#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
SKI	6497	broad.mit.edu	37	1	2160966	2160966	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr1:2160966A>C	ENST00000378536.4	+	1	833	c.761A>C	c.(760-762)tAc>tCc	p.Y254S		NM_003036.3	NP_003027.1	P12755	SKI_HUMAN	SKI proto-oncogene	254					anterior/posterior axis specification (GO:0009948)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|gene expression (GO:0010467)|lens morphogenesis in camera-type eye (GO:0002089)|myelination in peripheral nervous system (GO:0022011)|myotube differentiation (GO:0014902)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neural tube closure (GO:0001843)|nose morphogenesis (GO:0043585)|olfactory bulb development (GO:0021772)|palate development (GO:0060021)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|retina development in camera-type eye (GO:0060041)|skeletal muscle fiber development (GO:0048741)|SMAD protein signal transduction (GO:0060395)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase inhibitor activity (GO:0046811)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|repressing transcription factor binding (GO:0070491)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(2)|lung(5)|prostate(1)|stomach(1)	10	all_cancers(77;0.000139)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)			Epithelial(90;2.14e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.72e-29)|GBM - Glioblastoma multiforme(42;2.45e-08)|Colorectal(212;5.33e-05)|COAD - Colon adenocarcinoma(227;0.000228)|Kidney(185;0.00268)|BRCA - Breast invasive adenocarcinoma(365;0.00471)|STAD - Stomach adenocarcinoma(132;0.0147)|KIRC - Kidney renal clear cell carcinoma(229;0.0385)|Lung(427;0.207)		CGCCTCATGTACCCGCCGCAC	0.657																																					p.Y254S	Ovarian(177;144 1678 13697 20086 27838 40755)												.	SKI	33		0			c.A761C												27.0	30.0	29.0					1																	2160966		2186	4290	6476	SO:0001583	missense	6497	exon1			TCATGTACCCGCC	X15218	CCDS39.1	1p36.33	2014-06-25	2014-06-25		ENSG00000157933	ENSG00000157933		"""SKI transcriptional corepressors"""	10896	protein-coding gene	gene with protein product		164780	"""v-ski avian sarcoma viral oncogene homolog"""			2762147	Standard	NM_003036		Approved		uc001aja.4	P12755	OTTHUMG00000001407	ENST00000378536.4:c.761A>C	1.37:g.2160966A>C	ENSP00000367797:p.Tyr254Ser		Somatic	27	0.1111111111	3		WXS	Illumina HiSeq	Phase_I	30	0.20	6	NM_003036	42	0.02	1	Q5SYT7	Missense_Mutation	SNP	ENST00000378536.4	37	CCDS39.1	.	.	.	.	.	.	.	.	.	.	A	18.21	3.574386	0.65878	.	.	ENSG00000157933	ENST00000378536	D	0.96587	-4.06	4.39	4.39	0.52855	SAND domain-like (2);c-SKI Smad4-binding (1);	0.000000	0.85682	D	0.000000	D	0.97021	0.9027	L	0.60455	1.87	0.50467	D	0.999871	D	0.71674	0.998	D	0.65874	0.939	D	0.97395	0.9992	10	0.87932	D	0	-24.0972	12.7864	0.57507	1.0:0.0:0.0:0.0	.	254	P12755	SKI_HUMAN	S	254	ENSP00000367797:Y254S	ENSP00000367797:Y254S	Y	+	2	0	SKI	2150826	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.909000	0.48758	1.620000	0.50308	0.323000	0.21402	TAC			0.657	SKI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000004070.1		NM_003036	
PER3	8863	mdanderson.org	37	1	7902773	7902773	+	Silent	SNP	G	G	A	rs144281505		TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr1:7902773G>A	ENST00000361923.2	+	21	3739	c.3564G>A	c.(3562-3564)gcG>gcA	p.A1188A	PER3_ENST00000377532.3_Silent_p.A1197A	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	1188	CRY binding domain. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		CTGATGGTGCGGCCACATCCT	0.453													G|||	1	0.000199681	0.0	0.0	5008	,	,		14454	0.0		0.001	False		,,,				2504	0.0				p.A1188A													.	.			0			c.G3564A							G		1,4405	2.1+/-5.4	0,1,2202	184.0	160.0	168.0		3564	-6.7	0.0	1	dbSNP_134	168	0,8600		0,0,4300	no	coding-synonymous	PER3	NM_016831.1		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		1188/1202	7902773	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8863	exon21			TGGTGCGGCCACA	BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.3564G>A	1.37:g.7902773G>A			Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	63	0.05	3	NM_016831	10	0.00	0	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Silent	SNP	ENST00000361923.2	37	CCDS89.1																																																																																			0		0.453	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000003607.1		NM_016831	
UBE4B	10277	mdanderson.org	37	1	10182134	10182134	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr1:10182134G>T	ENST00000253251.8	+	9	2006	c.1167G>T	c.(1165-1167)caG>caT	p.Q389H	UBE4B_ENST00000377157.3_Splice_Site_p.Q273H|UBE4B_ENST00000343090.6_Splice_Site_p.Q518H|UBE4B_ENST00000475795.1_3'UTR					ubiquitination factor E4B											NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		TGTTCAAGCAGGTACGGTCGT	0.453																																					p.Q518H													.	.			0			c.G1554T												100.0	88.0	92.0					1																	10182134		2203	4300	6503	SO:0001630	splice_region_variant	10277	exon10			CAAGCAGGTACGG	AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.1167+1G>T	1.37:g.10182134G>T			Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	54	0.06	3	NM_001105562	36	0.00	0		Missense_Mutation	SNP	ENST00000253251.8	37	CCDS110.1	.	.	.	.	.	.	.	.	.	.	G	16.87	3.241574	0.58995	.	.	ENSG00000130939	ENST00000253251;ENST00000377157;ENST00000343090	T;T;T	0.47177	0.85;0.85;0.85	5.72	5.72	0.89469	.	0.177217	0.52532	D	0.000068	T	0.39332	0.1074	L	0.31926	0.97	0.80722	D	1	B;B	0.11235	0.004;0.0	B;B	0.06405	0.002;0.001	T	0.14392	-1.0474	10	0.49607	T	0.09	-22.2682	14.6972	0.69132	0.0:0.0:0.855:0.145	.	518;389	O95155;O95155-2	UBE4B_HUMAN;.	H	389;273;518	ENSP00000253251:Q389H;ENSP00000366362:Q273H;ENSP00000343001:Q518H	ENSP00000253251:Q389H	Q	+	3	2	UBE4B	10104721	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.238000	0.78173	2.693000	0.91896	0.655000	0.94253	CAG			0.453	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000005017.1		NM_006048	Missense_Mutation
EPB41	2035	broad.mit.edu	37	1	29379772	29379772	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr1:29379772A>G	ENST00000343067.4	+	12	1920	c.1793A>G	c.(1792-1794)aAg>aGg	p.K598R	EPB41_ENST00000349460.4_Missense_Mutation_p.K389R|EPB41_ENST00000373797.1_Missense_Mutation_p.K598R|EPB41_ENST00000373798.1_Missense_Mutation_p.K598R|EPB41_ENST00000347529.3_Missense_Mutation_p.K563R|EPB41_ENST00000373800.3_Missense_Mutation_p.K389R|EPB41_ENST00000356093.2_Missense_Mutation_p.K598R|EPB41_ENST00000398863.2_Missense_Mutation_p.K598R	NM_001166005.1	NP_001159477.1	P11171	41_HUMAN	erythrocyte membrane protein band 4.1	598	Hydrophilic.				actin cytoskeleton organization (GO:0030036)|blood circulation (GO:0008015)|cortical actin cytoskeleton organization (GO:0030866)|positive regulation of protein binding (GO:0032092)	cortical cytoskeleton (GO:0030863)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	1-phosphatidylinositol binding (GO:0005545)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(1)	14		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		GAAGTGAAAAAGGAAGACGAG	0.483																																					p.K598R													.	EPB41	118		0			c.A1793G												87.0	92.0	90.0					1																	29379772		2203	4300	6503	SO:0001583	missense	2035	exon12			TGAAAAAGGAAGA	BC039079	CCDS330.1, CCDS331.1, CCDS332.1, CCDS53288.1, CCDS53289.1	1p33-p32	2014-05-09	2014-05-09		ENSG00000159023	ENSG00000159023			3377	protein-coding gene	gene with protein product		130500	"""elliptocytosis 1, RH-linked"""	EL1			Standard	NM_001166005		Approved	4.1R	uc001brm.2	P11171	OTTHUMG00000003644	ENST00000343067.4:c.1793A>G	1.37:g.29379772A>G	ENSP00000345259:p.Lys598Arg		Somatic	423	0	0		WXS	Illumina HiSeq	Phase_I	360	0.02	7	NM_001166006	58	0.00	0	B1ALH8|B1ALH9|D3DPM9|D3DPN0|P11176|Q14245|Q5TB35|Q5VXN8|Q8IXV9|Q9Y578|Q9Y579	Missense_Mutation	SNP	ENST00000343067.4	37	CCDS53288.1	.	.	.	.	.	.	.	.	.	.	A	8.287	0.816906	0.16607	.	.	ENSG00000159023	ENST00000358989;ENST00000343067;ENST00000356093;ENST00000398863;ENST00000398861;ENST00000398865;ENST00000349460;ENST00000373800;ENST00000347529;ENST00000373798;ENST00000373797	D;D;D;D;D;T;D;D	0.84370	-1.84;-1.77;-1.62;-1.78;-1.8;-1.48;-1.84;-1.74	5.7	-7.73	0.01245	.	1.621660	0.03076	N	0.157807	T	0.65780	0.2724	N	0.11927	0.2	0.09310	N	1	B;B;B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B;B;B	0.04013	0.001;0.001;0.0;0.0;0.001;0.001;0.001;0.001;0.001;0.001	T	0.57075	-0.7873	10	0.12766	T	0.61	.	5.6076	0.17389	0.1761:0.2083:0.5128:0.1027	.	492;598;598;598;598;598;615;563;389;389	E9PEX0;E9PEW9;C9JTS2;P11171;P11171-2;P11171-7;Q59F12;P11171-5;P11171-4;P11171-3	.;.;.;41_HUMAN;.;.;.;.;.;.	R	615;598;598;598;492;598;389;389;563;598;598	ENSP00000345259:K598R;ENSP00000348397:K598R;ENSP00000381839:K598R;ENSP00000317597:K389R;ENSP00000362906:K389R;ENSP00000290100:K563R;ENSP00000362904:K598R;ENSP00000362903:K598R	ENSP00000345259:K598R	K	+	2	0	EPB41	29252359	0.000000	0.05858	0.073000	0.20177	0.997000	0.91878	-1.049000	0.03514	-1.099000	0.03034	0.533000	0.62120	AAG			0.483	EPB41-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000010312.1		NM_203342	
PRKAA2	5563	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	57111084	57111084	+	Missense_Mutation	SNP	C	C	A	rs200643979		TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr1:57111084C>A	ENST00000371244.4	+	1	90	c.24C>A	c.(22-24)gaC>gaA	p.D8E		NM_006252.3	NP_006243.2	P54646	AAPK2_HUMAN	protein kinase, AMP-activated, alpha 2 catalytic subunit	8					autophagy (GO:0006914)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|cellular response to glucose starvation (GO:0042149)|cellular response to nutrient levels (GO:0031669)|cholesterol biosynthetic process (GO:0006695)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|positive regulation of glycolytic process (GO:0045821)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	[acetyl-CoA carboxylase] kinase activity (GO:0050405)|[hydroxymethylglutaryl-CoA reductase (NADPH)] kinase activity (GO:0047322)|AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			breast(6)|endometrium(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|stomach(1)	23					Acetylsalicylic acid(DB00945)	AGAAGCACGACGGGCGGGTGA	0.701																																					p.D8E													.	.			0			c.C24A												37.0	36.0	37.0					1																	57111084		2192	4286	6478	SO:0001583	missense	5563	exon1			GCACGACGGGCGG	BC069823	CCDS605.1	1p31	2011-08-25			ENSG00000162409	ENSG00000162409			9377	protein-coding gene	gene with protein product		600497		PRKAA		7959015	Standard	NM_006252		Approved	AMPK, AMPKa2	uc001cyk.4	P54646	OTTHUMG00000008282	ENST00000371244.4:c.24C>A	1.37:g.57111084C>A	ENSP00000360290:p.Asp8Glu		Somatic	100	0	0		WXS	Illumina HiSeq	.	109	0.08	9	NM_006252	0		0	Q9H1E8|Q9UD43	Missense_Mutation	SNP	ENST00000371244.4	37	CCDS605.1	.	.	.	.	.	.	.	.	.	.	C	11.32	1.605015	0.28623	.	.	ENSG00000162409	ENST00000371244	T	0.70749	-0.51	4.0	0.879	0.19155	Protein kinase-like domain (1);	0.122891	0.53938	U	0.000052	T	0.44201	0.1282	N	0.13098	0.295	0.38340	D	0.94404	B	0.02656	0.0	B	0.01281	0.0	T	0.09997	-1.0649	10	0.15499	T	0.54	-8.5572	4.7574	0.13092	0.0:0.5718:0.1571:0.2712	.	8	P54646	AAPK2_HUMAN	E	8	ENSP00000360290:D8E	ENSP00000360290:D8E	D	+	3	2	PRKAA2	56883672	1.000000	0.71417	0.997000	0.53966	0.948000	0.59901	0.653000	0.24902	-0.121000	0.11787	0.306000	0.20318	GAC			0.701	PRKAA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000022753.2		NM_006252	
SRGAP2-AS1	100873165	broad.mit.edu	37	1	121116645	121116645	+	lincRNA	DEL	T	T	-	rs377003181		TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr1:121116645delT	ENST00000437515.1	-	0	329					NR_104189.1																						CAAGCCCCCCTTTAAAAAAAA	0.393																																					.													.	.			0			.																																											0	.			CCCCCCTTTAAAA																													1.37:g.121116645delT			Somatic	157	0	0		WXS	Illumina HiSeq	Phase_I	170	0.08	13	.	0		0		RNA	DEL	ENST00000437515.1	37																																																																																						0.393	RP11-343N15.1-002	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000098477.2			
OR2B11	127623	mdanderson.org	37	1	247614868	247614868	+	Silent	SNP	G	G	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr1:247614868G>T	ENST00000318749.6	-	1	440	c.417C>A	c.(415-417)ctC>ctA	p.L139L		NM_001004492.1	NP_001004492.1	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B, member 11	139						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(13)|large_intestine(7)|lung(31)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	60	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			CACGGTGCATGAGAACGGCAT	0.622																																					p.L139L													.	.			0			c.C417A												80.0	66.0	70.0					1																	247614868		2203	4300	6503	SO:0001819	synonymous_variant	127623	exon1			GTGCATGAGAACG		CCDS31090.1	1q44	2012-08-09			ENSG00000177535	ENSG00000177535		"""GPCR / Class A : Olfactory receptors"""	31249	protein-coding gene	gene with protein product							Standard	NM_001004492		Approved		uc010pyx.2	Q5JQS5	OTTHUMG00000040572	ENST00000318749.6:c.417C>A	1.37:g.247614868G>T			Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_001004492	0		0	B2RP03	Silent	SNP	ENST00000318749.6	37	CCDS31090.1																																																																																					0.622	OR2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000097620.1		NM_001004492	
WDFY4	57705	mdanderson.org	37	10	50165215	50165215	+	Silent	SNP	G	G	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr10:50165215G>T	ENST00000325239.5	+	51	8046	c.8019G>T	c.(8017-8019)gtG>gtT	p.V2673V	WDFY4_ENST00000465910.1_3'UTR|WDFY4_ENST00000413659.2_3'UTR	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	2673	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.					integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						TCCACAGTGTGAAGAGCACGT	0.582																																					p.V2673V													.	.			0			c.G8019T												91.0	94.0	93.0					10																	50165215		692	1591	2283	SO:0001819	synonymous_variant	57705	exon52			CAGTGTGAAGAGC	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.8019G>T	10.37:g.50165215G>T			Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_020945	19	0.00	0	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Silent	SNP	ENST00000325239.5	37	CCDS44385.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	7.490|7.490	0.650418|0.650418	0.14516|0.14516	.|.	.|.	ENSG00000128815|ENSG00000128815	ENST00000312002|ENST00000265453	.|.	.|.	.|.	5.51|5.51	2.64|2.64	0.31445|0.31445	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.47245|0.47245	D|D	0.999369|0.999369	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	5.0079|5.0079	0.14297|0.14297	0.3308:0.1553:0.5139:0.0|0.3308:0.1553:0.5139:0.0	.|.	.|.	.|.	.|.	X|L	1764|760	.|.	.|.	E|X	+|+	1|2	0|2	WDFY4|WDFY4	49835221|49835221	0.971000|0.971000	0.33674|0.33674	0.004000|0.004000	0.12327|0.12327	0.977000|0.977000	0.68977|0.68977	1.470000|1.470000	0.35354|0.35354	0.282000|0.282000	0.22254|0.22254	0.645000|0.645000	0.84053|0.84053	GAA|TGA			0.582	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				XM_033379	
FAM170B	170370	mdanderson.org	37	10	50339897	50339897	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr10:50339897G>A	ENST00000311787.5	-	2	702	c.613C>T	c.(613-615)Cgc>Tgc	p.R205C	FAM170B-AS1_ENST00000443389.1_RNA|FAM170B-AS1_ENST00000442525.1_RNA|FAM170B-AS1_ENST00000435809.1_RNA	NM_001164484.1	NP_001157956.1	A6NMN3	F170B_HUMAN	family with sequence similarity 170, member B	205										central_nervous_system(1)|endometrium(1)|skin(1)	3						GCCACGCAGCGCACCCCGTAG	0.657																																					p.R205C													.	.			0			c.C613T												15.0	16.0	16.0					10																	50339897		692	1591	2283	SO:0001583	missense	170370	exon2			CGCAGCGCACCCC		CCDS53536.1	10q11.23	2008-11-06	2008-06-12	2008-06-12	ENSG00000172538	ENSG00000172538			19736	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 73"""	C10orf73			Standard	NM_001164484		Approved	Em:AC084727.4	uc001jhj.3	A6NMN3	OTTHUMG00000018187	ENST00000311787.5:c.613C>T	10.37:g.50339897G>A	ENSP00000308292:p.Arg205Cys		Somatic	19	0	0		WXS	Illumina HiSeq	Phase_I	19	0.16	3	NM_001164484	1	0.00	0	Q86WY6|Q8N6K8	Missense_Mutation	SNP	ENST00000311787.5	37	CCDS53536.1	.	.	.	.	.	.	.	.	.	.	G	17.14	3.312910	0.60414	.	.	ENSG00000172538	ENST00000311787	T	0.46451	0.87	5.64	5.64	0.86602	.	0.000000	0.56097	D	0.000025	T	0.53981	0.1830	L	0.46157	1.445	0.45366	D	0.998354	D	0.60575	0.988	P	0.58928	0.848	T	0.54990	-0.8210	10	0.87932	D	0	-36.2344	15.2627	0.73637	0.0:0.0:1.0:0.0	.	205	A6NMN3	F170B_HUMAN	C	205	ENSP00000308292:R205C	ENSP00000308292:R205C	R	-	1	0	FAM170B	50009903	0.999000	0.42202	1.000000	0.80357	0.219000	0.24729	2.375000	0.44283	2.669000	0.90835	0.603000	0.83216	CGC			0.657	FAM170B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047974.1		XM_096317	
C10orf128	170371	mdanderson.org	37	10	50374968	50374968	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr10:50374968G>T	ENST00000474718.1	-	3	206	c.184C>A	c.(184-186)Cac>Aac	p.H62N	C10orf128_ENST00000374148.1_Missense_Mutation_p.H62N|C10orf128_ENST00000470884.1_5'UTR|C10orf128_ENST00000374153.2_Missense_Mutation_p.H62N|C10orf128_ENST00000374151.3_Missense_Mutation_p.H62N	NM_001010863.1	NP_001010863.1	Q5T292	CJ128_HUMAN	chromosome 10 open reading frame 128	62						integral component of membrane (GO:0016021)				breast(1)|large_intestine(1)|lung(1)	3						TCAAATAAGTGCCTCCTGATC	0.597																																					p.H62N													.	.			0			c.C184A												71.0	76.0	75.0					10																	50374968		2060	4201	6261	SO:0001583	missense	170371	exon3			ATAAGTGCCTCCT	BC031641	CCDS41519.1, CCDS73128.1	10q11.23	2012-06-13			ENSG00000204161	ENSG00000204161			27274	protein-coding gene	gene with protein product						12477932	Standard	NM_001010863		Approved	Em:AC084727.5	uc001jhn.4	Q5T292	OTTHUMG00000018188	ENST00000474718.1:c.184C>A	10.37:g.50374968G>T	ENSP00000417246:p.His62Asn		Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_001010863	32	0.00	0	A6XND2|Q5T289|Q5T291	Missense_Mutation	SNP	ENST00000474718.1	37	CCDS41519.1	.	.	.	.	.	.	.	.	.	.	G	11.76	1.733318	0.30684	.	.	ENSG00000204161	ENST00000374153;ENST00000474718;ENST00000453436;ENST00000374149;ENST00000374151;ENST00000374148	T;T;T;T;T	0.60299	0.25;0.34;0.24;0.2;0.21	4.47	3.55	0.40652	.	0.485095	0.15466	N	0.260860	T	0.46386	0.1390	L	0.34521	1.04	0.09310	N	1	P;P;B;P	0.40332	0.713;0.713;0.297;0.551	B;B;B;B	0.39562	0.303;0.303;0.067;0.189	T	0.38607	-0.9653	10	0.72032	D	0.01	.	9.5492	0.39299	0.0:0.0:0.7901:0.2099	.	62;62;62;62	Q5T292-2;Q5T292-3;Q5T292;Q5T292-4	.;.;CJ128_HUMAN;.	N	62;62;54;56;62;62	ENSP00000363268:H62N;ENSP00000417246:H62N;ENSP00000395067:H54N;ENSP00000363266:H62N;ENSP00000363263:H62N	ENSP00000363263:H62N	H	-	1	0	C10orf128	50044974	0.823000	0.29233	0.185000	0.23176	0.074000	0.17049	1.872000	0.39549	1.073000	0.40885	-0.553000	0.04205	CAC			0.597	C10orf128-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047978.1		NM_001010863	
