#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
SLC2A7	155184	mdanderson.org	37	1	9074853	9074853	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr1:9074853G>T	ENST00000400906.1	-	7	789	c.790C>A	c.(790-792)Cgc>Agc	p.R264S		NM_207420.2	NP_997303.2	Q6PXP3	GTR7_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 7	264					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			NS(1)|breast(1)|endometrium(4)|large_intestine(10)|lung(4)|prostate(2)|skin(2)	24	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.04e-07)|COAD - Colon adenocarcinoma(227;7.66e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		CCCTCGGCGCGCTCGGCCCGG	0.687																																					p.R264S													SLC2A7,NS,carcinoma,+2,1	SLC2A7	2	1	0			c.C790A												21.0	22.0	22.0					1																	9074853		2196	4296	6492	SO:0001583	missense	155184	exon7			CGGCGCGCTCGGC	AL356306	CCDS98.2	1p36.2	2013-05-22			ENSG00000197241	ENSG00000197241		"""Solute carriers"""	13445	protein-coding gene	gene with protein product	"""intestinal facilitative glucose transporter 7"""	610371				11780753	Standard	NM_207420		Approved	GLUT7	uc009vmo.1	Q6PXP3	OTTHUMG00000057499	ENST00000400906.1:c.790C>A	1.37:g.9074853G>T	ENSP00000383698:p.Arg264Ser		Somatic	38	0.0526315789	2		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_207420	0		0	A2A333	Missense_Mutation	SNP	ENST00000400906.1	37	CCDS98.2	.	.	.	.	.	.	.	.	.	.	G	2.927	-0.221859	0.06061	.	.	ENSG00000197241	ENST00000400906	T	0.73897	-0.79	3.96	-1.31	0.09230	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	7.200770	0.00357	N	0.000031	T	0.58018	0.2093	N	0.16166	0.38	0.24121	N	0.995803	P	0.34699	0.464	B	0.39419	0.299	T	0.50048	-0.8873	10	0.06757	T	0.87	.	7.3067	0.26451	0.0:0.1024:0.3534:0.5442	.	264	Q6PXP3	GTR7_HUMAN	S	264	ENSP00000383698:R264S	ENSP00000383698:R264S	R	-	1	0	SLC2A7	8997440	0.034000	0.19679	0.001000	0.08648	0.007000	0.05969	0.238000	0.18004	-0.456000	0.07043	0.484000	0.47621	CGC			0.687	SLC2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000127768.3		NM_207420	
AHDC1	27245	mdanderson.org	37	1	27878462	27878462	+	Silent	SNP	G	G	A			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr1:27878462G>A	ENST00000247087.5	-	5	761	c.165C>T	c.(163-165)caC>caT	p.H55H	AHDC1_ENST00000374011.2_Silent_p.H55H			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	55	Pro-rich.						DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		CGGAGAAGGCGTGGGTGGAGA	0.751																																					p.H55H													.	.			0			c.C165T												8.0	10.0	10.0					1																	27878462		2073	4063	6136	SO:0001819	synonymous_variant	27245	exon6			GAAGGCGTGGGTG	AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.165C>T	1.37:g.27878462G>A			Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	26	0.08	2	NM_001029882	5	0.00	0	Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Silent	SNP	ENST00000247087.5	37	CCDS30652.1																																																																																					0.751	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000009523.3			
CFAP57	149465	mdanderson.org	37	1	43652471	43652471	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr1:43652471G>T	ENST00000372492.4	+	6	1387	c.1063G>T	c.(1063-1065)Gcc>Tcc	p.A355S	WDR65_ENST00000528956.1_Missense_Mutation_p.A355S	NM_001195831.2	NP_001182760.2	Q96MR6	WDR65_HUMAN		355										NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				AACTCTGGTTGCCAGCACCAG	0.527																																					p.A355S													.	.			0			c.G1063T												116.0	99.0	105.0					1																	43652471		2203	4300	6503	SO:0001583	missense	149465	exon6			CTGGTTGCCAGCA																												ENST00000372492.4:c.1063G>T	1.37:g.43652471G>T	ENSP00000361570:p.Ala355Ser		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_152498	2	0.00	0	A6NKQ3|Q17RI9|Q5TAI0	Missense_Mutation	SNP	ENST00000372492.4	37		.	.	.	.	.	.	.	.	.	.	G	16.47	3.130944	0.56828	.	.	ENSG00000243710	ENST00000372492;ENST00000528956	T;T	0.14022	2.54;2.54	5.67	5.67	0.87782	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40 repeat-like-containing domain (1);	0.175329	0.50627	D	0.000113	T	0.13586	0.0329	M	0.63843	1.955	0.36584	D	0.873699	B;B	0.22211	0.066;0.025	B;B	0.25884	0.064;0.041	T	0.08785	-1.0705	10	0.06236	T	0.91	.	10.2282	0.43238	0.1466:0.0:0.8534:0.0	.	355;355	Q96MR6;Q96MR6-2	WDR65_HUMAN;.	S	355	ENSP00000361570:A355S;ENSP00000435310:A355S	ENSP00000361570:A355S	A	+	1	0	WDR65	43425058	1.000000	0.71417	0.994000	0.49952	0.832000	0.47134	2.869000	0.48444	2.649000	0.89929	0.655000	0.94253	GCC			0.527	WDR65-002	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding		OTTHUMT00000384325.1			
TGFBR3	7049	hgsc.bcm.edu	37	1	92163669	92163669	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr1:92163669T>C	ENST00000525962.1	-	14	2367	c.2306A>G	c.(2305-2307)aAg>aGg	p.K769R	TGFBR3_ENST00000370399.2_Missense_Mutation_p.K768R|TGFBR3_ENST00000212355.4_Missense_Mutation_p.K769R			Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	769					blastocyst development (GO:0001824)|blood vessel development (GO:0001568)|BMP signaling pathway (GO:0030509)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cell growth (GO:0016049)|cell migration (GO:0016477)|definitive erythrocyte differentiation (GO:0060318)|definitive hemopoiesis (GO:0060216)|epithelial to mesenchymal transition (GO:0001837)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|negative regulation of cellular component movement (GO:0051271)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of protein binding (GO:0043393)|response to follicle-stimulating hormone (GO:0032354)|response to hypoxia (GO:0001666)|response to luteinizing hormone (GO:0034699)|response to prostaglandin E (GO:0034695)|transforming growth factor beta receptor complex assembly (GO:0007181)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	coreceptor activity (GO:0015026)|glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|PDZ domain binding (GO:0030165)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type III (GO:0070123)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(24)|ovary(3)|prostate(4)|skin(1)|stomach(1)|urinary_tract(3)	55		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		ATTTGGTTCCTTCATGCTTGG	0.368																																					p.K769R													.	.			0			c.A2306G												143.0	144.0	144.0					1																	92163669		2203	4300	6503	SO:0001583	missense	7049	exon15			GGTTCCTTCATGC	L07594	CCDS30770.1, CCDS55614.1	1p33-p32	2008-02-05	2007-02-15		ENSG00000069702	ENSG00000069702		"""Proteoglycans / Cell surface : Other"""	11774	protein-coding gene	gene with protein product	"""betaglycan proteoglycan"""	600742	"""transforming growth factor, beta receptor III (betaglycan, 300kDa)"""			1333192, 1319842	Standard	NM_001195684		Approved	betaglycan, BGCAN	uc001doh.3	Q03167	OTTHUMG00000010097	ENST00000525962.1:c.2306A>G	1.37:g.92163669T>C	ENSP00000436127:p.Lys769Arg		Somatic	122	0	0		WXS	Illumina HiSeq	.	87	0.05	4	NM_003243	14	0.00	0	A0AUW8|A8K5N0|B9EG88|Q5T2T4|Q5U731|Q9UGI2	Missense_Mutation	SNP	ENST00000525962.1	37	CCDS30770.1	.	.	.	.	.	.	.	.	.	.	T	4.899	0.167085	0.09339	.	.	ENSG00000069702	ENST00000212355;ENST00000370399;ENST00000525962;ENST00000465892	T;T;T;T	0.31769	1.48;1.48;1.48;1.48	5.03	3.84	0.44239	.	0.676288	0.15298	N	0.269812	T	0.05914	0.0154	N	0.15975	0.35	0.09310	N	0.999996	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.08055	0.001;0.003;0.001	T	0.30387	-0.9980	10	0.18276	T	0.48	-22.6992	8.1929	0.31379	0.0:0.0:0.2648:0.7352	.	769;768;769	A8K5N0;Q03167-2;Q03167	.;.;TGBR3_HUMAN	R	769;768;769;768	ENSP00000212355:K769R;ENSP00000359426:K768R;ENSP00000436127:K769R;ENSP00000432638:K768R	ENSP00000212355:K769R	K	-	2	0	TGFBR3	91936257	0.844000	0.29557	0.620000	0.29132	0.432000	0.31715	2.176000	0.42500	2.000000	0.58554	0.533000	0.62120	AAG			0.368	TGFBR3-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000382308.1		NM_003243	
NBPF14	25832	broad.mit.edu	37	1	145293269	145293269	+	Splice_Site	SNP	G	G	A	rs61350760		TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr1:145293269G>A	ENST00000468030.1	+	5	1125		c.e5+1		NBPF10_ENST00000369338.1_Splice_Site|NBPF10_ENST00000342960.5_5'Flank|NBPF10_ENST00000369339.3_Intron																							TTTCACAACAGTAAGTTAAGA	0.423																																					.													.	NBPF10	221		0			.																																									SO:0001630	splice_region_variant	100132406	.			ACAACAGTAAGTT																												ENST00000468030.1:c.714+1G>A	1.37:g.145293269G>A			Somatic	29	0.0344827586	1		WXS	Illumina HiSeq	Phase_I	31	0.16	5	.	1	0.00	0		Splice_Site	SNP	ENST00000468030.1	37																																																																																						0.423	RP11-458D21.5-001	KNOWN	basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	protein_coding		OTTHUMT00000038553.9			Intron
HORMAD1	84072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	150680868	150680868	+	Silent	SNP	G	G	A	rs368484414		TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr1:150680868G>A	ENST00000361824.2	-	9	516	c.411C>T	c.(409-411)aaC>aaT	p.N137N	HORMAD1_ENST00000368995.4_Silent_p.N57N|HORMAD1_ENST00000368993.2_Silent_p.N137N|HORMAD1_ENST00000322343.7_Silent_p.N130N	NM_032132.4	NP_115508.2	Q86X24	HORM1_HUMAN	HORMA domain containing 1	137	HORMA. {ECO:0000255|PROSITE- ProRule:PRU00109}.				blastocyst development (GO:0001824)|meiotic DNA double-strand break formation (GO:0042138)|meiotic nuclear division (GO:0007126)|meiotic recombination checkpoint (GO:0051598)|meiotic sister chromatid cohesion (GO:0051177)|oogenesis (GO:0048477)|regulation of homologous chromosome segregation (GO:0060629)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(3)	16	all_cancers(9;3.23e-52)|all_epithelial(9;4.68e-43)|all_lung(15;5.74e-35)|Lung NSC(24;2.09e-31)|Breast(34;0.0009)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;2.32e-23)|all cancers(9;5.21e-23)|OV - Ovarian serous cystadenocarcinoma(6;6.72e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)			TGCTAGATTCGTTGCTTTGGT	0.323																																					p.N137N													.	.			0			c.C411T							G	,	0,4406		0,0,2203	99.0	92.0	94.0		390,411	-2.7	0.0	1		94	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	HORMAD1	NM_001199829.1,NM_032132.4	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	130/388,137/395	150680868	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	84072	exon9			AGATTCGTTGCTT	AL136755	CCDS967.1, CCDS55633.1	1q21.2	2009-03-09			ENSG00000143452	ENSG00000143452			25245	protein-coding gene	gene with protein product	"""cancer/testis antigen 46"""	609824				11230166, 15999985	Standard	NM_032132		Approved	DKFZP434A1315, CT46	uc001evk.2	Q86X24	OTTHUMG00000035005	ENST00000361824.2:c.411C>T	1.37:g.150680868G>A			Somatic	105	0	0		WXS	Illumina HiSeq	.	87	0.43	37	NM_032132	0		0	A6NMK2|B3KUK1|Q4G114|Q5T5I3|Q5T5I4|Q5T5I5|Q6FIC1|Q9H0K8	Silent	SNP	ENST00000361824.2	37	CCDS967.1																																																																																					0.323	HORMAD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000084722.1		NM_032132	
NPR1	4881	mdanderson.org	37	1	153651756	153651756	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr1:153651756G>T	ENST00000368680.3	+	1	644	c.172G>T	c.(172-174)Gcc>Tcc	p.A58S		NM_000906.3	NP_000897.3	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1	58					body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|G-protein coupled peptide receptor activity (GO:0008528)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(17)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Amyl Nitrite(DB01612)|Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Nesiritide(DB04899)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	CGTGGGACCCGCCGTGGAGCT	0.731																																					p.A58S	Pancreas(141;1349 1870 15144 15830 40702)												.	.			0			c.G172T												4.0	4.0	4.0					1																	153651756		1801	3554	5355	SO:0001583	missense	4881	exon1			GGACCCGCCGTGG	BC063304	CCDS1051.1	1q21-q22	2014-03-03	2014-03-03		ENSG00000169418	ENSG00000169418			7943	protein-coding gene	gene with protein product	"""guanylate cyclase A"""	108960	"""atrionatriuretic peptide receptor A"", ""natriuretic peptide receptor A"""	ANPRA, NPRA		1979052	Standard	NM_000906		Approved	GUCY2A, ANPa	uc001fcs.4	P16066	OTTHUMG00000037085	ENST00000368680.3:c.172G>T	1.37:g.153651756G>T	ENSP00000357669:p.Ala58Ser		Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	10	0.20	2	NM_000906	1	0.00	0	B0ZBF0|Q5SR08|Q6P4Q3	Missense_Mutation	SNP	ENST00000368680.3	37	CCDS1051.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.906781	0.92107	.	.	ENSG00000169418	ENST00000368680	D	0.91464	-2.85	3.93	3.93	0.45458	Extracellular ligand-binding receptor (1);	0.000000	0.64402	D	0.000002	D	0.95001	0.8382	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95715	0.8761	10	0.87932	D	0	.	13.4629	0.61237	0.0:0.0:1.0:0.0	.	58	P16066	ANPRA_HUMAN	S	58	ENSP00000357669:A58S	ENSP00000357669:A58S	A	+	1	0	NPR1	151918380	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	8.606000	0.90888	2.005000	0.58758	0.313000	0.20887	GCC			0.731	NPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000090034.1		NM_000906	
