.80206	.	0.000000	0.53938	D	0.000043	D	0.89791	0.6817	M	0.63843	1.955	0.80722	D	1	D;D;D	0.63046	0.992;0.992;0.986	D;P;P	0.68039	0.955;0.9;0.796	D	0.88903	0.3354	10	0.49607	T	0.09	-4.5688	19.4909	0.95049	0.0:0.0:1.0:0.0	.	2054;2053;2301	Q9H4A3-2;F5GWT4;Q9H4A3	.;.;WNK1_HUMAN	V	2053;2301;2561;1474;2799;243;1894	ENSP00000441972:G2053V;ENSP00000313059:G2301V;ENSP00000444465:G2561V;ENSP00000433548:G2799V;ENSP00000341292:G1894V	ENSP00000252477:G1474V	G	+	2	0	WNK1	887972	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.271000	0.65553	2.847000	0.97988	0.591000	0.81541	GGC			0.552	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206683.1		NM_018979	
MUC19	283463	broad.mit.edu;bcgsc.ca	37	12	40827571	40827572	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr12:40827571_40827572delTG	ENST00000454784.4	+	18	1835_1836	c.1102_1103delTG	c.(1102-1104)tgtfs	p.C368fs	RP11-115F18.1_ENST00000552757.1_RNA			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric	368	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						CACAGGACTCTGTGGTTCCTAC	0.416																																					.													.	.			0			.																																									SO:0001589	frameshift_variant	283463	.			GGACTCTGTGGTT	AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.1102_1103delTG	12.37:g.40827573_40827574delTG	ENSP00000476404:p.Cys368fs		Somatic	107	0	0		WXS	Illumina HiSeq	Phase_I	126	0.18	23	.	0		0	Q8NA85	Frame_Shift_Del	DEL	ENST00000454784.4	37																																																																																						0.416	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000384257.6		XM_003403524	
GPD1	2819	bcgsc.ca	37	12	50501424	50501424	+	Silent	SNP	G	G	A			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr12:50501424G>A	ENST00000301149.3	+	6	919	c.687G>A	c.(685-687)cgG>cgA	p.R229R	GPD1_ENST00000548814.1_Silent_p.R206R|GPD1_ENST00000547190.1_Intron	NM_001257199.1|NM_005276.3	NP_001244128.1|NP_005267.2	P21695	GPDA_HUMAN	glycerol-3-phosphate dehydrogenase 1 (soluble)	229					cellular lipid metabolic process (GO:0044255)|cellular response to cAMP (GO:0071320)|cellular response to tumor necrosis factor (GO:0071356)|gluconeogenesis (GO:0006094)|glycerol-3-phosphate catabolic process (GO:0046168)|glycerophosphate shuttle (GO:0006127)|glycerophospholipid biosynthetic process (GO:0046474)|NADH oxidation (GO:0006116)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of glycolytic process (GO:0045821)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycerol-3-phosphate dehydrogenase complex (GO:0009331)|mitochondrion (GO:0005739)	glycerol-3-phosphate dehydrogenase [NAD+] activity (GO:0004367)|glycerol-3-phosphate dehydrogenase activity (GO:0004368)|NAD binding (GO:0051287)	p.R229R(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8						CAGTGATCCGGCTGGGACTCA	0.577																																					p.R229R	NSCLC(141;1402 1905 9497 13391 44868)												GPD1,NS,carcinoma,0,1	GPD1	23	1	1	Substitution - coding silent(1)	endometrium(1)	c.G687A												155.0	144.0	148.0					12																	50501424		2203	4300	6503	SO:0001819	synonymous_variant	2819	exon6			GATCCGGCTGGGA		CCDS8799.1, CCDS58229.1	12q13.12	2013-09-20			ENSG00000167588	ENSG00000167588	1.1.1.8		4455	protein-coding gene	gene with protein product		138420					Standard	NM_005276		Approved		uc001rvz.4	P21695	OTTHUMG00000169813	ENST00000301149.3:c.687G>A	12.37:g.50501424G>A			Somatic	92	0	0		WXS	Illumina HiSeq	Phase_1	130	0.05	6	NM_005276	2	0.00	0	F8W1L5|Q8N1B0	Silent	SNP	ENST00000301149.3	37	CCDS8799.1																																																																																					0.577	GPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000406018.1			
MUCL1	118430	mdanderson.org	37	12	55250643	55250643	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr12:55250643G>A	ENST00000308796.6	+	3	236	c.190G>A	c.(190-192)Gct>Act	p.A64T	MUCL1_ENST00000547990.1_3'UTR|MUCL1_ENST00000546809.1_Missense_Mutation_p.A59T	NM_058173.2	NP_477521.1	Q96DR8	MUCL1_HUMAN	mucin-like 1	64	3 X 8 AA tandem repeat of T-T-A-A-[APS]- T-T-A.|Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|membrane (GO:0016020)				breast(1)|kidney(1)|lung(1)	3						tgcaaccaccgctgcttctac	0.507																																					p.A64T													.	.			0			c.G190A												155.0	132.0	139.0					12																	55250643		2203	4300	6503	SO:0001583	missense	118430	exon3			ACCACCGCTGCTT	AF414087	CCDS8885.1	12q13.2	2007-07-02							30588	protein-coding gene	gene with protein product	"""small breast epithelial mucin"""	610857				12019145	Standard	NM_058173		Approved	SBEM	uc001sgk.3	Q96DR8		ENST00000308796.6:c.190G>A	12.37:g.55250643G>A	ENSP00000311364:p.Ala64Thr		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	85	0.05	4	NM_058173	1	0.00	0	Q0VG95|Q32ZB5	Missense_Mutation	SNP	ENST00000308796.6	37	CCDS8885.1	.	.	.	.	.	.	.	.	.	.	G	3.942	-0.014051	0.07681	.	.	ENSG00000172551	ENST00000546809;ENST00000308796	.	.	.	2.54	-5.09	0.02920	.	0.585900	0.09776	N	0.757264	T	0.24084	0.0583	.	.	.	0.09310	N	1	B	0.19706	0.038	B	0.06405	0.002	T	0.15009	-1.0452	8	0.87932	D	0	.	2.2565	0.04056	0.5238:0.1373:0.2001:0.1388	.	64	Q96DR8	MUCL1_HUMAN	T	59;64	.	ENSP00000311364:A64T	A	+	1	0	MUCL1	53536910	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-2.725000	0.00808	-2.157000	0.00789	-0.657000	0.03884	GCT			0.507	MUCL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000406062.1		NM_058173	
ATP2B1	490	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	90018056	90018056	+	Silent	SNP	A	A	G			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr12:90018056A>G	ENST00000428670.3	-	9	1704	c.1248T>C	c.(1246-1248)ttT>ttC	p.F416F	ATP2B1_ENST00000261173.2_Silent_p.F416F|ATP2B1_ENST00000393164.2_Silent_p.F159F|ATP2B1_ENST00000348959.3_Silent_p.F416F|ATP2B1_ENST00000359142.3_Silent_p.F416F			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	416					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						AGAACTTCACAAAGTATTGTA	0.388																																					p.F416F													ATP2B1_ENST00000359142,NS,carcinoma,-1,2	ATP2B1_ENST00000359142	-1	2	0			c.T1248C												81.0	75.0	77.0					12																	90018056		2203	4300	6503	SO:0001819	synonymous_variant	490	exon8			CTTCACAAAGTAT	J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.1248T>C	12.37:g.90018056A>G			Somatic	205	0	0		WXS	Illumina HiSeq	.	247	0.12	30	NM_001001323	18	0.33	6	Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Silent	SNP	ENST00000428670.3	37	CCDS9035.1																																																																																					0.388	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000406653.1		NM_001682	
PWP1	11137	mdanderson.org	37	12	108105950	108105950	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr12:108105950A>T	ENST00000412830.3	+	15	1627	c.1459A>T	c.(1459-1461)Agt>Tgt	p.S487C	PWP1_ENST00000541166.1_Missense_Mutation_p.S425C	NM_007062.1	NP_008993.1	Q13610	PWP1_HUMAN	PWP1 homolog (S. cerevisiae)	487					transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(3)|endometrium(4)|kidney(1)|large_intestine(8)|lung(6)|urinary_tract(1)	23						TTCATCTATTAGTGGCCCTTT	0.383																																					p.S487C													.	.			0			c.A1459T												139.0	132.0	134.0					12																	108105950		2203	4300	6503	SO:0001583	missense	11137	exon15			TCTATTAGTGGCC	BC000067	CCDS9114.1	12q23.3	2013-06-10				ENSG00000136045		"""WD repeat domain containing"""	17015	protein-coding gene	gene with protein product	"""endonuclein"""					7828893, 11850830	Standard	NM_007062		Approved	IEF-SSP-9502	uc001tmo.1	Q13610	OTTHUMG00000169913	ENST00000412830.3:c.1459A>T	12.37:g.108105950A>T	ENSP00000387365:p.Ser487Cys		Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	98	0.05	5	NM_007062	586	0.00	0	A8K3R6|Q7Z3X9	Missense_Mutation	SNP	ENST00000412830.3	37	CCDS9114.1	.	.	.	.	.	.	.	.	.	.	A	5.978	0.364355	0.11296	.	.	ENSG00000136045	ENST00000412830;ENST00000541166	T;T	0.71461	-0.54;-0.57	5.86	3.5	0.40072	.	0.521299	0.24436	N	0.038549	T	0.54224	0.1845	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47209	-0.9135	10	0.52906	T	0.07	.	2.8099	0.05439	0.5582:0.1271:0.0699:0.2448	.	487	Q13610	PWP1_HUMAN	C	487;425	ENSP00000387365:S487C;ENSP00000445249:S425C	ENSP00000387365:S487C	S	+	1	0	PWP1	106630080	0.009000	0.17119	0.010000	0.14722	0.053000	0.15095	1.029000	0.30140	1.133000	0.42147	0.528000	0.53228	AGT			0.383	PWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000406539.1		NM_007062	
CLIP1	6249	broad.mit.edu	37	12	122812693	122812694	+	Frame_Shift_Ins	INS	-	-	T	rs77289752	byFrequency	TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr12:122812693_122812694insT	ENST00000540338.1	-	16	3090_3091	c.3049_3050insA	c.(3049-3051)acafs	p.T1017fs	CLIP1_ENST00000545889.1_Frame_Shift_Ins_p.T592fs|CLIP1_ENST00000361654.4_Frame_Shift_Ins_p.T895fs|CLIP1_ENST00000358808.2_Frame_Shift_Ins_p.T1006fs|CLIP1_ENST00000537178.1_Frame_Shift_Ins_p.T971fs|CLIP1_ENST00000302528.7_Frame_Shift_Ins_p.T1006fs			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	1017					microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		GTTGTGGCTTGTTTCCATTTTC	0.505																																					p.T1017fs													.	CLIP1	126		0			c.3050_3051insA																																									SO:0001589	frameshift_variant	6249	exon17			TGGCTTGTTTCCA		CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.3050dupA	12.37:g.122812696_122812696dupT	ENSP00000439093:p.Thr1017fs		Somatic	157	0	0		WXS	Illumina HiSeq	Phase_I	233	0.03	8	NM_001247997	200	0.00	0	A0AVD3|Q17RS4|Q29RG0	Frame_Shift_Ins	INS	ENST00000540338.1	37	CCDS58285.1																																																																																					0.505	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000401625.1		NM_002956	
DPPA3P2	400206	broad.mit.edu	37	14	36840945	36840945	+	RNA	SNP	G	G	A	rs539308132		TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr14:36840945G>A	ENST00000557188.1	+	0	576									developmental pluripotency associated 3 pseudogene 2																		GAGTTCGTACGCATGAAAGAA	0.458																																					.													ENSG00000188831,NS,carcinoma,0,1	.		1	0			.																																											0	.			TCGTACGCATGAA			14q13.3	2012-07-04			ENSG00000188831	ENSG00000188831			20417	pseudogene	pseudogene							Standard	NG_023379		Approved	STELLAR			OTTHUMG00000170728		14.37:g.36840945G>A			Somatic	284	0	0		WXS	Illumina HiSeq	Phase_I	239	0.02	4	.	1223	0.00	0		RNA	SNP	ENST00000557188.1	37																																																																																						0.458	DPPA3P2-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000410122.1			
Unknown	0	bcgsc.ca	37	14	65066984	65066984	+	IGR	SNP	T	T	C			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr14:65066984T>C								RP11-973N13.3 (3730 upstream) : PLEKHG3 (104169 downstream)																							TCCAGTAAAATTTTGTGCAAC	0.473																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GTAAAATTTTGTG																													14.37:g.65066984T>C			Somatic	212	0	0		WXS	Illumina HiSeq	Phase_1	214	0.20	42	.	24	0.00	0		RNA	SNP		37																																																																																					0	0.473										
TTC7B	145567	mdanderson.org	37	14	91044550	91044550	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr14:91044550C>T	ENST00000328459.6	-	19	2331	c.2210G>A	c.(2209-2211)gGc>gAc	p.G737D	TTC7B_ENST00000554654.1_5'UTR|TTC7B_ENST00000357056.2_Missense_Mutation_p.G754D	NM_001010854.1	NP_001010854.1	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B	737										NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	36		Melanoma(154;0.222)				AGCAATCTGGCCGCGCATGTA	0.592																																					p.G737D													.	.			0			c.G2210A												112.0	93.0	99.0					14																	91044550		2203	4300	6503	SO:0001583	missense	145567	exon19			ATCTGGCCGCGCA	BC035865	CCDS32140.1	14q32.12	2013-01-11	2004-06-02	2004-06-04		ENSG00000165914		"""Tetratricopeptide (TTC) repeat domain containing"""	19858	protein-coding gene	gene with protein product			"""tetratricopeptide repeat domain 7 like 1"""	TTC7L1			Standard	XM_005267367		Approved		uc001xyp.3	Q86TV6		ENST00000328459.6:c.2210G>A	14.37:g.91044550C>T	ENSP00000336127:p.Gly737Asp		Somatic	143	0	0		WXS	Illumina HiSeq	Phase_I	125	0.04	5	NM_001010854	50	0.00	0	Q86U24|Q86VT3	Missense_Mutation	SNP	ENST00000328459.6	37	CCDS32140.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.393020	0.83011	.	.	ENSG00000165914	ENST00000555768;ENST00000357056;ENST00000328459;ENST00000553972	T;T;T	0.66995	-0.24;-0.24;-0.24	5.48	4.57	0.56435	Protein prenyltransferase (1);Tetratricopeptide repeat-containing (1);	0.055136	0.64402	D	0.000001	D	0.85423	0.5693	M	0.92219	3.285	0.80722	D	1	D;D	0.69078	0.997;0.989	D;P	0.70016	0.967;0.787	D	0.89457	0.3734	10	0.87932	D	0	-11.0376	16.1412	0.81522	0.0:0.8663:0.1337:0.0	.	737;754	Q86TV6;Q86TV6-2	TTC7B_HUMAN;.	D	635;754;737;224	ENSP00000349564:G754D;ENSP00000336127:G737D;ENSP00000451440:G224D	ENSP00000336127:G737D	G	-	2	0	TTC7B	90114303	1.000000	0.71417	0.997000	0.53966	0.482000	0.33219	7.751000	0.85126	1.273000	0.44346	0.655000	0.94253	GGC			0.592	TTC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000411364.2			
GOLGA6L1	283767	mdanderson.org	37	15	22743174	22743174	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr15:22743174G>A	ENST00000560659.2	+	8	1409	c.1409G>A	c.(1408-1410)aGg>aAg	p.R470K	GOLGA6L1_ENST00000316397.3_Missense_Mutation_p.R520K			Q8N7Z2	GG6L1_HUMAN	golgin A6 family-like 1	514										NS(1)|breast(2)|endometrium(5)|large_intestine(1)|lung(1)|skin(1)	11						aagatgtggaggcaggaggag	0.547																																					p.R520K													.	.			0			c.G1559A												3.0	2.0	3.0					15																	22743174		912	1338	2250	SO:0001583	missense	283767	exon8			TGTGGAGGCAGGA	AK097517	CCDS73699.1	15q11.2	2012-10-05	2010-02-12		ENSG00000197414	ENSG00000277865			37444	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 1"""				Standard	NM_001001413		Approved		uc010tzx.1	Q8N7Z2	OTTHUMG00000171883	ENST00000560659.2:c.1409G>A	15.37:g.22743174G>A	ENSP00000452626:p.Arg470Lys		Somatic	112	0	0		WXS	Illumina HiSeq	Phase_I	83	0.08	7	NM_001001413	0		0		Missense_Mutation	SNP	ENST00000560659.2	37		.	.	.	.	.	.	.	.	.	.	.	0.722	-0.783311	0.02907	.	.	ENSG00000197414	ENST00000316397;ENST00000355145	T	0.09817	2.94	.	.	.	.	.	.	.	.	T	0.05364	0.0142	L	0.27053	0.805	0.09310	N	1	.	.	.	.	.	.	T	0.42327	-0.9458	5	0.02654	T	1	.	.	.	.	.	.	.	.	K	520	ENSP00000320207:R520K	ENSP00000320207:R520K	R	+	2	0	GOLGA6L1	20294538	0.737000	0.28175	0.321000	0.25320	0.325000	0.28411	-0.189000	0.09629	0.149000	0.19098	0.152000	0.16155	AGG			0.547	GOLGA6L1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000415616.2		NM_001001413	
C2CD4B	388125	mdanderson.org	37	15	62457154	62457154	+	Silent	SNP	C	C	A			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr15:62457154C>A	ENST00000380392.3	-	2	158	c.30G>T	c.(28-30)tcG>tcT	p.S10S		NM_001007595.2	NP_001007596.2	A6NLJ0	C2C4B_HUMAN	C2 calcium-dependent domain containing 4B	10						focal adhesion (GO:0005925)|nucleolus (GO:0005730)				skin(1)	1						TGCCTGCGGCCGAGGAACAGA	0.677																																					p.S10S													.	.			0			c.G30T												3.0	4.0	4.0					15																	62457154		1913	3822	5735	SO:0001819	synonymous_variant	388125	exon2			TGCGGCCGAGGAA	BM023530	CCDS32259.1	15q22.2	2009-09-28	2009-09-28	2009-09-28					33628	protein-coding gene	gene with protein product	"""nuclear localized factor 2"""	610344	"""family with sequence similarity 148, member B"""	FAM148B			Standard	NM_001007595		Approved	NLF2	uc002ahg.2	A6NLJ0		ENST00000380392.3:c.30G>T	15.37:g.62457154C>A			Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	25	0.08	2	NM_001007595	3	0.00	0		Silent	SNP	ENST00000380392.3	37	CCDS32259.1																																																																																					0.677	C2CD4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000416117.1		NM_001007595	
RBPMS2	348093	mdanderson.org	37	15	65043817	65043817	+	Silent	SNP	G	G	A	rs372396252		TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr15:65043817G>A	ENST00000300069.4	-	2	375	c.108C>T	c.(106-108)agC>agT	p.S36S	RBPMS2_ENST00000560606.1_5'UTR	NM_194272.1	NP_919248.1	Q6ZRY4	RBPS2_HUMAN	RNA binding protein with multiple splicing 2	36	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)			breast(1)|large_intestine(3)|lung(3)|prostate(1)	8						CAGGGAGGCCGCTGACAAACA	0.607																																					p.S36S													.	.			0			c.C108T							G		0,4404		0,0,2202	65.0	66.0	65.0		108	1.3	1.0	15		65	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	RBPMS2	NM_194272.1		0,1,6500	AA,AG,GG		0.0116,0.0,0.0077		36/210	65043817	1,13001	2202	4299	6501	SO:0001819	synonymous_variant	348093	exon2			GAGGCCGCTGACA	AY369207	CCDS32271.1	15q22.31	2014-05-15			ENSG00000166831	ENSG00000166831		"""RNA binding motif (RRM) containing"""	19098	protein-coding gene	gene with protein product							Standard	NM_194272		Approved		uc002anq.3	Q6ZRY4	OTTHUMG00000172423	ENST00000300069.4:c.108C>T	15.37:g.65043817G>A			Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	48	0.08	4	NM_194272	160	0.00	0	A2RRG0	Silent	SNP	ENST00000300069.4	37	CCDS32271.1																																																																																					0.607	RBPMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000418466.1			
IQGAP1	8826	mdanderson.org	37	15	91035814	91035814	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr15:91035814A>G	ENST00000268182.5	+	35	4623	c.4499A>G	c.(4498-4500)aAg>aGg	p.K1500R	IQGAP1_ENST00000560738.1_Missense_Mutation_p.K928R	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	1500	C2.				cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			CAGAGGAGAAAGGCCGAACTA	0.398																																					p.K1500R													.	.			0			c.A4499G												97.0	90.0	93.0					15																	91035814		2198	4298	6496	SO:0001583	missense	8826	exon35			GGAGAAAGGCCGA	D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.4499A>G	15.37:g.91035814A>G	ENSP00000268182:p.Lys1500Arg		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_003870	321	0.00	0	A7MBM3	Missense_Mutation	SNP	ENST00000268182.5	37	CCDS10362.1	.	.	.	.	.	.	.	.	.	.	A	25.8	4.672292	0.88348	.	.	ENSG00000140575	ENST00000268182	T	0.44482	0.92	6.07	6.07	0.98685	RasGAP protein, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.43919	0.1269	L	0.31752	0.955	0.80722	D	1	P;P	0.37141	0.584;0.584	B;P	0.47134	0.364;0.539	T	0.27536	-1.0071	10	0.33940	T	0.23	-34.1353	15.8088	0.78538	1.0:0.0:0.0:0.0	.	121;1500	B4DNP4;P46940	.;IQGA1_HUMAN	R	1500	ENSP00000268182:K1500R	ENSP00000268182:K1500R	K	+	2	0	IQGAP1	88836818	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.414000	0.80117	2.330000	0.79161	0.528000	0.53228	AAG			0.398	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313493.1		NM_003870	