MSMB	4477	mdanderson.org	37	10	51562390	51562390	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr10:51562390G>T	ENST00000358559.2	+	4	422	c.335G>T	c.(334-336)tGg>tTg	p.W112L	MSMB_ENST00000298239.6_Nonsense_Mutation_p.G77*|NCOA4_ENST00000430396.2_5'Flank|NCOA4_ENST00000414907.2_5'Flank|NCOA4_ENST00000452682.1_5'Flank|NCOA4_ENST00000438493.1_5'Flank|NCOA4_ENST00000374087.4_5'Flank	NM_002443.3	NP_002434.1	P08118	MSMB_HUMAN	microseminoprotein, beta-	112						extracellular space (GO:0005615)|nucleus (GO:0005634)				lung(4)|ovary(2)|prostate(1)	7						GTCAGTGAATGGATAATCTAA	0.458																																					p.G77X													.	.			0			c.G229T												160.0	135.0	144.0					10																	51562390		2203	4300	6503	SO:0001583	missense	4477	exon3			GTGAATGGATAAT	BC005257	CCDS73095.1, CCDS73096.1	10q11.2	2014-05-06			ENSG00000138294	ENSG00000263639			7372	protein-coding gene	gene with protein product		157145				1783399	Standard	NM_002443		Approved	PSP-94, PSP57, PSP94, IGBF, MSP, MSPB, PN44, PRPS, PSP	uc001jiq.3	P08118	OTTHUMG00000188315	ENST00000358559.2:c.335G>T	10.37:g.51562390G>T	ENSP00000351363:p.Trp112Leu		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_138634	1	0.00	0	B1API6|P11999|Q13125|Q6IAY9|Q9UC59	Nonsense_Mutation	SNP	ENST00000358559.2	37	CCDS7235.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.736|9.736	1.163472|1.163472	0.21538|0.21538	.|.	.|.	ENSG00000138294|ENSG00000138294	ENST00000298239|ENST00000358559	.|T	.|0.16457	.|2.34	4.33|4.33	2.34|2.34	0.29019|0.29019	.|.	.|0.868174	.|0.10276	.|N	.|0.694113	.|T	.|0.33673	.|0.0871	.|.	.|.	.|.	0.20638|0.20638	N|N	0.999872|0.999872	.|D	.|0.76494	.|0.999	.|D	.|0.70487	.|0.969	.|T	.|0.09907	.|-1.0653	.|9	0.87932|0.66056	D|D	0|0.02	-16.0319|-16.0319	5.3875|5.3875	0.16226|0.16226	0.1166:0.2017:0.6817:0.0|0.1166:0.2017:0.6817:0.0	.|.	.|112	.|P08118	.|MSMB_HUMAN	X|L	77|112	.|ENSP00000351363:W112L	ENSP00000298239:G77X|ENSP00000351363:W112L	G|W	+|+	1|2	0|0	MSMB|MSMB	51232396|51232396	0.050000|0.050000	0.20438|0.20438	0.008000|0.008000	0.14137|0.14137	0.005000|0.005000	0.04900|0.04900	0.921000|0.921000	0.28718|0.28718	0.684000|0.684000	0.31448|0.31448	0.650000|0.650000	0.86243|0.86243	GGA|TGG			0.458	MSMB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048034.1		NM_002443, NM_138634	
HHEX	3087	broad.mit.edu	37	10	94449787	94449787	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr10:94449787T>G	ENST00000282728.5	+	1	1843	c.44T>G	c.(43-45)gTg>gGg	p.V15G	HHEX_ENST00000492654.2_5'Flank|HHEX_ENST00000472590.2_5'Flank	NM_002729.4	NP_002720.1	Q03014	HHEX_HUMAN	hematopoietically expressed homeobox	15	Pro-rich.				anterior/posterior pattern specification (GO:0009952)|B cell differentiation (GO:0030183)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|DNA conformation change (GO:0071103)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|forebrain morphogenesis (GO:0048853)|gall bladder development (GO:0061010)|hepatic duct development (GO:0061011)|hepatoblast differentiation (GO:0061017)|hepatocyte differentiation (GO:0070365)|in utero embryonic development (GO:0001701)|interkinetic nuclear migration (GO:0022027)|mRNA export from nucleus (GO:0006406)|multicellular organism growth (GO:0035264)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription by transcription factor localization (GO:0010621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|pancreas development (GO:0031016)|poly(A)+ mRNA export from nucleus (GO:0016973)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|primary lung bud formation (GO:0060431)|primitive streak formation (GO:0090009)|protein localization to nucleus (GO:0034504)|regulation of cell proliferation (GO:0042127)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|eukaryotic initiation factor 4E binding (GO:0008190)|protein homodimerization activity (GO:0042803)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			kidney(2)|large_intestine(2)|lung(5)|ovary(1)	10						gccgTGGGGGTGCCGCTGTAC	0.786																																					p.V15G													.	HHEX	22		0			c.T44G																																									SO:0001583	missense	3087	exon1			TGGGGGTGCCGCT	Z21533	CCDS7423.1	10q23.33	2011-06-20	2007-02-15		ENSG00000152804	ENSG00000152804		"""Homeoboxes / ANTP class : NKL subclass"""	4901	protein-coding gene	gene with protein product		604420		PRHX		8096636, 8103988	Standard	NM_002729		Approved	HEX, HOX11L-PEN	uc001kid.3	Q03014	OTTHUMG00000018762	ENST00000282728.5:c.44T>G	10.37:g.94449787T>G	ENSP00000282728:p.Val15Gly		Somatic	40	0.325	13		WXS	Illumina HiSeq	Phase_I	44	0.66	29	NM_002729	4	0.00	0	B1AQ17|Q96CE9	Missense_Mutation	SNP	ENST00000282728.5	37	CCDS7423.1	.	.	.	.	.	.	.	.	.	.	T	10.67	1.415802	0.25552	.	.	ENSG00000152804	ENST00000282728	D	0.91996	-2.95	3.52	3.52	0.40303	.	0.000000	0.64402	D	0.000002	D	0.87402	0.6168	M	0.65975	2.015	0.80722	D	1	P	0.38195	0.622	B	0.30029	0.11	D	0.84882	0.0831	10	0.37606	T	0.19	.	7.7312	0.28788	0.0:0.105:0.0:0.895	.	15	Q03014	HHEX_HUMAN	G	15	ENSP00000282728:V15G	ENSP00000282728:V15G	V	+	2	0	HHEX	94439767	1.000000	0.71417	0.981000	0.43875	0.341000	0.28922	2.739000	0.47409	1.466000	0.48025	0.240000	0.17902	GTG			0.786	HHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049402.2			
MYOD1	4654	mdanderson.org	37	11	17741614	17741614	+	Silent	SNP	G	G	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr11:17741614G>T	ENST00000250003.3	+	1	500	c.285G>T	c.(283-285)ctG>ctT	p.L95L		NM_002478.4	NP_002469.2	P15172	MYOD1_HUMAN	myogenic differentiation 1	95					cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to oxygen levels (GO:0071453)|cellular response to starvation (GO:0009267)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|myoblast fate determination (GO:0007518)|myotube cell development (GO:0014904)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast fusion (GO:1901741)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle fiber adaptation (GO:0043503)|skeletal muscle fiber development (GO:0048741)|skeletal muscle tissue development (GO:0007519)|transcription from RNA polymerase II promoter (GO:0006366)	myofibril (GO:0030016)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|E-box binding (GO:0070888)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	17						GCTGCCTACTGTGGGCCTGCA	0.726																																					p.L95L													.	.			0			c.G285T												9.0	8.0	8.0					11																	17741614		2129	4130	6259	SO:0001819	synonymous_variant	4654	exon1			CCTACTGTGGGCC	AF027148	CCDS7826.1	11p15	2013-05-21	2005-09-12			ENSG00000129152		"""Basic helix-loop-helix proteins"""	7611	protein-coding gene	gene with protein product	"""myoblast determination protein 1"""	159970	"""myogenic factor 3"""	MYF3			Standard	NM_002478		Approved	PUM, MYOD, bHLHc1	uc001mni.3	P15172		ENST00000250003.3:c.285G>T	11.37:g.17741614G>T			Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_002478	0		0	O75321	Silent	SNP	ENST00000250003.3	37	CCDS7826.1																																																																																					0.726	MYOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000389387.1		NM_002478	
ANO3	63982	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	26547227	26547227	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr11:26547227G>T	ENST00000256737.3	+	7	1589		c.e7+1		ANO3_ENST00000525139.1_Splice_Site|ANO3_ENST00000537978.1_Splice_Site|ANO3_ENST00000531568.1_Splice_Site	NM_031418.2	NP_113606.2	Q9BYT9	ANO3_HUMAN	anoctamin 3						calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phospholipid scramblase activity (GO:0017128)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68						CAATGGGCAGGTTGGTGGGTG	0.343																																					.													.	ANO3	145		0			c.737+1G>T												140.0	157.0	151.0					11																	26547227		2203	4300	6503	SO:0001630	splice_region_variant	63982	exon7			GGGCAGGTTGGTG	AJ300461	CCDS31447.1	11p14.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000134343	ENSG00000134343		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	14004	protein-coding gene	gene with protein product	"""transmembrane protein 16C (eight membrane-spanning domains)"""	610110	"""chromosome 11 open reading frame 25"", ""transmembrane protein 16C"""	C11orf25, TMEM16C		12739008, 15067359, 23200863, 24692353	Standard	NM_031418		Approved	GENX-3947, DYT23	uc001mqt.4	Q9BYT9	OTTHUMG00000166096	ENST00000256737.3:c.737+1G>T	11.37:g.26547227G>T			Somatic	182	0.0054945055	1		WXS	Illumina HiSeq	Phase_I	106	0.29	31	NM_031418	0		0	B7Z3F5	Splice_Site	SNP	ENST00000256737.3	37	CCDS31447.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.387906	0.82902	.	.	ENSG00000134343	ENST00000537978;ENST00000525139;ENST00000256737;ENST00000531568	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8719	0.88813	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ANO3	26503803	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.529000	0.90602	2.567000	0.86603	0.650000	0.86243	.			0.343	ANO3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000387806.1		NM_031418	Intron
AMBRA1	55626	broad.mit.edu	37	11	46439570	46439570	+	Silent	SNP	G	G	A			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr11:46439570G>A	ENST00000458649.2	-	15	3427	c.3009C>T	c.(3007-3009)gcC>gcT	p.A1003A	AMBRA1_ENST00000534300.1_Silent_p.A943A|AMBRA1_ENST00000533727.1_Silent_p.A884A|AMBRA1_ENST00000426438.1_Silent_p.A974A|AMBRA1_ENST00000528950.1_Silent_p.A974A|AMBRA1_ENST00000298834.3_Silent_p.A943A|AMBRA1_ENST00000314845.3_Silent_p.A913A			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	1003					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		TCCGCTGGTCGGCAGGCATGG	0.483																																					p.A1006A													.	AMBRA1	201		0			c.C3018T												79.0	77.0	77.0					11																	46439570		2201	4299	6500	SO:0001819	synonymous_variant	55626	exon17			CTGGTCGGCAGGC	AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.3009C>T	11.37:g.46439570G>A			Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	87	0.03	3	NM_001267782	49	0.00	0	A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Silent	SNP	ENST00000458649.2	37																																																																																						0.483	AMBRA1-005	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000390103.1		NM_017749	
OR10S1	219873	mdanderson.org	37	11	123848345	123848345	+	Missense_Mutation	SNP	G	G	T	rs201821946		TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr11:123848345G>T	ENST00000531945.1	-	1	143	c.54C>A	c.(52-54)aaC>aaA	p.N18K		NM_001004474.1	NP_001004474.1	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S, member 1	18						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	36		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		CCACAGTCTGGTTGGGGTTCT	0.483																																					p.N18K													.	.			0			c.C54A												80.0	80.0	80.0					11																	123848345		2202	4299	6501	SO:0001583	missense	219873	exon1			AGTCTGGTTGGGG	BK004509	CCDS31701.1	11q24.1	2012-08-09			ENSG00000196248	ENSG00000196248		"""GPCR / Class A : Olfactory receptors"""	14807	protein-coding gene	gene with protein product							Standard	NM_001004474		Approved		uc001pzm.1	Q8NGN2	OTTHUMG00000165963	ENST00000531945.1:c.54C>A	11.37:g.123848345G>T	ENSP00000431914:p.Asn18Lys		Somatic	18	0	0		WXS	Illumina HiSeq	Phase_I	10	0.20	2	NM_001004474	0		0	B9EH43|Q6IEV3|Q96R78	Missense_Mutation	SNP	ENST00000531945.1	37	CCDS31701.1	.	.	.	.	.	.	.	.	.	.	G	12.37	1.916250	0.33815	.	.	ENSG00000196248	ENST00000531945	T	0.02158	4.42	4.75	2.84	0.33178	.	0.000000	0.45606	U	0.000356	T	0.05273	0.0140	M	0.92219	3.285	0.26741	N	0.970384	B	0.27997	0.197	B	0.24269	0.052	T	0.24693	-1.0153	10	0.87932	D	0	-19.7471	4.3184	0.11003	0.2469:0.0:0.5892:0.164	.	18	Q8NGN2	O10S1_HUMAN	K	18	ENSP00000431914:N18K	ENSP00000431914:N18K	N	-	3	2	OR10S1	123353555	.	.	0.982000	0.44146	0.169000	0.22640	.	.	0.601000	0.29879	0.644000	0.83932	AAC			0.483	OR10S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387265.2		NM_001004474	
ADAMTS15	170689	broad.mit.edu	37	11	130343024	130343024	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr11:130343024G>T	ENST00000299164.2	+	8	2161	c.2161G>T	c.(2161-2163)Ggg>Tgg	p.G721W		NM_139055.2	NP_620686.1	Q8TE58	ATS15_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 15	721	Spacer.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G721W(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(8)|urinary_tract(1)	36	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		AGGGCTGATCGGGGATGACAA	0.622																																					p.G721W													ADAMTS15,NS,carcinoma,0,3	ADAMTS15	103	3	1	Substitution - Missense(1)	lung(1)	c.G2161T												65.0	66.0	66.0					11																	130343024		2201	4297	6498	SO:0001583	missense	170689	exon8			CTGATCGGGGATG	AJ315733	CCDS8488.1	11q25	2008-02-01	2005-08-19		ENSG00000166106	ENSG00000166106		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	16305	protein-coding gene	gene with protein product		607509	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 15"""			11867212	Standard	NM_139055		Approved		uc010scd.2	Q8TE58	OTTHUMG00000165657	ENST00000299164.2:c.2161G>T	11.37:g.130343024G>T	ENSP00000299164:p.Gly721Trp		Somatic	137	0	0		WXS	Illumina HiSeq	Phase_I	121	0.02	3	NM_139055	4	0.00	0	Q32MI6	Missense_Mutation	SNP	ENST00000299164.2	37	CCDS8488.1	.	.	.	.	.	.	.	.	.	.	G	18.94	3.730713	0.69074	.	.	ENSG00000166106	ENST00000299164	T	0.60171	0.21	5.67	4.57	0.56435	ADAM-TS Spacer 1 (1);	.	.	.	.	T	0.60958	0.2309	L	0.36672	1.1	0.39541	D	0.968823	D	0.63046	0.992	D	0.66602	0.945	T	0.62863	-0.6764	9	0.59425	D	0.04	.	6.5758	0.22564	0.2543:0.0:0.7457:0.0	.	721	Q8TE58	ATS15_HUMAN	W	721	ENSP00000299164:G721W	ENSP00000299164:G721W	G	+	1	0	ADAMTS15	129848234	0.996000	0.38824	0.997000	0.53966	0.992000	0.81027	3.419000	0.52728	2.686000	0.91538	0.561000	0.74099	GGG			0.622	ADAMTS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000385638.1		NM_139055	
LPAR5	57121	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	6729744	6729744	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr12:6729744G>T	ENST00000329858.4	-	2	1427	c.671C>A	c.(670-672)aCg>aAg	p.T224K	LPAR5_ENST00000540335.1_5'UTR|LPAR5_ENST00000431922.1_Missense_Mutation_p.T224K	NM_020400.5	NP_065133.1	Q9H1C0	LPAR5_HUMAN	lysophosphatidic acid receptor 5	224						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|skin(2)	7						CTGGCTCTGCGTGGCGTCGGG	0.697																																					p.T224K	NSCLC(74;891 2312 37538)												.	.			0			c.C671A												6.0	5.0	5.0					12																	6729744		2057	3972	6029	SO:0001583	missense	57121	exon2			CTCTGCGTGGCGT	AJ272207	CCDS8553.1	12p13.31	2012-08-08	2008-04-11	2008-04-11		ENSG00000184574		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	13307	protein-coding gene	gene with protein product		606926	"""G protein-coupled receptor 92"""	GPR93, GPR92		11062477, 11574155, 16774927, 16651401	Standard	NM_020400		Approved	KPG_010, LPA5	uc009zer.2	Q9H1C0		ENST00000329858.4:c.671C>A	12.37:g.6729744G>T	ENSP00000327875:p.Thr224Lys		Somatic	58	0	0		WXS	Illumina HiSeq	.	108	0.10	11	NM_001142961	9	0.00	0		Missense_Mutation	SNP	ENST00000329858.4	37	CCDS8553.1	.	.	.	.	.	.	.	.	.	.	G	17.44	3.390036	0.61956	.	.	ENSG00000184574	ENST00000329858;ENST00000431922;ENST00000435659	T;T	0.36520	1.25;1.25	5.1	5.1	0.69264	GPCR, rhodopsin-like superfamily (1);	0.288449	0.28933	N	0.013666	T	0.35278	0.0926	L	0.36672	1.1	0.35878	D	0.828764	D	0.60160	0.987	P	0.56700	0.804	T	0.24083	-1.0170	10	0.05833	T	0.94	.	9.3852	0.38338	0.157:0.0:0.843:0.0	.	224	Q9H1C0	LPAR5_HUMAN	K	224	ENSP00000327875:T224K;ENSP00000393098:T224K	ENSP00000327875:T224K	T	-	2	0	LPAR5	6600005	0.994000	0.37717	0.982000	0.44146	0.896000	0.52359	2.892000	0.48625	2.652000	0.90054	0.561000	0.74099	ACG			0.697	LPAR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000400699.1		NM_020400	
PDE3A	5139	broad.mit.edu	37	12	20522114	20522115	+	5'Flank	INS	-	-	GCGT	rs138187101|rs71039938	byFrequency	TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr12:20522114_20522115insGCGT	ENST00000359062.3	+	0	0				RP11-284H19.1_ENST00000535755.1_RNA	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited						blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	AATTGGGAAGAgcgtgcgtgcg	0.594														639	0.127596	0.0212	0.1628	5008	,	,		12687	0.0337		0.2704	False		,,,				2504	0.1963				.													.	PDE3A	184		0			.																																									SO:0001631	upstream_gene_variant	0	.			GGGAAGAGCGTGC		CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962		12.37:g.20522119_20522122dupGCGT	Exception_encountered		Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	24	0.46	11	.	6	0.00	0	O60865|Q13348|Q17RD1	RNA	INS	ENST00000359062.3	37	CCDS31754.1																																																																																					0.594	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401756.2			
ADAMTS20	80070	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	43771347	43771347	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr12:43771347A>G	ENST00000389420.3	-	32	4815	c.4816T>C	c.(4816-4818)Ttt>Ctt	p.F1606L		NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1606	TSP type-1 14. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CTGTAACTAAATCCACAGTTG	0.348																																					p.F1606L													.	.			0			c.T4816C												85.0	84.0	84.0					12																	43771347		2203	4300	6503	SO:0001583	missense	80070	exon32			AACTAAATCCACA	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.4816T>C	12.37:g.43771347A>G	ENSP00000374071:p.Phe1606Leu		Somatic	183	0	0		WXS	Illumina HiSeq	.	133	0.17	23	NM_025003	0		0	A6NNC9|J3QT00	Missense_Mutation	SNP	ENST00000389420.3	37	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	A	5.340	0.247982	0.10130	.	.	ENSG00000173157	ENST00000389420	T	0.57273	0.41	5.08	2.63	0.31362	.	0.249386	0.28301	N	0.015844	T	0.30696	0.0773	N	0.17082	0.46	0.19575	N	0.999966	B	0.02656	0.0	B	0.04013	0.001	T	0.17592	-1.0364	10	0.11182	T	0.66	.	9.7489	0.40464	0.7316:0.0:0.2684:0.0	.	1606	P59510	ATS20_HUMAN	L	1606	ENSP00000374071:F1606L	ENSP00000374071:F1606L	F	-	1	0	ADAMTS20	42057614	0.060000	0.20803	0.487000	0.27428	0.861000	0.49209	0.025000	0.13577	0.431000	0.26258	0.533000	0.62120	TTT			0.348	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000403643.1		NM_025003	
PROSER1	80209	mdanderson.org	37	13	39588565	39588565	+	Missense_Mutation	SNP	G	G	T	rs141612774	byFrequency	TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr13:39588565G>T	ENST00000352251.3	-	11	1657	c.824C>A	c.(823-825)cCt>cAt	p.P275H	PROSER1_ENST00000350125.3_Missense_Mutation_p.P253H|PROSER1_ENST00000484434.3_Intron	NM_025138.4	NP_079414.3	Q86XN7	PRSR1_HUMAN	proline and serine rich 1	275	Pro-rich.																AGGTGTTGAAGGATTAGAACC	0.463																																					p.P275H													.	.			0			c.C824A												85.0	76.0	79.0					13																	39588565		2203	4300	6503	SO:0001583	missense	80209	exon11			GTTGAAGGATTAG	AK022723	CCDS9368.2	13q13.2	2011-08-09	2011-08-09	2011-08-09	ENSG00000120685	ENSG00000120685			20291	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 23"""	C13orf23			Standard	NM_025138		Approved	bA50D16.2, FLJ12661	uc001uwy.4	Q86XN7	OTTHUMG00000016764	ENST00000352251.3:c.824C>A	13.37:g.39588565G>T	ENSP00000332034:p.Pro275His		Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_025138	52	0.00	0	A6NJ97|Q6P2S2|Q7Z3X5|Q8N3D2|Q8N3P1|Q9H9M1	Missense_Mutation	SNP	ENST00000352251.3	37	CCDS9368.2	.	.	.	.	.	.	.	.	.	.	G	18.20	3.571366	0.65765	.	.	ENSG00000120685	ENST00000352251;ENST00000350125	T;T	0.35048	1.34;1.33	5.09	4.21	0.49690	.	.	.	.	.	T	0.54046	0.1834	M	0.61703	1.905	0.53688	D	0.999977	D;D	0.76494	0.999;0.999	D;D	0.67548	0.952;0.952	T	0.53287	-0.8460	8	.	.	.	-21.4525	13.5708	0.61845	0.0:0.0:0.8432:0.1568	.	253;275	A6NJ97;Q86XN7	.;PRSR1_HUMAN	H	275;253	ENSP00000332034:P275H;ENSP00000339123:P253H	.	P	-	2	0	PROSER1	38486565	1.000000	0.71417	0.349000	0.25694	0.944000	0.59088	6.876000	0.75556	1.063000	0.40649	0.650000	0.86243	CCT			0.463	PROSER1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044607.5		NM_025138	