ILDR2	387597	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	166904678	166904678	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr1:166904678G>A	ENST00000271417.3	-	6	795	c.740C>T	c.(739-741)cCt>cTt	p.P247L	ILDR2_ENST00000469934.2_Missense_Mutation_p.P247L|ILDR2_ENST00000528703.1_Intron|ILDR2_ENST00000526687.1_Intron|ILDR2_ENST00000529387.1_Intron|ILDR2_ENST00000525740.1_Intron|ILDR2_ENST00000529071.1_Missense_Mutation_p.P228L	NM_199351.2	NP_955383.1	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor 2	247					cell differentiation (GO:0030154)|homeostasis of number of cells within a tissue (GO:0048873)|insulin secretion (GO:0030073)|pancreas development (GO:0031016)|response to glucose (GO:0009749)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(3)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	22						GACAGAGGGAGGGTACCCGGC	0.592																																					p.P247L													.	.			0			c.C740T												52.0	51.0	51.0					1																	166904678		2203	4300	6503	SO:0001583	missense	387597	exon6			GAGGGAGGGTACC	AF503509	CCDS1256.1	1q24.1	2008-12-18	2008-12-18	2008-12-18	ENSG00000143195	ENSG00000143195			18131	protein-coding gene	gene with protein product	"""LISCH-like"""		"""chromosome 1 open reading frame 32"""	C1orf32			Standard	NM_199351		Approved		uc001gdx.2	Q71H61	OTTHUMG00000034320	ENST00000271417.3:c.740C>T	1.37:g.166904678G>A	ENSP00000271417:p.Pro247Leu		Somatic	74	0	0		WXS	Illumina HiSeq	.	68	0.26	18	NM_199351	0		0		Missense_Mutation	SNP	ENST00000271417.3	37	CCDS1256.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.031628	0.93575	.	.	ENSG00000143195	ENST00000271417;ENST00000469934;ENST00000529071	T;T;T	0.58940	0.34;0.38;0.3	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.72179	0.3428	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.74179	-0.3749	10	0.87932	D	0	.	19.7433	0.96241	0.0:0.0:1.0:0.0	.	247	Q71H61	ILDR2_HUMAN	L	247;247;228	ENSP00000271417:P247L;ENSP00000437008:P247L;ENSP00000436882:P228L	ENSP00000271417:P247L	P	-	2	0	ILDR2	165171302	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.230000	0.89793	2.662000	0.90505	0.556000	0.70494	CCT			0.592	ILDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000082880.2		NM_199351	
IARS2	55699	broad.mit.edu	37	1	220320874	220320874	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr1:220320874T>C	ENST00000302637.5	+	23	3040	c.2936T>C	c.(2935-2937)gTc>gCc	p.V979A	IARS2_ENST00000366922.1_Missense_Mutation_p.V907A	NM_018060.3	NP_060530.3	Q9NSE4	SYIM_HUMAN	isoleucyl-tRNA synthetase 2, mitochondrial	979					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			NS(1)|breast(1)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(17)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	AAAGTAATTGTCATGCCGACT	0.388																																					p.V979A													.	IARS2	106		0			c.T2936C												108.0	113.0	111.0					1																	220320874		2203	4300	6503	SO:0001583	missense	55699	exon23			TAATTGTCATGCC	AK022665	CCDS1523.1	1q41	2011-07-01	2007-02-26		ENSG00000067704	ENSG00000067704	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	29685	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 2, mitochondrial"""	612801					Standard	NM_018060		Approved	FLJ10326	uc001hmc.3	Q9NSE4	OTTHUMG00000037287	ENST00000302637.5:c.2936T>C	1.37:g.220320874T>C	ENSP00000303279:p.Val979Ala		Somatic	107	0	0		WXS	Illumina HiSeq	Phase_I	96	0.03	3	NM_018060	344	0.00	0	B2RPG8|Q1M2P9|Q6PI85|Q7L439|Q86WU9|Q96D91|Q9H9Q8|Q9NW42	Missense_Mutation	SNP	ENST00000302637.5	37	CCDS1523.1	.	.	.	.	.	.	.	.	.	.	T	14.25	2.479415	0.44044	.	.	ENSG00000067704	ENST00000366922;ENST00000302637	T;T	0.14022	2.54;2.54	5.65	5.65	0.86999	Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);	0.261224	0.37669	N	0.001988	T	0.07908	0.0198	N	0.08118	0	0.34080	D	0.659512	B	0.17465	0.022	B	0.14578	0.011	T	0.08764	-1.0706	10	0.62326	D	0.03	-21.1069	10.5532	0.45101	0.0:0.0813:0.0:0.9187	.	979	Q9NSE4	SYIM_HUMAN	A	907;979	ENSP00000355889:V907A;ENSP00000303279:V979A	ENSP00000303279:V979A	V	+	2	0	IARS2	218387497	0.993000	0.37304	0.986000	0.45419	0.903000	0.53119	2.276000	0.43408	2.152000	0.67230	0.477000	0.44152	GTC			0.388	IARS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_018060	
AIDA	64853	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	222849452	222849454	+	In_Frame_Del	DEL	GTA	GTA	-			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	GTA	GTA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr1:222849452_222849454delGTA	ENST00000340020.6	-	7	773_775	c.567_569delTAC	c.(565-570)attaca>ata	p.T190del	AIDA_ENST00000355727.2_Intron|AIDA_ENST00000541237.1_In_Frame_Del_p.T166del|AIDA_ENST00000474863.1_5'UTR	NM_022831.2	NP_073742.2	Q96BJ3	AIDA_HUMAN	axin interactor, dorsalization associated	190	Axin-binding. {ECO:0000250}.				dorsal/ventral pattern formation (GO:0009953)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|regulation of protein homodimerization activity (GO:0043496)	cytoplasm (GO:0005737)				kidney(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	10						TACACTAACTGTAATATAGGGAT	0.379																																					p.190_190del													.	AIDA	23		0			c.568_570del																																									SO:0001651	inframe_deletion	64853	exon7			CTAACTGTAATAT	BC043142	CCDS1533.1	1q41	2008-05-22	2008-05-22	2008-05-22	ENSG00000186063	ENSG00000186063			25761	protein-coding gene	gene with protein product	"""axin interaction partner and dorsalization antagonist"""	612375	"""chromosome 1 open reading frame 80"""	C1orf80		8619474, 9110174, 17681137	Standard	NM_022831		Approved	FLJ12806	uc001hnn.3	Q96BJ3	OTTHUMG00000037653	ENST00000340020.6:c.567_569delTAC	1.37:g.222849452_222849454delGTA	ENSP00000339161:p.Thr190del		Somatic	279	0	0		WXS	Illumina HiSeq	.	250	0.36	90	NM_022831	14	0.00	0	A8K1F0|Q49A81|Q5JRA4|Q658P1|Q9H9E8	In_Frame_Del	DEL	ENST00000340020.6	37	CCDS1533.1																																																																																					0.379	AIDA-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000091818.1		NM_022831	
ZNF672	79894	mdanderson.org	37	1	249142349	249142349	+	Silent	SNP	C	C	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr1:249142349C>T	ENST00000306562.3	+	4	1622	c.876C>T	c.(874-876)ttC>ttT	p.F292F		NM_024836.1	NP_079112.1	Q499Z4	ZN672_HUMAN	zinc finger protein 672	292					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(1)	5	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			GCAAGGGTTTCGGGCAGCGCT	0.701																																					p.F292F													.	.			0			c.C876T												10.0	9.0	9.0					1																	249142349		2174	4247	6421	SO:0001819	synonymous_variant	79894	exon4			GGGTTTCGGGCAG	AK027476	CCDS1638.1	1q44	2013-01-08			ENSG00000171161	ENSG00000171161		"""Zinc fingers, C2H2-type"""	26179	protein-coding gene	gene with protein product	"""hypothetical protein FLJ22301"""					12477932	Standard	NM_024836		Approved	FLJ22301	uc001iex.3	Q499Z4	OTTHUMG00000040377	ENST00000306562.3:c.876C>T	1.37:g.249142349C>T			Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	10	0.20	2	NM_024836	54	0.00	0	Q96H65|Q96IM3|Q9H6G5	Silent	SNP	ENST00000306562.3	37	CCDS1638.1																																																																																					0.701	ZNF672-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000097125.2		NM_024836	
ALOX5	240	broad.mit.edu;bcgsc.ca	37	10	45935962	45935962	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr10:45935962C>T	ENST00000374391.2	+	8	1119	c.1066C>T	c.(1066-1068)Cgt>Tgt	p.R356C	ALOX5_ENST00000542434.1_Missense_Mutation_p.R356C	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	356	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)			breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	AATCTGGGTGCGTTCCAGTGA	0.522																																					p.R356C													.	ALOX5	88		0			c.C1066T												102.0	86.0	92.0					10																	45935962		2203	4300	6503	SO:0001583	missense	240	exon8			TGGGTGCGTTCCA	J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.1066C>T	10.37:g.45935962C>T	ENSP00000363512:p.Arg356Cys		Somatic	149	0.0067114094	1		WXS	Illumina HiSeq	Phase_I	92	0.07	6	NM_001256153	32	0.00	0	B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	Missense_Mutation	SNP	ENST00000374391.2	37	CCDS7212.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.215825	0.79352	.	.	ENSG00000012779	ENST00000542434;ENST00000374391	D;D	0.90444	-2.67;-2.67	5.96	5.96	0.96718	Lipoxygenase, C-terminal (4);	0.095477	0.64402	D	0.000001	D	0.93298	0.7864	L	0.50993	1.605	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.983;0.996	D	0.92986	0.6410	10	0.62326	D	0.03	-21.3855	12.7994	0.57578	0.1634:0.8366:0.0:0.0	.	356;356;356	B7ZLS0;E5FPY8;P09917	.;.;LOX5_HUMAN	C	356	ENSP00000437634:R356C;ENSP00000363512:R356C	ENSP00000363512:R356C	R	+	1	0	ALOX5	45255968	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.601000	0.61090	2.833000	0.97629	0.650000	0.86243	CGT			0.522	ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047780.1			
JMJD1C	221037	mdanderson.org	37	10	64928259	64928259	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr10:64928259G>T	ENST00000399262.2	-	25	7687	c.7469C>A	c.(7468-7470)tCa>tAa	p.S2490*	JMJD1C_ENST00000399251.1_3'UTR|JMJD1C_ENST00000542921.1_Nonsense_Mutation_p.S2308*|JMJD1C_ENST00000402544.1_Nonsense_Mutation_p.S2253*	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	2490	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					TAAATGAAATGACTCTACAAG	0.373																																					p.S2490X													.	.			0			c.C7469A												72.0	71.0	71.0					10																	64928259		1814	4085	5899	SO:0001587	stop_gained	221037	exon25			TGAAATGACTCTA	L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.7469C>A	10.37:g.64928259G>T	ENSP00000382204:p.Ser2490*		Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_032776	60	0.00	0	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Nonsense_Mutation	SNP	ENST00000399262.2	37	CCDS41532.1	.	.	.	.	.	.	.	.	.	.	G	48	14.442954	0.99795	.	.	ENSG00000171988	ENST00000399262;ENST00000402544;ENST00000542921	.	.	.	5.58	5.58	0.84498	.	0.137472	0.50627	D	0.000114	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.4078	19.5672	0.95398	0.0:0.0:1.0:0.0	.	.	.	.	X	2490;2253;2308	.	ENSP00000382204:S2490X	S	-	2	0	JMJD1C	64598265	1.000000	0.71417	0.999000	0.59377	0.931000	0.56810	6.536000	0.73842	2.616000	0.88540	0.655000	0.94253	TCA			0.373	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000048249.2		NM_004241	
DLG5	9231	mdanderson.org	37	10	79581756	79581756	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr10:79581756G>T	ENST00000372391.2	-	15	2491	c.2486C>A	c.(2485-2487)gCt>gAt	p.A829D	DLG5_ENST00000372388.2_Intron|DLG5_ENST00000459739.1_5'Flank	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	829					apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)			breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			TTTGTTATGAGCCTGGACCTC	0.512																																					p.A829D													.	.			0			c.C2486A												133.0	134.0	133.0					10																	79581756		2203	4300	6503	SO:0001583	missense	9231	exon15			TTATGAGCCTGGA	U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.2486C>A	10.37:g.79581756G>T	ENSP00000361467:p.Ala829Asp		Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_004747	55	0.00	0	A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Missense_Mutation	SNP	ENST00000372391.2	37	CCDS7353.2	.	.	.	.	.	.	.	.	.	.	G	22.2	4.252568	0.80135	.	.	ENSG00000151208	ENST00000372391;ENST00000372392	T	0.04862	3.54	5.66	4.76	0.60689	.	0.000000	0.38837	N	0.001551	T	0.13114	0.0318	L	0.27053	0.805	0.80722	D	1	D;P	0.69078	0.997;0.893	D;P	0.65233	0.933;0.482	T	0.08146	-1.0736	10	0.40728	T	0.16	.	14.4571	0.67423	0.0706:0.0:0.9294:0.0	.	719;829	Q8TDM6-4;Q8TDM6	.;DLG5_HUMAN	D	829;378	ENSP00000361467:A829D	ENSP00000361467:A829D	A	-	2	0	DLG5	79251762	1.000000	0.71417	0.697000	0.30258	0.797000	0.45037	4.222000	0.58580	1.410000	0.46936	0.609000	0.83330	GCT			0.512	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048900.2			
ITPRIP	85450	mdanderson.org	37	10	106075100	106075100	+	Missense_Mutation	SNP	C	C	T	rs150063098		TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr10:106075100C>T	ENST00000337478.1	-	2	881	c.710G>A	c.(709-711)cGc>cAc	p.R237H	ITPRIP_ENST00000278071.2_Missense_Mutation_p.R237H|ITPRIP_ENST00000358187.2_Missense_Mutation_p.R237H|RP11-127L20.5_ENST00000472915.2_RNA	NM_001272013.1	NP_001258942.1	Q8IWB1	IPRI_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein	237						membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(9)|upper_aerodigestive_tract(1)	20						GTAGCCCTGGCGATCCAGGGG	0.647																																					p.R237H													.	.			0			c.G710A							C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	37.0	39.0	38.0		710	4.3	1.0	10	dbSNP_134	38	0,8600		0,0,4300	yes	missense	ITPRIP	NM_033397.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	237/548	106075100	1,13005	2203	4300	6503	SO:0001583	missense	85450	exon2			CCCTGGCGATCCA	AB051541	CCDS7557.1	10q25.1	2011-04-28	2011-04-28	2008-08-11	ENSG00000148841	ENSG00000148841			29370	protein-coding gene	gene with protein product			"""KIAA1754"", ""inositol 1,4,5-triphosphate receptor interacting protein"""	KIAA1754		11214970, 16990268	Standard	NM_001272012		Approved	bA127L20.2, DANGER	uc001kye.4	Q8IWB1	OTTHUMG00000019003	ENST00000337478.1:c.710G>A	10.37:g.106075100C>T	ENSP00000337178:p.Arg237His		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_001272013	7	0.00	0	D3DRA5|Q5JU17|Q96MS8|Q9C0A9	Missense_Mutation	SNP	ENST00000337478.1	37	CCDS7557.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	13.84	2.358125	0.41801	2.27E-4	0.0	ENSG00000148841	ENST00000337478;ENST00000278071;ENST00000358187	T;T;T	0.24538	1.85;1.85;1.85	5.25	4.3	0.51218	.	0.517494	0.21234	N	0.077928	T	0.19765	0.0475	L	0.57536	1.79	0.27131	N	0.961907	D	0.58268	0.982	B	0.38296	0.27	T	0.40232	-0.9574	10	0.62326	D	0.03	-26.9789	4.3821	0.11299	0.2007:0.6111:0.0:0.1882	.	237	Q8IWB1	IPRI_HUMAN	H	237	ENSP00000337178:R237H;ENSP00000278071:R237H;ENSP00000350915:R237H	ENSP00000278071:R237H	R	-	2	0	ITPRIP	106065090	0.995000	0.38212	1.000000	0.80357	0.896000	0.52359	0.785000	0.26830	2.601000	0.87937	0.467000	0.42956	CGC	0		0.647	ITPRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050204.1		NM_033397	
