#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
Unknown	0	bcgsc.ca	37	1	17077221	17077221	+	IGR	SNP	G	G	A			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr1:17077221G>A								RNU1-4 (10047 upstream) : MST1L (4183 downstream)																							TGGAGGAGGAGCAGCAGGGAG	0.662																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	100421113	.			GGAGGAGCAGCAG																													1.37:g.17077221G>A			Somatic	61	0.0163934426	1		WXS	Illumina HiSeq	Phase_1	131	0.11	14	.	0		0		RNA	SNP		37																																																																																					0	0.662										
OTUD3	23252	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	20234139	20234139	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr1:20234139C>T	ENST00000375120.3	+	8	1098	c.1097C>T	c.(1096-1098)gCc>gTc	p.A366V		NM_015207.1	NP_056022.1	Q5T2D3	OTUD3_HUMAN	OTU deubiquitinase 3	366					protein K11-linked deubiquitination (GO:0035871)|protein K6-linked deubiquitination (GO:0044313)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|kidney(2)|large_intestine(4)|lung(1)|skin(1)	9		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000276)|Lung NSC(340;0.000338)|Breast(348;0.000812)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.12e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000142)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.000408)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CGCCACAAAGCCCTGGAGAGC	0.562																																					p.A366V													.	.			0			c.C1097T												57.0	71.0	66.0					1																	20234139		2101	4216	6317	SO:0001583	missense	23252	exon8			ACAAAGCCCTGGA	AB007928	CCDS41279.1	1p36.13	2014-02-24	2014-02-24		ENSG00000169914	ENSG00000169914		"""OTU domain containing"""	29038	protein-coding gene	gene with protein product		611758	"""OTU domain containing 3"""			9455484, 23827681	Standard	NM_015207		Approved	KIAA0459, DUBA4	uc001bcs.4	Q5T2D3	OTTHUMG00000002696	ENST00000375120.3:c.1097C>T	1.37:g.20234139C>T	ENSP00000364261:p.Ala366Val		Somatic	58	0	0		WXS	Illumina HiSeq	.	96	0.17	16	NM_015207	8	0.13	1	O75047	Missense_Mutation	SNP	ENST00000375120.3	37	CCDS41279.1	.	.	.	.	.	.	.	.	.	.	C	10.15	1.271839	0.23221	.	.	ENSG00000169914	ENST00000375120	T	0.20069	2.1	5.93	5.01	0.66863	.	0.111064	0.64402	D	0.000013	T	0.09468	0.0233	N	0.15975	0.35	0.31031	N	0.717378	B	0.18610	0.029	B	0.09377	0.004	T	0.20605	-1.0270	10	0.02654	T	1	.	8.9583	0.35832	0.0:0.7947:0.0:0.2053	.	366	Q5T2D3	OTUD3_HUMAN	V	366	ENSP00000364261:A366V	ENSP00000364261:A366V	A	+	2	0	OTUD3	20106726	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.045000	0.49838	2.805000	0.96524	0.655000	0.94253	GCC			0.562	OTUD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000007655.1			
ADAMTSL4	54507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	150526002	150526002	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr1:150526002C>A	ENST00000369038.2	+	4	736	c.535C>A	c.(535-537)Ccc>Acc	p.P179T	ADAMTSL4_ENST00000271643.4_Missense_Mutation_p.P179T|MIR4257_ENST00000581735.1_RNA|ADAMTSL4_ENST00000369041.5_Missense_Mutation_p.P179T|ADAMTSL4_ENST00000369039.5_Missense_Mutation_p.P179T|RP11-54A4.2_ENST00000442435.2_RNA			Q6UY14	ATL4_HUMAN	ADAMTS-like 4	179					apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)			breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			TCGGAGCCCACCCAGATCTGA	0.597																																					p.P179T													.	.			0			c.C535A												98.0	100.0	100.0					1																	150526002		2203	4300	6503	SO:0001583	missense	54507	exon6			AGCCCACCCAGAT	BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000369038.2:c.535C>A	1.37:g.150526002C>A	ENSP00000358034:p.Pro179Thr		Somatic	62	0	0		WXS	Illumina HiSeq	.	105	0.24	25	NM_019032	9	0.44	4	B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	Missense_Mutation	SNP	ENST00000369038.2	37	CCDS955.1	.	.	.	.	.	.	.	.	.	.	C	10.56	1.383741	0.25031	.	.	ENSG00000143382	ENST00000369041;ENST00000271643;ENST00000369039;ENST00000369038	T;T;T;T	0.61859	0.15;0.07;0.36;0.07	3.87	2.95	0.34219	.	.	.	.	.	T	0.21921	0.0528	L	0.44542	1.39	0.09310	N	1	B;B;B;B	0.27416	0.001;0.001;0.019;0.178	B;B;B;B	0.25140	0.001;0.001;0.011;0.058	T	0.19679	-1.0298	9	0.13108	T	0.6	.	7.2997	0.26413	0.0:0.8723:0.0:0.1277	.	179;179;179;179	B7ZMJ3;F8WAD0;Q6UY14;Q6UY14-2	.;.;ATL4_HUMAN;.	T	179	ENSP00000358037:P179T;ENSP00000271643:P179T;ENSP00000358035:P179T;ENSP00000358034:P179T	ENSP00000271643:P179T	P	+	1	0	ADAMTSL4	148792626	0.000000	0.05858	0.001000	0.08648	0.293000	0.27360	0.085000	0.14912	0.625000	0.30304	0.536000	0.68110	CCC			0.597	ADAMTSL4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000084395.4		NM_019032	
PGLYRP4	57115	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	153303252	153303252	+	Missense_Mutation	SNP	G	G	C	rs41310915	byFrequency	TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr1:153303252G>C	ENST00000359650.5	-	9	1177	c.1113C>G	c.(1111-1113)ttC>ttG	p.F371L	PGLYRP4_ENST00000368739.3_Missense_Mutation_p.F367L|RNU6-160P_ENST00000384591.1_RNA	NM_020393.2	NP_065126.2	Q96LB8	PGRP4_HUMAN	peptidoglycan recognition protein 4	371					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|skin(1)|stomach(1)	23	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTCAGTGTTTGAAATGAGGCC	0.557																																					p.F371L													.	.			0			c.C1113G												115.0	107.0	110.0					1																	153303252		2203	4300	6503	SO:0001583	missense	57115	exon9			GTGTTTGAAATGA	AF242518	CCDS30871.1	1q21	2008-02-05			ENSG00000163218	ENSG00000163218			30015	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I beta precursor"""	608198				11461926	Standard	XR_241090		Approved	SBBI67, PGRPIB, PGLYRPIbeta, PGRP-Ibeta	uc001fbo.3	Q96LB8	OTTHUMG00000037057	ENST00000359650.5:c.1113C>G	1.37:g.153303252G>C	ENSP00000352672:p.Phe371Leu		Somatic	175	0	0		WXS	Illumina HiSeq	.	166	0.27	45	NM_020393	0		0	A8K838|Q3B822|Q3B823|Q5SY63|Q5SY64|Q9HD75	Missense_Mutation	SNP	ENST00000359650.5	37	CCDS30871.1	.	.	.	.	.	.	.	.	.	.	G	11.76	1.735601	0.30774	.	.	ENSG00000163218	ENST00000368739;ENST00000359650	T;T	0.17213	2.29;2.29	3.02	2.09	0.27110	N-acetylmuramoyl-L-alanine amidase domain (2);	0.112970	0.37304	N	0.002153	T	0.06508	0.0167	M	0.76433	2.335	0.33294	D	0.56391	P;P	0.39940	0.696;0.57	B;B	0.29663	0.105;0.049	T	0.09164	-1.0687	10	0.62326	D	0.03	-41.2079	5.7592	0.18190	0.1561:0.0:0.8439:0.0	.	367;371	Q96LB8-2;Q96LB8	.;PGRP4_HUMAN	L	367;371	ENSP00000357728:F367L;ENSP00000352672:F371L	ENSP00000352672:F371L	F	-	3	2	PGLYRP4	151569876	1.000000	0.71417	0.972000	0.41901	0.841000	0.47740	2.095000	0.41729	0.570000	0.29347	0.455000	0.32223	TTC			0.557	PGLYRP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000089978.1		NM_020393	
PEAR1	375033	hgsc.bcm.edu	37	1	156875139	156875139	+	Missense_Mutation	SNP	G	G	T	rs367928332		TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr1:156875139G>T	ENST00000338302.3	+	5	455	c.230G>T	c.(229-231)cGt>cTt	p.R77L	PEAR1_ENST00000292357.7_Missense_Mutation_p.R77L			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	77	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.				recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					ACCGTGTACCGTCAGGTGGTG	0.657																																					p.R77L													PEAR1,NS,haematopoietic_neoplasm,+1,2	PEAR1	1	2	0			c.G230T												66.0	58.0	61.0					1																	156875139		2203	4300	6503	SO:0001583	missense	375033	exon4			TGTACCGTCAGGT	AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.230G>T	1.37:g.156875139G>T	ENSP00000344465:p.Arg77Leu		Somatic	15	0.0666666667	1		WXS	Illumina HiSeq	.	29	0.69	20	NM_001080471	1	0.00	0	Q8TEK2	Missense_Mutation	SNP	ENST00000338302.3	37	CCDS30892.1	.	.	.	.	.	.	.	.	.	.	G	16.89	3.246144	0.59103	.	.	ENSG00000187800	ENST00000338302;ENST00000455314;ENST00000292357	D;T;D	0.90620	-2.7;0.57;-2.7	3.92	2.01	0.26516	EMI domain (1);	0.180201	0.27035	N	0.021250	D	0.85784	0.5777	L	0.36672	1.1	0.48830	D	0.999719	D	0.67145	0.996	P	0.57425	0.82	D	0.85126	0.0972	10	0.87932	D	0	.	8.25	0.31712	0.2038:0.0:0.7962:0.0	.	77	Q5VY43	PEAR1_HUMAN	L	77	ENSP00000344465:R77L;ENSP00000389742:R77L;ENSP00000292357:R77L	ENSP00000292357:R77L	R	+	2	0	PEAR1	155141763	1.000000	0.71417	0.969000	0.41365	0.894000	0.52154	6.979000	0.76154	0.311000	0.23014	-0.150000	0.13652	CGT			0.657	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000098937.2		NM_001080471	
LAD1	3898	broad.mit.edu	37	1	201356276	201356276	+	Silent	SNP	G	G	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr1:201356276G>T	ENST00000391967.2	-	3	514	c.213C>A	c.(211-213)ccC>ccA	p.P71P	LAD1_ENST00000367313.3_Silent_p.P85P	NM_005558.3	NP_005549.2	O00515	LAD1_HUMAN	ladinin 1	71						basement membrane (GO:0005604)	structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(6)|prostate(2)|skin(2)	19						GCAGTGGCTTGGGCACCTCTG	0.562																																					p.P71P													.	LAD1	42		0			c.C213A												39.0	40.0	40.0					1																	201356276		2203	4300	6503	SO:0001819	synonymous_variant	3898	exon3			TGGCTTGGGCACC	U42408	CCDS1410.1	1q25.1-q32.3	2008-02-05			ENSG00000159166	ENSG00000159166			6472	protein-coding gene	gene with protein product		602314				8618013, 9119369	Standard	NM_005558		Approved		uc001gwm.3	O00515	OTTHUMG00000035737	ENST00000391967.2:c.213C>A	1.37:g.201356276G>T			Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	79	0.04	3	NM_005558	44	0.00	0	O95614|Q96GD8	Silent	SNP	ENST00000391967.2	37	CCDS1410.1																																																																																					0.562	LAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000086946.1		NM_005558	
ADSS	159	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	244600986	244600986	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr1:244600986T>C	ENST00000366535.3	-	2	584	c.268A>G	c.(268-270)Aat>Gat	p.N90D		NM_001126.3	NP_001117.2			adenylosuccinate synthase											endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	12	all_cancers(71;2.17e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)	all_cancers(173;0.0896)|all_epithelial(177;0.172)	all cancers(7;9.71e-08)|GBM - Glioblastoma multiforme(7;1.28e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.0014)			GCAGTGACATTTGGATTAATT	0.358																																					p.N90D													.	.			0			c.A268G												129.0	139.0	136.0					1																	244600986		2203	4300	6503	SO:0001583	missense	159	exon2			TGACATTTGGATT	BC012356	CCDS1624.1	1q44	2008-02-05			ENSG00000035687	ENSG00000035687	6.3.4.4		292	protein-coding gene	gene with protein product		103060				2004783, 1592113	Standard	NM_001126		Approved		uc001iaj.3	P30520	OTTHUMG00000040102	ENST00000366535.3:c.268A>G	1.37:g.244600986T>C	ENSP00000355493:p.Asn90Asp		Somatic	95	0	0		WXS	Illumina HiSeq	.	95	0.23	22	NM_001126	144	0.33	48		Missense_Mutation	SNP	ENST00000366535.3	37	CCDS1624.1	.	.	.	.	.	.	.	.	.	.	T	16.76	3.211349	0.58343	.	.	ENSG00000035687	ENST00000366535;ENST00000449326;ENST00000430700	T	0.42513	0.97	5.81	5.81	0.92471	.	0.126914	0.64402	D	0.000001	T	0.25865	0.0630	N	0.17248	0.465	0.46749	D	0.999182	B	0.02656	0.0	B	0.04013	0.001	T	0.10706	-1.0618	10	0.06365	T	0.9	-14.1074	15.1599	0.72775	0.0:0.0:0.0:1.0	.	90	P30520	PURA2_HUMAN	D	90;69;30	ENSP00000355493:N90D	ENSP00000355493:N90D	N	-	1	0	ADSS	242667609	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	7.393000	0.79851	2.217000	0.71921	0.482000	0.46254	AAT			0.358	ADSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000096697.1		NM_001126	
UBTD1	80019	mdanderson.org	37	10	99329931	99329931	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr10:99329931G>A	ENST00000370664.3	+	3	671	c.335G>A	c.(334-336)cGc>cAc	p.R112H	ANKRD2_ENST00000370655.1_5'Flank|ANKRD2_ENST00000455090.1_5'Flank|ANKRD2_ENST00000307518.5_5'Flank|ANKRD2_ENST00000298808.5_5'Flank	NM_024954.3	NP_079230.1	Q9HAC8	UBTD1_HUMAN	ubiquitin domain containing 1	112										central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(1)|skin(1)	7		Colorectal(252;0.162)		Epithelial(162;3.04e-10)|all cancers(201;2.86e-08)		CTGGGCAATCGCTACCAGCTG	0.602																																					p.R112H	Pancreas(100;169 2668 32720)												UBTD1,colon,carcinoma,0,2	UBTD1	0	2	0			c.G335A												76.0	86.0	83.0					10																	99329931		2203	4300	6503	SO:0001583	missense	80019	exon3			GCAATCGCTACCA	BC007331	CCDS7465.1	10q24.2	2005-09-22			ENSG00000165886	ENSG00000165886			25683	protein-coding gene	gene with protein product						12477932	Standard	NM_024954		Approved	FLJ11807	uc001knv.1	Q9HAC8	OTTHUMG00000018856	ENST00000370664.3:c.335G>A	10.37:g.99329931G>A	ENSP00000359698:p.Arg112His		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_024954	72	0.00	0	D3DR57|Q53HI3	Missense_Mutation	SNP	ENST00000370664.3	37	CCDS7465.1	.	.	.	.	.	.	.	.	.	.	G	18.59	3.656311	0.67586	.	.	ENSG00000165886	ENST00000370664	T	0.47177	0.85	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.63733	0.2536	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.72338	0.977	T	0.57118	-0.7866	10	0.26408	T	0.33	-21.8286	18.6768	0.91531	0.0:0.0:1.0:0.0	.	112	Q9HAC8	UBTD1_HUMAN	H	112	ENSP00000359698:R112H	ENSP00000359698:R112H	R	+	2	0	UBTD1	99319921	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	9.813000	0.99286	2.687000	0.91594	0.655000	0.94253	CGC			0.602	UBTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049701.1		NM_024954	
TCF7L2	6934	broad.mit.edu	37	10	114925530	114925530	+	Silent	SNP	C	C	A			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr10:114925530C>A	ENST00000355995.4	+	15	2166	c.1659C>A	c.(1657-1659)ccC>ccA	p.P553P	TCF7L2_ENST00000536810.1_Silent_p.P536P|TCF7L2_ENST00000355717.4_3'UTR|TCF7L2_ENST00000466338.1_3'UTR|TCF7L2_ENST00000543371.1_Silent_p.P536P|TCF7L2_ENST00000538897.1_3'UTR|TCF7L2_ENST00000369397.4_Silent_p.P530P|TCF7L2_ENST00000542695.1_Silent_p.P269P|TCF7L2_ENST00000369386.1_3'UTR|TCF7L2_ENST00000545257.1_Silent_p.P553P			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)	553					blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		CTCCGCCACCCGCCCTCCTGC	0.706			T	VTI1A	colorectal																																p.P536P				Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	.	TCF7L2	298		0			c.C1608A												44.0	50.0	48.0					10																	114925530		2203	4300	6503	SO:0001819	synonymous_variant	6934	exon14			GCCACCCGCCCTC	X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	ENST00000355995.4:c.1659C>A	10.37:g.114925530C>A			Somatic	124	0.0080645161	1		WXS	Illumina HiSeq	Phase_I	126	0.02	3	NM_001146274	34	0.00	0	B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	Silent	SNP	ENST00000355995.4	37																																																																																						0.706	TCF7L2-203	KNOWN	basic	protein_coding	protein_coding				NM_030756	
HSPA12A	259217	mdanderson.org	37	10	118439125	118439125	+	Missense_Mutation	SNP	G	G	T	rs368507473	byFrequency	TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr10:118439125G>T	ENST00000369209.3	-	10	1279	c.1175C>A	c.(1174-1176)gCg>gAg	p.A392E		NM_025015.2	NP_079291.2	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A	392						extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32				all cancers(201;0.0158)		TGGGGCAGCCGCCCTTTTGCG	0.483																																					p.A392E													HSPA12A,colon,carcinoma,0,1	HSPA12A	0	1	0			c.C1175A												114.0	114.0	114.0					10																	118439125		1911	4128	6039	SO:0001583	missense	259217	exon10			GCAGCCGCCCTTT	AB007877	CCDS41569.1	10q25.3	2011-09-02	2002-08-29		ENSG00000165868	ENSG00000165868		"""Heat shock proteins / HSP70"""	19022	protein-coding gene	gene with protein product		610701	"""heat shock 70kD protein 12A"""			12552099	Standard	NM_025015		Approved	FLJ13874, KIAA0417	uc001lct.3	O43301	OTTHUMG00000019107	ENST00000369209.3:c.1175C>A	10.37:g.118439125G>T	ENSP00000358211:p.Ala392Glu		Somatic	119	0	0		WXS	Illumina HiSeq	Phase_I	95	0.05	5	NM_025015	3	0.00	0		Missense_Mutation	SNP	ENST00000369209.3	37	CCDS41569.1	.	.	.	.	.	.	.	.	.	.	G	32	5.122393	0.94429	.	.	ENSG00000165868	ENST00000369209	T	0.29397	1.57	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.36026	0.0952	N	0.20304	0.555	0.80722	D	1	P	0.52316	0.952	P	0.56042	0.79	T	0.02512	-1.1148	10	0.17369	T	0.5	.	20.3931	0.98965	0.0:0.0:1.0:0.0	.	392	O43301	HS12A_HUMAN	E	392	ENSP00000358211:A392E	ENSP00000358211:A392E	A	-	2	0	HSPA12A	118429115	1.000000	0.71417	0.856000	0.33681	0.780000	0.44128	9.476000	0.97823	2.824000	0.97209	0.655000	0.94253	GCG			0.483	HSPA12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050530.1		NM_025015	
SCGB2A2	4250	mdanderson.org	37	11	62038534	62038534	+	Silent	SNP	G	G	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr11:62038534G>T	ENST00000227918.2	+	2	299	c.237G>T	c.(235-237)gtG>gtT	p.V79V	SCGB2A2_ENST00000525380.1_Silent_p.V79V	NM_002411.2	NP_002402.1	Q13296	SG2A2_HUMAN	secretoglobin, family 2A, member 2	79										large_intestine(1)|lung(4)|ovary(1)|prostate(1)	7						ATGTTGAGGTGTTTATGGTAA	0.393																																					p.V79V													.	.			0			c.G237T												155.0	154.0	154.0					11																	62038534		2202	4299	6501	SO:0001819	synonymous_variant	4250	exon2			TGAGGTGTTTATG	AF015224	CCDS8018.1	11q13	2011-12-14	2002-03-22	2002-03-22	ENSG00000110484	ENSG00000110484		"""Secretoglobins"""	7050	protein-coding gene	gene with protein product	"""mammaglobin A"""	605562	"""mammaglobin 1"""	MGB1		9488047, 8631025, 22155607	Standard	XM_005274005		Approved	UGB2, MGC71974	uc001ntc.3	Q13296	OTTHUMG00000167509	ENST00000227918.2:c.237G>T	11.37:g.62038534G>T			Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_002411	0		0	A1A522|Q86WH8	Silent	SNP	ENST00000227918.2	37	CCDS8018.1																																																																																					0.393	SCGB2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394860.1		NM_002411	
RTN3	10313	broad.mit.edu	37	11	63525788	63525788	+	3'UTR	DEL	T	T	-			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr11:63525788delT	ENST00000377819.5	+	0	3368				RTN3_ENST00000339997.4_3'UTR|RTN3_ENST00000537981.1_3'UTR|RTN3_ENST00000341307.2_3'UTR|RTN3_ENST00000540798.1_3'UTR|C11orf95_ENST00000433688.1_lincRNA|RTN3_ENST00000354497.4_Frame_Shift_Del_p.A190fs|RTN3_ENST00000356000.3_3'UTR	NM_001265589.1	NP_001252518.1	O95197	RTN3_HUMAN	reticulon 3						apoptotic process (GO:0006915)|endoplasmic reticulum tubular network organization (GO:0071786)|response to stress (GO:0006950)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	20						CATTCCAAGCTTTTTTTTTAA	0.348																																					p.A190fs													.	RTN3	104		0			c.570delT												48.0	49.0	49.0					11																	63525788		2201	4298	6499	SO:0001624	3_prime_UTR_variant	10313	exon4			CCAAGCTTTTTTT	AF059524	CCDS8048.1, CCDS8049.1, CCDS8050.1, CCDS41664.1, CCDS58141.1, CCDS58142.1, CCDS58143.1	11q13	2011-01-14			ENSG00000133318	ENSG00000133318			10469	protein-coding gene	gene with protein product	"""neuroendocrine-specific protein-like 2"", ""NSP-like protein II"", ""isoforme III"", ""ASY interacting protein"", ""homolog of ASY protein"""	604249				10331947	Standard	NM_006054		Approved	NSPL2, NSPLII, ASYIP, HAP, RTN3-A1	uc001nxq.3	O95197		ENST00000377819.5:c.*115T>-	11.37:g.63525788delT			Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	78	0.09	7	NM_001265591	226	0.00	0	B3KQS2|B7Z308|B7Z4M0|F5H774|Q147U9|Q496K2|Q53GN3|Q59EP0|Q5UEP2|Q6T930|Q7RTM7|Q7RTM8|Q7RTN3	Frame_Shift_Del	DEL	ENST00000377819.5	37	CCDS58141.1																																																																																					0.348	RTN3-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000397846.1		NM_006054	
TEX40	25858	mdanderson.org	37	11	64071021	64071021	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr11:64071021G>T	ENST00000328404.6	+	3	440	c.420G>T	c.(418-420)gaG>gaT	p.E140D	TEX40_ENST00000539943.1_Missense_Mutation_p.E98D|ESRRA_ENST00000406310.1_5'Flank|ESRRA_ENST00000000442.6_5'Flank|RP11-783K16.10_ENST00000539086.1_RNA|ESRRA_ENST00000405666.1_5'Flank	NM_001039496.1	NP_001034585.1	Q9NTU4	TEX40_HUMAN	testis expressed 40	140					cell differentiation (GO:0030154)|male meiosis (GO:0007140)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)											ACTGGGCAGAGCAGCAGAGCA	0.532																																					p.E140D													.	.			0			c.G420T												45.0	47.0	47.0					11																	64071021		1981	4155	6136	SO:0001583	missense	25858	exon3			GGCAGAGCAGCAG			11q13.1	2013-01-11	2013-01-11	2013-01-11	ENSG00000219435	ENSG00000219435			19231	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 20"""	C11orf20			Standard	NM_001039496		Approved	DKFZP566E164	uc009ypm.3	Q9NTU4	OTTHUMG00000167820	ENST00000328404.6:c.420G>T	11.37:g.64071021G>T	ENSP00000330877:p.Glu140Asp		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_001039496	9	0.00	0		Missense_Mutation	SNP	ENST00000328404.6	37		.	.	.	.	.	.	.	.	.	.	G	19.24	3.788591	0.70337	.	.	ENSG00000219435	ENST00000328404;ENST00000539943	T;T	0.59638	0.26;0.25	4.29	0.266	0.15617	.	.	.	.	.	T	0.61248	0.2332	L	0.32530	0.975	0.25129	N	0.990586	D	0.89917	1.0	D	0.91635	0.999	T	0.51164	-0.8740	9	0.87932	D	0	-20.4708	6.7581	0.23526	0.4068:0.0:0.5932:0.0	.	140	Q9NTU4	CK020_HUMAN	D	140;98	ENSP00000330877:E140D;ENSP00000443917:E98D	ENSP00000330877:E140D	E	+	3	2	C11orf20	63827597	1.000000	0.71417	0.984000	0.44739	0.989000	0.77384	1.463000	0.35277	-0.029000	0.13827	0.561000	0.74099	GAG			0.532	TEX40-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_001039496	