DZIP1	22873	mdanderson.org	37	13	96239894	96239894	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr13:96239894G>T	ENST00000376829.2	-	20	2968	c.2117C>A	c.(2116-2118)cCa>cAa	p.P706Q	DZIP1_ENST00000347108.3_Missense_Mutation_p.P706Q|DZIP1_ENST00000361396.2_Missense_Mutation_p.P687Q|DZIP1_ENST00000361156.3_Missense_Mutation_p.P687Q	NM_198968.3	NP_945319.1	Q86YF9	DZIP1_HUMAN	DAZ interacting zinc finger protein 1	706					cilium assembly (GO:0042384)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.P687Q(1)		endometrium(1)|kidney(1)|large_intestine(20)|lung(11)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	38	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)			CTTGTTTTGTGGTGGCGGCAC	0.577																																					p.P706Q													DZIP1_ENST00000347108,NS,carcinoma,0,3	DZIP1_ENST00000347108	0	3	1	Substitution - Missense(1)	pancreas(1)	c.C2117A												132.0	110.0	117.0					13																	96239894		2203	4300	6503	SO:0001583	missense	22873	exon20			TTTTGTGGTGGCG	AB023213	CCDS9477.1, CCDS9478.1	13q32.1	2013-05-22	2013-05-22		ENSG00000134874	ENSG00000134874		"""Zinc fingers, C2H2-type"""	20908	protein-coding gene	gene with protein product		608671	"""DAZ interacting protein 1"""				Standard	NM_014934		Approved	KIAA0996, DZIP	uc001vmk.4	Q86YF9	OTTHUMG00000017224	ENST00000376829.2:c.2117C>A	13.37:g.96239894G>T	ENSP00000366025:p.Pro706Gln		Somatic	156	0	0		WXS	Illumina HiSeq	Phase_I	119	0.04	5	NM_198968	36	0.00	0	Q5W078|Q5W079|Q8WY45|Q8WY46|Q9UGA5|Q9Y2K0	Missense_Mutation	SNP	ENST00000376829.2	37	CCDS9478.1	.	.	.	.	.	.	.	.	.	.	G	4.276	0.050312	0.08243	.	.	ENSG00000134874	ENST00000347108;ENST00000361156;ENST00000361396;ENST00000376829	T;T;T;T	0.29397	1.57;1.57;1.57;1.57	5.35	4.51	0.55191	.	0.387393	0.29239	N	0.012740	T	0.11750	0.0286	N	0.02011	-0.69	0.09310	N	1	B;B	0.20988	0.05;0.029	B;B	0.21708	0.036;0.016	T	0.24835	-1.0149	10	0.21014	T	0.42	-0.3812	9.5113	0.39078	0.174:0.0:0.826:0.0	.	687;706	Q86YF9-2;Q86YF9	.;DZIP1_HUMAN	Q	706;687;687;706	ENSP00000257312:P706Q;ENSP00000355018:P687Q;ENSP00000355175:P687Q;ENSP00000366025:P706Q	ENSP00000257312:P706Q	P	-	2	0	DZIP1	95037895	0.003000	0.15002	0.001000	0.08648	0.000000	0.00434	1.256000	0.32921	1.260000	0.44134	-0.126000	0.14955	CCA			0.577	DZIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000045496.3		NM_014934	
ARID4A	5926	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	58832861	58832861	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr14:58832861C>G	ENST00000355431.3	+	22	3809	c.3436C>G	c.(3436-3438)Ccg>Gcg	p.P1146A	ARID4A_ENST00000431317.2_Intron|ARID4A_ENST00000395168.3_Intron|ARID4A_ENST00000348476.3_Intron	NM_002892.3	NP_002883.3	P29374	ARI4A_HUMAN	AT rich interactive domain 4A (RBP1-like)	1146					erythrocyte development (GO:0048821)|histone H3-K4 trimethylation (GO:0080182)|histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|central_nervous_system(1)|cervix(4)|endometrium(8)|kidney(2)|large_intestine(14)|lung(19)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						AAGAATATCCCCGCACATCAA	0.398																																					p.P1146A													ARID4A_ENST00000355431,NS,carcinoma,-2,2	ARID4A_ENST00000355431	-2	2	0			c.C3436G												166.0	176.0	173.0					14																	58832861		2203	4300	6503	SO:0001583	missense	5926	exon22			ATATCCCCGCACA	S57153	CCDS9732.1, CCDS9733.1, CCDS45114.1	14q22.3	2013-02-07	2004-01-28	2004-01-28	ENSG00000032219	ENSG00000032219		"""-"""	9885	protein-coding gene	gene with protein product		180201	"""retinoblastoma-binding protein 1"""	RBBP1		1857421, 8455946	Standard	NM_023000		Approved	RBP1, RBP-1	uc001xdp.3	P29374	OTTHUMG00000140320	ENST00000355431.3:c.3436C>G	14.37:g.58832861C>G	ENSP00000347602:p.Pro1146Ala		Somatic	172	0	0		WXS	Illumina HiSeq	.	152	0.20	31	NM_002892	28	0.29	8	Q15991|Q15992|Q15993	Missense_Mutation	SNP	ENST00000355431.3	37	CCDS9732.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.031170	0.75504	.	.	ENSG00000032219	ENST00000355431	T	0.15952	2.38	5.12	5.12	0.69794	.	0.000000	0.64402	D	0.000011	T	0.41558	0.1164	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.07947	-1.0746	10	0.34782	T	0.22	-14.2313	18.9177	0.92512	0.0:1.0:0.0:0.0	.	1146	P29374	ARI4A_HUMAN	A	1146	ENSP00000347602:P1146A	ENSP00000347602:P1146A	P	+	1	0	ARID4A	57902614	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.954000	0.63631	2.544000	0.85801	0.650000	0.86243	CCG			0.398	ARID4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000276927.2		NM_023001	
PDCD6IPP2	646278	broad.mit.edu	37	15	29052465	29052465	+	RNA	DEL	T	T	-			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr15:29052465delT	ENST00000562423.1	+	0	680																											attttatttattttttttttg	0.418																																					.													.	.			0			.																																											0	.			TATTTATTTTTTT																													15.37:g.29052465delT			Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	6	0.50	3	.	0		0		RNA	DEL	ENST00000562423.1	37																																																																																						0.418	RP11-578F21.12-004	PUTATIVE	basic	processed_transcript	pseudogene		OTTHUMT00000431789.1			
EIF3J	8669	broad.mit.edu	37	15	44829571	44829571	+	Silent	SNP	C	C	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr15:44829571C>T	ENST00000535391.1	+	2	105	c.93C>T	c.(91-93)ggC>ggT	p.G31G	EIF3J_ENST00000261868.5_Silent_p.G31G|EIF3J-AS1_ENST00000313807.4_lincRNA|EIF3J_ENST00000424492.3_Silent_p.G31G					eukaryotic translation initiation factor 3, subunit J											endometrium(1)|large_intestine(5)|liver(2)|skin(1)	9		all_cancers(109;2.81e-14)|all_epithelial(112;2.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;3.13e-20)|GBM - Glioblastoma multiforme(94;9.81e-07)|COAD - Colon adenocarcinoma(120;0.0754)|Colorectal(105;0.0758)		TGGGGGGCGGCGGCACTGCCG	0.726																																					p.G31G													.	EIF3J	29		0			c.C93T												6.0	7.0	7.0					15																	44829571		2085	4088	6173	SO:0001819	synonymous_variant	8669	exon2			GGGCGGCGGCACT	U97670	CCDS10111.1, CCDS61612.1, CCDS61613.1	15q21.1	2014-05-13	2007-07-27	2007-07-27	ENSG00000104131	ENSG00000104131			3270	protein-coding gene	gene with protein product		603910	"""eukaryotic translation initiation factor 3, subunit 1 alpha, 35kDa"""	EIF3S1		9822659	Standard	NM_001284335		Approved	eIF3-p35, eIF3-alpha, eIF3j	uc001ztv.3	O75822	OTTHUMG00000131158	ENST00000535391.1:c.93C>T	15.37:g.44829571C>T			Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	74	0.04	3	NM_003758	40	0.00	0		Silent	SNP	ENST00000535391.1	37																																																																																						0.726	EIF3J-002	NOVEL	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000396804.1		NM_003758	
SPG11	80208	mdanderson.org	37	15	44955776	44955776	+	Silent	SNP	G	G	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr15:44955776G>T	ENST00000261866.7	-	1	86	c.70C>A	c.(70-72)Cgg>Agg	p.R24R	SPG11_ENST00000535302.2_Silent_p.R24R|SPG11_ENST00000558319.1_Silent_p.R24R|SPG11_ENST00000427534.2_Silent_p.R24R|SPG11_ENST00000559193.1_Silent_p.R24R	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	24					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		GGTAGAACCCGCCCCATGGCC	0.706																																					p.R24R													.	.			0			c.C70A												6.0	8.0	8.0					15																	44955776		2083	4147	6230	SO:0001819	synonymous_variant	80208	exon1			GAACCCGCCCCAT		CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.70C>A	15.37:g.44955776G>T			Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	23	0.09	2	NM_025137	4	0.00	0	A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Silent	SNP	ENST00000261866.7	37	CCDS10112.1																																																																																					0.706	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000253927.1			
RASGRF1	5923	mdanderson.org	37	15	79382584	79382584	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr15:79382584T>C	ENST00000419573.3	-	1	531	c.257A>G	c.(256-258)aAg>aGg	p.K86R	RASGRF1_ENST00000558480.2_Missense_Mutation_p.K86R	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	86	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						CAGCGGCTCCTTGGCCGACAG	0.726																																					p.K86R													.	.			0			c.A257G												12.0	14.0	13.0					15																	79382584		2186	4270	6456	SO:0001583	missense	5923	exon1			GGCTCCTTGGCCG	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.257A>G	15.37:g.79382584T>C	ENSP00000405963:p.Lys86Arg		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	26	0.08	2	NM_002891	0		0	F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	ENST00000419573.3	37	CCDS10309.1	.	.	.	.	.	.	.	.	.	.	T	11.58	1.681726	0.29872	.	.	ENSG00000058335	ENST00000419573;ENST00000394741	T	0.12147	2.71	3.69	3.69	0.42338	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	1.767440	0.03047	N	0.154081	T	0.16342	0.0393	L	0.51914	1.62	0.80722	D	1	B;B;B	0.17038	0.02;0.003;0.004	B;B;B	0.17433	0.018;0.008;0.006	T	0.33803	-0.9854	10	0.13470	T	0.59	.	10.3585	0.43977	0.0:0.0:0.0:1.0	.	86;86;86	Q8IUU5;Q13972;F8VPA5	.;RGRF1_HUMAN;.	R	86	ENSP00000405963:K86R	ENSP00000378224:K86R	K	-	2	0	RASGRF1	77169639	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	2.068000	0.41471	1.548000	0.49413	0.260000	0.18958	AAG			0.726	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000291371.3		NM_002891	
LRRK1	79705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	101555582	101555582	+	Silent	SNP	T	T	A			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr15:101555582T>A	ENST00000388948.3	+	12	1943	c.1584T>A	c.(1582-1584)ggT>ggA	p.G528G	LRRK1_ENST00000284395.5_Silent_p.G525G	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CCACCAGAGGTCGCCAGCGCT	0.547											OREG0011796|OREG0023522	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)|type=TRANSCRIPTION FACTOR BINDING SITE|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip); Conservation found by scanning with a motif model																									p.G528G													.	.			0			c.T1584A												54.0	57.0	56.0					15																	101555582		2076	4217	6293	SO:0001819	synonymous_variant	79705	exon12			CAGAGGTCGCCAG	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.1584T>A	15.37:g.101555582T>A			Somatic	107	0	0	1359	WXS	Illumina HiSeq	.	83	0.24	20	NM_024652	9	0.22	2		Silent	SNP	ENST00000388948.3	37	CCDS42086.1																																																																																					0.547	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000384567.2		NM_024652	
HN1L	90861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	1748931	1748931	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr16:1748931C>G	ENST00000248098.3	+	5	562	c.505C>G	c.(505-507)Ccg>Gcg	p.P169A	HN1L_ENST00000382710.4_Missense_Mutation_p.P157A|HN1L_ENST00000562684.1_Missense_Mutation_p.P197A|HN1L_ENST00000569256.1_3'UTR|HN1L_ENST00000382711.5_Missense_Mutation_p.P153A|HN1L_ENST00000569765.1_3'UTR|HN1L_ENST00000561516.1_3'UTR	NM_144570.2	NP_653171.1	Q9H910	HN1L_HUMAN	hematological and neurological expressed 1-like	169						cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|kidney(2)|lung(3)|upper_aerodigestive_tract(1)	9						CCGGCTGGGGCCGCGGCCTCG	0.637																																					p.P169A													HN1L,NS,carcinoma,-1,1	HN1L	-1	1	0			c.C505G												56.0	69.0	65.0					16																	1748931		2199	4300	6499	SO:0001583	missense	90861	exon5			CTGGGGCCGCGGC	AK023154	CCDS10441.1	16p13.3	2006-12-13	2006-12-13	2006-12-13	ENSG00000206053	ENSG00000206053			14137	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 34"""	C16orf34		15094197	Standard	NM_144570		Approved	FLJ13092, L11, KIAA1426	uc002cmg.3	Q9H910	OTTHUMG00000047859	ENST00000248098.3:c.505C>G	16.37:g.1748931C>G	ENSP00000248098:p.Pro169Ala		Somatic	55	0	0		WXS	Illumina HiSeq	.	61	0.13	8	NM_144570	145	0.31	45	B1AJY2|Q6EIC7	Missense_Mutation	SNP	ENST00000248098.3	37	CCDS10441.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.938660	0.73557	.	.	ENSG00000206053	ENST00000248098;ENST00000382711;ENST00000382710	.	.	.	6.17	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.78635	0.4314	M	0.79258	2.445	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	T	0.79752	-0.1671	9	0.66056	D	0.02	-25.454	13.9833	0.64317	0.0:0.9285:0.0:0.0715	.	157;197;169	A6NGP5;B4DLH4;Q9H910	.;.;HN1L_HUMAN	A	169;197;157	.	ENSP00000248098:P169A	P	+	1	0	HN1L	1688932	0.999000	0.42202	0.991000	0.47740	0.289000	0.27227	4.995000	0.63908	2.941000	0.99782	0.655000	0.94253	CCG			0.637	HN1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000109086.2		NM_144570	
TBL3	10607	mdanderson.org	37	16	2027606	2027606	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr16:2027606C>T	ENST00000568546.1	+	17	1962	c.1834C>T	c.(1834-1836)Cac>Tac	p.H612Y		NM_006453.2	NP_006444.2	Q12788	TBL3_HUMAN	transducin (beta)-like 3	612					G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|intracellular signal transduction (GO:0035556)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)|receptor signaling protein activity (GO:0005057)			breast(1)|endometrium(2)|kidney(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	18						CTGGGGGCTGCACTGCAGCCG	0.642																																					p.H612Y	Melanoma(118;616 1651 35077 38081 48633)												.	.			0			c.C1834T												37.0	31.0	33.0					16																	2027606		2181	4287	6468	SO:0001583	missense	10607	exon17			GGGCTGCACTGCA	U02609	CCDS10453.1	16p13.3	2013-01-10			ENSG00000183751	ENSG00000183751		"""WD repeat domain containing"""	11587	protein-coding gene	gene with protein product		605915				8307582	Standard	NM_006453		Approved	SAZD, UTP13	uc002cnu.1	Q12788	OTTHUMG00000128710	ENST00000568546.1:c.1834C>T	16.37:g.2027606C>T	ENSP00000454836:p.His612Tyr		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	70	0.06	4	NM_006453	137	0.00	0	Q59GD6|Q8IVB7|Q96A78	Missense_Mutation	SNP	ENST00000568546.1	37	CCDS10453.1	.	.	.	.	.	.	.	.	.	.	C	17.03	3.284039	0.59867	.	.	ENSG00000183751	ENST00000332704	.	.	.	5.54	5.54	0.83059	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.75860	0.3907	L	0.53249	1.67	0.58432	D	0.999998	D;D	0.76494	0.97;0.999	P;D	0.68621	0.884;0.959	T	0.77308	-0.2636	9	0.72032	D	0.01	-30.5371	18.4479	0.90691	0.0:1.0:0.0:0.0	.	374;612	A0JLS5;Q12788	.;TBL3_HUMAN	Y	612	.	ENSP00000331815:H612Y	H	+	1	0	TBL3	1967607	1.000000	0.71417	0.987000	0.45799	0.814000	0.46013	5.814000	0.69208	2.601000	0.87937	0.561000	0.74099	CAC			0.642	TBL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250615.3		NM_006453	
CREBBP	1387	mdanderson.org	37	16	3777828	3777828	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr16:3777828G>A	ENST00000262367.5	-	31	8029	c.7220C>T	c.(7219-7221)gCa>gTa	p.A2407V	CREBBP_ENST00000382070.3_Missense_Mutation_p.A2369V	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	2407					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GGGGAGCATTGCACTCTGTTC	0.632			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.A2407V				Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	.			0			c.C7220T												88.0	85.0	86.0					16																	3777828		2197	4300	6497	SO:0001583	missense	1387	exon31			AGCATTGCACTCT	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.7220C>T	16.37:g.3777828G>A	ENSP00000262367:p.Ala2407Val		Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	70	0.07	5	NM_004380	222	0.00	0	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	37	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	g	14.43	2.534340	0.45073	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070;ENST00000323508	D;D	0.87256	-2.23;-2.15	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	D	0.92515	0.7623	M	0.64997	1.995	0.80722	D	1	D;D	0.63880	0.993;0.993	D;D	0.72625	0.978;0.978	D	0.92764	0.6226	10	0.66056	D	0.02	-13.4771	18.4232	0.90598	0.0:0.0:1.0:0.0	.	2437;2407	Q4LE28;Q92793	.;CBP_HUMAN	V	2407;2437;2369;942	ENSP00000262367:A2407V;ENSP00000371502:A2369V	ENSP00000262367:A2407V	A	-	2	0	CREBBP	3717829	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.705000	0.98719	2.668000	0.90789	0.655000	0.94253	GCA			0.632	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251591.2		NM_004380	
KAT8	84148	mdanderson.org	37	16	31142271	31142271	+	Intron	SNP	A	A	T	rs17855606	byFrequency	TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr16:31142271A>T	ENST00000543774.2	+	11	1647				KAT8_ENST00000448516.2_Silent_p.I454I|KAT8_ENST00000219797.4_Intron|RP11-388M20.2_ENST00000563605.1_RNA			Q9H7Z6	KAT8_HUMAN	K(lysine) acetyltransferase 8						chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|myeloid cell differentiation (GO:0030099)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	histone acetyltransferase complex (GO:0000123)|kinetochore (GO:0000776)|MLL1 complex (GO:0071339)|MSL complex (GO:0072487)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|methylated histone binding (GO:0035064)|transcription factor binding (GO:0008134)										GTGTCAGTATATGGACTGGTA	0.587																																					p.I454I													.	.			0			c.A1362T												7.0	8.0	7.0					16																	31142271		2125	4211	6336	SO:0001627	intron_variant	84148	exon10			CAGTATATGGACT	AF217501	CCDS10706.1, CCDS45468.1	16p11.1	2013-01-10	2011-07-21	2011-07-21	ENSG00000103510	ENSG00000103510	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17933	protein-coding gene	gene with protein product		609912	"""MYST histone acetyltransferase 1"""	MYST1		10786633	Standard	NM_032188		Approved	MOF, FLJ14040, hMOF, ZC2HC8	uc002eax.3	Q9H7Z6	OTTHUMG00000132410	ENST00000543774.2:c.1312+50A>T	16.37:g.31142271A>T			Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_182958	1	0.00	0	A8K4Z1|G5E9P2|Q659G0|Q7LC17|Q8IY59|Q8WYB4|Q8WZ14|Q9HAC5|Q9NR35	Silent	SNP	ENST00000543774.2	37	CCDS10706.1																																																																																					0.587	KAT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000255546.3		NM_032188	
CMTR2	55783	ucsc.edu	37	16	71317853	71317853	+	Silent	SNP	A	A	C	rs200001480	byFrequency	TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr16:71317853A>C	ENST00000338099.5	-	3	2307	c.1971T>G	c.(1969-1971)ggT>ggG	p.G657G	CMTR2_ENST00000434935.2_Silent_p.G657G			Q8IYT2	CMTR2_HUMAN	cap methyltransferase 2	657					7-methylguanosine mRNA capping (GO:0006370)|cap2 mRNA methylation (GO:0097310)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	mRNA (nucleoside-2'-O-)-methyltransferase activity (GO:0004483)										CAAAGATCAAACCAGCCATAA	0.423																																					p.G657G													.	FTSJD1	70		0			c.T1971G												86.0	90.0	89.0					16																	71317853		2198	4299	6497	SO:0001819	synonymous_variant	0	exon3			GATCAAACCAGCC	BC035005	CCDS10898.1	16q22.2	2013-07-23	2013-07-23	2013-07-23	ENSG00000180917	ENSG00000180917			25635	protein-coding gene	gene with protein product	"""adrift homolog (Drosophila)"""		"""FtsJ methyltransferase domain containing 1"""	FTSJD1		21310715	Standard	NM_018348		Approved	FLJ11171, AFT, MTr2	uc010cga.3	Q8IYT2	OTTHUMG00000137587	ENST00000338099.5:c.1971T>G	16.37:g.71317853A>C			Somatic	95	0.0631578947	6		RNA-Seq	Illumina HiSeq		69	0.06	4	NM_018348	39	0.13	5	B2RCD5|D3DWS1|Q8NE77|Q8NFR5|Q9H8Z4|Q9NUS3|Q9NXF5	Silent	SNP	ENST00000338099.5	37	CCDS10898.1																																																																																					0.423	CMTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268984.2		NM_018348	