OR6A2	8590	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	6816325	6816325	+	Silent	SNP	G	G	A			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr11:6816325G>A	ENST00000332601.3	-	1	803	c.615C>T	c.(613-615)ttC>ttT	p.F205F		NM_003696.2	NP_003687.2	O95222	OR6A2_HUMAN	olfactory receptor, family 6, subfamily A, member 2	205					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(4)|pancreas(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	29		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TGGCCAGGATGAAATCTGTAA	0.493																																					p.F205F													.	.			0			c.C615T												110.0	116.0	114.0					11																	6816325		2201	4296	6497	SO:0001819	synonymous_variant	8590	exon1			CAGGATGAAATCT	AB065822	CCDS7772.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184933	ENSG00000184933		"""GPCR / Class A : Olfactory receptors"""	15301	protein-coding gene	gene with protein product		608495		OR6A2P, OR6A1			Standard	NM_003696		Approved	OR11-55	uc001mes.1	O95222	OTTHUMG00000165736	ENST00000332601.3:c.615C>T	11.37:g.6816325G>A			Somatic	42	0	0		WXS	Illumina HiSeq	.	56	0.52	29	NM_003696	0		0	Q3MJC7|Q6IF35|Q9H206	Silent	SNP	ENST00000332601.3	37	CCDS7772.1																																																																																					0.493	OR6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000385981.1		NM_003696	
LMO1	4004	mdanderson.org	37	11	8252027	8252027	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr11:8252027G>T	ENST00000335790.3	-	2	545	c.50C>A	c.(49-51)cCc>cAc	p.P17H	LMO1_ENST00000428101.2_Missense_Mutation_p.P16H|LMO1_ENST00000534484.1_Missense_Mutation_p.P6H	NM_002315.2	NP_002306.1	P25800	RBTN1_HUMAN	LIM domain only 1 (rhombotin 1)	17					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|skin(1)	5				Epithelial(150;1.59e-07)|BRCA - Breast invasive adenocarcinoma(625;0.203)		CTTCCCTTTGGGCTGGACGGA	0.587			"""T, A"""	TRD@	"""T-ALL, neuroblastoma"""	neuroblastoma																															p.P17H			yes	Dom	yes		11	11p15	4004	LIM domain only 1 (rhombotin 1) (RBTN1)		L	.	.			0			c.C50A												105.0	111.0	109.0					11																	8252027		2199	4296	6495	SO:0001583	missense	4004	exon2			CCTTTGGGCTGGA	M26682	CCDS44534.1, CCDS58118.1	11p15	2014-09-17			ENSG00000166407	ENSG00000166407			6641	protein-coding gene	gene with protein product		186921		RBTN1		2034676, 1703797	Standard	NM_002315		Approved	TTG1, RHOM1	uc001mgh.2	P25800	OTTHUMG00000165833	ENST00000335790.3:c.50C>A	11.37:g.8252027G>T	ENSP00000338207:p.Pro17His		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_002315	0		0	E9PSF5|Q4VBC5|Q8IXR0	Missense_Mutation	SNP	ENST00000335790.3	37	CCDS44534.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.719995	0.89205	.	.	ENSG00000166407	ENST00000335790;ENST00000428101;ENST00000534484	T;T;T	0.32272	1.47;1.46;1.56	5.36	5.36	0.76844	.	0.119734	0.64402	D	0.000016	T	0.41949	0.1181	M	0.71036	2.16	0.80722	D	1	P;P	0.44344	0.833;0.833	P;P	0.44447	0.45;0.45	T	0.44907	-0.9297	10	0.72032	D	0.01	.	17.275	0.87112	0.0:0.0:1.0:0.0	.	16;17	E9PSF5;P25800	.;RBTN1_HUMAN	H	17;16;6	ENSP00000338207:P17H;ENSP00000404538:P16H;ENSP00000435456:P6H	ENSP00000338207:P17H	P	-	2	0	LMO1	8208603	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.496000	0.97967	2.533000	0.85409	0.655000	0.94253	CCC			0.587	LMO1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000386503.2		NM_002315	
TRIM44	54765	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	35684815	35684815	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr11:35684815C>A	ENST00000299413.5	+	1	463	c.156C>A	c.(154-156)ttC>ttA	p.F52L	RP1-276E15.1_ENST00000525573.2_lincRNA	NM_017583.4	NP_060053.2	Q96DX7	TRI44_HUMAN	tripartite motif containing 44	52						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18	all_lung(20;0.0317)|Lung NSC(22;0.0661)|all_epithelial(35;0.115)	all_hematologic(20;0.107)				GGCAGAAGTTCCTCAGTCACC	0.677																																					p.F52L													.	.			0			c.C156A												52.0	54.0	54.0					11																	35684815		2202	4298	6500	SO:0001583	missense	54765	exon1			GAAGTTCCTCAGT	BC024031	CCDS31461.1	11p13	2011-04-20	2011-01-25		ENSG00000166326	ENSG00000166326		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19016	protein-coding gene	gene with protein product		612298	"""tripartite motif-containing 44"""				Standard	NM_017583		Approved	DIPB, MC7	uc001mwi.2	Q96DX7	OTTHUMG00000166312	ENST00000299413.5:c.156C>A	11.37:g.35684815C>A	ENSP00000299413:p.Phe52Leu		Somatic	44	0	0		WXS	Illumina HiSeq	.	51	0.33	17	NM_017583	41	0.20	8	D3DR14|Q96QY2|Q9UGK0	Missense_Mutation	SNP	ENST00000299413.5	37	CCDS31461.1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.042363	0.55003	.	.	ENSG00000166326	ENST00000299413	T	0.30182	1.54	4.76	4.76	0.60689	.	0.000000	0.36134	N	0.002778	T	0.17831	0.0428	N	0.08118	0	0.33102	D	0.53932	P	0.42692	0.787	B	0.38056	0.264	T	0.26985	-1.0087	10	0.62326	D	0.03	-8.1467	15.2628	0.73637	0.0:1.0:0.0:0.0	.	52	Q96DX7	TRI44_HUMAN	L	52	ENSP00000299413:F52L	ENSP00000299413:F52L	F	+	3	2	TRIM44	35641391	0.996000	0.38824	0.943000	0.38184	0.303000	0.27691	3.575000	0.53870	2.169000	0.68431	0.555000	0.69702	TTC			0.677	TRIM44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000389081.1		NM_017583	
RTN4RL2	349667	mdanderson.org	37	11	57244302	57244302	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr11:57244302C>G	ENST00000335099.3	+	3	1498	c.1181C>G	c.(1180-1182)cCg>cGg	p.P394R	RP11-624G17.3_ENST00000528885.1_RNA	NM_178570.1	NP_848665.1			reticulon 4 receptor-like 2											NS(1)|endometrium(1)|large_intestine(2)|lung(2)	6						CAGGCGCCCCCGGACTCCCGA	0.726																																					p.P394R													.	.			0			c.C1181G												11.0	14.0	13.0					11																	57244302		2046	4053	6099	SO:0001583	missense	349667	exon3			CGCCCCCGGACTC	BK001302	CCDS7957.1	11q12.1	2008-02-05			ENSG00000186907	ENSG00000186907			23053	protein-coding gene	gene with protein product		610462					Standard	NM_178570		Approved	NgR2, NGRH1	uc010rjt.2	Q86UN3	OTTHUMG00000167028	ENST00000335099.3:c.1181C>G	11.37:g.57244302C>G	ENSP00000335397:p.Pro394Arg		Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	20	0.15	3	NM_178570	5	0.00	0		Missense_Mutation	SNP	ENST00000335099.3	37	CCDS7957.1	.	.	.	.	.	.	.	.	.	.	C	10.62	1.401112	0.25291	.	.	ENSG00000186907	ENST00000335099	T	0.57273	0.41	3.03	1.96	0.26148	.	.	.	.	.	T	0.26882	0.0658	N	0.14661	0.345	0.80722	D	1	P	0.51351	0.944	B	0.38327	0.271	T	0.02581	-1.1138	9	0.26408	T	0.33	.	5.9088	0.19016	0.0:0.7436:0.0:0.2564	.	394	Q86UN3	R4RL2_HUMAN	R	394	ENSP00000335397:P394R	ENSP00000335397:P394R	P	+	2	0	RTN4RL2	57000878	0.544000	0.26441	0.979000	0.43373	0.403000	0.30841	1.384000	0.34396	1.540000	0.49301	0.306000	0.20318	CCG			0.726	RTN4RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000392537.1		NM_178570	
DAK	26007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	61111415	61111415	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr11:61111415C>A	ENST00000394900.3	+	12	1299	c.1070C>A	c.(1069-1071)cCc>cAc	p.P357H		NM_015533.3	NP_056348.2	Q3LXA3	DHAK_HUMAN	dihydroxyacetone kinase 2 homolog (S. cerevisiae)	357					carbohydrate phosphorylation (GO:0046835)|cellular carbohydrate metabolic process (GO:0044262)|glycerol metabolic process (GO:0006071)|innate immune response (GO:0045087)|regulation of innate immune response (GO:0045088)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|FAD-AMP lyase (cyclizing) activity (GO:0034012)|glycerone kinase activity (GO:0004371)|metal ion binding (GO:0046872)|triokinase activity (GO:0050354)			NS(1)|breast(3)|endometrium(3)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	23						CCTGCCGAGCCCCAGGAGGCC	0.632																																					p.P357H													.	.			0			c.C1070A												48.0	56.0	53.0					11																	61111415		2203	4299	6502	SO:0001583	missense	26007	exon12			CCGAGCCCCAGGA		CCDS8003.1	11q12.2	2009-11-06	2006-04-04		ENSG00000149476	ENSG00000149476			24552	protein-coding gene	gene with protein product		615844	"""dihydroxyacetone kinase 2 homolog (yeast)"""				Standard	XM_005273898		Approved	DKFZP586B1621, NET45	uc001nre.3	Q3LXA3	OTTHUMG00000168076	ENST00000394900.3:c.1070C>A	11.37:g.61111415C>A	ENSP00000378360:p.Pro357His		Somatic	25	0	0		WXS	Illumina HiSeq	.	32	0.47	15	NM_015533	102	0.67	68	Q2L9C1|Q53EQ9|Q9BVA7|Q9H895	Missense_Mutation	SNP	ENST00000394900.3	37	CCDS8003.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.254193	0.80135	.	.	ENSG00000149476	ENST00000394900;ENST00000529479	T;T	0.30981	1.51;1.51	5.84	3.85	0.44370	Dak phosphatase (1);	0.574862	0.19054	N	0.123941	T	0.17746	0.0426	N	0.08118	0	0.09310	N	1	P;P	0.47910	0.703;0.902	B;P	0.48840	0.246;0.592	T	0.06734	-1.0810	10	0.39692	T	0.17	-29.7947	3.2298	0.06745	0.2411:0.4375:0.2376:0.0838	.	357;357	Q2L9C1;Q3LXA3	.;DHAK_HUMAN	H	357;356	ENSP00000378360:P357H;ENSP00000432539:P356H	ENSP00000378360:P357H	P	+	2	0	DAK	60867991	0.226000	0.23696	0.563000	0.28383	0.448000	0.32197	0.821000	0.27338	2.779000	0.95612	0.655000	0.94253	CCC			0.632	DAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394425.4		NM_015533	
CHRM1	1128	mdanderson.org	37	11	62677783	62677783	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr11:62677783G>A	ENST00000306960.3	-	2	1331	c.790C>T	c.(790-792)Cgg>Tgg	p.R264W	AP000438.2_ENST00000543624.1_RNA	NM_000738.2	NP_000729.2	P11229	ACM1_HUMAN	cholinergic receptor, muscarinic 1	264					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|cognition (GO:0050890)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of ion transport (GO:0043270)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of locomotion (GO:0040012)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)			large_intestine(5)|lung(3)|stomach(1)	9					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Benzatropine(DB00245)|Biperiden(DB00810)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbachol(DB00411)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Citalopram(DB00215)|Clidinium(DB00771)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyclopentolate(DB00979)|Cycrimine(DB00942)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Doxylamine(DB00366)|Escitalopram(DB01175)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Flupentixol(DB00875)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methantheline(DB00940)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Oxyphenonium(DB00219)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pirenzepine(DB00670)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propantheline(DB00782)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Trospium(DB00209)|Ziprasidone(DB00246)	CTGGGGGCCCGGCAGCAGCGA	0.657																																					p.R264W													.	.			0			c.C790T																																									SO:0001583	missense	1128	exon2			GGGCCCGGCAGCA	Y00508	CCDS8040.1	11q12-q13	2012-08-08				ENSG00000168539		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1950	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 1"""	118510					Standard	NM_000738		Approved		uc001nwi.3	P11229		ENST00000306960.3:c.790C>T	11.37:g.62677783G>A	ENSP00000306490:p.Arg264Trp		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	51	0.08	4	NM_000738	0		0	Q96RH1	Missense_Mutation	SNP	ENST00000306960.3	37	CCDS8040.1	.	.	.	.	.	.	.	.	.	.	G	8.142	0.785477	0.16189	.	.	ENSG00000168539	ENST00000306960;ENST00000543973	T;T	0.60548	0.21;0.18	4.72	0.212	0.15240	GPCR, rhodopsin-like superfamily (1);	0.429938	0.18600	N	0.136479	T	0.44871	0.1314	L	0.48362	1.52	0.26108	N	0.98072	B	0.06786	0.001	B	0.01281	0.0	T	0.41124	-0.9526	10	0.62326	D	0.03	-12.9274	6.6667	0.23044	0.0914:0.0:0.4721:0.4365	.	264	P11229	ACM1_HUMAN	W	264	ENSP00000306490:R264W;ENSP00000441188:R264W	ENSP00000306490:R264W	R	-	1	2	CHRM1	62434359	0.507000	0.26146	0.533000	0.28001	0.796000	0.44982	0.774000	0.26675	0.176000	0.19873	-0.261000	0.10672	CGG			0.657	CHRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396178.1		NM_000738	