PC	5091	mdanderson.org	37	11	66639190	66639190	+	Missense_Mutation	SNP	G	G	T	rs368549197		TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr11:66639190G>T	ENST00000393958.2	-	4	382	c.289C>A	c.(289-291)Ctg>Atg	p.L97M	PC_ENST00000393955.2_Missense_Mutation_p.L97M|PC_ENST00000393960.1_Missense_Mutation_p.L97M|PC_ENST00000355677.3_Missense_Mutation_p.L97M|PC_ENST00000524491.1_Missense_Mutation_p.L57M	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	97	Biotin carboxylation.				biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	GGGATGTGCAGGTAGGCCTGC	0.642																																					p.L97M													.	.			0			c.C289A							G	MET/LEU,MET/LEU,MET/LEU	0,4368		0,0,2184	23.0	25.0	24.0		289,289,289	4.4	1.0	11		24	1,8541		0,1,4270	no	missense,missense,missense	PC	NM_000920.3,NM_001040716.1,NM_022172.2	15,15,15	0,1,6454	TT,TG,GG		0.0117,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	97/1179,97/1179,97/1179	66639190	1,12909	2184	4271	6455	SO:0001583	missense	5091	exon4			TGTGCAGGTAGGC	U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.289C>A	11.37:g.66639190G>T	ENSP00000377530:p.Leu97Met		Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	26	0.08	2	NM_000920	29	0.00	0	B4DN00|Q16705	Missense_Mutation	SNP	ENST00000393958.2	37	CCDS8152.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.430554	0.83776	0.0	1.17E-4	ENSG00000173599	ENST00000393955;ENST00000393958;ENST00000393960;ENST00000524491;ENST00000355677	D;D;D;D;D	0.98400	-4.91;-4.91;-4.91;-4.91;-4.91	4.45	4.45	0.53987	Pre-ATP-grasp fold (1);PreATP-grasp-like fold (1);Biotin carboxylation domain (1);Carbamoyl-phosphate synthase, large subunit, N-terminal (1);	0.000000	0.64402	D	0.000017	D	0.98988	0.9655	M	0.93375	3.41	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	D	0.99418	1.0932	10	0.87932	D	0	-14.0082	8.2574	0.31765	0.1058:0.0:0.8942:0.0	.	97	P11498	PYC_HUMAN	M	97;97;97;57;97	ENSP00000377527:L97M;ENSP00000377530:L97M;ENSP00000377532:L97M;ENSP00000434192:L57M;ENSP00000347900:L97M	ENSP00000347900:L97M	L	-	1	2	PC	66395766	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.574000	0.67424	2.311000	0.77944	0.655000	0.94253	CTG			0.642	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393115.1		NM_001040716	
TCIRG1	10312	mdanderson.org	37	11	67818066	67818066	+	Missense_Mutation	SNP	G	G	T	rs370231613		TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr11:67818066G>T	ENST00000265686.3	+	19	2457	c.2349G>T	c.(2347-2349)atG>atT	p.M783I	RP11-802E16.3_ENST00000534517.1_RNA|RP11-802E16.3_ENST00000529934.1_RNA|TCIRG1_ENST00000530802.1_Intron|RP11-802E16.3_ENST00000526897.1_RNA|CHKA_ENST00000533728.1_5'Flank|TCIRG1_ENST00000532635.1_Missense_Mutation_p.M567I	NM_006019.3	NP_006010.2	Q13488	VPP3_HUMAN	T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3	783					ATP hydrolysis coupled proton transport (GO:0015991)|cellular defense response (GO:0006968)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of cell proliferation (GO:0008284)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(3)|prostate(1)	16						TTGCCGTGATGACCGTGGCTA	0.667																																					p.M783I													.	.			0			c.G2349T												122.0	126.0	124.0					11																	67818066		2200	4294	6494	SO:0001583	missense	10312	exon19			CGTGATGACCGTG	AF025374	CCDS8177.1, CCDS53670.1	11q13.2	2014-09-17	2006-01-20		ENSG00000110719	ENSG00000110719		"""ATPases / V-type"""	11647	protein-coding gene	gene with protein product	"""T-cell immune response cDNA 7"""	604592	"""T-cell, immune regulator 1"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein a isoform 3"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3"""			8579597, 9806637	Standard	NM_006019		Approved	TIRC7, OC-116, OC116, ATP6N1C, Atp6i, a3, ATP6V0A3	uc001one.3	Q13488	OTTHUMG00000167358	ENST00000265686.3:c.2349G>T	11.37:g.67818066G>T	ENSP00000265686:p.Met783Ile		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_006019	56	0.00	0	O75877|Q8WVC5	Missense_Mutation	SNP	ENST00000265686.3	37	CCDS8177.1	.	.	.	.	.	.	.	.	.	.	G	10.94	1.494048	0.26774	.	.	ENSG00000110719	ENST00000265686;ENST00000532635	D;D	0.85013	-1.93;-1.93	4.12	3.12	0.35913	.	0.247466	0.33217	N	0.005151	T	0.67674	0.2918	N	0.03016	-0.435	0.30962	N	0.723556	B	0.16802	0.019	B	0.16722	0.016	T	0.70517	-0.4850	10	0.72032	D	0.01	-13.1264	12.5048	0.55975	0.0:0.0:0.8328:0.1672	.	783	Q13488	VPP3_HUMAN	I	783;567	ENSP00000265686:M783I;ENSP00000434407:M567I	ENSP00000265686:M783I	M	+	3	0	TCIRG1	67574642	1.000000	0.71417	0.867000	0.34043	0.229000	0.25112	0.822000	0.27352	2.286000	0.76751	0.462000	0.41574	ATG			0.667	TCIRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394305.1		NM_006019	
UVRAG	7405	mdanderson.org	37	11	75852429	75852429	+	Missense_Mutation	SNP	G	G	A	rs569873877		TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr11:75852429G>A	ENST00000356136.3	+	15	2313	c.2072G>A	c.(2071-2073)cGc>cAc	p.R691H	UVRAG_ENST00000532130.1_Missense_Mutation_p.R319H|UVRAG_ENST00000533454.1_Missense_Mutation_p.R319H|UVRAG_ENST00000538870.1_Missense_Mutation_p.R247H|UVRAG_ENST00000528420.1_Missense_Mutation_p.R590H|UVRAG_ENST00000531818.1_Missense_Mutation_p.R319H|UVRAG_ENST00000539288.1_Missense_Mutation_p.R319H	NM_003369.3	NP_003360.2	Q9P2Y5	UVRAG_HUMAN	UV radiation resistance associated	691					DNA repair (GO:0006281)|positive regulation of autophagy (GO:0010508)|SNARE complex assembly (GO:0035493)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)|phagocytic vesicle (GO:0045335)|protein complex (GO:0043234)				central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(1)|large_intestine(2)|lung(15)|skin(5)|urinary_tract(2)	32						TCCAGCTTCCGCCGGCCGCGC	0.502													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19999	0.0		0.0	False		,,,				2504	0.0				p.R691H													UVRAG,NS,carcinoma,+1,1	UVRAG	1	1	0			c.G2072A												50.0	53.0	52.0					11																	75852429		2200	4292	6492	SO:0001583	missense	7405	exon15			GCTTCCGCCGGCC	X99050, AB012958	CCDS8241.1	11q13	2012-11-15	2012-11-15		ENSG00000198382	ENSG00000198382			12640	protein-coding gene	gene with protein product	"""beclin 1 binding protein"""	602493	"""UV radiation resistance associated gene"""			9169138, 16799551, 18843052	Standard	NM_003369		Approved	VPS38	uc001oxc.3	Q9P2Y5	OTTHUMG00000165319	ENST00000356136.3:c.2072G>A	11.37:g.75852429G>A	ENSP00000348455:p.Arg691His		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_003369	55	0.00	0	B3KTC1|O00392	Missense_Mutation	SNP	ENST00000356136.3	37	CCDS8241.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.004423	0.74932	.	.	ENSG00000198382	ENST00000356136;ENST00000528420;ENST00000533454;ENST00000531818;ENST00000532130;ENST00000539288;ENST00000538870	T	0.57107	0.42	5.99	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.60170	0.2248	L	0.36672	1.1	0.80722	D	1	P;D	0.67145	0.76;0.996	B;P	0.61132	0.191;0.884	T	0.64313	-0.6437	10	0.87932	D	0	-5.0674	14.3019	0.66359	0.0705:0.0:0.9295:0.0	.	247;691	B7Z6A0;Q9P2Y5	.;UVRAG_HUMAN	H	691;590;319;319;319;319;247	ENSP00000348455:R691H	ENSP00000348455:R691H	R	+	2	0	UVRAG	75530077	1.000000	0.71417	1.000000	0.80357	0.421000	0.31385	7.607000	0.82883	1.549000	0.49425	-0.136000	0.14681	CGC			0.502	UVRAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000383430.1		NM_003369	
FAT3	120114	broad.mit.edu;mdanderson.org	37	11	92086050	92086050	+	Missense_Mutation	SNP	C	C	T	rs538781318		TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr11:92086050C>T	ENST00000298047.6	+	1	789	c.772C>T	c.(772-774)Cgc>Tgc	p.R258C	FAT3_ENST00000525166.1_Missense_Mutation_p.R108C|FAT3_ENST00000409404.2_Missense_Mutation_p.R258C|FAT3_ENST00000541502.1_Missense_Mutation_p.R258C			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	258	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R258C(2)|p.R258S(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TCACATTGAGCGCATAAATGA	0.428										TCGA Ovarian(4;0.039)			C|||	1	0.000199681	0.0008	0.0	5008	,	,		21189	0.0		0.0	False		,,,				2504	0.0				p.R258C													FAT3_ENST00000409404,NS,carcinoma,0,8	FAT3	1822	8	4	Substitution - Missense(4)	cervix(2)|lung(2)	c.C772T												186.0	178.0	181.0					11																	92086050		2000	4175	6175	SO:0001583	missense	120114	exon1			ATTGAGCGCATAA	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.772C>T	11.37:g.92086050C>T	ENSP00000298047:p.Arg258Cys		Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	92	0.04	4	NM_001008781	1	0.00	0	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	C	18.34	3.603479	0.66445	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502;ENST00000525166	T;T;T;T	0.61980	0.06;0.06;0.06;0.06	4.83	4.83	0.62350	.	.	.	.	.	T	0.76557	0.4004	L	0.56769	1.78	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.78940	-0.2006	9	0.66056	D	0.02	.	17.2694	0.87097	0.0:1.0:0.0:0.0	.	258	Q8TDW7-3	.	C	258;258;258;108	ENSP00000298047:R258C;ENSP00000387040:R258C;ENSP00000443786:R258C;ENSP00000432586:R108C	ENSP00000298047:R258C	R	+	1	0	FAT3	91725698	1.000000	0.71417	0.953000	0.39169	0.741000	0.42261	7.752000	0.85141	2.359000	0.80004	0.557000	0.71058	CGC			0.428	FAT3-201	KNOWN	basic	protein_coding	protein_coding				NM_001008781	
KMT2D	8085	broad.mit.edu	37	12	49444814	49444814	+	Silent	SNP	A	A	G			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr12:49444814A>G	ENST00000301067.7	-	10	2651	c.2652T>C	c.(2650-2652)ccT>ccC	p.P884P		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	884	Pro-rich.			Missing (in Ref. 1; AAC51734). {ECO:0000305}.	chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.P884P(1)									CCCCAGGGGGAGGGAACAAGG	0.642																																					p.P884P													MLL2_ENST00000301067,NS,carcinoma,0,1	MLL2	1173	1	1	Substitution - coding silent(1)	lung(1)	c.T2652C												50.0	56.0	54.0					12																	49444814		2012	4171	6183	SO:0001819	synonymous_variant	8085	exon10			AGGGGGAGGGAAC	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.2652T>C	12.37:g.49444814A>G			Somatic	122	0	0		WXS	Illumina HiSeq	Phase_I	138	0.04	5	NM_003482	6	0.00	0	O14687	Silent	SNP	ENST00000301067.7	37	CCDS44873.1																																																																																					0.642	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390183.2			
RP11-597A11.1	0	broad.mit.edu	37	14	20138372	20138372	+	RNA	DEL	G	G	-	rs542749146|rs368935470		TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr14:20138372delG	ENST00000548261.1	+	0	391																											TGAAACAaaagaaagaaagaa	0.398																																					.													.	.			0			.																																											0	.			ACAAAAGAAAGAA																													14.37:g.20138372delG			Somatic	12	0	0		WXS	Illumina HiSeq	Phase_I	16	0.44	7	.	0		0		RNA	DEL	ENST00000548261.1	37																																																																																						0.398	RP11-597A11.1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000409571.1			
GOLGA6L1	283767	broad.mit.edu	37	15	22743373	22743373	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr15:22743373G>C	ENST00000560659.2	+	8	1608	c.1608G>C	c.(1606-1608)aaG>aaC	p.K536N	GOLGA6L1_ENST00000316397.3_Missense_Mutation_p.K586N			Q8N7Z2	GG6L1_HUMAN	golgin A6 family-like 1	560										NS(1)|breast(2)|endometrium(5)|large_intestine(1)|lung(1)|skin(1)	11						agaaggagaagatacgagagc	0.537																																					p.K586N													.	GOLGA6L1	20		0			c.G1758C												1.0	1.0	1.0					15																	22743373		24	28	52	SO:0001583	missense	283767	exon8			GGAGAAGATACGA	AK097517	CCDS73699.1	15q11.2	2012-10-05	2010-02-12		ENSG00000197414	ENSG00000277865			37444	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 1"""				Standard	NM_001001413		Approved		uc010tzx.1	Q8N7Z2	OTTHUMG00000171883	ENST00000560659.2:c.1608G>C	15.37:g.22743373G>C	ENSP00000452626:p.Lys536Asn		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	24	0.13	3	NM_001001413	0		0		Missense_Mutation	SNP	ENST00000560659.2	37		.	.	.	.	.	.	.	.	.	.	.	3.946	-0.013182	0.07727	.	.	ENSG00000197414	ENST00000316397;ENST00000355145	T	0.12039	2.72	.	.	.	.	.	.	.	.	T	0.10723	0.0262	L	0.34521	1.04	0.09310	N	1	.	.	.	.	.	.	T	0.32428	-0.9907	6	0.42905	T	0.14	.	3.6737	0.08284	0.0:0.4921:0.5079:0.0	.	.	.	.	N	586;546	ENSP00000320207:K586N	ENSP00000320207:K586N	K	+	3	2	GOLGA6L1	20294737	0.006000	0.16342	0.012000	0.15200	0.012000	0.07955	0.372000	0.20467	0.149000	0.19098	0.152000	0.16155	AAG			0.537	GOLGA6L1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000415616.2		NM_001001413	
GOLGA8S	653061	hgsc.bcm.edu	37	15	23606532	23606532	+	Missense_Mutation	SNP	C	C	G	rs62001550		TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr15:23606532C>G	ENST00000562295.1	+	12	1039	c.1039C>G	c.(1039-1041)Cag>Gag	p.Q347E	RN7SL536P_ENST00000491146.2_RNA					golgin A8 family, member S																		TCGGGAGCAGCAGGAGAGGCT	0.617																																					.													.	.			0			.																																									SO:0001583	missense	653061	.			GAGCAGCAGGAGA			15q11.2	2013-01-17			ENSG00000261739	ENSG00000261739			44409	other	unknown							Standard	NR_038843		Approved		uc021sfv.2		OTTHUMG00000176415	ENST00000562295.1:c.1039C>G	15.37:g.23606532C>G	ENSP00000455298:p.Gln347Glu		Somatic	8	0	0		WXS	Illumina HiSeq	.	8	0.50	4	.	0		0		RNA	SNP	ENST00000562295.1	37																																																																																						0.617	GOLGA8S-001	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000431934.1		NR_038843	
HERC2	8924	broad.mit.edu	37	15	28459392	28459392	+	Missense_Mutation	SNP	G	G	A	rs138059246	byFrequency	TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr15:28459392G>A	ENST00000261609.7	-	41	6493	c.6385C>T	c.(6385-6387)Cgc>Tgc	p.R2129C		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GCCTGCGGGCGCACCCTGCGC	0.667																																					p.R2129C													HERC2,NS,carcinoma,0,1	HERC2	501	1	0			c.C6385T												25.0	26.0	25.0					15																	28459392		2195	4292	6487	SO:0001583	missense	8924	exon41			GCGGGCGCACCCT	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.6385C>T	15.37:g.28459392G>A	ENSP00000261609:p.Arg2129Cys		Somatic	43	0.023255814	1		WXS	Illumina HiSeq	Phase_I	31	0.13	4	NM_004667	10	0.00	0		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	G	15.82	2.944883	0.53079	.	.	ENSG00000128731	ENST00000261609	T	0.41400	1.0	4.75	3.77	0.43336	.	0.000000	0.85682	D	0.000000	T	0.53594	0.1806	L	0.44542	1.39	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.55866	-0.8073	10	0.72032	D	0.01	.	12.4051	0.55434	0.0:0.0:0.7652:0.2348	.	2129	O95714	HERC2_HUMAN	C	2129	ENSP00000261609:R2129C	ENSP00000261609:R2129C	R	-	1	0	HERC2	26132987	1.000000	0.71417	0.956000	0.39512	0.126000	0.20510	3.130000	0.50508	2.461000	0.83175	0.484000	0.47621	CGC			0.667	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251358.2		NM_004667	
SLC12A6	9990	mdanderson.org	37	15	34549912	34549912	+	Silent	SNP	G	G	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr15:34549912G>T	ENST00000354181.3	-	6	1113	c.621C>A	c.(619-621)cgC>cgA	p.R207R	SLC12A6_ENST00000451844.2_Intron|SLC12A6_ENST00000560164.1_Intron|SLC12A6_ENST00000397707.2_Silent_p.R192R|SLC12A6_ENST00000290209.5_Silent_p.R156R|SLC12A6_ENST00000558589.1_Silent_p.R198R|SLC12A6_ENST00000558667.1_Silent_p.R207R|RP11-1084A12.2_ENST00000559867.1_RNA|SLC12A6_ENST00000458406.2_Silent_p.R148R|SLC12A6_ENST00000560611.1_Silent_p.R207R|SLC12A6_ENST00000397702.2_Silent_p.R148R			Q9UHW9	S12A6_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 6	207					angiogenesis (GO:0001525)|cellular hypotonic response (GO:0071476)|cellular hypotonic salinity response (GO:0071477)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|rubidium ion transport (GO:0035826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium ion transmembrane transporter activity (GO:0015079)|potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)|rubidium ion transmembrane transporter activity (GO:0035827)			central_nervous_system(5)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|skin(3)	45		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	CCCATGTAAGGCGTAAAAAAA	0.453																																					p.R207R													.	.			0			c.C621A												68.0	62.0	64.0					15																	34549912		2201	4298	6499	SO:0001819	synonymous_variant	9990	exon5			TGTAAGGCGTAAA	AF108831	CCDS10036.1, CCDS42010.1, CCDS42011.1, CCDS42012.1, CCDS58352.1	15q13	2014-09-17	2013-07-18		ENSG00000140199	ENSG00000140199		"""Solute carriers"""	10914	protein-coding gene	gene with protein product		604878	"""agenesis of corpus callosum and peripheral neuropathy (Andermann syndrome)"""	KCC3, ACCPN		10187864, 10347194	Standard	NM_133647		Approved		uc001zhw.3	Q9UHW9	OTTHUMG00000129441	ENST00000354181.3:c.621C>A	15.37:g.34549912G>T			Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	53	0.06	3	NM_133647	7	0.00	0	A0AV76|Q2VI00|Q7Z2E7|Q7Z4G5|Q8TDD4|Q9UFR2|Q9Y642|Q9Y665	Silent	SNP	ENST00000354181.3	37	CCDS58352.1																																																																																					0.453	SLC12A6-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000417991.1		NM_005135	
MYO1E	4643	mdanderson.org	37	15	59453379	59453379	+	Missense_Mutation	SNP	C	C	T	rs202237883		TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr15:59453379C>T	ENST00000288235.4	-	24	3077	c.2678G>A	c.(2677-2679)gGc>gAc	p.G893D		NM_004998.3	NP_004989.2	Q12965	MYO1E_HUMAN	myosin IE	893	Myosin tail. {ECO:0000255}.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(6)|lung(10)|pancreas(2)|prostate(1)|urinary_tract(1)	33				all cancers(107;0.207)		TTGCCGGGAGCCCCCTGCACT	0.562											OREG0023156	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	1	0.000199681	0.0	0.0	5008	,	,		15964	0.0		0.001	False		,,,				2504	0.0				p.G893D													.	.			0			c.G2678A							C	ASP/GLY	2,4380	4.2+/-10.8	0,2,2189	49.0	50.0	50.0		2678	5.0	1.0	15		50	3,8579	3.0+/-9.4	0,3,4288	no	missense	MYO1E	NM_004998.2	94	0,5,6477	TT,TC,CC		0.035,0.0456,0.0386	possibly-damaging	893/1109	59453379	5,12959	2191	4291	6482	SO:0001583	missense	4643	exon24			CGGGAGCCCCCTG	U14391	CCDS32254.1	15q21-q22	2011-09-27				ENSG00000157483		"""Myosins / Myosin superfamily : Class I"""	7599	protein-coding gene	gene with protein product	"""myosin-IC"""	601479				8884266	Standard	NM_004998		Approved	MYO1C, HuncM-IC, MGC104638	uc002aga.4	Q12965		ENST00000288235.4:c.2678G>A	15.37:g.59453379C>T	ENSP00000288235:p.Gly893Asp		Somatic	48	0	0	1038	WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_004998	77	0.00	0	Q14778	Missense_Mutation	SNP	ENST00000288235.4	37	CCDS32254.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.367089	0.82463	4.56E-4	3.5E-4	ENSG00000157483	ENST00000288235	T	0.36520	1.25	5.04	5.04	0.67666	Myosin tail 2 (1);	0.096704	0.64402	D	0.000001	T	0.63462	0.2513	M	0.80508	2.5	0.80722	D	1	D	0.63046	0.992	D	0.70487	0.969	T	0.67413	-0.5677	10	0.62326	D	0.03	.	18.5731	0.91144	0.0:1.0:0.0:0.0	.	893	Q12965	MYO1E_HUMAN	D	893	ENSP00000288235:G893D	ENSP00000288235:G893D	G	-	2	0	MYO1E	57240671	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	5.917000	0.69989	2.632000	0.89209	0.561000	0.74099	GGC			0.562	MYO1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000416024.1		NM_004998	
SMAD6	4091	broad.mit.edu	37	15	66996088	66996090	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	GCT	GCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr15:66996088_66996090delGCT	ENST00000288840.5	+	1	1523_1525	c.492_494delGCT	c.(490-495)cggctg>cgg	p.L168del	SMAD6_ENST00000457357.2_In_Frame_Del_p.L168del	NM_005585.4	NP_005576.3	O43541	SMAD6_HUMAN	SMAD family member 6	168	MH1. {ECO:0000255|PROSITE- ProRule:PRU00438}.|Poly-Leu.				BMP signaling pathway (GO:0030509)|cell-substrate adhesion (GO:0031589)|fat cell differentiation (GO:0045444)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|response to estrogen (GO:0043627)|response to laminar fluid shear stress (GO:0034616)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|zygotic specification of dorsal/ventral axis (GO:0007352)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, inhibitory cytoplasmic mediator activity (GO:0030617)|type I activin receptor binding (GO:0070698)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)			lung(1)|skin(1)	2						CGCGCTCGCGGCTGCTGCTGCTG	0.759																																					p.164_165del	Esophageal Squamous(179;72 2004 22333 39628 47290)												.	SMAD6	14		0			c.492_494del																																									SO:0001651	inframe_deletion	4091	exon1			CTCGCGGCTGCTG	BC012986	CCDS10221.1	15q22.31	2014-09-11	2006-11-06	2004-05-26	ENSG00000137834	ENSG00000137834		"""SMADs"""	6772	protein-coding gene	gene with protein product		602931	"""MAD, mothers against decapentaplegic homolog 6 (Drosophila)"", ""SMAD, mothers against DPP homolog 6 (Drosophila)"""	MADH7, MADH6		9256479	Standard	NR_027654		Approved	HsT17432	uc002aqf.3	O43541	OTTHUMG00000133218	ENST00000288840.5:c.492_494delGCT	15.37:g.66996097_66996099delGCT	ENSP00000288840:p.Leu168del		Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	NM_005585	3	0.00	0	A9J6M5|O43654|Q15799|Q7Z7L4|Q96E31|Q9UKZ3	In_Frame_Del	DEL	ENST00000288840.5	37	CCDS10221.1																																																																																					0.759	SMAD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256953.2		NM_005585	
COX5A	9377	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	15	75219171	75219171	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr15:75219171G>T	ENST00000322347.6	-	3	428	c.275C>A	c.(274-276)gCt>gAt	p.A92D	COX5A_ENST00000568783.1_Missense_Mutation_p.A92D|COX5A_ENST00000567270.1_Missense_Mutation_p.A53D|COX5A_ENST00000568517.1_Missense_Mutation_p.A11D|COX5A_ENST00000564811.1_Missense_Mutation_p.A92D|COX5A_ENST00000562233.1_Intron	NM_004255.3	NP_004246.2	P20674	COX5A_HUMAN	cytochrome c oxidase subunit Va	92					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)	cytochrome-c oxidase activity (GO:0004129)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|pancreas(1)	3						TGCCCGCAAAGCAGCATCAAT	0.393																																					p.A92D													.	.			0			c.C275A												95.0	91.0	93.0					15																	75219171		2197	4295	6492	SO:0001583	missense	9377	exon3			CGCAAAGCAGCAT	M22760	CCDS10273.1	15q25	2011-07-04			ENSG00000178741	ENSG00000178741	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2267	protein-coding gene	gene with protein product		603773				10072584, 2853101	Standard	NM_004255		Approved		uc002azi.4	P20674	OTTHUMG00000142825	ENST00000322347.6:c.275C>A	15.37:g.75219171G>T	ENSP00000317780:p.Ala92Asp		Somatic	86	0	0		WXS	Illumina HiSeq	.	100	0.05	5	NM_004255	3045	0.00	1	P30045|Q8TB65	Missense_Mutation	SNP	ENST00000322347.6	37	CCDS10273.1	.	.	.	.	.	.	.	.	.	.	G	31	5.104312	0.94245	.	.	ENSG00000178741	ENST00000322347	.	.	.	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.85570	0.5727	M	0.90814	3.15	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88252	0.2917	9	0.87932	D	0	-12.7967	18.0514	0.89349	0.0:0.0:1.0:0.0	.	92	P20674	COX5A_HUMAN	D	92	.	ENSP00000317780:A92D	A	-	2	0	COX5A	73006224	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.292000	0.96076	2.609000	0.88269	0.655000	0.94253	GCT			0.393	COX5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000286417.1		NM_004255	