ZFPM1	161882	ucsc.edu;bcgsc.ca	37	16	88552419	88552419	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr16:88552419C>T	ENST00000319555.3	+	2	435	c.113C>T	c.(112-114)aCg>aTg	p.T38M	ZFPM1_ENST00000569086.1_3'UTR	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	38					atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		CAAAAGGCCACGGCACCTGAA	0.652																																					p.T38M	Pancreas(49;850 1106 29641 32847 38344)												.	ZFPM1	32		0			c.C113T												60.0	55.0	57.0					16																	88552419		2194	4298	6492	SO:0001583	missense	161882	exon2			AGGCCACGGCACC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.113C>T	16.37:g.88552419C>T	ENSP00000326630:p.Thr38Met		Somatic	61	0	0		WXS	Illumina HiSeq		38	0.11	4	NM_153813	26	0.00	0		Missense_Mutation	SNP	ENST00000319555.3	37	CCDS32502.1	.	.	.	.	.	.	.	.	.	.	c	8.640	0.895758	0.17686	.	.	ENSG00000179588	ENST00000319555	T	0.08008	3.14	3.77	-1.15	0.09709	.	12.568400	0.01061	U	0.004643	T	0.04588	0.0125	N	0.12182	0.205	0.09310	N	1	B	0.26081	0.141	B	0.14578	0.011	T	0.32481	-0.9905	10	0.42905	T	0.14	1.0124	1.8452	0.03158	0.16:0.4852:0.1566:0.1982	.	38	Q8IX07	FOG1_HUMAN	M	38	ENSP00000326630:T38M	ENSP00000326630:T38M	T	+	2	0	ZFPM1	87079920	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.700000	0.05081	0.025000	0.15241	-1.740000	0.00687	ACG			0.652	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000422270.2			
CDK10	8558	mdanderson.org	37	16	89761464	89761464	+	Silent	SNP	C	C	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr16:89761464C>T	ENST00000353379.7	+	11	961	c.918C>T	c.(916-918)taC>taT	p.Y306Y	CDK10_ENST00000505473.1_Silent_p.Y235Y|CDK10_ENST00000331006.8_Silent_p.Y259Y	NM_001098533.2|NM_001160367.1|NM_052988.4	NP_001092003.2|NP_001153839.1|NP_443714.3	Q15131	CDK10_HUMAN	cyclin-dependent kinase 10	306	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of cell proliferation (GO:0008285)|traversing start control point of mitotic cell cycle (GO:0007089)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			ovary(1)	1		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0276)		TGTTCATGTACGACCCTAAGA	0.617																																					p.Y306Y													.	.			0			c.C918T												40.0	44.0	43.0					16																	89761464		2198	4300	6498	SO:0001819	synonymous_variant	8558	exon11			CATGTACGACCCT	L33264	CCDS10984.2, CCDS32514.1, CCDS32514.2	16q24.3	2011-11-08	2007-11-21		ENSG00000185324	ENSG00000185324		"""Cyclin-dependent kinases"""	1770	protein-coding gene	gene with protein product		603464	"""cyclin-dependent kinase (CDC2-like) 10"""			8208557, 8084611	Standard	NM_052988		Approved	PISSLRE	uc010cio.3	Q15131	OTTHUMG00000138049	ENST00000353379.7:c.918C>T	16.37:g.89761464C>T			Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	56	0.05	3	NM_052988	92	0.00	0	A8K370|A8K8I6|A8MXU6|B3KQJ3|B7Z420|D3DX82|D3DX83|Q0VGZ7|Q15130|Q6PJC0	Silent	SNP	ENST00000353379.7	37	CCDS10984.2																																																																																					0.617	CDK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000269925.2			
SRCIN1	80725	mdanderson.org	37	17	36705442	36705442	+	Missense_Mutation	SNP	C	C	A	rs372264724		TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr17:36705442C>A	ENST00000264659.7	-	16	3191	c.2967G>T	c.(2965-2967)gaG>gaT	p.E989D	SRCIN1_ENST00000398579.4_5'UTR|SRCIN1_ENST00000578925.1_Missense_Mutation_p.E1023D	NM_025248.2	NP_079524.2	Q9C0H9	SRCN1_HUMAN	SRC kinase signaling inhibitor 1	861					exocytosis (GO:0006887)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell migration (GO:0030334)|regulation of dendritic spine morphogenesis (GO:0061001)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	protein kinase binding (GO:0019901)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)	19						GCACGGTCAACTCATCTGCAG	0.627																																					p.E989D													.	.			0			c.G2967T												13.0	15.0	14.0					17																	36705442		1995	4140	6135	SO:0001583	missense	80725	exon16			GGTCAACTCATCT		CCDS45660.1	17q12	2009-12-14			ENSG00000017373	ENSG00000277363			29506	protein-coding gene	gene with protein product	"""p130Cas-associated protein"", ""SNAP-25-interacting protein"""	610786				11214970	Standard	NM_025248		Approved	SNIP, p140Cap, KIAA1684	uc002hqd.3	Q9C0H9		ENST00000264659.7:c.2967G>T	17.37:g.36705442C>A	ENSP00000264659:p.Glu989Asp		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	27	0.11	3	NM_025248	7	0.00	0	Q75T46|Q8N4W8	Missense_Mutation	SNP	ENST00000264659.7	37	CCDS45660.1	.	.	.	.	.	.	.	.	.	.	C	14.34	2.506784	0.44558	.	.	ENSG00000017373	ENST00000264659;ENST00000542707;ENST00000398579	T	0.58060	0.36	5.29	2.24	0.28232	.	0.000000	0.85682	D	0.000000	T	0.39784	0.1091	L	0.34521	1.04	0.42919	D	0.994288	B;B;B	0.23442	0.085;0.085;0.085	B;B;B	0.30943	0.074;0.122;0.074	T	0.10730	-1.0617	10	0.23891	T	0.37	-33.3281	9.5426	0.39262	0.0:0.7777:0.0:0.2223	.	861;861;989	Q9C0H9-2;Q9C0H9;Q9C0H9-5	.;SRCN1_HUMAN;.	D	989;770;843	ENSP00000264659:E989D	ENSP00000264659:E989D	E	-	3	2	SRCIN1	33958968	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	1.087000	0.30865	0.241000	0.21283	0.555000	0.69702	GAG			0.627	SRCIN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000441878.4		NM_025248	
PYY	5697	broad.mit.edu	37	17	42030831	42030831	+	Silent	SNP	C	C	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr17:42030831C>T	ENST00000360085.2	-	5	561	c.21G>A	c.(19-21)ccG>ccA	p.P7P	PYY_ENST00000592796.1_Silent_p.P7P	NM_004160.4	NP_004151	P10082	PYY_HUMAN	peptide YY	7					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|digestion (GO:0007586)|eating behavior (GO:0042755)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)			endometrium(1)|ovary(1)	2		Breast(137;0.00314)|Prostate(33;0.0724)		BRCA - Breast invasive adenocarcinoma(366;0.12)		AGGCGGGCCACGGCCTGCGCA	0.687																																					p.P7P													.	PYY	11		0			c.G21A												27.0	24.0	25.0					17																	42030831		2201	4299	6500	SO:0001819	synonymous_variant	5697	exon5			GGGCCACGGCCTG		CCDS32662.1	17q21.1	2013-02-28				ENSG00000131096		"""Endogenous ligands"""	9748	protein-coding gene	gene with protein product	"""prepro-PYY"""	600781				7782089	Standard	NM_004160		Approved	PYY1	uc002ieq.3	P10082		ENST00000360085.2:c.21G>A	17.37:g.42030831C>T			Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	152	0.04	6	NM_004160	37	0.00	0	Q5U5Q6|Q6FGH8	Silent	SNP	ENST00000360085.2	37	CCDS32662.1																																																																																					0.687	PYY-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000457658.1		NM_004160	
RNF126P1	376412	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	55123140	55123140	+	RNA	SNP	A	A	C			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr17:55123140A>C	ENST00000567452.1	+	0	302					NR_002818.2				ring finger protein 126 pseudogene 1																		GGCATCTTTGACGACAGCTTC	0.652																																					.													.	.			0			.																																											376412	.			TCTTTGACGACAG	BC033555		17q23.2	2004-04-22				ENSG00000261192		"""RING-type (C3HC4) zinc fingers"""	30340	pseudogene	pseudogene						12477932	Standard	NR_002818		Approved		uc002iuw.3				17.37:g.55123140A>C			Somatic	40	0	0		WXS	Illumina HiSeq	.	48	0.15	7	.	1	0.00	0		RNA	SNP	ENST00000567452.1	37																																																																																						0.652	RNF126P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000431453.1			
MRC2	9902	mdanderson.org	37	17	60742301	60742301	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr17:60742301C>T	ENST00000303375.5	+	2	913	c.511C>T	c.(511-513)Ccc>Tcc	p.P171S		NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	171					collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						ATGTGCTCTGCCCTACCACGG	0.642																																					p.P171S													.	.			0			c.C511T												33.0	35.0	34.0					17																	60742301		2203	4300	6503	SO:0001583	missense	9902	exon2			GCTCTGCCCTACC	AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.511C>T	17.37:g.60742301C>T	ENSP00000307513:p.Pro171Ser		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	21	0.10	2	NM_006039	101	0.00	0	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Missense_Mutation	SNP	ENST00000303375.5	37	CCDS11634.1	.	.	.	.	.	.	.	.	.	.	C	6.215	0.407824	0.11754	.	.	ENSG00000011028	ENST00000303375	T	0.31247	1.5	5.23	5.23	0.72850	Ricin B-related lectin (1);Fibronectin, type II, collagen-binding (1);Kringle-like fold (1);	0.315846	0.34700	N	0.003756	T	0.32102	0.0818	L	0.61218	1.895	0.80722	D	1	B	0.32245	0.361	B	0.26416	0.069	T	0.09796	-1.0658	10	0.21014	T	0.42	-25.7187	18.8087	0.92048	0.0:1.0:0.0:0.0	.	171	Q9UBG0	MRC2_HUMAN	S	171	ENSP00000307513:P171S	ENSP00000307513:P171S	P	+	1	0	MRC2	58096033	0.998000	0.40836	1.000000	0.80357	0.458000	0.32498	2.039000	0.41193	2.450000	0.82876	0.561000	0.74099	CCC			0.642	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000445152.1			
LAMA1	284217	broad.mit.edu	37	18	7023227	7023227	+	Silent	SNP	G	G	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr18:7023227G>T	ENST00000389658.3	-	19	2730	c.2637C>A	c.(2635-2637)ggC>ggA	p.G879G		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	879	Laminin EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CACAGTGGGCGCCATCTGTGT	0.607																																					p.G879G													.	LAMA1	458		0			c.C2637A												93.0	70.0	78.0					18																	7023227		2203	4300	6503	SO:0001819	synonymous_variant	284217	exon19			GTGGGCGCCATCT	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.2637C>A	18.37:g.7023227G>T			Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	104	0.04	4	NM_005559	15	0.00	0		Silent	SNP	ENST00000389658.3	37	CCDS32787.1																																																																																					0.607	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257369.1		NM_005559	
KATNAL2	83473	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	44584611	44584611	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr18:44584611T>C	ENST00000245121.5	+	4	316	c.122T>C	c.(121-123)aTg>aCg	p.M41T	KATNAL2_ENST00000356157.7_Missense_Mutation_p.M113T|KATNAL2_ENST00000592005.1_Intron	NM_031303.2	NP_112593.2			katanin p60 subunit A-like 2											central_nervous_system(2)|endometrium(3)|large_intestine(8)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	27						CTTAGGATGATGAACGACAGT	0.423																																					p.M41T													.	.			0			c.T122C												81.0	84.0	83.0					18																	44584611		2203	4300	6503	SO:0001583	missense	83473	exon4			GGATGATGAACGA	BC034999	CCDS32828.1	18q21.1	2010-04-21			ENSG00000167216	ENSG00000167216		"""ATPases / AAA-type"""	25387	protein-coding gene	gene with protein product		614697				12477932	Standard	NM_031303		Approved	MGC33211, DKFZP667C165	uc002lco.3	Q8IYT4		ENST00000245121.5:c.122T>C	18.37:g.44584611T>C	ENSP00000245121:p.Met41Thr		Somatic	103	0	0		WXS	Illumina HiSeq	.	81	0.16	13	NM_031303	3	0.67	2		Missense_Mutation	SNP	ENST00000245121.5	37	CCDS32828.1	.	.	.	.	.	.	.	.	.	.	T	1.526	-0.545711	0.04024	.	.	ENSG00000167216	ENST00000356157;ENST00000245121	D;D	0.92805	-3.11;-3.1	5.22	-1.81	0.07882	.	0.882371	0.10147	N	0.710145	T	0.81992	0.4940	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.64863	-0.6307	10	0.12430	T	0.62	-7.4723	7.0572	0.25106	0.0:0.4763:0.1458:0.3779	.	113	Q8IYT4	KATL2_HUMAN	T	113;41	ENSP00000348478:M113T;ENSP00000245121:M41T	ENSP00000245121:M41T	M	+	2	0	KATNAL2	42838609	0.755000	0.28372	0.000000	0.03702	0.760000	0.43138	-0.129000	0.10515	-0.539000	0.06273	0.379000	0.24179	ATG			0.423	KATNAL2-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000446138.2		NM_031303	
APC2	10297	mdanderson.org	37	19	1470177	1470177	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr19:1470177G>T	ENST00000535453.1	+	14	8590	c.6877G>T	c.(6877-6879)Gcc>Tcc	p.A2293S	APC2_ENST00000238483.4_Missense_Mutation_p.A2019S|APC2_ENST00000233607.2_Missense_Mutation_p.A2293S|C19orf25_ENST00000588427.1_Intron			P02655	APOC2_HUMAN	adenomatosis polyposis coli 2	0					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|chylomicron remnant clearance (GO:0034382)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle clearance (GO:0034384)|lipid catabolic process (GO:0016042)|lipoprotein metabolic process (GO:0042157)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipid catabolic process (GO:0060697)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|very-low-density lipoprotein particle remodeling (GO:0034372)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|kidney(4)|large_intestine(2)|lung(5)|pancreas(1)|skin(2)	18		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGCGGAGAAAGCCCCGGCCAC	0.716																																					p.A2293S													.	.			0			c.G6877T												5.0	6.0	5.0					19																	1470177		1633	3611	5244	SO:0001583	missense	10297	exon15			GAGAAAGCCCCGG		CCDS12068.1	19p13.3	2013-02-14			ENSG00000115266	ENSG00000115266		"""Armadillo repeat containing"""	24036	protein-coding gene	gene with protein product	"""adenomatous polyposis coli like"""	612034				9823329, 10021369	Standard	XM_005259475		Approved	APCL	uc002lsr.1	O95996		ENST00000535453.1:c.6877G>T	19.37:g.1470177G>T	ENSP00000442954:p.Ala2293Ser		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_005883	0		0	C0JYY4|Q9BS39|Q9UDE3|Q9UNK3	Missense_Mutation	SNP	ENST00000535453.1	37	CCDS12068.1	.	.	.	.	.	.	.	.	.	.	G	15.37	2.814026	0.50527	.	.	ENSG00000115266	ENST00000233607;ENST00000238483;ENST00000535453	D;D;D	0.93604	-3.25;-2.91;-3.25	2.44	2.44	0.29823	.	0.515907	0.17885	N	0.158707	D	0.93210	0.7837	L	0.29908	0.895	0.80722	D	1	D;D	0.67145	0.996;0.993	D;D	0.75484	0.986;0.968	D	0.92220	0.5783	10	0.52906	T	0.07	-20.3939	11.0282	0.47757	0.0:0.0:1.0:0.0	.	2292;2293	O95996-3;O95996	.;APC2_HUMAN	S	2293;2019;2293	ENSP00000233607:A2293S;ENSP00000238483:A2019S;ENSP00000442954:A2293S	ENSP00000233607:A2293S	A	+	1	0	APC2	1421177	1.000000	0.71417	0.972000	0.41901	0.188000	0.23474	3.398000	0.52579	1.693000	0.51124	0.555000	0.69702	GCC			0.716	APC2-004	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000449539.2		NM_005883	
ZNF555	148254	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	2853172	2853172	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr19:2853172G>A	ENST00000334241.4	+	4	1247	c.1109G>A	c.(1108-1110)tGc>tAc	p.C370Y	AC006130.3_ENST00000589365.1_RNA|ZNF555_ENST00000591539.1_Missense_Mutation_p.C369Y	NM_001172775.1|NM_152791.4	NP_001166246.1|NP_690004.4	Q8NEP9	ZN555_HUMAN	zinc finger protein 555	370					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(3)|urinary_tract(4)	23				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCTACGAATGCAAACAGTGT	0.448																																					p.C370Y													.	.			0			c.G1109A												82.0	71.0	75.0					19																	2853172		2203	4300	6503	SO:0001583	missense	148254	exon4			ACGAATGCAAACA	AL832140	CCDS12096.1, CCDS59329.1	19p13.3	2013-09-20			ENSG00000186300	ENSG00000186300		"""Zinc fingers, C2H2-type"", ""-"""	28382	protein-coding gene	gene with protein product						12477932	Standard	NM_152791		Approved	MGC26707	uc002lwo.3	Q8NEP9	OTTHUMG00000180500	ENST00000334241.4:c.1109G>A	19.37:g.2853172G>A	ENSP00000334853:p.Cys370Tyr		Somatic	183	0	0		WXS	Illumina HiSeq	.	115	0.10	12	NM_152791	5	0.60	3	A8KA89|K7EQM2|Q8NA46|Q96MP1	Missense_Mutation	SNP	ENST00000334241.4	37	CCDS12096.1	.	.	.	.	.	.	.	.	.	.	G	17.77	3.472017	0.63737	.	.	ENSG00000186300	ENST00000334241;ENST00000382127	D	0.85088	-1.94	3.23	3.23	0.37069	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93743	0.8000	H	0.94925	3.6	0.36404	D	0.863331	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96338	0.9249	9	0.87932	D	0	.	12.2801	0.54759	0.0:0.0:1.0:0.0	.	370;369	Q8NEP9;A8KA89	ZN555_HUMAN;.	Y	370;369	ENSP00000334853:C370Y	ENSP00000334853:C370Y	C	+	2	0	ZNF555	2804172	1.000000	0.71417	0.154000	0.22540	0.987000	0.75469	5.585000	0.67497	1.815000	0.52974	0.561000	0.74099	TGC			0.448	ZNF555-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000451637.3		NM_152791	
LPHN1	22859	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	14273727	14273727	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr19:14273727G>A	ENST00000340736.6	-	6	1198	c.901C>T	c.(901-903)Cgc>Tgc	p.R301C	CTB-55O6.12_ENST00000588387.1_RNA|LPHN1_ENST00000361434.3_Missense_Mutation_p.R296C|CTB-55O6.12_ENST00000592086.1_RNA|LPHN1_ENST00000591528.1_5'Flank	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	301	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CCCTCAAAGCGCAGTGTGTAG	0.622																																					p.R301C													.	.			0			c.C901T												93.0	67.0	76.0					19																	14273727		2203	4300	6503	SO:0001583	missense	22859	exon6			CAAAGCGCAGTGT	AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.901C>T	19.37:g.14273727G>A	ENSP00000340688:p.Arg301Cys		Somatic	70	0	0		WXS	Illumina HiSeq	.	63	0.19	12	NM_001008701	46	0.35	16	Q96IE7|Q9BU07|Q9HAR3	Missense_Mutation	SNP	ENST00000340736.6	37	CCDS32928.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.628780	0.87560	.	.	ENSG00000072071	ENST00000340736;ENST00000361434	D;D	0.90504	-2.68;-2.68	5.27	5.27	0.74061	Olfactomedin-like (3);	0.000000	0.85682	D	0.000000	D	0.95345	0.8489	M	0.79805	2.47	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95823	0.8851	10	0.87932	D	0	.	16.3786	0.83431	0.0:0.0:1.0:0.0	.	296;301	O94910-2;O94910	.;LPHN1_HUMAN	C	301;296	ENSP00000340688:R301C;ENSP00000355328:R296C	ENSP00000340688:R301C	R	-	1	0	LPHN1	14134727	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	9.779000	0.99018	2.450000	0.82876	0.655000	0.94253	CGC			0.622	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000459696.1		NM_014921	