TELO2	9894	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	1552339	1552339	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr16:1552339G>T	ENST00000262319.6	+	13	1866	c.1587G>T	c.(1585-1587)gaG>gaT	p.E529D	TELO2_ENST00000564507.1_3'UTR	NM_016111.3	NP_057195.2	Q9Y4R8	TELO2_HUMAN	telomere maintenance 2	529					regulation of TOR signaling (GO:0032006)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	protein complex binding (GO:0032403)			NS(1)|endometrium(1)|kidney(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	19		Hepatocellular(780;0.219)				AGGACATAGAGCGCTGGGAGG	0.692																																					p.E529D													.	.			0			c.G1587T												8.0	10.0	9.0					16																	1552339		2150	4211	6361	SO:0001583	missense	9894	exon13			CATAGAGCGCTGG	AL080126	CCDS32363.1	16p13.3	2013-08-06	2013-08-06		ENSG00000100726	ENSG00000100726			29099	protein-coding gene	gene with protein product		611140	"""TEL2, telomere maintenance 2, homolog (S. cerevisiae)"""			9734811, 11230166, 12670948	Standard	NM_016111		Approved	KIAA0683, hCLK2, TEL2	uc002cly.3	Q9Y4R8	OTTHUMG00000044471	ENST00000262319.6:c.1587G>T	16.37:g.1552339G>T	ENSP00000262319:p.Glu529Asp		Somatic	74	0	0		WXS	Illumina HiSeq	.	56	0.16	9	NM_016111	130	0.29	38	D3DU73|O75168|Q7LDV4|Q9BR21	Missense_Mutation	SNP	ENST00000262319.6	37	CCDS32363.1	.	.	.	.	.	.	.	.	.	.	G	11.75	1.733239	0.30684	.	.	ENSG00000100726	ENST00000262319	T	0.35236	1.32	5.3	2.22	0.28083	Telomere length regulation protein, conserved domain (1);	0.290468	0.36519	N	0.002554	T	0.17619	0.0423	N	0.16602	0.42	0.41410	D	0.987738	B	0.30973	0.302	B	0.31869	0.137	T	0.07481	-1.0770	10	0.15499	T	0.54	-22.9972	4.7748	0.13173	0.3403:0.1483:0.5114:0.0	.	529	Q9Y4R8	TELO2_HUMAN	D	529	ENSP00000262319:E529D	ENSP00000262319:E529D	E	+	3	2	TELO2	1492340	1.000000	0.71417	0.953000	0.39169	0.457000	0.32468	1.344000	0.33941	0.228000	0.21019	0.462000	0.41574	GAG			0.692	TELO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000103602.2		NM_016111	
PALB2	79728	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	23614909	23614909	+	Silent	SNP	G	G	A			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr16:23614909G>A	ENST00000261584.4	-	13	3584	c.3432C>T	c.(3430-3432)ctC>ctT	p.L1144L	CTD-2196E14.3_ENST00000561764.1_RNA	NM_024675.3	NP_078951.2	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	1144	Interaction with RAD51, BRCA2 and POLH.|Required for interaction with POLH and POLH DNA synthesis stimulation.				DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|inner cell mass cell proliferation (GO:0001833)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|post-anal tail morphogenesis (GO:0036342)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(3)	55				GBM - Glioblastoma multiforme(48;0.0167)		TACACTGACCGAGAAGTAAGT	0.473			"""F, N, Mis"""			"""Wilms tumor, medulloblastoma, AML ,breast"""		Involved in tolerance or repair of DNA crosslinks																													p.L1144L			yes	Rec		"""Fanconi anaemia N, breast cancer susceptibility """	16	16p12.1	79728	partner and localizer of BRCA2		"""L, O, E"""	.	.			0			c.C3432T												109.0	94.0	99.0					16																	23614909		2197	4300	6497	SO:0001819	synonymous_variant	79728	exon13			CTGACCGAGAAGT		CCDS32406.1	16p12.1	2014-09-17				ENSG00000083093		"""Fanconi anemia, complementation groups"""	26144	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group N"""	610355				16793542, 17200672	Standard	NM_024675		Approved	FLJ21816, FANCN	uc002dlx.1	Q86YC2		ENST00000261584.4:c.3432C>T	16.37:g.23614909G>A			Somatic	134	0	0		WXS	Illumina HiSeq	.	106	0.08	8	NM_024675	151	0.25	38	A6NIE1|Q8N7Y6|Q8ND31|Q9H6W1	Silent	SNP	ENST00000261584.4	37	CCDS32406.1																																																																																					0.473	PALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000435287.2		NM_024675	
RRN3P2	653390	broad.mit.edu	37	16	29110438	29110438	+	RNA	SNP	T	T	C			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr16:29110438T>C	ENST00000564580.1	+	0	1111							A6NIE6	RN3P2_HUMAN	RNA polymerase I transcription factor homolog (S. cerevisiae) pseudogene 2									p.L368P(6)									TTGCAGTATCTTCAGAGTCTG	0.328																																					.													.	.			6	Substitution - Missense(6)	endometrium(5)|kidney(1)	.																																											0	.			AGTATCTTCAGAG			16p11.2	2011-12-02			ENSG00000103472	ENSG00000103472			37619	pseudogene	pseudogene							Standard	NR_003369		Approved		uc002dsf.4	A6NIE6			16.37:g.29110438T>C			Somatic	303	0.00330033	1		WXS	Illumina HiSeq	Phase_I	347	0.03	10	.	0		0		RNA	SNP	ENST00000564580.1	37		.	.	.	.	.	.	.	.	.	.	t	5.164	0.215759	0.09810	.	.	ENSG00000103472	ENST00000427965	.	.	.	1.93	1.93	0.25924	.	0.000000	0.64402	U	0.000008	T	0.52645	0.1747	.	.	.	.	.	.	.	.	.	.	.	.	T	0.63580	-0.6605	5	0.56958	D	0.05	.	7.5159	0.27600	0.0:0.0:0.0:1.0	.	.	.	.	P	368	.	ENSP00000398611:L368P	L	+	2	0	AC009093.1	29017939	1.000000	0.71417	0.752000	0.31206	0.354000	0.29330	6.384000	0.73177	0.893000	0.36288	0.155000	0.16302	CTT			0.328	RRN3P2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000433243.1		NR_003369	
ZNF785	146540	mdanderson.org	37	16	30594139	30594139	+	Silent	SNP	G	G	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr16:30594139G>T	ENST00000395216.2	-	3	1119	c.960C>A	c.(958-960)cgC>cgA	p.R320R	AC002310.7_ENST00000492040.1_RNA|AC002310.7_ENST00000486926.1_RNA|ZNF785_ENST00000470110.1_Silent_p.R305R	NM_152458.6	NP_689671.2	A8K8V0	ZN785_HUMAN	zinc finger protein 785	320					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	9						AATAGGTGAAGCGGCGGCCGC	0.642																																					p.R320R													.	.			0			c.C960A												53.0	61.0	58.0					16																	30594139		2197	4300	6497	SO:0001819	synonymous_variant	146540	exon3			GGTGAAGCGGCGG	BC040642	CCDS10685.1	16p11.2	2013-01-08			ENSG00000197162	ENSG00000197162		"""Zinc fingers, C2H2-type"", ""-"""	26496	protein-coding gene	gene with protein product						10493829	Standard	NM_152458		Approved	FLJ32130	uc002dyu.3	A8K8V0	OTTHUMG00000132398	ENST00000395216.2:c.960C>A	16.37:g.30594139G>T			Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_152458	9	0.00	0	O75701|Q8IW91|Q8WV14|Q96MN0	Silent	SNP	ENST00000395216.2	37	CCDS10685.1																																																																																					0.642	ZNF785-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000255529.2		NM_152458	
RP11-19N8.4	0	broad.mit.edu	37	16	33092505	33092505	+	lincRNA	DEL	T	T	-	rs201425843		TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr16:33092505delT	ENST00000561541.1	-	0	291																											TCACCTTTCCTGTCATTCCCT	0.373																																					.													.	.			0			.																																											0	.			CTTTCCTGTCATT																													16.37:g.33092505delT			Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	27	0.07	2	.	0		0		RNA	DEL	ENST00000561541.1	37																																																																																						0.373	RP11-19N8.4-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000432096.1			
GPR114	221188	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	57600650	57600650	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr16:57600650T>C	ENST00000340339.4	+	7	1209	c.686T>C	c.(685-687)tTt>tCt	p.F229S	GPR114_ENST00000349457.3_Missense_Mutation_p.F229S|GPR114_ENST00000394361.4_3'UTR	NM_153837.1	NP_722579.1	Q8IZF4	GP114_HUMAN	G protein-coupled receptor 114	229	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(5)|ovary(2)|stomach(1)|urinary_tract(1)	23						CTCACCTACTTTGCTGTTCTC	0.607																																					p.F229S													.	.			0			c.T686C												62.0	55.0	58.0					16																	57600650		2198	4300	6498	SO:0001583	missense	221188	exon7			CCTACTTTGCTGT	AY140956	CCDS10785.1	16q13	2014-08-08			ENSG00000159618	ENSG00000159618		"""-"", ""GPCR / Class B : Orphans"""	19010	protein-coding gene	gene with protein product						12435584	Standard	NM_153837		Approved	PGR27	uc002ely.3	Q8IZF4	OTTHUMG00000133461	ENST00000340339.4:c.686T>C	16.37:g.57600650T>C	ENSP00000342981:p.Phe229Ser		Somatic	33	0	0		WXS	Illumina HiSeq	.	27	0.22	6	NM_153837	14	0.14	2	B3KXZ5|Q6ZMH7|Q6ZML4|Q86SL8|Q8IZ14	Missense_Mutation	SNP	ENST00000340339.4	37	CCDS10785.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.493984	0.84962	.	.	ENSG00000159618	ENST00000394361;ENST00000340339;ENST00000349457	D;D	0.87179	-2.22;-2.22	5.14	5.14	0.70334	GPS domain (3);	0.119958	0.37761	N	0.001953	D	0.95620	0.8576	H	0.97465	4.01	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.96660	0.9488	10	0.87932	D	0	.	12.3636	0.55217	0.0:0.0:0.0:1.0	.	229;229	B4E148;Q8IZF4	.;GP114_HUMAN	S	229	ENSP00000342981:F229S;ENSP00000290823:F229S	ENSP00000342981:F229S	F	+	2	0	GPR114	56158151	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.617000	0.74210	1.954000	0.56735	0.397000	0.26171	TTT			0.607	GPR114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257336.3		NM_153837	
E2F4	1874	hgsc.bcm.edu	37	16	67229841	67229841	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr16:67229841A>G	ENST00000379378.3	+	7	1024	c.965A>G	c.(964-966)aAc>aGc	p.N322S		NM_001950.3	NP_001941.2	Q16254	E2F4_HUMAN	E2F transcription factor 4, p107/p130-binding	322	Poly-Ser.				blood circulation (GO:0008015)|cell volume homeostasis (GO:0006884)|cilium assembly (GO:0042384)|epithelial cell development (GO:0002064)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of cell size (GO:0008361)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(4)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)	11		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000697)|Epithelial(162;0.00303)|all cancers(182;0.0325)		agcaacagtaacagcagcagT	0.622																																					p.N322S													.	.			0			c.A965G												62.0	65.0	64.0					16																	67229841		2198	4300	6498	SO:0001583	missense	1874	exon7			ACAGTAACAGCAG	BC021050	CCDS32464.1	16q22.1	2014-05-06			ENSG00000205250	ENSG00000205250			3118	protein-coding gene	gene with protein product		600659				7958924, 7892279	Standard	NM_001950		Approved	E2F-4	uc002erz.3	Q16254	OTTHUMG00000172975	ENST00000379378.3:c.965A>G	16.37:g.67229841A>G	ENSP00000368686:p.Asn322Ser		Somatic	104	0	0		WXS	Illumina HiSeq	.	129	0.05	7	NM_001950	358	0.03	12	A6NGR8|B5BU56|Q12991|Q15328	Missense_Mutation	SNP	ENST00000379378.3	37	CCDS32464.1	.	.	.	.	.	.	.	.	.	.	A	0.009	-1.858792	0.00558	.	.	ENSG00000205250	ENST00000379378	D	0.85339	-1.97	3.78	2.8	0.32819	.	0.815688	0.10990	N	0.611709	T	0.64011	0.2560	N	0.08118	0	0.09310	N	0.999996	B	0.02656	0.0	B	0.01281	0.0	T	0.54105	-0.8343	10	0.02654	T	1	-0.3705	5.2064	0.15293	0.1738:0.0:0.8262:0.0	.	322	Q16254	E2F4_HUMAN	S	322	ENSP00000368686:N322S	ENSP00000368686:N322S	N	+	2	0	E2F4	65787342	1.000000	0.71417	0.859000	0.33776	0.003000	0.03518	2.063000	0.41423	1.093000	0.41377	0.533000	0.62120	AAC			0.622	E2F4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000421565.1		NM_001950	
RP11-252A24.2	0	broad.mit.edu	37	16	74372915	74372915	+	RNA	DEL	T	T	-	rs397827801|rs11353924|rs532713769|rs398078750		TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr16:74372915delT	ENST00000429810.2	-	0	1404																											ACGTAGtttgttttttttttt	0.438																																					.													.	.			0			.																																											0	.			AGTTTGTTTTTTT																													16.37:g.74372915delT			Somatic	10	0	0		WXS	Illumina HiSeq	Phase_I	23	0.30	7	.	0		0		RNA	DEL	ENST00000429810.2	37																																																																																						0.438	RP11-252A24.2-003	KNOWN	basic	retained_intron	pseudogene		OTTHUMT00000434683.1			
CMC2	56942	mdanderson.org	37	16	81053827	81053827	+	De_novo_Start_OutOfFrame	SNP	G	G	A	rs150065918		TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr16:81053827G>A	ENST00000565914.1	-	0	48				CENPN_ENST00000393335.3_Silent_p.P159P|CENPN_ENST00000305850.5_Silent_p.P159P|CENPN_ENST00000299572.5_Silent_p.P159P|CENPN_ENST00000428963.2_Silent_p.P159P|CENPN_ENST00000439957.3_Silent_p.P139P|RP11-303E16.3_ENST00000562315.1_RNA			Q9NRP2	COXM2_HUMAN	C-x(9)-C motif containing 2							mitochondrion (GO:0005739)											CCCAGACTCCGTACGCCTTCA	0.458																																					p.P159P													CENPN_ENST00000439957,colon,carcinoma,+1,2	CENPN_ENST00000439957	1	2	0			c.G477A							G	,,	0,4404		0,0,2202	132.0	95.0	107.0		477,477,477	-11.8	0.0	16	dbSNP_134	107	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	CENPN	NM_001100624.1,NM_001100625.1,NM_018455.4	,,	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	,,	159/340,159/354,159/205	81053827	1,13003	2202	4300	6502			55839	exon6			GACTCCGTACGCC	BC032631	CCDS10930.1	16q23.2	2013-10-18	2013-10-18	2012-02-14	ENSG00000103121	ENSG00000103121			24447	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 61"", ""COX assembly mitochondrial protein 2 homolog (S. cerevisiae)"""	C16orf61		20220131	Standard	NM_020188		Approved	DC13, MGC45036	uc002ffu.3	Q9NRP2	OTTHUMG00000137625	ENST00000565914.1:c.-150C>T	16.37:g.81053827G>A			Somatic	71	0.014084507	1		WXS	Illumina HiSeq	Phase_I	60	0.07	4	NM_018455	138	0.00	0	D3DUK6	Silent	SNP	ENST00000565914.1	37	CCDS10930.1																																																																																					0.458	CMC2-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000432291.1		NM_020188	
FANCA	2175	mdanderson.org	37	16	89851354	89851354	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr16:89851354G>A	ENST00000389301.3	-	15	1408	c.1378C>T	c.(1378-1380)Cga>Tga	p.R460*	FANCA_ENST00000568369.1_Nonsense_Mutation_p.R460*	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	460					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		TGGTAGCCTCGTGTGCTCCCA	0.587			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.R460X			yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	.	.			0			c.C1378T												107.0	97.0	100.0					16																	89851354		2198	4300	6498	SO:0001587	stop_gained	2175	exon15	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AGCCTCGTGTGCT	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.1378C>T	16.37:g.89851354G>A	ENSP00000373952:p.Arg460*		Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_000135	34	0.00	0	A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Nonsense_Mutation	SNP	ENST00000389301.3	37	CCDS32515.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.962077	0.92791	.	.	ENSG00000187741	ENST00000389301	.	.	.	5.68	-0.772	0.10998	.	0.618268	0.14837	N	0.295527	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	-4.3725	11.8864	0.52604	0.0:0.0808:0.2697:0.6496	.	.	.	.	X	460	.	ENSP00000373952:R460X	R	-	1	2	FANCA	88378855	0.009000	0.17119	0.000000	0.03702	0.011000	0.07611	0.636000	0.24644	-0.003000	0.14444	0.549000	0.68633	CGA			0.587	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000421927.1			
LRRC37A4P	55073	bcgsc.ca	37	17	43626397	43626397	+	RNA	SNP	G	G	C	rs200849412	byFrequency	TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr17:43626397G>C	ENST00000586411.1	-	0	1652				RP11-798G7.6_ENST00000586348.1_lincRNA																							TAGCCTCCTGGTGGACTAGAG	0.557																																					.													.	.			0			.																																											55073	.			CTCCTGGTGGACT																													17.37:g.43626397G>C			Somatic	461	0.0412147505	19		WXS	Illumina HiSeq	Phase_1	520	0.10	52	.	0		0		RNA	SNP	ENST00000586411.1	37																																																																																						0.557	RP11-798G7.7-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript		OTTHUMT00000452150.1			
ENTHD2	146705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	79204389	79204389	+	Silent	SNP	C	C	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr17:79204389C>T	ENST00000300714.3	-	11	1041	c.984G>A	c.(982-984)gaG>gaA	p.E328E	ENTHD2_ENST00000374769.2_Silent_p.E244E|AC027601.1_ENST00000569559.1_RNA|AC027601.1_ENST00000575922.1_RNA	NM_144679.2	NP_653280.1	Q96N21	AP4AT_HUMAN	ENTH domain containing 2	328						cytoplasmic vesicle (GO:0031410)											CCATGCTGAGCTCCTGCAGCC	0.687											OREG0024811	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E328E													.	.			0			c.G984A												26.0	26.0	26.0					17																	79204389		2202	4298	6500	SO:0001819	synonymous_variant	146705	exon11			GCTGAGCTCCTGC	AK056090	CCDS11779.1	17q25.3	2012-07-18	2012-07-18	2012-07-18	ENSG00000167302	ENSG00000167302			26458	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 56"""	C17orf56			Standard	NM_144679		Approved	FLJ31528	uc002jzu.2	Q96N21	OTTHUMG00000177866	ENST00000300714.3:c.984G>A	17.37:g.79204389C>T			Somatic	60	0	0	1189	WXS	Illumina HiSeq	.	65	0.15	10	NM_144679	107	0.23	25	Q6ZQU0|Q6ZSQ9	Silent	SNP	ENST00000300714.3	37	CCDS11779.1																																																																																					0.687	ENTHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000439315.1		NM_144679	
WDR45B	56270	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	80573887	80573887	+	Missense_Mutation	SNP	C	C	T	rs139641537		TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr17:80573887C>T	ENST00000392325.4	-	10	1137	c.943G>A	c.(943-945)Ggc>Agc	p.G315S	WDR45B_ENST00000571835.1_5'Flank	NM_019613.3	NP_062559.2	Q5MNZ6	WIPI3_HUMAN	WD repeat domain 45B	315																	TAGTAGCTGCCGTCTGCACAA	0.493																																					p.G315S													.	.			0			c.G943A							C	SER/GLY	0,4406		0,0,2203	118.0	99.0	106.0		943	3.8	1.0	17	dbSNP_134	106	1,8599	1.2+/-3.3	0,1,4299	no	missense	WDR45L	NM_019613.3	56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	315/345	80573887	1,13005	2203	4300	6503	SO:0001583	missense	56270	exon10			AGCTGCCGTCTGC	AF091083	CCDS11815.2	17q25.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000141580	ENSG00000141580		"""WD repeat domain containing"""	25072	protein-coding gene	gene with protein product		609226	"""WDR45-like"""	WDR45L		12477932	Standard	NM_019613		Approved	WIPI3	uc002kfq.3	Q5MNZ6	OTTHUMG00000150146	ENST00000392325.4:c.943G>A	17.37:g.80573887C>T	ENSP00000376139:p.Gly315Ser		Somatic	70	0	0		WXS	Illumina HiSeq	.	79	0.10	8	NM_019613	251	0.26	65	O95328|Q2MCP6|Q6IBN2	Missense_Mutation	SNP	ENST00000392325.4	37	CCDS11815.2	.	.	.	.	.	.	.	.	.	.	C	18.77	3.695819	0.68386	0.0	1.16E-4	ENSG00000141580	ENST00000392325;ENST00000539012	D	0.86164	-2.08	4.79	3.83	0.44106	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.93478	0.7919	M	0.85630	2.765	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	D	0.94247	0.7490	10	0.66056	D	0.02	-22.8334	14.827	0.70120	0.1454:0.8546:0.0:0.0	.	315	Q5MNZ6	WIPI3_HUMAN	S	315;287	ENSP00000376139:G315S	ENSP00000376139:G315S	G	-	1	0	WDR45L	78167176	1.000000	0.71417	0.982000	0.44146	0.171000	0.22731	7.298000	0.78815	1.152000	0.42452	-0.360000	0.07572	GGC	0		0.493	WDR45B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316536.1		NM_019613	