ANO1	55107	broad.mit.edu	37	11	69951865	69951865	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr11:69951865T>C	ENST00000355303.5	+	5	1023	c.718T>C	c.(718-720)Ttt>Ctt	p.F240L	ANO1_ENST00000538023.1_Missense_Mutation_p.F240L|ANO1_ENST00000531349.1_5'Flank|ANO1_ENST00000530676.1_Missense_Mutation_p.F124L|ANO1_ENST00000398543.2_Missense_Mutation_p.F124L|ANO1_ENST00000316296.5_Missense_Mutation_p.F212L	NM_018043.5	NP_060513.5	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	240					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of membrane potential (GO:0042391)|trachea development (GO:0060438)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)	p.F240L(2)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(12)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)	29					Crofelemer(DB04941)	TAAGGATTCCTTTTTCGACAG	0.493																																					p.F240L													ANO1_ENST00000355303,NS,carcinoma,0,2	ANO1	156	2	2	Substitution - Missense(2)	kidney(2)	c.T718C												107.0	106.0	106.0					11																	69951865		1921	4124	6045	SO:0001583	missense	55107	exon5			GATTCCTTTTTCG	BC033036	CCDS44663.1	11q13.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000131620	ENSG00000131620		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	21625	protein-coding gene	gene with protein product		610108	"""oral cancer overexpressed 2"", ""transmembrane protein 16A"""	ORAOV2, TMEM16A		15067359, 18724360, 24692353	Standard	NM_018043		Approved	TAOS2, FLJ10261, DOG1	uc001opj.3	Q5XXA6	OTTHUMG00000167204	ENST00000355303.5:c.718T>C	11.37:g.69951865T>C	ENSP00000347454:p.Phe240Leu		Somatic	145	0	0		WXS	Illumina HiSeq	Phase_I	118	0.03	3	NM_018043	1	0.00	0	A8KAM3|Q8IYY8|Q8N7V3	Missense_Mutation	SNP	ENST00000355303.5	37	CCDS44663.1	.	.	.	.	.	.	.	.	.	.	T	14.59	2.581482	0.46006	.	.	ENSG00000131620	ENST00000355303;ENST00000538023;ENST00000398543;ENST00000546327;ENST00000531604;ENST00000316296;ENST00000530676	T;T;T;T;T;T	0.72615	-0.67;-0.67;-0.67;-0.67;-0.67;-0.67	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.83487	0.5265	M	0.79258	2.445	0.80722	D	1	D;P	0.76494	0.999;0.849	D;B	0.85130	0.997;0.411	D	0.84699	0.0727	9	.	.	.	.	14.2923	0.66286	0.0:0.0:0.0:1.0	.	212;240	Q5XXA6-3;Q5XXA6	.;ANO1_HUMAN	L	240;240;124;24;207;212;124	ENSP00000347454:F240L;ENSP00000444689:F240L;ENSP00000381551:F124L;ENSP00000436392:F207L;ENSP00000319477:F212L;ENSP00000435797:F124L	.	F	+	1	0	ANO1	69629513	1.000000	0.71417	0.998000	0.56505	0.056000	0.15407	7.300000	0.78841	1.975000	0.57531	0.528000	0.53228	TTT			0.493	ANO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000393685.1		NM_018043	
MAML2	84441	broad.mit.edu;mdanderson.org	37	11	95825254	95825254	+	Silent	SNP	C	C	T	rs61749250		TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr11:95825254C>T	ENST00000524717.1	-	2	3225	c.1941G>A	c.(1939-1941)caG>caA	p.Q647Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	647					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Q647Q(1)	CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgctgttgttgct	0.512			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q647Q				Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	MAML2,caecum,carcinoma,0,2	MAML2	94	2	1	Substitution - coding silent(1)	endometrium(1)	c.G1941A							C		0,4198		0,0,2099	35.0	40.0	38.0		1941	1.7	0.1	11	dbSNP_129	38	5,8237		0,5,4116	no	coding-synonymous	MAML2	NM_032427.1		0,5,6215	TT,TC,CC		0.0607,0.0,0.0402		647/1157	95825254	5,12435	2099	4121	6220	SO:0001819	synonymous_variant	84441	exon2			CTGCTGCTGTTGT	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1941G>A	11.37:g.95825254C>T			Somatic	63	0.0158730159	1		WXS	Illumina HiSeq	Phase_I	74	0.05	4	NM_032427	12	0.00	0	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																					0.512	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000395540.1			
GRIA4	2893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	105797664	105797664	+	Splice_Site	SNP	G	G	C			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr11:105797664G>C	ENST00000530497.1	+	12	2045	c.2045G>C	c.(2044-2046)aGa>aCa	p.R682T	GRIA4_ENST00000525187.1_Splice_Site_p.R682T|GRIA4_ENST00000393127.2_Splice_Site_p.R682T|GRIA4_ENST00000282499.5_Splice_Site_p.R682T			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	682					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		GAATTCTTCAGAGTAAGTTAA	0.353																																					p.R682T													.	.			0			c.G2045C												46.0	43.0	44.0					11																	105797664		2202	4298	6500	SO:0001630	splice_region_variant	2893	exon13			TCTTCAGAGTAAG	U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.2046+1G>C	11.37:g.105797664G>C			Somatic	96	0	0		WXS	Illumina HiSeq	.	88	0.31	27	NM_001077243	0		0	Q86XE8	Missense_Mutation	SNP	ENST00000530497.1	37	CCDS8333.1	.	.	.	.	.	.	.	.	.	.	G	16.62	3.172860	0.57584	.	.	ENSG00000152578	ENST00000282499;ENST00000393127;ENST00000530497;ENST00000525187	T;T;T;T	0.39056	1.1;1.1;1.1;1.1	5.53	5.53	0.82687	Ionotropic glutamate receptor (2);	0.060481	0.64402	D	0.000002	T	0.57917	0.2086	M	0.86097	2.795	0.58432	D	0.999999	B;P	0.36712	0.433;0.566	B;P	0.46172	0.263;0.506	T	0.62393	-0.6864	10	0.62326	D	0.03	.	13.0845	0.59132	0.0736:0.0:0.9264:0.0	.	682;682	P48058;G3V164	GRIA4_HUMAN;.	T	682	ENSP00000282499:R682T;ENSP00000376835:R682T;ENSP00000435775:R682T;ENSP00000432180:R682T	ENSP00000282499:R682T	R	+	2	0	GRIA4	105302874	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	6.821000	0.75272	2.756000	0.94617	0.655000	0.94253	AGA			0.353	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000388593.1			Missense_Mutation
BCO2	83875	mdanderson.org	37	11	112050195	112050195	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr11:112050195G>T	ENST00000357685.5	+	2	418	c.283G>T	c.(283-285)Ggg>Tgg	p.G95W	AP002884.3_ENST00000532612.1_Missense_Mutation_p.G66W|BCO2_ENST00000438022.1_Missense_Mutation_p.G61W|SDHD_ENST00000525468.1_Intron|BCO2_ENST00000526088.1_Missense_Mutation_p.G61W|SDHD_ENST00000532699.1_Intron|BCO2_ENST00000393032.2_Missense_Mutation_p.G61W|BCO2_ENST00000532593.1_Intron|BCO2_ENST00000531169.1_Missense_Mutation_p.G61W|BCO2_ENST00000361053.4_Missense_Mutation_p.G95W			Q9BYV7	BCDO2_HUMAN	beta-carotene oxygenase 2	95					carotene catabolic process (GO:0016121)|carotene metabolic process (GO:0016119)|carotenoid metabolic process (GO:0016116)|oxidation-reduction process (GO:0055114)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			NS(1)|breast(1)|kidney(3)|large_intestine(1)|lung(9)|skin(1)	16						ATTCGAGTTTGGGAAGGATAA	0.473																																					p.G95W	GBM(177;1916 2099 21049 29541 39946)												.	.			0			c.G283T												71.0	69.0	70.0					11																	112050195		2201	4297	6498	SO:0001583	missense	83875	exon2			GAGTTTGGGAAGG	AJ290393	CCDS8358.2, CCDS41716.1, CCDS58181.1, CCDS58182.1, CCDS58183.1	11q23.1	2014-05-12	2008-04-15	2008-04-15	ENSG00000197580	ENSG00000197580	1.13.11.71		18503	protein-coding gene	gene with protein product	"""beta-carotene 9',10' oxygenase"", ""carotenoid-9',10'-cleaving dioxygenase"""	611740	"""beta-carotene dioxygenase 2"""	BCDO2		11278918, 15983114, 15949678	Standard	NM_031938		Approved	FLJ34464, B-DIOX-II	uc001pnf.3	Q9BYV7	OTTHUMG00000167155	ENST00000357685.5:c.283G>T	11.37:g.112050195G>T	ENSP00000350314:p.Gly95Trp		Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_001256398	1	0.00	0	B0YIX5|B4DNC3|E9PBI8|E9PJJ1|Q8IUS0|Q96JC8|Q96JY5	Missense_Mutation	SNP	ENST00000357685.5	37	CCDS8358.2	.	.	.	.	.	.	.	.	.	.	G	21.3	4.121206	0.77436	.	.	ENSG00000197580	ENST00000357685;ENST00000393032;ENST00000361053;ENST00000438022;ENST00000526088;ENST00000531169	D;D;D;D;D;D	0.95447	-3.71;-3.71;-3.71;-3.71;-3.71;-3.71	5.53	5.53	0.82687	.	0.049032	0.85682	D	0.000000	D	0.98305	0.9438	M	0.93638	3.44	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99308	1.0903	9	.	.	.	-22.4217	16.3772	0.83410	0.0:0.0:1.0:0.0	.	72;95;95	C9JEZ9;E9PBI8;Q9BYV7	.;.;BCDO2_HUMAN	W	95;61;95;61;61;61	ENSP00000350314:G95W;ENSP00000376752:G61W;ENSP00000354338:G95W;ENSP00000414843:G61W;ENSP00000436615:G61W;ENSP00000437053:G61W	.	G	+	1	0	BCO2	111555405	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	3.594000	0.54008	2.613000	0.88420	0.655000	0.94253	GGG			0.473	BCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256570.3		NM_001037290	
DSCAML1	57453	mdanderson.org	37	11	117376428	117376428	+	Silent	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr11:117376428G>T	ENST00000321322.6	-	9	1984	c.1983C>A	c.(1981-1983)ccC>ccA	p.P661P	DSCAML1_ENST00000527706.1_Silent_p.P391P	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	601	Ig-like C2-type 7.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GGAATTCGAAGGGCTGGATCA	0.642																																					p.P661P													.	.			0			c.C1983A												57.0	49.0	52.0					11																	117376428		2201	4296	6497	SO:0001819	synonymous_variant	57453	exon9			TTCGAAGGGCTGG		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.1983C>A	11.37:g.117376428G>T			Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	15	0.20	3	NM_020693	15	0.00	0	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Silent	SNP	ENST00000321322.6	37	CCDS8384.1																																																																																					0.642	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000392907.2		NM_020693	
CLSTN3	9746	broad.mit.edu	37	12	7281645	7281674	+	5'Flank	DEL	TTCCTGAGGAAGGAACCTGGAGCAGGATCC	TTCCTGAGGAAGGAACCTGGAGCAGGATCC	-	rs148894272|rs6144602|rs552263970		TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	TTCCTGAGGAAGGAACCTGGAGCAGGATCC	TTCCTGAGGAAGGAACCTGGAGCAGGATCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr12:7281645_7281674delTTCCTGAGGAAGGAACCTGGAGCAGGATCC	ENST00000266546.6	+	0	0				RBP5_ENST00000542370.1_5'Flank|RP11-273B20.1_ENST00000544657.1_RNA|RP11-273B20.1_ENST00000538062.1_RNA|RBP5_ENST00000266560.3_5'Flank	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3						homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						ACCTTGGCTTTTCCTGAGGAAGGAACCTGGAGCAGGATCCTTCCTGAGGA	0.57														5008	1.0	1.0	1.0	5008	,	,		18442	1.0		1.0	False		,,,				2504	1.0				.													.	RBP5	20		0			.																																									SO:0001631	upstream_gene_variant	0	.			TGGCTTTTCCTGA	AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167		12.37:g.7281645_7281674delTTCCTGAGGAAGGAACCTGGAGCAGGATCC	Exception_encountered		Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	7	0.29	2	.	35	0.00	0	D3DUT6|O94831|Q2T9J5|Q5UE57	RNA	DEL	ENST00000266546.6	37	CCDS8575.1																																																																																					0.570	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398560.2		NM_014718	
UTP20	27340	mdanderson.org	37	12	101763632	101763632	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr12:101763632G>T	ENST00000261637.4	+	49	6692	c.6518G>T	c.(6517-6519)aGg>aTg	p.R2173M		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	2173					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						GGGGCCGCCAGGGGCCAGAAC	0.512																																					p.R2173M													.	.			0			c.G6518T												106.0	117.0	113.0					12																	101763632		2203	4300	6503	SO:0001583	missense	27340	exon49			CCGCCAGGGGCCA	AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.6518G>T	12.37:g.101763632G>T	ENSP00000261637:p.Arg2173Met		Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_014503	35	0.00	0	Q9H3H4	Missense_Mutation	SNP	ENST00000261637.4	37	CCDS9081.1	.	.	.	.	.	.	.	.	.	.	G	17.79	3.474924	0.63737	.	.	ENSG00000120800	ENST00000261637	T	0.66099	-0.19	5.58	-3.73	0.04398	Armadillo-type fold (1);	0.500761	0.23748	N	0.044946	T	0.53965	0.1829	L	0.46157	1.445	0.37472	D	0.915666	P	0.45348	0.856	B	0.43536	0.423	T	0.59669	-0.7411	10	0.46703	T	0.11	-2.3665	15.423	0.75028	0.8631:0.0:0.1369:0.0	.	2173	O75691	UTP20_HUMAN	M	2173	ENSP00000261637:R2173M	ENSP00000261637:R2173M	R	+	2	0	UTP20	100287763	0.733000	0.28132	0.740000	0.30986	0.985000	0.73830	0.070000	0.14573	-0.821000	0.04312	-0.145000	0.13849	AGG			0.512	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000408242.1		NM_014503	
RPLP0	6175	hgsc.bcm.edu;bcgsc.ca	37	12	120634676	120634690	+	In_Frame_Del	DEL	GTGGCAGCAGCCACA	GTGGCAGCAGCCACA	-	rs572058538	byFrequency	TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	GTGGCAGCAGCCACA	GTGGCAGCAGCCACA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr12:120634676_120634690delGTGGCAGCAGCCACA	ENST00000551150.1	-	7	1155_1169	c.840_854delTGTGGCTGCTGCCAC	c.(838-855)cctgtggctgctgccacc>ccc	p.VAAAT281del	RPLP0_ENST00000228306.4_In_Frame_Del_p.VAAAT281del|GCN1L1_ENST00000300648.6_5'Flank|RPLP0_ENST00000552292.1_In_Frame_Del_p.VAAAT71del|RPLP0_ENST00000550296.1_5'Flank|RPLP0_ENST00000313104.5_In_Frame_Del_p.VAAAT219del|RPLP0_ENST00000392514.4_In_Frame_Del_p.VAAAT281del|RPLP0_ENST00000546989.1_In_Frame_Del_p.VAAAT245del			P05388	RLA0_HUMAN	ribosomal protein, large, P0	281					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosome biogenesis (GO:0042254)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					agcagctgtggtggcagcagccacaggggcagcag	0.558																																					p.281_285del													.	RPLP0	27		0			c.841_855del																																									SO:0001651	inframe_deletion	6175	exon8			GCTGTGGTGGCAG	AB007187	CCDS9193.1	12q24.2	2011-07-29			ENSG00000089157	ENSG00000089157		"""L ribosomal proteins"""	10371	protein-coding gene	gene with protein product	"""acidic ribosomal phosphoprotein P0"""	180510				9582194	Standard	NM_053275		Approved	PRLP0, P0, L10E, RPP0, LP0	uc001txq.3	P05388	OTTHUMG00000169317	ENST00000551150.1:c.840_854delTGTGGCTGCTGCCAC	12.37:g.120634676_120634690delGTGGCAGCAGCCACA	ENSP00000449328:p.Val281_Thr285del		Somatic	225	0	0		WXS	Illumina HiSeq	.	211	0.28	59	NM_053275	4632	0.00	0	Q3B7A4|Q9BVK4	In_Frame_Del	DEL	ENST00000551150.1	37	CCDS9193.1																																																																																					0.558	RPLP0-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000403448.3		NM_053275	