PDPK1	5170	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	2647685	2647685	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr16:2647685G>A	ENST00000342085.4	+	14	1737	c.1588G>A	c.(1588-1590)Ggg>Agg	p.G530R	CTD-3126B10.1_ENST00000562166.1_RNA|PDPK1_ENST00000268673.7_Missense_Mutation_p.G403R|PDPK1_ENST00000441549.3_3'UTR|PDPK1_ENST00000389224.3_Missense_Mutation_p.G503R|PDPK1_ENST00000354836.5_Missense_Mutation_p.G506R	NM_002613.4	NP_002604.1	O15530	PDPK1_HUMAN	3-phosphoinositide dependent protein kinase 1	530	PH.				actin cytoskeleton organization (GO:0030036)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway (GO:0097191)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|focal adhesion assembly (GO:0048041)|hyperosmotic response (GO:0006972)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of endothelial cell migration (GO:0010594)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of mast cell degranulation (GO:0043304)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell development (GO:0003323)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	3-phosphoinositide-dependent protein kinase activity (GO:0004676)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	7		Ovarian(90;0.17)			Celecoxib(DB00482)	GGACCCCAGCGGGAACGCACA	0.612																																					p.G530R													.	.			0			c.G1588A												88.0	77.0	81.0					16																	2647685		2198	4300	6498	SO:0001583	missense	5170	exon14			CCCAGCGGGAACG	AF017995	CCDS10472.1, CCDS10473.1, CCDS58411.1	16p13.3	2014-03-20	2014-03-20		ENSG00000140992	ENSG00000140992			8816	protein-coding gene	gene with protein product	"""PkB kinase"""	605213				9094314, 9445477	Standard	NM_002613		Approved	PDK1	uc002cqs.4	O15530	OTTHUMG00000128874	ENST00000342085.4:c.1588G>A	16.37:g.2647685G>A	ENSP00000344220:p.Gly530Arg		Somatic	146	0	0		WXS	Illumina HiSeq	.	144	0.28	41	NM_002613	62	0.39	24	H0Y4Z0|Q59EH6|Q6FI20|Q8IV52|Q9BRD5	Missense_Mutation	SNP	ENST00000342085.4	37	CCDS10472.1	.	.	.	.	.	.	.	.	.	.	-	17.64	3.440842	0.63067	.	.	ENSG00000140992	ENST00000342085;ENST00000268673;ENST00000354836;ENST00000389224	T;T;T;T	0.23552	1.9;1.9;1.9;1.9	5.21	5.21	0.72293	Pleckstrin homology-type (1);	0.000000	0.85682	U	0.000000	T	0.46171	0.1379	L	0.52206	1.635	0.80722	D	1	D;D	0.89917	1.0;0.963	D;B	0.77004	0.989;0.429	T	0.28650	-1.0037	10	0.44086	T	0.13	-20.8719	17.3267	0.87251	0.0:0.0:1.0:0.0	.	403;530	O15530-4;O15530	.;PDPK1_HUMAN	R	530;403;506;503	ENSP00000344220:G530R;ENSP00000268673:G403R;ENSP00000346895:G506R;ENSP00000373876:G503R	ENSP00000268673:G403R	G	+	1	0	PDPK1	2587686	1.000000	0.71417	0.653000	0.29593	0.621000	0.37620	7.732000	0.84908	2.394000	0.81467	0.650000	0.86243	GGG			0.612	PDPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250831.3			
SRRM2	23524	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	16	2819139	2819139	+	Silent	SNP	C	C	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr16:2819139C>T	ENST00000301740.8	+	12	8424	c.7875C>T	c.(7873-7875)tcC>tcT	p.S2625S	SRRM2_ENST00000574593.1_3'UTR|AC092117.2_ENST00000581119.1_RNA	NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	2625	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						cctcctcctcctcttcttcct	0.592																																					p.S2625S													.	.			0			c.C7875T												141.0	121.0	128.0					16																	2819139		2198	4300	6498	SO:0001819	synonymous_variant	23524	exon12			CTCCTCCTCTTCT	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.7875C>T	16.37:g.2819139C>T			Somatic	70	0	0		WXS	Illumina HiSeq	.	94	0.09	8	NM_016333	971	0.01	5	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Silent	SNP	ENST00000301740.8	37	CCDS32373.1																																																																																					0.592	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000436411.1			
RABEP2	79874	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	28925902	28925902	+	Silent	SNP	A	A	C			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr16:28925902A>C	ENST00000358201.4	-	5	1137	c.549T>G	c.(547-549)cgT>cgG	p.R183R	RABEP2_ENST00000561803.1_5'Flank|RABEP2_ENST00000357573.6_Silent_p.R183R|RABEP2_ENST00000544477.1_Silent_p.R112R	NM_024816.2	NP_079092.2	Q9H5N1	RABE2_HUMAN	rabaptin, RAB GTPase binding effector protein 2	183					endocytosis (GO:0006897)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	16						CATGCCGGGGACGTCTCTAGG	0.711																																					p.R183R	Pancreas(66;639 1284 10093 31061 49099)												.	.			0			c.T549G												26.0	33.0	31.0					16																	28925902		1908	4101	6009	SO:0001819	synonymous_variant	79874	exon5			CCGGGGACGTCTC	AK026935	CCDS42140.1	16p11.2	2014-09-11			ENSG00000177548	ENSG00000177548			24817	protein-coding gene	gene with protein product		611869				12477932	Standard	NM_024816		Approved	FRA, FLJ23282	uc002drq.3	Q9H5N1	OTTHUMG00000176593	ENST00000358201.4:c.549T>G	16.37:g.28925902A>C			Somatic	63	0	0		WXS	Illumina HiSeq	.	41	0.17	7	NM_024816	34	0.18	6		Silent	SNP	ENST00000358201.4	37	CCDS42140.1																																																																																					0.711	RABEP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000432691.1		NM_024816	
TGFB1I1	7041	broad.mit.edu	37	16	31484850	31484850	+	Silent	SNP	T	T	C			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr16:31484850T>C	ENST00000394863.3	+	2	232	c.102T>C	c.(100-102)ccT>ccC	p.P34P	TGFB1I1_ENST00000567607.1_Silent_p.P17P|TGFB1I1_ENST00000361773.3_Silent_p.P17P|TGFB1I1_ENST00000394858.2_Silent_p.P17P	NM_001042454.2	NP_001035919.1	O43294	TGFI1_HUMAN	transforming growth factor beta 1 induced transcript 1	34	Interaction with PTK2B/PYK2.|Transcription activation. {ECO:0000250}.				androgen receptor signaling pathway (GO:0030521)|cell adhesion (GO:0007155)|cell fate commitment (GO:0045165)|epithelial cell differentiation (GO:0030855)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|response to heat (GO:0009408)|transcription from RNA polymerase II promoter (GO:0006366)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|I-SMAD binding (GO:0070411)|Roundabout binding (GO:0048495)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			lung(8)|upper_aerodigestive_tract(1)	9						CTCTCACCCCTCCCCCATCCT	0.642																																					p.P34P													.	TGFB1I1	60		0			c.T102C												35.0	40.0	39.0					16																	31484850		2197	4300	6497	SO:0001819	synonymous_variant	7041	exon2			CACCCCTCCCCCA	AB007836	CCDS10713.1, CCDS42156.1	16p11	2008-02-05			ENSG00000140682	ENSG00000140682			11767	protein-coding gene	gene with protein product		602353				9422762, 10075738	Standard	NM_015927		Approved	Hic-5, TSC-5, ARA55, HIC-5	uc002ecd.2	O43294	OTTHUMG00000132467	ENST00000394863.3:c.102T>C	16.37:g.31484850T>C			Somatic	37	0.1081081081	4		WXS	Illumina HiSeq	Phase_I	37	0.22	8	NM_001042454	21	0.00	0	B2R8D5|Q9BPW3|Q9Y2V5	Silent	SNP	ENST00000394863.3	37	CCDS42156.1																																																																																					0.642	TGFB1I1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000255630.3			
CIAPIN1	57019	mdanderson.org	37	16	57463161	57463161	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr16:57463161C>T	ENST00000569979.1	-	6	708	c.662G>A	c.(661-663)aGc>aAc	p.S221N	CIAPIN1_ENST00000568940.1_Silent_p.Q248Q|CIAPIN1_ENST00000569370.1_Silent_p.Q248Q|CIAPIN1_ENST00000567518.1_Missense_Mutation_p.S274N|CIAPIN1_ENST00000569246.1_5'Flank|CIAPIN1_ENST00000394391.4_Missense_Mutation_p.S287N|CIAPIN1_ENST00000565961.1_Silent_p.Q221Q					cytokine induced apoptosis inhibitor 1											cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	10						GTAGGGGCAGCTGGCACAGCG	0.552																																					p.S287N													.	.			0			c.G860A												60.0	60.0	60.0					16																	57463161		2007	4177	6184	SO:0001583	missense	57019	exon9			GGGCAGCTGGCAC	AF248964	CCDS10781.2	16q21	2012-09-20			ENSG00000005194	ENSG00000005194			28050	protein-coding gene	gene with protein product		608943				10493829, 11230166	Standard	XM_005256061		Approved	Anamorsin	uc002ell.1	Q6FI81	OTTHUMG00000133457	ENST00000569979.1:c.662G>A	16.37:g.57463161C>T	ENSP00000458000:p.Ser221Asn		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_020313	536	0.00	0		Missense_Mutation	SNP	ENST00000569979.1	37		.	.	.	.	.	.	.	.	.	.	C	17.29	3.350909	0.61183	.	.	ENSG00000005194	ENST00000394391	T	0.36157	1.27	4.73	2.74	0.32292	.	0.041556	0.85682	N	0.000000	T	0.33876	0.0878	M	0.62088	1.915	0.36245	D	0.85354	B;B	0.20550	0.046;0.008	B;B	0.19946	0.027;0.019	T	0.31861	-0.9928	10	0.45353	T	0.12	-8.5092	9.8209	0.40883	0.0:0.8415:0.0:0.1585	.	274;287	Q6FI81-3;Q6FI81	.;CPIN1_HUMAN	N	287	ENSP00000377914:S287N	ENSP00000377914:S287N	S	-	2	0	CIAPIN1	56020662	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.245000	0.65405	0.516000	0.28340	0.561000	0.74099	AGC			0.552	CIAPIN1-010	NOVEL	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000432580.1		NM_020313	
OR1A1	8383	hgsc.bcm.edu;bcgsc.ca	37	17	3118967	3118967	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr17:3118967C>G	ENST00000304094.1	+	1	53	c.53C>G	c.(52-54)aCt>aGt	p.T18S		NM_014565.2	NP_055380.2	Q9P1Q5	OR1A1_HUMAN	olfactory receptor, family 1, subfamily A, member 1	18						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	23						CTGGGAGTTACTGGTCAGCAG	0.423																																					p.T18S													.	.			0			c.C53G												131.0	110.0	117.0					17																	3118967		2203	4300	6503	SO:0001583	missense	8383	exon1			GAGTTACTGGTCA	AF087918	CCDS11022.1	17p13.3	2012-08-09			ENSG00000172146	ENSG00000172146		"""GPCR / Class A : Olfactory receptors"""	8179	protein-coding gene	gene with protein product						10673334	Standard	NM_014565		Approved	OR17-7	uc010vrc.2	Q9P1Q5	OTTHUMG00000090637	ENST00000304094.1:c.53C>G	17.37:g.3118967C>G	ENSP00000305207:p.Thr18Ser		Somatic	94	0	0		WXS	Illumina HiSeq	.	79	0.05	4	NM_014565	0		0	A5D914|Q6IFM1|Q6NTA9|Q96R87	Missense_Mutation	SNP	ENST00000304094.1	37	CCDS11022.1	.	.	.	.	.	.	.	.	.	.	C	0.015	-1.545863	0.00926	.	.	ENSG00000172146	ENST00000304094	T	0.01068	5.38	4.76	0.117	0.14652	.	0.420272	0.20509	N	0.090922	T	0.00496	0.0016	N	0.01817	-0.705	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.47522	-0.9111	10	0.02654	T	1	.	10.1635	0.42866	0.1374:0.3696:0.493:0.0	.	18	Q9P1Q5	OR1A1_HUMAN	S	18	ENSP00000305207:T18S	ENSP00000305207:T18S	T	+	2	0	OR1A1	3065717	0.000000	0.05858	0.033000	0.17914	0.941000	0.58515	0.742000	0.26216	-0.072000	0.12864	-0.694000	0.03704	ACT			0.423	OR1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207292.1		NM_014565	
ALOX15	246	mdanderson.org	37	17	4535309	4535309	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr17:4535309G>A	ENST00000570836.1	-	14	1780	c.1684C>T	c.(1684-1686)Cgg>Tgg	p.R562W	ALOX15_ENST00000574640.1_Missense_Mutation_p.R523W|ALOX15_ENST00000545513.1_Missense_Mutation_p.R584W|ALOX15_ENST00000293761.3_Missense_Mutation_p.R562W			P16050	LOX15_HUMAN	arachidonate 15-lipoxygenase	562	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				apoptotic cell clearance (GO:0043277)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|cellular response to calcium ion (GO:0071277)|cellular response to interleukin-13 (GO:0035963)|hepoxilin biosynthetic process (GO:0051122)|inflammatory response (GO:0006954)|leukotriene metabolic process (GO:0006691)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxygenase pathway (GO:0019372)|negative regulation of adaptive immune response (GO:0002820)|ossification (GO:0001503)|phosphatidylethanolamine biosynthetic process (GO:0006646)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of engulfment of apoptotic cell (GO:1901074)|regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035358)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|lipid particle (GO:0005811)|membrane (GO:0016020)|plasma membrane (GO:0005886)	arachidonate 12-lipoxygenase activity (GO:0004052)|arachidonate 15-lipoxygenase activity (GO:0050473)|eoxin A4 synthase activity (GO:0097260)|iron ion binding (GO:0005506)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(5)	20				READ - Rectum adenocarcinoma(115;0.0327)		GGGGGCAGCCGCATCGTGCAG	0.607																																					p.R562W													.	.			0			c.C1684T												60.0	55.0	57.0					17																	4535309		2203	4300	6503	SO:0001583	missense	246	exon13			GCAGCCGCATCGT	M23892	CCDS11049.1	17p13.3	2010-09-24			ENSG00000161905	ENSG00000161905	1.13.11.33	"""Arachidonate lipoxygenases"""	433	protein-coding gene	gene with protein product		152392				1570320	Standard	NM_001140		Approved	15-LOX-1	uc002fyh.3	P16050	OTTHUMG00000090746	ENST00000570836.1:c.1684C>T	17.37:g.4535309G>A	ENSP00000458832:p.Arg562Trp		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_001140	1	0.00	0	A8K2P4|B7ZA11|Q8N6R7|Q99657	Missense_Mutation	SNP	ENST00000570836.1	37	CCDS11049.1	.	.	.	.	.	.	.	.	.	.	G	16.64	3.179751	0.57800	.	.	ENSG00000161905	ENST00000293761;ENST00000545513	D;D	0.83075	-1.68;-1.68	4.33	3.32	0.38043	Lipoxygenase, C-terminal (3);	0.000000	0.64402	D	0.000001	D	0.90174	0.6929	M	0.93898	3.47	0.37184	D	0.903643	D;P;D	0.65815	0.993;0.939;0.995	P;P;P	0.55999	0.684;0.563;0.789	D	0.92028	0.5631	10	0.72032	D	0.01	-7.3666	9.1329	0.36857	0.0:0.0:0.782:0.218	.	584;523;562	F5H0G8;B7ZA11;P16050	.;.;LOX15_HUMAN	W	562;584	ENSP00000293761:R562W;ENSP00000439855:R584W	ENSP00000293761:R562W	R	-	1	2	ALOX15	4482058	0.979000	0.34478	1.000000	0.80357	0.991000	0.79684	0.191000	0.17076	0.992000	0.38840	0.655000	0.94253	CGG			0.607	ALOX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207487.2			
KCTD11	147040	mdanderson.org	37	17	7256675	7256675	+	Silent	SNP	G	G	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr17:7256675G>T	ENST00000333751.3	+	1	1468	c.414G>T	c.(412-414)cgG>cgT	p.R138R	RP11-542C16.1_ENST00000572417.1_RNA|TMEM95_ENST00000576060.1_5'Flank|TMEM95_ENST00000389982.4_5'Flank|TMEM95_ENST00000330767.4_5'Flank	NM_001002914.2	NP_001002914.1	Q693B1	KCD11_HUMAN	potassium channel tetramerization domain containing 11	138					cell cycle (GO:0007049)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)				kidney(1)|large_intestine(2)|lung(1)	4		Prostate(122;0.157)				GTGCTTTGCGGGCCCGATTTG	0.627																																					p.R138R													KCTD11,NS,carcinoma,0,1	KCTD11	0	1	0			c.G414T												94.0	82.0	86.0					17																	7256675		2203	4300	6503	SO:0001819	synonymous_variant	147040	exon1			TTTGCGGGCCCGA	AK056227	CCDS32545.1	17p13.2	2013-06-20	2013-06-20	2003-11-26	ENSG00000213859	ENSG00000213859			21302	protein-coding gene	gene with protein product		609848	"""chromosome 17 open reading frame 36"", ""potassium channel tetramerisation domain containing 11"""	C17orf36		12186855, 21472142	Standard	NM_001002914		Approved	REN, KCASH1	uc002gge.4	Q693B1	OTTHUMG00000132061	ENST00000333751.3:c.414G>T	17.37:g.7256675G>T			Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_001002914	10	0.00	0	B3KPE0	Silent	SNP	ENST00000333751.3	37	CCDS32545.1																																																																																					0.627	KCTD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255084.2		NM_001002914	
PIK3R5	23533	mdanderson.org	37	17	8808104	8808104	+	Silent	SNP	G	G	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr17:8808104G>T	ENST00000447110.1	-	5	526	c.402C>A	c.(400-402)ctC>ctA	p.L134L	PIK3R5_ENST00000584803.1_Silent_p.L134L|PIK3R5_ENST00000581552.1_Silent_p.L134L	NM_001142633.2|NM_001251851.1|NM_001251852.1|NM_001251853.1|NM_001251855.1	NP_001136105.1|NP_001238780.1|NP_001238781.1|NP_001238782.1|NP_001238784.1	Q8WYR1	PI3R5_HUMAN	phosphoinositide-3-kinase, regulatory subunit 5	134					blood coagulation (GO:0007596)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|G-protein beta/gamma-subunit complex binding (GO:0031683)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(14)|prostate(3)|skin(4)|urinary_tract(1)	34						CTGGGGCCTTGAGTTCAGCAT	0.557																																					p.L134L	NSCLC(18;589 615 7696 20311 50332)												.	.			0			c.C402A												83.0	78.0	79.0					17																	8808104		2203	4300	6503	SO:0001819	synonymous_variant	23533	exon5			GGCCTTGAGTTCA	AF128881	CCDS11147.1, CCDS73986.1	17p13.1	2011-10-13	2008-02-04		ENSG00000141506	ENSG00000141506			30035	protein-coding gene	gene with protein product		611317				12507995	Standard	NM_014308		Approved	P101-PI3K, p101	uc002glt.3	Q8WYR1	OTTHUMG00000108197	ENST00000447110.1:c.402C>A	17.37:g.8808104G>T			Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_001142633	12	0.00	0	B0LPH4|D3DTS3|Q5G936|Q5G938|Q5G939|Q8IZ23|Q9Y2Y2	Silent	SNP	ENST00000447110.1	37	CCDS11147.1																																																																																					0.557	PIK3R5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000227003.2		NM_014308	
MYO18A	399687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	27401817	27401817	+	Missense_Mutation	SNP	C	C	T	rs144652932	byFrequency	TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr17:27401817C>T	ENST00000527372.1	-	42	6316	c.6136G>A	c.(6136-6138)Gag>Aag	p.E2046K	TIAF1_ENST00000359450.6_5'UTR|MYO18A_ENST00000531253.1_Missense_Mutation_p.E2031K|TIAF1_ENST00000408971.2_5'UTR|MYO18A_ENST00000533112.1_Missense_Mutation_p.E1994K|MYO18A_ENST00000529578.1_5'UTR|MYO18A_ENST00000354329.4_Missense_Mutation_p.E2046K	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	2046					actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			AGCTTGGCCTCTGTGTCGCTG	0.612																																					p.E2046K	Esophageal Squamous(182;472 2015 7001 15270 22562)												.	.			0			c.G6136A												138.0	141.0	140.0					17																	27401817		2139	4254	6393	SO:0001583	missense	399687	exon42			TGGCCTCTGTGTC	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.6136G>A	17.37:g.27401817C>T	ENSP00000437073:p.Glu2046Lys		Somatic	144	0	0		WXS	Illumina HiSeq	.	166	0.19	32	NM_078471	115	0.17	19	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Missense_Mutation	SNP	ENST00000527372.1	37	CCDS45642.1	.	.	.	.	.	.	.	.	.	.	C	19.79	3.893850	0.72639	.	.	ENSG00000196535	ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372;ENST00000529799;ENST00000540575;ENST00000458428;ENST00000546105	D;D;D;D	0.91068	-2.57;-2.78;-2.58;-2.57	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.91257	0.7244	N	0.24115	0.695	0.80722	D	1	P;D;D;P	0.56035	0.496;0.974;0.974;0.454	B;D;D;B	0.67725	0.196;0.953;0.953;0.078	D	0.91509	0.5225	10	0.46703	T	0.11	.	15.9564	0.79891	0.0:1.0:0.0:0.0	.	1634;1994;2031;2046	F8W6Y3;Q92614-3;Q92614-4;Q92614	.;.;.;MY18A_HUMAN	K	2046;1994;1994;2031;2046;927;927;1634;312	ENSP00000346291:E2046K;ENSP00000435932:E1994K;ENSP00000434228:E2031K;ENSP00000437073:E2046K	ENSP00000346291:E2046K	E	-	1	0	MYO18A	24425943	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	3.270000	0.51600	2.554000	0.86153	0.655000	0.94253	GAG			0.612	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000389396.1		NM_078471	
GIT1	28964	mdanderson.org	37	17	27903296	27903296	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr17:27903296G>T	ENST00000225394.3	-	14	1801	c.1553C>A	c.(1552-1554)cCc>cAc	p.P518H	GIT1_ENST00000394869.3_Missense_Mutation_p.P527H|RP11-68I3.2_ENST00000581474.1_RNA|GIT1_ENST00000579937.1_Missense_Mutation_p.P518H|GIT1_ENST00000581348.1_Missense_Mutation_p.P527H	NM_014030.3	NP_054749.2	Q9Y2X7	GIT1_HUMAN	G protein-coupled receptor kinase interacting ArfGAP 1	518					regulation of ARF GTPase activity (GO:0032312)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			large_intestine(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				READ - Rectum adenocarcinoma(3;0.0419)|Colorectal(3;0.069)		GCCCCCAAAGGGCTTCAGGGC	0.637																																					p.P527H	Colon(81;41 1719 20078 35068)												.	.			0			c.C1580A												63.0	72.0	69.0					17																	27903296		2203	4300	6503	SO:0001583	missense	28964	exon15			CCAAAGGGCTTCA	AF124490	CCDS11250.1, CCDS42290.1	17p11.2	2013-01-10	2008-09-05		ENSG00000108262	ENSG00000108262		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	4272	protein-coding gene	gene with protein product		608434	"""G protein-coupled receptor kinase interactor 1"""			9826657, 10896954	Standard	NM_014030		Approved		uc002heg.2	Q9Y2X7	OTTHUMG00000132730	ENST00000225394.3:c.1553C>A	17.37:g.27903296G>T	ENSP00000225394:p.Pro518His		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_001085454	144	0.00	0	B4DGU9|B4DSV3|Q86SS0|Q9BRJ4	Missense_Mutation	SNP	ENST00000225394.3	37	CCDS11250.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.016843	0.75161	.	.	ENSG00000108262	ENST00000225394;ENST00000394869	T;T	0.74526	-0.79;-0.85	4.67	4.67	0.58626	.	0.179902	0.48767	D	0.000165	D	0.82939	0.5146	L	0.55990	1.75	0.49213	D	0.999768	D;D;D;D	0.69078	0.994;0.997;0.994;0.994	P;D;P;P	0.65987	0.873;0.94;0.873;0.873	D	0.84739	0.0750	10	0.72032	D	0.01	.	18.1368	0.89622	0.0:0.0:1.0:0.0	.	531;527;527;518	Q59FC3;Q9Y2X7-3;B4DGU9;Q9Y2X7	.;.;.;GIT1_HUMAN	H	518;527	ENSP00000225394:P518H;ENSP00000378338:P527H	ENSP00000225394:P518H	P	-	2	0	GIT1	24927422	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	4.971000	0.63749	2.588000	0.87417	0.448000	0.29417	CCC			0.637	GIT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000256073.1		NM_014030	