ZNF57	126295	broad.mit.edu	37	19	2918277	2918277	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr19:2918277G>T	ENST00000306908.5	+	4	1806	c.1658G>T	c.(1657-1659)aGc>aTc	p.S553I	ZNF57_ENST00000523428.1_Missense_Mutation_p.S521I|AC006277.2_ENST00000520090.2_RNA	NM_173480.2	NP_775751.1	Q68EA5	ZNF57_HUMAN	zinc finger protein 57	553					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.00161)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCAGTGAGAGCACACACTAA	0.398																																					p.S553I	NSCLC(150;910 1964 4303 10464 26498)												.	ZNF57	57		0			c.G1658T												70.0	71.0	71.0					19																	2918277		2199	4299	6498	SO:0001583	missense	126295	exon4			GTGAGAGCACACA	M88368	CCDS12098.1	19p13.3	2013-01-08			ENSG00000171970	ENSG00000171970		"""Zinc fingers, C2H2-type"", ""-"""	13125	protein-coding gene	gene with protein product			"""zinc finger protein 424"""	ZNF424		1505991	Standard	NM_173480		Approved		uc002lwr.3	Q68EA5	OTTHUMG00000164485	ENST00000306908.5:c.1658G>T	19.37:g.2918277G>T	ENSP00000303696:p.Ser553Ile		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	57	0.05	3	NM_173480	64	0.00	0	Q8N6R9	Missense_Mutation	SNP	ENST00000306908.5	37	CCDS12098.1	.	.	.	.	.	.	.	.	.	.	G	6.585	0.476253	0.12521	.	.	ENSG00000171970	ENST00000306908;ENST00000395204;ENST00000523428	T;T	0.05925	3.47;3.37	1.83	-3.67	0.04476	.	.	.	.	.	T	0.03053	0.0090	N	0.19112	0.55	0.09310	N	1	P	0.39094	0.659	B	0.32090	0.14	T	0.28427	-1.0044	9	0.66056	D	0.02	.	3.8573	0.08981	0.4516:0.3752:0.1733:0.0	.	553	Q68EA5	ZNF57_HUMAN	I	553;555;521	ENSP00000303696:S553I;ENSP00000430223:S521I	ENSP00000303696:S553I	S	+	2	0	ZNF57	2869277	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.150000	0.03178	-1.417000	0.02017	0.511000	0.50034	AGC			0.398	ZNF57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378969.1		NM_173480	
ARHGEF18	23370	mdanderson.org	37	19	7505295	7505295	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr19:7505295G>T	ENST00000359920.6	+	1	722	c.469G>T	c.(469-471)Gtc>Ttc	p.V157F	ARHGEF18_ENST00000319670.9_5'UTR|CTD-2207O23.3_ENST00000593531.1_Missense_Mutation_p.M114I	NM_001130955.1	NP_001124427.1	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 18	157					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transforming growth factor beta receptor signaling pathway (GO:0007179)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	23		Renal(5;0.0902)				GTCCAGGAATGTCGGTATGAC	0.662																																					p.V157F													.	.			0			c.G469T												49.0	46.0	47.0					19																	7505295		2203	4300	6503	SO:0001583	missense	23370	exon1			AGGAATGTCGGTA	AK074372	CCDS12177.1, CCDS45946.1	19p13.3	2013-01-10	2009-06-12			ENSG00000104880		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	17090	protein-coding gene	gene with protein product	"""Rho-specific guanine nucleotide exchange factor p114"""		"""rho/rac guanine nucleotide exchange factor (GEF) 18"""			9628581, 11318610	Standard	NM_015318		Approved	P114-RhoGEF, KIAA0521, MGC15913	uc002mgi.3	Q6ZSZ5		ENST00000359920.6:c.469G>T	19.37:g.7505295G>T	ENSP00000352995:p.Val157Phe		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	20	0.10	2	NM_001130955	32	0.00	0	A8MV62|B5ME81|O60274|Q6DD92	Missense_Mutation	SNP	ENST00000359920.6	37	CCDS45946.1	.	.	.	.	.	.	.	.	.	.	G	15.75	2.925123	0.52759	.	.	ENSG00000104880	ENST00000359920	T	0.34472	1.36	5.43	5.43	0.79202	.	0.335387	0.21164	N	0.079110	T	0.29126	0.0724	L	0.32530	0.975	0.80722	D	1	P	0.43885	0.82	B	0.39379	0.298	T	0.06588	-1.0818	10	0.56958	D	0.05	-24.2317	12.4868	0.55877	0.0:0.1681:0.8319:0.0	.	157	Q6ZSZ5	ARHGI_HUMAN	F	157	ENSP00000352995:V157F	ENSP00000352995:V157F	V	+	1	0	ARHGEF18	7411295	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.239000	0.58694	2.548000	0.85928	0.561000	0.74099	GTC			0.662	ARHGEF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000436340.1		NM_015318	
FBN3	84467	mdanderson.org	37	19	8212313	8212313	+	Silent	SNP	G	G	A			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr19:8212313G>A	ENST00000600128.1	-	2	466	c.52C>T	c.(52-54)Ctg>Ttg	p.L18L	FBN3_ENST00000601739.1_Silent_p.L18L|FBN3_ENST00000270509.2_Silent_p.L18L			Q75N90	FBN3_HUMAN	fibrillin 3	18						proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						GACCAGGCCAGCAGGAGCCGG	0.692																																					p.L18L													.	.			0			c.C52T												5.0	7.0	6.0					19																	8212313		2142	4171	6313	SO:0001819	synonymous_variant	84467	exon1			AGGCCAGCAGGAG		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.52C>T	19.37:g.8212313G>A			Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_032447	4	0.00	0	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Silent	SNP	ENST00000600128.1	37	CCDS12196.1																																																																																					0.692	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000461428.2		NM_032447	
CCDC159	126075	broad.mit.edu	37	19	11464523	11464523	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr19:11464523G>T	ENST00000588790.1	+	11	1192	c.745G>T	c.(745-747)Gcc>Tcc	p.A249S	CCDC159_ENST00000458408.1_Missense_Mutation_p.A249S|DKFZP761J1410_ENST00000251473.5_5'Flank|DKFZP761J1410_ENST00000591608.1_5'Flank			P0C7I6	CC159_HUMAN	coiled-coil domain containing 159	364										endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	5						GTGCTCGGGGGCCTGTCCCAA	0.587																																					p.A249S													.	CCDC159	35		0			c.G745T												19.0	21.0	20.0					19																	11464523		1911	4137	6048	SO:0001583	missense	126075	exon9			TCGGGGGCCTGTC	BC038439	CCDS45976.1	19p13.2	2010-02-17			ENSG00000183401	ENSG00000183401			26996	protein-coding gene	gene with protein product							Standard	NM_001080503		Approved		uc010xlt.2	P0C7I6		ENST00000588790.1:c.745G>T	19.37:g.11464523G>T	ENSP00000468232:p.Ala249Ser		Somatic	89	0.0112359551	1		WXS	Illumina HiSeq	Phase_I	85	0.05	4	NM_001080503	27	0.00	0	B4DEG3|B4DWR8|B4E133|B7ZAM4	Missense_Mutation	SNP	ENST00000588790.1	37	CCDS45976.1	.	.	.	.	.	.	.	.	.	.	G	6.981	0.551134	0.13374	.	.	ENSG00000183401	ENST00000458408;ENST00000427879	T	0.44881	0.91	4.03	-1.86	0.07760	.	.	.	.	.	T	0.20618	0.0496	N	0.22421	0.69	0.09310	N	1	B;B	0.19200	0.034;0.003	B;B	0.21151	0.033;0.01	T	0.28933	-1.0028	9	0.10377	T	0.69	.	3.2836	0.06924	0.4716:0.0:0.3389:0.1894	.	364;249	P0C7I6;P0C7I6-2	CC159_HUMAN;.	S	249;364	ENSP00000402239:A249S	ENSP00000390400:A364S	A	+	1	0	CCDC159	11325523	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.226000	0.17776	-0.209000	0.10156	0.313000	0.20887	GCC			0.587	CCDC159-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458761.1		NM_001080503	
ZNF681	148213	mdanderson.org	37	19	23926883	23926883	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr19:23926883G>T	ENST00000402377.3	-	4	1610	c.1469C>A	c.(1468-1470)tCc>tAc	p.S490Y	ZNF681_ENST00000395385.3_Missense_Mutation_p.S421Y	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	490					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				AAGGATTGAGGACTGGTTAAA	0.363																																					p.S490Y													.	.			0			c.C1469A												54.0	60.0	58.0					19																	23926883		2199	4298	6497	SO:0001583	missense	148213	exon4			ATTGAGGACTGGT	AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.1469C>A	19.37:g.23926883G>T	ENSP00000384000:p.Ser490Tyr		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	21	0.14	3	NM_138286	56	0.00	0	B3KVF7	Missense_Mutation	SNP	ENST00000402377.3	37	CCDS12414.2	.	.	.	.	.	.	.	.	.	.	.	9.575	1.122000	0.20877	.	.	ENSG00000196172	ENST00000402377;ENST00000395385	T;T	0.01209	5.17;5.17	1.51	-3.01	0.05463	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01800	0.0057	L	0.45470	1.425	0.09310	N	1	D	0.63046	0.992	P	0.52627	0.704	T	0.45381	-0.9265	9	0.38643	T	0.18	.	4.0586	0.09827	0.0:0.4672:0.2991:0.2337	.	490	Q96N22	ZN681_HUMAN	Y	490;421	ENSP00000384000:S490Y;ENSP00000378783:S421Y	ENSP00000378783:S421Y	S	-	2	0	ZNF681	23718723	0.000000	0.05858	0.001000	0.08648	0.025000	0.11179	-3.146000	0.00584	-0.142000	0.11354	0.313000	0.20887	TCC			0.363	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320248.2		NM_138286	
ZNF181	339318	hgsc.bcm.edu	37	19	35232200	35232200	+	Missense_Mutation	SNP	T	T	G	rs143797666	byFrequency	TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr19:35232200T>G	ENST00000492450.1	+	4	1003	c.914T>G	c.(913-915)gTc>gGc	p.V305G	ZNF181_ENST00000392232.3_Missense_Mutation_p.V349G|ZNF181_ENST00000459757.2_Missense_Mutation_p.V304G			Q2M3W8	ZN181_HUMAN	zinc finger protein 181	305					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V241G(4)		endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(1)	22	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			TTTAGCCATGTCTCATCACTT	0.413													T|||	3	0.000599042	0.0	0.0	5008	,	,		22105	0.002		0.0	False		,,,				2504	0.001				p.V305G													ZNF181,NS,carcinoma,0,5	ZNF181	0	5	4	Substitution - Missense(4)	lung(2)|endometrium(2)	c.T914G												91.0	88.0	89.0					19																	35232200		2203	4300	6503	SO:0001583	missense	339318	exon4			GCCATGTCTCATC	BC104759, H54888	CCDS32990.2, CCDS46043.1	19q13.13	2013-01-08	2006-04-27		ENSG00000197841	ENSG00000197841		"""Zinc fingers, C2H2-type"", ""-"""	12971	protein-coding gene	gene with protein product		606741	"""zinc finger protein 181 (HHZ181)"""				Standard	NM_001029997		Approved	HHZ181, MGC44316	uc002nvu.3	Q2M3W8	OTTHUMG00000157508	ENST00000492450.1:c.914T>G	19.37:g.35232200T>G	ENSP00000420727:p.Val305Gly		Somatic	109	0.0183486239	2		WXS	Illumina HiSeq	.	119	0.05	6	NM_001029997	10	0.00	0	B7ZKX3|Q49A75	Missense_Mutation	SNP	ENST00000492450.1	37	CCDS32990.2	.	.	.	.	.	.	.	.	.	.	T	1.102	-0.660828	0.03454	.	.	ENSG00000197841	ENST00000392232;ENST00000425140;ENST00000492450;ENST00000459757	T;T;T	0.38560	2.43;1.13;1.13	2.89	2.89	0.33648	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.16642	0.0400	N	0.10733	0.035	0.09310	N	0.999999	P;B	0.38978	0.652;0.0	B;B	0.30179	0.112;0.001	T	0.04017	-1.0984	9	0.22109	T	0.4	.	5.4169	0.16378	0.2509:0.0:0.0:0.749	.	304;305	B7ZKX3;Q2M3W8	.;ZN181_HUMAN	G	349;304;305;304	ENSP00000376065:V349G;ENSP00000420727:V305G;ENSP00000419435:V304G	ENSP00000376065:V349G	V	+	2	0	ZNF181	39924040	0.000000	0.05858	0.880000	0.34516	0.765000	0.43378	-0.861000	0.04268	1.565000	0.49641	0.402000	0.26972	GTC			0.413	ZNF181-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000349005.3		NM_001029997	
IFNL2	282616	broad.mit.edu	37	19	39760455	39760455	+	Silent	SNP	A	A	C	rs577518793	byFrequency	TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr19:39760455A>C	ENST00000331982.5	+	5	553	c.498A>C	c.(496-498)ccA>ccC	p.P166P		NM_172138.1	NP_742150.1	Q8IZJ0	IFNL2_HUMAN	interferon, lambda 2	166					defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|mucosal immune response (GO:0002385)|positive regulation of immune response (GO:0050778)	extracellular space (GO:0005615)											AGGAGGCCCCAAAAAAGGTGA	0.677													A|||	55	0.0109824	0.003	0.013	5008	,	,		13585	0.0248		0.0139	False		,,,				2504	0.0031				p.P166P													IL28A,NS,carcinoma,+2,1	.		1	0			c.A498C												18.0	24.0	22.0					19																	39760455		2171	4273	6444	SO:0001819	synonymous_variant	282616	exon5			GGCCCCAAAAAAG	AY129148	CCDS42567.1	19q13.13	2014-05-22	2012-11-26	2012-11-26	ENSG00000183709	ENSG00000183709		"""Interferons"""	18364	protein-coding gene	gene with protein product		607401	"""interleukin 28A"", ""interleukin 28A (interferon, lambda 2)"""	IL28A			Standard	NM_172138		Approved	IL-28A	uc002oku.1	Q8IZJ0		ENST00000331982.5:c.498A>C	19.37:g.39760455A>C			Somatic	135	0	0		WXS	Illumina HiSeq	Phase_I	134	0.04	6	NM_172138	0		0	Q45KQ8|Q6VN55|Q8IWL7	Silent	SNP	ENST00000331982.5	37	CCDS42567.1																																																																																					0.677	IFNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463833.1		NM_172138	
IL4I1	259307	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50399126	50399126	+	Silent	SNP	G	G	A	rs138779872		TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr19:50399126G>A	ENST00000391826.2	-	3	340	c.198C>T	c.(196-198)ggC>ggT	p.G66G	IL4I1_ENST00000595948.1_Silent_p.G88G|IL4I1_ENST00000341114.3_Silent_p.G88G	NM_152899.1	NP_690863.1	Q96RQ9	OXLA_HUMAN	interleukin 4 induced 1	66						extracellular region (GO:0005576)|lysosome (GO:0005764)	L-amino-acid oxidase activity (GO:0001716)			endometrium(3)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	16		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00245)|OV - Ovarian serous cystadenocarcinoma(262;0.0169)	Flavin adenine dinucleotide(DB03147)	CCACACCAGCGCCAACCACAA	0.612																																					p.G88G													.	.			0			c.C264T							G	,	1,4403	2.1+/-5.4	0,1,2201	108.0	114.0	112.0		198,264	-10.8	0.1	19	dbSNP_134	112	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	IL4I1	NM_152899.1,NM_172374.1	,	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	,	66/568,88/590	50399126	1,13003	2202	4300	6502	SO:0001819	synonymous_variant	259307	exon5			ACCAGCGCCAACC	AF293462	CCDS12786.1, CCDS12787.1	19q13.3-q13.4	2014-06-26				ENSG00000104951			19094	protein-coding gene	gene with protein product		609742				12031486	Standard	NM_152899		Approved	FIG1	uc002pqt.1	Q96RQ9		ENST00000391826.2:c.198C>T	19.37:g.50399126G>A			Somatic	76	0	0		WXS	Illumina HiSeq	.	64	0.14	9	NM_172374	116	0.00	0	Q1WMJ3|Q4GZN1|Q4GZN2|Q6P2Q3|Q8TEM5|Q96RQ8	Silent	SNP	ENST00000391826.2	37	CCDS12787.1																																																																																			0		0.612	IL4I1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466413.1			
SSC5D	284297	broad.mit.edu	37	19	56029372	56029372	+	Silent	SNP	G	G	C	rs562566738	byFrequency	TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr19:56029372G>C	ENST00000389623.6	+	14	3752	c.3729G>C	c.(3727-3729)acG>acC	p.T1243T		NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	1243	Pro-rich.|Thr-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						accccaccacgacccctcatc	0.602													-|||	3	0.000599042	0.0023	0.0	5008	,	,		8413	0.0		0.0	False		,,,				2504	0.0				p.T1243T													.	SSC5D	65		0			c.G3729C												634.0	742.0	709.0					19																	56029372		688	1590	2278	SO:0001819	synonymous_variant	284297	exon14			CACCACGACCCCT		CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.3729G>C	19.37:g.56029372G>C			Somatic	346	0.0231213873	8		WXS	Illumina HiSeq	Phase_I	303	0.04	13	NM_001144950	11	0.00	0	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Silent	SNP	ENST00000389623.6	37	CCDS46196.1																																																																																					0.602	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000453345.2		XM_001718392	
ZNF587B	100293516	broad.mit.edu	37	19	58353308	58353308	+	Intron	SNP	A	A	G			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr19:58353308A>G	ENST00000442832.4	+	3	1356				ZNF587B_ENST00000316462.4_Intron|ZNF587B_ENST00000594901.1_Silent_p.K422K|CTD-2583A14.10_ENST00000598031.1_Intron	NM_001204818.1	NP_001191747.1	E7ETH6	Z587B_HUMAN	zinc finger protein 587B						regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										TTAATGAAAAAGGACACCTTA	0.423																																					.													.	.			0			.																																									SO:0001627	intron_variant	100293516	.			TGAAAAAGGACAC	AK299091	CCDS56109.1	19q13.43	2013-01-08				ENSG00000269343		"""Zinc fingers, C2H2-type"", ""-"""	37142	protein-coding gene	gene with protein product							Standard	NM_001204818		Approved		uc021vcp.1	E7ETH6		ENST00000442832.4:c.1122+144A>G	19.37:g.58353308A>G			Somatic	104	0	0		WXS	Illumina HiSeq	Phase_I	124	0.03	4	.	25	0.00	0	B4DR41	Silent	SNP	ENST00000442832.4	37	CCDS56109.1																																																																																					0.423	ZNF587B-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000466834.2		NM_001204818	
FNDC4	64838	mdanderson.org	37	2	27717514	27717514	+	Missense_Mutation	SNP	G	G	T	rs372961149		TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr2:27717514G>T	ENST00000264703.3	-	2	424	c.33C>A	c.(31-33)agC>agA	p.S11R	GCKR_ENST00000264717.2_5'Flank|GCKR_ENST00000424318.2_5'Flank	NM_022823.2	NP_073734.1	Q9H6D8	FNDC4_HUMAN	fibronectin type III domain containing 4	11						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|prostate(1)|skin(1)	9	Acute lymphoblastic leukemia(172;0.155)					CACGGAGTCCGCTGGGGGGGG	0.647																																					p.S11R													.	.			0			c.C33A												14.0	15.0	14.0					2																	27717514		2201	4294	6495	SO:0001583	missense	64838	exon2			GAGTCCGCTGGGG	AK026015	CCDS1756.1	2p23.3	2013-02-11			ENSG00000115226	ENSG00000115226		"""Fibronectin type III domain containing"""	20239	protein-coding gene	gene with protein product		611905				12384288	Standard	NM_022823		Approved	FLJ22362, FRCP1	uc002rkx.3	Q9H6D8	OTTHUMG00000097787	ENST00000264703.3:c.33C>A	2.37:g.27717514G>T	ENSP00000264703:p.Ser11Arg		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	83	0.05	4	NM_022823	62	0.00	0	D6W560	Missense_Mutation	SNP	ENST00000264703.3	37	CCDS1756.1	.	.	.	.	.	.	.	.	.	.	G	12.30	1.897634	0.33535	.	.	ENSG00000115226	ENST00000264703	T	0.07021	3.23	4.92	1.6	0.23607	.	2.302850	0.02021	N	0.047796	T	0.04724	0.0128	N	0.03608	-0.345	0.20489	N	0.999898	P	0.35383	0.498	B	0.36335	0.222	T	0.23013	-1.0200	10	0.41790	T	0.15	-21.9848	4.3353	0.11083	0.2448:0.0:0.5742:0.181	.	11	Q9H6D8	FNDC4_HUMAN	R	11	ENSP00000264703:S11R	ENSP00000264703:S11R	S	-	3	2	FNDC4	27571018	0.219000	0.23619	0.850000	0.33497	0.695000	0.40330	-0.351000	0.07711	0.481000	0.27557	0.456000	0.33151	AGC			0.647	FNDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000215031.1		NM_022823	