CHERP	10523	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	16636107	16636107	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr19:16636107C>T	ENST00000198939.6	-	10	1756	c.1720G>A	c.(1720-1722)Gag>Aag	p.E574K	CTD-3222D19.2_ENST00000409035.1_Intron|CHERP_ENST00000546361.2_Missense_Mutation_p.E563K|CHERP_ENST00000544299.1_5'UTR					calcium homeostasis endoplasmic reticulum protein											endometrium(3)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|stomach(1)|urinary_tract(3)	24						GGCGGCCGCTCGAAGGGGTGC	0.697																																					p.E563K													.	.			0			c.G1687A												10.0	14.0	13.0					19																	16636107		1855	4011	5866	SO:0001583	missense	10523	exon10			GCCGCTCGAAGGG	U94836	CCDS42518.1	19p13.1	2013-01-28				ENSG00000085872		"""G patch domain containing"""	16930	protein-coding gene	gene with protein product						8896557, 10794731	Standard	NM_006387		Approved	ERPROT213-21, DAN16	uc002nei.1	Q8IWX8	OTTHUMG00000169304	ENST00000198939.6:c.1720G>A	19.37:g.16636107C>T	ENSP00000198939:p.Glu574Lys		Somatic	75	0	0		WXS	Illumina HiSeq	.	85	0.16	14	NM_006387	80	0.35	28		Missense_Mutation	SNP	ENST00000198939.6	37		.	.	.	.	.	.	.	.	.	.	C	32	5.140963	0.94560	.	.	ENSG00000085872	ENST00000546361;ENST00000198939	D;D	0.89552	-2.53;-2.53	5.13	5.13	0.70059	.	.	.	.	.	D	0.85957	0.5818	L	0.54323	1.7	0.58432	D	0.999996	D	0.61697	0.99	B	0.41764	0.366	D	0.84256	0.0480	9	0.15066	T	0.55	-24.6394	17.577	0.87953	0.0:1.0:0.0:0.0	.	563	Q8IWX8	CHERP_HUMAN	K	563;574	ENSP00000439856:E563K;ENSP00000198939:E574K	ENSP00000198939:E574K	E	-	1	0	CHERP	16497107	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.178000	0.77657	2.386000	0.81285	0.561000	0.74099	GAG			0.697	CHERP-003	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000403372.1		NM_006387	
ZNF14	7561	broad.mit.edu	37	19	19823097	19823097	+	Silent	SNP	C	C	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr19:19823097C>T	ENST00000344099.3	-	4	1131	c.993G>A	c.(991-993)ggG>ggA	p.G331G		NM_021030.2	NP_066358.2	P17017	ZNF14_HUMAN	zinc finger protein 14	331					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(2)|endometrium(1)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32		Renal(1328;0.0474)				AAGGTCGAGCCCCAGTGTGTA	0.378																																					p.G331G													ZNF14,NS,carcinoma,-1,1	ZNF14	89	1	0			c.G993A												50.0	49.0	50.0					19																	19823097		2203	4300	6503	SO:0001819	synonymous_variant	7561	exon4			TCGAGCCCCAGTG	AA286756	CCDS12409.1	19p13.11	2013-01-08	2006-05-10					"""Zinc fingers, C2H2-type"", ""-"""	12924	protein-coding gene	gene with protein product		194556	"""zinc finger protein 14 (KOX 6)"""				Standard	NM_021030		Approved	KOX6, GIOT-4	uc002nnk.1	P17017		ENST00000344099.3:c.993G>A	19.37:g.19823097C>T			Somatic	143	0	0		WXS	Illumina HiSeq	Phase_I	101	0.03	3	NM_021030	4	0.00	0	B9EGA4|Q9ULZ5	Silent	SNP	ENST00000344099.3	37	CCDS12409.1																																																																																					0.378	ZNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000460775.1		NM_021030	
APOB	338	broad.mit.edu	37	2	21266752	21266754	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	CAG	CAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr2:21266752_21266754delCAG	ENST00000233242.1	-	1	191_193	c.64_66delCTG	c.(64-66)ctgdel	p.L22del	APOB_ENST00000399256.4_In_Frame_Del_p.L22del	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	22					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGCGCCCGCcagcagcagcagc	0.793																																					p.22_22del													.	APOB	761		0			c.64_66del									3,591		1,1,295						-2.7	0.0			1	21,1493		6,9,742	no	coding	APOB	NM_000384.2		7,10,1037	A1A1,A1R,RR		1.3871,0.5051,1.1385				24,2084				SO:0001651	inframe_deletion	338	exon1			GCCCGCCAGCAGC	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.64_66delCTG	2.37:g.21266761_21266763delCAG	ENSP00000233242:p.Leu22del		Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	NM_000384	0		0	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	In_Frame_Del	DEL	ENST00000233242.1	37	CCDS1703.1																																																																																					0.793	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207571.1			
SCN7A	6332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	167313390	167313390	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr2:167313390T>A	ENST00000409855.1	-	10	1406	c.1280A>T	c.(1279-1281)gAa>gTa	p.E427V		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	427					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	CTCATCTGTTTCATTTCCTTC	0.289																																					p.E427V													.	.			0			c.A1280T												70.0	60.0	63.0					2																	167313390		1704	3841	5545	SO:0001583	missense	6332	exon10			TCTGTTTCATTTC	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.1280A>T	2.37:g.167313390T>A	ENSP00000386796:p.Glu427Val		Somatic	82	0	0		WXS	Illumina HiSeq	.	59	0.19	11	NM_002976	3	0.33	1		Missense_Mutation	SNP	ENST00000409855.1	37	CCDS46442.1	.	.	.	.	.	.	.	.	.	.	T	11.67	1.708019	0.30322	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992	D;D	0.97303	-4.33;-4.31	4.58	0.737	0.18314	.	0.542520	0.16434	N	0.214609	D	0.94512	0.8233	M	0.79693	2.465	0.09310	N	1	B	0.26400	0.148	B	0.18871	0.023	D	0.87797	0.2622	10	0.45353	T	0.12	.	2.276	0.04103	0.1547:0.0889:0.1609:0.5954	.	427	Q01118	SCN7A_HUMAN	V	427	ENSP00000386796:E427V;ENSP00000413699:E427V	ENSP00000259060:E427V	E	-	2	0	SCN7A	167021636	0.000000	0.05858	0.001000	0.08648	0.071000	0.16799	0.264000	0.18497	-0.023000	0.13963	0.454000	0.30748	GAA			0.289	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000333745.1			
Unknown	0	bcgsc.ca	37	2	186412033	186412033	+	IGR	SNP	C	C	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr2:186412033C>T								ZNF804A (607814 upstream) : U8 (114467 downstream)																							CCACTGCTTCCGATTTAACCT	0.458																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			TGCTTCCGATTTA																													2.37:g.186412033C>T			Somatic	136	0	0		WXS	Illumina HiSeq	Phase_1	106	0.14	15	.	8	0.00	0		RNA	SNP		37																																																																																					0	0.458										
SMARCAL1	50485	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	217329366	217329366	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr2:217329366C>T	ENST00000357276.4	+	13	2447	c.2117C>T	c.(2116-2118)gCt>gTt	p.A706V	SMARCAL1_ENST00000358207.5_Missense_Mutation_p.A706V	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	706					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		AACAGAACAGCTGAAGCTAAA	0.383									Schimke Immuno-Osseous Dysplasia																												p.A706V													.	.			0			c.C2117T												159.0	157.0	158.0					2																	217329366		2203	4300	6503	SO:0001583	missense	50485	exon13	Familial Cancer Database	SIOD	GAACAGCTGAAGC	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.2117C>T	2.37:g.217329366C>T	ENSP00000349823:p.Ala706Val		Somatic	70	0	0		WXS	Illumina HiSeq	.	68	0.15	10	NM_014140	63	0.22	14	A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Missense_Mutation	SNP	ENST00000357276.4	37	CCDS2403.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.724593	0.89298	.	.	ENSG00000138375	ENST00000357276;ENST00000358207;ENST00000392128	T;T;T	0.80123	-1.34;-1.34;-1.34	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.90143	0.6920	M	0.86343	2.81	0.58432	D	0.999996	P	0.51791	0.948	P	0.61132	0.884	D	0.91337	0.5094	10	0.72032	D	0.01	-14.0005	17.6906	0.88268	0.0:1.0:0.0:0.0	.	706	Q9NZC9	SMAL1_HUMAN	V	706;706;548	ENSP00000349823:A706V;ENSP00000350940:A706V;ENSP00000375974:A548V	ENSP00000349823:A706V	A	+	2	0	SMARCAL1	217037611	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	5.933000	0.70130	2.765000	0.95021	0.650000	0.86243	GCT			0.383	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256671.2			
ZCCHC3	85364	broad.mit.edu	37	20	279150	279150	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr20:279150A>G	ENST00000382352.3	+	1	1414	c.923A>G	c.(922-924)gAg>gGg	p.E308G		NM_033089.6	NP_149080	Q9NUD5	ZCHC3_HUMAN	zinc finger, CCHC domain containing 3	308							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|prostate(2)	8		all_cancers(10;0.000209)|Lung NSC(37;0.0417)|all_lung(30;0.0713)|all_epithelial(17;0.0748)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			CGCCAGGGGGAGGGCGGGGTC	0.632																																					p.E308G													.	ZCCHC3	20		0			c.A923G												47.0	53.0	51.0					20																	279150		1961	4143	6104	SO:0001583	missense	85364	exon1			AGGGGGAGGGCGG	AL034548	CCDS42844.1	20p13-p12.2	2014-04-10	2004-07-14	2004-07-14	ENSG00000177764	ENSG00000247315		"""Zinc fingers, CCHC domain containing"""	16230	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 99"""	C20orf99			Standard	NM_033089		Approved	dJ1103G7.7	uc002wdf.3	Q9NUD5	OTTHUMG00000188280	ENST00000382352.3:c.923A>G	20.37:g.279150A>G	ENSP00000371789:p.Glu308Gly		Somatic	110	0.0272727273	3		WXS	Illumina HiSeq	Phase_I	66	0.05	3	NM_033089	12	0.00	0	Q3B7J3|Q6NT79	Missense_Mutation	SNP	ENST00000382352.3	37	CCDS42844.1	.	.	.	.	.	.	.	.	.	.	A	15.77	2.930635	0.52866	.	.	ENSG00000177764	ENST00000382352	.	.	.	5.2	5.2	0.72013	.	0.263997	0.28834	N	0.013991	T	0.51210	0.1661	N	0.08118	0	0.39317	D	0.965172	D	0.76494	0.999	D	0.66716	0.946	T	0.61811	-0.6986	9	0.62326	D	0.03	-34.7009	13.0708	0.59059	1.0:0.0:0.0:0.0	.	308	Q9NUD5	ZCHC3_HUMAN	G	308	.	ENSP00000371789:E308G	E	+	2	0	ZCCHC3	227150	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.349000	0.66010	2.186000	0.69663	0.454000	0.30748	GAG			0.632	ZCCHC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077447.1			
NDRG3	57446	broad.mit.edu;ucsc.edu;mdanderson.org	37	20	35284911	35284911	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr20:35284911G>A	ENST00000349004.1	-	14	964	c.883C>T	c.(883-885)Cag>Tag	p.Q295*	NDRG3_ENST00000359675.2_Nonsense_Mutation_p.Q283*|NDRG3_ENST00000373773.3_Nonsense_Mutation_p.Q200*|NDRG3_ENST00000540765.1_Nonsense_Mutation_p.Q191*|NDRG3_ENST00000373803.2_Nonsense_Mutation_p.Q295*	NM_032013.3	NP_114402.1	Q9UGV2	NDRG3_HUMAN	NDRG family member 3	295					cell differentiation (GO:0030154)|negative regulation of cell growth (GO:0030308)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	12		Myeloproliferative disorder(115;0.00878)				TGAACTACCTGGGGCAGTCCC	0.438																																					p.Q295X													.	NDRG3	32		0			c.C883T												53.0	55.0	54.0					20																	35284911		2203	4300	6503	SO:0001587	stop_gained	57446	exon14			CTACCTGGGGCAG	AL031662	CCDS13284.1, CCDS13285.1	20q11.21-q11.23	2008-07-28			ENSG00000101079	ENSG00000101079			14462	protein-coding gene	gene with protein product		605273				10831399, 17998568	Standard	NM_032013		Approved		uc002xfw.3	Q9UGV2	OTTHUMG00000032398	ENST00000349004.1:c.883C>T	20.37:g.35284911G>A	ENSP00000345292:p.Gln295*		Somatic	210	0.0047619048	1		WXS	Illumina HiSeq	Phase_I	170	0.32	55	NM_032013	26	0.00	0	A2A2S8|E1P5U7|E1P5U8|Q5TH32|Q96PL8|Q96SM2|Q9BXY7|Q9H3N7|Q9H411|Q9H8J6	Nonsense_Mutation	SNP	ENST00000349004.1	37	CCDS13285.1	.	.	.	.	.	.	.	.	.	.	G	33	5.200100	0.94997	.	.	ENSG00000101079	ENST00000349004;ENST00000373803;ENST00000359675;ENST00000373773;ENST00000540765	.	.	.	5.09	5.09	0.68999	.	0.052672	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.3671	0.83335	0.0:0.0:1.0:0.0	.	.	.	.	X	295;295;283;200;191	.	ENSP00000345292:Q295X	Q	-	1	0	NDRG3	34718325	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	9.140000	0.94607	2.808000	0.96608	0.655000	0.94253	CAG			0.438	NDRG3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000079053.2			
ZMYND8	23613	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	45874864	45874864	+	Silent	SNP	G	G	A			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr20:45874864G>A	ENST00000311275.7	-	14	2365	c.2112C>T	c.(2110-2112)ggC>ggT	p.G704G	ZMYND8_ENST00000396281.4_Silent_p.G704G|ZMYND8_ENST00000540497.1_Silent_p.G652G|ZMYND8_ENST00000360911.3_Silent_p.G699G|ZMYND8_ENST00000536340.1_Silent_p.G731G|ZMYND8_ENST00000352431.2_Silent_p.G724G|ZMYND8_ENST00000446994.2_Silent_p.G641G|ZMYND8_ENST00000461685.1_Silent_p.G724G|ZMYND8_ENST00000372023.3_Silent_p.G699G|ZMYND8_ENST00000458360.2_Silent_p.G699G|ZMYND8_ENST00000471951.2_Silent_p.G724G|ZMYND8_ENST00000262975.4_Silent_p.G704G|ZMYND8_ENST00000468376.2_5'UTR|ZMYND8_ENST00000355972.4_Silent_p.G704G	NM_001281772.1|NM_001281778.1|NM_001281783.1	NP_001268701.1|NP_001268707.1|NP_001268712.1	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8	704					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|prostate(3)|skin(2)|urinary_tract(8)	62			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			CAGAGTCCAGGCCCAAATGGA	0.463																																					p.G724G													.	.			0			c.C2172T												160.0	154.0	156.0					20																	45874864		2203	4300	6503	SO:0001819	synonymous_variant	23613	exon14			GTCCAGGCCCAAA	U48251	CCDS13404.1, CCDS13405.1, CCDS46613.1, CCDS63300.1, CCDS63301.1, CCDS63304.1, CCDS63306.1, CCDS74738.1	20q13.12	2013-01-28	2007-01-29	2007-01-29	ENSG00000101040	ENSG00000101040		"""Zinc fingers, MYND-type"", ""Zinc fingers, PHD-type"""	9397	protein-coding gene	gene with protein product		615713	"""protein kinase C binding protein 1"""	PRKCBP1			Standard	NM_001281769		Approved	RACK7	uc002xtb.1	Q9ULU4	OTTHUMG00000032667	ENST00000311275.7:c.2112C>T	20.37:g.45874864G>A			Somatic	211	0	0		WXS	Illumina HiSeq	.	184	0.17	32	NM_183047	72	0.38	27	B3KVL2|B7Z2A8|B7Z3E0|B7Z680|B7ZM62|E1P5U5|F5H0X3|H7C0U2|J3KPU3|Q13517|Q2HXV1|Q2HXV2|Q2HXV3|Q2HXV4|Q2HXV7|Q2HXV8|Q2HXV9|Q2HXW0|Q2HXW1|Q2HXW2|Q4JJ94|Q4JJ95|Q5TH09|Q5TH11|Q6MZM1|Q8WXC5|Q9H1F3|Q9H1F4|Q9H1F5|Q9H1L8|Q9H1L9|Q9H2G5|Q9NYN3|Q9UIX6	Silent	SNP	ENST00000311275.7	37		.	.	.	.	.	.	.	.	.	.	G	9.658	1.143385	0.21205	.	.	ENSG00000101040	ENST00000467200	.	.	.	5.91	2.51	0.30379	.	.	.	.	.	T	0.42787	0.1218	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33007	-0.9885	4	.	.	.	-14.3936	0.9633	0.01400	0.1543:0.1749:0.2588:0.4119	.	.	.	.	S	632	.	.	P	-	1	0	ZMYND8	45308271	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.856000	0.27818	0.792000	0.33850	0.655000	0.94253	CCT			0.463	ZMYND8-007	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000079596.2		NM_183047	
MIR3687-2	103504728	broad.mit.edu	37	21	9825838	9825839	+	RNA	INS	-	-	GCG	rs372061766|rs369177681|rs563875271	byFrequency	TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr21:9825838_9825839insGCG	ENST00000577708.1	+	0	0				MIR3648_ENST00000581792.1_RNA	NR_037458.1																						cggccgcgactgcggcggcggt	0.842																																					.													.	.			0			.																																											0	.			CGCGACTGCGGCG																													21.37:g.9825845_9825847dupGCG			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	11	0.73	8	.	0		0		RNA	INS	ENST00000577708.1	37																																																																																						0.842	MIR3687-201	KNOWN	basic	miRNA	miRNA					
CBS	875	mdanderson.org	37	21	44478969	44478969	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr21:44478969G>T	ENST00000398165.3	-	14	1592	c.1333C>A	c.(1333-1335)Cag>Aag	p.Q445K	CBS_ENST00000398168.1_Missense_Mutation_p.Q445K|CBS_ENST00000352178.5_Missense_Mutation_p.Q445K|CBS_ENST00000398158.1_Missense_Mutation_p.Q445K|CBS_ENST00000544202.1_Missense_Mutation_p.Q357K|CBS_ENST00000359624.3_Missense_Mutation_p.Q445K	NM_000071.2	NP_000062.1	P35520	CBS_HUMAN	cystathionine-beta-synthase	445	CBS. {ECO:0000255|PROSITE- ProRule:PRU00703}.				cellular nitrogen compound metabolic process (GO:0034641)|cysteine biosynthetic process from serine (GO:0006535)|cysteine biosynthetic process via cystathionine (GO:0019343)|homocysteine catabolic process (GO:0043418)|homocysteine metabolic process (GO:0050667)|hydrogen sulfide biosynthetic process (GO:0070814)|L-cysteine catabolic process (GO:0019448)|L-serine catabolic process (GO:0006565)|L-serine metabolic process (GO:0006563)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|transsulfuration (GO:0019346)	cytosol (GO:0005829)|nucleus (GO:0005634)	adenyl nucleotide binding (GO:0030554)|cystathionine beta-synthase activity (GO:0004122)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|modified amino acid binding (GO:0072341)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(8)	17					L-Cysteine(DB00151)|L-Serine(DB00133)|S-Adenosylmethionine(DB00118)	ACGGGCGCCTGGTCGAAGCCC	0.662																																					p.Q445K													.	.			0			c.C1333A												33.0	33.0	33.0					21																	44478969		2178	4275	6453	SO:0001583	missense	875	exon14			GCGCCTGGTCGAA	L14577	CCDS13693.1	21q22.3	2014-09-17			ENSG00000160200	ENSG00000160200	4.2.1.22		1550	protein-coding gene	gene with protein product		613381				9790750	Standard	NM_000071		Approved	HIP4	uc002zcv.2	P35520	OTTHUMG00000086834	ENST00000398165.3:c.1333C>A	21.37:g.44478969G>T	ENSP00000381231:p.Gln445Lys		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	24	0.13	3	NM_001178009	174	0.00	0	B2R993|D3DSK4|Q99425|Q9BWC5	Missense_Mutation	SNP	ENST00000398165.3	37	CCDS13693.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.8|26.8	4.776484|4.776484	0.90195|0.90195	.|.	.|.	ENSG00000160200|ENSG00000160200	ENST00000451248|ENST00000398158;ENST00000398165;ENST00000359624;ENST00000352178;ENST00000398168;ENST00000539520;ENST00000544202	.|D;D;D;D;D;D	.|0.93547	.|-3.24;-3.24;-3.24;-3.24;-3.24;-3.24	4.71|4.71	4.71|4.71	0.59529|0.59529	.|Cystathionine beta-synthase, core (3);	.|0.061461	.|0.64402	.|D	.|0.000002	D|D	0.96747|0.96747	0.8938|0.8938	M|M	0.87269|0.87269	2.87|2.87	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D;D	.|0.64830	.|0.984;0.994;0.962	.|P;D;P	.|0.63113	.|0.825;0.911;0.782	D|D	0.97657|0.97657	1.0158|1.0158	5|10	.|0.87932	.|D	.|0	-33.5509|-33.5509	17.3489|17.3489	0.87317|0.87317	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|445;445;402	.|P35520-2;P35520;B7Z2D6	.|.;CBS_HUMAN;.	Q|K	28|445;445;445;445;445;402;357	.|ENSP00000381225:Q445K;ENSP00000381231:Q445K;ENSP00000352643:Q445K;ENSP00000344460:Q445K;ENSP00000381234:Q445K;ENSP00000439332:Q357K	.|ENSP00000344460:Q445K	P|Q	-|-	2|1	0|0	CBS|CBS	43352038|43352038	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.925000|0.925000	0.55904|0.55904	9.217000|9.217000	0.95160|0.95160	2.192000|2.192000	0.70111|0.70111	0.558000|0.558000	0.71614|0.71614	CCA|CAG			0.662	CBS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000195525.1		NM_000071	
KREMEN1	83999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	29521294	29521294	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr22:29521294A>G	ENST00000407188.1	+	5	515	c.515A>G	c.(514-516)aAt>aGt	p.N172S	KREMEN1_ENST00000400335.4_Missense_Mutation_p.N174S|KREMEN1_ENST00000327813.5_Missense_Mutation_p.N174S|KREMEN1_ENST00000400338.2_Missense_Mutation_p.N174S			Q96MU8	KREM1_HUMAN	kringle containing transmembrane protein 1	172	WSC. {ECO:0000255|PROSITE- ProRule:PRU00558}.				cell communication (GO:0007154)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	20						TGTGGAAACAATCCTGATTAC	0.547																																					p.N174S													.	.			0			c.A521G												178.0	186.0	184.0					22																	29521294		2156	4265	6421	SO:0001583	missense	83999	exon5			GAAACAATCCTGA	AB059618	CCDS43000.1, CCDS13849.1, CCDS43000.2	22q12.1	2008-03-27	2002-11-13	2002-11-15	ENSG00000183762	ENSG00000183762			17550	protein-coding gene	gene with protein product		609898	"""kringle containing transmembrane protein"""	KREMEN		11267660	Standard	NM_001039570		Approved	KRM1	uc011akm.1	Q96MU8	OTTHUMG00000030987	ENST00000407188.1:c.515A>G	22.37:g.29521294A>G	ENSP00000385431:p.Asn172Ser		Somatic	116	0	0		WXS	Illumina HiSeq	.	80	0.21	17	NM_001039570	12	0.33	4	B0QY46|B0QY47|B1AJR5|Q5TIB9|Q6P3X6|Q9BY70|Q9UGS5|Q9UGU1	Missense_Mutation	SNP	ENST00000407188.1	37	CCDS43000.2	.	.	.	.	.	.	.	.	.	.	A	9.888	1.203493	0.22121	.	.	ENSG00000183762	ENST00000400335;ENST00000400338;ENST00000327813;ENST00000407188	T;T;T;T	0.52295	0.67;0.67;0.67;0.67	5.74	4.71	0.59529	Carbohydrate-binding WSC (2);	0.080880	0.49916	D	0.000124	T	0.24084	0.0583	N	0.03948	-0.315	0.38960	D	0.958524	P;P;B	0.47253	0.892;0.571;0.005	B;B;B	0.42495	0.389;0.124;0.005	T	0.08126	-1.0737	10	0.17369	T	0.5	.	10.3953	0.44196	0.9223:0.0:0.0777:0.0	.	172;174;174	Q96MU8;Q96MU8-2;Q96MU8-3	KREM1_HUMAN;.;.	S	174;174;174;172	ENSP00000383189:N174S;ENSP00000383192:N174S;ENSP00000331242:N174S;ENSP00000385431:N172S	ENSP00000331242:N174S	N	+	2	0	KREMEN1	27851294	1.000000	0.71417	0.991000	0.47740	0.139000	0.21198	6.868000	0.75516	1.106000	0.41623	0.528000	0.53228	AAT			0.547	KREMEN1-004	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320947.1			