CCL18	6362	broad.mit.edu	37	17	34398343	34398343	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr17:34398343C>T	ENST00000004921.3	+	3	275	c.212C>T	c.(211-213)gCt>gTt	p.A71V	AC069363.1_ENST00000588864.1_RNA|AC069363.1_ENST00000590992.1_RNA	NM_002988.2	NP_002979.1	P55774	CCL18_HUMAN	chemokine (C-C motif) ligand 18 (pulmonary and activation-regulated)	71					cell chemotaxis (GO:0060326)|cell communication (GO:0007154)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|immune response (GO:0006955)|inflammatory response (GO:0006954)|response to biotic stimulus (GO:0009607)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	chemokine activity (GO:0008009)			endometrium(1)|large_intestine(2)|lung(1)	4		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		CAGATCTGTGCTGACCCCAAT	0.572																																					p.A71V													.	CCL18	9		0			c.C212T												81.0	80.0	81.0					17																	34398343		2203	4300	6503	SO:0001583	missense	6362	exon3			TCTGTGCTGACCC	Y13710	CCDS11306.1	17q11.2	2014-05-06	2002-08-22	2002-08-23	ENSG00000006074	ENSG00000275385		"""Chemokine ligands"""	10616	protein-coding gene	gene with protein product		603757	"""small inducible cytokine subfamily A (Cys-Cys), member 18, pulmonary and activation-regulated"""	SCYA18		9233607, 10049593	Standard	NM_002988		Approved	DC-CK1, PARC, AMAC-1, DCCK1, MIP-4, CKb7	uc002hku.3	P55774	OTTHUMG00000188410	ENST00000004921.3:c.212C>T	17.37:g.34398343C>T	ENSP00000004921:p.Ala71Val		Somatic	285	0	0		WXS	Illumina HiSeq	Phase_I	375	0.02	6	NM_002988	8	0.00	0	B5BUM2|Q53X71	Missense_Mutation	SNP	ENST00000004921.3	37	CCDS11306.1	.	.	.	.	.	.	.	.	.	.	.	15.99	2.995109	0.54041	.	.	ENSG00000006074	ENST00000004921	T	0.05580	3.42	4.44	4.44	0.53790	CC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	0.228496	0.35291	N	0.003317	T	0.22126	0.0533	.	.	.	0.37919	D	0.931617	D	0.76494	0.999	D	0.77557	0.99	T	0.01305	-1.1390	9	0.56958	D	0.05	.	12.7487	0.57296	0.0:1.0:0.0:0.0	.	71	P55774	CCL18_HUMAN	V	71	ENSP00000004921:A71V	ENSP00000004921:A71V	A	+	2	0	CCL18	31422456	0.931000	0.31567	0.636000	0.29352	0.067000	0.16453	1.755000	0.38379	2.440000	0.82611	0.591000	0.81541	GCT			0.572	CCL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256583.1		NM_002988	
KRTAP4-7	100132476	hgsc.bcm.edu	37	17	39240805	39240805	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr17:39240805G>T	ENST00000391417.4	+	1	347	c.347G>T	c.(346-348)cGc>cTc	p.R116L		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	141	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].		Missing. {ECO:0000269|PubMed:15955084}.		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						agctgctgccgcccctgctgc	0.672																																					p.R116L													KRTAP4-7,caecum,carcinoma,+1,1	KRTAP4-7	1	1	0			c.G347T												18.0	18.0	18.0					17																	39240805		692	1587	2279	SO:0001583	missense	100132476	exon1			GCTGCCGCCCCTG	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.347G>T	17.37:g.39240805G>T	ENSP00000375236:p.Arg116Leu		Somatic	37	0	0		WXS	Illumina HiSeq	.	50	0.14	7	NM_033061	0		0	A0AVM6|A8MQ08|A8MTL4	Missense_Mutation	SNP	ENST00000391417.4	37	CCDS45673.1	.	.	.	.	.	.	.	.	.	.	.	6.805	0.517638	0.13005	.	.	ENSG00000240871	ENST00000391417	T	0.00606	6.26	3.15	2.13	0.27403	.	0.163808	0.19966	U	0.102091	T	0.00496	0.0016	.	.	.	0.09310	N	1	B	0.18461	0.028	B	0.15052	0.012	T	0.45804	-0.9236	9	0.28530	T	0.3	.	9.2621	0.37619	0.0:0.0:0.7821:0.2179	.	171	Q9BYR0	KRA47_HUMAN	L	116	ENSP00000375236:R116L	ENSP00000375236:R116L	R	+	2	0	KRTAP4-7	36494331	0.000000	0.05858	0.028000	0.17463	0.502000	0.33828	-0.081000	0.11321	0.603000	0.29913	0.289000	0.19496	CGC			0.672	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257686.1			
LRRC37A4P	55073	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	43625492	43625492	+	RNA	SNP	G	G	A			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr17:43625492G>A	ENST00000586411.1	-	0	1652				RP11-798G7.6_ENST00000586348.1_lincRNA																							GGTTGGAGATGGTTTAACCTC	0.517																																					.													.	.			0			.																																											0	.			GGAGATGGTTTAA																													17.37:g.43625492G>A			Somatic	370	0.0054054054	2		WXS	Illumina HiSeq	Phase_I	538	0.14	75	.	2	0.00	0		RNA	SNP	ENST00000586411.1	37																																																																																						0.517	RP11-798G7.7-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript		OTTHUMT00000452150.1			
AMZ2P1	201283	broad.mit.edu	37	17	62968690	62968690	+	RNA	SNP	A	A	G			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr17:62968690A>G	ENST00000430983.1	-	0	1554					NR_026903.1				archaelysin family metallopeptidase 2 pseudogene 1																		AAAATTCCACAAGTCTCTTGG	0.373																																					.													.	.			0			.																																											0	.			TTCCACAAGTCTC	AK056627		17q24.1	2012-10-16	2010-04-08		ENSG00000214174	ENSG00000214174			26491	pseudogene	pseudogene							Standard	NR_026903		Approved	FLJ32065	uc002jfb.3		OTTHUMG00000132075		17.37:g.62968690A>G			Somatic	71	0.014084507	1		WXS	Illumina HiSeq	Phase_I	114	0.04	4	.	67	0.00	0		RNA	SNP	ENST00000430983.1	37																																																																																						0.373	AMZ2P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000255102.1		NM_153032	
RANBP3	8498	mdanderson.org	37	19	5914617	5914617	+	IGR	SNP	G	G	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr19:5914617G>T	ENST00000340578.6	-	0	3233				CAPS_ENST00000452990.2_Missense_Mutation_p.A43S|AC104532.4_ENST00000591109.1_RNA|AC104532.2_ENST00000588891.1_3'UTR|CAPS_ENST00000222125.5_Missense_Mutation_p.A43S|CAPS_ENST00000588776.1_Missense_Mutation_p.A129S	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3						intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						ATCCCTGGACGCTGATGAGTT	0.652																																					p.A43S													.	.			0			c.G127T												70.0	71.0	71.0					19																	5914617		2203	4300	6503	SO:0001628	intergenic_variant	828	exon3			CTGGACGCTGATG	Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4			19.37:g.5914617G>T			Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_080590	14	0.00	0	B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Missense_Mutation	SNP	ENST00000340578.6	37	CCDS42478.1	.	.	.	.	.	.	.	.	.	.	G	2.216	-0.379608	0.05000	.	.	ENSG00000105519	ENST00000394521;ENST00000222125;ENST00000452990	T;T	0.71222	-0.55;-0.55	5.3	3.09	0.35607	EF-hand-like domain (1);	0.597668	0.16492	N	0.212061	T	0.54886	0.1886	L	0.29908	0.895	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.12837	0.008;0.001	T	0.38607	-0.9653	10	0.25106	T	0.35	-11.0734	8.3054	0.32038	0.0:0.1534:0.5297:0.3168	.	176;43	Q8NF12;Q13938	.;CAYP1_HUMAN	S	176;43;43	ENSP00000222125:A43S;ENSP00000403263:A43S	ENSP00000222125:A43S	A	+	1	0	CAPS	5865617	0.000000	0.05858	0.002000	0.10522	0.005000	0.04900	0.256000	0.18351	0.583000	0.29574	0.555000	0.69702	GCT			0.652	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000452304.1		NM_007322	
ICAM3	3385	ucsc.edu	37	19	10444835	10444835	+	Splice_Site	SNP	C	C	A			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr19:10444835C>A	ENST00000160262.5	-	6	1650		c.e6+1		ICAM3_ENST00000589261.1_Splice_Site|RAVER1_ENST00000293677.6_5'Flank	NM_002162.3	NP_002153.2	P32942	ICAM3_HUMAN	intercellular adhesion molecule 3						extracellular matrix organization (GO:0030198)|regulation of immune response (GO:0050776)|single organismal cell-cell adhesion (GO:0016337)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	13			OV - Ovarian serous cystadenocarcinoma(20;6.13e-09)|Epithelial(33;9.69e-06)|all cancers(31;2.05e-05)			TGTTAGCTCACCCTCAATGTC	0.567																																					.													.	ICAM3	29		0			c.1441+1G>T												69.0	64.0	66.0					19																	10444835		2203	4300	6503	SO:0001630	splice_region_variant	3385	exon7			AGCTCACCCTCAA		CCDS12235.1	19p13.3-p13.2	2013-01-11				ENSG00000076662		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5346	protein-coding gene	gene with protein product		146631				1448174	Standard	NM_002162		Approved	CDW50, ICAM-R, CD50	uc002mob.2	P32942		ENST00000160262.5:c.1441+1G>T	19.37:g.10444835C>A			Somatic	40	0	0		WXS	Illumina HiSeq		37	0.11	4	NM_002162	9	0.00	0	Q6PD68	Splice_Site	SNP	ENST00000160262.5	37	CCDS12235.1	.	.	.	.	.	.	.	.	.	.	C	13.29	2.193240	0.38707	.	.	ENSG00000076662	ENST00000160262	.	.	.	4.48	4.48	0.54585	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.833	0.57756	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ICAM3	10305835	0.739000	0.28196	0.134000	0.22075	0.011000	0.07611	1.903000	0.39858	2.481000	0.83766	0.561000	0.74099	.			0.567	ICAM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000451234.1			Intron
TYK2	7297	mdanderson.org	37	19	10468498	10468498	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr19:10468498G>T	ENST00000525621.1	-	17	2889	c.2408C>A	c.(2407-2409)aCc>aAc	p.T803N	TYK2_ENST00000524462.1_Missense_Mutation_p.T618N|TYK2_ENST00000529370.1_Missense_Mutation_p.T803N|TYK2_ENST00000264818.6_Missense_Mutation_p.T803N	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	803	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			CTCCAGGAGGGTGGCGCCAAA	0.672																																					p.T803N													.	.			0			c.C2408A												34.0	33.0	34.0					19																	10468498		2203	4300	6503	SO:0001583	missense	7297	exon17			AGGAGGGTGGCGC		CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.2408C>A	19.37:g.10468498G>T	ENSP00000431885:p.Thr803Asn		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_003331	22	0.00	0	Q6QB10|Q96CH0	Missense_Mutation	SNP	ENST00000525621.1	37	CCDS12236.1	.	.	.	.	.	.	.	.	.	.	G	19.00	3.742134	0.69418	.	.	ENSG00000105397	ENST00000524462;ENST00000525621;ENST00000264818;ENST00000543792;ENST00000529370	T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1	4.86	2.65	0.31530	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.111786	0.37053	N	0.002279	D	0.84097	0.5397	H	0.96239	3.79	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.995	D	0.87620	0.2509	10	0.87932	D	0	-24.8182	12.8436	0.57817	0.0:0.3149:0.6851:0.0	.	803;803	E9PPF2;P29597	.;TYK2_HUMAN	N	618;803;803;550;803	ENSP00000433203:T618N;ENSP00000431885:T803N;ENSP00000264818:T803N;ENSP00000432728:T803N	ENSP00000264818:T803N	T	-	2	0	TYK2	10329498	1.000000	0.71417	0.977000	0.42913	0.753000	0.42808	7.306000	0.78905	0.608000	0.30000	-0.175000	0.13238	ACC			0.672	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000389443.1			
ZBTB32	27033	mdanderson.org	37	19	36206029	36206029	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr19:36206029G>T	ENST00000392197.2	+	3	819	c.501G>T	c.(499-501)aaG>aaT	p.K167N	KMT2B_ENST00000222270.7_5'Flank|KMT2B_ENST00000420124.1_5'Flank|KMT2B_ENST00000341701.1_5'Flank|ZBTB32_ENST00000262630.3_Missense_Mutation_p.K167N|KMT2B_ENST00000607650.1_RNA			Q9Y2Y4	ZBT32_HUMAN	zinc finger and BTB domain containing 32	167					DNA repair (GO:0006281)|hemopoiesis (GO:0030097)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cytokine production (GO:0001817)|T cell proliferation (GO:0042098)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(1)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	14	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TGTTGCACAAGCACTCGCCAC	0.562																																					p.K167N													.	.			0			c.G501T												46.0	46.0	46.0					19																	36206029		2203	4300	6503	SO:0001583	missense	27033	exon2			GCACAAGCACTCG	AF130255	CCDS12471.1	19q13.1	2013-01-08			ENSG00000011590	ENSG00000011590		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16763	protein-coding gene	gene with protein product	"""repressor of GATA"""	605859				10572087	Standard	XM_005258739		Approved	TZFP, FAZF, FAXF, Rog, ZNF538	uc002oay.3	Q9Y2Y4	OTTHUMG00000048118	ENST00000392197.2:c.501G>T	19.37:g.36206029G>T	ENSP00000376035:p.Lys167Asn		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_014383	5	0.00	0	Q8WVP2	Missense_Mutation	SNP	ENST00000392197.2	37	CCDS12471.1	.	.	.	.	.	.	.	.	.	.	G	8.824	0.938245	0.18206	.	.	ENSG00000011590	ENST00000262630;ENST00000392197	T;T	0.09538	2.97;2.97	5.2	3.01	0.34805	.	0.796770	0.10958	N	0.615232	T	0.06234	0.0161	N	0.19112	0.55	0.09310	N	1	B	0.29432	0.244	B	0.22152	0.038	T	0.38478	-0.9659	10	0.22109	T	0.4	-3.5582	6.8041	0.23768	0.0921:0.0:0.7351:0.1728	.	167	Q9Y2Y4	ZBT32_HUMAN	N	167	ENSP00000262630:K167N;ENSP00000376035:K167N	ENSP00000262630:K167N	K	+	3	2	ZBTB32	40897869	0.003000	0.15002	0.107000	0.21349	0.136000	0.21042	0.869000	0.27996	1.167000	0.42706	0.655000	0.94253	AAG			0.562	ZBTB32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000109491.3		NM_014383	
CAPNS1	826	mdanderson.org	37	19	36632054	36632054	+	Silent	SNP	C	C	T	rs17879825		TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr19:36632054C>T	ENST00000246533.3	+	2	739	c.141C>T	c.(139-141)ggC>ggT	p.G47G	AD001527.7_ENST00000604228.1_RNA|CAPNS1_ENST00000588815.1_Silent_p.G47G|CAPNS1_ENST00000589146.1_Intron|CAPNS1_ENST00000588780.1_Silent_p.G47G|CAPNS1_ENST00000587718.1_Silent_p.G47G|CAPNS1_ENST00000590874.1_Silent_p.G47G	NM_001003962.1|NM_001749.2	NP_001003962.1|NP_001740.1	P04632	CPNS1_HUMAN	calpain, small subunit 1	47	Gly-rich (hydrophobic).|Poly-Gly.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			cervix(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			gcggcggcggcggtggtggag	0.761																																					p.G47G	Esophageal Squamous(129;1541 1691 5780 18353 34150)												.	.			0			c.C141T																																									SO:0001819	synonymous_variant	826	exon2			CGGCGGCGGTGGT	X04106	CCDS12489.1	19q13.1	2013-01-10		2001-08-10	ENSG00000126247	ENSG00000126247	3.4.22.52	"""EF-hand domain containing"""	1481	protein-coding gene	gene with protein product		114170		CAPN4		3024120, 3016651	Standard	NM_001003962		Approved	CANP, CANPS, 30K, CDPS	uc002odj.3	P04632		ENST00000246533.3:c.141C>T	19.37:g.36632054C>T			Somatic	95	0.0210526316	2		WXS	Illumina HiSeq	Phase_I	113	0.05	6	NM_001749	2	0.00	0	A8K0P1|Q8WTX3|Q96EW0	Silent	SNP	ENST00000246533.3	37	CCDS12489.1																																																																																			0.006		0.761	CAPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000457411.2			
TRMT61B	55006	mdanderson.org	37	2	29093089	29093089	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr2:29093089C>G	ENST00000306108.5	-	1	78	c.55G>C	c.(55-57)Gga>Cga	p.G19R		NM_017910.3	NP_060380.3	Q9BVS5	TR61B_HUMAN	tRNA methyltransferase 61 homolog B (S. cerevisiae)	19					mitochondrial tRNA methylation (GO:0070901)|protein homooligomerization (GO:0051260)	mitochondrion (GO:0005739)|tRNA (m1A) methyltransferase complex (GO:0031515)	tRNA (adenine-N1-)-methyltransferase activity (GO:0016429)			endometrium(2)|kidney(1)|large_intestine(2)|lung(8)	13						GAATTGGTTCCGAGCCCCTGC	0.622																																					p.G19R													.	.			0			c.G55C												23.0	28.0	26.0					2																	29093089		2200	4297	6497	SO:0001583	missense	55006	exon1			TGGTTCCGAGCCC	BC010365	CCDS1768.1	2p23.2	2009-01-09			ENSG00000171103	ENSG00000171103			26070	protein-coding gene	gene with protein product						11230166	Standard	NM_017910		Approved	FLJ20628	uc002rmm.3	Q9BVS5	OTTHUMG00000128433	ENST00000306108.5:c.55G>C	2.37:g.29093089C>G	ENSP00000302801:p.Gly19Arg		Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	24	0.13	3	NM_017910	66	0.00	0	Q9H0Q9|Q9NWS7	Missense_Mutation	SNP	ENST00000306108.5	37	CCDS1768.1	.	.	.	.	.	.	.	.	.	.	C	12.59	1.984954	0.35036	.	.	ENSG00000171103	ENST00000306108	T	0.53857	0.6	5.44	0.481	0.16809	.	0.794537	0.10783	N	0.634623	T	0.32823	0.0842	N	0.19112	0.55	0.09310	N	1	B;B	0.17667	0.023;0.013	B;B	0.17979	0.02;0.009	T	0.23476	-1.0187	10	0.18710	T	0.47	.	7.8569	0.29487	0.0:0.5692:0.0:0.4308	.	19;19	F8WDR2;Q9BVS5	.;TR61B_HUMAN	R	19	ENSP00000302801:G19R	ENSP00000302801:G19R	G	-	1	0	TRMT61B	28946593	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.037000	0.12164	0.083000	0.17047	0.561000	0.74099	GGA			0.622	TRMT61B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250224.1		NM_017910	
DYSF	8291	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	71783195	71783195	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr2:71783195G>T	ENST00000258104.3	+	22	2433	c.2156G>T	c.(2155-2157)gGc>gTc	p.G719V	DYSF_ENST00000409366.1_Missense_Mutation_p.G720V|DYSF_ENST00000409582.3_Missense_Mutation_p.G736V|DYSF_ENST00000394120.2_Missense_Mutation_p.G720V|DYSF_ENST00000409762.1_Missense_Mutation_p.G736V|DYSF_ENST00000409651.1_Missense_Mutation_p.G751V|DYSF_ENST00000429174.2_Missense_Mutation_p.G719V|DYSF_ENST00000410041.1_Missense_Mutation_p.G737V|DYSF_ENST00000410020.3_Missense_Mutation_p.G737V|DYSF_ENST00000413539.2_Missense_Mutation_p.G750V|DYSF_ENST00000409744.1_Missense_Mutation_p.G706V	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	719					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						CTCATCGCAGGCTGCAGGTAG	0.667																																					p.G751V													.	.			0			c.G2252T												21.0	18.0	19.0					2																	71783195		2189	4283	6472	SO:0001583	missense	8291	exon23			TCGCAGGCTGCAG	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.2156G>T	2.37:g.71783195G>T	ENSP00000258104:p.Gly719Val		Somatic	78	0	0		WXS	Illumina HiSeq	.	90	0.31	28	NM_001130982	46	0.17	8	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	ENST00000258104.3	37	CCDS1918.1	.	.	.	.	.	.	.	.	.	.	G	13.44	2.237550	0.39598	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	T;T;T;T;T;T;T;T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11	4.08	1.42	0.22433	Ferlin A-domain (1);	0.115096	0.56097	D	0.000025	T	0.63943	0.2554	N	0.22421	0.69	0.51233	D	0.99991	B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.22800	0.036;0.036;0.036;0.036;0.007;0.007;0.007;0.004;0.036;0.036;0.075;0.02;0.036;0.045	B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.32393	0.032;0.06;0.06;0.06;0.02;0.06;0.038;0.038;0.06;0.088;0.145;0.06;0.06;0.099	T	0.55535	-0.8126	10	0.62326	D	0.03	-6.6413	6.9035	0.24295	0.7903:0.0:0.2097:0.0	.	751;737;720;706;737;706;736;705;750;736;719;705;720;719	O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	V	750;736;736;719;719;751;720;706;720;737;737	ENSP00000407046:G750V;ENSP00000387137:G736V;ENSP00000386547:G736V;ENSP00000398305:G719V;ENSP00000258104:G719V;ENSP00000386683:G751V;ENSP00000377678:G720V;ENSP00000386285:G706V;ENSP00000386512:G720V;ENSP00000386881:G737V;ENSP00000386617:G737V	ENSP00000258104:G719V	G	+	2	0	DYSF	71636703	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	5.099000	0.64554	0.119000	0.18210	-0.459000	0.05422	GGC			0.667	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000251970.3		NM_003494	
TEKT4	150483	mdanderson.org	37	2	95540628	95540628	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr2:95540628T>C	ENST00000295201.4	+	4	958	c.821T>C	c.(820-822)cTt>cCt	p.L274P	AC097374.2_ENST00000568768.1_RNA	NM_144705.2	NP_653306.1	Q8WW24	TEKT4_HUMAN	tektin 4	274					cell projection organization (GO:0030030)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	28						GACTGCATCCTTCGCGACACC	0.692																																					p.L274P													.	.			0			c.T821C												26.0	32.0	30.0					2																	95540628		2198	4296	6494	SO:0001583	missense	150483	exon4			GCATCCTTCGCGA	AK097438	CCDS2005.1	2q11.2	2008-02-05			ENSG00000163060	ENSG00000163060			31012	protein-coding gene	gene with protein product							Standard	XM_005263876		Approved	MGC27019	uc002stw.1	Q8WW24	OTTHUMG00000130396	ENST00000295201.4:c.821T>C	2.37:g.95540628T>C	ENSP00000295201:p.Leu274Pro		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	24	0.13	3	NM_144705	0		0		Missense_Mutation	SNP	ENST00000295201.4	37	CCDS2005.1	.	.	.	.	.	.	.	.	.	.	.	15.38	2.815625	0.50527	.	.	ENSG00000163060	ENST00000295201	T	0.04156	3.69	2.18	2.18	0.27775	.	0.000000	0.64402	D	0.000001	T	0.24699	0.0599	M	0.93150	3.385	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.02958	-1.1089	10	0.87932	D	0	-12.971	7.9469	0.29991	0.0:0.0:0.0:1.0	.	274	Q8WW24	TEKT4_HUMAN	P	274	ENSP00000295201:L274P	ENSP00000295201:L274P	L	+	2	0	TEKT4	94904355	0.708000	0.27876	0.648000	0.29521	0.401000	0.30781	3.418000	0.52721	1.021000	0.39600	0.382000	0.24955	CTT			0.692	TEKT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252777.1		NM_144705	
FBLN7	129804	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	112896249	112896250	+	Frame_Shift_Del	DEL	CG	CG	-	rs201573384		TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	CG	CG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr2:112896249_112896250delCG	ENST00000331203.2	+	1	288_289	c.17_18delCG	c.(16-18)ccgfs	p.P6fs	FBLN7_ENST00000409903.1_Frame_Shift_Del_p.P6fs|FBLN7_ENST00000409450.3_Frame_Shift_Del_p.P6fs|FBLN7_ENST00000409667.3_Frame_Shift_Del_p.P6fs	NM_001128165.1|NM_153214.2	NP_001121637.1|NP_694946.2	Q53RD9	FBLN7_HUMAN	fibulin 7	6					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						CCCAGCTCTCCGCGCGCGCTCT	0.673																																					p.6_6del													.	FBLN7	49		0			c.16_17del																																									SO:0001589	frameshift_variant	129804	exon1			GCTCTCCGCGCGC		CCDS2095.1, CCDS46391.1	2q13	2010-06-15			ENSG00000144152	ENSG00000144152		"""Fibulins"""	26740	protein-coding gene	gene with protein product		611551				17699513	Standard	NM_153214		Approved	FLJ37440, TM14	uc002tho.1	Q53RD9	OTTHUMG00000153267	ENST00000331203.2:c.17_18delCG	2.37:g.112896255_112896256delCG	ENSP00000331411:p.Pro6fs		Somatic	123	0	0		WXS	Illumina HiSeq	.	118	0.16	19	NM_153214	1	0.00	0	A0JNV1|A0JNV2|Q5H9P5|Q8N9G0	Frame_Shift_Del	DEL	ENST00000331203.2	37	CCDS2095.1																																																																																					0.673	FBLN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000330505.1		NM_153214	