FAHD2CP	729234	broad.mit.edu	37	2	96679935	96679937	+	RNA	DEL	AAC	AAC	-	rs113830014|rs545983595	byFrequency	TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	AAC	AAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr2:96679935_96679937delAAC	ENST00000607780.1	+	0	414									fumarylacetoacetate hydrolase domain containing 2C, pseudogene																		ggaggtgattaacaatttgaagg	0.433														2262	0.451677	0.5537	0.4078	5008	,	,		19642	0.3353		0.4066	False		,,,				2504	0.5112				.													.	.			0			.																																											0	.			GTGATTAACAATT			2q11.1	2012-06-29			ENSG00000231584	ENSG00000231584			44135	pseudogene	pseudogene							Standard	NR_003698		Approved		uc010fht.3		OTTHUMG00000155210		2.37:g.96679935_96679937delAAC			Somatic	9	0.1111111111	1		WXS	Illumina HiSeq	Phase_I	13	0.46	6	.	0		0		RNA	DEL	ENST00000607780.1	37																																																																																						0.433	FAHD2CP-005	KNOWN	non_canonical_TEC|basic	processed_transcript	pseudogene		OTTHUMT00000470200.1		NR_003698	
ACMSD	130013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	135630212	135630212	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr2:135630212G>T	ENST00000356140.5	+	8	985		c.e8+1		ACMSD_ENST00000283054.4_Splice_Site|AC016725.4_ENST00000413962.1_RNA|AC016725.4_ENST00000428857.1_RNA|AC016725.4_ENST00000392929.2_RNA|AC016725.4_ENST00000537615.1_RNA|ACMSD_ENST00000392928.1_Splice_Site	NM_138326.2	NP_612199.2	Q8TDX5	ACMSD_HUMAN	aminocarboxymuconate semialdehyde decarboxylase						cellular nitrogen compound metabolic process (GO:0034641)|quinolinate metabolic process (GO:0046874)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aminocarboxymuconate-semialdehyde decarboxylase activity (GO:0001760)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(4)|lung(6)|skin(1)	14				BRCA - Breast invasive adenocarcinoma(221;0.115)		CATAGGAAAGGTAAGCCCAGT	0.478																																					.													.	.			0			c.849+1G>T												120.0	107.0	112.0					2																	135630212		2203	4300	6503	SO:0001630	splice_region_variant	130013	exon8			GGAAAGGTAAGCC	AB071418	CCDS2173.2	2q21.3	2008-03-11			ENSG00000153086	ENSG00000153086	4.1.1.45		19288	protein-coding gene	gene with protein product		608889				12140278	Standard	NM_138326		Approved		uc002ttz.3	Q8TDX5	OTTHUMG00000131711	ENST00000356140.5:c.849+1G>T	2.37:g.135630212G>T			Somatic	94	0	0		WXS	Illumina HiSeq	.	140	0.20	28	NM_138326	0		0	Q3B7X3|Q53SR5|Q96KY2	Splice_Site	SNP	ENST00000356140.5	37	CCDS2173.2	.	.	.	.	.	.	.	.	.	.	G	25.6	4.658414	0.88154	.	.	ENSG00000153086	ENST00000356140;ENST00000283054;ENST00000392928	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4305	0.94762	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACMSD	135346682	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	9.837000	0.99465	2.616000	0.88540	0.484000	0.47621	.			0.478	ACMSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254627.1			Intron
CHPF	79586	mdanderson.org	37	2	220406810	220406810	+	Missense_Mutation	SNP	C	C	T	rs369325931		TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr2:220406810C>T	ENST00000243776.6	-	2	664	c.416G>A	c.(415-417)cGc>cAc	p.R139H	CHPF_ENST00000373891.2_Missense_Mutation_p.R139H|CHPF_ENST00000535926.1_5'UTR|TMEM198_ENST00000344458.2_5'Flank|TMEM198_ENST00000373883.3_5'Flank	NM_024536.5	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	139					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	21		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		CCCCAGCGTGCGGTTCACGGC	0.711											OREG0015229	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R139H													.	.			0			c.G416A												7.0	8.0	7.0					2																	220406810		2163	4231	6394	SO:0001583	missense	79586	exon2			AGCGTGCGGTTCA	BC008878	CCDS2443.1, CCDS56169.1	2q35	2014-02-12			ENSG00000123989	ENSG00000123989	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24291	protein-coding gene	gene with protein product	"""chondroitin sulfate synthase 2"""	610405				11230166, 12716890	Standard	NM_024536		Approved	CSS2, CHSY2	uc002vmc.4	Q8IZ52	OTTHUMG00000058929	ENST00000243776.6:c.416G>A	2.37:g.220406810C>T	ENSP00000243776:p.Arg139His		Somatic	20	0	0	2266	WXS	Illumina HiSeq	Phase_I	13	0.15	2	NM_024536	185	0.00	0	B4DXU0|Q6UXD6|Q7L4G1|Q9H0F8|Q9H618	Missense_Mutation	SNP	ENST00000243776.6	37	CCDS2443.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.606922	0.87157	.	.	ENSG00000123989	ENST00000243776;ENST00000373891	T	0.13538	2.58	4.28	4.28	0.50868	.	0.000000	0.85682	D	0.000000	T	0.36908	0.0984	M	0.69358	2.11	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.985	T	0.24440	-1.0160	10	0.87932	D	0	-19.4827	17.2807	0.87127	0.0:1.0:0.0:0.0	.	139;139	F8W6H2;Q8IZ52	.;CHSS2_HUMAN	H	139	ENSP00000243776:R139H	ENSP00000243776:R139H	R	-	2	0	CHPF	220115054	1.000000	0.71417	1.000000	0.80357	0.318000	0.28184	4.803000	0.62546	2.399000	0.81585	0.448000	0.29417	CGC			0.711	CHPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000130268.1		NM_024536	
ALPP	250	mdanderson.org	37	2	233246466	233246466	+	Silent	SNP	C	C	A	rs556577773	byFrequency	TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr2:233246466C>A	ENST00000392027.2	+	11	1838	c.1569C>A	c.(1567-1569)gcC>gcA	p.A523A	AC068134.8_ENST00000441266.1_RNA|AC068134.8_ENST00000439072.1_RNA	NM_001632.3	NP_001623.3	P05187	PPB1_HUMAN	alkaline phosphatase, placental	523					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|endometrium(1)|kidney(4)|large_intestine(2)|liver(1)|lung(10)|ovary(2)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		CTCTGCTGGCCGGGACCCTGC	0.736													c|||	4	0.000798722	0.0008	0.0	5008	,	,		12231	0.0		0.001	False		,,,				2504	0.002				p.A523A													.	.			0			c.C1569A																																									SO:0001819	synonymous_variant	250	exon11			GCTGGCCGGGACC	M14169	CCDS2490.1	2q37.1	2010-06-24	2010-06-24		ENSG00000163283	ENSG00000163283	3.1.3.1		439	protein-coding gene	gene with protein product	"""Regan isozyme"""	171800	"""alkaline phosphatase, placental (Regan isozyme)"""			3001717, 3461452	Standard	XM_005246439		Approved		uc002vsq.3	P05187	OTTHUMG00000133255	ENST00000392027.2:c.1569C>A	2.37:g.233246466C>A			Somatic	29	0.0344827586	1		WXS	Illumina HiSeq	Phase_I	19	0.16	3	NM_001632	0		0	P05188|P06861|Q53S78|Q96DB7	Silent	SNP	ENST00000392027.2	37	CCDS2490.1																																																																																					0.736	ALPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257032.3		NM_001632	
ALPI	248	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	233321406	233321406	+	Splice_Site	SNP	G	G	A			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr2:233321406G>A	ENST00000295463.3	+	3	377		c.e3+1			NM_001631.3	NP_001622.2	P09923	PPBI_HUMAN	alkaline phosphatase, intestinal						dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|protease binding (GO:0002020)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|prostate(2)|upper_aerodigestive_tract(1)	24		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.64e-16)|Kidney(3;9.71e-08)|KIRC - Kidney renal clear cell carcinoma(3;2.74e-06)|BRCA - Breast invasive adenocarcinoma(100;0.000763)|Lung(119;0.00564)|LUSC - Lung squamous cell carcinoma(224;0.00746)		TCTGTCCAAGGTAAGGGCTGG	0.607																																					.													.	.			0			c.300+1G>A												26.0	25.0	25.0					2																	233321406		2201	4297	6498	SO:0001630	splice_region_variant	248	exon3			TCCAAGGTAAGGG	M15694	CCDS2492.1	2q37.1	2008-02-05			ENSG00000163295	ENSG00000163295	3.1.3.1		437	protein-coding gene	gene with protein product		171740				3468508, 3469665	Standard	NM_001631		Approved		uc002vst.4	P09923	OTTHUMG00000133258	ENST00000295463.3:c.300+1G>A	2.37:g.233321406G>A			Somatic	110	0	0		WXS	Illumina HiSeq	.	89	0.19	17	NM_001631	0		0	B2R7Y4|Q53S80|Q9UBV5|Q9UCL2	Splice_Site	SNP	ENST00000295463.3	37	CCDS2492.1	.	.	.	.	.	.	.	.	.	.	G	16.52	3.146070	0.57044	.	.	ENSG00000163295	ENST00000295463	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5859	0.91189	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ALPI	233029650	1.000000	0.71417	1.000000	0.80357	0.469000	0.32828	6.372000	0.73123	2.814000	0.96858	0.655000	0.94253	.			0.607	ALPI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257035.2		NM_001631	Intron
CDC25B	994	mdanderson.org	37	20	3777215	3777215	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr20:3777215G>T	ENST00000245960.5	+	1	734	c.37G>T	c.(37-39)Gct>Tct	p.A13S	CDC25B_ENST00000379598.5_Intron|CDC25B_ENST00000340833.4_Missense_Mutation_p.A13S|CDC25B_ENST00000344256.6_Intron|CDC25B_ENST00000467519.1_Intron|CDC25B_ENST00000439880.2_Missense_Mutation_p.A13S	NM_004358.3|NM_021872.2|NM_021873.2	NP_004349.1|NP_068658.1|NP_068659.1	P30305	MPIP2_HUMAN	cell division cycle 25B	13					female meiosis I (GO:0007144)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|oocyte maturation (GO:0001556)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein kinase activity (GO:0045860)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			NS(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(1)	18						GCCAGGCTCGGCTCTCAGTCC	0.766																																					p.A13S													.	.			0			c.G37T												2.0	3.0	3.0					20																	3777215		1534	3271	4805	SO:0001583	missense	994	exon1			GGCTCGGCTCTCA		CCDS13065.1, CCDS13066.1, CCDS13067.1, CCDS74700.1, CCDS74701.1	20p13	2013-01-17	2013-01-17		ENSG00000101224	ENSG00000101224		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"""	1726	protein-coding gene	gene with protein product		116949	"""cell division cycle 25B"", ""cell division cycle 25 homolog B (S. cerevisiae)"", ""cell division cycle 25 homolog B (S. pombe)"""			1836978	Standard	NM_021873		Approved		uc002wjn.3	P30305	OTTHUMG00000031764	ENST00000245960.5:c.37G>T	20.37:g.3777215G>T	ENSP00000245960:p.Ala13Ser		Somatic	10	0	0		WXS	Illumina HiSeq	Phase_I	18	0.17	3	NM_021873	22	0.00	0	D3DVY1|D3DVY2|D3DVY3|D3DVY4|O43551|Q13971|Q5JX77|Q6RSS1|Q9BRA6	Missense_Mutation	SNP	ENST00000245960.5	37	CCDS13067.1	.	.	.	.	.	.	.	.	.	.	G	12.59	1.984980	0.35036	.	.	ENSG00000101224	ENST00000245960;ENST00000439880;ENST00000340833	T;T;T	0.19250	2.34;2.32;2.16	4.27	-1.82	0.07857	.	0.701264	0.14174	N	0.336462	T	0.13670	0.0331	L	0.47716	1.5	0.22330	N	0.999198	P;P;P	0.42692	0.461;0.787;0.682	B;B;B	0.37601	0.13;0.254;0.129	T	0.14980	-1.0453	10	0.33940	T	0.23	0.3591	5.5791	0.17241	0.2504:0.2629:0.4867:0.0	.	13;13;13	P30305-3;P30305-2;P30305	.;.;MPIP2_HUMAN	S	13	ENSP00000245960:A13S;ENSP00000405972:A13S;ENSP00000339170:A13S	ENSP00000245960:A13S	A	+	1	0	CDC25B	3725215	0.004000	0.15560	0.044000	0.18714	0.299000	0.27559	-0.188000	0.09642	-0.379000	0.07906	-1.113000	0.02065	GCT			0.766	CDC25B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077779.2		NM_021874	
TMX4	56255	broad.mit.edu	37	20	8000252	8000252	+	Silent	SNP	A	A	C			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr20:8000252A>C	ENST00000246024.2	-	1	224	c.9T>G	c.(7-9)ggT>ggG	p.G3G	RP5-971N18.3_ENST00000607924.1_RNA|RP5-971N18.3_ENST00000457707.1_RNA	NM_021156.2	NP_066979.2	Q9H1E5	TMX4_HUMAN	thioredoxin-related transmembrane protein 4	3					cell redox homeostasis (GO:0045454)|oxidation-reduction process (GO:0055114)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			endometrium(3)|large_intestine(2)|lung(11)|skin(1)	17						CGCAGCGCCCACCCGCCATGT	0.761																																					p.G3G													.	TMX4	39		0			c.T9G												1.0	1.0	1.0					20																	8000252		958	2169	3127	SO:0001819	synonymous_variant	56255	exon1			GCGCCCACCCGCC		CCDS13101.1	20p12	2011-10-19	2009-02-23	2009-02-23	ENSG00000125827	ENSG00000125827		"""Protein disulfide isomerases"""	25237	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 14"""		"""thioredoxin domain containing 13"""	TXNDC13			Standard	NM_021156		Approved	DJ971N18.2, KIAA1162, PDIA14	uc002wmx.1	Q9H1E5	OTTHUMG00000031843	ENST00000246024.2:c.9T>G	20.37:g.8000252A>C			Somatic	40	0.425	17		WXS	Illumina HiSeq	Phase_I	41	0.51	21	NM_021156	6	0.00	0	Q8N4P7|Q8NCC1|Q9UJA1|Q9ULQ8	Silent	SNP	ENST00000246024.2	37	CCDS13101.1																																																																																					0.761	TMX4-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000077928.2		NM_021156	
RRBP1	6238	bcgsc.ca	37	20	17639790	17639790	+	Missense_Mutation	SNP	C	C	T	rs111560928		TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr20:17639790C>T	ENST00000377813.1	-	3	1666	c.1363G>A	c.(1363-1365)Gcc>Acc	p.A455T	RRBP1_ENST00000377807.2_Intron|RRBP1_ENST00000360807.4_Intron|RRBP1_ENST00000455029.2_Intron|RRBP1_ENST00000246043.4_Missense_Mutation_p.A455T			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	455	41 X 10 AA approximate tandem repeats of [TN]-Q-[GSA]-[KRQT]-K-[ATGSV]-[ED]- [GTAS]-[ATIS]-[PQTAS].				osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						TGGTTCTGGGCCCCCTCGGCC	0.667																																					.													.	RRBP1	157		0			.																																									SO:0001583	missense	6238	.			TCTGGGCCCCCTC	AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.1363G>A	20.37:g.17639790C>T	ENSP00000367044:p.Ala455Thr		Somatic	234	0.0341880342	8		WXS	Illumina HiSeq	Phase_1	206	0.06	13	.	1232	0.16	196	A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Missense_Mutation	SNP	ENST00000377813.1	37		.	.	.	.	.	.	.	.	.	.	C	5.956	0.360386	0.11296	.	.	ENSG00000125844	ENST00000377813;ENST00000246043	T;T	0.42513	0.97;0.97	4.63	-5.82	0.02333	.	0.474496	0.15770	N	0.245458	T	0.19485	0.0468	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.21793	-1.0235	7	0.21014	T	0.42	-7.3899	3.3287	0.07076	0.1164:0.2312:0.1149:0.5376	.	.	.	.	T	455	ENSP00000367044:A455T;ENSP00000246043:A455T	ENSP00000246043:A455T	A	-	1	0	RRBP1	17587790	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.507000	0.00448	-0.805000	0.04404	-0.367000	0.07326	GCC			0.667	RRBP1-002	NOVEL	basic	protein_coding	protein_coding		OTTHUMT00000078125.1		NM_001042576	
FAM182B	728882	hgsc.bcm.edu;mdanderson.org	37	20	25755519	25755519	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr20:25755519T>G	ENST00000376403.1	-	3	815	c.437A>C	c.(436-438)cAt>cCt	p.H146P	FAM182B_ENST00000478164.1_Intron|FAM182B_ENST00000376404.2_Intron			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B	146										lung(1)	1						GCGGCCACCATGCTGCCCGCT	0.706																																					.													.	.			0			.																																									SO:0001583	missense	728882	.			CCACCATGCTGCC			20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000376403.1:c.437A>C	20.37:g.25755519T>G	ENSP00000365585:p.His146Pro		Somatic	65	0	0		WXS	Illumina HiSeq	.	63	0.11	7	.	3	0.00	0	Q4G0Q1	RNA	SNP	ENST00000376403.1	37		.	.	.	.	.	.	.	.	.	.	.	0.827	-0.746612	0.03065	.	.	ENSG00000175170	ENST00000376403	.	.	.	.	.	.	.	.	.	.	.	T	0.39036	0.1063	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.39210	-0.9625	3	0.87932	D	0	.	.	.	.	.	.	.	.	P	146	.	ENSP00000365585:H146P	H	-	2	0	FAM182B	25703519	0.078000	0.21339	0.062000	0.19696	0.062000	0.15995	-0.905000	0.04075	0.056000	0.16144	0.055000	0.15244	CAT			0.706	FAM182B-003	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding		OTTHUMT00000078463.2		NR_026714	
OGFR	11054	mdanderson.org	37	20	61436316	61436316	+	Silent	SNP	C	C	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr20:61436316C>T	ENST00000290291.6	+	1	130	c.105C>T	c.(103-105)gaC>gaT	p.D35D	OGFR_ENST00000370461.1_5'Flank|OGFR-AS1_ENST00000431361.1_RNA	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	35					opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)			endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					GCGCGAGGGACGCGGACGCAG	0.761																																					p.D35D													.	.			0			c.C105T												16.0	16.0	16.0					20																	61436316		1703	3180	4883	SO:0001819	synonymous_variant	11054	exon1			GAGGGACGCGGAC	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.105C>T	20.37:g.61436316C>T			Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	15	0.13	2	NM_007346	118	0.00	0	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Silent	SNP	ENST00000290291.6	37	CCDS13504.1																																																																																					0.761	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000080067.1			
AP001347.6	0	broad.mit.edu	37	21	15461085	15461085	+	RNA	DEL	G	G	-	rs199958475|rs9917537	byFrequency	TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr21:15461085delG	ENST00000428809.1	+	0	372				AP001347.6_ENST00000432621.1_RNA|AP001347.6_ENST00000448463.1_RNA																							CTTaaaaaaagaaaagaaaag	0.338																																					.													.	.			0			.																																											0	.			AAAAAAGAAAAGA																													21.37:g.15461085delG			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	DEL	ENST00000428809.1	37																																																																																						0.338	AP001347.6-001	KNOWN	basic	antisense	antisense		OTTHUMT00000157812.1			
HMGN1	3150	broad.mit.edu	37	21	40720231	40720231	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr21:40720231T>C	ENST00000380749.5	-	4	395	c.113A>G	c.(112-114)aAg>aGg	p.K38R	HMGN1_ENST00000361263.4_5'Flank|snoU13_ENST00000459446.1_RNA|HMGN1_ENST00000489072.1_5'UTR|HMGN1_ENST00000380747.1_Missense_Mutation_p.K54R|HMGN1_ENST00000380748.1_Missense_Mutation_p.K28R	NM_004965.6	NP_004956.5	P05114	HMGN1_HUMAN	high mobility group nucleosome binding domain 1	38					chromatin organization (GO:0006325)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|post-embryonic camera-type eye morphogenesis (GO:0048597)|pyrimidine dimer repair by nucleotide-excision repair (GO:0000720)|regulation of development, heterochronic (GO:0040034)|regulation of epithelial cell proliferation (GO:0050678)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to UV-B (GO:0010224)|response to UV-C (GO:0010225)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(2)|lung(1)	3		Prostate(19;8.69e-07)				CGCTGCTGCCTTTTTCGGCTT	0.547																																					p.K38R													.	HMGN1	8		0			c.A113G												90.0	89.0	89.0					21																	40720231		2203	4300	6503	SO:0001583	missense	3150	exon4			GCTGCCTTTTTCG		CCDS33559.1	21q22.3	2011-07-01	2011-04-05	2002-08-16	ENSG00000205581	ENSG00000205581		"""High-mobility group / Canonical"""	4984	protein-coding gene	gene with protein product	"""high-mobility group nucleosome binding 1"", ""nonhistone chromosomal protein HMG-14"""	163920	"""high-mobility group (nonhistone chromosomal) protein 14"", ""high-mobility group nucleosome binding domain 1"""	HMG14		3782107, 2563381	Standard	NM_004965		Approved	FLJ27265, FLJ31471, MGC104230, MGC117425	uc002yxo.3	P05114	OTTHUMG00000066178	ENST00000380749.5:c.113A>G	21.37:g.40720231T>C	ENSP00000370125:p.Lys38Arg		Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	204	0.02	5	NM_004965	2084	0.00	0	Q3KQR8	Missense_Mutation	SNP	ENST00000380749.5	37	CCDS33559.1	.	.	.	.	.	.	.	.	.	.	T	10.89	1.477052	0.26511	.	.	ENSG00000205581	ENST00000380749;ENST00000380748;ENST00000380747	.	.	.	4.4	3.22	0.36961	.	.	.	.	.	T	0.44265	0.1285	L	0.60455	1.87	0.80722	D	1	P	0.39157	0.662	B	0.38921	0.285	T	0.34750	-0.9816	8	0.33141	T	0.24	.	5.7595	0.18192	0.0:0.0938:0.1661:0.74	.	38	P05114	HMGN1_HUMAN	R	38;28;54	.	ENSP00000288344:K38R	K	-	2	0	HMGN1	39642101	1.000000	0.71417	0.991000	0.47740	0.419000	0.31324	2.573000	0.46007	1.598000	0.50083	0.533000	0.62120	AAG			0.547	HMGN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000141645.2		NM_004965	