TMEM115	11070	mdanderson.org	37	3	50396199	50396199	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr3:50396199A>G	ENST00000266025.3	-	1	842	c.296T>C	c.(295-297)cTc>cCc	p.L99P	XXcos-LUCA11.5_ENST00000606589.1_Intron	NM_007024.4	NP_008955.1	Q12893	TM115_HUMAN	transmembrane protein 115	99					negative regulation of cell proliferation (GO:0008285)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(2)|endometrium(1)|lung(1)|prostate(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		GAAGAAGATGAGCAGCTCCAA	0.607																																					p.L99P													.	.			0			c.T296C												68.0	81.0	76.0					3																	50396199		2203	4300	6503	SO:0001583	missense	11070	exon1			AAGATGAGCAGCT	BC011948	CCDS2828.1	3p21.31	2008-11-04			ENSG00000126062	ENSG00000126062			30055	protein-coding gene	gene with protein product	"""placental protein 6"""	607069				11085536	Standard	NM_007024		Approved	PL6	uc003dan.1	Q12893	OTTHUMG00000044212	ENST00000266025.3:c.296T>C	3.37:g.50396199A>G	ENSP00000266025:p.Leu99Pro		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_007024	116	0.00	0	A2IDB7|O14568|Q6IAY4|Q9UIX3	Missense_Mutation	SNP	ENST00000266025.3	37	CCDS2828.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.456353	0.84317	.	.	ENSG00000126062	ENST00000266025	T	0.16196	2.36	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.45617	0.1351	M	0.83774	2.66	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.50874	-0.8776	10	0.72032	D	0.01	12.0165	14.4388	0.67301	1.0:0.0:0.0:0.0	.	99	Q12893	TM115_HUMAN	P	99	ENSP00000266025:L99P	ENSP00000266025:L99P	L	-	2	0	TMEM115	50371203	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.994000	0.93529	2.110000	0.64415	0.460000	0.39030	CTC			0.607	TMEM115-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000102784.3		NM_007024	
RBM15B	29890	broad.mit.edu;bcgsc.ca	37	3	51430005	51430023	+	Frame_Shift_Del	DEL	GGGCTAAGGTGGCCATGTC	GGGCTAAGGTGGCCATGTC	-			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	GGGCTAAGGTGGCCATGTC	GGGCTAAGGTGGCCATGTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr3:51430005_51430023delGGGCTAAGGTGGCCATGTC	ENST00000323686.4	+	1	1275_1293	c.1175_1193delGGGCTAAGGTGGCCATGTC	c.(1174-1194)agggctaaggtggccatgtcgfs	p.RAKVAMS392fs		NM_013286.4	NP_037418.3	Q8NDT2	RB15B_HUMAN	RNA binding motif protein 15B	392	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|large_intestine(5)|lung(3)	12				BRCA - Breast invasive adenocarcinoma(193;0.000224)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		ATGGCCCATAGGGCTAAGGTGGCCATGTCGGGCCGAGTG	0.589																																					p.392_398del													RBM15B,colon,carcinoma,0,1	RBM15B	47	1	0			c.1175_1193del																																									SO:0001589	frameshift_variant	29890	exon1			CCCATAGGGCTAA	AL831838	CCDS33764.1	3p21.1	2013-02-12			ENSG00000179837	ENSG00000259956		"""RNA binding motif (RRM) containing"""	24303	protein-coding gene	gene with protein product		612602				16129689	Standard	NM_013286		Approved	HUMAGCGB, OTT3	uc003dbd.3	Q8NDT2	OTTHUMG00000156896	ENST00000323686.4:c.1175_1193delGGGCTAAGGTGGCCATGTC	3.37:g.51430005_51430023delGGGCTAAGGTGGCCATGTC	ENSP00000313890:p.Arg392fs		Somatic	146	0	0		WXS	Illumina HiSeq	Phase_I	109	0.08	9	NM_013286	64	0.00	0	A4QPG7|Q6QE19|Q9BV96	Frame_Shift_Del	DEL	ENST00000323686.4	37	CCDS33764.1																																																																																					0.589	RBM15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000346489.1		NM_013286	
PARP9	83666	broad.mit.edu	37	3	122255025	122255025	+	Silent	SNP	C	C	G			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr3:122255025C>G	ENST00000360356.2	-	10	2402	c.2175G>C	c.(2173-2175)tcG>tcC	p.S725S	PARP9_ENST00000471785.1_Silent_p.S690S|PARP9_ENST00000492382.1_Silent_p.S270S|PARP9_ENST00000477522.2_Silent_p.S690S|PARP9_ENST00000462315.1_Silent_p.S690S	NM_001146102.1|NM_031458.2	NP_001139574.1|NP_113646.2	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	725	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				cell migration (GO:0016477)|double-strand break repair (GO:0006302)|regulation of response to interferon-gamma (GO:0060330)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	34				GBM - Glioblastoma multiforme(114;0.0519)		CGCAAGGTGTCGAGTACATTC	0.463																																					p.S725S													.	PARP9	72		0			c.G2175C												219.0	182.0	195.0					3																	122255025		2203	4300	6503	SO:0001819	synonymous_variant	83666	exon10			AGGTGTCGAGTAC	AF307339	CCDS3014.1, CCDS54633.1, CCDS54634.1	3q13-q21	2010-02-16			ENSG00000138496	ENSG00000138496		"""Poly (ADP-ribose) polymerases"""	24118	protein-coding gene	gene with protein product		612065				11110709	Standard	NM_031458		Approved	BAL, BAL1	uc003efi.3	Q8IXQ6	OTTHUMG00000159522	ENST00000360356.2:c.2175G>C	3.37:g.122255025C>G			Somatic	283	0	0		WXS	Illumina HiSeq	Phase_I	277	0.02	6	NM_031458	140	0.04	6	A8KA94|B2R8S9|E9PFM7|Q8TCP3|Q9BZL8|Q9BZL9	Silent	SNP	ENST00000360356.2	37	CCDS3014.1																																																																																					0.463	PARP9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000355957.1	rescued with RNA-seq	NM_031458	
CLSTN2	64084	mdanderson.org	37	3	140281041	140281041	+	Silent	SNP	G	G	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr3:140281041G>T	ENST00000458420.3	+	13	2293	c.2103G>T	c.(2101-2103)gtG>gtT	p.V701V		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	701					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						ACATTTTGGTGATCGGAGGGG	0.488										HNSCC(16;0.037)																											p.V701V	GBM(45;858 913 3709 36904 37282)												.	.			0			c.G2103T												107.0	103.0	104.0					3																	140281041		2203	4300	6503	SO:0001819	synonymous_variant	64084	exon13			TTTGGTGATCGGA	AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.2103G>T	3.37:g.140281041G>T			Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	69	0.06	4	NM_022131	4	0.00	0	B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Silent	SNP	ENST00000458420.3	37	CCDS3112.1																																																																																					0.488	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000359393.3		NM_022131	
CHST2	9435	broad.mit.edu	37	3	142840095	142840095	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr3:142840095T>G	ENST00000309575.3	+	2	1821	c.437T>G	c.(436-438)gTt>gGt	p.V146G		NM_004267.4	NP_004258.2	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2	146					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|multicellular organismal development (GO:0007275)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(2)	22						ATGGCGGGGGTTGCGGCCCCT	0.731																																					p.V146G													.	CHST2	67		0			c.T437G												6.0	8.0	7.0					3																	142840095		2129	4205	6334	SO:0001583	missense	9435	exon2			CGGGGGTTGCGGC	BC042160	CCDS3129.1	3q24	2007-03-14			ENSG00000175040	ENSG00000175040		"""Sulfotransferases, membrane-bound"""	1970	protein-coding gene	gene with protein product		603798				10049591	Standard	NM_004267		Approved	C6ST	uc003evm.3	Q9Y4C5	OTTHUMG00000159351	ENST00000309575.3:c.437T>G	3.37:g.142840095T>G	ENSP00000307911:p.Val146Gly		Somatic	44	0.2954545455	13		WXS	Illumina HiSeq	Phase_I	45	0.27	12	NM_004267	34	0.06	2	D3DNG5|Q2M370|Q9GZN5|Q9UED5|Q9Y6F2	Missense_Mutation	SNP	ENST00000309575.3	37	CCDS3129.1	.	.	.	.	.	.	.	.	.	.	T	2.191	-0.385339	0.04966	.	.	ENSG00000175040	ENST00000309575	D	0.96459	-4.02	4.3	-0.151	0.13411	.	.	.	.	.	D	0.86293	0.5898	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.76691	-0.2866	9	0.15066	T	0.55	-25.9731	5.8433	0.18645	0.0:0.5203:0.2944:0.1853	.	146	Q9Y4C5	CHST2_HUMAN	G	146	ENSP00000307911:V146G	ENSP00000307911:V146G	V	+	2	0	CHST2	144322785	0.035000	0.19736	0.067000	0.19924	0.009000	0.06853	0.045000	0.14013	0.074000	0.16767	-0.548000	0.04221	GTT			0.731	CHST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000354850.1		NM_004267	
PRSS12	8492	broad.mit.edu	37	4	119252936	119252936	+	Silent	SNP	T	T	G			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr4:119252936T>G	ENST00000296498.3	-	4	1188	c.906A>C	c.(904-906)ggA>ggC	p.G302G		NM_003619.3	NP_003610.2	P56730	NETR_HUMAN	protease, serine, 12 (neurotrypsin, motopsin)	302	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.				exocytosis (GO:0006887)|zymogen activation (GO:0031638)	axon (GO:0030424)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)|terminal bouton (GO:0043195)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(3)|kidney(1)|large_intestine(9)|lung(11)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	29						CACAAACGGTTCCCCACTGGC	0.527																																					p.G302G													.	PRSS12	71		0			c.A906C												89.0	79.0	82.0					4																	119252936		2203	4300	6503	SO:0001819	synonymous_variant	8492	exon4			AACGGTTCCCCAC	AJ001531	CCDS3709.1	4q25-q26	2010-05-07			ENSG00000164099	ENSG00000164099		"""Serine peptidases / Serine peptidases"""	9477	protein-coding gene	gene with protein product		606709				9540828, 9245503	Standard	NM_003619		Approved	BSSP-3, MRT1	uc003ica.2	P56730	OTTHUMG00000161166	ENST00000296498.3:c.906A>C	4.37:g.119252936T>G			Somatic	372	0.0080645161	3		WXS	Illumina HiSeq	Phase_I	302	0.03	8	NM_003619	10	0.00	0	Q9UP16	Silent	SNP	ENST00000296498.3	37	CCDS3709.1																																																																																					0.527	PRSS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256516.2			
SLC6A19	340024	hgsc.bcm.edu	37	5	1216727	1216727	+	Silent	SNP	G	G	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr5:1216727G>T	ENST00000304460.10	+	7	998	c.942G>T	c.(940-942)tcG>tcT	p.S314S		NM_001003841.2	NP_001003841.1	Q695T7	S6A19_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 19	314					amino acid transport (GO:0006865)|ion transport (GO:0006811)|response to nutrient (GO:0007584)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|neutral amino acid transmembrane transporter activity (GO:0015175)	p.S314S(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(25)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			GCTTCACATCGGTGTATGTGG	0.587																																					p.S314S													SLC6A19,brain,primitive_neuroectodermal_tumour-medulloblastoma,0,1	SLC6A19	0	1	1	Substitution - coding silent(1)	central_nervous_system(1)	c.G942T												295.0	211.0	240.0					5																	1216727		2203	4300	6503	SO:0001819	synonymous_variant	340024	exon7			CACATCGGTGTAT	AK096054	CCDS34130.1	5p15	2013-07-19			ENSG00000174358	ENSG00000174358		"""Solute carriers"""	27960	protein-coding gene	gene with protein product	"""Hartnup disease"""	608893					Standard	NM_001003841		Approved		uc003jbw.4	Q695T7	OTTHUMG00000161636	ENST00000304460.10:c.942G>T	5.37:g.1216727G>T			Somatic	124	0	0		WXS	Illumina HiSeq	.	82	0.05	4	NM_001003841	4	0.00	0	A8K446	Silent	SNP	ENST00000304460.10	37	CCDS34130.1																																																																																					0.587	SLC6A19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000365557.1		XM_291120	
PCDHGB1	56104	broad.mit.edu	37	5	140730563	140730563	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr5:140730563G>T	ENST00000523390.1	+	1	736	c.736G>T	c.(736-738)Gtt>Ttt	p.V246F	PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	246	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTATACAGGGTTAGCCTCCA	0.562																																					p.V246F													.	PCDHGB1	198		0			c.G736T												89.0	93.0	92.0					5																	140730563		2011	4175	6186	SO:0001583	missense	0	exon1			TACAGGGTTAGCC	AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.736G>T	5.37:g.140730563G>T	ENSP00000429273:p.Val246Phe		Somatic	135	0	0		WXS	Illumina HiSeq	Phase_I	114	0.03	3	NM_018922	0		0	Q3SY75|Q9Y5C8	Missense_Mutation	SNP	ENST00000523390.1	37	CCDS54923.1	.	.	.	.	.	.	.	.	.	.	.	14.41	2.525996	0.44969	.	.	ENSG00000254221	ENST00000523390	T	0.01099	5.34	5.44	4.57	0.56435	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.05868	0.0153	M	0.71581	2.175	0.58432	D	0.999997	D;D	0.60575	0.986;0.988	D;D	0.69479	0.955;0.964	T	0.10941	-1.0608	9	0.72032	D	0.01	.	14.0984	0.65039	0.0739:0.0:0.9261:0.0	.	246;246	Q9Y5G3-2;Q9Y5G3	.;PCDGD_HUMAN	F	246	ENSP00000429273:V246F	ENSP00000429273:V246F	V	+	1	0	PCDHGB1	140710747	0.970000	0.33590	0.186000	0.23195	0.564000	0.35744	5.612000	0.67681	1.409000	0.46915	0.563000	0.77884	GTT			0.562	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000374740.1		NM_018922	
TBC1D9B	23061	mdanderson.org	37	5	179306156	179306156	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr5:179306156G>T	ENST00000356834.3	-	9	1495	c.1458C>A	c.(1456-1458)ttC>ttA	p.F486L	TBC1D9B_ENST00000355235.3_Missense_Mutation_p.F486L	NM_198868.2	NP_942568.2	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)	486						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	28	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CGTACTCGAAGAAGTGGATGT	0.622																																					p.F486L													.	.			0			c.C1458A												61.0	54.0	56.0					5																	179306156		2203	4300	6503	SO:0001583	missense	23061	exon9			CTCGAAGAAGTGG	AB014576	CCDS4450.1, CCDS43408.1	5q35.3	2013-01-10			ENSG00000197226	ENSG00000197226		"""EF-hand domain containing"""	29097	protein-coding gene	gene with protein product						9734811	Standard	NM_198868		Approved	KIAA0676	uc003mlh.3	Q66K14	OTTHUMG00000130911	ENST00000356834.3:c.1458C>A	5.37:g.179306156G>T	ENSP00000349291:p.Phe486Leu		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	12	0.17	2	NM_015043	90	0.00	0	D3DWQ5|D3DWQ6|O75163|Q53EY0|Q6MZI2|Q96H49	Missense_Mutation	SNP	ENST00000356834.3	37	CCDS43408.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.47|14.47	2.546111|2.546111	0.45383|0.45383	.|.	.|.	ENSG00000197226|ENSG00000197226	ENST00000356834;ENST00000355235|ENST00000522472	T;T|.	0.04049|.	3.72;3.72|.	5.28|5.28	3.49|3.49	0.39957|0.39957	Rab-GAP/TBC domain (1);|.	0.115737|.	0.64402|.	D|.	0.000011|.	T|T	0.72993|0.72993	0.3530|0.3530	M|M	0.83312|0.83312	2.635|2.635	0.80722|0.80722	D|D	1|1	P;P;B|.	0.47191|.	0.826;0.891;0.011|.	P;P;B|.	0.55577|.	0.606;0.779;0.056|.	T|T	0.71922|0.71922	-0.4446|-0.4446	10|5	0.33141|.	T|.	0.24|.	-27.9664|-27.9664	9.3107|9.3107	0.37903|0.37903	0.2219:0.0:0.7781:0.0|0.2219:0.0:0.7781:0.0	.|.	486;486;486|.	A1L3A9;Q66K14-2;Q66K14|.	.;.;TBC9B_HUMAN|.	L|I	486|40	ENSP00000349291:F486L;ENSP00000347375:F486L|.	ENSP00000347375:F486L|.	F|L	-|-	3|1	2|0	TBC1D9B|TBC1D9B	179238762|179238762	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.646000|0.646000	0.38490|0.38490	2.923000|2.923000	0.48868|0.48868	0.615000|0.615000	0.30124|0.30124	0.550000|0.550000	0.68814|0.68814	TTC|CTT			0.622	TBC1D9B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000253501.3		NM_015043	
GNB2L1	10399	broad.mit.edu;mdanderson.org	37	5	180668627	180668627	+	Silent	SNP	C	C	A			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr5:180668627C>A	ENST00000512805.1	-	3	702	c.294G>T	c.(292-294)acG>acT	p.T98T	GNB2L1_ENST00000514455.1_5'Flank|GNB2L1_ENST00000505461.1_5'UTR|GNB2L1_ENST00000456394.2_Silent_p.T98T|GNB2L1_ENST00000376817.4_Silent_p.T54T|SNORD95_ENST00000579879.1_RNA|SNORD96A_ENST00000606577.1_RNA|GNB2L1_ENST00000511566.1_Silent_p.T98T|GNB2L1_ENST00000511900.1_Intron|GNB2L1_ENST00000504726.1_Intron	NM_006098.4	NP_006089.1	P63244	GBLP_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1	98				Missing (in Ref. 4; BAG53102). {ECO:0000305}.	activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cell cycle (GO:0007049)|gastrulation (GO:0007369)|negative regulation of cell growth (GO:0030308)|negative regulation of gene expression (GO:0010629)|negative regulation of hydrogen peroxide-induced neuron death (GO:1903208)|negative regulation of phagocytosis (GO:0050765)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein tyrosine kinase activity (GO:0061099)|negative regulation of translation (GO:0017148)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP catabolic process (GO:0030822)|positive regulation of cell migration (GO:0030335)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|positive regulation of gastrulation (GO:2000543)|positive regulation of GTPase activity (GO:0043547)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein phosphorylation (GO:0001934)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|regulation of protein localization (GO:0032880)|rhythmic process (GO:0048511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|phagocytic cup (GO:0001891)|small ribosomal subunit (GO:0015935)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|ion channel inhibitor activity (GO:0008200)|poly(A) RNA binding (GO:0044822)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase inhibitor activity (GO:0030292)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|SH2 domain binding (GO:0042169)			lung(3)|skin(2)	5	all_cancers(89;8.79e-06)|all_epithelial(37;1.13e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0654)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.101)|all cancers(165;0.11)		CAAATCGCCTCGTGGTGGTGC	0.502																																					p.T98T													.	GNB2L1	22		0			c.G294T												105.0	88.0	94.0					5																	180668627		2203	4300	6503	SO:0001819	synonymous_variant	10399	exon3			TCGCCTCGTGGTG	M24194	CCDS34324.1	5q35.3	2013-01-10				ENSG00000204628		"""WD repeat domain containing"""	4399	protein-coding gene	gene with protein product	"""Receptor for Activated C Kinase 1"""	176981				8302854, 2499885	Standard	NM_006098		Approved	Gnb2-rs1, RACK1, H12.3	uc003mni.1	P63244		ENST00000512805.1:c.294G>T	5.37:g.180668627C>A			Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	45	0.11	5	NM_006098	2875	0.30	862	B3KTJ0|D3DWS0|P25388|P99049|Q53HU2|Q5J8M6|Q5VLR4|Q6FH47	Silent	SNP	ENST00000512805.1	37	CCDS34324.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.27|14.27	2.485057|2.485057	0.44147|0.44147	.|.	.|.	ENSG00000204628|ENSG00000204628	ENST00000502905;ENST00000504128|ENST00000507756	.|.	.|.	.|.	5.76|5.76	-11.5|-11.5	0.00074|0.00074	.|.	.|.	.|.	.|.	.|.	.|T	.|0.52757	.|0.1754	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.69514	.|-0.5125	.|5	.|0.87932	.|D	.|0	-6.752|-6.752	6.7187|6.7187	0.23318|0.23318	0.0822:0.4598:0.0896:0.3684|0.0822:0.4598:0.0896:0.3684	.|.	.|.	.|.	.|.	X|L	16;5|29	.|.	.|ENSP00000426270:R61L	E|R	-|-	1|2	0|0	GNB2L1|GNB2L1	180601233|180601233	0.009000|0.009000	0.17119|0.17119	0.003000|0.003000	0.11579|0.11579	0.310000|0.310000	0.27922|0.27922	-1.224000|-1.224000	0.02959|0.02959	-1.735000|-1.735000	0.01353|0.01353	-0.140000|-0.140000	0.14226|0.14226	GAG|CGA			0.502	GNB2L1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000372943.2		NM_006098	