LAMP1	3916	mdanderson.org	37	13	113965084	113965084	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr13:113965084G>T	ENST00000332556.4	+	4	658	c.464G>T	c.(463-465)tGt>tTt	p.C155F	LAMP1_ENST00000397181.3_Intron	NM_005561.3	NP_005552.3	P11279	LAMP1_HUMAN	lysosomal-associated membrane protein 1	155	First lumenal domain.				autophagic cell death (GO:0048102)|autophagy (GO:0006914)|establishment of protein localization to organelle (GO:0072594)|Golgi to lysosome transport (GO:0090160)|granzyme-mediated apoptotic signaling pathway (GO:0008626)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|protein stabilization (GO:0050821)|regulation of organelle transport along microtubule (GO:1902513)	alveolar lamellar body (GO:0097208)|cytolytic granule (GO:0044194)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|melanosome (GO:0042470)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|phagolysosome membrane (GO:0061474)|sarcolemma (GO:0042383)	enzyme binding (GO:0019899)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(2)|prostate(1)|skin(1)|stomach(2)	16	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.025)|GBM - Glioblastoma multiforme(44;0.206)|Epithelial(84;0.246)			AAATACAGATGTGTTAGTGGC	0.423																																					p.C155F													.	.			0			c.G464T												102.0	108.0	106.0					13																	113965084		2145	4244	6389	SO:0001583	missense	3916	exon4			ACAGATGTGTTAG	J03263	CCDS41909.1	13q34	2011-11-24			ENSG00000185896	ENSG00000185896		"""CD molecules"""	6499	protein-coding gene	gene with protein product		153330					Standard	NM_005561		Approved	CD107a	uc001vtm.1	P11279	OTTHUMG00000017380	ENST00000332556.4:c.464G>T	13.37:g.113965084G>T	ENSP00000333298:p.Cys155Phe		Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_005561	522	0.00	0	B4DWL3|Q8WU33|Q96I40|Q9BRD2|Q9NP13	Missense_Mutation	SNP	ENST00000332556.4	37	CCDS41909.1	.	.	.	.	.	.	.	.	.	.	G	12.56	1.975167	0.34848	.	.	ENSG00000185896	ENST00000332556	T	0.39592	1.07	5.53	5.53	0.82687	.	0.103006	0.64402	D	0.000002	T	0.69726	0.3143	M	0.90483	3.12	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75852	-0.3171	10	0.87932	D	0	-12.0266	13.0449	0.58920	0.0:0.0:0.8389:0.1611	.	155	P11279	LAMP1_HUMAN	F	155	ENSP00000333298:C155F	ENSP00000333298:C155F	C	+	2	0	LAMP1	113013085	0.996000	0.38824	0.779000	0.31741	0.011000	0.07611	4.818000	0.62657	2.599000	0.87857	0.563000	0.77884	TGT			0.423	LAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045876.2			
RPGRIP1	57096	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	21798426	21798426	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr14:21798426T>C	ENST00000400017.2	+	19	3118	c.3118T>C	c.(3118-3120)Tgg>Cgg	p.W1040R	RPGRIP1_ENST00000382933.4_Missense_Mutation_p.W366R|RPGRIP1_ENST00000556336.1_Missense_Mutation_p.W697R|RPGRIP1_ENST00000557771.1_Missense_Mutation_p.W1002R|RPGRIP1_ENST00000307974.4_Missense_Mutation_p.W399R|RPGRIP1_ENST00000206660.6_Missense_Mutation_p.W1040R	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1	1040					eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)				breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		TTACACTGAGTGGAAGTTCTC	0.388																																					p.W1040R													.	.			0			c.T3118C												148.0	142.0	144.0					14																	21798426		1855	4096	5951	SO:0001583	missense	57096	exon19			ACTGAGTGGAAGT	AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	ENST00000400017.2:c.3118T>C	14.37:g.21798426T>C	ENSP00000382895:p.Trp1040Arg		Somatic	50	0	0		WXS	Illumina HiSeq	.	35	0.46	16	NM_020366	0		0	Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Missense_Mutation	SNP	ENST00000400017.2	37	CCDS45080.1	.	.	.	.	.	.	.	.	.	.	T	3.761	-0.049623	0.07407	.	.	ENSG00000092200	ENST00000556336;ENST00000557771;ENST00000400017;ENST00000206660;ENST00000382933;ENST00000555587;ENST00000307974	T;T;T;T;T;T;T	0.78003	-0.05;-0.82;-0.86;-0.86;-0.39;-1.14;-1.14	3.91	3.91	0.45181	.	1.033030	0.07602	N	0.923752	T	0.75642	0.3877	M	0.63428	1.95	0.29101	N	0.88148	B;B;B;B;B;P	0.51351	0.0;0.001;0.0;0.032;0.0;0.944	B;B;B;B;B;B	0.44044	0.001;0.002;0.002;0.034;0.002;0.439	T	0.64651	-0.6357	10	0.20519	T	0.43	-0.6601	9.4345	0.38630	0.0:0.0:0.0:1.0	.	423;399;515;366;656;1040	Q96KN7-2;Q96KN7-3;G3V3I7;Q96KN7-4;Q96KN7-5;Q96KN7	.;.;.;.;.;RPGR1_HUMAN	R	697;1002;1040;1040;366;515;399	ENSP00000450445:W697R;ENSP00000451219:W1002R;ENSP00000382895:W1040R;ENSP00000206660:W1040R;ENSP00000372391:W366R;ENSP00000451262:W515R;ENSP00000309721:W399R	ENSP00000206660:W1040R	W	+	1	0	RPGRIP1	20868266	0.680000	0.27605	0.996000	0.52242	0.244000	0.25665	0.765000	0.26546	2.019000	0.59389	0.472000	0.43445	TGG			0.388	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000410258.1		NM_020366	
PRKCH	5583	mdanderson.org	37	14	62016448	62016448	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr14:62016448G>T	ENST00000332981.5	+	14	2336	c.1951G>T	c.(1951-1953)Gaa>Taa	p.E651*	PRKCH_ENST00000555082.1_Nonsense_Mutation_p.E490*|RP11-47I22.4_ENST00000556347.1_Intron|PRKCH_ENST00000556245.1_3'UTR	NM_006255.3	NP_006246.2	P24723	KPCL_HUMAN	protein kinase C, eta	651	AGC-kinase C-terminal.				blood coagulation (GO:0007596)|negative regulation of glial cell apoptotic process (GO:0034351)|platelet activation (GO:0030168)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein kinase C signaling (GO:0070528)|protein phosphorylation (GO:0006468)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		CTTCATAAAGGAAGAGCCAGT	0.393																																					p.E651X	Melanoma(135;863 1779 8064 14443 26348)												.	.			0			c.G1951T												141.0	144.0	143.0					14																	62016448		2203	4300	6503	SO:0001587	stop_gained	5583	exon14			ATAAAGGAAGAGC	M55284	CCDS9752.1	14q23.1	2009-07-10			ENSG00000027075	ENSG00000027075	2.7.11.1		9403	protein-coding gene	gene with protein product		605437		PRKCL		1986216, 1545821	Standard	NM_006255		Approved	PKC-L, PKCL	uc001xfn.3	P24723	OTTHUMG00000152341	ENST00000332981.5:c.1951G>T	14.37:g.62016448G>T	ENSP00000329127:p.Glu651*		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	27	0.11	3	NM_006255	11	0.00	0	B4DJN5|Q16246|Q8NE03	Nonsense_Mutation	SNP	ENST00000332981.5	37	CCDS9752.1	.	.	.	.	.	.	.	.	.	.	G	42	9.396273	0.99158	.	.	ENSG00000027075	ENST00000332981;ENST00000555082	.	.	.	5.6	4.71	0.59529	.	0.000000	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.976	0.80063	0.0:0.0:0.8643:0.1357	.	.	.	.	X	651;490	.	ENSP00000329127:E651X	E	+	1	0	PRKCH	61086201	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.808000	0.99193	1.360000	0.45960	0.655000	0.94253	GAA			0.393	PRKCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000276974.2		NM_006255	
PLEKHH1	57475	mdanderson.org	37	14	68024067	68024067	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr14:68024067G>T	ENST00000329153.5	+	4	403	c.271G>T	c.(271-273)Gaa>Taa	p.E91*		NM_020715.2	NP_065766.1	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1	91						cytoskeleton (GO:0005856)				endometrium(2)|kidney(4)|lung(12)|urinary_tract(1)	19				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		GAAATACCAAGAATTGCTGAA	0.498																																					p.E91X													.	.			0			c.G271T												76.0	81.0	80.0					14																	68024067		1947	4146	6093	SO:0001587	stop_gained	57475	exon4			TACCAAGAATTGC	AB033026	CCDS45128.1	14q24.1	2013-01-10				ENSG00000054690		"""Pleckstrin homology (PH) domain containing"""	17733	protein-coding gene	gene with protein product						10574462	Standard	NM_020715		Approved	KIAA1200	uc001xjl.1	Q9ULM0		ENST00000329153.5:c.271G>T	14.37:g.68024067G>T	ENSP00000330278:p.Glu91*		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_020715	17	0.00	0	A6H8X6|Q6PJL4|Q6ZWC7	Nonsense_Mutation	SNP	ENST00000329153.5	37	CCDS45128.1	.	.	.	.	.	.	.	.	.	.	G	31	5.089385	0.94149	.	.	ENSG00000054690	ENST00000329153	.	.	.	5.41	5.41	0.78517	.	0.153604	0.64402	D	0.000018	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	.	12.2858	0.54791	0.0:0.17:0.83:0.0	.	.	.	.	X	91	.	ENSP00000330278:E91X	E	+	1	0	PLEKHH1	67093820	1.000000	0.71417	0.992000	0.48379	0.517000	0.34286	6.130000	0.71663	2.826000	0.97356	0.561000	0.74099	GAA			0.498	PLEKHH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000412730.3		XM_031054	
ZDHHC22	283576	broad.mit.edu	37	14	77600225	77600225	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr14:77600225G>T	ENST00000319374.4	-	3	795	c.593C>A	c.(592-594)gCc>gAc	p.A198D	RP11-463C8.4_ENST00000557752.1_Intron	NM_174976.2	NP_777636.2	Q8N966	ZDH22_HUMAN	zinc finger, DHHC-type containing 22	198					protein localization to plasma membrane (GO:0072659)|protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			kidney(1)|lung(1)|urinary_tract(1)	3			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0277)		GCCGGCGCAGGCCAGGCCGAT	0.677																																					p.A198D													.	ZDHHC22	30		0			c.C593A												24.0	31.0	29.0					14																	77600225		2015	4180	6195	SO:0001583	missense	283576	exon3			GCGCAGGCCAGGC	AK095612	CCDS45140.1	14q24.3	2008-08-06	2004-03-05	2004-03-10	ENSG00000177108	ENSG00000177108		"""Zinc fingers, DHHC-type"""	20106	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 59"""	C14orf59			Standard	NM_174976		Approved		uc010asp.3	Q8N966		ENST00000319374.4:c.593C>A	14.37:g.77600225G>T	ENSP00000318222:p.Ala198Asp		Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	72	0.08	6	NM_174976	0		0	A6NH02|B7Z2L5|Q149P4	Missense_Mutation	SNP	ENST00000319374.4	37	CCDS45140.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.437422	0.83885	.	.	ENSG00000177108	ENST00000319374	T	0.25250	1.81	5.27	5.27	0.74061	.	.	.	.	.	T	0.50086	0.1595	M	0.69523	2.12	0.46701	D	0.999162	D	0.71674	0.998	D	0.66351	0.943	T	0.42949	-0.9421	9	0.36615	T	0.2	.	18.894	0.92416	0.0:0.0:1.0:0.0	.	198	Q8N966	ZDH22_HUMAN	D	198	ENSP00000318222:A198D	ENSP00000318222:A198D	A	-	2	0	ZDHHC22	76669978	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.195000	0.77798	2.445000	0.82738	0.561000	0.74099	GCC			0.677	ZDHHC22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000414289.1		NM_174976	
DLK1	8788	ucsc.edu;bcgsc.ca	37	14	101195284	101195284	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr14:101195284G>A	ENST00000341267.4	+	3	385	c.143G>A	c.(142-144)gGc>gAc	p.G48D	DLK1_ENST00000556051.1_Missense_Mutation_p.G48D|DLK1_ENST00000331224.6_Missense_Mutation_p.G48D	NM_003836.5	NP_003827	P80370	DLK1_HUMAN	delta-like 1 homolog (Drosophila)	48	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|embryonic skeletal system development (GO:0048706)|multicellular organismal development (GO:0007275)|negative regulation of Notch signaling pathway (GO:0045746)|Notch signaling pathway (GO:0007219)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(16)|ovary(2)|prostate(1)|skin(1)	29		Melanoma(154;0.155)				TGCCAGCCTGGCTGGCAGGGT	0.622																																					p.G48D													.	DLK1	57		0			c.G143A												96.0	102.0	100.0					14																	101195284		2203	4300	6503	SO:0001583	missense	8788	exon3			AGCCTGGCTGGCA	U15979	CCDS9963.1	14q32	2011-12-05	2001-12-03			ENSG00000185559			2907	protein-coding gene	gene with protein product		176290	"""delta-like homolog (Drosophila)"""			8095043, 7925474	Standard	NM_003836		Approved	FA1, pG2, Pref-1, ZOG, Delta1	uc001yhs.4	P80370		ENST00000341267.4:c.143G>A	14.37:g.101195284G>A	ENSP00000340292:p.Gly48Asp		Somatic	42	0	0		WXS	Illumina HiSeq		36	0.11	4	NM_003836	13	0.00	0	P15803|Q96DW5	Missense_Mutation	SNP	ENST00000341267.4	37	CCDS9963.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.759531	0.89932	.	.	ENSG00000185559	ENST00000392848;ENST00000341267;ENST00000331224;ENST00000556051	D;T;T;D	0.88124	-2.34;-1.32;2.51;-2.34	4.41	4.41	0.53225	Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.95050	0.8397	M	0.93808	3.46	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96498	0.9369	10	0.87932	D	0	.	16.0144	0.80425	0.0:0.0:1.0:0.0	.	48;48	P80370-2;P80370	.;DLK1_HUMAN	D	48	ENSP00000376589:G48D;ENSP00000340292:G48D;ENSP00000331081:G48D;ENSP00000450821:G48D	ENSP00000331081:G48D	G	+	2	0	DLK1	100265037	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.726000	0.98782	2.021000	0.59480	0.591000	0.81541	GGC			0.622	DLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000414389.1			
HERC2P9	440248	broad.mit.edu	37	15	28929626	28929634	+	RNA	DEL	GAAGAGCGG	GAAGAGCGG	-	rs202184936		TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	GAAGAGCGG	GAAGAGCGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr15:28929626_28929634delGAAGAGCGG	ENST00000528584.1	+	0	2163_2171					NR_036443.1				hect domain and RLD 2 pseudogene 9																		TGAAGACTGTGAAGAGCGGGTCAGGAAGA	0.531																																					.													.	.			0			.																																											0	.			GACTGTGAAGAGC	BC047911		15q13.1	2011-05-24			ENSG00000206149	ENSG00000206149			30495	pseudogene	pseudogene							Standard	NR_036443		Approved	FLJ59185	uc010azc.3		OTTHUMG00000167114		15.37:g.28929626_28929634delGAAGAGCGG			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	7	0.29	2	.	50	0.00	0		RNA	DEL	ENST00000528584.1	37																																																																																						0.531	HERC2P9-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000393268.1		NR_036443	
NANOGP8	388112	bcgsc.ca	37	15	35377147	35377147	+	IGR	SNP	A	A	G			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr15:35377147A>G								RP11-463I20.2 (73755 upstream) : RP11-323I15.5 (14075 downstream)																							CCATGGAGGAAGGAAGAGGAG	0.478																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	388112	.			GGAGGAAGGAAGA																													15.37:g.35377147A>G			Somatic	82	0.0243902439	2		WXS	Illumina HiSeq	Phase_1	92	0.21	19	.	0		0		RNA	SNP		37																																																																																					0	0.478										