NF1P6	644637	bcgsc.ca	37	22	16346480	16346480	+	IGR	SNP	A	A	G	rs11703442		TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr22:16346480A>G								POTEH (58543 upstream) : LA16c-2F2.8 (26600 downstream)																							TTAAATGCTTAGTAGCACAGA	0.284																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	644637	.			ATGCTTAGTAGCA																													22.37:g.16346480A>G			Somatic	82	0.012195122	1		WXS	Illumina HiSeq	Phase_1	141	0.15	21	.	0		0		RNA	SNP		37																																																																																					0	0.284										
CECR2	27443	broad.mit.edu	37	22	17978523	17978523	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr22:17978523C>T	ENST00000400573.5	+	4	428	c.421C>T	c.(421-423)Cga>Tga	p.R141*	CECR2_ENST00000400585.2_5'UTR|CECR2_ENST00000342247.5_Nonsense_Mutation_p.R121*|CECR2_ENST00000262608.8_Nonsense_Mutation_p.R122*			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	163					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		CTATGGAACACGAATGTACAA	0.458																																					.													.	CECR2	233		0			.												77.0	74.0	75.0					22																	17978523		1861	4103	5964	SO:0001587	stop_gained	27443	.			GGAACACGAATGT	AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400573.5:c.421C>T	22.37:g.17978523C>T	ENSP00000383417:p.Arg141*		Somatic	184	0	0		WXS	Illumina HiSeq	Phase_I	150	0.03	5	.	46	0.00	0	A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Nonsense_Mutation	SNP	ENST00000400573.5	37		.	.	.	.	.	.	.	.	.	.	C	29.6	5.017182	0.93404	.	.	ENSG00000099954	ENST00000342247;ENST00000400573;ENST00000262608	.	.	.	5.74	5.74	0.90152	.	0.000000	0.31071	U	0.008315	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.6768	19.9332	0.97128	0.0:1.0:0.0:0.0	.	.	.	.	X	121;141;122	.	ENSP00000262608:R122X	R	+	1	2	CECR2	16358523	0.997000	0.39634	0.988000	0.46212	0.997000	0.91878	3.630000	0.54273	2.702000	0.92279	0.655000	0.94253	CGA			0.458	CECR2-001	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000316104.5		NM_031413	
MYO18B	84700	broad.mit.edu	37	22	26224747	26224747	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr22:26224747T>C	ENST00000407587.2	+	15	2960	c.2791T>C	c.(2791-2793)Ttt>Ctt	p.F931L	MYO18B_ENST00000335473.7_Missense_Mutation_p.F931L|MYO18B_ENST00000536101.1_Missense_Mutation_p.F931L			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	931	Myosin motor.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CCCTAGATCCTTTTCCTCCCA	0.562																																					p.F931L													.	MYO18B	322		0			c.T2791C												117.0	118.0	118.0					22																	26224747		2010	4186	6196	SO:0001583	missense	84700	exon15			AGATCCTTTTCCT	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.2791T>C	22.37:g.26224747T>C	ENSP00000386096:p.Phe931Leu		Somatic	68	0.0294117647	2		WXS	Illumina HiSeq	Phase_I	87	0.05	4	NM_032608	0		0	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37		.	.	.	.	.	.	.	.	.	.	T	0.182	-1.061501	0.01950	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.81908	-1.55;-1.55;-1.55	4.69	3.66	0.41972	Myosin head, motor domain (2);	0.376755	0.27896	N	0.017415	T	0.49525	0.1562	N	0.00855	-1.145	0.34164	D	0.668955	B;B;B;B	0.13594	0.003;0.008;0.005;0.006	B;B;B;B	0.14023	0.006;0.01;0.004;0.006	T	0.54207	-0.8328	10	0.02654	T	1	.	6.9148	0.24354	0.0:0.1817:0.0:0.8183	.	444;931;931;931	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	L	931	ENSP00000441229:F931L;ENSP00000334563:F931L;ENSP00000386096:F931L	ENSP00000334563:F931L	F	+	1	0	MYO18B	24554747	0.995000	0.38212	0.999000	0.59377	0.330000	0.28571	2.577000	0.46042	0.832000	0.34804	0.460000	0.39030	TTT			0.562	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding		OTTHUMT00000400691.1		NM_032608	
ITPR1	3708	mdanderson.org	37	3	4718333	4718333	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr3:4718333G>T	ENST00000443694.2	+	21	2770	c.2770G>T	c.(2770-2772)Gag>Tag	p.E924*	ITPR1_ENST00000423119.2_Nonsense_Mutation_p.E930*|ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000354582.6_Nonsense_Mutation_p.E939*|ITPR1_ENST00000302640.8_Nonsense_Mutation_p.E924*|ITPR1_ENST00000357086.4_Nonsense_Mutation_p.E930*|ITPR1_ENST00000456211.2_Nonsense_Mutation_p.E915*			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	939					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	TGGCGTGGGAGAGCTGATGAC	0.547																																					p.E930X													.	.			0			c.G2788T												78.0	82.0	81.0					3																	4718333		2043	4202	6245	SO:0001587	stop_gained	3708	exon24			GTGGGAGAGCTGA	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.2770G>T	3.37:g.4718333G>T	ENSP00000401671:p.Glu924*		Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_001099952	2	0.00	0	E7EPX7|E9PDE9|Q14660|Q99897	Nonsense_Mutation	SNP	ENST00000443694.2	37	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	G	45	11.516846	0.99570	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000357086;ENST00000456211;ENST00000443694	.	.	.	4.1	4.1	0.47936	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	16.8665	0.86030	0.0:0.0:1.0:0.0	.	.	.	.	X	939;924;939;930;930;915;924	.	ENSP00000306253:E924X	E	+	1	0	ITPR1	4693333	1.000000	0.71417	0.967000	0.41034	0.897000	0.52465	7.305000	0.78891	2.280000	0.76307	0.313000	0.20887	GAG			0.547	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000337982.3		NM_002222	
EDEM1	9695	broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	5229493	5229493	+	Start_Codon_SNP	SNP	G	G	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr3:5229493G>T	ENST00000256497.4	+	1	136	c.3G>T	c.(1-3)atG>atT	p.M1I	EDEM1_ENST00000445686.1_5'Flank|AC026202.1_ENST00000600805.1_Missense_Mutation_p.H164N|AC026202.3_ENST00000439325.1_RNA	NM_014674.2	NP_055489.1	Q92611	EDEM1_HUMAN	ER degradation enhancer, mannosidase alpha-like 1	1					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	calcium ion binding (GO:0005509)|misfolded protein binding (GO:0051787)			NS(1)|breast(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22				Epithelial(13;0.0588)|OV - Ovarian serous cystadenocarcinoma(96;0.0682)		GCGCGACCATGCAATGGCGAG	0.701																																					p.M1I													EDEM1,NS,carcinoma,+2,1	EDEM1	45	1	0			c.G3T												14.0	18.0	16.0					3																	5229493		2197	4298	6495	SO:0001582	initiator_codon_variant	0	exon1			GACCATGCAATGG	D86967	CCDS33686.1	3p26.1	2008-02-05			ENSG00000134109	ENSG00000134109			18967	protein-coding gene	gene with protein product		607673				12610306	Standard	NM_014674		Approved	KIAA0212, EDEM	uc003bqi.3	Q92611	OTTHUMG00000154896	ENST00000256497.4:c.3G>T	3.37:g.5229493G>T	ENSP00000256497:p.Met1Ile		Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	52	0.10	5	NM_014674	5	0.00	0	A8K9C8|B4DXP3	Missense_Mutation	SNP	ENST00000256497.4	37	CCDS33686.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.087543	0.76642	.	.	ENSG00000134109	ENST00000256497	D	0.84730	-1.89	3.95	3.95	0.45737	.	0.346719	0.37304	N	0.002151	T	0.80639	0.4661	.	.	.	0.80722	D	1	B	0.25667	0.131	B	0.19666	0.026	T	0.81013	-0.1125	9	0.87932	D	0	-31.0453	13.9362	0.64026	0.0:0.0:1.0:0.0	.	1	Q92611	EDEM1_HUMAN	I	1	ENSP00000256497:M1I	ENSP00000256497:M1I	M	+	3	0	EDEM1	5204493	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	5.177000	0.65032	2.016000	0.59253	0.306000	0.20318	ATG			0.701	EDEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000337566.2		NM_014674	Missense_Mutation
PLXNB1	5364	mdanderson.org	37	3	48461313	48461313	+	Silent	SNP	C	C	T	rs2362450	byFrequency	TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr3:48461313C>T	ENST00000358536.4	-	11	2651	c.2382G>A	c.(2380-2382)ccG>ccA	p.P794P	PLXNB1_ENST00000456774.1_Intron|PLXNB1_ENST00000296440.6_Silent_p.P794P|PLXNB1_ENST00000448774.2_Intron|PLXNB1_ENST00000358459.4_Intron	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	794	Pro-rich.				axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CTACCTCTGACGGTGACAGCG	0.657																																					p.P794P													PLXNB1,colon,carcinoma,-2,1	PLXNB1	-2	1	0			c.G2382A												13.0	16.0	15.0					3																	48461313		2202	4294	6496	SO:0001819	synonymous_variant	5364	exon11			CTCTGACGGTGAC	X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.2382G>A	3.37:g.48461313C>T			Somatic	96	0	0		WXS	Illumina HiSeq	Phase_I	91	0.03	3	NM_001130082	17	0.00	0	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Silent	SNP	ENST00000358536.4	37	CCDS2765.1																																																																																					0.657	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000344454.1		NM_002673	
TMPRSS7	344805	broad.mit.edu	37	3	111799770	111799770	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr3:111799770G>T	ENST00000452346.2	+	18	2374	c.2371G>T	c.(2371-2373)Ggt>Tgt	p.G791C	TMPRSS7_ENST00000419127.1_Missense_Mutation_p.G665C			Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	791	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(2)|endometrium(6)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						GGGAGATTCGGGTGGACCTTT	0.383																																					p.G665C													.	TMPRSS7	126		0			c.G1993T												236.0	222.0	227.0					3																	111799770		1900	4134	6034	SO:0001583	missense	344805	exon16			GATTCGGGTGGAC	BN000125	CCDS43129.2	3q13.2	2010-04-13	2004-03-16		ENSG00000176040	ENSG00000176040		"""Serine peptidases / Transmembrane"""	30846	protein-coding gene	gene with protein product			"""type II transmembrane serine protease 7"""			12838346	Standard	NM_001042575		Approved		uc010hqb.2	Q7RTY8	OTTHUMG00000157148	ENST00000452346.2:c.2371G>T	3.37:g.111799770G>T	ENSP00000398236:p.Gly791Cys		Somatic	235	0	0		WXS	Illumina HiSeq	Phase_I	241	0.03	7	NM_001042575	0		0	C9J8P7|E9PAS3|Q17RH4	Missense_Mutation	SNP	ENST00000452346.2	37		.	.	.	.	.	.	.	.	.	.	G	23.9	4.473425	0.84640	.	.	ENSG00000176040	ENST00000452346;ENST00000443106;ENST00000437906;ENST00000419127	D;D	0.99871	-7.35;-7.35	5.75	5.75	0.90469	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.99935	0.9971	H	0.99794	4.785	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95995	0.8989	10	0.87932	D	0	.	18.7257	0.91713	0.0:0.0:1.0:0.0	.	791;665	Q7RTY8;Q7RTY8-2	TMPS7_HUMAN;.	C	791;779;765;665	ENSP00000398236:G791C;ENSP00000411645:G665C	ENSP00000411645:G665C	G	+	1	0	TMPRSS7	113282460	1.000000	0.71417	0.960000	0.40013	0.922000	0.55478	8.943000	0.92975	2.728000	0.93425	0.650000	0.86243	GGT			0.383	TMPRSS7-003	NOVEL	NAGNAG_splice_site|not_organism_supported|basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000347592.2		XM_293599	
EFCC1	79825	mdanderson.org	37	3	128720514	128720514	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr3:128720514G>T	ENST00000480450.1	+	1	43	c.43G>T	c.(43-45)Gcg>Tcg	p.A15S	EFCC1_ENST00000436022.2_5'UTR|KIAA1257_ENST00000510149.1_Intron			Q9HA90	EFCC1_HUMAN	EF-hand and coiled-coil domain containing 1	15							calcium ion binding (GO:0005509)										CATGGAGGGCGCGGGAGGTGA	0.756																																					p.A15S													.	.			0			c.G43T																																									SO:0001583	missense	79825	exon1			GAGGGCGCGGGAG	AK022119	CCDS3054.1, CCDS3054.2	3q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000114654	ENSG00000114654		"""EF-hand domain containing"""	25692	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 73"", ""coiled-coil domain containing 48"""	C3orf73, CCDC48			Standard	NM_024768		Approved	FLJ12057	uc011bkt.2	Q9HA90	OTTHUMG00000158996	ENST00000480450.1:c.43G>T	3.37:g.128720514G>T	ENSP00000420075:p.Ala15Ser		Somatic	11	0	0		WXS	Illumina HiSeq	Phase_I	10	0.20	2	NM_024768	0		0	A8MYE2	Missense_Mutation	SNP	ENST00000480450.1	37	CCDS3054.2	.	.	.	.	.	.	.	.	.	.	g	12.43	1.935354	0.34189	.	.	ENSG00000114654	ENST00000480450	T	0.58652	0.32	3.51	-0.957	0.10350	.	0.297853	0.25958	N	0.027204	T	0.31765	0.0807	N	0.19112	0.55	0.80722	D	1	B	0.24882	0.113	B	0.24848	0.056	T	0.03268	-1.1054	10	0.15066	T	0.55	1.0988	4.8541	0.13550	0.0:0.1691:0.2973:0.5336	.	15	Q9HA90	CCD48_HUMAN	S	15	ENSP00000420075:A15S	ENSP00000420075:A15S	A	+	1	0	CCDC48	130203204	0.552000	0.26505	0.964000	0.40570	0.110000	0.19582	1.619000	0.36965	-0.034000	0.13713	0.299000	0.19835	GCG			0.756	EFCC1-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000352832.1		NM_024768	
SI	6476	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	164709984	164709984	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr3:164709984C>A	ENST00000264382.3	-	43	5026	c.4964G>T	c.(4963-4965)cGg>cTg	p.R1655L		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1655	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	GTCAAACCACCGAGCATTGGG	0.348										HNSCC(35;0.089)																											p.R1655L													.	.			0			c.G4964T												131.0	138.0	136.0					3																	164709984		2203	4300	6503	SO:0001583	missense	6476	exon43			AACCACCGAGCAT	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.4964G>T	3.37:g.164709984C>A	ENSP00000264382:p.Arg1655Leu		Somatic	184	0	0		WXS	Illumina HiSeq	.	259	0.12	32	NM_001041	0		0	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	C	16.76	3.212896	0.58452	.	.	ENSG00000090402	ENST00000264382	D	0.91237	-2.81	4.74	4.74	0.60224	.	0.000000	0.85682	D	0.000000	D	0.88526	0.6460	L	0.49126	1.545	0.58432	D	0.999997	B	0.34349	0.45	B	0.36567	0.228	D	0.87631	0.2516	10	0.40728	T	0.16	.	16.0285	0.80560	0.0:1.0:0.0:0.0	.	1655	P14410	SUIS_HUMAN	L	1655	ENSP00000264382:R1655L	ENSP00000264382:R1655L	R	-	2	0	SI	166192678	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.411000	0.59781	2.609000	0.88269	0.655000	0.94253	CGG			0.348	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350116.1		NM_001041	
ADD1	118	broad.mit.edu	37	4	2895781	2895781	+	Silent	SNP	T	T	C			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr4:2895781T>C	ENST00000398129.1	+	4	572	c.552T>C	c.(550-552)ccT>ccC	p.P184P	ADD1_ENST00000398123.2_Silent_p.P184P|ADD1_ENST00000503455.2_Silent_p.P184P|ADD1_ENST00000446856.1_Silent_p.P184P|ADD1_ENST00000264758.7_Silent_p.P184P|ADD1_ENST00000513328.2_Silent_p.P184P|ADD1_ENST00000398125.1_Silent_p.P184P|ADD1_ENST00000355842.3_Silent_p.P184P			P35611	ADDA_HUMAN	adducin 1 (alpha)	184					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cell morphogenesis (GO:0000902)|cell volume homeostasis (GO:0006884)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|endoplasmic reticulum unfolded protein response (GO:0030968)|erythrocyte differentiation (GO:0030218)|hemoglobin metabolic process (GO:0020027)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein binding (GO:0032092)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|F-actin capping protein complex (GO:0008290)|focal adhesion (GO:0005925)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TCATTGTCCCTTTTGGGCTTC	0.428																																					p.P184P	Esophageal Squamous(71;505 1201 20414 34538 37449)												.	ADD1	56		0			c.T552C												205.0	175.0	185.0					4																	2895781		2203	4300	6503	SO:0001819	synonymous_variant	118	exon5			TGTCCCTTTTGGG	L07261	CCDS3363.1, CCDS3364.1, CCDS43205.1, CCDS75094.1	4p16.3	2009-04-22			ENSG00000087274	ENSG00000087274			243	protein-coding gene	gene with protein product		102680				1840603	Standard	NM_001119		Approved		uc003gfq.3	P35611	OTTHUMG00000122080	ENST00000398129.1:c.552T>C	4.37:g.2895781T>C			Somatic	172	0	0		WXS	Illumina HiSeq	Phase_I	175	0.02	3	NM_014190	86	0.00	0	A2A3N8|A2A3P0|B4DI79|D3DVR3|D3DVR4|D3DVR5|Q13734|Q14729|Q16156|Q86XM2|Q9UJB6	Silent	SNP	ENST00000398129.1	37	CCDS43205.1																																																																																					0.428	ADD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000242840.1		NM_014189	
BST1	683	mdanderson.org	37	4	15704856	15704856	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr4:15704856C>T	ENST00000265016.4	+	1	284	c.89C>T	c.(88-90)gCg>gTg	p.A30V	BST1_ENST00000382346.3_Missense_Mutation_p.A30V	NM_004334.2	NP_004325.2	Q10588	BST1_HUMAN	bone marrow stromal cell antigen 1	30					humoral immune response (GO:0006959)|multicellular organismal development (GO:0007275)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	NAD(P)+ nucleosidase activity (GO:0050135)|NAD+ nucleosidase activity (GO:0003953)|transferase activity (GO:0016740)			central_nervous_system(1)|large_intestine(1)|lung(2)|stomach(3)|urinary_tract(1)	8						gcgggcggggcgcgcgcgcgg	0.726																																					p.A30V													.	.			0			c.C89T												3.0	4.0	4.0					4																	15704856		1804	3715	5519	SO:0001583	missense	683	exon1			GCGGGGCGCGCGC	D21878	CCDS3416.1	4p15	2010-05-04			ENSG00000109743	ENSG00000109743	3.2.2.5	"""CD molecules"""	1118	protein-coding gene	gene with protein product	"""NAD(+) nucleosidase"", ""ADP-ribosyl cyclase 2"""	600387				8202488	Standard	NM_004334		Approved	CD157	uc003goh.4	Q10588	OTTHUMG00000097739	ENST00000265016.4:c.89C>T	4.37:g.15704856C>T	ENSP00000265016:p.Ala30Val		Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	20	0.10	2	NM_004334	3	0.00	0	B2R6A2|Q1XII0|Q5U0K0|Q96EN3	Missense_Mutation	SNP	ENST00000265016.4	37	CCDS3416.1	.	.	.	.	.	.	.	.	.	.	C	9.000	0.979811	0.18812	.	.	ENSG00000109743	ENST00000265016;ENST00000382346	T;T	0.15139	2.48;2.45	3.22	-2.65	0.06095	.	1.178170	0.06446	N	0.726953	T	0.09642	0.0237	N	0.21448	0.665	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.36672	-0.9738	10	0.29301	T	0.29	-3.7819	4.0555	0.09814	0.0:0.308:0.3437:0.3483	.	30	Q10588	BST1_HUMAN	V	30	ENSP00000265016:A30V;ENSP00000371783:A30V	ENSP00000265016:A30V	A	+	2	0	BST1	15313954	0.000000	0.05858	0.000000	0.03702	0.072000	0.16883	-1.621000	0.02044	-0.518000	0.06452	-0.369000	0.07265	GCG			0.726	BST1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000214968.2		NM_004334	