SMPD4	55627	mdanderson.org	37	2	130910298	130910298	+	Missense_Mutation	SNP	G	G	A	rs542450477		TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr2:130910298G>A	ENST00000409031.1	-	20	3579	c.2431C>T	c.(2431-2433)Cgc>Tgc	p.R811C	SMPD4_ENST00000453750.1_Missense_Mutation_p.R560C|SMPD4_ENST00000339679.7_Missense_Mutation_p.R669C|SMPD4_ENST00000431183.2_Missense_Mutation_p.R709C|SMPD4_ENST00000351288.6_Missense_Mutation_p.R782C|SMPD4_ENST00000443958.2_Missense_Mutation_p.R475C|SMPD4_ENST00000452225.2_Missense_Mutation_p.R552C|SMPD4_ENST00000426662.2_Missense_Mutation_p.R447C	NM_017951.4	NP_060421.2	Q9NXE4	NSMA3_HUMAN	sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)	772					cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glycerophospholipid catabolic process (GO:0046475)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)|sphingomyelin phosphodiesterase D activity (GO:0050290)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(17)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29	Colorectal(110;0.1)				Phosphatidylserine(DB00144)	CCCAGGAAGCGCAGGCTGAGC	0.697													.|||	1	0.000199681	0.0	0.0	5008	,	,		14884	0.001		0.0	False		,,,				2504	0.0				p.R811C													.	.			0			c.C2431T												11.0	13.0	12.0					2																	130910298		2157	4219	6376	SO:0001583	missense	55627	exon20			GGAAGCGCAGGCT	AF052134	CCDS2156.2, CCDS42751.1, CCDS54398.1	2q21.1	2009-11-06			ENSG00000136699	ENSG00000136699			32949	protein-coding gene	gene with protein product		610457				16517606	Standard	NM_001171083		Approved	FLJ20297, FLJ20756, nSMase-3, KIAA1418, NSMASE3, NET13	uc002tqr.2	Q9NXE4	OTTHUMG00000131624	ENST00000409031.1:c.2431C>T	2.37:g.130910298G>A	ENSP00000386531:p.Arg811Cys		Somatic	67	0.0149253731	1		WXS	Illumina HiSeq	Phase_I	70	0.06	4	NM_017951	249	0.00	0	B4DM23|B4DQ31|B4DRB8|B4DWK7|B4E0L6|E7ESA2|E9PCE6|Q6FI76|Q6P1P7|Q6ZT43|Q9H0M2|Q9NW20|Q9NWL2|Q9P2C9	Missense_Mutation	SNP	ENST00000409031.1	37	CCDS42751.1	.	.	.	.	.	.	.	.	.	.	.	21.5	4.160861	0.78226	.	.	ENSG00000136699	ENST00000351288;ENST00000409031;ENST00000431183;ENST00000453750;ENST00000443958;ENST00000339679;ENST00000452225;ENST00000426662	.	.	.	4.08	3.12	0.35913	.	0.000000	0.85682	D	0.000000	T	0.76835	0.4043	M	0.83483	2.645	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;0.998;0.992;1.0;1.0;0.995;1.0	T	0.78499	-0.2180	9	0.66056	D	0.02	.	8.4224	0.32710	0.0:0.0:0.6178:0.3822	.	447;552;709;669;560;743;772;811;818;343	B4E0L6;B4DQ31;E7ESA2;B4E0T5;B4DM23;Q9NXE4-2;Q9NXE4;B1PBA3;Q9NXE4-4;Q9NXE4-5	.;.;.;.;.;.;NSMA3_HUMAN;.;.;.	C	782;811;709;560;475;669;552;447	.	ENSP00000339721:R669C	R	-	1	0	SMPD4	130626768	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	4.409000	0.59768	1.797000	0.52628	0.455000	0.32223	CGC			0.697	SMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254516.3		NM_017751	
GRB14	2888	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	165353738	165353738	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr2:165353738C>A	ENST00000263915.3	-	11	1815	c.1277G>T	c.(1276-1278)aGc>aTc	p.S426I	GRB14_ENST00000497306.1_5'Flank|GRB14_ENST00000543549.1_Missense_Mutation_p.S339I	NM_004490.2	NP_004481.2	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14	426					blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			breast(3)|endometrium(2)|large_intestine(6)|lung(10)|ovary(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32						TGTGGCAGAGCTCTGTGAAGA	0.443																																					p.S426I													.	.			0			c.G1277T												119.0	117.0	118.0					2																	165353738		2203	4300	6503	SO:0001583	missense	2888	exon11			GCAGAGCTCTGTG		CCDS2222.1	2q22-q24	2013-02-14			ENSG00000115290	ENSG00000115290		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4565	protein-coding gene	gene with protein product		601524				8812444	Standard	XM_005246477		Approved		uc002ucl.3	Q14449	OTTHUMG00000132135	ENST00000263915.3:c.1277G>T	2.37:g.165353738C>A	ENSP00000263915:p.Ser426Ile		Somatic	201	0	0		WXS	Illumina HiSeq	.	188	0.24	45	NM_004490	14	0.43	6	B7Z7F9|Q7Z6I1	Missense_Mutation	SNP	ENST00000263915.3	37	CCDS2222.1	.	.	.	.	.	.	.	.	.	.	C	8.662	0.900756	0.17686	.	.	ENSG00000115290	ENST00000263915;ENST00000543549;ENST00000446413	T;T;D	0.93307	0.86;0.86;-3.2	5.49	2.45	0.29901	.	0.152878	0.64402	D	0.000015	D	0.88321	0.6405	L	0.49778	1.585	0.44492	D	0.997436	B;B	0.14012	0.001;0.009	B;B	0.12156	0.002;0.007	T	0.83334	-0.0011	10	0.45353	T	0.12	-13.6095	4.987	0.14194	0.0:0.4666:0.3262:0.2072	.	339;426	B7Z7F9;Q14449	.;GRB14_HUMAN	I	426;339;381	ENSP00000263915:S426I;ENSP00000443699:S339I;ENSP00000416786:S381I	ENSP00000263915:S426I	S	-	2	0	GRB14	165061984	1.000000	0.71417	0.974000	0.42286	0.150000	0.21749	1.102000	0.31050	1.302000	0.44855	0.655000	0.94253	AGC			0.443	GRB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255180.2			
CXCR1	3577	hgsc.bcm.edu	37	2	219029115	219029115	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr2:219029115G>T	ENST00000295683.2	-	2	940	c.820C>A	c.(820-822)Cag>Aag	p.Q274K		NM_000634.2	NP_000625.1	P25024	CXCR1_HUMAN	chemokine (C-X-C motif) receptor 1	274					cell surface receptor signaling pathway (GO:0007166)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|interleukin-8-mediated signaling pathway (GO:0038112)|receptor internalization (GO:0031623)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|interleukin-8 binding (GO:0019959)|interleukin-8 receptor activity (GO:0004918)			endometrium(1)|large_intestine(2)|lung(7)|prostate(3)	13					Ketoprofen(DB01009)	CAGCTCTCCTGGATCACCTGG	0.577																																					p.Q274K													.	.			0			c.C820A												80.0	76.0	77.0					2																	219029115		2203	4300	6503	SO:0001583	missense	3577	exon2			TCTCCTGGATCAC	U11870	CCDS2409.1	2q35	2012-08-08	2009-11-25	2009-11-25	ENSG00000163464	ENSG00000163464		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"", ""Interleukins and interleukin receptors"""	6026	protein-coding gene	gene with protein product		146929	"""interleukin 8 receptor, alpha"""	CMKAR1, IL8RA		1303245, 1427896	Standard	NM_000634		Approved	CKR-1, CDw128a, CD181	uc002vhc.3	P25024	OTTHUMG00000133108	ENST00000295683.2:c.820C>A	2.37:g.219029115G>T	ENSP00000295683:p.Gln274Lys		Somatic	95	0	0		WXS	Illumina HiSeq	.	119	0.04	5	NM_000634	0		0	B2R6Q3|Q2YEF8|Q2YEG4|Q2YEG5|Q2YEG7|Q2YEG8|Q53R18|Q6IN95|Q8N6T6|Q9P2T8|Q9P2T9|Q9P2U0|Q9P2U1|Q9P2U2	Missense_Mutation	SNP	ENST00000295683.2	37	CCDS2409.1	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.397763	0.00198	.	.	ENSG00000163464	ENST00000295683;ENST00000421691	T	0.65178	-0.14	4.89	-9.77	0.00500	GPCR, rhodopsin-like superfamily (1);	2.830220	0.00678	N	0.000668	T	0.35008	0.0917	N	0.12471	0.22	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.30822	-0.9965	10	0.09084	T	0.74	.	6.9158	0.24359	0.0759:0.1133:0.4744:0.3364	.	274	P25024	CXCR1_HUMAN	K	274;218	ENSP00000295683:Q274K	ENSP00000295683:Q274K	Q	-	1	0	CXCR1	218737360	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-6.831000	0.00052	-3.946000	0.00088	-2.518000	0.00185	CAG			0.577	CXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256773.2		NM_000634	
SPHKAP	80309	mdanderson.org	37	2	228883882	228883882	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr2:228883882T>C	ENST00000392056.3	-	7	1734	c.1688A>G	c.(1687-1689)cAg>cGg	p.Q563R	SPHKAP_ENST00000344657.5_Missense_Mutation_p.Q563R	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	563						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		ACTGGCCACCTGAGTCATGCC	0.562																																					p.Q563R													SPHKAP,larynx,carcinoma,+1,1	SPHKAP	1	1	0			c.A1688G												112.0	103.0	106.0					2																	228883882		2203	4300	6503	SO:0001583	missense	80309	exon7			GCCACCTGAGTCA		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.1688A>G	2.37:g.228883882T>C	ENSP00000375909:p.Gln563Arg		Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_030623	0		0	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.503231	0.85176	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.52526	0.66;0.66	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.69700	0.3140	M	0.78637	2.42	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.91635	0.996;0.999	T	0.72414	-0.4301	10	0.54805	T	0.06	.	15.4114	0.74923	0.0:0.0:0.0:1.0	.	563;563	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	R	563	ENSP00000375909:Q563R;ENSP00000339886:Q563R	ENSP00000339886:Q563R	Q	-	2	0	SPHKAP	228592126	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.396000	0.79891	2.228000	0.72767	0.533000	0.62120	CAG			0.562	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000331750.1		NM_030623	
DIS3L2	129563	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	233194705	233194705	+	Splice_Site	SNP	A	A	G			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr2:233194705A>G	ENST00000409307.1	+	14	1922	c.1922A>G	c.(1921-1923)aAt>aGt	p.N641S	DIS3L2_ENST00000273009.6_Intron|DIS3L2_ENST00000325385.7_Splice_Site_p.N641S					DIS3 like 3'-5' exoribonuclease 2											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		GGAGCCCTCAATGTGAGTGGT	0.647																																					p.N641S													.	.			0			c.A1922G												36.0	42.0	40.0					2																	233194705		1935	4125	6060	SO:0001630	splice_region_variant	129563	exon15			CCCTCAATGTGAG	BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000409307.1:c.1923+1A>G	2.37:g.233194705A>G			Somatic	80	0	0		WXS	Illumina HiSeq	.	80	0.33	26	NM_152383	20	0.30	6		Missense_Mutation	SNP	ENST00000409307.1	37	CCDS42834.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	11.15|11.15	1.554676|1.554676	0.27739|0.27739	.|.	.|.	ENSG00000144535|ENSG00000144535	ENST00000542873|ENST00000325385;ENST00000431466;ENST00000409307;ENST00000424049	.|T;T;T	.|0.35048	.|1.33;1.33;1.33	5.33|5.33	5.33|5.33	0.75918|0.75918	.|Ribonuclease II/R (2);	.|0.346876	.|0.28748	.|N	.|0.014268	T|T	0.20577|0.20577	0.0495|0.0495	N|N	0.05259|0.05259	-0.085|-0.085	0.80722|0.80722	D|D	1|1	.|B	.|0.11235	.|0.004	.|B	.|0.17979	.|0.02	T|T	0.07366|0.07366	-1.0776|-1.0776	5|10	.|0.22706	.|T	.|0.39	-9.5511|-9.5511	15.0389|15.0389	0.71770|0.71770	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|641	.|Q8IYB7	.|DI3L2_HUMAN	V|S	617|641;641;641;276	.|ENSP00000315569:N641S;ENSP00000386799:N641S;ENSP00000415419:N276S	.|ENSP00000315569:N641S	M|N	+|+	1|2	0|0	DIS3L2|DIS3L2	232902949|232902949	0.981000|0.981000	0.34729|0.34729	0.932000|0.932000	0.37286|0.37286	0.953000|0.953000	0.61014|0.61014	6.697000|6.697000	0.74603|0.74603	2.023000|2.023000	0.59567|0.59567	0.520000|0.520000	0.50463|0.50463	ATG|AAT			0.647	DIS3L2-015	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000330988.1		NM_152383	Missense_Mutation
MYLK2	85366	broad.mit.edu	37	20	30418685	30418685	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr20:30418685G>A	ENST00000375994.2	+	8	1561	c.1288G>A	c.(1288-1290)Gca>Aca	p.A430T	MYLK2_ENST00000468730.1_3'UTR|MYLK2_ENST00000375985.4_Missense_Mutation_p.A430T			Q9H1R3	MYLK2_HUMAN	myosin light chain kinase 2	430	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|neuromuscular synaptic transmission (GO:0007274)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of gene expression (GO:0010628)|protein autophosphorylation (GO:0046777)|regulation of muscle filament sliding (GO:0032971)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle satellite cell differentiation (GO:0014816)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			CTTTGGCCTGGCACGGAGGTA	0.622																																					p.A430T													.	MYLK2	76		0			c.G1288A												116.0	113.0	114.0					20																	30418685		2203	4300	6503	SO:0001583	missense	85366	exon9			GGCCTGGCACGGA	AF325549	CCDS13191.1	20q13.31	2014-09-17	2008-01-23		ENSG00000101306	ENSG00000101306	2.7.11.18		16243	protein-coding gene	gene with protein product	"""skeletal muscle myosin light chain kinase"""	606566	"""myosin light chain kinase 2, skeletal muscle"""				Standard	NM_033118		Approved	skMLCK, KMLC, MLCK2	uc002wwq.2	Q9H1R3	OTTHUMG00000032194	ENST00000375994.2:c.1288G>A	20.37:g.30418685G>A	ENSP00000365162:p.Ala430Thr		Somatic	159	0	0		WXS	Illumina HiSeq	Phase_I	164	0.03	5	NM_033118	1	0.00	0	Q569L1|Q96I84	Missense_Mutation	SNP	ENST00000375994.2	37	CCDS13191.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.611591	0.87258	.	.	ENSG00000101306	ENST00000375994;ENST00000375985	T;T	0.75821	-0.97;-0.97	3.76	3.76	0.43208	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.86564	0.5963	M	0.88640	2.97	0.58432	D	0.999998	D	0.64830	0.994	D	0.63113	0.911	D	0.89895	0.4040	9	0.87932	D	0	.	15.0927	0.72207	0.0:0.0:1.0:0.0	.	430	Q9H1R3	MYLK2_HUMAN	T	430	ENSP00000365162:A430T;ENSP00000365152:A430T	ENSP00000365152:A430T	A	+	1	0	MYLK2	29882346	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.490000	0.97952	2.063000	0.61619	0.561000	0.74099	GCA			0.622	MYLK2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078583.2		NM_033118	
PCIF1	63935	mdanderson.org	37	20	44567735	44567735	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr20:44567735C>T	ENST00000372409.3	+	3	461	c.97C>T	c.(97-99)Cca>Tca	p.P33S		NM_022104.3	NP_071387.1	Q9H4Z3	PCIF1_HUMAN	PDX1 C-terminal inhibiting factor 1	33					negative regulation of phosphatase activity (GO:0010923)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	20						TTCTCCAAAGCCAATCCGCCT	0.637																																					p.P33S													.	.			0			c.C97T												68.0	67.0	67.0					20																	44567735		2203	4300	6503	SO:0001583	missense	63935	exon3			CCAAAGCCAATCC	AB050014	CCDS13388.1	20q13.12	2014-06-13	2008-04-29	2008-04-29	ENSG00000100982	ENSG00000100982			16200	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 121"""		"""chromosome 20 open reading frame 67"""	C20orf67		12565871, 15121856	Standard	NM_022104		Approved	bA465L10.1, PPP1R121	uc002xqs.3	Q9H4Z3	OTTHUMG00000032635	ENST00000372409.3:c.97C>T	20.37:g.44567735C>T	ENSP00000361486:p.Pro33Ser		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	54	0.06	3	NM_022104	58	0.00	0	E1P5P1|Q54AB9|Q9NT85	Missense_Mutation	SNP	ENST00000372409.3	37	CCDS13388.1	.	.	.	.	.	.	.	.	.	.	C	16.96	3.265458	0.59431	.	.	ENSG00000100982	ENST00000372409;ENST00000443130	.	.	.	5.69	5.69	0.88448	.	0.195351	0.45867	D	0.000336	T	0.49474	0.1559	N	0.14661	0.345	0.46849	D	0.999223	B	0.12013	0.005	B	0.13407	0.009	T	0.41858	-0.9485	9	0.51188	T	0.08	-14.0075	18.7927	0.91980	0.0:1.0:0.0:0.0	.	33	Q9H4Z3	PCIF1_HUMAN	S	33	.	ENSP00000361486:P33S	P	+	1	0	PCIF1	44001142	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.969000	0.63735	2.676000	0.91093	0.655000	0.94253	CCA			0.637	PCIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079550.1		NM_022104	
FAM3B	54097	mdanderson.org	37	21	42694879	42694879	+	Missense_Mutation	SNP	G	G	A	rs371282791		TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr21:42694879G>A	ENST00000357985.2	+	2	195	c.49G>A	c.(49-51)Gcc>Acc	p.A17T	FAM3B_ENST00000398652.3_Missense_Mutation_p.A56T|FAM3B_ENST00000398646.3_Missense_Mutation_p.A40T|FAM3B_ENST00000479810.2_3'UTR|FAM3B_ENST00000398647.3_Intron	NM_058186.3	NP_478066.3	P58499	FAM3B_HUMAN	family with sequence similarity 3, member B	17					apoptotic process (GO:0006915)|insulin secretion (GO:0030073)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)			central_nervous_system(2)|endometrium(1)|lung(2)	5		Prostate(19;1.57e-07)|all_epithelial(19;0.0404)				CGTGGTCTTCGCCTCCTTGTG	0.622																																					p.A17T													.	.			0			c.G49A							G	THR/ALA,	0,4406		0,0,2203	218.0	160.0	180.0		49,	4.0	0.2	21		180	1,8599	1.2+/-3.3	0,1,4299	no	missense,intron	FAM3B	NM_058186.3,NM_206964.1	58,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,	17/236,	42694879	1,13005	2203	4300	6503	SO:0001583	missense	54097	exon2			GTCTTCGCCTCCT	AF494379	CCDS13671.1, CCDS42930.1	21q22.3	2014-08-14	2002-05-23	2002-06-20	ENSG00000183844	ENSG00000183844			1253	protein-coding gene	gene with protein product	"""pancreatic-derived factor"""	608617	"""chromosome 21 open reading frame 11"""	C21orf11			Standard	NM_058186		Approved	D21M16SJHU19e, PRED44, 2-21, ORF9, C21orf76, PANDER	uc002yzb.1	P58499	OTTHUMG00000086752	ENST00000357985.2:c.49G>A	21.37:g.42694879G>A	ENSP00000350673:p.Ala17Thr		Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	26	0.12	3	NM_058186	1	0.00	0		Missense_Mutation	SNP	ENST00000357985.2	37	CCDS13671.1	.	.	.	.	.	.	.	.	.	.	G	11.54	1.669775	0.29693	0.0	1.16E-4	ENSG00000183844	ENST00000357985;ENST00000398652;ENST00000398646	T;T;T	0.56275	0.61;0.47;0.55	4.9	3.99	0.46301	.	0.268590	0.31301	N	0.007888	T	0.59280	0.2182	L	0.48362	1.52	0.36231	D	0.852661	D;D;D	0.89917	1.0;0.997;0.997	D;P;P	0.69142	0.962;0.818;0.818	T	0.60855	-0.7180	10	0.16420	T	0.52	.	10.1775	0.42948	0.0:0.0:0.7923:0.2077	.	31;40;17	B7Z7I9;A8MTF8;P58499	.;.;FAM3B_HUMAN	T	17;56;40	ENSP00000350673:A17T;ENSP00000381646:A56T;ENSP00000381641:A40T	ENSP00000350673:A17T	A	+	1	0	FAM3B	41616749	0.468000	0.25839	0.213000	0.23690	0.009000	0.06853	1.256000	0.32921	0.990000	0.38787	0.655000	0.94253	GCC			0.622	FAM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000195142.1		NM_058186	
SLC37A1	54020	broad.mit.edu	37	21	43974235	43974235	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr21:43974235G>A	ENST00000352133.2	+	10	1814	c.832G>A	c.(832-834)Gaa>Aaa	p.E278K	SLC37A1_ENST00000398341.3_Missense_Mutation_p.E278K			P57057	GLPT_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 1	278					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	transporter activity (GO:0005215)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(3)	15						CTTGAAGAGCGAAAAGAACAA	0.438																																					p.E278K													.	SLC37A1	48		0			c.G832A												55.0	52.0	53.0					21																	43974235		2203	4300	6503	SO:0001583	missense	54020	exon11			AAGAGCGAAAAGA	AJ269529	CCDS13689.1	21q22.3	2013-07-17	2013-07-17		ENSG00000160190	ENSG00000160190		"""Solute carriers"""	11024	protein-coding gene	gene with protein product		608094	"""solute carrier family 37 (glycerol-3-phosphate transporter), member 1"""			11112347	Standard	NM_018964		Approved		uc002zbi.3	P57057	OTTHUMG00000086803	ENST00000352133.2:c.832G>A	21.37:g.43974235G>A	ENSP00000344648:p.Glu278Lys		Somatic	24	0.0833333333	2		WXS	Illumina HiSeq	Phase_I	43	0.09	4	NM_018964	17	0.00	0	D3DSJ7|Q9HAQ1	Missense_Mutation	SNP	ENST00000352133.2	37	CCDS13689.1	.	.	.	.	.	.	.	.	.	.	G	16.42	3.117326	0.56505	.	.	ENSG00000160190	ENST00000398341;ENST00000352133	T;T	0.22539	1.95;1.95	4.67	4.67	0.58626	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.714590	0.13538	N	0.380479	T	0.11665	0.0284	N	0.04805	-0.155	0.09310	N	0.999998	B	0.22146	0.065	B	0.16722	0.016	T	0.18023	-1.0350	10	0.33940	T	0.23	-14.5235	13.0883	0.59153	0.0:0.0:1.0:0.0	.	278	P57057	GLPT_HUMAN	K	278	ENSP00000381383:E278K;ENSP00000344648:E278K	ENSP00000344648:E278K	E	+	1	0	SLC37A1	42847304	0.651000	0.27340	0.031000	0.17742	0.569000	0.35902	2.354000	0.44098	2.142000	0.66516	0.563000	0.77884	GAA			0.438	SLC37A1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000195377.1			
MCM3AP	8888	hgsc.bcm.edu;mdanderson.org	37	21	47664965	47664965	+	Silent	SNP	G	G	A			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr21:47664965G>A	ENST00000397708.1	-	24	5048	c.4794C>T	c.(4792-4794)ggC>ggT	p.G1598G	MCM3AP_ENST00000467026.1_5'UTR|MCM3AP-AS1_ENST00000432735.1_RNA|MCM3AP_ENST00000291688.1_Silent_p.G1598G|MCM3AP-AS1_ENST00000414659.1_RNA|MCM3AP-AS1_ENST00000590829.1_RNA|MCM3AP-AS1_ENST00000444998.1_RNA|MCM3AP-AS1_ENST00000455567.1_RNA|AP001469.7_ENST00000444966.1_RNA|MCM3AP-AS1_ENST00000591223.1_RNA|MCM3AP-AS1_ENST00000421927.1_RNA|MCM3AP-AS1_ENST00000588753.1_RNA			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	1598					DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)	p.G1598G(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					AAGCAAGACCGCCCAGACGCC	0.537																																					p.G1598G													MCM3AP,caecum,carcinoma,-1,2	MCM3AP	-1	2	1	Substitution - coding silent(1)	endometrium(1)	c.C4794T												92.0	88.0	89.0					21																	47664965		2203	4300	6503	SO:0001819	synonymous_variant	8888	exon23			AAGACCGCCCAGA	AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.4794C>T	21.37:g.47664965G>A			Somatic	119	0	0		WXS	Illumina HiSeq	.	121	0.04	5	NM_003906	130	0.00	0	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Silent	SNP	ENST00000397708.1	37	CCDS13734.1																																																																																					0.537	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207254.1		NM_003906	
PCNT	5116	broad.mit.edu	37	21	47831434	47831434	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr21:47831434C>A	ENST00000359568.5	+	28	5554	c.5447C>A	c.(5446-5448)gCc>gAc	p.A1816D	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	1816					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					CACAGCCAGGCCCTGGAGGCC	0.706																																					p.A1816D													.	PCNT	283		0			c.C5447A												8.0	11.0	10.0					21																	47831434		2125	4213	6338	SO:0001583	missense	5116	exon28			GCCAGGCCCTGGA	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.5447C>A	21.37:g.47831434C>A	ENSP00000352572:p.Ala1816Asp		Somatic	36	0.0277777778	1		WXS	Illumina HiSeq	Phase_I	39	0.10	4	NM_006031	21	0.10	2	O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	37	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	C	18.21	3.574208	0.65878	.	.	ENSG00000160299	ENST00000359568	T	0.01572	4.76	5.79	3.8	0.43715	.	0.000000	0.32190	N	0.006460	T	0.04272	0.0118	L	0.34521	1.04	0.09310	N	0.999999	D;D	0.76494	0.999;0.999	D;D	0.69479	0.964;0.922	T	0.51156	-0.8741	10	0.18710	T	0.47	.	12.1547	0.54070	0.2978:0.7022:0.0:0.0	.	1698;1816	O95613-2;O95613	.;PCNT_HUMAN	D	1816	ENSP00000352572:A1816D	ENSP00000352572:A1816D	A	+	2	0	PCNT	46655862	0.477000	0.25909	1.000000	0.80357	0.855000	0.48748	0.786000	0.26844	2.739000	0.93911	0.563000	0.77884	GCC			0.706	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207336.1		NM_006031	