PPP1R14D	54866	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	15	41108371	41108371	+	Silent	SNP	C	C	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr15:41108371C>T	ENST00000299174.5	-	2	403	c.336G>A	c.(334-336)ctG>ctA	p.L112L	PPP1R14D_ENST00000427255.2_Nonsense_Mutation_p.W151*	NM_017726.7	NP_060196.1	Q9NXH3	PP14D_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 14D	112					regulation of phosphorylation (GO:0042325)	cytoplasm (GO:0005737)	protein phosphatase inhibitor activity (GO:0004864)			breast(1)|large_intestine(2)|lung(2)|skin(1)	6		all_cancers(109;6.29e-14)|all_epithelial(112;1.48e-11)|Lung NSC(122;5.77e-09)|all_lung(180;1.08e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.88e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		ATCCTACCTCCAGCTGAGTCT	0.542																																					p.W151X													.	.			0			c.G452A												79.0	76.0	77.0					15																	41108371		2203	4300	6503	SO:0001819	synonymous_variant	54866	exon3			TACCTCCAGCTGA	AK000258	CCDS10066.1, CCDS45230.1	15q11.2-q14	2012-04-17			ENSG00000166143	ENSG00000166143		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14953	protein-coding gene	gene with protein product	"""gut and brain phosphatase inhibitor 1"", ""PKC-dependent PP1 inhibitory protein"""	613256				11948623	Standard	NM_017726		Approved	CPI17-like, FLJ20251, GBPI-1, MGC119014, MGC119016	uc001zmz.3	Q9NXH3	OTTHUMG00000130064	ENST00000299174.5:c.336G>A	15.37:g.41108371C>T			Somatic	89	0	0		WXS	Illumina HiSeq	.	68	0.38	26	NM_001130143	0		0	Q4V773	Nonsense_Mutation	SNP	ENST00000299174.5	37	CCDS10066.1	.	.	.	.	.	.	.	.	.	.	C	17.70	3.455304	0.63401	.	.	ENSG00000166143	ENST00000427255	.	.	.	4.93	1.95	0.26073	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.071	0.09882	0.1852:0.6199:0.0:0.1949	.	.	.	.	X	151	.	ENSP00000398342:W151X	W	-	2	0	PPP1R14D	38895663	0.998000	0.40836	0.965000	0.40720	0.935000	0.57460	0.569000	0.23638	0.254000	0.21573	0.655000	0.94253	TGG			0.542	PPP1R14D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252355.2		NM_017726	
CCDC64B	146439	mdanderson.org	37	16	3080740	3080740	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr16:3080740G>T	ENST00000572449.1	-	4	634	c.572C>A	c.(571-573)gCt>gAt	p.A191D	CCDC64B_ENST00000573514.1_De_novo_Start_OutOfFrame|CCDC64B_ENST00000389347.4_Missense_Mutation_p.A191D|RP11-473M20.5_ENST00000382225.3_RNA			A1A5D9	BICR2_HUMAN	coiled-coil domain containing 64B	191										breast(1)|endometrium(2)|large_intestine(1)	4						CTCTGCTCCAGCCAGTGCCTG	0.632																																					p.A191D													.	.			0			c.C572A												26.0	29.0	28.0					16																	3080740		2008	4163	6171	SO:0001583	missense	146439	exon3			GCTCCAGCCAGTG	BC128602	CCDS45393.1	16p13.3	2008-07-04				ENSG00000162069			33584	protein-coding gene	gene with protein product							Standard	NM_001103175		Approved		uc002ctf.4	A1A5D9		ENST00000572449.1:c.572C>A	16.37:g.3080740G>T	ENSP00000459043:p.Ala191Asp		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_001103175	21	0.00	0	Q658L9	Missense_Mutation	SNP	ENST00000572449.1	37	CCDS45393.1	.	.	.	.	.	.	.	.	.	.	G	12.91	2.080248	0.36662	.	.	ENSG00000162069	ENST00000389347	T	0.31769	1.48	4.86	3.8	0.43715	.	0.706198	0.13985	N	0.349183	T	0.21801	0.0525	N	0.08118	0	0.31014	N	0.718869	D	0.53745	0.962	P	0.52481	0.7	T	0.02109	-1.1212	10	0.22706	T	0.39	-0.8159	7.8372	0.29376	0.1588:0.0:0.8412:0.0	.	191	A1A5D9	BICR2_HUMAN	D	191	ENSP00000373998:A191D	ENSP00000373998:A191D	A	-	2	0	CCDC64B	3020741	0.896000	0.30565	0.975000	0.42487	0.543000	0.35085	1.858000	0.39408	2.251000	0.74343	0.561000	0.74099	GCT			0.632	CCDC64B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000436991.1			
SMG1P3	100271836	broad.mit.edu	37	16	21469994	21469994	+	RNA	DEL	A	A	-			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr16:21469994delA	ENST00000520823.2	-	0	749				snoU13_ENST00000459321.1_RNA																							ACTGTACATTAAAAAAAAAAA	0.294																																					.													.	.			0			.																																											0	.			TACATTAAAAAAA																													16.37:g.21469994delA			Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	60	0.13	8	.	0		0		RNA	DEL	ENST00000520823.2	37																																																																																						0.294	CTD-2547E10.2-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000378302.2			
PKD1L2	114780	broad.mit.edu	37	16	81155069	81155069	+	RNA	DEL	A	A	-	rs557576474		TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr16:81155069delA	ENST00000534142.1	-	0	1000				PKD1L2_ENST00000525539.1_RNA|PKD1L2_ENST00000533478.1_RNA			Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						actccatctcaaaaaaaaaaa	0.527																																					.													.	PKD1L2	361		0			.																																											114780	.			CATCTCAAAAAAA	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81155069delA			Somatic	11	0	0		WXS	Illumina HiSeq	Phase_I	12	0.25	3	.	0		0	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	RNA	DEL	ENST00000534142.1	37																																																																																						0.527	PKD1L2-009	PUTATIVE	basic|exp_conf	processed_transcript	polymorphic_pseudogene		OTTHUMT00000387969.1			
KDM6B	23135	mdanderson.org	37	17	7751802	7751802	+	Silent	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr17:7751802G>T	ENST00000448097.2	+	11	2527	c.2196G>T	c.(2194-2196)ctG>ctT	p.L732L	KDM6B_ENST00000254846.5_Silent_p.L732L			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	732	Pro-rich.				cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						TTGCATCTCTGCAGTCTCCTT	0.622																																					p.L732L													KDM6B,NS,carcinoma,+2,1	KDM6B	2	1	0			c.G2196T												65.0	79.0	74.0					17																	7751802		2203	4300	6503	SO:0001819	synonymous_variant	23135	exon11			ATCTCTGCAGTCT	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.2196G>T	17.37:g.7751802G>T			Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	29	0.10	3	NM_001080424	32	0.00	0	C9IZ40|Q96G33	Silent	SNP	ENST00000448097.2	37																																																																																						0.622	KDM6B-002	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000440248.1		XM_043272	
DHRS11	79154	mdanderson.org	37	17	34958334	34958334	+	IGR	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr17:34958334G>T	ENST00000251312.5	+	0	1598				MRM1_ENST00000585770.1_5'Flank|MRM1_ENST00000250156.7_Missense_Mutation_p.G32V	NM_024308.3	NP_077284.2	Q6UWP2	DHR11_HUMAN	dehydrogenase/reductase (SDR family) member 11							extracellular region (GO:0005576)	oxidoreductase activity (GO:0016491)			endometrium(1)|lung(4)	5						CGGCCTGGTGGGGAGGAGCTA	0.677																																					p.G32V													.	.			0			c.G95T												61.0	62.0	62.0					17																	34958334		2202	4300	6502	SO:0001628	intergenic_variant	79922	exon1			CTGGTGGGGAGGA		CCDS11315.2	17q12	2014-05-06			ENSG00000108272	ENSG00000278535		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	28639	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 24C, member 1"""					12975309, 19027726	Standard	NM_024308		Approved	MGC4172, SDR24C1	uc002hnd.3	Q6UWP2	OTTHUMG00000188442		17.37:g.34958334G>T			Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	22	0.14	3	NM_024864	35	0.00	0	B2RDZ3|Q9BUC7|Q9H674	Missense_Mutation	SNP	ENST00000251312.5	37	CCDS11315.2	.	.	.	.	.	.	.	.	.	.	G	22.6	4.311303	0.81358	.	.	ENSG00000129282	ENST00000250156	T	0.55052	0.54	4.79	4.79	0.61399	.	0.154450	0.46145	D	0.000305	T	0.58864	0.2152	L	0.32530	0.975	0.80722	D	1	D	0.65815	0.995	P	0.60682	0.878	T	0.60821	-0.7187	10	0.59425	D	0.04	-24.9592	15.0349	0.71738	0.0:0.0:1.0:0.0	.	32	Q6IN84	MRM1_HUMAN	V	32	ENSP00000250156:G32V	ENSP00000250156:G32V	G	+	2	0	MRM1	32032447	1.000000	0.71417	0.999000	0.59377	0.884000	0.51177	3.171000	0.50824	2.654000	0.90174	0.555000	0.69702	GGG			0.677	DHRS11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256681.2		NM_024308	
HEXIM2	124790	mdanderson.org	37	17	43246847	43246847	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr17:43246847A>T	ENST00000307275.3	+	4	968	c.532A>T	c.(532-534)Agt>Tgt	p.S178C	HEXIM2_ENST00000591576.1_Missense_Mutation_p.S178C|RP13-890H12.2_ENST00000589796.1_RNA|RP13-890H12.2_ENST00000589451.1_RNA|HEXIM2_ENST00000592695.1_Missense_Mutation_p.S178C	NM_144608.1	NP_653209.1	Q96MH2	HEXI2_HUMAN	hexamethylene bis-acetamide inducible 2	178					negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|snRNA binding (GO:0017069)			endometrium(1)|large_intestine(3)|lung(1)	5						GGCCGGGGACAGTGATGGGCG	0.632																																					p.S178C													.	.			0			c.A532T												29.0	27.0	28.0					17																	43246847		2203	4300	6503	SO:0001583	missense	124790	exon4			GGGGACAGTGATG	AK056946	CCDS11496.1	17q21.31	2011-07-29	2011-07-29			ENSG00000168517			28591	protein-coding gene	gene with protein product		615695				12832472	Standard	NM_144608		Approved	FLJ32384	uc002iih.1	Q96MH2		ENST00000307275.3:c.532A>T	17.37:g.43246847A>T	ENSP00000302276:p.Ser178Cys		Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_144608	56	0.00	0	D3DX66	Missense_Mutation	SNP	ENST00000307275.3	37	CCDS11496.1	.	.	.	.	.	.	.	.	.	.	A	17.22	3.334971	0.60853	.	.	ENSG00000168517	ENST00000307275	.	.	.	5.01	2.59	0.31030	.	0.260146	0.47455	D	0.000221	T	0.46983	0.1421	M	0.73962	2.25	0.27963	N	0.936684	D	0.54964	0.969	P	0.50378	0.639	T	0.44205	-0.9343	9	0.59425	D	0.04	-11.8116	5.6832	0.17788	0.7338:0.1685:0.0977:0.0	.	178	Q96MH2	HEXI2_HUMAN	C	178	.	ENSP00000302276:S178C	S	+	1	0	HEXIM2	40602630	0.403000	0.25319	0.968000	0.41197	0.758000	0.43043	0.584000	0.23864	1.022000	0.39626	0.459000	0.35465	AGT			0.632	HEXIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450181.1		NM_144608	
AP3D1	8943	mdanderson.org	37	19	2102188	2102188	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr19:2102188G>T	ENST00000345016.5	-	30	3677	c.3446C>A	c.(3445-3447)aCg>aAg	p.T1149K	AP3D1_ENST00000355272.6_Missense_Mutation_p.T1211K|AP3D1_ENST00000350812.6_Missense_Mutation_p.T980K|AP3D1_ENST00000356926.4_Missense_Mutation_p.T1108K	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	1149					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTTGGCCAGCGTCGCCTTCAT	0.592																																					p.T1211K													.	.			0			c.C3632A												121.0	129.0	126.0					19																	2102188		2049	4196	6245	SO:0001583	missense	8943	exon32			GCCAGCGTCGCCT	U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.3446C>A	19.37:g.2102188G>T	ENSP00000344055:p.Thr1149Lys		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_001261826	431	0.00	0	O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Missense_Mutation	SNP	ENST00000345016.5	37	CCDS42459.1	.	.	.	.	.	.	.	.	.	.	G	13.85	2.360289	0.41801	.	.	ENSG00000065000	ENST00000356926;ENST00000345016;ENST00000355272;ENST00000343722;ENST00000350812	T;T;T;T	0.19250	2.16;2.66;2.67;2.17	4.41	4.41	0.53225	.	0.000000	0.85682	D	0.000000	T	0.42359	0.1199	M	0.68317	2.08	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.87578	0.998;0.997;0.998;0.997	T	0.18999	-1.0319	10	0.26408	T	0.33	-26.5955	14.1817	0.65578	0.0:0.0:1.0:0.0	.	980;1211;1149;1108	E7EMM2;O14617-5;O14617;G5E988	.;.;AP3D1_HUMAN;.	K	1108;1149;1211;1017;980	ENSP00000349398:T1108K;ENSP00000344055:T1149K;ENSP00000347416:T1211K;ENSP00000342321:T980K	ENSP00000341579:T1017K	T	-	2	0	AP3D1	2053188	1.000000	0.71417	0.291000	0.24904	0.218000	0.24690	6.674000	0.74487	2.016000	0.59253	0.561000	0.74099	ACG			0.592	AP3D1-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000450912.1			
DOHH	83475	mdanderson.org	37	19	3491805	3491805	+	Silent	SNP	C	C	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr19:3491805C>T	ENST00000427575.1	-	5	1045	c.594G>A	c.(592-594)ctG>ctA	p.L198L	DOHH_ENST00000250937.3_Silent_p.L198L	NM_001145165.1	NP_001138637.1			deoxyhypusine hydroxylase/monooxygenase											central_nervous_system(1)|large_intestine(1)|lung(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCCACAGTGCAGACCTGCAG	0.682																																					p.L198L													.	.			0			c.G594A												4.0	3.0	3.0					19																	3491805		1908	3818	5726	SO:0001819	synonymous_variant	83475	exon5			ACAGTGCAGACCT	BC002817	CCDS12108.1	19p13.3	2008-02-05	2006-05-22	2006-05-22		ENSG00000129932			28662	protein-coding gene	gene with protein product		611262	"""HEAT-like (PBS lyase) repeat containing 1"""	HLRC1		16371467, 16533814	Standard	NM_031304		Approved	MGC4293	uc002lxs.3	Q9BU89		ENST00000427575.1:c.594G>A	19.37:g.3491805C>T			Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	25	0.12	3	NM_001145165	44	0.00	0		Silent	SNP	ENST00000427575.1	37	CCDS12108.1																																																																																					0.682	DOHH-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452932.1		NM_031304	