LCORL	254251	mdanderson.org	37	4	18023327	18023327	+	Silent	SNP	G	G	A			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr4:18023327G>A	ENST00000382226.5	-	1	156	c.48C>T	c.(46-48)gcC>gcT	p.A16A	LCORL_ENST00000326877.4_Silent_p.A16A|LCORL_ENST00000512376.2_5'UTR|LCORL_ENST00000382224.1_5'Flank|LCORL_ENST00000539056.1_5'UTR	NM_001166139.1	NP_001159611.1	Q8N3X6	LCORL_HUMAN	ligand dependent nuclear receptor corepressor-like	16	Ala-rich.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)			kidney(1)|large_intestine(1)|lung(1)|prostate(1)	4						cggcggcggcggcagcagcgg	0.697																																					p.A16A													.	.			0			c.C48T												2.0	3.0	2.0					4																	18023327		1081	2500	3581	SO:0001819	synonymous_variant	254251	exon1			GGCGGCGGCAGCA		CCDS3425.1, CCDS54749.1	4p15.32	2006-06-14			ENSG00000178177	ENSG00000178177			30776	protein-coding gene	gene with protein product		611799				12560079	Standard	NM_153686		Approved	MLR1, FLJ30696	uc021xmr.1	Q8N3X6	OTTHUMG00000128538	ENST00000382226.5:c.48C>T	4.37:g.18023327G>A			Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	69	0.06	4	NM_153686	0		0	Q96NK1	Silent	SNP	ENST00000382226.5	37	CCDS54749.1																																																																																					0.697	LCORL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_153686	
GYPB	2994	broad.mit.edu	37	4	144922392	144922392	+	Missense_Mutation	SNP	G	G	A	rs201949116		TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr4:144922392G>A	ENST00000502664.1	-	2	133	c.82C>T	c.(82-84)Cac>Tac	p.H28Y	RP11-673E1.4_ENST00000506982.1_RNA|GYPB_ENST00000429670.2_Missense_Mutation_p.H28Y|GYPB_ENST00000513128.1_Intron|GYPB_ENST00000283126.7_Missense_Mutation_p.H28Y|GYPB_ENST00000510196.2_5'UTR	NM_002100.4	NP_002091	P06028	GLPB_HUMAN	glycophorin B (MNS blood group)	28						integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|large_intestine(2)|skin(1)	4	all_hematologic(180;0.158)					GTTGAAGTGTGCATTGCCACC	0.363																																					p.H28Y													.	GYPB	17		0			c.C82T							G	TYR/HIS	0,4394		0,0,2197	171.0	208.0	195.0		82	-0.1	0.0	4		195	3,8597	3.0+/-9.4	0,3,4297	no	missense	GYPB	NM_002100.4	83	0,3,6494	AA,AG,GG		0.0349,0.0,0.0231		28/92	144922392	3,12991	2197	4300	6497	SO:0001583	missense	2994	exon2			AAGTGTGCATTGC		CCDS54809.1	4q31.21	2014-09-17	2006-02-23			ENSG00000250361		"""CD molecules"", ""Blood group antigens"""	4703	protein-coding gene	gene with protein product		111740	"""glycophorin B (includes Ss blood group)"", ""glycophorin B (Ss blood group)"""	MNS			Standard	NM_002100		Approved	GPB, SS, CD235b		P06028		ENST00000502664.1:c.82C>T	4.37:g.144922392G>A	ENSP00000427690:p.His28Tyr		Somatic	497	0	0		WXS	Illumina HiSeq	Phase_I	483	0.01	6	NM_002100	0		0	B8Q174|E2QBW7|Q0VAF4|Q58HE9|Q58HF0|Q58HF1|Q9UCH7	Missense_Mutation	SNP	ENST00000502664.1	37	CCDS54809.1	.	.	.	.	.	.	.	.	.	.	G	10.29	1.308177	0.23821	0.0	3.49E-4	ENSG00000250361	ENST00000283126;ENST00000502664;ENST00000429670	T;T;T	0.14516	2.5;2.5;2.83	0.843	-0.0765	0.13723	.	.	.	.	.	T	0.20129	0.0484	.	.	.	0.09310	N	1	P	0.43431	0.807	P	0.53518	0.728	T	0.17319	-1.0373	8	0.87932	D	0	.	3.3149	0.07030	0.312:0.0:0.688:0.0	.	28	E2QBW7	.	Y	28	ENSP00000283126:H28Y;ENSP00000427690:H28Y;ENSP00000394200:H28Y	ENSP00000283126:H28Y	H	-	1	0	GYPB	145141842	0.000000	0.05858	0.001000	0.08648	0.067000	0.16453	-0.397000	0.07269	-0.031000	0.13781	0.121000	0.15741	CAC			0.363	GYPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000364791.1		NM_002100	
C4orf51	646603	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	146617775	146617775	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr4:146617775G>C	ENST00000438731.1	+	2	298	c.298G>C	c.(298-300)Gat>Cat	p.D100H		NM_001080531.1	NP_001074000.1	C9J302	CD051_HUMAN	chromosome 4 open reading frame 51	100										haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)	6						AGAGACTACAGATATCAAAGG	0.423																																					p.D100H													.	.			0			c.G298C												134.0	128.0	130.0					4																	146617775		1871	4116	5987	SO:0001583	missense	646603	exon2			ACTACAGATATCA		CCDS47140.1	4q31.21	2009-09-09			ENSG00000237136	ENSG00000237136			37264	protein-coding gene	gene with protein product							Standard	NM_001080531		Approved		uc003ikk.3	C9J302	OTTHUMG00000161367	ENST00000438731.1:c.298G>C	4.37:g.146617775G>C	ENSP00000391404:p.Asp100His		Somatic	92	0	0		WXS	Illumina HiSeq	.	81	0.09	7	NM_001080531	41	0.98	40		Missense_Mutation	SNP	ENST00000438731.1	37	CCDS47140.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.76|11.76	1.733870|1.733870	0.30684|0.30684	.|.	.|.	ENSG00000237136|ENSG00000237136	ENST00000438731|ENST00000511965	.|.	.|.	.|.	3.67|3.67	-0.0909|-0.0909	0.13663|0.13663	.|.	.|.	.|.	.|.	.|.	T|T	0.21631|0.21631	0.0521|0.0521	L|L	0.27053|0.27053	0.805|0.805	0.09310|0.09310	N|N	1|1	D|.	0.65815|.	0.995|.	P|.	0.57101|.	0.813|.	T|T	0.24333|0.24333	-1.0163|-1.0163	8|5	0.87932|.	D|.	0|.	.|.	3.0398|3.0398	0.06134|0.06134	0.329:0.0:0.479:0.192|0.329:0.0:0.479:0.192	.|.	100|.	C9J302|.	CD051_HUMAN|.	H|H	100|59	.|.	ENSP00000391404:D100H|.	D|Q	+|+	1|3	0|2	C4orf51|C4orf51	146837225|146837225	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	0.478000|0.478000	0.22212|0.22212	-0.060000|-0.060000	0.13132|0.13132	0.561000|0.561000	0.74099|0.74099	GAT|CAG			0.423	C4orf51-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_001080531	
KATNBL1P4	100128982	bcgsc.ca	37	5	51227604	51227604	+	IGR	SNP	C	C	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr5:51227604C>T								RNA5SP182 (45001 upstream) : CTD-2203A3.1 (76260 downstream)																							ATATATCTTACTTGAACGCTG	0.393																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			ATCTTACTTGAAC																													5.37:g.51227604C>T			Somatic	26	0	0		WXS	Illumina HiSeq	Phase_1	27	0.19	5	.	0		0		RNA	SNP		37																																																																																					0	0.393										
FCHO2	115548	broad.mit.edu	37	5	72286323	72286323	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr5:72286323G>T	ENST00000430046.2	+	4	335	c.219G>T	c.(217-219)tgG>tgT	p.W73C	FCHO2_ENST00000287761.6_Missense_Mutation_p.W73C|FCHO2_ENST00000341845.6_Missense_Mutation_p.W73C|FCHO2_ENST00000512348.1_Missense_Mutation_p.W73C	NM_001146032.1|NM_138782.2	NP_001139504.1|NP_620137.2	Q0JRZ9	FCHO2_HUMAN	FCH domain only 2	73	FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.|Mediates dimerization and binding to membranes enriched in Pi(4,5)-P2 and induces their tubulation.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|membrane invagination (GO:0010324)|protein localization to plasma membrane (GO:0072659)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	17		Lung NSC(167;0.0465)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;4.6e-53)		CACCAGTATGGGATGTATTCA	0.284																																					p.W73C													.	FCHO2	96		0			c.G219T												28.0	25.0	26.0					5																	72286323		1718	3882	5600	SO:0001583	missense	115548	exon4			AGTATGGGATGTA	AL831971	CCDS47230.1, CCDS54868.1	5q13.2	2005-08-15			ENSG00000157107	ENSG00000157107			25180	protein-coding gene	gene with protein product		613438				15254787	Standard	NM_138782		Approved		uc003kcl.3	Q0JRZ9	OTTHUMG00000162413	ENST00000430046.2:c.219G>T	5.37:g.72286323G>T	ENSP00000393776:p.Trp73Cys		Somatic	197	0	0		WXS	Illumina HiSeq	Phase_I	272	0.02	5	NM_138782	6	0.00	0	A8K6W7|B2RNQ9|B4DHK0|E9PG79|Q0JTJ3|Q96CF5	Missense_Mutation	SNP	ENST00000430046.2	37	CCDS47230.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.50|19.50	3.839362|3.839362	0.71488|0.71488	.|.	.|.	ENSG00000157107|ENSG00000157107	ENST00000507345|ENST00000430046;ENST00000341845;ENST00000512348;ENST00000287761	.|T;T;T;T	.|0.25579	.|1.79;1.79;1.79;1.79	5.91|5.91	5.91|5.91	0.95273|0.95273	.|Fps/Fes/Fer/CIP4 homology (3);	.|0.054812	.|0.85682	.|D	.|0.000000	T|T	0.62085|0.62085	0.2399|0.2399	M|M	0.91038|0.91038	3.17|3.17	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|0.999;1.0;0.983	T|T	0.69022|0.69022	-0.5255|-0.5255	5|10	.|0.72032	.|D	.|0.01	-4.901|-4.901	18.4761|18.4761	0.90793|0.90793	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|73;73;73	.|E9PG79;Q0JRZ9-2;Q0JRZ9	.|.;.;FCHO2_HUMAN	V|C	43|73	.|ENSP00000393776:W73C;ENSP00000344034:W73C;ENSP00000427296:W73C;ENSP00000287761:W73C	.|ENSP00000287761:W73C	G|W	+|+	2|3	0|0	FCHO2|FCHO2	72322079|72322079	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.973000|0.973000	0.67179|0.67179	9.137000|9.137000	0.94496|0.94496	2.805000|2.805000	0.96524|0.96524	0.460000|0.460000	0.39030|0.39030	GGG|TGG			0.284	FCHO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000368795.3		XM_291142	
PCDHGA6	56109	mdanderson.org	37	5	140755446	140755446	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr5:140755446G>T	ENST00000517434.1	+	1	1796	c.1796G>T	c.(1795-1797)gGc>gTc	p.G599V	PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	599	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G599V(1)		breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAGACTCGGGCCAGAACGCC	0.706																																					p.G599V													PCDHGA6_ENST00000517434,NS,carcinoma,0,1	PCDHGA6_ENST00000517434	0	1	1	Substitution - Missense(1)	prostate(1)	c.G1796T												33.0	41.0	38.0					5																	140755446		2200	4290	6490	SO:0001583	missense	56109	exon1			ACTCGGGCCAGAA	AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.1796G>T	5.37:g.140755446G>T	ENSP00000429601:p.Gly599Val		Somatic	62	0.0483870968	3		WXS	Illumina HiSeq	Phase_I	42	0.10	4	NM_018919	0		0	A6H8K7|B2RN55|Q9Y5D1	Missense_Mutation	SNP	ENST00000517434.1	37	CCDS54926.1	.	.	.	.	.	.	.	.	.	.	.	17.96	3.515488	0.64634	.	.	ENSG00000253731	ENST00000517434	T	0.65364	-0.15	4.75	4.75	0.60458	Cadherin (4);Cadherin-like (1);	0.000000	0.31648	U	0.007290	D	0.88085	0.6342	H	0.99011	4.4	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92948	0.6378	10	0.87932	D	0	.	18.374	0.90430	0.0:0.0:1.0:0.0	.	599;599	Q9Y5G7-2;Q9Y5G7	.;PCDG6_HUMAN	V	599	ENSP00000429601:G599V	ENSP00000429601:G599V	G	+	2	0	PCDHGA6	140735630	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	6.387000	0.73191	2.643000	0.89663	0.558000	0.71614	GGC			0.706	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000374743.1		NM_018919	
IRF4	3662	broad.mit.edu	37	6	401642	401642	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr6:401642G>A	ENST00000380956.4	+	7	1090	c.964G>A	c.(964-966)Gac>Aac	p.D322N		NM_001195286.1|NM_002460.3	NP_001182215.1|NP_002451.2	Q15306	IRF4_HUMAN	interferon regulatory factor 4	322					cytokine-mediated signaling pathway (GO:0019221)|defense response to protozoan (GO:0042832)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of DNA binding (GO:0043388)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of interleukin-13 biosynthetic process (GO:0045368)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of T-helper cell differentiation (GO:0045622)|T cell activation (GO:0042110)|T-helper 17 cell lineage commitment (GO:0072540)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear nucleosome (GO:0000788)|nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		GATGGCCCCCGACGGGCTCTA	0.612			T	IGH@	MM																																p.D322N				Dom	yes		6	6p25-p23	3662	interferon regulatory factor 4		L	.	IRF4	65		0			c.G964A												45.0	46.0	46.0					6																	401642		2203	4300	6503	SO:0001583	missense	3662	exon7			GCCCCCGACGGGC	U52682	CCDS4469.1	6p25-p23	2008-08-29			ENSG00000137265	ENSG00000137265			6119	protein-coding gene	gene with protein product		601900		MUM1		8921401, 18417578	Standard	NM_002460		Approved	LSIRF	uc003msz.4	Q15306	OTTHUMG00000016294	ENST00000380956.4:c.964G>A	6.37:g.401642G>A	ENSP00000370343:p.Asp322Asn		Somatic	124	0	0		WXS	Illumina HiSeq	Phase_I	127	0.03	4	NM_002460	4	0.00	0	Q5VUI7|Q99660	Missense_Mutation	SNP	ENST00000380956.4	37	CCDS4469.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.940566	0.92526	.	.	ENSG00000137265	ENST00000380956;ENST00000412334	D	0.94862	-3.54	5.76	5.76	0.90799	SMAD domain-like (1);SMAD/FHA domain (1);Interferon regulatory factor-3 (1);	0.000000	0.85682	D	0.000000	D	0.93651	0.7972	L	0.48986	1.54	0.80722	D	1	P;P;P;D	0.61080	0.954;0.9;0.943;0.989	P;P;P;P	0.54210	0.581;0.459;0.55;0.745	D	0.91137	0.4942	10	0.20046	T	0.44	-25.6885	19.9857	0.97347	0.0:0.0:1.0:0.0	.	322;352;321;322	F2Z3D5;Q99419;Q15306-2;Q15306	.;.;.;IRF4_HUMAN	N	322;351	ENSP00000370343:D322N	ENSP00000370343:D322N	D	+	1	0	IRF4	346642	1.000000	0.71417	0.760000	0.31359	0.673000	0.39480	9.414000	0.97362	2.706000	0.92434	0.655000	0.94253	GAC			0.612	IRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000043638.1			
PBX2	5089	broad.mit.edu	37	6	32156160	32156160	+	Silent	SNP	T	T	A			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr6:32156160T>A	ENST00000375050.4	-	3	687	c.417A>T	c.(415-417)gcA>gcT	p.A139A	XXbac-BPG300A18.13_ENST00000559458.1_RNA	NM_002586.4	NP_002577.2	P40425	PBX2_HUMAN	pre-B-cell leukemia homeobox 2	139	Poly-Ala.				embryonic limb morphogenesis (GO:0030326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|lung(9)|ovary(1)|prostate(2)	14						CGGCTGCAGCTGCTGCTGCTG	0.617																																					p.A139A													.	PBX2	29		0			c.A417T												25.0	33.0	30.0					6																	32156160		2177	4253	6430	SO:0001819	synonymous_variant	5089	exon3			TGCAGCTGCTGCT		CCDS4748.1	6p21.32	2011-06-20	2007-01-30		ENSG00000204304	ENSG00000204304		"""Homeoboxes / TALE class"""	8633	protein-coding gene	gene with protein product		176311	"""pre-B-cell leukemia transcription factor 2"""			7835890	Standard	NM_002586		Approved	G17, HOX12, PBX2MHC	uc003oav.1	P40425	OTTHUMG00000031116	ENST00000375050.4:c.417A>T	6.37:g.32156160T>A			Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	77	0.05	4	NM_002586	120	0.00	0	A2BFJ2	Silent	SNP	ENST00000375050.4	37	CCDS4748.1																																																																																					0.617	PBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076194.4			
IBTK	25998	broad.mit.edu	37	6	82924303	82924303	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr6:82924303G>T	ENST00000306270.7	-	12	2394	c.1845C>A	c.(1843-1845)tgC>tgA	p.C615*	IBTK_ENST00000510291.1_Nonsense_Mutation_p.C615*|IBTK_ENST00000503631.1_Intron	NM_015525.2	NP_056340.2	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton agammaglobulinemia tyrosine kinase	615	BTB 1. {ECO:0000255|PROSITE- ProRule:PRU00037}.				negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein tyrosine kinase activity (GO:0061099)|release of sequestered calcium ion into cytosol (GO:0051209)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine kinase inhibitor activity (GO:0030292)			central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(10)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	54		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		CAAAGAGATGGCACCCTGCAG	0.343																																					p.C615X													.	IBTK	128		0			c.C1845A												46.0	46.0	46.0					6																	82924303		2203	4300	6503	SO:0001587	stop_gained	25998	exon12			GAGATGGCACCCT	AF235049	CCDS34490.1, CCDS75486.1	6q14.3	2013-01-10	2003-10-06	2003-10-08	ENSG00000005700	ENSG00000005700		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	17853	protein-coding gene	gene with protein product		606457	"""Bruton agammaglobulinemia tyrosine kinase inhibitor"""	BTKI		11577348	Standard	XM_006715453		Approved	DKFZP564B116, BTBD26	uc003pjl.1	Q9P2D0	OTTHUMG00000015102	ENST00000306270.7:c.1845C>A	6.37:g.82924303G>T	ENSP00000305721:p.Cys615*		Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	168	0.02	4	NM_015525	24	0.00	0	Q2QKU2|Q2QKU3|Q2QKU4|Q5TFD7|Q5TFD9|Q8IUQ9|Q8IUY7|Q8TAI4|Q9HBI8|Q9Y3T8	Nonsense_Mutation	SNP	ENST00000306270.7	37	CCDS34490.1	.	.	.	.	.	.	.	.	.	.	G	37	6.635437	0.97722	.	.	ENSG00000005700	ENST00000306270;ENST00000510291	.	.	.	5.71	3.68	0.42216	.	0.041945	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08179	T	0.78	-5.9165	4.1618	0.10287	0.4663:0.0:0.5337:0.0	.	.	.	.	X	615	.	ENSP00000305721:C615X	C	-	3	2	IBTK	82981022	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.582000	0.46085	1.413000	0.46997	0.655000	0.94253	TGC			0.343	IBTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041337.2		NM_015525	
MAP7	9053	broad.mit.edu;mdanderson.org	37	6	136732800	136732800	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr6:136732800G>A	ENST00000354570.3	-	3	612	c.202C>T	c.(202-204)Cgg>Tgg	p.R68W	MAP7_ENST00000432797.2_5'UTR|MAP7_ENST00000438100.2_Missense_Mutation_p.R90W|MAP7_ENST00000544465.1_Missense_Mutation_p.R53W|MAP7_ENST00000454590.1_Missense_Mutation_p.R90W	NM_001198616.1|NM_001198617.1|NM_001198619.1|NM_003980.4	NP_001185545.1|NP_001185546.1|NP_001185548.1|NP_003971.1	Q14244	MAP7_HUMAN	microtubule-associated protein 7	68					cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|establishment or maintenance of cell polarity (GO:0007163)|fertilization (GO:0009566)|germ cell development (GO:0007281)|glycosphingolipid metabolic process (GO:0006687)|homeostasis of number of cells (GO:0048872)|Leydig cell differentiation (GO:0033327)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nucleus organization (GO:0006997)|organ growth (GO:0035265)|protein localization to plasma membrane (GO:0072659)|response to osmotic stress (GO:0006970)|response to retinoic acid (GO:0032526)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(11)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00199)|OV - Ovarian serous cystadenocarcinoma(155;0.00643)		CGGGCCAGCCGCTGCCGGTCA	0.483																																					p.R90W													.	MAP7	63		0			c.C268T												32.0	32.0	32.0					6																	136732800		2196	4287	6483	SO:0001583	missense	9053	exon3			CCAGCCGCTGCCG	X73882	CCDS5178.1, CCDS56452.1, CCDS56453.1, CCDS56454.1, CCDS56455.1, CCDS75527.1, CCDS75528.1, CCDS75529.1	6q23.2	2008-07-28			ENSG00000135525	ENSG00000135525			6869	protein-coding gene	gene with protein product		604108				8408219	Standard	NM_003980		Approved	E-MAP-115	uc011edg.2	Q14244	OTTHUMG00000015646	ENST00000354570.3:c.202C>T	6.37:g.136732800G>A	ENSP00000346581:p.Arg68Trp		Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	69	0.06	4	NM_001198611	55	0.00	0	B7Z290|B7Z400|B7Z5S7|B7Z9U7|C9JPS0|E9PCP3|F5H1E2|Q7Z6S0|Q8TAU5|Q9NY82|Q9NY83	Missense_Mutation	SNP	ENST00000354570.3	37	CCDS5178.1	.	.	.	.	.	.	.	.	.	.	G	17.02	3.280686	0.59758	.	.	ENSG00000135525	ENST00000354570;ENST00000454590;ENST00000544465;ENST00000438100;ENST00000345567	T;T;T;T	0.08370	3.1;3.1;3.1;3.1	5.39	3.58	0.41010	.	0.000000	0.42172	D	0.000757	T	0.19805	0.0476	M	0.86028	2.79	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.998;0.998;0.999;0.998;0.99;0.999;0.999;0.998	T	0.01706	-1.1291	10	0.72032	D	0.01	-13.0464	11.0345	0.47793	0.0:0.0:0.6618:0.3382	.	90;90;53;90;90;68;68;68	B7Z290;B7ZB64;F5H1E2;E9PCP3;B7Z400;F8W783;Q14244-2;Q14244	.;.;.;.;.;.;.;MAP7_HUMAN	W	68;90;53;90;68	ENSP00000346581:R68W;ENSP00000414712:R90W;ENSP00000445737:R53W;ENSP00000400790:R90W	ENSP00000344217:R68W	R	-	1	2	MAP7	136774493	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.540000	0.45727	0.634000	0.30469	0.655000	0.94253	CGG			0.483	MAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042382.2		NM_003980	