BTN2A2	10385	hgsc.bcm.edu	37	6	26384092	26384092	+	Missense_Mutation	SNP	C	C	T	rs546542545		TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr6:26384092C>T	ENST00000356709.4	+	2	154	c.43C>T	c.(43-45)Ctc>Ttc	p.L15F	BTN2A2_ENST00000432533.2_Missense_Mutation_p.L15F|BTN2A2_ENST00000352867.2_Missense_Mutation_p.L15F|BTN2A2_ENST00000469230.1_Missense_Mutation_p.L15F|BTN2A2_ENST00000416795.2_Missense_Mutation_p.L15F|BTN2A2_ENST00000482536.1_Missense_Mutation_p.L15F	NM_001197240.1|NM_006995.4	NP_001184169.1|NP_008926.2	Q8WVV5	BT2A2_HUMAN	butyrophilin, subfamily 2, member A2	15					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cellular metabolic process (GO:0031324)|negative regulation of cytokine secretion (GO:0050710)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|large_intestine(5)|lung(13)	23						GCCAGCCTCcctcctcctcct	0.587																																					p.L15F													BTN2A2_ENST00000432533,bladder,carcinoma,-1,2	BTN2A2_ENST00000432533	-1	2	0			c.C43T												191.0	138.0	156.0					6																	26384092		2203	4300	6503	SO:0001583	missense	10385	exon2			GCCTCCCTCCTCC	U90550	CCDS4606.1, CCDS4607.1, CCDS56401.1, CCDS56402.1, CCDS56403.1	6p22.1	2014-01-14			ENSG00000124508	ENSG00000124508		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1137	protein-coding gene	gene with protein product		613591				10354554, 9149941	Standard	NM_006995		Approved	BTF2, BT2.2, BTN2.2	uc003nhq.3	Q8WVV5	OTTHUMG00000014452	ENST00000356709.4:c.43C>T	6.37:g.26384092C>T	ENSP00000349143:p.Leu15Phe		Somatic	92	0.0108695652	1		WXS	Illumina HiSeq	.	100	0.05	5	NM_181531	36	0.00	0	A6NM84|B4DE97|B4DQ01|E9PH07|O00480	Missense_Mutation	SNP	ENST00000356709.4	37	CCDS4606.1	.	.	.	.	.	.	.	.	.	.	c	14.03	2.412871	0.42817	.	.	ENSG00000124508	ENST00000469230;ENST00000356709;ENST00000352867;ENST00000493275;ENST00000472507;ENST00000482536;ENST00000432533;ENST00000416795;ENST00000494184;ENST00000483410	T;T;T;T;T;T;D;T;T;T	0.90444	3.76;1.1;0.43;4.24;3.36;-0.21;-2.67;1.1;2.29;3.8	2.01	1.1	0.20463	.	0.656368	0.12607	N	0.454165	T	0.62085	0.2399	N	0.08118	0	0.21675	N	0.999591	B;B;B;B;B;B	0.24132	0.003;0.008;0.098;0.014;0.003;0.003	B;B;B;B;B;B	0.15052	0.002;0.003;0.012;0.006;0.002;0.002	T	0.57562	-0.7790	10	0.87932	D	0	.	4.8159	0.13367	0.0:0.8071:0.0:0.1929	.	15;15;15;15;15;15	E9PH07;B4DQ01;B4E3J1;Q8WVV5-2;A6NM84;Q8WVV5	.;.;.;.;.;BT2A2_HUMAN	F	15	ENSP00000417472:L15F;ENSP00000349143:L15F;ENSP00000337117:L15F;ENSP00000418857:L15F;ENSP00000419226:L15F;ENSP00000419451:L15F;ENSP00000394241:L15F;ENSP00000399308:L15F;ENSP00000417511:L15F;ENSP00000418176:L15F	ENSP00000337117:L15F	L	+	1	0	BTN2A2	26492071	0.000000	0.05858	0.368000	0.25939	0.580000	0.36256	-0.390000	0.07332	0.383000	0.24910	0.298000	0.19748	CTC			0.587	BTN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040117.1			
BTN2A3P	54718	broad.mit.edu	37	6	26422353	26422353	+	RNA	SNP	C	C	T	rs571530750	byFrequency	TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr6:26422353C>T	ENST00000466808.2	+	0	7							Q96KV6	BT2A3_HUMAN	butyrophilin, subfamily 2, member A3, pseudogene							integral component of membrane (GO:0016021)		p.P3S(2)									GCTCATGGAACCAGCTGCTGC	0.622													C|||	7	0.00139776	0.0023	0.0	5008	,	,		16376	0.001		0.0	False		,,,				2504	0.0031				.													BTN2A3,NS,carcinoma,0,9	.		9	2	Substitution - Missense(2)	endometrium(1)|kidney(1)	.																																											0	.			ATGGAACCAGCTG	AL021917		6p22.1	2014-01-14	2011-09-06	2011-09-06	ENSG00000124549	ENSG00000124549		"""Butyrophilins"""	13229	pseudogene	pseudogene		613592	"""butyrophilin, subfamily 2, member A3"""	BTN2A3			Standard	NR_027795		Approved	BTN2.3	uc011dkl.1	Q96KV6	OTTHUMG00000014453		6.37:g.26422353C>T			Somatic	77	0.012987013	1		WXS	Illumina HiSeq	Phase_I	61	0.07	4	.	9	0.00	0	A6NEF4	RNA	SNP	ENST00000466808.2	37																																																																																						0.622	BTN2A3P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000040118.4		NR_027795	
NKAPL	222698	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	28228082	28228082	+	Silent	SNP	T	T	C			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr6:28228082T>C	ENST00000343684.3	+	1	985	c.933T>C	c.(931-933)taT>taC	p.Y311Y	ZKSCAN4_ENST00000423974.2_5'Flank	NM_001007531.1	NP_001007532.1	Q5M9Q1	NKAPL_HUMAN	NFKB activating protein-like	311										breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31						TGGCTGAGTATGTAAAAGCTG	0.448																																					p.Y311Y													NKAPL,NS,carcinoma,0,1	NKAPL	0	1	0			c.T933C												126.0	127.0	127.0					6																	28228082		2203	4300	6503	SO:0001819	synonymous_variant	222698	exon1			TGAGTATGTAAAA	BC038240	CCDS34353.1	6p21.33	2008-02-05	2007-08-16	2007-08-16	ENSG00000189134	ENSG00000189134			21584	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 194"""	C6orf194			Standard	NM_001007531		Approved	bA424I5.1	uc003nkt.4	Q5M9Q1	OTTHUMG00000014517	ENST00000343684.3:c.933T>C	6.37:g.28228082T>C			Somatic	115	0	0		WXS	Illumina HiSeq	.	113	0.10	11	NM_001007531	4	0.00	0	Q3MIV1|Q9H4Q7	Silent	SNP	ENST00000343684.3	37	CCDS34353.1																																																																																					0.448	NKAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040185.1			
TNFAIP3	7128	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	138200293	138200293	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr6:138200293G>C	ENST00000237289.4	+	7	1777	c.1711G>C	c.(1711-1713)Gtc>Ctc	p.V571L		NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	571	Interaction with TNIP1. {ECO:0000250}.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)|p.V571I(1)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		CTCGCGGCTCGTCCGGAGCCC	0.632			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																p.V571L	GBM(130;153 1739 22295 28918 47987)			Rec	yes		6	6q23	7128	"""tumor necrosis factor, alpha-induced protein 3"""		L	TNFAIP3,rectum,carcinoma,-1,2	TNFAIP3	-1	2	26	Whole gene deletion(25)|Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(26)	c.G1711C												56.0	62.0	60.0					6																	138200293		2203	4300	6503	SO:0001583	missense	7128	exon7			CGGCTCGTCCGGA	M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.1711G>C	6.37:g.138200293G>C	ENSP00000237289:p.Val571Leu		Somatic	65	0.0307692308	2		WXS	Illumina HiSeq	.	52	0.17	9	NM_001270507	56	0.14	8	B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Missense_Mutation	SNP	ENST00000237289.4	37	CCDS5187.1	.	.	.	.	.	.	.	.	.	.	G	2.975	-0.211559	0.06140	.	.	ENSG00000118503	ENST00000237289;ENST00000535574;ENST00000544646	T	0.21932	1.98	5.84	-4.67	0.03319	.	1.311420	0.04429	N	0.368847	T	0.03348	0.0097	N	0.22421	0.69	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.35674	-0.9779	10	0.31617	T	0.26	-21.4622	4.3053	0.10944	0.3632:0.0909:0.4171:0.1288	.	571	P21580	TNAP3_HUMAN	L	571	ENSP00000237289:V571L	ENSP00000237289:V571L	V	+	1	0	TNFAIP3	138241986	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	0.086000	0.14935	-1.131000	0.02910	-1.165000	0.01757	GTC			0.632	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042414.1			
HIVEP2	3097	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	143091135	143091135	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr6:143091135T>C	ENST00000367604.1	-	4	5380	c.4741A>G	c.(4741-4743)Agc>Ggc	p.S1581G	HIVEP2_ENST00000367603.2_Missense_Mutation_p.S1581G|HIVEP2_ENST00000012134.2_Missense_Mutation_p.S1581G			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1581	Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		CTCTGTGGGCTCATGCTCATG	0.557																																					p.S1581G	Esophageal Squamous(107;843 1510 13293 16805 42198)												.	HIVEP2	225		0			c.A4741G												102.0	109.0	107.0					6																	143091135		2081	4219	6300	SO:0001583	missense	3097	exon5			GTGGGCTCATGCT	M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.4741A>G	6.37:g.143091135T>C	ENSP00000356576:p.Ser1581Gly		Somatic	165	0.0060606061	1		WXS	Illumina HiSeq	Phase_I	159	0.20	32	NM_006734	8	0.25	2	Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	ENST00000367604.1	37	CCDS43510.1	.	.	.	.	.	.	.	.	.	.	T	16.92	3.255306	0.59321	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.03035	4.07;4.07;4.07	6.06	6.06	0.98353	.	0.035254	0.85682	D	0.000000	T	0.06371	0.0164	M	0.64567	1.98	0.51767	D	0.999932	D	0.60575	0.988	P	0.52343	0.696	T	0.19516	-1.0303	10	0.48119	T	0.1	-17.9503	16.6154	0.84909	0.0:0.0:0.0:1.0	.	1581	P31629	ZEP2_HUMAN	G	1581	ENSP00000356576:S1581G;ENSP00000356575:S1581G;ENSP00000012134:S1581G	ENSP00000012134:S1581G	S	-	1	0	HIVEP2	143132828	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.092000	0.71414	2.315000	0.78130	0.533000	0.62120	AGC			0.557	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042495.1			
CREB5	9586	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	28547354	28547354	+	Splice_Site	SNP	G	G	A	rs142741982		TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr7:28547354G>A	ENST00000357727.2	+	4	680	c.290G>A	c.(289-291)cGg>cAg	p.R97Q	CREB5_ENST00000409603.1_Splice_Site_p.R64Q|CREB5_ENST00000396299.2_Splice_Site_p.R64Q|CREB5_ENST00000396300.2_Splice_Site_p.R90Q	NM_182898.2	NP_878901.2	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5	97					adipose tissue development (GO:0060612)|fat cell differentiation (GO:0045444)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(13)|prostate(1)|skin(3)	32						AGCAGCAAGCGGGTAGGTTTG	0.562																																					p.R97Q													CREB5,rectum,carcinoma,+1,1	CREB5	1	1	0			c.G290A												85.0	91.0	89.0					7																	28547354		2203	4300	6503	SO:0001630	splice_region_variant	9586	exon4			GCAAGCGGGTAGG	L05515	CCDS5417.1, CCDS5418.1, CCDS43562.1, CCDS43563.1	7p15	2013-01-10			ENSG00000146592	ENSG00000146592		"""basic leucine zipper proteins"""	16844	protein-coding gene	gene with protein product	"""cAMP response element binding protein CRE-Bpa"""					8378084, 8440710	Standard	XM_005249906		Approved	H_GS165L15.1, CRE-BPA	uc003szr.3	Q02930	OTTHUMG00000097081	ENST00000357727.2:c.291+1G>A	7.37:g.28547354G>A			Somatic	91	0	0		WXS	Illumina HiSeq	.	71	0.15	11	NM_182898	0		0	A8KA51|B4DU13|B5BUH3|C9JK47|Q05886|Q06246|Q75N02|Q86UJ9	Missense_Mutation	SNP	ENST00000357727.2	37	CCDS5417.1	.	.	.	.	.	.	.	.	.	.	G	13.43	2.235326	0.39498	.	.	ENSG00000146592	ENST00000396299;ENST00000424599;ENST00000357727;ENST00000396300;ENST00000409603	T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44	5.49	5.49	0.81192	.	0.055994	0.64402	D	0.000001	T	0.22282	0.0537	N	0.21448	0.665	0.80722	D	1	B	0.14438	0.01	B	0.04013	0.001	T	0.07195	-1.0785	10	0.11794	T	0.64	-22.8426	18.1451	0.89652	0.0:0.0:1.0:0.0	.	97	Q02930	CREB5_HUMAN	Q	64;90;97;90;64	ENSP00000379593:R64Q;ENSP00000394088:R90Q;ENSP00000350359:R97Q;ENSP00000379594:R90Q;ENSP00000387197:R64Q	ENSP00000350359:R97Q	R	+	2	0	CREB5	28513879	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	6.925000	0.75829	2.592000	0.87571	0.655000	0.94253	CGG	0		0.562	CREB5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000214204.4		NM_004904	Missense_Mutation
VWC2	375567	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	49815586	49815586	+	Silent	SNP	G	G	C			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr7:49815586G>C	ENST00000340652.4	+	2	1111	c.555G>C	c.(553-555)ccG>ccC	p.P185P		NM_198570.3	NP_940972.2	Q2TAL6	VWC2_HUMAN	von Willebrand factor C domain containing 2	185	VWFC 1. {ECO:0000255|PROSITE- ProRule:PRU00220}.				negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of neuron differentiation (GO:0045666)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|basement membrane (GO:0005604)|cell junction (GO:0030054)|extracellular space (GO:0005615)|interstitial matrix (GO:0005614)|synapse (GO:0045202)				cervix(1)|endometrium(2)|large_intestine(1)|lung(3)|prostate(1)	8						AGGAGGGGCCGCTGTGCGCGC	0.706																																					p.P185P													.	.			0			c.G555C												10.0	13.0	12.0					7																	49815586		2156	4205	6361	SO:0001819	synonymous_variant	375567	exon2			GGGGCCGCTGTGC	AY358393	CCDS5508.1	7p12.3-p12.2	2007-07-19			ENSG00000188730	ENSG00000188730			30200	protein-coding gene	gene with protein product	"""brorin"", ""brain-specific chordin-like"""	611108				17400546	Standard	NM_198570		Approved	PSST739, UNQ739	uc003tot.1	Q2TAL6	OTTHUMG00000129265	ENST00000340652.4:c.555G>C	7.37:g.49815586G>C			Somatic	16	0	0		WXS	Illumina HiSeq	.	22	0.23	5	NM_198570	0		0	Q6UXE2	Silent	SNP	ENST00000340652.4	37	CCDS5508.1																																																																																					0.706	VWC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251375.2		NM_198570	
TMEM229A	730130	broad.mit.edu;mdanderson.org	37	7	123672968	123672968	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr7:123672968C>G	ENST00000455783.1	-	1	555	c.90G>C	c.(88-90)gaG>gaC	p.E30D	RP5-921G16.1_ENST00000484322.1_RNA	NM_001136002.1	NP_001129474.1	B2RXF0	T229A_HUMAN	transmembrane protein 229A	30						host cell nucleus (GO:0042025)|integral component of membrane (GO:0016021)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)	6						CGGCTGCCGCCTCGCTTCCTg	0.771																																					p.E30D													.	TMEM229A	31		0			c.G90C												2.0	3.0	2.0					7																	123672968		375	1069	1444	SO:0001583	missense	730130	exon1			TGCCGCCTCGCTT	BC157828	CCDS47694.1	7q31.32	2009-09-22			ENSG00000234224	ENSG00000234224			37279	protein-coding gene	gene with protein product							Standard	NM_001136002		Approved		uc011kob.2	B2RXF0	OTTHUMG00000154762	ENST00000455783.1:c.90G>C	7.37:g.123672968C>G	ENSP00000395244:p.Glu30Asp		Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	16	0.19	3	NM_001136002	0		0	A4D0X6	Missense_Mutation	SNP	ENST00000455783.1	37	CCDS47694.1	.	.	.	.	.	.	.	.	.	.	C	10.51	1.371126	0.24771	.	.	ENSG00000234224	ENST00000455783	.	.	.	2.69	1.77	0.24775	.	.	.	.	.	T	0.24160	0.0585	N	0.14661	0.345	0.09310	N	1	B	0.19935	0.04	B	0.12837	0.008	T	0.18241	-1.0343	8	0.36615	T	0.2	.	8.0213	0.30410	0.0:0.8522:0.0:0.1478	.	30	B2RXF0	T229A_HUMAN	D	30	.	ENSP00000395244:E30D	E	-	3	2	TMEM229A	123460204	0.001000	0.12720	0.016000	0.15963	0.200000	0.23975	0.944000	0.29043	-0.029000	0.13827	-1.443000	0.01068	GAG			0.771	TMEM229A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000336960.3		NM_001136002	
ZC3HC1	51530	mdanderson.org	37	7	129691202	129691202	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr7:129691202G>A	ENST00000358303.4	-	1	89	c.5C>T	c.(4-6)gCg>gTg	p.A2V	ZC3HC1_ENST00000311873.5_5'UTR|ZC3HC1_ENST00000360708.5_Missense_Mutation_p.A2V|ZC3HC1_ENST00000481503.1_Missense_Mutation_p.A2V	NM_016478.3	NP_057562.3	Q86WB0	NIPA_HUMAN	zinc finger, C3HC-type containing 1	2					mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|protein ubiquitination (GO:0016567)	nuclear membrane (GO:0031965)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(6)|large_intestine(10)|lung(2)|prostate(1)|urinary_tract(1)	22	Melanoma(18;0.0435)					ACAGGGCGCCGCCATCTTGGT	0.602																																					p.A2V	Melanoma(115;540 1606 16325 28853 48167)												.	.			0			c.C5T												40.0	43.0	42.0					7																	129691202		2203	4300	6503	SO:0001583	missense	51530	exon1			GGCGCCGCCATCT	AF151050	CCDS34753.1, CCDS64767.1, CCDS75659.1	7q32.2	2013-01-17			ENSG00000091732	ENSG00000091732		"""Zinc fingers, C3HC-type"""	29913	protein-coding gene	gene with protein product	"""nuclear interaction partner of ALK"""					11042152	Standard	XM_005250403		Approved	NIPA	uc003vpi.3	Q86WB0	OTTHUMG00000157648	ENST00000358303.4:c.5C>T	7.37:g.129691202G>A	ENSP00000351052:p.Ala2Val		Somatic	119	0	0		WXS	Illumina HiSeq	Phase_I	95	0.05	5	NM_016478	8	0.00	0	A6NH66|Q75MF3|Q75MF4|Q8N330|Q96F75|Q9HA34|Q9NVX4|Q9P0R0	Missense_Mutation	SNP	ENST00000358303.4	37	CCDS34753.1	.	.	.	.	.	.	.	.	.	.	G	18.16	3.561785	0.65538	.	.	ENSG00000091732	ENST00000358303;ENST00000360708;ENST00000481503;ENST00000480193	T;T;T	0.50001	1.37;0.8;0.76	5.2	4.25	0.50352	.	0.061103	0.64402	D	0.000004	T	0.32793	0.0841	L	0.29908	0.895	0.80722	D	1	P	0.51653	0.947	B	0.37508	0.252	T	0.30504	-0.9976	10	0.62326	D	0.03	-11.1516	12.7085	0.57076	0.0:0.0:0.8251:0.1749	.	2	Q86WB0	NIPA_HUMAN	V	2	ENSP00000351052:A2V;ENSP00000353933:A2V;ENSP00000418533:A2V	ENSP00000351052:A2V	A	-	2	0	ZC3HC1	129478438	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	3.208000	0.51114	2.715000	0.92844	0.561000	0.74099	GCG			0.602	ZC3HC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000349316.1		NM_016478	
SSPO	23145	mdanderson.org	37	7	149509500	149509500	+	RNA	SNP	G	G	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr7:149509500G>T	ENST00000378016.2	+	0	9898							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			ACAGGGGGAGGTCTGCCAGGC	0.706																																					p.V3300F													.	.			0			c.G9898T												11.0	13.0	12.0					7																	149509500		1939	4107	6046			23145	exon69			GGGGAGGTCTGCC	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149509500G>T			Somatic	27	0.037037037	1		WXS	Illumina HiSeq	Phase_I	19	0.11	2	NM_198455	0		0	Q76B61	Missense_Mutation	SNP	ENST00000378016.2	37																																																																																						0.706	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript					
FAM83A	84985	broad.mit.edu	37	8	124219616	124219616	+	Silent	SNP	C	C	G			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr8:124219616C>G	ENST00000518448.1	+	5	3007	c.993C>G	c.(991-993)tcC>tcG	p.S331S	FAM83A_ENST00000536633.1_Silent_p.S331S|FAM83A_ENST00000276699.6_Silent_p.S331S|FAM83A_ENST00000522648.1_Silent_p.S275S|FAM83A_ENST00000318462.6_Silent_p.S331S|FAM83A_ENST00000546351.1_Silent_p.S275S			Q86UY5	FA83A_HUMAN	family with sequence similarity 83, member A	331	Ser-rich.									breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(2)|skin(1)	17	Lung NSC(37;1.55e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			ACCGCACGTCCTCCAACCCCT	0.741																																					p.S331S													.	FAM83A	64		0			c.C993G												12.0	15.0	14.0					8																	124219616		2185	4282	6467	SO:0001819	synonymous_variant	84985	exon4			CACGTCCTCCAAC	BC052300	CCDS6339.1, CCDS6340.1, CCDS75784.1	8q24.13	2014-03-13			ENSG00000147689	ENSG00000147689			28210	protein-coding gene	gene with protein product						22886303	Standard	XM_005251087		Approved	MGC14128, BJ-TSA-9	uc003ypx.3	Q86UY5	OTTHUMG00000165083	ENST00000518448.1:c.993C>G	8.37:g.124219616C>G			Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	58	0.05	3	NM_032899	0		0	Q71HL2|Q8N7I1|Q96I47	Silent	SNP	ENST00000518448.1	37	CCDS6340.1																																																																																					0.741	FAM83A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381737.1		NM_032899	
LINC01410	103352539	broad.mit.edu	37	9	66459814	66459814	+	lincRNA	DEL	T	T	-			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr9:66459814delT	ENST00000424345.1	+	0	74				RNA5SP283_ENST00000365604.1_RNA																							ccaggatttgtccccagtgcc	0.348																																					.													.	.			0			.																																											0	.			GATTTGTCCCCAG																													9.37:g.66459814delT			Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	4	0.00	0		RNA	DEL	ENST00000424345.1	37																																																																																						0.348	RP11-262H14.1-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000128851.1			