TBXA2R	6915	mdanderson.org	37	19	3600390	3600390	+	Silent	SNP	G	G	T	rs5745	byFrequency	TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr19:3600390G>T	ENST00000375190.4	-	2	636	c.243C>A	c.(241-243)acC>acA	p.T81T	TBXA2R_ENST00000411851.3_Silent_p.T81T|TBXA2R_ENST00000587717.1_5'Flank|TBXA2R_ENST00000589966.1_Silent_p.T81T	NM_001060.5|NM_201636.2	NP_001051.1|NP_963998.2	P21731	TA2R_HUMAN	thromboxane A2 receptor	81					blood coagulation (GO:0007596)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of vasoconstriction (GO:0045907)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|second-messenger-mediated signaling (GO:0019932)|thromboxane A2 signaling pathway (GO:0038193)	acrosomal vesicle (GO:0001669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|thromboxane A2 receptor activity (GO:0004961)			kidney(1)|lung(2)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	8		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)	Ridogrel(DB01207)	CGATGGTACCGGTCACCAGCA	0.677																																					p.T81T													.	.			0			c.C243A												36.0	51.0	46.0					19																	3600390		2164	4242	6406	SO:0001819	synonymous_variant	6915	exon2			GGTACCGGTCACC		CCDS42467.1, CCDS54198.1	19p13.3	2014-09-17						"""GPCR / Class A : Prostanoid receptors"""	11608	protein-coding gene	gene with protein product		188070				1825698	Standard	NM_001060		Approved		uc021umv.1	P21731		ENST00000375190.4:c.243C>A	19.37:g.3600390G>T			Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_001060	2	0.00	0	O75228|Q6DK52|Q9UCY1|Q9UCY2	Silent	SNP	ENST00000375190.4	37	CCDS42467.1																																																																																					0.677	TBXA2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000453081.2			
CD97	976	mdanderson.org	37	19	14512474	14512474	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr19:14512474T>C	ENST00000242786.5	+	11	1165	c.1085T>C	c.(1084-1086)cTg>cCg	p.L362P	CD97_ENST00000357355.3_Missense_Mutation_p.L313P|CTC-548K16.5_ENST00000590626.1_RNA|CD97_ENST00000358600.3_Missense_Mutation_p.L269P	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	362					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						GAGCTGACCCTGATGATCCAG	0.637																																					p.L362P													.	.			0			c.T1085C												57.0	47.0	50.0					19																	14512474		2203	4300	6503	SO:0001583	missense	976	exon11			TGACCCTGATGAT		CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.1085T>C	19.37:g.14512474T>C	ENSP00000242786:p.Leu362Pro		Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_078481	30	0.00	0	A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Missense_Mutation	SNP	ENST00000242786.5	37	CCDS32929.1	.	.	.	.	.	.	.	.	.	.	T	17.25	3.341782	0.61073	.	.	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000358600;ENST00000393059	T;T;T	0.76709	-1.04;-0.87;-0.48	5.29	5.29	0.74685	.	.	.	.	.	D	0.87680	0.6238	M	0.81341	2.54	0.30137	N	0.804241	D;D;P	0.89917	1.0;1.0;0.609	D;D;B	0.87578	0.998;0.998;0.17	D	0.85377	0.1117	9	0.87932	D	0	.	11.6139	0.51078	0.0:0.0:0.0:1.0	.	269;313;362	P48960-2;P48960-3;P48960	.;.;CD97_HUMAN	P	362;313;269;312	ENSP00000242786:L362P;ENSP00000349918:L313P;ENSP00000351413:L269P	ENSP00000242786:L362P	L	+	2	0	CD97	14373474	0.306000	0.24490	0.185000	0.23176	0.179000	0.23085	3.477000	0.53151	1.998000	0.58463	0.454000	0.30748	CTG			0.637	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000459821.2		NM_078481	
ZNF253	56242	broad.mit.edu	37	19	20003204	20003204	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr19:20003204T>C	ENST00000589717.1	+	4	1240	c.1148T>C	c.(1147-1149)cTt>cCt	p.L383P	AC011477.1_ENST00000578823.1_RNA|ZNF253_ENST00000355650.4_Missense_Mutation_p.L307P|CTC-559E9.8_ENST00000585571.1_RNA	NM_021047.2	NP_066385.2	O75346	ZN253_HUMAN	zinc finger protein 253	383				Missing (in Ref. 1; AAC26844). {ECO:0000305}.	negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TCCACAACCCTTTTTTCACAT	0.398																																					p.L383P													.	ZNF253	99		0			c.T1148C												40.0	45.0	43.0					19																	20003204		2131	4263	6394	SO:0001583	missense	56242	exon4			CAACCCTTTTTTC	AF038951	CCDS42532.1	19p12	2014-02-12	2003-12-17		ENSG00000256771	ENSG00000256771		"""Zinc fingers, C2H2-type"", ""-"""	13497	protein-coding gene	gene with protein product		606954	"""zinc finger protein 411"""	ZNF411		10585455	Standard	NM_021047		Approved	BMZF-1, FLJ90391	uc002noj.3	O75346	OTTHUMG00000182369	ENST00000589717.1:c.1148T>C	19.37:g.20003204T>C	ENSP00000468720:p.Leu383Pro		Somatic	124	0.0080645161	1		WXS	Illumina HiSeq	Phase_I	78	0.04	3	NM_021047	20	0.00	0	A4FVA7|Q0P6G3|Q6P0L2|Q8NCA3|Q8NCF9	Missense_Mutation	SNP	ENST00000589717.1	37	CCDS42532.1	.	.	.	.	.	.	.	.	.	.	t	11.74	1.729158	0.30684	.	.	ENSG00000256771	ENST00000355650	.	.	.	0.81	0.81	0.18732	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.71039	0.3293	M	0.93898	3.47	0.22866	N	0.998631	D	0.89917	1.0	D	0.91635	0.999	T	0.57406	-0.7817	7	.	.	.	.	5.4325	0.16460	0.0:0.0:0.0:1.0	.	383	O75346	ZN253_HUMAN	P	383	.	.	L	+	2	0	ZNF253	19864204	0.044000	0.20184	0.553000	0.28255	0.554000	0.35429	1.850000	0.39328	0.156000	0.19299	0.155000	0.16302	CTT			0.398	ZNF253-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000460802.1		NM_021047	
CAPNS1	826	bcgsc.ca	37	19	36632054	36632054	+	Silent	SNP	C	C	T	rs17879825		TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr19:36632054C>T	ENST00000246533.3	+	2	739	c.141C>T	c.(139-141)ggC>ggT	p.G47G	AD001527.7_ENST00000604228.1_RNA|CAPNS1_ENST00000590874.1_Silent_p.G47G|CAPNS1_ENST00000588780.1_Silent_p.G47G|CAPNS1_ENST00000589146.1_Intron|CAPNS1_ENST00000587718.1_Silent_p.G47G|CAPNS1_ENST00000588815.1_Silent_p.G47G	NM_001003962.1|NM_001749.2	NP_001003962.1|NP_001740.1	P04632	CPNS1_HUMAN	calpain, small subunit 1	47	Gly-rich (hydrophobic).|Poly-Gly.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			cervix(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			gcggcggcggcggtggtggag	0.761																																					p.G47G	Esophageal Squamous(129;1541 1691 5780 18353 34150)												.	CAPNS1	19		0			c.C141T																																									SO:0001819	synonymous_variant	826	exon2			CGGCGGCGGTGGT	X04106	CCDS12489.1	19q13.1	2013-01-10		2001-08-10	ENSG00000126247	ENSG00000126247	3.4.22.52	"""EF-hand domain containing"""	1481	protein-coding gene	gene with protein product		114170		CAPN4		3024120, 3016651	Standard	NM_001003962		Approved	CANP, CANPS, 30K, CDPS	uc002odj.3	P04632		ENST00000246533.3:c.141C>T	19.37:g.36632054C>T			Somatic	139	0.0143884892	2		WXS	Illumina HiSeq	Phase_1	104	0.08	8	NM_001749	3	0.00	0	A8K0P1|Q8WTX3|Q96EW0	Silent	SNP	ENST00000246533.3	37	CCDS12489.1																																																																																					0.761	CAPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000457411.2			
FCGBP	8857	mdanderson.org	37	19	40433368	40433368	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr19:40433368G>A	ENST00000221347.6	-	2	908	c.901C>T	c.(901-903)Cca>Tca	p.P301S		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	301	IgGFc-binding.					extracellular vesicular exosome (GO:0070062)		p.P301S(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GGCCAGGATGGCCGGACCTCA	0.567																																					p.P301S													FCGBP,colon,carcinoma,0,1	FCGBP	0	1	1	Substitution - Missense(1)	large_intestine(1)	c.C901T												61.0	56.0	58.0					19																	40433368		2203	4300	6503	SO:0001583	missense	8857	exon2			AGGATGGCCGGAC	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.901C>T	19.37:g.40433368G>A	ENSP00000221347:p.Pro301Ser		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	31	0.10	3	NM_003890	3	0.00	0	O95784	Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	G	4.517	0.095996	0.08681	.	.	ENSG00000090920	ENST00000221347	T	0.13901	2.55	4.36	4.36	0.52297	.	0.436920	0.18570	N	0.137369	T	0.04092	0.0114	N	0.02315	-0.6	0.09310	N	1	B	0.25772	0.134	B	0.17979	0.02	T	0.42032	-0.9475	10	0.09338	T	0.73	.	6.6416	0.22913	0.1871:0.0:0.8129:0.0	.	301	Q9Y6R7	FCGBP_HUMAN	S	301	ENSP00000221347:P301S	ENSP00000221347:P301S	P	-	1	0	FCGBP	45125208	0.055000	0.20627	0.045000	0.18777	0.286000	0.27126	2.391000	0.44424	2.715000	0.92844	0.655000	0.94253	CCA			0.567	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462507.1		NM_003890	
HSD17B14	51171	mdanderson.org	37	19	49337583	49337583	+	Missense_Mutation	SNP	G	G	A	rs11547571		TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr19:49337583G>A	ENST00000263278.4	-	3	426	c.160C>T	c.(160-162)Cct>Tct	p.P54S	HSD17B14_ENST00000599157.1_Missense_Mutation_p.P54S	NM_016246.2	NP_057330.2	Q9BPX1	DHB14_HUMAN	hydroxysteroid (17-beta) dehydrogenase 14	54					steroid catabolic process (GO:0006706)	cytosol (GO:0005829)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|testosterone 17-beta-dehydrogenase (NADP+) activity (GO:0047045)			large_intestine(3)|lung(1)|skin(1)	5		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000341)|all cancers(93;0.000764)|GBM - Glioblastoma multiforme(486;0.0233)|Epithelial(262;0.0346)		ACAGCTCCAGGGAGCTCCTGC	0.592																																					p.P54S													.	.			0			c.C160T												89.0	85.0	86.0					19																	49337583		2203	4300	6503	SO:0001583	missense	51171	exon3			CTCCAGGGAGCTC	AF126781	CCDS12736.1	19q13.33	2011-09-14	2006-11-22	2006-11-22		ENSG00000087076		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	23238	protein-coding gene	gene with protein product	"""retinal short-chain dehydrogenase/reductase 3"", ""short chain dehydrogenase/reductase family 47C, member 1"""	612832	"""dehydrogenase/reductase (SDR family) member 10"""	DHRS10		10800688, 17067289, 19027726	Standard	XM_005258969		Approved	retSDR3, SDR47C1	uc002pkv.1	Q9BPX1		ENST00000263278.4:c.160C>T	19.37:g.49337583G>A	ENSP00000263278:p.Pro54Ser		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_016246	233	0.00	0	Q9UKU3	Missense_Mutation	SNP	ENST00000263278.4	37	CCDS12736.1	.	.	.	.	.	.	.	.	.	.	g	0.090	-1.168754	0.01660	.	.	ENSG00000087076	ENST00000263278	D	0.87029	-2.2	3.81	1.58	0.23477	NAD(P)-binding domain (1);	0.398881	0.23551	N	0.046969	T	0.66645	0.2810	N	0.04090	-0.28	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.53669	-0.8406	10	0.27785	T	0.31	.	4.1343	0.10164	0.127:0.0:0.6433:0.2297	.	54	Q9BPX1	DHB14_HUMAN	S	54	ENSP00000263278:P54S	ENSP00000263278:P54S	P	-	1	0	HSD17B14	54029395	0.007000	0.16637	0.031000	0.17742	0.225000	0.24961	0.614000	0.24314	0.389000	0.25086	0.437000	0.28790	CCT			0.592	HSD17B14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466212.1		NM_016246	
SIGLEC10	89790	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	51919248	51919248	+	Silent	SNP	G	G	A			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr19:51919248G>A	ENST00000339313.5	-	5	1044	c.928C>T	c.(928-930)Ctg>Ttg	p.L310L	SIGLEC10_ENST00000436984.2_Silent_p.L262L|CTD-2616J11.2_ENST00000526996.1_RNA|SIGLEC10_ENST00000356298.5_Silent_p.L310L|SIGLEC10_ENST00000432469.2_Silent_p.L227L|CTD-2616J11.2_ENST00000532688.1_RNA|SIGLEC10_ENST00000439889.2_Silent_p.L252L|SIGLEC10_ENST00000353836.5_Silent_p.L310L|SIGLEC10_ENST00000441969.3_Silent_p.L252L|SIGLEC10_ENST00000525998.1_Intron|CTD-2616J11.3_ENST00000532473.1_RNA|SIGLEC10_ENST00000442846.3_Intron			Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10	310	Ig-like C2-type 2.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(27)|ovary(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		ACCCCGGGCAGCTCCAGCCCC	0.667																																					p.L310L													.	SIGLEC10	112		0			c.C928T												32.0	37.0	35.0					19																	51919248		2203	4300	6503	SO:0001819	synonymous_variant	89790	exon5			CGGGCAGCTCCAG	AF310233	CCDS12832.1, CCDS54301.1, CCDS54302.1, CCDS54303.1, CCDS54304.1, CCDS54305.1	19q13.3	2013-01-29			ENSG00000142512	ENSG00000142512		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15620	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 10 Ig-like lectin 7"", ""siglec-like gene 2"""	606091				11284738	Standard	NM_033130		Approved	SIGLEC-10, SLG2, PRO940, MGC126774	uc002pwo.3	Q96LC7	OTTHUMG00000165521	ENST00000339313.5:c.928C>T	19.37:g.51919248G>A			Somatic	112	0	0		WXS	Illumina HiSeq	Phase_I	82	0.16	13	NM_001171157	6	0.00	0	A8K1I5|A8K3C7|C9JJ33|C9JM10|F8W917|Q3MIR5|Q6UXI8|Q96G54|Q96LC8	Silent	SNP	ENST00000339313.5	37	CCDS12832.1																																																																																					0.667	SIGLEC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000384620.2		NM_033130	
ZNF320	162967	mdanderson.org	37	19	53384632	53384632	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr19:53384632C>A	ENST00000595635.1	-	8	1248	c.747G>T	c.(745-747)gaG>gaT	p.E249D	ZNF320_ENST00000600930.1_Intron|ZNF320_ENST00000597909.1_Intron|ZNF320_ENST00000391781.2_Missense_Mutation_p.E249D	NM_207333.2	NP_997216.2	A2RRD8	ZN320_HUMAN	zinc finger protein 320	249					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(4)|large_intestine(5)|liver(1)|lung(10)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(134;0.0534)		TCTTGCCACACTCATTACACT	0.398																																					p.E249D													.	.			0			c.G747T												136.0	123.0	127.0					19																	53384632		2203	4300	6503	SO:0001583	missense	162967	exon4			GCCACACTCATTA	AF086262	CCDS33095.1	19q13.41	2014-09-04			ENSG00000182986	ENSG00000182986		"""Zinc fingers, C2H2-type"", ""-"""	13842	protein-coding gene	gene with protein product		606427				11536051	Standard	XM_006723059		Approved	ZFPL, DKFZp686G16228	uc002qag.3	A2RRD8	OTTHUMG00000182797	ENST00000595635.1:c.747G>T	19.37:g.53384632C>A	ENSP00000473091:p.Glu249Asp		Somatic	86	0.011627907	1		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_207333	20	0.00	0	Q8NDR6	Missense_Mutation	SNP	ENST00000595635.1	37	CCDS33095.1	.	.	.	.	.	.	.	.	.	.	-	7.548	0.662163	0.14645	.	.	ENSG00000182986	ENST00000391781	T	0.35973	1.28	1.74	-2.36	0.06663	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.21801	0.0525	N	0.21142	0.635	0.09310	N	1	B	0.18461	0.028	B	0.21917	0.037	T	0.28267	-1.0049	9	0.56958	D	0.05	.	6.394	0.21603	0.0:0.5635:0.0:0.4365	.	249	A2RRD8	ZN320_HUMAN	D	249	ENSP00000375660:E249D	ENSP00000375660:E249D	E	-	3	2	ZNF320	58076444	0.000000	0.05858	0.003000	0.11579	0.185000	0.23345	-6.315000	0.00071	-0.361000	0.08125	0.184000	0.17185	GAG			0.398	ZNF320-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463771.1		NM_207333	