PEX26	55670	hgsc.bcm.edu	37	22	18568023	18568023	+	Splice_Site	SNP	A	A	G			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr22:18568023A>G	ENST00000329627.7	+	5	1019	c.813A>G	c.(811-813)ccA>ccG	p.P271P	PEX26_ENST00000428061.2_Intron|PEX26_ENST00000399744.3_Splice_Site_p.P271P	NM_017929.5	NP_060399.1	Q7Z412	PEX26_HUMAN	peroxisomal biogenesis factor 26	271					protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome membrane (GO:0045046)	integral component of peroxisomal membrane (GO:0005779)|peroxisome (GO:0005777)	ATPase binding (GO:0051117)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			breast(1)|kidney(2)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						GATTTGATCCAGGTAAGAGGT	0.567																																					p.P271P													.	.			0			c.A813G												81.0	77.0	78.0					22																	18568023		2203	4300	6503	SO:0001630	splice_region_variant	55670	exon4			TGATCCAGGTAAG	AB089678	CCDS13750.1, CCDS56221.1	22q11.21	2008-08-26	2008-08-26		ENSG00000215193	ENSG00000215193			22965	protein-coding gene	gene with protein product		608666	"""peroxisome biogenesis factor 26"""			12717447, 12851857	Standard	NM_017929		Approved	FLJ20695	uc002znp.4	Q7Z412	OTTHUMG00000149970	ENST00000329627.7:c.814+1A>G	22.37:g.18568023A>G			Somatic	70	0	0		WXS	Illumina HiSeq	.	96	0.04	4	NM_001127649	132	0.00	0	F6UBB5|Q7Z413|Q7Z414|Q7Z415|Q7Z416|Q96B12|Q9NWQ0|Q9NXU0	Silent	SNP	ENST00000329627.7	37	CCDS13750.1																																																																																					0.567	PEX26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000314644.3		NM_017929	Silent
GGT2	728441	broad.mit.edu	37	22	21563143	21563143	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr22:21563143C>A	ENST00000401924.1	-	13	1870	c.1379G>T	c.(1378-1380)gGc>gTc	p.G460V	GGT2_ENST00000424627.1_Missense_Mutation_p.G460V|GGT2_ENST00000405188.4_Missense_Mutation_p.G450V			P36268	GGT2_HUMAN	gamma-glutamyltransferase 2	460					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	anchored component of external side of plasma membrane (GO:0031362)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)										GCCGTCCTGGCCCACCATGAT	0.652																																					.													.	.			0			.																																									SO:0001583	missense	728441	.			TCCTGGCCCACCA	M30474		22q11.21	2012-04-19			ENSG00000133475	ENSG00000133475	2.3.2.2	"""Gamma-glutamyltransferases"""	4251	protein-coding gene	gene with protein product		137181		GGT		8104871, 18357469	Standard	XM_006724392		Approved		uc011aic.1	P36268	OTTHUMG00000150617	ENST00000401924.1:c.1379G>T	22.37:g.21563143C>A	ENSP00000385721:p.Gly460Val		Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	131	0.05	7	.	2	0.00	0		Missense_Mutation	SNP	ENST00000401924.1	37		.	.	.	.	.	.	.	.	.	.	c	10.24	1.295108	0.23564	.	.	ENSG00000133475	ENST00000405188;ENST00000401924;ENST00000424627	T;T;T	0.06371	3.31;3.31;3.31	1.68	0.613	0.17597	.	0.109447	0.64402	D	0.000014	T	0.09555	0.0235	L	0.53249	1.67	0.48975	D	0.999736	.	.	.	.	.	.	T	0.11299	-1.0593	8	0.87932	D	0	-47.0295	3.9082	0.09191	0.0:0.5835:0.0:0.4165	.	.	.	.	V	450;460;460	ENSP00000385601:G450V;ENSP00000385721:G460V;ENSP00000402035:G460V	ENSP00000385721:G460V	G	-	2	0	GGT2	19893143	0.994000	0.37717	0.092000	0.20876	0.358000	0.29455	1.419000	0.34793	0.263000	0.21812	0.175000	0.17021	GGC			0.652	GGT2-002	KNOWN	non_canonical_other|not_best_in_genome_evidence|basic|appris_principal|exp_conf	protein_coding	protein_coding		OTTHUMT00000320092.2		XM_001129377	
DRICH1	51233	broad.mit.edu	37	22	23974156	23974156	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr22:23974156T>C	ENST00000317749.5	-	1	352	c.55A>G	c.(55-57)Aag>Gag	p.K19E	KB-1572G7.3_ENST00000390329.3_RNA	NM_016449.3	NP_057533.2	Q6PGQ1	DRIC1_HUMAN		19										endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)|skin(1)	11						GGTGCGTCCTTCCCCCTGGGC	0.532																																					p.K19E													.	C22orf43	18		0			c.A55G												93.0	95.0	95.0					22																	23974156		1965	4139	6104	SO:0001583	missense	51233	exon1			CGTCCTTCCCCCT																												ENST00000317749.5:c.55A>G	22.37:g.23974156T>C	ENSP00000316137:p.Lys19Glu		Somatic	150	0.02	3		WXS	Illumina HiSeq	Phase_I	247	0.03	7	NM_016449	1	0.00	0	Q6ICJ8|Q6P4I3|Q9NU31	Missense_Mutation	SNP	ENST00000317749.5	37	CCDS42985.1	.	.	.	.	.	.	.	.	.	.	t	6.700	0.497794	0.12762	.	.	ENSG00000189269	ENST00000317749	T	0.32515	1.45	0.14	-0.28	0.12886	.	.	.	.	.	T	0.30324	0.0761	L	0.34521	1.04	0.09310	N	1	P	0.49696	0.927	P	0.56563	0.801	T	0.20306	-1.0279	8	0.51188	T	0.08	.	.	.	.	.	19	Q6PGQ1	CV043_HUMAN	E	19	ENSP00000316137:K19E	ENSP00000316137:K19E	K	-	1	0	C22orf43	22304156	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	-0.944000	0.03913	-1.393000	0.02079	-1.425000	0.01104	AAG			0.532	C22orf43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319708.2			
UQCR10	29796	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	30163557	30163557	+	Intron	SNP	C	C	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr22:30163557C>T	ENST00000330029.6	+	1	180				ZMAT5_ENST00000344318.3_5'Flank|UQCR10_ENST00000401406.3_Missense_Mutation_p.P57L|ZMAT5_ENST00000397781.3_5'Flank	NM_001003684.1|NM_013387.3	NP_001003684.1|NP_037519.2	Q9UDW1	QCR9_HUMAN	ubiquinol-cytochrome c reductase, complex III subunit X						cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)	ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)	5						TGTGCCATCCCTGACCTTGGA	0.592																																					p.P57L													.	.			0			c.C170T												30.0	32.0	31.0					22																	30163557		1967	4141	6108	SO:0001627	intron_variant	29796	exon1			CCATCCCTGACCT	AB028598	CCDS46680.1, CCDS46681.1	22q12.2	2011-07-04			ENSG00000184076	ENSG00000184076		"""Mitochondrial respiratory chain complex / Complex III"""	30863	protein-coding gene	gene with protein product	"""ubiquinol-cytochrome c reductase, complex III subunit X, 7.2kDa"", ""complex III subunit 9"""	610843				11042152	Standard	NM_013387		Approved	HSPC051, UCRC, QCR9, UCCR7.2	uc003agq.1	Q9UDW1	OTTHUMG00000151283	ENST00000330029.6:c.150+20C>T	22.37:g.30163557C>T			Somatic	92	0	0		WXS	Illumina HiSeq	.	58	0.28	16	NM_001003684	121	0.30	36	B5MCM5|Q9T2V6	Missense_Mutation	SNP	ENST00000330029.6	37	CCDS46680.1	.	.	.	.	.	.	.	.	.	.	C	15.14	2.743646	0.49151	.	.	ENSG00000184076	ENST00000401406;ENST00000406782	T	0.41758	0.99	5.73	2.42	0.29668	.	.	.	.	.	T	0.28830	0.0715	.	.	.	0.28695	N	0.904405	B	0.02656	0.0	B	0.06405	0.002	T	0.21075	-1.0256	8	0.46703	T	0.11	.	5.114	0.14825	0.1475:0.6309:0.1425:0.0791	.	57	Q9UDW1-2	.	L	57	ENSP00000384962:P57L	ENSP00000384962:P57L	P	+	2	0	UQCR10	28493557	0.992000	0.36948	0.605000	0.28930	0.846000	0.48090	2.615000	0.46368	0.305000	0.22832	-0.343000	0.07986	CCT			0.592	UQCR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000322081.1		NM_013387	
GGA1	26088	mdanderson.org	37	22	38019586	38019586	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr22:38019586C>T	ENST00000343632.4	+	9	1164	c.778C>T	c.(778-780)Cgg>Tgg	p.R260W	GGA1_ENST00000325180.8_Missense_Mutation_p.R260W|GGA1_ENST00000337437.4_Missense_Mutation_p.R227W|GGA1_ENST00000406772.1_Missense_Mutation_p.R187W|GGA1_ENST00000381756.5_Missense_Mutation_p.R277W	NM_001172687.1|NM_013365.4	NP_001166158.1|NP_037497.1	Q9UJY5	GGA1_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 1	260	GAT. {ECO:0000255|PROSITE- ProRule:PRU00373}.|Interaction with ARF3.				intracellular protein transport (GO:0006886)|positive regulation of protein catabolic process (GO:0045732)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	10	Melanoma(58;0.0574)					TGAGCGGATGCGGCCCACGCT	0.667											OREG0026543	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R260W													.	.			0			c.C778T												56.0	50.0	52.0					22																	38019586		2202	4298	6500	SO:0001583	missense	26088	exon9			CGGATGCGGCCCA	AF190862	CCDS13951.1, CCDS33643.1, CCDS54526.1	22q13.31	2010-02-12	2010-02-12		ENSG00000100083	ENSG00000100083			17842	protein-coding gene	gene with protein product		606004				10747088, 10747089, 16407204	Standard	NM_013365		Approved		uc003atc.3	Q9UJY5	OTTHUMG00000030985	ENST00000343632.4:c.778C>T	22.37:g.38019586C>T	ENSP00000341344:p.Arg260Trp		Somatic	91	0	0	875	WXS	Illumina HiSeq	Phase_I	86	0.05	4	NM_001001560	68	0.00	0	A8K3D3|B0QYR7|Q5TG07|Q86YA9|Q8NCS6|Q9BW94|Q9UG00|Q9UGW0|Q9UGW1	Missense_Mutation	SNP	ENST00000343632.4	37	CCDS13951.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.559474	0.86335	.	.	ENSG00000100083	ENST00000343632;ENST00000381756;ENST00000325180;ENST00000337437;ENST00000406772	T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63	4.92	3.85	0.44370	GAT (2);	0.000000	0.85682	D	0.000000	T	0.70945	0.3282	M	0.88450	2.955	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.996	D;D;D	0.76071	0.963;0.987;0.956	T	0.77081	-0.2720	10	0.87932	D	0	-28.6761	12.2874	0.54798	0.3842:0.6158:0.0:0.0	.	277;260;260	Q6IC75;Q86YA9;Q9UJY5	.;.;GGA1_HUMAN	W	260;277;260;227;187	ENSP00000341344:R260W;ENSP00000371175:R277W;ENSP00000321288:R260W;ENSP00000338647:R227W;ENSP00000385287:R187W	ENSP00000321288:R260W	R	+	1	2	GGA1	36349532	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	1.814000	0.38972	2.285000	0.76669	0.462000	0.41574	CGG			0.667	GGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000075873.3		NM_013365	
HDAC10	83933	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	50688078	50688081	+	Frame_Shift_Del	DEL	AAAG	AAAG	-			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	AAAG	AAAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr22:50688078_50688081delAAAG	ENST00000216271.5	-	6	898_901	c.546_549delCTTT	c.(544-549)ctctttfs	p.LF182fs	MAPK12_ENST00000497036.1_5'UTR|HDAC10_ENST00000498366.1_5'UTR|HDAC10_ENST00000349505.4_Frame_Shift_Del_p.LF182fs|HDAC10_ENST00000448072.1_Frame_Shift_Del_p.LF182fs	NM_001159286.1|NM_032019.5	NP_001152758.1|NP_114408.3	Q969S8	HDA10_HUMAN	histone deacetylase 10	182	Histone deacetylase.				chromatin modification (GO:0016568)|histone deacetylation (GO:0016575)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|oligodendrocyte development (GO:0014003)|protein deacetylation (GO:0006476)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)			endometrium(2)|kidney(2)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	8		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GGTCATCCTCAAAGAGATACTGGA	0.613																																					p.183_184del													.	HDAC10	29		0			c.547_550del																																									SO:0001589	frameshift_variant	83933	exon6			ATCCTCAAAGAGA	AF393962	CCDS14088.1, CCDS54545.1	22q13.31	2008-06-10			ENSG00000100429	ENSG00000100429			18128	protein-coding gene	gene with protein product		608544				11677242, 11726666	Standard	NM_032019		Approved	DKFZP761B039	uc003bkg.3	Q969S8	OTTHUMG00000044647	ENST00000216271.5:c.546_549delCTTT	22.37:g.50688078_50688081delAAAG	ENSP00000216271:p.Leu182fs		Somatic	69	0	0		WXS	Illumina HiSeq	.	69	0.22	15	NM_032019	27	0.00	0	Q08AP4|Q6STF9|Q96P77|Q96P78|Q9H028|Q9UGX1|Q9UGX2	Frame_Shift_Del	DEL	ENST00000216271.5	37	CCDS14088.1																																																																																					0.613	HDAC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000104141.4		NM_032019	
CAMKV	79012	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	49899544	49899552	+	In_Frame_Del	DEL	TTCTTGCAG	TTCTTGCAG	-			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	TTCTTGCAG	TTCTTGCAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr3:49899544_49899552delTTCTTGCAG	ENST00000477224.1	-	3	631_639	c.153_161delCTGCAAGAA	c.(151-162)acctgcaagaag>acg	p.CKK52del	CAMKV_ENST00000466940.1_In_Frame_Del_p.CKK52del|CAMKV_ENST00000498324.1_5'UTR|CAMKV_ENST00000488336.1_In_Frame_Del_p.CKK52del|CAMKV_ENST00000296471.7_In_Frame_Del_p.CKK52del|CAMKV_ENST00000467248.1_5'UTR|CAMKV_ENST00000463537.1_In_Frame_Del_p.CKK52del|RN7SL217P_ENST00000584520.1_RNA			Q8NCB2	CAMKV_HUMAN	CaM kinase-like vesicle-associated	52	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			central_nervous_system(1)|large_intestine(2)|lung(2)|ovary(2)	7				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		CTTCTGGAACTTCTTGCAGGTGTGCAGCT	0.589																																					p.52_54del													.	CAMKV	84		0			c.154_162del																																									SO:0001651	inframe_deletion	79012	exon3			TGGAACTTCTTGC	BC017363	CCDS33762.1	3p21.31	2005-03-04			ENSG00000164076	ENSG00000164076			28788	protein-coding gene	gene with protein product		614993				12477932	Standard	XM_005265478		Approved	MGC8407, VACAMKL	uc003cxt.1	Q8NCB2	OTTHUMG00000158288	ENST00000477224.1:c.153_161delCTGCAAGAA	3.37:g.49899544_49899552delTTCTTGCAG	ENSP00000419195:p.Cys52_Lys54del		Somatic	78	0	0		WXS	Illumina HiSeq	.	80	0.28	22	NM_024046	68	0.44	30	A6NFD4|Q6FIB8|Q8NBS8|Q8NC85|Q8NDU4|Q8WTT8|Q9BQC9|Q9H0Q5	In_Frame_Del	DEL	ENST00000477224.1	37	CCDS33762.1																																																																																					0.589	CAMKV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350584.4		NM_024046	
STAB1	23166	mdanderson.org	37	3	52557127	52557127	+	Missense_Mutation	SNP	G	G	A	rs372724948		TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr3:52557127G>A	ENST00000321725.6	+	63	7073	c.6997G>A	c.(6997-6999)Gcc>Acc	p.A2333T		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	2333	FAS1 7. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		GGCTGCCACTGCCAACTTCTC	0.617																																					p.A2333T													.	.			0			c.G6997A							G	THR/ALA	0,4404		0,0,2202	77.0	80.0	79.0		6997	4.0	0.9	3		79	1,8595	1.2+/-3.3	0,1,4297	no	missense	STAB1	NM_015136.2	58	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	2333/2571	52557127	1,12999	2202	4298	6500	SO:0001583	missense	23166	exon63			GCCACTGCCAACT	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.6997G>A	3.37:g.52557127G>A	ENSP00000312946:p.Ala2333Thr		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	23	0.13	3	NM_015136	38	0.00	0	A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	ENST00000321725.6	37	CCDS33768.1	.	.	.	.	.	.	.	.	.	.	G	19.73	3.882732	0.72410	0.0	1.16E-4	ENSG00000010327	ENST00000321725	D	0.91464	-2.85	5.74	3.96	0.45880	FAS1 domain (3);	0.279368	0.34750	N	0.003703	D	0.91092	0.7196	M	0.65975	2.015	0.32946	D	0.519097	D;D	0.59357	0.985;0.967	P;P	0.53360	0.724;0.629	D	0.91750	0.5411	10	0.62326	D	0.03	.	7.1758	0.25744	0.1513:0.1398:0.7089:0.0	.	220;2333	B3KSK0;Q9NY15	.;STAB1_HUMAN	T	2333	ENSP00000312946:A2333T	ENSP00000312946:A2333T	A	+	1	0	STAB1	52532167	0.047000	0.20315	0.885000	0.34714	0.914000	0.54420	0.684000	0.25364	0.784000	0.33661	0.561000	0.74099	GCC			0.617	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000351380.2		NM_015136	
SDAD1	55153	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	76882374	76882374	+	Silent	SNP	G	G	A	rs143777133		TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr4:76882374G>A	ENST00000356260.5	-	15	1387	c.1269C>T	c.(1267-1269)caC>caT	p.H423H	SDAD1_ENST00000513089.1_5'UTR|SDAD1_ENST00000395711.4_Silent_p.H386H	NM_018115.2	NP_060585.2	Q9NVU7	SDA1_HUMAN	SDA1 domain containing 1	423					actin cytoskeleton organization (GO:0030036)|protein transport (GO:0015031)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal large subunit export from nucleus (GO:0000055)	nucleolus (GO:0005730)				breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	19			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TCTTATCCTTGTGTGTTTTAT	0.393																																					p.H423H													.	.			0			c.C1269T							G		0,4406		0,0,2203	140.0	125.0	130.0		1269	2.6	1.0	4	dbSNP_134	130	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SDAD1	NM_018115.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		423/688	76882374	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	55153	exon15			ATCCTTGTGTGTT	AF132198	CCDS3573.2, CCDS75147.1	4q21.21	2010-11-24			ENSG00000198301	ENSG00000198301			25537	protein-coding gene	gene with protein product						11483580	Standard	NM_001288984		Approved	FLJ10498	uc003hje.4	Q9NVU7	OTTHUMG00000130111	ENST00000356260.5:c.1269C>T	4.37:g.76882374G>A			Somatic	125	0	0		WXS	Illumina HiSeq	.	117	0.30	35	NM_018115	161	0.43	70	Q32Q11|Q68D52|Q7Z5U4|Q9H831|Q9H9P6	Silent	SNP	ENST00000356260.5	37	CCDS3573.2																																																																																			0		0.393	SDAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252418.3		NM_018115	
CTD-2044J15.2	0	broad.mit.edu	37	5	6674476	6674477	+	lincRNA	INS	-	-	A	rs571663034		TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr5:6674476_6674477insA	ENST00000606434.1	+	0	3258_3259																											ttaaatctattaaAAAAAAAAC	0.376																																					.													.	.			0			.																																											0	.			ATCTATTAAAAAA																													5.37:g.6674486_6674486dupA			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	1	0.00	0		RNA	INS	ENST00000606434.1	37																																																																																						0.376	CTD-2044J15.2-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000470470.1			
CTNND2	1501	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	11397161	11397161	+	Silent	SNP	C	C	T	rs61749784	byFrequency	TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr5:11397161C>T	ENST00000304623.8	-	6	783	c.594G>A	c.(592-594)acG>acA	p.T198T	CTNND2_ENST00000511377.1_Silent_p.T107T|CTNND2_ENST00000503622.1_Intron|CTNND2_ENST00000458100.2_5'UTR|CTNND2_ENST00000359640.2_Silent_p.T198T	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	198					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.T198T(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						AGCTCTGGCCCGTAGCTCGGG	0.612													C|||	9	0.00179712	0.0068	0.0	5008	,	,		16864	0.0		0.0	False		,,,				2504	0.0				p.T198T													.	.			1	Substitution - coding silent(1)	lung(1)	c.G594A							C		16,4390	23.3+/-48.9	0,16,2187	100.0	101.0	101.0		594	-11.8	0.0	5	dbSNP_129	101	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CTNND2	NM_001332.2		0,17,6486	TT,TC,CC		0.0116,0.3631,0.1307		198/1226	11397161	17,12989	2203	4300	6503	SO:0001819	synonymous_variant	1501	exon6			CTGGCCCGTAGCT	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.594G>A	5.37:g.11397161C>T			Somatic	50	0	0		WXS	Illumina HiSeq	.	63	0.38	24	NM_001332	0		0	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Silent	SNP	ENST00000304623.8	37	CCDS3881.1																																																																																			0.002		0.612	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206999.1		NM_001332	
NKX2-5	1482	broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	172659730	172659730	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr5:172659730C>T	ENST00000329198.4	-	2	1090	c.817G>A	c.(817-819)Gct>Act	p.A273T		NM_001166175.1|NM_001166176.1|NM_004387.3	NP_001159647.1|NP_001159648.1|NP_004378.1	P52952	NKX25_HUMAN	NK2 homeobox 5	273	Ala/Pro-rich.				adult heart development (GO:0007512)|apoptotic process involved in heart morphogenesis (GO:0003278)|atrial cardiac muscle cell development (GO:0055014)|atrial septum morphogenesis (GO:0060413)|atrioventricular node cell development (GO:0060928)|atrioventricular node cell fate commitment (GO:0060929)|BMP signaling pathway (GO:0030509)|bundle of His development (GO:0003166)|canonical Wnt signaling pathway (GO:0060070)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac ventricle formation (GO:0003211)|cell differentiation (GO:0030154)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|hemopoiesis (GO:0030097)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|pharyngeal system development (GO:0060037)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart contraction (GO:0045823)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription via serum response element binding (GO:0010735)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of voltage-gated calcium channel activity (GO:1901387)|proepicardium development (GO:0003342)|pulmonary myocardium development (GO:0003350)|Purkinje myocyte differentiation (GO:0003168)|regulation of cardiac muscle cell proliferation (GO:0060043)|regulation of cardiac muscle contraction (GO:0055117)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|sarcomere organization (GO:0045214)|septum secundum development (GO:0003285)|spleen development (GO:0048536)|thyroid gland development (GO:0030878)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|serum response element binding (GO:0010736)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)	12	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			GCGGGGTAAGCGGCAGTGCAG	0.672																																					p.A273T	Esophageal Squamous(72;810 1219 2387 13420 44943)												.	NKX2-5	42		0			c.G817A												11.0	13.0	12.0					5																	172659730		2196	4286	6482	SO:0001583	missense	0	exon2			GGTAAGCGGCAGT	AB021133	CCDS4387.1, CCDS54949.1, CCDS54950.1	5q34	2014-09-17	2011-06-01	2002-10-04	ENSG00000183072	ENSG00000183072		"""Homeoboxes / ANTP class : NKL subclass"""	2488	protein-coding gene	gene with protein product	"""tinman paralog (Drosophila)"""	600584	"""cardiac-specific homeo box"", ""NK2 transcription factor related, locus 5 (Drosophila)"""	CSX, NKX2E		7665173, 8900537	Standard	NM_004387		Approved	CSX1, NKX2.5, NKX4-1	uc003mcm.2	P52952	OTTHUMG00000130522	ENST00000329198.4:c.817G>A	5.37:g.172659730C>T	ENSP00000327758:p.Ala273Thr		Somatic	88	0.0113636364	1		WXS	Illumina HiSeq	Phase_I	73	0.33	24	NM_004387	0		0	A8K3K0|B4DNB6|E9PBU6	Missense_Mutation	SNP	ENST00000329198.4	37	CCDS4387.1	.	.	.	.	.	.	.	.	.	.	C	7.504	0.653196	0.14580	.	.	ENSG00000183072	ENST00000329198	D	0.90197	-2.63	4.07	4.07	0.47477	.	.	.	.	.	T	0.75917	0.3915	N	0.14661	0.345	0.80722	D	1	P	0.47545	0.897	B	0.32724	0.151	T	0.76572	-0.2910	9	0.09590	T	0.72	.	11.6143	0.51080	0.0:1.0:0.0:0.0	.	273	P52952	NKX25_HUMAN	T	273	ENSP00000327758:A273T	ENSP00000327758:A273T	A	-	1	0	NKX2-5	172592336	0.895000	0.30542	0.787000	0.31911	0.085000	0.17905	1.416000	0.34759	2.083000	0.62718	0.542000	0.68232	GCT			0.672	NKX2-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252942.2			