TRPM6	140803	mdanderson.org	37	9	77390989	77390989	+	Missense_Mutation	SNP	G	G	T	rs376920206		TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr9:77390989G>T	ENST00000360774.1	-	24	3450	c.3213C>A	c.(3211-3213)aaC>aaA	p.N1071K	TRPM6_ENST00000449912.2_Missense_Mutation_p.N1066K|TRPM6_ENST00000451710.3_Missense_Mutation_p.N1071K|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000376864.4_Missense_Mutation_p.N1071K|TRPM6_ENST00000376872.3_Intron|TRPM6_ENST00000361255.3_Missense_Mutation_p.N1066K	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1071			N -> D (in dbSNP:rs2274922).		calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						CTAAGTAAACGTTGCTGTAAG	0.413																																					p.N1071K													.	.			0			c.C3213A												83.0	93.0	89.0					9																	77390989		2203	4300	6503	SO:0001583	missense	140803	exon24			GTAAACGTTGCTG	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.3213C>A	9.37:g.77390989G>T	ENSP00000354006:p.Asn1071Lys		Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	53	0.06	3	NM_017662	0		0	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	37	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	G	17.45	3.392992	0.62066	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000449912;ENST00000361255;ENST00000376864;ENST00000312449;ENST00000448641	T;T;T;T;T	0.57907	0.44;0.44;0.44;0.44;0.37	5.49	-6.89	0.01660	.	0.085849	0.85682	D	0.000000	T	0.60209	0.2251	M	0.84082	2.675	0.39432	D	0.967103	P;P;D	0.54601	0.945;0.942;0.967	B;P;P	0.51297	0.443;0.665;0.646	T	0.74487	-0.3649	10	0.87932	D	0	.	16.379	0.83439	0.3935:0.0:0.6065:0.0	.	1071;1066;1066	Q9BX84;Q9BX84-3;Q9BX84-2	TRPM6_HUMAN;.;.	K	1071;1071;1066;1066;1071;734;734	ENSP00000354006:N1071K;ENSP00000407341:N1071K;ENSP00000396672:N1066K;ENSP00000354962:N1066K;ENSP00000366060:N1071K	ENSP00000309693:N734K	N	-	3	2	TRPM6	76580809	0.248000	0.23930	0.869000	0.34112	0.829000	0.46940	-0.177000	0.09796	-1.181000	0.02730	-0.948000	0.02665	AAC			0.413	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000052693.1		NM_017662	
ANKS6	203286	hgsc.bcm.edu	37	9	101546298	101546298	+	Missense_Mutation	SNP	G	G	T	rs376042242		TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr9:101546298G>T	ENST00000353234.4	-	4	1096	c.1049C>A	c.(1048-1050)gCg>gAg	p.A350E	ANKS6_ENST00000540940.1_Missense_Mutation_p.A155E|ANKS6_ENST00000375018.1_Missense_Mutation_p.A350E|ANKS6_ENST00000375019.2_Missense_Mutation_p.A49E			Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain containing 6	350						cilium (GO:0005929)|cytoplasm (GO:0005737)				endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	21		Acute lymphoblastic leukemia(62;0.0527)				GTCAACATCCGCGTGCCTCTC	0.642																																					p.A350E													ANKS6,NS,carcinoma,-1,1	ANKS6	-1	1	0			c.C1049A												57.0	63.0	61.0					9																	101546298		2175	4270	6445	SO:0001583	missense	203286	exon4			ACATCCGCGTGCC	AK094247	CCDS43856.1	9q31.1	2013-09-10	2006-02-17	2006-02-17	ENSG00000165138	ENSG00000165138		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26724	protein-coding gene	gene with protein product		615370	"""sterile alpha motif domain containing 6"", ""ankyrin repeat domain 14"""	SAMD6, ANKRD14		23793029	Standard	XM_005251793		Approved	FLJ36928, NPHP16	uc004ayu.3	Q68DC2	OTTHUMG00000020347	ENST00000353234.4:c.1049C>A	9.37:g.101546298G>T	ENSP00000297837:p.Ala350Glu		Somatic	61	0	0		WXS	Illumina HiSeq	.	49	0.04	2	NM_173551	29	0.00	0	A0SE62|Q5VSL0|Q5VSL2|Q5VSL3|Q5VSL4|Q68DB8|Q6P2R2|Q8N9L6|Q96D62	Missense_Mutation	SNP	ENST00000353234.4	37	CCDS43856.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.034540	0.75617	.	.	ENSG00000165138	ENST00000375019;ENST00000375018;ENST00000353234;ENST00000540940	T;T;T;T	0.61742	0.85;0.85;0.85;0.08	5.52	5.52	0.82312	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.81009	0.4734	M	0.89658	3.05	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	D	0.84493	0.0612	10	0.87932	D	0	-20.8171	17.2881	0.87147	0.0:0.0:1.0:0.0	.	350	Q68DC2	ANKS6_HUMAN	E	49;350;350;155	ENSP00000364159:A49E;ENSP00000364158:A350E;ENSP00000297837:A350E;ENSP00000442189:A155E	ENSP00000297837:A350E	A	-	2	0	ANKS6	100586119	1.000000	0.71417	0.182000	0.23118	0.313000	0.28021	6.447000	0.73465	2.746000	0.94184	0.650000	0.86243	GCG			0.642	ANKS6-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000277053.1		NM_173551	
LRRC37A5P	652972	broad.mit.edu	37	9	114370697	114370698	+	RNA	INS	-	-	A			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr9:114370697_114370698insA	ENST00000374304.1	-	0	506							Q49AS3	L37A5_HUMAN	leucine rich repeat containing 37, member A5, pseudogene																		TTTTTAGTGAGAAAAAAAAAAG	0.347																																					.													.	.			0			.																																											0	.			TAGTGAGAAAAAA	BC031236		9q31.3	2012-10-16	2012-03-07	2012-03-07	ENSG00000204173	ENSG00000204173			23369	pseudogene	pseudogene			"""chromosome 9 open reading frame 29"""	C9orf29			Standard	NR_034087		Approved		uc022bly.1	Q49AS3	OTTHUMG00000020494		9.37:g.114370707_114370707dupA			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	6	0.50	3	.	0		0	Q5JVP0	RNA	INS	ENST00000374304.1	37																																																																																						0.347	LRRC37A5P-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000053655.2		NR_034087	
SURF6	6838	bcgsc.ca	37	9	136198944	136198944	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr9:136198944G>T	ENST00000372022.4	-	5	1112	c.847C>A	c.(847-849)Cgt>Agt	p.R283S	SURF6_ENST00000468290.1_5'UTR	NM_006753.4	NP_006744.2	O75683	SURF6_HUMAN	surfeit 6	283					ribosome biogenesis (GO:0042254)	granular component (GO:0001652)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	12				OV - Ovarian serous cystadenocarcinoma(145;1.16e-06)|Epithelial(140;8.34e-06)|all cancers(34;7.08e-05)		TCGTCGTCACGGATCTTCACG	0.682																																					p.R283S													.	SURF6	32		0			c.C847A												64.0	59.0	61.0					9																	136198944		2203	4300	6503	SO:0001583	missense	6838	exon5			CGTCACGGATCTT	AF186772	CCDS6962.1	9q33-q34	2010-07-06			ENSG00000148296	ENSG00000148296			11478	protein-coding gene	gene with protein product	"""surfeit locus protein 6"""	185642				9740673, 15629442	Standard	NM_006753		Approved	FLJ30322, RRP14	uc004cdb.4	O75683	OTTHUMG00000020871	ENST00000372022.4:c.847C>A	9.37:g.136198944G>T	ENSP00000361092:p.Arg283Ser		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_1	44	0.09	4	NM_006753	126	0.00	0	Q5T8U1|Q9BRK9|Q9BTZ5|Q9UK24	Missense_Mutation	SNP	ENST00000372022.4	37	CCDS6962.1	.	.	.	.	.	.	.	.	.	.	G	16.57	3.161143	0.57368	.	.	ENSG00000148296	ENST00000372022	T	0.16073	2.37	5.15	4.22	0.49857	.	0.249082	0.37178	N	0.002209	T	0.35537	0.0935	M	0.73962	2.25	0.37006	D	0.895513	D	0.54397	0.966	P	0.58660	0.843	T	0.41963	-0.9479	10	0.56958	D	0.05	-12.5828	11.7322	0.51744	0.0:0.0:0.6682:0.3318	.	283	O75683	SURF6_HUMAN	S	283	ENSP00000361092:R283S	ENSP00000361092:R283S	R	-	1	0	SURF6	135188765	1.000000	0.71417	0.829000	0.32907	0.343000	0.28985	3.406000	0.52637	1.094000	0.41399	0.467000	0.42956	CGT			0.682	SURF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054905.1		NM_006753	
ARSF	416	broad.mit.edu	37	X	3030575	3030575	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chrX:3030575G>A	ENST00000381127.1	+	11	1972	c.1751G>A	c.(1750-1752)cGg>cAg	p.R584Q	ARSF_ENST00000537104.1_Missense_Mutation_p.R584Q|ARSF_ENST00000359361.2_Missense_Mutation_p.R584Q	NM_001201538.1|NM_001201539.1	NP_001188467.1|NP_001188468.1	P54793	ARSF_HUMAN	arylsulfatase F	584					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	38		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TCTCAGCCTCGGGGTCCTAAC	0.488																																					p.R584Q													.	ARSF	97		0			c.G1751A												39.0	32.0	34.0					X																	3030575		2203	4300	6503	SO:0001583	missense	416	exon11			AGCCTCGGGGTCC	X97868	CCDS14123.1	Xp22.3	2013-02-14			ENSG00000062096	ENSG00000062096		"""Arylsulfatase family"""	721	protein-coding gene	gene with protein product		300003				7720070	Standard	NM_004042		Approved		uc022brz.1	P54793	OTTHUMG00000021081	ENST00000381127.1:c.1751G>A	X.37:g.3030575G>A	ENSP00000370519:p.Arg584Gln		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	141	0.04	6	NM_004042	1	0.00	0	Q8TCC5	Missense_Mutation	SNP	ENST00000381127.1	37	CCDS14123.1	.	.	.	.	.	.	.	.	.	.	g	5.958	0.360698	0.11296	.	.	ENSG00000062096	ENST00000381127;ENST00000537104;ENST00000359361	D;D;D	0.95918	-3.85;-3.85;-3.85	2.46	-0.34	0.12643	.	.	.	.	.	D	0.84552	0.5497	N	0.14661	0.345	0.09310	N	1	P	0.44627	0.839	B	0.33846	0.171	T	0.78922	-0.2013	9	0.21014	T	0.42	.	3.266	0.06865	0.3922:0.0:0.4143:0.1935	.	584	P54793	ARSF_HUMAN	Q	584	ENSP00000370519:R584Q;ENSP00000445594:R584Q;ENSP00000352319:R584Q	ENSP00000352319:R584Q	R	+	2	0	ARSF	3040575	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.013000	0.03645	-0.310000	0.08766	-1.939000	0.00497	CGG			0.488	ARSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055652.1			
RAI2	10742	broad.mit.edu	37	X	17819967	17819967	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chrX:17819967G>T	ENST00000545871.1	-	3	624	c.164C>A	c.(163-165)gCc>gAc	p.A55D	RAI2_ENST00000415486.3_Intron|RAI2_ENST00000360011.1_Missense_Mutation_p.A55D|RAI2_ENST00000451717.1_Missense_Mutation_p.A55D|RAI2_ENST00000331511.1_Missense_Mutation_p.A55D	NM_001172739.1|NM_001172743.1	NP_001166210|NP_001166214	Q9Y5P3	RAI2_HUMAN	retinoic acid induced 2	55					embryo development (GO:0009790)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	22	Hepatocellular(33;0.183)					AATGGATGGGGCTGGCACGGT	0.602																																					p.A55D													.	RAI2	66		0			c.C164A												94.0	93.0	93.0					X																	17819967		2203	4300	6503	SO:0001583	missense	10742	exon3			GATGGGGCTGGCA	Z93242	CCDS14183.1, CCDS55374.1	Xp22	2008-02-05			ENSG00000131831	ENSG00000131831			9835	protein-coding gene	gene with protein product		300217				10049581, 10394933	Standard	NR_033348		Approved		uc010nfa.3	Q9Y5P3	OTTHUMG00000021209	ENST00000545871.1:c.164C>A	X.37:g.17819967G>T	ENSP00000444210:p.Ala55Asp		Somatic	120	0	0		WXS	Illumina HiSeq	Phase_I	208	0.02	5	NM_001172739	25	0.00	0	B1B1K2|B4DQM9|E7EMN4|Q8N6X7	Missense_Mutation	SNP	ENST00000545871.1	37	CCDS14183.1	.	.	.	.	.	.	.	.	.	.	G	14.07	2.426784	0.43020	.	.	ENSG00000131831	ENST00000331511;ENST00000360011;ENST00000545871;ENST00000451717	T;T;T;T	0.39997	1.05;1.05;1.05;1.05	5.5	4.63	0.57726	.	0.344597	0.27039	N	0.021239	T	0.39145	0.1067	L	0.27053	0.805	0.80722	D	1	P	0.37158	0.585	B	0.42827	0.399	T	0.35301	-0.9794	10	0.72032	D	0.01	-16.9152	15.5332	0.75980	0.0:0.1348:0.8652:0.0	.	55	Q9Y5P3	RAI2_HUMAN	D	55	ENSP00000333456:A55D;ENSP00000353106:A55D;ENSP00000444210:A55D;ENSP00000401323:A55D	ENSP00000333456:A55D	A	-	2	0	RAI2	17729888	1.000000	0.71417	0.950000	0.38849	0.847000	0.48162	9.132000	0.94455	1.088000	0.41272	0.529000	0.55759	GCC			0.602	RAI2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055937.1		NM_021785	
CHDC2	286464	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	36091305	36091305	+	Silent	SNP	A	A	C			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chrX:36091305A>C	ENST00000313548.4	+	4	426	c.240A>C	c.(238-240)tcA>tcC	p.S80S		NM_173695.2	NP_775966.1	Q8N9S7	CHDC2_HUMAN	calponin homology domain containing 2	80						integral component of membrane (GO:0016021)											GTGAAACATCAGAGGAAGATC	0.358																																					p.S80S													.	.			0			c.A240C												79.0	72.0	75.0					X																	36091305		2202	4300	6502	SO:0001819	synonymous_variant	286464	exon4			AACATCAGAGGAA	AK093920	CCDS14238.1	Xp21.1	2014-08-07	2012-11-28	2012-11-28	ENSG00000176034	ENSG00000176034			26708	protein-coding gene	gene with protein product			"""chromosome X open reading frame 59"""	CXorf59			Standard	NM_173695		Approved	FLJ36601, RP13-11B7.1	uc004ddk.1	Q8N9S7	OTTHUMG00000021351	ENST00000313548.4:c.240A>C	X.37:g.36091305A>C			Somatic	287	0	0		WXS	Illumina HiSeq	.	363	0.49	177	NM_173695	0		0		Silent	SNP	ENST00000313548.4	37	CCDS14238.1																																																																																					0.358	CHDC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_173695	
ZNF182	7569	mdanderson.org	37	X	47847944	47847944	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chrX:47847944G>T	ENST00000396965.1	-	4	402	c.52C>A	c.(52-54)Cag>Aag	p.Q18K	ZNF182_ENST00000376943.3_Intron|ZNF182_ENST00000305127.6_Missense_Mutation_p.Q18K	NM_001178099.1	NP_001171570.1	P17025	ZN182_HUMAN	zinc finger protein 182	18					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)	22						tttgccttctgccatgagtag	0.502																																					p.Q18K													.	.			0			c.C52A												285.0	129.0	186.0					X																	47847944		1327	2309	3636	SO:0001583	missense	7569	exon4			CCTTCTGCCATGA	AK122874, R98366	CCDS35235.1, CCDS35236.1	Xp11.23	2013-01-08	2006-05-10	2006-05-10	ENSG00000147118	ENSG00000147118		"""Zinc fingers, C2H2-type"", ""-"""	13001	protein-coding gene	gene with protein product		314993	"""zinc finger protein 182 (HHZ150)"", ""zinc finger protein 21 (KOX 14)"""	ZNF21		8088786, 2014798, 8914609	Standard	NM_001178099		Approved	KOX14, HHZ150, Zfp182	uc004dit.3	P17025	OTTHUMG00000021460	ENST00000396965.1:c.52C>A	X.37:g.47847944G>T	ENSP00000380165:p.Gln18Lys		Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_006962	0		0	A2IDD7|Q3KP67|Q96QH7	Missense_Mutation	SNP	ENST00000396965.1	37	CCDS35236.1	.	.	.	.	.	.	.	.	.	.	g	9.283	1.048716	0.19827	.	.	ENSG00000147118	ENST00000396965;ENST00000305127	T;T	0.06294	3.32;3.32	0.13	0.13	0.14746	.	.	.	.	.	T	0.02610	0.0079	N	0.11560	0.145	0.32269	N	0.569076	B	0.26041	0.14	B	0.22880	0.042	T	0.45877	-0.9231	8	0.06099	T	0.92	.	.	.	.	.	18	P17025	ZN182_HUMAN	K	18	ENSP00000380165:Q18K;ENSP00000306351:Q18K	ENSP00000306351:Q18K	Q	-	1	0	ZNF182	47732888	0.915000	0.31059	0.638000	0.29380	0.639000	0.38242	-0.598000	0.05706	0.171000	0.19730	0.173000	0.16961	CAG			0.502	ZNF182-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000277055.1		NM_006962	
ATRX	546	broad.mit.edu	37	X	76938655	76938655	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chrX:76938655T>C	ENST00000373344.5	-	9	2307	c.2093A>G	c.(2092-2094)aAg>aGg	p.K698R	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Missense_Mutation_p.K660R	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	698					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						ACGCTTATCCTTTTTTCTCAC	0.353			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																														p.K698R				Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	.	ATRX	833		1	Unknown(1)	bone(1)	c.A2093G												154.0	151.0	152.0					X																	76938655		2203	4295	6498	SO:0001583	missense	546	exon9			TTATCCTTTTTTC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.2093A>G	X.37:g.76938655T>C	ENSP00000362441:p.Lys698Arg		Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	140	0.02	3	NM_000489	36	0.00	0	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	ENST00000373344.5	37	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	T	7.861	0.725980	0.15439	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862	D;D	0.92911	-3.1;-3.13	5.74	5.74	0.90152	.	0.591571	0.17731	N	0.163908	D	0.89121	0.6625	L	0.58101	1.795	0.80722	D	1	P;P;B;P	0.40660	0.457;0.726;0.449;0.457	B;B;B;B	0.35413	0.129;0.202;0.154;0.129	D	0.89028	0.3440	10	0.66056	D	0.02	-5.582	11.0484	0.47872	0.0:0.0:0.1529:0.8471	.	698;630;660;698	A4LAA3;P46100-6;P46100-4;P46100	.;.;.;ATRX_HUMAN	R	698;660;625	ENSP00000362441:K698R;ENSP00000378967:K660R	ENSP00000362441:K698R	K	-	2	0	ATRX	76825311	0.999000	0.42202	0.999000	0.59377	0.864000	0.49448	1.969000	0.40510	1.923000	0.55706	0.417000	0.27973	AAG			0.353	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000058860.2		NM_000489	
TERF1P4	648283	bcgsc.ca	37	X	83004277	83004277	+	IGR	SNP	A	A	T			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chrX:83004277A>T								RP3-326L13.3 (237142 upstream) : CYLC1 (111876 downstream)																							TTGTATCCAAATTAGCTTCAG	0.363																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	648283	.			ATCCAAATTAGCT																													X.37:g.83004277A>T			Somatic	34	0	0		WXS	Illumina HiSeq	Phase_1	36	0.19	7	.	1	0.00	0		RNA	SNP		37																																																																																					0	0.363										
SERBP1P2	359996	bcgsc.ca	37	Y	4669795	4669795	+	IGR	SNP	G	G	A			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chrY:4669795G>A								RNU6-303P (626664 upstream) : PCDH11Y (198471 downstream)																							TGTCAGTCCTGCTGCTGAGGT	0.512																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	359996	.			AGTCCTGCTGCTG																													Y.37:g.4669795G>A			Somatic	24	0	0		WXS	Illumina HiSeq	Phase_1	20	0.20	4	.	0		0		RNA	SNP		37																																																																																					0	0.512										
SEPHS2	22928	mdanderson.org	37	16	30456664	30456664	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGP-01A-11D-A42Y-10	TCGA-2G-AAGP-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79a36367-9e68-4e76-af66-085a68c13add	2f54fd19-65e9-4992-a984-fc446f349244	g.chr16:30456664C>A	ENST00000478753.2	-	1	838	c.385G>T	c.(385-387)Ggg>Tgg	p.G129W	SEPHS2_ENST00000542752.1_Missense_Mutation_p.G72W|SEPHS2_ENST00000500504.2_Missense_Mutation_p.G129W			Q99611	SPS2_HUMAN	selenophosphate synthetase 2	129					selenocysteine biosynthetic process (GO:0016260)		ATP binding (GO:0005524)|selenide, water dikinase activity (GO:0004756)			breast(3)|cervix(1)|kidney(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	10						GACAGGCCCCCGTGCCTCAGG	0.647																																					.	Esophageal Squamous(81;1142 1261 11202 24614 35697)												.	.			0			.												31.0	32.0	32.0					16																	30456664		1940	4119	6059	SO:0001583	missense	22928	.			GGCCCCCGTGCCT	BC002381		16p11.2	2013-02-15			ENSG00000179918	ENSG00000179918			19686	protein-coding gene	gene with protein product		606218				10608886	Standard	NM_012248		Approved	SPS2, SPS2b	uc021tgl.1	Q99611	OTTHUMG00000176988	ENST00000478753.2:c.385G>T	16.37:g.30456664C>A	ENSP00000418669:p.Gly129Trp		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	.	134	0.00	0	Q9BUQ2	Missense_Mutation	SNP	ENST00000478753.2	37		.	.	.	.	.	.	.	.	.	.	C	20.8	4.056099	0.76074	.	.	ENSG00000179918	ENST00000478753;ENST00000542752;ENST00000418751;ENST00000500504	T;T;T	0.30448	1.53;1.53;1.53	5.64	5.64	0.86602	PurM, N-terminal-like (1);AIR synthase-related protein (1);	0.051580	0.85682	D	0.000000	T	0.62672	0.2447	M	0.92317	3.295	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.967	T	0.69847	-0.5034	10	0.87932	D	0	-20.7385	10.9452	0.47296	0.0:0.9149:0.0:0.0851	.	129;72	Q99611;F5H8F9	SPS2_HUMAN;.	W	129;72;80;129	ENSP00000418669:G129W;ENSP00000443601:G72W;ENSP00000426234:G129W	ENSP00000390233:G80W	G	-	1	0	SEPHS2	30364165	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	5.690000	0.68241	2.828000	0.97474	0.655000	0.94253	GGG			0.647	SEPHS2-001	KNOWN	basic|seleno	protein_coding	protein_coding		OTTHUMT00000109640.11		NM_012248	