ARID1B	57492	broad.mit.edu;mdanderson.org	37	6	157100005	157100005	+	Silent	SNP	C	C	A	rs587779748|rs184815562		TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr6:157100005C>A	ENST00000350026.5	+	1	943	c.942C>A	c.(940-942)ggC>ggA	p.G314G	ARID1B_ENST00000275248.4_Silent_p.G256G|RP11-230C9.3_ENST00000604792.1_RNA|ARID1B_ENST00000367148.1_Silent_p.G314G|MIR4466_ENST00000606121.1_RNA|ARID1B_ENST00000346085.5_Silent_p.G314G|RP11-230C9.2_ENST00000603191.1_lincRNA	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	314	Gly-rich.				chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		gcggcggcggcggaggaggag	0.756																																					p.G314G													.	ARID1B	320		0			c.C942A												1.0	1.0	1.0					6																	157100005		538	1345	1883	SO:0001819	synonymous_variant	57492	exon1			CGGCGGCGGAGGA	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.942C>A	6.37:g.157100005C>A			Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	51	0.08	4	NM_017519	0		0	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Silent	SNP	ENST00000350026.5	37	CCDS5251.2																																																																																					0.756	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000372723.1		NM_020732	
DPY19L2P1	554236	bcgsc.ca	37	7	35221093	35221094	+	IGR	DEL	AA	AA	-			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	AA	AA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr7:35221093_35221094delAA								DPY19L2P1 (73747 upstream) : TBX20 (20947 downstream)																							GATCATTTTCAAAAAGTGTTAC	0.292																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	554236	.			ATTTTCAAAAAGT																													7.37:g.35221095_35221096delAA			Somatic	162	0	0		WXS	Illumina HiSeq	Phase_1	213	0.13	28	.	0		0		RNA	DEL		37																																																																																					0	0.292										
NACAD	23148	broad.mit.edu	37	7	45123697	45123697	+	Silent	SNP	C	C	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr7:45123697C>T	ENST00000490531.2	-	2	2101	c.2082G>A	c.(2080-2082)tcG>tcA	p.S694S		NM_001146334.1	NP_001139806.1	O15069	NACAD_HUMAN	NAC alpha domain containing	694					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|skin(2)	5						TTGGGGCTGACGAGAGATCTG	0.632																																					p.S694S													.	NACAD	44		0			c.G2082A												1.0	1.0	1.0					7																	45123697		51	296	347	SO:0001819	synonymous_variant	23148	exon2			GGCTGACGAGAGA	AB002361	CCDS47582.1	7p13	2010-07-14			ENSG00000136274	ENSG00000136274			22196	protein-coding gene	gene with protein product							Standard	NM_001146334		Approved	KIAA0363	uc003tmt.3	O15069	OTTHUMG00000159170	ENST00000490531.2:c.2082G>A	7.37:g.45123697C>T			Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	17	0.18	3	NM_001146334	149	0.00	0		Silent	SNP	ENST00000490531.2	37	CCDS47582.1																																																																																					0.632	NACAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000353652.2		NM_001146334	
CALD1	800	broad.mit.edu	37	7	134620437	134620437	+	Splice_Site	SNP	A	A	G			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr7:134620437A>G	ENST00000361675.2	+	6	1537		c.e6-1		CALD1_ENST00000543443.1_Intron|CALD1_ENST00000393118.2_Splice_Site|CALD1_ENST00000361901.2_Intron|CALD1_ENST00000417172.1_Intron|CALD1_ENST00000361388.2_Splice_Site|CALD1_ENST00000495522.1_Splice_Site|CALD1_ENST00000424922.1_Intron|CALD1_ENST00000422748.1_Splice_Site			Q05682	CALD1_HUMAN	caldesmon 1						cellular component movement (GO:0006928)|muscle contraction (GO:0006936)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|calmodulin binding (GO:0005516)|tropomyosin binding (GO:0005523)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(15)|lung(10)	43						GAAAATAAAAAGGGAGAAGAG	0.408																																					.													.	CALD1	150		0			c.1309-2A>G												57.0	54.0	55.0					7																	134620437		2203	4300	6503	SO:0001630	splice_region_variant	800	exon6			ATAAAAAGGGAGA	M64110	CCDS5834.1, CCDS5835.1, CCDS5836.1, CCDS47716.1, CCDS47717.1, CCDS5836.2	7q33	2007-04-23			ENSG00000122786	ENSG00000122786			1441	protein-coding gene	gene with protein product		114213				1885618	Standard	NM_004342		Approved	CDM, H-CAD, L-CAD	uc003vrz.3	Q05682	OTTHUMG00000155407	ENST00000361675.2:c.1309-1A>G	7.37:g.134620437A>G			Somatic	143	0	0		WXS	Illumina HiSeq	Phase_I	163	0.02	4	NM_033138	4	0.00	0	A8K0X1|Q13978|Q13979|Q14741|Q14742|Q9UD91	Splice_Site	SNP	ENST00000361675.2	37	CCDS5835.1	.	.	.	.	.	.	.	.	.	.	A	18.38	3.610866	0.66558	.	.	ENSG00000122786	ENST00000361388;ENST00000422748;ENST00000361675;ENST00000393118;ENST00000495522	.	.	.	5.87	4.72	0.59763	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.6038	0.45381	0.9275:0.0:0.0725:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CALD1	134270977	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.976000	0.70484	1.049000	0.40321	0.528000	0.53228	.			0.408	CALD1-005	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000339939.1		NM_033138	Intron
ZNF786	136051	mdanderson.org	37	7	148768896	148768896	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr7:148768896G>T	ENST00000491431.1	-	4	1032	c.968C>A	c.(967-969)cCg>cAg	p.P323Q	ZNF786_ENST00000451334.3_Missense_Mutation_p.P286Q|ZNF786_ENST00000316286.9_Missense_Mutation_p.P237Q	NM_152411.3	NP_689624.2	Q8N393	ZN786_HUMAN	zinc finger protein 786	323					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(2)	26	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			CCAAGAGGCCGGCCCCTCCCG	0.711																																					p.P323Q													.	.			0			c.C968A												7.0	9.0	8.0					7																	148768896		1852	3914	5766	SO:0001583	missense	136051	exon4			GAGGCCGGCCCCT	AK095701, AL834510	CCDS47738.1	7q36.1	2013-01-08			ENSG00000197362	ENSG00000197362		"""Zinc fingers, C2H2-type"", ""-"""	21806	protein-coding gene	gene with protein product							Standard	NM_152411		Approved	DKFZp762I137	uc003wfh.2	Q8N393	OTTHUMG00000158975	ENST00000491431.1:c.968C>A	7.37:g.148768896G>T	ENSP00000417470:p.Pro323Gln		Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	19	0.11	2	NM_152411	29	0.00	0	A1A568|B4DMI1	Missense_Mutation	SNP	ENST00000491431.1	37	CCDS47738.1	.	.	.	.	.	.	.	.	.	.	G	13.57	2.277999	0.40294	.	.	ENSG00000197362	ENST00000316286;ENST00000538412;ENST00000491431;ENST00000451334	T;T;T	0.08634	3.07;3.22;3.14	3.71	1.89	0.25635	.	0.469242	0.16050	N	0.232007	T	0.16854	0.0405	M	0.90705	3.14	0.09310	N	1	P	0.42039	0.769	B	0.42882	0.401	T	0.10497	-1.0627	10	0.87932	D	0	-0.9002	6.2867	0.21037	0.2342:0.0:0.7658:0.0	.	323	Q8N393	ZN786_HUMAN	Q	237;237;323;286	ENSP00000313516:P237Q;ENSP00000417470:P323Q;ENSP00000404984:P286Q	ENSP00000313516:P237Q	P	-	2	0	ZNF786	148399829	0.008000	0.16893	0.002000	0.10522	0.001000	0.01503	0.327000	0.19663	0.381000	0.24851	-0.137000	0.14449	CCG			0.711	ZNF786-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000352751.1		NM_152411	
RHEB	6009	broad.mit.edu	37	7	151188048	151188048	+	Nonsense_Mutation	SNP	G	G	C			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr7:151188048G>C	ENST00000262187.5	-	2	517	c.105C>G	c.(103-105)taC>taG	p.Y35*	RHEB_ENST00000496004.1_5'UTR|RHEB_ENST00000472642.1_5'UTR	NM_005614.3	NP_005605.1	Q15382	RHEB_HUMAN	Ras homolog enriched in brain	35					cell cycle arrest (GO:0007050)|insulin receptor signaling pathway (GO:0008286)|positive regulation of TOR signaling (GO:0032008)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|spliceosomal complex (GO:0005681)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)			breast(3)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)	14			OV - Ovarian serous cystadenocarcinoma(82;0.00306)	UCEC - Uterine corpus endometrioid carcinoma (81;0.174)		TGGTTGGATCGTAGGAGTCCA	0.363																																					p.Y35X	Pancreas(98;671 892 8111 15140 36556 39178 39939 44184)												RHEB,NS,carcinoma,-2,3	RHEB	30	3	0			c.C105G												103.0	101.0	101.0					7																	151188048		2203	4300	6503	SO:0001587	stop_gained	6009	exon2			TGGATCGTAGGAG	D78132	CCDS5927.1	7q36	2014-05-09	2003-07-14	2003-07-14	ENSG00000106615	ENSG00000106615			10011	protein-coding gene	gene with protein product		601293	"""Ras homolog enriched in brain 2"""	RHEB2		8661031	Standard	NM_005614		Approved		uc003wkh.1	Q15382	OTTHUMG00000157330	ENST00000262187.5:c.105C>G	7.37:g.151188048G>C	ENSP00000262187:p.Tyr35*		Somatic	103	0	0		WXS	Illumina HiSeq	Phase_I	95	0.04	4	NM_005614	299	0.00	1	B3KWN6|D3DX13|Q53Y56|Q99444	Nonsense_Mutation	SNP	ENST00000262187.5	37	CCDS5927.1	.	.	.	.	.	.	.	.	.	.	G	38	7.217892	0.98143	.	.	ENSG00000106615	ENST00000262187	.	.	.	5.42	-2.72	0.05968	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.969	0.53053	0.6443:0.0:0.3557:0.0	.	.	.	.	X	35	.	ENSP00000262187:Y35X	Y	-	3	2	RHEB	150818981	0.938000	0.31826	0.980000	0.43619	0.995000	0.86356	0.097000	0.15168	-0.458000	0.07023	-0.140000	0.14226	TAC			0.363	RHEB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348468.2		NM_005614	
RHEB	6009	hgsc.bcm.edu;broad.mit.edu	37	7	151188050	151188050	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr7:151188050A>G	ENST00000262187.5	-	2	515	c.103T>C	c.(103-105)Tac>Cac	p.Y35H	RHEB_ENST00000496004.1_5'UTR|RHEB_ENST00000472642.1_5'UTR	NM_005614.3	NP_005605.1	Q15382	RHEB_HUMAN	Ras homolog enriched in brain	35					cell cycle arrest (GO:0007050)|insulin receptor signaling pathway (GO:0008286)|positive regulation of TOR signaling (GO:0032008)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|spliceosomal complex (GO:0005681)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)	p.Y35N(1)		breast(3)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)	14			OV - Ovarian serous cystadenocarcinoma(82;0.00306)	UCEC - Uterine corpus endometrioid carcinoma (81;0.174)		GTTGGATCGTAGGAGTCCACA	0.358																																					p.Y35H	Pancreas(98;671 892 8111 15140 36556 39178 39939 44184)												RHEB,NS,carcinoma,0,3	RHEB	0	3	1	Substitution - Missense(1)	kidney(1)	c.T103C												103.0	100.0	101.0					7																	151188050		2203	4300	6503	SO:0001583	missense	6009	exon2			GATCGTAGGAGTC	D78132	CCDS5927.1	7q36	2014-05-09	2003-07-14	2003-07-14	ENSG00000106615	ENSG00000106615			10011	protein-coding gene	gene with protein product		601293	"""Ras homolog enriched in brain 2"""	RHEB2		8661031	Standard	NM_005614		Approved		uc003wkh.1	Q15382	OTTHUMG00000157330	ENST00000262187.5:c.103T>C	7.37:g.151188050A>G	ENSP00000262187:p.Tyr35His		Somatic	98	0	0		WXS	Illumina HiSeq	.	93	0.04	4	NM_005614	299	0.01	2	B3KWN6|D3DX13|Q53Y56|Q99444	Missense_Mutation	SNP	ENST00000262187.5	37	CCDS5927.1	.	.	.	.	.	.	.	.	.	.	A	25.7	4.668912	0.88348	.	.	ENSG00000106615	ENST00000262187	T	0.81330	-1.48	5.42	5.42	0.78866	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.88078	0.6340	M	0.67700	2.07	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89242	0.3584	10	0.87932	D	0	.	13.3975	0.60863	1.0:0.0:0.0:0.0	.	35	Q15382	RHEB_HUMAN	H	35	ENSP00000262187:Y35H	ENSP00000262187:Y35H	Y	-	1	0	RHEB	150818983	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.143000	0.89621	2.051000	0.60960	0.533000	0.62120	TAC			0.358	RHEB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348468.2		NM_005614	
DLC1	10395	broad.mit.edu;bcgsc.ca	37	8	13357185	13357185	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr8:13357185delC	ENST00000276297.4	-	2	805	c.396delG	c.(394-396)gggfs	p.G132fs	DLC1_ENST00000511869.1_Frame_Shift_Del_p.G132fs|DLC1_ENST00000316609.5_Frame_Shift_Del_p.G132fs	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	132					actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						ATGTTTTCTGCCCTTGGGTAT	0.428																																					p.G132fs													.	DLC1	411		0			c.396delG												157.0	158.0	158.0					8																	13357185		2203	4300	6503	SO:0001589	frameshift_variant	10395	exon2			TTTCTGCCCTTGG	AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.396delG	8.37:g.13357185delC	ENSP00000276297:p.Gly132fs		Somatic	176	0	0		WXS	Illumina HiSeq	Phase_I	125	0.15	19	NM_182643	2	0.00	0	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Frame_Shift_Del	DEL	ENST00000276297.4	37	CCDS5989.1																																																																																					0.428	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000207632.2		NM_182643, NM_006094	
PCMTD1	115294	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	8	52733191	52733191	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr8:52733191G>A	ENST00000360540.5	-	7	1200	c.794C>T	c.(793-795)gCc>gTc	p.A265V	PCMTD1_ENST00000544451.1_Missense_Mutation_p.A189V|PCMTD1_ENST00000522514.1_Missense_Mutation_p.A265V|PCMTD1_ENST00000519559.1_5'UTR	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	265						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				AATCCCCTTGGCCTGCATCTC	0.413																																					p.A265V													PCMTD1,NS,carcinoma,+1,1	PCMTD1	1	1	0			c.C794T												100.0	104.0	103.0					8																	52733191		2203	4297	6500	SO:0001583	missense	115294	exon6			CCCTTGGCCTGCA		CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.794C>T	8.37:g.52733191G>A	ENSP00000353739:p.Ala265Val		Somatic	143	0	0		WXS	Illumina HiSeq	.	137	0.05	7	NM_052937	16	0.00	0	Q96FK9	Missense_Mutation	SNP	ENST00000360540.5	37	CCDS6148.1	.	.	.	.	.	.	.	.	.	.	G	17.94	3.511582	0.64522	.	.	ENSG00000168300	ENST00000360540;ENST00000544451;ENST00000522514	T;T;T	0.40476	1.03;1.03;1.03	5.77	5.77	0.91146	.	0.057264	0.64402	D	0.000002	T	0.56702	0.2003	L	0.44542	1.39	0.52501	D	0.999951	P;D;B	0.71674	0.791;0.998;0.012	B;D;B	0.65684	0.272;0.937;0.011	T	0.43410	-0.9393	10	0.26408	T	0.33	-28.5971	19.9832	0.97338	0.0:0.0:1.0:0.0	.	135;189;265	B4E2B4;F5H1M8;Q96MG8	.;.;PCMD1_HUMAN	V	265;189;265	ENSP00000353739:A265V;ENSP00000444026:A189V;ENSP00000428099:A265V	ENSP00000353739:A265V	A	-	2	0	PCMTD1	52895744	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.494000	0.60347	2.722000	0.93159	0.655000	0.94253	GCC			0.413	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000377909.2		NM_052937	
ZFPM2	23414	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	106813720	106813720	+	Silent	SNP	A	A	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr8:106813720A>T	ENST00000407775.2	+	8	1660	c.1410A>T	c.(1408-1410)atA>atT	p.I470I	RP11-152P17.2_ENST00000521622.1_RNA|RP11-152P17.2_ENST00000518932.1_RNA|ZFPM2_ENST00000517361.1_Silent_p.I338I|RP11-152P17.2_ENST00000524045.2_RNA|ZFPM2_ENST00000520492.1_Silent_p.I338I|RP11-152P17.2_ENST00000520594.1_RNA|RP11-152P17.2_ENST00000520433.1_RNA|ZFPM2_ENST00000378472.4_Silent_p.I201I|ZFPM2_ENST00000522296.1_3'UTR|RP11-152P17.2_ENST00000509144.2_RNA	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	470					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			ACACAAAAATAAAGTCTGAGC	0.443																																					p.I470I													.	.			0			c.A1410T												81.0	87.0	85.0					8																	106813720		1859	4092	5951	SO:0001819	synonymous_variant	23414	exon8			AAAAATAAAGTCT	AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.1410A>T	8.37:g.106813720A>T			Somatic	62	0	0		WXS	Illumina HiSeq	.	87	0.23	20	NM_012082	8	0.25	2	Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Silent	SNP	ENST00000407775.2	37	CCDS47908.1																																																																																					0.443	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000380614.1			
HHLA1	10086	mdanderson.org	37	8	133089975	133089975	+	Nonsense_Mutation	SNP	A	A	T	rs2280851	byFrequency	TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr8:133089975A>T	ENST00000414222.1	-	11	1168	c.1169T>A	c.(1168-1170)tTg>tAg	p.L390*	HHLA1_ENST00000434736.2_Nonsense_Mutation_p.L426*|OC90_ENST00000262283.5_Nonsense_Mutation_p.L132*	NM_001145095.1	NP_001138567.1	C9JL84	HHLA1_HUMAN	HERV-H LTR-associating 1	390				L -> S (in Ref. 1; AAD13107). {ECO:0000305}.		extracellular region (GO:0005576)				endometrium(6)|kidney(1)|lung(2)|skin(1)|stomach(2)	12						TCTCTTACCCAAGGTAGGGCT	0.468																																					p.L390X													.	.			0			c.T1169A												48.0	43.0	45.0					8																	133089975		692	1591	2283	SO:0001587	stop_gained	10086	exon11			TTACCCAAGGTAG	AF110315		8q24	2011-03-01			ENSG00000132297	ENSG00000132297			4904	protein-coding gene	gene with protein product		604109		PLA2L		10329003	Standard	NM_001145095		Approved		uc011liy.1	C9JL84	OTTHUMG00000140390	ENST00000414222.1:c.1169T>A	8.37:g.133089975A>T	ENSP00000388322:p.Leu390*		Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	99	0.03	3	NM_001145095	0		0		Nonsense_Mutation	SNP	ENST00000414222.1	37		.	.	.	.	.	.	.	.	.	.	G	27.0	4.790006	0.90367	.	.	ENSG00000258417;ENSG00000132297;ENSG00000132297	ENST00000262283;ENST00000414222;ENST00000434736	.	.	.	4.87	3.06	0.35304	.	.	.	.	.	.	.	.	.	.	.	0.09310	P	0.99999999812214	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	-9.3372	5.7681	0.18237	0.1791:0.1599:0.661:0.0	.	.	.	.	X	132;390;426	.	ENSP00000388322:L390X	L	-	2	0	RP11-240B13.2;HHLA1	133159157	0.676000	0.27567	0.025000	0.17156	0.002000	0.02628	0.793000	0.26944	0.341000	0.23771	-0.799000	0.03217	TTG			0.468	HHLA1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				XR_017860	
ARC	23237	broad.mit.edu	37	8	143694937	143694937	+	Silent	SNP	G	G	A			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr8:143694937G>A	ENST00000356613.2	-	1	1896	c.696C>T	c.(694-696)ggC>ggT	p.G232G	ARC_ENST00000581404.1_5'Flank	NM_015193.4	NP_056008.1	O60936	NOL3_HUMAN	activity-regulated cytoskeleton-associated protein	0					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of gene expression (GO:0010468)|response to hypoxia (GO:0001666)|response to injury involved in regulation of muscle adaptation (GO:0014876)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|sarcoplasm (GO:0016528)	identical protein binding (GO:0042802)|RNA binding (GO:0003723)	p.G232G(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(1)	13	all_cancers(97;3.55e-12)|all_epithelial(106;1.03e-08)|Lung NSC(106;0.000353)|all_lung(105;0.00092)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.0279)				CCTCAGAGCCGCCCACCTGCC	0.637																																					p.G232G													ARC,caecum,carcinoma,0,1	ARC	34	1	1	Substitution - coding silent(1)	large_intestine(1)	c.C696T												27.0	28.0	28.0					8																	143694937		2177	4264	6441	SO:0001819	synonymous_variant	23237	exon1			AGAGCCGCCCACC	AF193421	CCDS34950.1	8q24.3	2008-08-01			ENSG00000198576	ENSG00000198576			648	protein-coding gene	gene with protein product		612461				10970730, 17466953	Standard	NM_015193		Approved	KIAA0278, Arg3.1	uc003ywn.2	Q7LC44	OTTHUMG00000134310	ENST00000356613.2:c.696C>T	8.37:g.143694937G>A			Somatic	68	0.0147058824	1		WXS	Illumina HiSeq	Phase_I	53	0.08	4	NM_015193	1	0.00	0	B4DFL0|O60937	Silent	SNP	ENST00000356613.2	37	CCDS34950.1																																																																																					0.637	ARC-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000259274.2			