GPRIN1	114787	broad.mit.edu;mdanderson.org	37	5	176024694	176024694	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr5:176024694A>C	ENST00000303991.4	-	2	2319	c.2142T>G	c.(2140-2142)agT>agG	p.S714R		NM_052899.2	NP_443131.2	Q7Z2K8	GRIN1_HUMAN	G protein regulated inducer of neurite outgrowth 1	714					neuron projection development (GO:0031175)	cell projection (GO:0042995)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCTTCTCCAGACTCAGGGGGA	0.642																																					p.S714R													.	GPRIN1	77		0			c.T2142G												59.0	61.0	60.0					5																	176024694		2203	4300	6503	SO:0001583	missense	114787	exon2			CTCCAGACTCAGG	AB067480	CCDS4405.1	5q35.2	2008-02-05			ENSG00000169258	ENSG00000169258			24835	protein-coding gene	gene with protein product		611239				11572484	Standard	NM_052899		Approved	GRIN1, KIAA1893	uc003meo.1	Q7Z2K8	OTTHUMG00000130659	ENST00000303991.4:c.2142T>G	5.37:g.176024694A>C	ENSP00000305839:p.Ser714Arg		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	33	0.24	8	NM_052899	8	0.13	1	C9JM70|Q8ND74|Q96PZ4	Missense_Mutation	SNP	ENST00000303991.4	37	CCDS4405.1	.	.	.	.	.	.	.	.	.	.	A	11.94	1.788010	0.31593	.	.	ENSG00000169258	ENST00000303991;ENST00000335532	T	0.09445	2.98	4.36	-4.41	0.03590	.	2.270560	0.02154	N	0.058253	T	0.06005	0.0156	N	0.08118	0	0.09310	N	1	B	0.14805	0.011	B	0.17979	0.02	T	0.37641	-0.9697	10	0.30854	T	0.27	4.9054	8.8996	0.35485	0.3636:0.0:0.5221:0.1143	.	714	Q7Z2K8	GRIN1_HUMAN	R	714	ENSP00000305839:S714R	ENSP00000305839:S714R	S	-	3	2	GPRIN1	175957300	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-0.115000	0.10741	-0.584000	0.05913	0.374000	0.22700	AGT			0.642	GPRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253149.1		NM_052899	
HK3	3101	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	5	176316733	176316733	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr5:176316733C>T	ENST00000292432.5	-	7	734	c.643G>A	c.(643-645)Gac>Aac	p.D215N		NM_002115.2	NP_002106.2	P52790	HXK3_HUMAN	hexokinase 3 (white cell)	215	Hexokinase type-1 1.|Regulatory.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|hormone binding (GO:0042562)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCAACCACGTCGATGTTGTAG	0.617																																					p.D215N													.	.			0			c.G643A												144.0	123.0	130.0					5																	176316733		2203	4300	6503	SO:0001583	missense	3101	exon7			CCACGTCGATGTT		CCDS4407.1	5q35.2	2008-02-05			ENSG00000160883	ENSG00000160883	2.7.1.1		4925	protein-coding gene	gene with protein product		142570				8812439	Standard	NM_002115		Approved		uc003mfa.3	P52790	OTTHUMG00000130855	ENST00000292432.5:c.643G>A	5.37:g.176316733C>T	ENSP00000292432:p.Asp215Asn		Somatic	49	0	0		WXS	Illumina HiSeq	.	48	0.15	7	NM_002115	2	0.00	0	Q8N1E7	Missense_Mutation	SNP	ENST00000292432.5	37	CCDS4407.1	.	.	.	.	.	.	.	.	.	.	C	17.84	3.488840	0.64074	.	.	ENSG00000160883	ENST00000292432	D	0.98996	-5.31	5.56	4.62	0.57501	Hexokinase, N-terminal (1);	0.905303	0.09408	N	0.806288	D	0.97964	0.9330	L	0.35288	1.05	0.36177	D	0.849184	D	0.52996	0.957	P	0.51324	0.666	D	0.95436	0.8521	10	0.35671	T	0.21	-2.3086	12.5946	0.56461	0.0:0.9098:0.0:0.0902	.	215	P52790	HXK3_HUMAN	N	215	ENSP00000292432:D215N	ENSP00000292432:D215N	D	-	1	0	HK3	176249339	0.592000	0.26832	0.006000	0.13384	0.231000	0.25187	1.886000	0.39688	1.201000	0.43203	0.462000	0.41574	GAC			0.617	HK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253428.1			
GRK6	2870	hgsc.bcm.edu	37	5	176867681	176867681	+	Intron	SNP	C	C	T	rs372493562		TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr5:176867681C>T	ENST00000355472.5	+	14	1572				GRK6_ENST00000393576.3_Intron|PRR7-AS1_ENST00000511565.1_RNA|PRR7-AS1_ENST00000514846.1_RNA|GRK6_ENST00000528793.1_Intron|GRK6_ENST00000355958.5_Intron|PRR7-AS1_ENST00000425316.3_RNA	NM_001004106.2|NM_002082.3	NP_001004106.1|NP_002073.2	P43250	GRK6_HUMAN	G protein-coupled receptor kinase 6						regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway (GO:0016055)	membrane (GO:0016020)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)			breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(5)|stomach(1)	25	all_cancers(89;1.15e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCTATCTGACCGTTGCCTCTG	0.577																																					.													.	.			0			.							C	,,	3,4403	6.2+/-15.9	0,3,2200	74.0	73.0	73.0		,,	-5.2	0.0	5		73	0,8600		0,0,4300	no	intron,intron,intron	GRK6	NM_001004105.2,NM_001004106.2,NM_002082.3	,,	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	,,	,,	176867681	3,13003	2203	4300	6503	SO:0001627	intron_variant	340037	.			TCTGACCGTTGCC		CCDS34303.1, CCDS43406.1, CCDS47348.1	5q35	2011-01-14	2004-02-04	2004-02-06	ENSG00000198055	ENSG00000198055			4545	protein-coding gene	gene with protein product		600869		GPRK6		8415712	Standard	NM_002082		Approved		uc021yiu.1	P43250	OTTHUMG00000163401	ENST00000355472.5:c.1405-20C>T	5.37:g.176867681C>T			Somatic	82	0	0		WXS	Illumina HiSeq	.	98	0.18	18	.	0		0	O60541|Q13652	RNA	SNP	ENST00000355472.5	37	CCDS34303.1																																																																																					0.577	GRK6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000373204.1		NM_002082	
NUP153	9972	mdanderson.org	37	6	17688695	17688695	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr6:17688695G>A	ENST00000262077.2	-	2	265	c.266C>T	c.(265-267)gCc>gTc	p.A89V	NUP153_ENST00000537253.1_Missense_Mutation_p.A89V	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa	89					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			CTCCTCATCGGCATATACCAG	0.413																																					p.A89V													.	.			0			c.C266T												125.0	118.0	120.0					6																	17688695		2203	4300	6503	SO:0001583	missense	9972	exon2			TCATCGGCATATA	Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.266C>T	6.37:g.17688695G>A	ENSP00000262077:p.Ala89Val		Somatic	99	0.0101010101	1		WXS	Illumina HiSeq	Phase_I	133	0.04	5	NM_005124	105	0.00	0	B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Missense_Mutation	SNP	ENST00000262077.2	37	CCDS4541.1	.	.	.	.	.	.	.	.	.	.	G	1.629	-0.519594	0.04171	.	.	ENSG00000124789	ENST00000262077;ENST00000430136;ENST00000537253	T;T	0.06608	3.29;3.28	5.37	2.54	0.30619	.	0.794432	0.10937	N	0.617747	T	0.00496	0.0016	N	0.01048	-1.04	0.09310	N	1	B;B;B	0.11235	0.004;0.002;0.0	B;B;B	0.11329	0.006;0.003;0.002	T	0.44847	-0.9301	10	0.12103	T	0.63	0.2509	3.5064	0.07692	0.1519:0.1326:0.5788:0.1367	.	89;111;89	F6QR24;Q4LE47;P49790	.;.;NU153_HUMAN	V	89;111;89	ENSP00000262077:A89V;ENSP00000444029:A89V	ENSP00000262077:A89V	A	-	2	0	NUP153	17796674	0.063000	0.20901	0.000000	0.03702	0.002000	0.02628	1.229000	0.32600	0.206000	0.20587	-0.145000	0.13849	GCC			0.413	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039953.1			
BTN2A3P	54718	hgsc.bcm.edu;broad.mit.edu	37	6	26422353	26422353	+	RNA	SNP	C	C	T	rs571530750	byFrequency	TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr6:26422353C>T	ENST00000466808.2	+	0	7							Q96KV6	BT2A3_HUMAN	butyrophilin, subfamily 2, member A3, pseudogene							integral component of membrane (GO:0016021)		p.P3S(2)									GCTCATGGAACCAGCTGCTGC	0.622													C|||	7	0.00139776	0.0023	0.0	5008	,	,		16376	0.001		0.0	False		,,,				2504	0.0031				.													BTN2A3,NS,carcinoma,0,9	BTN2A3	0	9	2	Substitution - Missense(2)	endometrium(1)|kidney(1)	.																																											54718	.			ATGGAACCAGCTG	AL021917		6p22.1	2014-01-14	2011-09-06	2011-09-06	ENSG00000124549	ENSG00000124549		"""Butyrophilins"""	13229	pseudogene	pseudogene		613592	"""butyrophilin, subfamily 2, member A3"""	BTN2A3			Standard	NR_027795		Approved	BTN2.3	uc011dkl.1	Q96KV6	OTTHUMG00000014453		6.37:g.26422353C>T			Somatic	81	0.012345679	1		WXS	Illumina HiSeq	.	114	0.09	10	.	2	0.00	0	A6NEF4	RNA	SNP	ENST00000466808.2	37																																																																																						0.622	BTN2A3P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000040118.4		NR_027795	
KLHDC3	116138	broad.mit.edu	37	6	42985386	42985386	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr6:42985386G>T	ENST00000326974.4	+	3	479	c.284G>T	c.(283-285)cGg>cTg	p.R95L	KLHDC3_ENST00000244670.8_5'UTR|KLHDC3_ENST00000332245.8_Intron	NM_057161.3	NP_476502.1	Q9BQ90	KLDC3_HUMAN	kelch domain containing 3	95					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|reciprocal meiotic recombination (GO:0007131)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)	chromatin binding (GO:0003682)			cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9			Colorectal(64;0.00237)|all cancers(41;0.0034)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0539)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			TGGGGCGGGCGGAATGACACC	0.562																																					p.R95L													.	KLHDC3	23		0			c.G284T												75.0	74.0	74.0					6																	42985386		2203	4300	6503	SO:0001583	missense	116138	exon3			GCGGGCGGAATGA	AB055925	CCDS4880.1	6p21.1	2003-06-12			ENSG00000124702	ENSG00000124702			20704	protein-coding gene	gene with protein product		611248				12444059, 12606021	Standard	NM_057161		Approved	PEAS, hPeas, dJ20C7.3	uc003otl.3	Q9BQ90	OTTHUMG00000014714	ENST00000326974.4:c.284G>T	6.37:g.42985386G>T	ENSP00000313995:p.Arg95Leu		Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	105	0.05	5	NM_057161	362	0.00	0	A8K2W9	Missense_Mutation	SNP	ENST00000326974.4	37	CCDS4880.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.787467	0.90367	.	.	ENSG00000124702	ENST00000326974;ENST00000432243;ENST00000394096;ENST00000426116	T	0.64085	-0.08	5.4	5.4	0.78164	Kelch-type beta propeller (1);	0.059263	0.64402	D	0.000002	T	0.74726	0.3754	M	0.66297	2.02	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72075	0.968;0.976	T	0.75331	-0.3355	10	0.59425	D	0.04	.	19.5531	0.95330	0.0:0.0:1.0:0.0	.	95;95	E7ENU0;Q9BQ90	.;KLDC3_HUMAN	L	95;95;95;68	ENSP00000313995:R95L	ENSP00000313995:R95L	R	+	2	0	KLHDC3	43093364	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	9.271000	0.95698	2.701000	0.92244	0.655000	0.94253	CGG			0.562	KLHDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040570.1		NM_057161	
PKHD1	5314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	51512912	51512912	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr6:51512912C>T	ENST00000371117.3	-	63	11590	c.11315G>A	c.(11314-11316)cGa>cAa	p.R3772Q		NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	3772					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CTCTACTCTTCGATTCTAGAA	0.413																																					p.R3772Q													.	.			0			c.G11315A												86.0	88.0	88.0					6																	51512912		2203	4300	6503	SO:0001583	missense	5314	exon63			ACTCTTCGATTCT	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.11315G>A	6.37:g.51512912C>T	ENSP00000360158:p.Arg3772Gln		Somatic	81	0	0		WXS	Illumina HiSeq	.	80	0.26	21	NM_138694	0		0	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	C	13.41	2.228756	0.39399	.	.	ENSG00000170927	ENST00000371117	D	0.85556	-2.0	5.24	1.46	0.22682	.	0.641631	0.14441	N	0.319411	T	0.52435	0.1734	N	0.20401	0.57	0.53005	D	0.999969	B	0.22480	0.07	B	0.11329	0.006	T	0.32955	-0.9887	10	0.15499	T	0.54	.	7.7819	0.29070	0.0:0.5695:0.0:0.4305	.	3772	P08F94	PKHD1_HUMAN	Q	3772	ENSP00000360158:R3772Q	ENSP00000360158:R3772Q	R	-	2	0	PKHD1	51620871	0.004000	0.15560	0.942000	0.38095	0.848000	0.48234	-0.869000	0.04232	-0.023000	0.13963	0.650000	0.86243	CGA			0.413	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000040893.1		NM_138694	
IRAK1BP1	134728	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	79577463	79577463	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr6:79577463G>A	ENST00000369940.2	+	1	275	c.170G>A	c.(169-171)gGc>gAc	p.G57D		NM_001010844.2	NP_001010844.1	Q5VVH5	IKBP1_HUMAN	interleukin-1 receptor-associated kinase 1 binding protein 1	57	Intrinsically disordered.				I-kappaB kinase/NF-kappaB signaling (GO:0007249)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(3)	12		all_cancers(76;0.0398)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)		BRCA - Breast invasive adenocarcinoma(397;0.21)		CAAGTAAGCGGCACCTCAGAA	0.637																																					p.G57D													.	IRAK1BP1	18		0			c.G170A												40.0	40.0	40.0					6																	79577463		2203	4300	6503	SO:0001583	missense	134728	exon1			TAAGCGGCACCTC	AI478629	CCDS34488.1	6q14-q15	2006-04-12				ENSG00000146243			17368	protein-coding gene	gene with protein product		615375				11096118	Standard	XM_005248654		Approved	AIP70, SIMPL	uc003pim.4	Q5VVH5		ENST00000369940.2:c.170G>A	6.37:g.79577463G>A	ENSP00000358956:p.Gly57Asp		Somatic	96	0.0104166667	1		WXS	Illumina HiSeq	Phase_I	87	0.30	26	NM_001010844	7	0.43	3		Missense_Mutation	SNP	ENST00000369940.2	37	CCDS34488.1	.	.	.	.	.	.	.	.	.	.	G	17.07	3.296133	0.60086	.	.	ENSG00000146243	ENST00000369940	.	.	.	4.35	4.35	0.52113	.	0.000000	0.85682	D	0.000000	T	0.71550	0.3353	M	0.69823	2.125	0.51767	D	0.999937	D	0.89917	1.0	D	0.97110	1.0	T	0.72760	-0.4196	8	.	.	.	-6.7271	14.408	0.67096	0.0:0.0:1.0:0.0	.	57	Q5VVH5	IKBP1_HUMAN	D	57	.	.	G	+	2	0	IRAK1BP1	79634182	1.000000	0.71417	0.784000	0.31847	0.146000	0.21551	3.842000	0.55858	2.225000	0.72522	0.561000	0.74099	GGC			0.637	IRAK1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041296.2		XM_059729	
OPRM1	4988	mdanderson.org	37	6	154428665	154428665	+	Intron	SNP	G	G	A			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr6:154428665G>A	ENST00000330432.7	+	4	1401				OPRM1_ENST00000337049.4_Intron|OPRM1_ENST00000434900.2_Intron|OPRM1_ENST00000518759.1_Intron|OPRM1_ENST00000524163.1_Intron|OPRM1_ENST00000520708.1_Intron|OPRM1_ENST00000414028.2_Intron|OPRM1_ENST00000522555.1_Intron|OPRM1_ENST00000522236.1_Intron|OPRM1_ENST00000452687.2_Intron|OPRM1_ENST00000435918.2_Intron|OPRM1_ENST00000419506.2_Silent_p.G410G	NM_000914.3	NP_000905.3	P35372	OPRM_HUMAN	opioid receptor, mu 1						adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral response to ethanol (GO:0048149)|calcium ion transmembrane transport (GO:0070588)|cellular response to stress (GO:0033554)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|locomotory behavior (GO:0007626)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of Wnt protein secretion (GO:0061358)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neurogenesis (GO:0050769)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-endorphin receptor activity (GO:0004979)|G-protein alpha-subunit binding (GO:0001965)|G-protein coupled receptor activity (GO:0004930)|morphine receptor activity (GO:0038047)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	33		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Alvimopan(DB06274)|Amitriptyline(DB00321)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Ethylmorphine(DB01466)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Methylnaltrexone(DB06800)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Ondansetron(DB00904)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Pethidine(DB00454)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	acaatgcagggcagtctccat	0.408																																					p.G410G													.	.			0			c.G1230A												140.0	130.0	133.0					6																	154428665		692	1591	2283	SO:0001627	intron_variant	4988	exon4			TGCAGGGCAGTCT	L29301	CCDS43517.1, CCDS43518.1, CCDS47503.1, CCDS47504.1, CCDS47505.1, CCDS47506.1, CCDS47507.1, CCDS47508.1, CCDS55071.1, CCDS55068.1, CCDS55069.1, CCDS55070.1	6q24-q25	2012-08-08			ENSG00000112038	ENSG00000112038		"""GPCR / Class A : Opioid receptors"""	8156	protein-coding gene	gene with protein product		600018					Standard	NM_001145285		Approved	MOR1	uc003qpo.1	P35372	OTTHUMG00000015870	ENST00000330432.7:c.1165-11153G>A	6.37:g.154428665G>A			Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	53	0.06	3	NM_001145286	0		0	B0FXJ1|B2R9S7|B8Q1L7|B8Q1L8|B8Q1L9|E7EWZ3|G8XRH6|G8XRH8|Q12930|Q4VWM1|Q4VWM2|Q4VWM3|Q4VWM4|Q4VWM6|Q4VWX6|Q5TDA1|Q6UPP1|Q6UQ80|Q7Z2D8|Q86V80|Q8IWW3|Q8IWW4|Q9UCZ4|Q9UN57	Silent	SNP	ENST00000330432.7	37	CCDS55070.1																																																																																					0.408	OPRM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000042786.2		NM_000914	
RABGEF1	27342	ucsc.edu	37	7	66270306	66270306	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr7:66270306A>G	ENST00000284957.5	+	8	1077	c.1000A>G	c.(1000-1002)Aat>Gat	p.N334D	RABGEF1_ENST00000439720.2_Missense_Mutation_p.N347D|RABGEF1_ENST00000484547.2_3'UTR|RABGEF1_ENST00000450873.2_Missense_Mutation_p.N334D|KCTD7_ENST00000380828.2_Missense_Mutation_p.N374D|RABGEF1_ENST00000437078.2_Missense_Mutation_p.N348D|KCTD7_ENST00000451741.2_Missense_Mutation_p.N334D|KCTD7_ENST00000510829.2_Missense_Mutation_p.N334D			Q9UJ41	RABX5_HUMAN	RAB guanine nucleotide exchange factor (GEF) 1	551					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein targeting to membrane (GO:0006612)	early endosome (GO:0005769)	DNA binding (GO:0003677)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|stomach(1)	27						CCTTCAGTCTAATATCCAGTA	0.502																																					p.N334D													.	RABGEF1	56		0			c.A1000G												112.0	97.0	102.0					7																	66270306		2203	4300	6503	SO:0001583	missense	27342	exon8			CAGTCTAATATCC	AJ250042	CCDS5535.1, CCDS69308.1, CCDS75610.1	7q11.21	2010-07-09			ENSG00000154710	ENSG00000154710			17676	protein-coding gene	gene with protein product		609700				12505986, 11098082	Standard	NM_014504		Approved	rabex-5, RABEX5	uc003tvh.3	Q9UJ41	OTTHUMG00000129547	ENST00000284957.5:c.1000A>G	7.37:g.66270306A>G	ENSP00000284957:p.Asn334Asp		Somatic	87	0	0		RNA-Seq	Illumina HiSeq		163	0.02	4	NM_014504	119	0.12	14	B4DZM7|Q3HKR2|Q3HKR3|Q53FG0	Missense_Mutation	SNP	ENST00000284957.5	37	CCDS5535.1	.	.	.	.	.	.	.	.	.	.	A	33	5.281764	0.95489	.	.	ENSG00000243335;ENSG00000243335;ENSG00000243335;ENSG00000243335;ENSG00000243335;ENSG00000154710;ENSG00000154710;ENSG00000154710;ENSG00000154710	ENST00000380827;ENST00000380828;ENST00000510829;ENST00000451741;ENST00000539561;ENST00000284957;ENST00000450873;ENST00000439720;ENST00000437078	T;T;T;T;T;T;T	0.35973	1.28;1.28;1.28;1.28;1.28;1.28;1.28	5.6	5.6	0.85130	Vacuolar sorting protein 9, subgroup (1);Vacuolar sorting protein 9 (2);	0.000000	0.85682	D	0.000000	T	0.61060	0.2317	M	0.78801	2.425	0.80722	D	1	D;D;P	0.69078	0.997;0.997;0.95	D;D;D	0.71870	0.975;0.954;0.962	T	0.66217	-0.5979	10	0.87932	D	0	-21.4594	14.9658	0.71193	1.0:0.0:0.0:0.0	.	348;168;551	B4DZM7;B3KMF1;Q9UJ41	.;.;RABX5_HUMAN	D	418;374;334;334;250;334;334;347;348	ENSP00000370208:N374D;ENSP00000421124:N334D;ENSP00000398177:N334D;ENSP00000284957:N334D;ENSP00000415815:N334D;ENSP00000403429:N347D;ENSP00000390480:N348D	ENSP00000370207:N418D	N	+	1	0	RABGEF1;KCTD7	65907741	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.802000	0.91910	2.135000	0.66039	0.533000	0.62120	AAT			0.502	RABGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251737.3	rescued with RNA-seq	NM_014504	
GTF2IRD2P1	401375	broad.mit.edu	37	7	72663998	72663998	+	RNA	SNP	T	T	G			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr7:72663998T>G	ENST00000425256.1	-	0	902									GTF2I repeat domain containing 2 pseudogene 1																		ATAGCCGGGGTCCTTGAATAC	0.488																																					.													.	.			0			.																																											0	.			CCGGGGTCCTTGA	AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72663998T>G			Somatic	100	0.01	1		WXS	Illumina HiSeq	Phase_I	187	0.03	6	.	0		0		RNA	SNP	ENST00000425256.1	37																																																																																						0.488	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000345921.1		NR_002164	
SRPK2	6733	broad.mit.edu	37	7	104844187	104844187	+	Silent	SNP	C	C	T	rs150640356		TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr7:104844187C>T	ENST00000393651.3	-	3	204	c.117G>A	c.(115-117)ccG>ccA	p.P39P	SRPK2_ENST00000489828.1_Silent_p.P28P|SRPK2_ENST00000357311.3_Silent_p.P28P	NM_182692.1	NP_872634.1			SRSF protein kinase 2											NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(11)|large_intestine(6)|lung(4)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	35						gtggtggtggcggtggAGGAG	0.552																																					p.P39P													.	SRPK2	76		0			c.G117A							C	,	1,4405	2.1+/-5.4	0,1,2202	51.0	46.0	47.0		84,117	-8.9	0.0	7	dbSNP_134	47	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	SRPK2	NM_182691.1,NM_182692.1	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	28/689,39/700	104844187	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	6733	exon3			TGGTGGCGGTGGA	U88666	CCDS5735.1, CCDS34724.1	7q22-q31.1	2010-06-23	2010-06-23		ENSG00000135250	ENSG00000135250			11306	protein-coding gene	gene with protein product	"""SR protein kinase 2"", ""serine/arginine-rich splicing factor kinase 2"""	602980	"""SFRS protein kinase 2"""			8208298, 9472028	Standard	NM_182692		Approved	SFRSK2	uc003vcv.4	P78362	OTTHUMG00000157405	ENST00000393651.3:c.117G>A	7.37:g.104844187C>T			Somatic	74	0.0135135135	1		WXS	Illumina HiSeq	Phase_I	117	0.05	6	NM_182692	83	0.00	0		Silent	SNP	ENST00000393651.3	37	CCDS34724.1																																																																																					0.552	SRPK2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000348723.1		NM_182691	
XRCC2	7516	broad.mit.edu;mdanderson.org	37	7	152357797	152357797	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr7:152357797G>T	ENST00000359321.1	-	2	195	c.110C>A	c.(109-111)tCa>tAa	p.S37*	XRCC2_ENST00000495707.1_5'UTR	NM_005431.1	NP_005422.1	O43543	XRCC2_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 2	37					centrosome organization (GO:0051297)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|in utero embryonic development (GO:0001701)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of neurogenesis (GO:0050769)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|strand invasion (GO:0042148)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Rad51B-Rad51C-Rad51D-XRCC2 complex (GO:0033063)|replication fork (GO:0005657)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)			NS(1)|breast(1)|large_intestine(5)|liver(1)|lung(1)|prostate(2)	11		all_hematologic(28;0.0592)|Prostate(32;0.081)	OV - Ovarian serous cystadenocarcinoma(82;0.0423)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0429)		ATGCACAGGTGAATCTTCATC	0.333								Homologous recombination																													p.S37X													.	XRCC2	30		0			c.C110A												65.0	72.0	70.0					7																	152357797		2203	4300	6503	SO:0001587	stop_gained	7516	exon2			ACAGGTGAATCTT	Y08837	CCDS5933.1	7q36	2006-05-04			ENSG00000196584	ENSG00000196584			12829	protein-coding gene	gene with protein product	"""RAD51-like"""	600375				7607692, 10422536	Standard	NM_005431		Approved		uc003wld.3	O43543	OTTHUMG00000151470	ENST00000359321.1:c.110C>A	7.37:g.152357797G>T	ENSP00000352271:p.Ser37*		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	80	0.06	5	NM_005431	47	0.00	0	B2R925	Nonsense_Mutation	SNP	ENST00000359321.1	37	CCDS5933.1	.	.	.	.	.	.	.	.	.	.	G	36	5.684706	0.96784	.	.	ENSG00000196584	ENST00000359321	.	.	.	4.98	3.13	0.36017	.	0.376195	0.26251	N	0.025460	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-4.878	6.6122	0.22757	0.0921:0.0:0.7281:0.1798	.	.	.	.	X	37	.	ENSP00000352271:S37X	S	-	2	0	XRCC2	151988730	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	1.393000	0.34497	1.061000	0.40601	0.563000	0.77884	TCA			0.333	XRCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000322783.1		NM_005431	
WRN	7486	hgsc.bcm.edu	37	8	30945390	30945390	+	Missense_Mutation	SNP	A	A	T	rs149565907	byFrequency	TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr8:30945390A>T	ENST00000298139.5	+	12	1779	c.1530A>T	c.(1528-1530)gaA>gaT	p.E510D		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	510	Poly-Glu.				aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)			central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		aagaagaagaagatgatgaaa	0.373			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome				A|||	19	0.00379393	0.0	0.0	5008	,	,		18765	0.0169		0.0	False		,,,				2504	0.002				p.E510D	Ovarian(18;161 598 2706 14834 27543)		yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	WRN,NS,carcinoma,0,1	WRN	0	1	0			c.A1530T							A	ASP/GLU	0,4406		0,0,2203	76.0	72.0	73.0		1530		0.9	8	dbSNP_134	73	1,8599	1.2+/-3.3	0,1,4299	yes	missense	WRN	NM_000553.4	45	0,1,6502	TT,TA,AA		0.0116,0.0,0.0077	benign	510/1433	30945390	1,13005	2203	4300	6503	SO:0001583	missense	7486	exon12	Familial Cancer Database	WS, Adult Progeria	AGAAGAAGATGAT		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.1530A>T	8.37:g.30945390A>T	ENSP00000298139:p.Glu510Asp		Somatic	53	0	0		WXS	Illumina HiSeq	.	62	0.05	3	NM_000553	20	0.00	0	A1KYY9	Missense_Mutation	SNP	ENST00000298139.5	37	CCDS6082.1	5	0.0022893772893772895	0	0.0	0	0.0	5	0.008741258741258742	0	0.0	A	0.001	-3.733300	0.00005	0.0	1.16E-4	ENSG00000165392	ENST00000298139	T	0.43688	0.94	.	.	.	.	0.540108	0.15136	N	0.278577	T	0.05044	0.0135	N	0.00621	-1.32	0.09310	N	0.999991	B	0.02656	0.0	B	0.01281	0.0	T	0.13282	-1.0515	8	0.02654	T	1	-5.6664	.	.	.	.	510	Q14191	WRN_HUMAN	D	510	ENSP00000298139:E510D	ENSP00000298139:E510D	E	+	3	2	WRN	31064932	0.898000	0.30612	0.889000	0.34880	0.359000	0.29487	-0.189000	0.09629	-1.869000	0.01141	-1.957000	0.00481	GAA	0.001		0.373	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000376248.1			
YTHDF3	253943	broad.mit.edu	37	8	64099415	64099415	+	Silent	SNP	A	A	G			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr8:64099415A>G	ENST00000539294.1	+	4	1159	c.843A>G	c.(841-843)aaA>aaG	p.K281K	YTHDF3_ENST00000521674.1_3'UTR|YTHDF3_ENST00000542911.2_Silent_p.K92K|YTHDF3_ENST00000517371.1_Intron	NM_001277817.1|NM_001277818.1|NM_152758.4	NP_001264746.1|NP_001264747.1|NP_689971.4	Q7Z739	YTHD3_HUMAN	YTH domain family, member 3	282							N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)					Breast(64;0.0716)	all_cancers(86;0.169)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.146)	BRCA - Breast invasive adenocarcinoma(89;0.161)			GGGATGAAAAAGGGTCAGTGG	0.463																																					.													.	YTHDF3	13		0			.												61.0	66.0	64.0					8																	64099415		1952	4150	6102	SO:0001819	synonymous_variant	253943	.			TGAAAAAGGGTCA	BC052970	CCDS75747.1, CCDS75748.1, CCDS75749.1	8q12.3	2013-06-07	2004-11-16		ENSG00000185728	ENSG00000185728			26465	protein-coding gene	gene with protein product			"""YTH domain family 3"""			12477932	Standard	NM_152758		Approved	FLJ31657	uc003xuz.4	Q7Z739	OTTHUMG00000164369	ENST00000539294.1:c.843A>G	8.37:g.64099415A>G			Somatic	139	0.0143884892	2		WXS	Illumina HiSeq	Phase_I	152	0.02	3	.	130	0.00	0	B3KXL4|Q63Z37|Q659A3	Silent	SNP	ENST00000539294.1	37																																																																																						0.463	YTHDF3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_152758	
MAPK15	225689	broad.mit.edu	37	8	144803971	144803971	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr8:144803971C>T	ENST00000338033.4	+	13	1498	c.1379C>T	c.(1378-1380)gCg>gTg	p.A460V	RP11-429J17.5_ENST00000527908.1_RNA	NM_139021.2	NP_620590.2	Q8TD08	MK15_HUMAN	mitogen-activated protein kinase 15	460					MAPK cascade (GO:0000165)|negative regulation of DNA replication (GO:0008156)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|response to estradiol (GO:0032355)	extracellular region (GO:0005576)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|SH3 domain binding (GO:0017124)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|stomach(1)	12	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			TCCCAGGCTGCGGCTCAGGTG	0.687																																					p.A460V													MAPK15,bladder,carcinoma,-1,1	MAPK15	32	1	0			c.C1379T												36.0	46.0	42.0					8																	144803971		2003	4138	6141	SO:0001583	missense	225689	exon13			AGGCTGCGGCTCA	AY065978	CCDS6409.2	8q24.3	2011-06-09			ENSG00000181085	ENSG00000181085		"""Mitogen-activated protein kinase cascade / Kinases"""	24667	protein-coding gene	gene with protein product	"""extracellular signal regulated kinase 8"""					11875070	Standard	XM_006716528		Approved	ERK8, ERK7	uc003yzj.3	Q8TD08	OTTHUMG00000146450	ENST00000338033.4:c.1379C>T	8.37:g.144803971C>T	ENSP00000337691:p.Ala460Val		Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	87	0.03	3	NM_139021	3	0.00	0	Q2TCF9|Q8N362	Missense_Mutation	SNP	ENST00000338033.4	37	CCDS6409.2	.	.	.	.	.	.	.	.	.	.	c	3.609	-0.080014	0.07141	.	.	ENSG00000181085	ENST00000338033	T	0.73681	-0.77	3.23	1.34	0.21922	.	0.646760	0.13722	U	0.367328	T	0.49064	0.1535	N	0.14661	0.345	0.09310	N	0.999998	B	0.25312	0.123	B	0.15484	0.013	T	0.27297	-1.0078	10	0.31617	T	0.26	-9.8294	2.0728	0.03618	0.1985:0.4874:0.1941:0.12	.	460	Q8TD08	MK15_HUMAN	V	460	ENSP00000337691:A460V	ENSP00000337691:A460V	A	+	2	0	MAPK15	144875959	0.002000	0.14202	0.014000	0.15608	0.007000	0.05969	0.549000	0.23329	0.082000	0.17018	-0.676000	0.03789	GCG			0.687	MAPK15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000300348.1		NM_139021	
GNAQ	2776	mdanderson.org	37	9	80537095	80537095	+	Nonsense_Mutation	SNP	G	G	T	rs200106152		TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr9:80537095G>T	ENST00000286548.4	-	2	525	c.303C>A	c.(301-303)taC>taA	p.Y101*		NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	101					action potential (GO:0001508)|activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|developmental pigmentation (GO:0048066)|embryonic digit morphogenesis (GO:0042733)|forebrain neuron development (GO:0021884)|glutamate receptor signaling pathway (GO:0007215)|heart development (GO:0007507)|maternal behavior (GO:0042711)|negative regulation of protein kinase activity (GO:0006469)|neuron remodeling (GO:0016322)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|post-embryonic development (GO:0009791)|protein stabilization (GO:0050821)|regulation of catenin import into nucleus (GO:0035412)|regulation of melanocyte differentiation (GO:0045634)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)			NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302						GCTCATACTTGTATGGGATCT	0.473			Mis		uveal melanoma																																p.Y101X				Dom	yes		9	9q21	2776	"""guanine nucleotide binding protein (G protein), q polypeptide"""		E	.	.			0			c.C303A												202.0	163.0	176.0					9																	80537095		2203	4300	6503	SO:0001587	stop_gained	2776	exon2			ATACTTGTATGGG		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052			4390	protein-coding gene	gene with protein product		600998				8825633	Standard	NM_002072		Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.303C>A	9.37:g.80537095G>T	ENSP00000286548:p.Tyr101*		Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	71	0.06	4	NM_002072	18	0.00	0	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	Nonsense_Mutation	SNP	ENST00000286548.4	37	CCDS6658.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	39	7.470181	0.98302	.	.	ENSG00000156052	ENST00000286548;ENST00000411677	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.877	0.96880	0.0:0.0:1.0:0.0	.	.	.	.	X	101;72	.	ENSP00000286548:Y101X	Y	-	3	2	GNAQ	79726915	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.743000	0.68655	2.696000	0.92011	0.650000	0.86243	TAC	0		0.473	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052761.1		NM_002072	
SPATA31D1	389763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	84609192	84609192	+	Silent	SNP	G	G	A			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr9:84609192G>A	ENST00000344803.2	+	4	3854	c.3807G>A	c.(3805-3807)aaG>aaA	p.K1269K		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1269					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TGGCACAGAAGCAGGAGCCCA	0.537																																					p.K1269K													.	.			0			c.G3807A												93.0	92.0	92.0					9																	84609192		2001	4175	6176	SO:0001819	synonymous_variant	389763	exon4			ACAGAAGCAGGAG		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.3807G>A	9.37:g.84609192G>A			Somatic	56	0	0		WXS	Illumina HiSeq	.	85	0.34	29	NM_001001670	0		0		Silent	SNP	ENST00000344803.2	37	CCDS47986.1																																																																																					0.537	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000402325.1		NM_001001670	
FAM206A	54942	broad.mit.edu	37	9	111696846	111696846	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr9:111696846G>T	ENST00000322940.6	+	1	385		c.e1+1		FAM206A_ENST00000374624.3_Splice_Site|FAM206A_ENST00000466200.1_Splice_Site|IKBKAP_ENST00000374647.5_5'Flank|IKBKAP_ENST00000537196.1_5'Flank	NM_017832.3	NP_060302.1	Q9NX38	F206A_HUMAN	family with sequence similarity 206, member A							nucleus (GO:0005634)											TACAAACCGGGTAAGTGCGGA	0.617																																					.													.	.			0			c.79+1G>T												67.0	47.0	54.0					9																	111696846		2203	4300	6503	SO:0001630	splice_region_variant	54942	exon1			AACCGGGTAAGTG	BC015795	CCDS6774.1	9q31	2011-08-15	2011-08-15	2011-08-15	ENSG00000119328	ENSG00000119328			1364	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 6"""	C9orf6			Standard	NM_017832		Approved	CG-8, FLJ20457	uc004bdn.3	Q9NX38	OTTHUMG00000020467	ENST00000322940.6:c.79+1G>T	9.37:g.111696846G>T			Somatic	189	0	0		WXS	Illumina HiSeq	Phase_I	188	0.03	5	NM_017832	0		0	Q5JTR0|Q5JTR1	Splice_Site	SNP	ENST00000322940.6	37	CCDS6774.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.716823	0.89205	.	.	ENSG00000119328	ENST00000322940;ENST00000374624;ENST00000445175	.	.	.	5.26	4.36	0.52297	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.0054	0.41953	0.0942:0.0:0.9058:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C9orf6	110736667	1.000000	0.71417	0.909000	0.35828	0.751000	0.42716	7.251000	0.78297	1.357000	0.45904	0.655000	0.94253	.			0.617	FAM206A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053582.1		NM_017832	Intron
TRIM32	22954	mdanderson.org	37	9	119460603	119460603	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr9:119460603G>T	ENST00000450136.1	+	2	743	c.582G>T	c.(580-582)agG>agT	p.R194S	TRIM32_ENST00000373983.2_Missense_Mutation_p.R194S|ASTN2_ENST00000361477.3_Intron|ASTN2_ENST00000313400.4_Intron|ASTN2_ENST00000361209.2_Intron|ASTN2_ENST00000373996.3_Intron	NM_001099679.1|NM_012210.3	NP_001093149.1|NP_036342.2	Q13049	TRI32_HUMAN	tripartite motif containing 32	194					fat cell differentiation (GO:0045444)|innate immune response (GO:0045087)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of proteolysis (GO:0045862)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of type I interferon production (GO:0032479)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|striated muscle myosin thick filament (GO:0005863)	ligase activity (GO:0016874)|myosin binding (GO:0017022)|protein self-association (GO:0043621)|RNA binding (GO:0003723)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|translation initiation factor binding (GO:0031369)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	26						AGGAGCGCAGGGTCCAGGATG	0.557																																					p.R194S	Esophageal Squamous(92;212 1916 19711 26951)												.	.			0			c.G582T												60.0	61.0	61.0					9																	119460603		2203	4300	6503	SO:0001583	missense	22954	exon2			GCGCAGGGTCCAG	U18543	CCDS6817.1	9q33.1	2014-09-17	2011-01-25		ENSG00000119401	ENSG00000119401		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16380	protein-coding gene	gene with protein product		602290	"""limb girdle muscular dystrophy 2H (autosomal recessive)"", ""tripartite motif-containing 32"""	LGMD2H		11331580, 7778269, 16606853	Standard	NM_001099679		Approved	HT2A, TATIP, BBS11	uc004bjx.2	Q13049	OTTHUMG00000021026	ENST00000450136.1:c.582G>T	9.37:g.119460603G>T	ENSP00000408292:p.Arg194Ser		Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_012210	17	0.00	0	Q9NQP8	Missense_Mutation	SNP	ENST00000450136.1	37	CCDS6817.1	.	.	.	.	.	.	.	.	.	.	G	6.107	0.387936	0.11581	.	.	ENSG00000119401	ENST00000450136;ENST00000373983	T;T	0.68181	-0.31;-0.31	5.36	3.43	0.39272	.	0.145674	0.38605	N	0.001625	T	0.46054	0.1373	N	0.24115	0.695	0.32813	D	0.501706	B	0.10296	0.003	B	0.08055	0.003	T	0.43750	-0.9372	9	.	.	.	-17.6144	6.2533	0.20859	0.1712:0.1509:0.6779:0.0	.	194	Q13049	TRI32_HUMAN	S	194	ENSP00000408292:R194S;ENSP00000363095:R194S	.	R	+	3	2	TRIM32	118500424	1.000000	0.71417	0.978000	0.43139	0.952000	0.60782	1.238000	0.32707	0.527000	0.28560	0.655000	0.94253	AGG			0.557	TRIM32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055466.2		NM_012210	
DENND1A	57706	broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	126144051	126144051	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chr9:126144051C>T	ENST00000373624.2	-	22	2891	c.2690G>A	c.(2689-2691)gGc>gAc	p.G897D	DENND1A_ENST00000394219.3_Missense_Mutation_p.G908D|DENND1A_ENST00000542603.1_Missense_Mutation_p.G682D|DENND1A_ENST00000473039.1_5'UTR	NM_020946.1	NP_065997.1	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A	897	Pro-rich.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|regulation of Rab protein signal transduction (GO:0032483)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|liver(2)|lung(18)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43						GGGCATCTGGCCAAAGAGGTT	0.667																																					p.G897D													.	DENND1A	112		0			c.G2690A												6.0	7.0	7.0					9																	126144051		2086	4141	6227	SO:0001583	missense	57706	exon22			ATCTGGCCAAAGA	AB046828	CCDS35133.1, CCDS35134.1	9q34.11	2012-10-03	2005-08-17	2005-08-17	ENSG00000119522	ENSG00000119522		"""DENN/MADD domain containing"""	29324	protein-coding gene	gene with protein product		613633	"""KIAA1608"""	KIAA1608		10997877	Standard	XM_005252109		Approved	FLJ21129, FAM31A	uc004bnz.1	Q8TEH3	OTTHUMG00000020643	ENST00000373624.2:c.2690G>A	9.37:g.126144051C>T	ENSP00000362727:p.Gly897Asp		Somatic	184	0.0054347826	1		WXS	Illumina HiSeq	Phase_I	173	0.16	28	NM_020946	8	0.13	1	A8MZA3|B1AM80|B7Z3C8|B7Z669|D3PFD3|Q05C88|Q5VWF0|Q6PJZ5|Q8IVD6|Q9H796	Missense_Mutation	SNP	ENST00000373624.2	37	CCDS35133.1	.	.	.	.	.	.	.	.	.	.	C	18.23	3.577013	0.65878	.	.	ENSG00000119522	ENST00000373624;ENST00000542603;ENST00000394219	T;T;T	0.27557	3.1;1.66;2.96	4.79	4.79	0.61399	.	0.143568	0.46145	D	0.000301	T	0.42607	0.1210	L	0.34521	1.04	0.80722	D	1	D;D;D;D	0.69078	0.997;0.997;0.986;0.976	D;D;P;P	0.65443	0.913;0.935;0.722;0.601	T	0.35574	-0.9783	10	0.62326	D	0.03	-20.8296	14.3736	0.66857	0.0:0.8515:0.1485:0.0	.	908;898;897;760	Q8TEH3-6;Q8TEH3-7;Q8TEH3;Q9HCG4	.;.;DEN1A_HUMAN;.	D	897;682;908	ENSP00000362727:G897D;ENSP00000437457:G682D;ENSP00000377766:G908D	ENSP00000362727:G897D	G	-	2	0	DENND1A	125183872	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	3.983000	0.56916	2.222000	0.72286	0.555000	0.69702	GGC			0.667	DENND1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000053997.1		NM_024820	
MAGEB10	139422	mdanderson.org	37	X	27840132	27840132	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chrX:27840132G>T	ENST00000356790.2	+	3	954	c.709G>T	c.(709-711)Gag>Tag	p.E237*		NM_182506.3	NP_872312.2	Q96LZ2	MAGBA_HUMAN	melanoma antigen family B, 10	237	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	26						TGACGGAATTGAGCACTTCAT	0.468																																					p.E237X													.	.			0			c.G709T												54.0	49.0	51.0					X																	27840132		2202	4300	6502	SO:0001587	stop_gained	139422	exon3			GGAATTGAGCACT		CCDS35221.1	Xp21.3	2008-02-05			ENSG00000177689	ENSG00000177689			25377	protein-coding gene	gene with protein product		300761				11454705	Standard	NM_182506		Approved	FLJ32965	uc004dbw.3	Q96LZ2	OTTHUMG00000046084	ENST00000356790.2:c.709G>T	X.37:g.27840132G>T	ENSP00000368304:p.Glu237*		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_182506	0		0	Q494Y6|Q494Y7|Q9BZ78	Nonsense_Mutation	SNP	ENST00000356790.2	37	CCDS35221.1	.	.	.	.	.	.	.	.	.	.	G	14.26	2.482119	0.44147	.	.	ENSG00000177689	ENST00000356790	.	.	.	2.33	-4.67	0.03319	.	0.667399	0.12927	U	0.427665	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.4999	0.22164	0.199:0.1658:0.6353:0.0	.	.	.	.	X	237	.	ENSP00000368304:E237X	E	+	1	0	MAGEB10	27750053	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.314000	0.02715	-2.039000	0.00917	-0.444000	0.05651	GAG			0.468	MAGEB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000106216.1		NM_182506	
ATRX	546	broad.mit.edu	37	X	76855029	76855029	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chrX:76855029T>C	ENST00000373344.5	-	25	6021	c.5807A>G	c.(5806-5808)aAg>aGg	p.K1936R	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Missense_Mutation_p.K1898R	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1936	Poly-Lys.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.K1936T(2)|p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TTTTTTCCCCTTTTTCCCTTT	0.348			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																														p.K1936R				Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	.	ATRX	833		3	Substitution - Missense(2)|Unknown(1)	lung(2)|bone(1)	c.A5807G												329.0	308.0	315.0					X																	76855029		2203	4295	6498	SO:0001583	missense	546	exon25			TTCCCCTTTTTCC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.5807A>G	X.37:g.76855029T>C	ENSP00000362441:p.Lys1936Arg		Somatic	232	0	0		WXS	Illumina HiSeq	Phase_I	294	0.02	6	NM_000489	42	0.00	0	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	ENST00000373344.5	37	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	T	10.86	1.468878	0.26335	.	.	ENSG00000085224	ENST00000373344;ENST00000395603	D;D	0.92647	-3.07;-3.08	5.64	0.648	0.17801	.	0.202398	0.40469	N	0.001084	T	0.82217	0.4989	N	0.16903	0.455	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.08055	0.003;0.002	T	0.67492	-0.5657	10	0.38643	T	0.18	-2.2976	8.217	0.31519	0.0:0.3103:0.0:0.6897	.	1898;1936	P46100-4;P46100	.;ATRX_HUMAN	R	1936;1898	ENSP00000362441:K1936R;ENSP00000378967:K1898R	ENSP00000362441:K1936R	K	-	2	0	ATRX	76741685	0.758000	0.28405	0.831000	0.32960	0.973000	0.67179	1.172000	0.31908	-0.241000	0.09681	-0.330000	0.08379	AAG			0.348	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000058860.2		NM_000489	
CTAG2	30848	broad.mit.edu	37	X	153881676	153881676	+	Silent	SNP	A	A	C	rs370709312		TCGA-2G-AAGO-01A-11D-A42Y-10	TCGA-2G-AAGO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	95579513-5f16-4bdc-bf4c-4d4d76a3d069	ce86540c-8488-46d3-9a6f-591f2f3b5be7	g.chrX:153881676A>C	ENST00000247306.4	-	1	177	c.114T>G	c.(112-114)ggT>ggG	p.G38G	CTAG2_ENST00000369585.3_Silent_p.G38G	NM_020994.3	NP_066274.2	O75638	CTAG2_HUMAN	cancer/testis antigen 2	38	Gly-rich.					centrosome (GO:0005813)				central_nervous_system(1)|endometrium(1)|lung(6)|ovary(1)|pancreas(1)	10	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CGCCCGTGGCACCCGCCTCTC	0.761																																					p.G38G													.	CTAG2	88		0			c.T114G												2.0	3.0	3.0					X																	153881676		1206	2709	3915	SO:0001819	synonymous_variant	30848	exon1			CGTGGCACCCGCC	AJ012833	CCDS14759.1, CCDS35455.1	Xq28	2009-08-18			ENSG00000126890	ENSG00000126890			2492	protein-coding gene	gene with protein product	"""CTL-recognized antigen on melanoma"", ""LAGE-1a protein"", ""cancer/testis antigen family 6, member 2a"", ""cancer/testis antigen family 6, member 2b"""	300396				9626360, 10399963	Standard	NM_020994		Approved	LAGE-1, CAMEL, LAGE1, ESO2, MGC3803, MGC138724, CT6.2a, CT6.2b, LAGE-1a, LAGE-1b	uc004fmi.2	O75638	OTTHUMG00000024239	ENST00000247306.4:c.114T>G	X.37:g.153881676A>C			Somatic	38	0.2894736842	11		WXS	Illumina HiSeq	Phase_I	45	0.53	24	NM_020994	1	0.00	0	O75637|Q0VIL6|Q14CD6|Q2Z1N4|Q9BU80|Q9UJ89|Q9Y479	Silent	SNP	ENST00000247306.4	37	CCDS14759.1																																																																																					0.761	CTAG2-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000061176.1		NM_020994	