LURAP1L	286343	hgsc.bcm.edu;broad.mit.edu	37	9	12821707	12821707	+	Missense_Mutation	SNP	A	A	G	rs199636506		TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr9:12821707A>G	ENST00000319264.3	+	2	1330	c.635A>G	c.(634-636)cAg>cGg	p.Q212R		NM_203403.1	NP_981948.1	Q8IV03	LUR1L_HUMAN	leucine rich adaptor protein 1-like	215																	GAGGACTCACAGGCACTACAC	0.478																																					p.Q212R													.	.			0			c.A635G							A	ARG/GLN	0,4406		0,0,2203	186.0	169.0	175.0		635	5.3	0.8	9		175	2,8598	2.2+/-6.3	0,2,4298	yes	missense	C9orf150	NM_203403.1	43	0,2,6501	GG,GA,AA		0.0233,0.0,0.0154	benign	212/229	12821707	2,13004	2203	4300	6503	SO:0001583	missense	286343	exon2			ACTCACAGGCACT	AK095824	CCDS6473.1	9p22.3	2012-02-01	2012-02-01	2012-02-01	ENSG00000153714	ENSG00000153714			31452	protein-coding gene	gene with protein product	"""similar to DNA segment, Chr 4, Brigham & Womens Genetics 0951 expressed"""		"""chromosome 9 open reading frame 150"""	C9orf150		12766061	Standard	NM_203403		Approved	MGC46502, FLJ38505, bA3L8.2	uc003zkw.3	Q8IV03	OTTHUMG00000019557	ENST00000319264.3:c.635A>G	9.37:g.12821707A>G	ENSP00000321026:p.Gln212Arg		Somatic	83	0	0		WXS	Illumina HiSeq	.	90	0.04	4	NM_203403	2	0.00	0	Q5VZX7|Q8N923|Q8NCG2	Missense_Mutation	SNP	ENST00000319264.3	37	CCDS6473.1	.	.	.	.	.	.	.	.	.	.	A	11.32	1.604771	0.28623	0.0	2.33E-4	ENSG00000153714	ENST00000319264	T	0.44881	0.91	5.29	5.29	0.74685	.	0.511996	0.19155	N	0.121344	T	0.32556	0.0833	N	0.24115	0.695	0.09310	N	1	B	0.26258	0.145	B	0.21708	0.036	T	0.32587	-0.9901	10	0.66056	D	0.02	.	15.5259	0.75905	1.0:0.0:0.0:0.0	.	215	Q8IV03	CI150_HUMAN	R	212	ENSP00000321026:Q212R	ENSP00000321026:Q212R	Q	+	2	0	C9orf150	12811707	0.995000	0.38212	0.838000	0.33150	0.724000	0.41520	6.239000	0.72356	2.130000	0.65690	0.460000	0.39030	CAG			0.478	LURAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051730.1		NM_203403	
CDKN2B	1030	mdanderson.org	37	9	22006138	22006138	+	Silent	SNP	G	G	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr9:22006138G>T	ENST00000276925.6	-	2	674	c.265C>A	c.(265-267)Cgg>Agg	p.R89R	CDKN2B-AS1_ENST00000582072.1_RNA|CDKN2B-AS1_ENST00000584637.1_RNA|CDKN2B-AS1_ENST00000583719.1_RNA|CDKN2B-AS1_ENST00000428597.1_RNA|CDKN2B-AS1_ENST00000584351.1_RNA|CDKN2B-AS1_ENST00000581051.1_RNA|CDKN2B-AS1_ENST00000455933.2_RNA|CDKN2B_ENST00000380142.4_3'UTR|CDKN2B-AS1_ENST00000580467.1_RNA|CDKN2B-AS1_ENST00000468603.2_RNA|CDKN2B-AS1_ENST00000584816.1_RNA|CDKN2B-AS1_ENST00000577551.1_RNA|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2B-AS1_ENST00000580576.1_RNA|CDKN2B-AS1_ENST00000585267.1_RNA|CDKN2B-AS1_ENST00000582301.1_RNA|CDKN2B-AS1_ENST00000584020.1_RNA	NM_004936.3|NM_078487.2	NP_004927.2|NP_511042.1	P42772	CDN2B_HUMAN	cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)	89					aging (GO:0007568)|cell cycle arrest (GO:0007050)|cellular response to extracellular stimulus (GO:0031668)|cellular response to nutrient (GO:0031670)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|liver development (GO:0001889)|megakaryocyte differentiation (GO:0030219)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of phosphorylation (GO:0042326)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to cytokine (GO:0034097)|response to organic cyclic compound (GO:0014070)|spleen development (GO:0048536)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein kinase binding (GO:0019901)	p.0(1)|p.0?(1)		lung(2)	2		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;1.31e-280)|Lung NSC(2;2.28e-131)|all_lung(2;2.11e-123)|Glioma(2;5.66e-57)|all_neural(2;3.05e-50)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;8.01e-33)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00369)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;3.29e-71)|Epithelial(2;9.08e-60)|LUSC - Lung squamous cell carcinoma(2;5.8e-46)|LUAD - Lung adenocarcinoma(2;1.43e-25)|BRCA - Breast invasive adenocarcinoma(2;5.37e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;6.92e-07)|KIRC - Kidney renal clear cell carcinoma(2;8.63e-07)|OV - Ovarian serous cystadenocarcinoma(39;0.014)|COAD - Colon adenocarcinoma(8;0.143)		AAGCCCTCCCGGGCAGCATCA	0.731																																					p.R89R													.	.			2	Whole gene deletion(2)	lung(2)	c.C265A												17.0	22.0	21.0					9																	22006138		2192	4286	6478	SO:0001819	synonymous_variant	1030	exon2			CCTCCCGGGCAGC	AB060808	CCDS6512.1, CCDS6513.1	9p21	2008-07-21			ENSG00000147883	ENSG00000147883			1788	protein-coding gene	gene with protein product		600431				8078588	Standard	NM_004936		Approved	P15, MTS2, INK4B, TP15, CDK4I, p15INK4b	uc003zpo.3	P42772	OTTHUMG00000019691	ENST00000276925.6:c.265C>A	9.37:g.22006138G>T			Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	27	0.11	3	NM_004936	3	0.00	0	O15125|Q6FI09	Silent	SNP	ENST00000276925.6	37	CCDS6512.1																																																																																					0.731	CDKN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051932.2		NM_004936	
WNK2	65268	mdanderson.org	37	9	95947607	95947607	+	Silent	SNP	T	T	A			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chr9:95947607T>A	ENST00000297954.4	+	1	396	c.396T>A	c.(394-396)gcT>gcA	p.A132A	WNK2_ENST00000427277.2_5'UTR|WNK2_ENST00000395475.2_Silent_p.A118A|WNK2_ENST00000356055.3_5'UTR|WNK2_ENST00000349097.3_5'UTR|WNK2_ENST00000395477.2_Silent_p.A132A	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	132					intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						TCGCAGCCGCTGTCGAAACCG	0.796																																					p.A132A													.	.			0			c.T396A												2.0	3.0	3.0					9																	95947607		1250	2797	4047	SO:0001819	synonymous_variant	65268	exon1			AGCCGCTGTCGAA	AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.396T>A	9.37:g.95947607T>A			Somatic	10	0	0		WXS	Illumina HiSeq	Phase_I	26	0.12	3	NM_006648	14	0.00	0	Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Silent	SNP	ENST00000297954.4	37		.	.	.	.	.	.	.	.	.	.	t	2.202	-0.382730	0.04966	.	.	ENSG00000165238	ENST00000432730	.	.	.	2.5	-4.99	0.03010	.	.	.	.	.	T	0.15739	0.0379	.	.	.	0.22081	N	0.999375	.	.	.	.	.	.	T	0.22556	-1.0213	4	.	.	.	.	0.2409	0.00192	0.3445:0.2041:0.2362:0.2153	.	.	.	.	Q	128	.	.	L	+	2	0	WNK2	94987428	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-2.893000	0.00708	-1.456000	0.01921	-0.444000	0.05651	CTG			0.796	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000317359.1		NM_006648	
NDP	4693	broad.mit.edu	37	X	43817791	43817791	+	Missense_Mutation	SNP	G	G	C	rs144031424		TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chrX:43817791G>C	ENST00000378062.5	-	2	508	c.101C>G	c.(100-102)tCg>tGg	p.S34W	NDP-AS1_ENST00000435093.1_RNA|NDP_ENST00000470584.1_Intron	NM_000266.3	NP_000257.1	Q00604	NDP_HUMAN	Norrie disease (pseudoglioma)	34					canonical Wnt signaling pathway (GO:0060070)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|extracellular matrix-cell signaling (GO:0035426)|nervous system development (GO:0007399)|placenta development (GO:0001890)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|vacuole organization (GO:0007033)|visual perception (GO:0007601)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)	frizzled binding (GO:0005109)|growth factor activity (GO:0008083)|protein homodimerization activity (GO:0042803)			kidney(1)|lung(2)	3						TCGAGGGTCCGAGTCCATTAT	0.468																																					p.S34W													.	NDP	12		0			c.C101G												242.0	170.0	194.0					X																	43817791		2203	4300	6503	SO:0001583	missense	4693	exon2			GGGTCCGAGTCCA	X65882	CCDS14262.1	Xp11.4-p11.3	2013-02-26			ENSG00000124479	ENSG00000124479		"""Endogenous ligands"""	7678	protein-coding gene	gene with protein product		300658	"""exudative vitreoretinopathy 2 (X-linked)"""	EVR2		8252044	Standard	NM_000266		Approved	norrin	uc004dga.3	Q00604	OTTHUMG00000021391	ENST00000378062.5:c.101C>G	X.37:g.43817791G>C	ENSP00000367301:p.Ser34Trp		Somatic	113	0	0		WXS	Illumina HiSeq	Phase_I	107	0.04	4	NM_000266	1	0.00	0	B2R8K6|Q5JYH5	Missense_Mutation	SNP	ENST00000378062.5	37	CCDS14262.1	.	.	.	.	.	.	.	.	.	.	G	12.49	1.953404	0.34471	.	.	ENSG00000124479	ENST00000378062	D	0.99005	-5.32	5.81	5.81	0.92471	.	0.418341	0.22660	N	0.057206	D	0.97015	0.9025	N	0.19112	0.55	0.46011	D	0.998816	P	0.52463	0.953	P	0.44673	0.457	D	0.97782	1.0233	10	0.87932	D	0	-5.9693	15.3537	0.74412	0.0:0.0:0.8602:0.1398	.	34	Q00604	NDP_HUMAN	W	34	ENSP00000367301:S34W	ENSP00000367301:S34W	S	-	2	0	NDP	43702735	1.000000	0.71417	0.997000	0.53966	0.932000	0.56968	3.250000	0.51445	2.428000	0.82296	0.600000	0.82982	TCG			0.468	NDP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056309.1		NM_000266	
EBP	10682	broad.mit.edu	37	X	48385673	48385673	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chrX:48385673G>T	ENST00000495186.1	+	4	1292	c.469G>T	c.(469-471)Ggc>Tgc	p.G157C	EBP_ENST00000276096.6_3'UTR	NM_006579.2	NP_006570.1	Q15125	EBP_HUMAN	emopamil binding protein (sterol isomerase)	157					cholesterol biosynthetic process (GO:0006695)|cholesterol metabolic process (GO:0008203)|drug transmembrane transport (GO:0006855)|hemopoiesis (GO:0030097)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)	C-8 sterol isomerase activity (GO:0000247)|cholestenol delta-isomerase activity (GO:0047750)|drug transmembrane transporter activity (GO:0015238)|steroid delta-isomerase activity (GO:0004769)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|stomach(1)	11					Tamoxifen(DB00675)	GGTCTCTGTGGGTAAGGAAAG	0.587																																					p.G157C	Ovarian(41;550 1000 33077 33474 52335)												.	EBP	30		0			c.G469T	GRCh37	CM024393	EBP	M								91.0	84.0	87.0					X																	48385673		2203	4300	6503	SO:0001630	splice_region_variant	10682	exon4			TCTGTGGGTAAGG	Z37986	CCDS14300.1	Xp11.23-p11.22	2013-05-22	2001-11-28		ENSG00000147155	ENSG00000147155			3133	protein-coding gene	gene with protein product	"""3-beta-hydroxysteroid-delta-8,delta-7-isomerase"", ""Chondrodysplasia punctata-2, X-linked dominant (Happle syndrome)"", ""sterol 8-isomerase"""	300205	"""emopamil-binding protein (sterol isomerase)"""	CDPX2		7706302, 8938429	Standard	NM_006579		Approved	CPX, CPXD, CHO2	uc004djx.4	Q15125	OTTHUMG00000034482	ENST00000495186.1:c.469+1G>T	X.37:g.48385673G>T			Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	71	0.04	3	NM_006579	359	0.00	0	Q6FGL3|Q6IBI9	Splice_Site	SNP	ENST00000495186.1	37	CCDS14300.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.070223	0.76301	.	.	ENSG00000147155	ENST00000495186;ENST00000446158	D;D	0.98105	-4.72;-4.72	5.5	5.5	0.81552	.	0.278219	0.40385	N	0.001118	D	0.98317	0.9442	M	0.74467	2.265	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98111	1.0420	10	0.30854	T	0.27	-8.3689	13.6629	0.62378	0.0:0.0:1.0:0.0	.	157	Q15125	EBP_HUMAN	C	157	ENSP00000417052:G157C;ENSP00000390031:G157C	ENSP00000390031:G157C	G	+	1	0	EBP	48270617	1.000000	0.71417	0.993000	0.49108	0.583000	0.36354	8.330000	0.90019	2.293000	0.77203	0.585000	0.79938	GGC			0.587	EBP-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000083372.1		NM_006579	Missense_Mutation
MAGED1	9500	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	51637753	51637753	+	Intron	SNP	C	C	A			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chrX:51637753C>A	ENST00000375722.1	+	2	297				MAGED1_ENST00000375695.2_Missense_Mutation_p.P26T|MAGED1_ENST00000494718.1_Intron|MAGED1_ENST00000326587.7_Intron|MAGED1_ENST00000375772.3_Intron			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1						apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					AGTCTGTCACCCCCTCCCCCA	0.562										Multiple Myeloma(10;0.10)	OREG0019786	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P26T													.	.			0			c.C76A												37.0	34.0	35.0					X																	51637753		2203	4299	6502	SO:0001627	intron_variant	9500	exon3			TGTCACCCCCTCC	AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.45+308C>A	X.37:g.51637753C>A			Somatic	107	0	0	978	WXS	Illumina HiSeq	.	119	0.33	39	NM_001005333	3	1.00	3	Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	Missense_Mutation	SNP	ENST00000375722.1	37	CCDS14337.1	.	.	.	.	.	.	.	.	.	.	C	7.135	0.580685	0.13686	.	.	ENSG00000179222	ENST00000375695	T	0.03004	4.08	2.79	2.79	0.32731	.	.	.	.	.	T	0.04952	0.0133	.	.	.	0.26655	N	0.972017	B	0.28552	0.215	B	0.36030	0.216	T	0.30179	-0.9987	8	0.87932	D	0	.	8.3191	0.32119	0.0:1.0:0.0:0.0	.	26	Q9Y5V3-2	.	T	26	ENSP00000364847:P26T	ENSP00000364847:P26T	P	+	1	0	MAGED1	51654493	0.672000	0.27530	0.977000	0.42913	0.185000	0.23345	1.988000	0.40697	1.681000	0.50988	0.425000	0.28330	CCC			0.562	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056593.1		NM_001005332	
KLF8	11279	bcgsc.ca	37	X	56295891	56295891	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chrX:56295891G>C	ENST00000468660.1	+	4	1015	c.727G>C	c.(727-729)Gcc>Ccc	p.A243P	KLF8_ENST00000374928.3_Missense_Mutation_p.A243P	NM_007250.4	NP_009181.2	O95600	KLF8_HUMAN	Kruppel-like factor 8	243					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(4)|large_intestine(6)|lung(5)|ovary(1)	16						TGGATCCTCAGCCTTGCAGAG	0.458																																					p.A243P													.	KLF8	38		0			c.G727C												146.0	114.0	125.0					X																	56295891		2203	4300	6503	SO:0001583	missense	11279	exon5			TCCTCAGCCTTGC	U28282	CCDS14373.1, CCDS55428.1	Xp11.21	2013-01-08			ENSG00000102349	ENSG00000102349		"""Zinc fingers, C2H2-type"", ""Kruppel-like transcription factors"""	6351	protein-coding gene	gene with protein product		300286					Standard	NM_007250		Approved	BKLF3, ZNF741, DXS741	uc004dur.3	O95600	OTTHUMG00000021666	ENST00000468660.1:c.727G>C	X.37:g.56295891G>C	ENSP00000417303:p.Ala243Pro		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_1	76	0.05	4	NM_001159296	48	0.00	0	B4DJN3|E7EQQ8|L0R3U8|L0R4U2|Q2M246|Q59GV5|Q5HYQ5|Q5JXP7|Q6MZJ7|Q9UGC4	Missense_Mutation	SNP	ENST00000468660.1	37	CCDS14373.1	.	.	.	.	.	.	.	.	.	.	G	14.94	2.685579	0.47991	.	.	ENSG00000102349	ENST00000374928;ENST00000468660	T	0.06933	3.24	4.13	-0.309	0.12769	.	0.664627	0.14027	N	0.346409	T	0.06781	0.0173	L	0.34521	1.04	0.31500	N	0.664928	P;P	0.44195	0.828;0.61	P;B	0.44561	0.453;0.266	T	0.28522	-1.0041	10	0.66056	D	0.02	.	2.6256	0.04928	0.2477:0.0:0.3547:0.3976	.	243;243	E7EQQ8;O95600	.;KLF8_HUMAN	P	243	ENSP00000417303:A243P	ENSP00000364063:A243P	A	+	1	0	KLF8	56312616	0.390000	0.25213	0.609000	0.28983	0.955000	0.61496	0.498000	0.22530	-0.003000	0.14444	0.600000	0.82982	GCC			0.458	KLF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056887.2		NM_007250	
BRWD3	254065	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	79959062	79959062	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chrX:79959062G>T	ENST00000373275.4	-	24	2968	c.2752C>A	c.(2752-2754)Cct>Act	p.P918T	BRWD3_ENST00000473691.1_5'UTR	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	918					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						TCTTCATTAGGCTCACCTGCT	0.378																																					p.P918T													.	.			0			c.C2752A												68.0	59.0	62.0					X																	79959062		2203	4299	6502	SO:0001583	missense	254065	exon24			CATTAGGCTCACC		CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.2752C>A	X.37:g.79959062G>T	ENSP00000362372:p.Pro918Thr		Somatic	361	0	0		WXS	Illumina HiSeq	.	486	0.28	134	NM_153252	75	0.45	34	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	ENST00000373275.4	37	CCDS14447.1	.	.	.	.	.	.	.	.	.	.	G	4.621	0.115422	0.08831	.	.	ENSG00000165288	ENST00000373275	T	0.53206	0.63	5.02	3.25	0.37280	.	0.299004	0.37761	N	0.001949	T	0.32496	0.0831	L	0.31926	0.97	0.37003	D	0.895357	B	0.22414	0.069	B	0.15870	0.014	T	0.17410	-1.0370	9	.	.	.	0.1518	9.5056	0.39044	0.0762:0.0:0.7816:0.1422	.	918	Q6RI45	BRWD3_HUMAN	T	918	ENSP00000362372:P918T	.	P	-	1	0	BRWD3	79845718	1.000000	0.71417	0.994000	0.49952	0.963000	0.63663	4.725000	0.61979	0.619000	0.30197	-0.198000	0.12761	CCT			0.378	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057344.1		NM_153252	
NXF4	55999	hgsc.bcm.edu	37	X	101819124	101819124	+	RNA	SNP	G	G	C			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chrX:101819124G>C	ENST00000360035.2	+	0	1258					NR_002216.1				nuclear RNA export factor 4 pseudogene											endometrium(2)|lung(8)	10						tctctctcctgtctctctgtc	0.557													c|||	93	0.0246358	0.0401	0.013	3775	,	,		13457	0.0159		0.005	False		,,,				2504	0.0102				.													.	.			0			.																																											55999	.			TCTCCTGTCTCTC	AK124700		Xq22	2005-01-24			ENSG00000196970	ENSG00000196970			8074	pseudogene	pseudogene		300318	"""nuclear RNA export factor 4"""			11566096	Standard	NR_002216		Approved		uc004ejf.1		OTTHUMG00000039695		X.37:g.101819124G>C			Somatic	90	0	0		WXS	Illumina HiSeq	.	102	0.06	6	.	0		0		RNA	SNP	ENST00000360035.2	37																																																																																						0.557	NXF4-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000095720.1			
PRR32	100130613	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	125954748	125954748	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGJ-01A-11D-A42Y-10	TCGA-2G-AAGJ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33a1d123-4f2c-4210-bc91-4ad16e31105d	aeaad8c4-5cdd-4ffd-bd16-b8d99b390608	g.chrX:125954748G>A	ENST00000371125.3	+	2	207	c.127G>A	c.(127-129)Gat>Aat	p.D43N		NM_001122716.1	NP_001116188.1	B1ATL7	PRR32_HUMAN		43																	CAAGCCAGAGGATGACGCAGA	0.557																																					p.D43N													.	.			0			c.G127A												85.0	67.0	72.0					X																	125954748		692	1591	2283	SO:0001583	missense	100130613	exon2			CCAGAGGATGACG																												ENST00000371125.3:c.127G>A	X.37:g.125954748G>A	ENSP00000360166:p.Asp43Asn		Somatic	162	0	0		WXS	Illumina HiSeq	.	161	0.32	51	NM_001122716	0		0		Missense_Mutation	SNP	ENST00000371125.3	37	CCDS48163.1	.	.	.	.	.	.	.	.	.	.	G	11.10	1.539507	0.27563	.	.	ENSG00000183631	ENST00000371125	T	0.35789	1.29	4.38	1.46	0.22682	.	.	.	.	.	T	0.22589	0.0545	N	0.24115	0.695	0.09310	N	1	B	0.20261	0.043	B	0.23018	0.043	T	0.22487	-1.0215	9	0.46703	T	0.11	.	5.4174	0.16382	0.4299:0.0:0.5701:0.0	.	43	B1ATL7	CX064_HUMAN	N	43	ENSP00000360166:D43N	ENSP00000360166:D43N	D	+	1	0	CXorf64	125782429	0.022000	0.18835	0.001000	0.08648	0.012000	0.07955	0.614000	0.24314	0.155000	0.19261	-0.191000	0.12829	GAT			0.557	CXorf64-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058188.1			