ZNF772	400720	hgsc.bcm.edu;mdanderson.org	37	19	57984888	57984888	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr19:57984888G>T	ENST00000343280.4	-	5	1484	c.1224C>A	c.(1222-1224)tgC>tgA	p.C408*	AC004076.9_ENST00000415705.3_Intron|AC004076.9_ENST00000596831.1_Intron|ZNF772_ENST00000600175.1_Intron|ZNF772_ENST00000601768.1_Intron|ZNF772_ENST00000356584.3_Nonsense_Mutation_p.C367*|ZNF772_ENST00000427512.2_Nonsense_Mutation_p.C296*|ZNF772_ENST00000425074.3_3'UTR	NM_001024596.2	NP_001019767.1	Q68DY9	ZN772_HUMAN	zinc finger protein 772	408					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(4)|lung(3)	9		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)|Lung(386;0.174)		CACATGCGATGCACTCATAAG	0.413																																					p.C408X	Melanoma(5;289 436 14293 15924 30817)												.	.			0			c.C1224A												131.0	117.0	122.0					19																	57984888		2203	4300	6503	SO:0001587	stop_gained	400720	exon5			TGCGATGCACTCA	BX647068	CCDS33133.1, CCDS46210.1	19q13.43	2013-01-08				ENSG00000197128		"""Zinc fingers, C2H2-type"", ""-"""	33106	protein-coding gene	gene with protein product							Standard	NM_001024596		Approved	DKFZp686I1569	uc002qot.3	Q68DY9		ENST00000343280.4:c.1224C>A	19.37:g.57984888G>T	ENSP00000341165:p.Cys408*		Somatic	88	0	0		WXS	Illumina HiSeq	.	65	0.23	15	NM_001024596	1	0.00	0	A6NJK9|B4DH56|B4DYS0	Nonsense_Mutation	SNP	ENST00000343280.4	37	CCDS33133.1	.	.	.	.	.	.	.	.	.	.	G	36	5.926403	0.97110	.	.	ENSG00000197128	ENST00000343280;ENST00000427512;ENST00000356584;ENST00000291809	.	.	.	3.72	0.187	0.15109	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.3786	0.11283	0.2225:0.0:0.5946:0.1829	.	.	.	.	X	408;296;367;333	.	ENSP00000291809:C333X	C	-	3	2	ZNF772	62676700	0.000000	0.05858	1.000000	0.80357	0.935000	0.57460	-0.341000	0.07811	0.778000	0.33520	0.305000	0.20034	TGC			0.413	ZNF772-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000397447.1		NM_001024596	
ATAD2B	54454	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	24080341	24080341	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr2:24080341A>C	ENST00000238789.5	-	13	1855	c.1512T>G	c.(1510-1512)ttT>ttG	p.F504L		NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	504						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTATTTCATCAAAAAATATTA	0.259																																					p.F504L													.	.			0			c.T1512G												38.0	35.0	36.0					2																	24080341		1792	4056	5848	SO:0001583	missense	54454	exon13			TTCATCAAAAAAT	AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.1512T>G	2.37:g.24080341A>C	ENSP00000238789:p.Phe504Leu		Somatic	371	0	0		WXS	Illumina HiSeq	.	437	0.31	134	NM_001242338	1	0.00	0	B9ZVQ5|Q6ZNA6|Q8N9E7	Missense_Mutation	SNP	ENST00000238789.5	37	CCDS46227.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.5|24.5	4.540999|4.540999	0.85917|0.85917	.|.	.|.	ENSG00000119778|ENSG00000119778	ENST00000238789|ENST00000366438	D|.	0.92299|.	-3.01|.	5.64|5.64	5.64|5.64	0.86602|0.86602	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);|.	.|.	.|.	.|.	.|.	T|T	0.40322|0.40322	0.1112|0.1112	N|N	0.05619|0.05619	-0.005|-0.005	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.83275|.	0.996|.	T|T	0.34875|0.34875	-0.9811|-0.9811	9|5	0.66056|.	D|.	0.02|.	.|.	16.1729|16.1729	0.81831|0.81831	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	504|.	Q9ULI0|.	ATD2B_HUMAN|.	L|W	504|126	ENSP00000238789:F504L|.	ENSP00000238789:F504L|.	F|L	-|-	3|2	2|0	ATAD2B|ATAD2B	23933845|23933845	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	5.272000|5.272000	0.65559|0.65559	2.281000|2.281000	0.76405|0.76405	0.533000|0.533000	0.62120|0.62120	TTT|TTG			0.259	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000324333.1		NM_017552	
USP39	10713	mdanderson.org	37	2	85866488	85866488	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr2:85866488G>T	ENST00000323701.6	+	9	1268	c.1258G>T	c.(1258-1260)Gct>Tct	p.A420S	USP39_ENST00000459775.1_3'UTR|USP39_ENST00000409470.1_Missense_Mutation_p.A420S|USP39_ENST00000409025.1_Missense_Mutation_p.A420S|USP39_ENST00000409766.3_Missense_Mutation_p.A420S|USP39_ENST00000450066.2_Missense_Mutation_p.A317S	NM_006590.3	NP_006581.2	Q53GS9	SNUT2_HUMAN	ubiquitin specific peptidase 39	420	USP.				cell cycle (GO:0007049)|cell division (GO:0051301)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|ubiquitin-dependent protein catabolic process (GO:0006511)	spliceosomal complex (GO:0005681)	ubiquitinyl hydrolase activity (GO:0036459)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	19						CAACATCCTGGCTAAGTTCAA	0.473																																					p.A420S													.	.			0			c.G1258T												128.0	104.0	112.0					2																	85866488		2203	4300	6503	SO:0001583	missense	10713	exon9			ATCCTGGCTAAGT	AF132955	CCDS33234.1, CCDS58716.1, CCDS58717.1, CCDS74534.1	2p11.2	2009-01-06	2005-08-08		ENSG00000168883	ENSG00000168883		"""Ubiquitin-specific peptidases"""	20071	protein-coding gene	gene with protein product	"""snRNP assembly defective 1 homolog (S.cerevisiae)"", ""small nuclear ribonucleoprotein 65kDa (U4/U6.U5)"""	611594	"""ubiquitin specific protease 39"""			12838346	Standard	NM_006590		Approved	SAD1, CGI-21, SNRNP65	uc002sqg.4	Q53GS9	OTTHUMG00000153090	ENST00000323701.6:c.1258G>T	2.37:g.85866488G>T	ENSP00000312981:p.Ala420Ser		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	55	0.07	4	NM_001256725	431	0.00	0	A8K086|B3KM40|B4DHT4|D6W5L4|G5E9H0|Q6NX47|Q96RK9|Q9BV89|Q9H381|Q9P050|Q9Y310	Missense_Mutation	SNP	ENST00000323701.6	37	CCDS33234.1	.	.	.	.	.	.	.	.	.	.	G	13.64	2.296059	0.40594	.	.	ENSG00000168883	ENST00000450066;ENST00000409025;ENST00000409470;ENST00000323701;ENST00000409766	T;T;T;T;T	0.28454	1.61;4.2;1.61;1.61;1.61	5.75	5.75	0.90469	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.101253	0.64402	D	0.000004	T	0.18593	0.0446	N	0.12422	0.21	0.47407	D	0.999416	B;B;B;B;B;B	0.20368	0.0;0.001;0.035;0.044;0.044;0.009	B;B;B;B;B;B	0.18263	0.007;0.007;0.012;0.021;0.021;0.012	T	0.08868	-1.0701	10	0.09084	T	0.74	-9.0462	17.4249	0.87524	0.0:0.0:1.0:0.0	.	317;342;420;420;420;420	B4DHT4;B7Z7L9;G5E9H0;B3KM40;B9A018;Q53GS9	.;.;.;.;.;SNUT2_HUMAN	S	317;420;420;420;420	ENSP00000396133:A317S;ENSP00000386572:A420S;ENSP00000386864:A420S;ENSP00000312981:A420S;ENSP00000386803:A420S	ENSP00000312981:A420S	A	+	1	0	USP39	85719999	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.314000	0.96306	2.721000	0.93114	0.655000	0.94253	GCT			0.473	USP39-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000329892.1		NM_006590	
ANKRD36C	400986	broad.mit.edu	37	2	96646519	96646519	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr2:96646519T>A	ENST00000456556.1	-	5	692	c.608A>T	c.(607-609)cAt>cTt	p.H203L				Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C	203							ion channel inhibitor activity (GO:0008200)	p.H203L(2)		breast(1)|endometrium(8)|kidney(5)|lung(4)	18						AGTAACAGCATGTATGAGGGC	0.313																																					.													ENSG00000174501,NS,carcinoma,0,2	.		2	2	Substitution - Missense(2)	endometrium(1)|kidney(1)	.																																									SO:0001583	missense	400986	.			ACAGCATGTATGA	AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.608A>T	2.37:g.96646519T>A	ENSP00000403302:p.His203Leu		Somatic	157	0	0		WXS	Illumina HiSeq	Phase_I	160	0.04	6	.	0		0	C9JZ08|Q15694|Q53S06|Q658V2	Missense_Mutation	SNP	ENST00000456556.1	37		.	.	.	.	.	.	.	.	.	.	t	0.018	-1.473154	0.01044	.	.	ENSG00000174501	ENST00000456556	T	0.60920	0.15	0.845	0.845	0.18950	.	0.746432	0.10173	N	0.706819	T	0.18257	0.0438	N	0.00771	-1.2	0.20489	N	0.999892	.	.	.	.	.	.	T	0.27938	-1.0059	8	0.02654	T	1	.	2.9617	0.05895	0.6006:0.0:0.0:0.3994	.	.	.	.	L	203	ENSP00000403302:H203L	ENSP00000403302:H203L	H	-	2	0	AC073995.2	96010246	0.995000	0.38212	0.906000	0.35671	0.376000	0.30014	0.366000	0.20365	-0.138000	0.11434	-1.957000	0.00481	CAT			0.313	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000338799.2		NM_001010914	
PLEKHA3	65977	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	179355457	179355467	+	Frame_Shift_Del	DEL	AATGCAGCTGA	AATGCAGCTGA	-			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	AATGCAGCTGA	AATGCAGCTGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr2:179355457_179355467delAATGCAGCTGA	ENST00000234453.5	+	3	631_641	c.229_239delAATGCAGCTGA	c.(229-240)aatgcagctgaafs	p.NAAE77fs	PLEKHA3_ENST00000461474.1_3'UTR	NM_019091.3	NP_061964.3	Q9HB20	PKHA3_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3	77	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.					Golgi apparatus (GO:0005794)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.0266)|all cancers(119;0.0865)			GAAGGCAGTGAATGCAGCTGAAAGACAGAGG	0.412																																					p.76_80del													.	PLEKHA3	25		0			c.228_238del																																									SO:0001589	frameshift_variant	65977	exon3			GCAGTGAATGCAG	AF286162	CCDS33336.1	2q31.2	2013-01-10	2002-01-14		ENSG00000116095	ENSG00000116095		"""Pleckstrin homology (PH) domain containing"""	14338	protein-coding gene	gene with protein product	"""four-phosphate-adaptor protein 1"""	607774	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 3"""			11001876, 15107860	Standard	NM_019091		Approved	FAPP1	uc002umn.3	Q9HB20	OTTHUMG00000154446	ENST00000234453.5:c.229_239delAATGCAGCTGA	2.37:g.179355457_179355467delAATGCAGCTGA	ENSP00000234453:p.Asn77fs		Somatic	228	0	0		WXS	Illumina HiSeq	.	162	0.30	48	NM_019091	10	0.00	0	Q4ZG69|Q86TQ1|Q9NXT3	Frame_Shift_Del	DEL	ENST00000234453.5	37	CCDS33336.1																																																																																					0.412	PLEKHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000335241.2		NM_019091	
OBSL1	23363	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	220416900	220416900	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr2:220416900C>T	ENST00000404537.1	-	19	5403	c.5347G>A	c.(5347-5349)Gag>Aag	p.E1783K	OBSL1_ENST00000373876.1_Missense_Mutation_p.E1691K|OBSL1_ENST00000265318.4_3'UTR	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	1783					cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		CCGGCGTCCTCGGCGCGCAGC	0.662																																					p.E1783K													OBSL1_ENST00000404537,NS,carcinoma,0,1	OBSL1_ENST00000404537	0	1	0			c.G5347A												15.0	17.0	17.0					2																	220416900		1895	4095	5990	SO:0001583	missense	23363	exon19			CGTCCTCGGCGCG	BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.5347G>A	2.37:g.220416900C>T	ENSP00000385636:p.Glu1783Lys		Somatic	239	0	0		WXS	Illumina HiSeq	.	187	0.41	76	NM_015311	10	0.40	4	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Missense_Mutation	SNP	ENST00000404537.1	37	CCDS46520.1	.	.	.	.	.	.	.	.	.	.	C	15.98	2.992738	0.54041	.	.	ENSG00000124006	ENST00000404537;ENST00000373876	T;T	0.47528	0.84;0.84	4.76	4.76	0.60689	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.62307	0.2417	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.55970	-0.8056	9	0.17832	T	0.49	.	15.2908	0.73865	0.0:1.0:0.0:0.0	.	1783	O75147	OBSL1_HUMAN	K	1783;1691	ENSP00000385636:E1783K;ENSP00000362983:E1691K	ENSP00000362983:E1691K	E	-	1	0	OBSL1	220125144	1.000000	0.71417	0.932000	0.37286	0.407000	0.30961	6.393000	0.73217	2.456000	0.83038	0.655000	0.94253	GAG			0.662	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000322012.1			
MACROD2	140733	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	13982939	13982939	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr20:13982939T>G	ENST00000310348.4	+	2	52	c.52T>G	c.(52-54)Tta>Gta	p.L18V	MACROD2_ENST00000217246.4_Missense_Mutation_p.L18V			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2	18					brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				GCAAGAACGTTTATTGAAGAT	0.343																																					p.L18V													.	.			0			c.T52G												77.0	76.0	76.0					20																	13982939		2203	4300	6503	SO:0001583	missense	140733	exon2			GAACGTTTATTGA	BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.52T>G	20.37:g.13982939T>G	ENSP00000309809:p.Leu18Val		Somatic	72	0	0		WXS	Illumina HiSeq	.	76	0.20	15	NM_080676	1	0.00	0	A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	Missense_Mutation	SNP	ENST00000310348.4	37	CCDS13120.2	.	.	.	.	.	.	.	.	.	.	T	19.29	3.799298	0.70567	.	.	ENSG00000172264	ENST00000217246;ENST00000310348	T;T	0.42900	0.96;0.96	6.02	6.02	0.97574	.	0.000000	0.56097	D	0.000027	T	0.61476	0.2350	M	0.75777	2.31	0.80722	D	1	D;D	0.59357	0.985;0.957	D;D	0.68943	0.914;0.961	T	0.65825	-0.6074	10	0.87932	D	0	-5.0174	9.8057	0.40792	0.0:0.0765:0.0:0.9235	.	18;18	A1Z1Q3;A1Z1Q3-2	MACD2_HUMAN;.	V	18	ENSP00000217246:L18V;ENSP00000309809:L18V	ENSP00000217246:L18V	L	+	1	2	MACROD2	13930939	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.702000	0.47102	2.304000	0.77564	0.528000	0.53228	TTA			0.343	MACROD2-201	KNOWN	basic|CCDS	protein_coding	protein_coding				NM_080676	
LAMA5	3911	ucsc.edu;bcgsc.ca	37	20	60892038	60892038	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr20:60892038G>A	ENST00000252999.3	-	56	7619	c.7553C>T	c.(7552-7554)gCc>gTc	p.A2518V		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	2518	Domain II and I.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GGCCTCGATGGCCCTCTGGGT	0.687																																					p.A2518V													.	LAMA5	268		0			c.C7553T												59.0	53.0	55.0					20																	60892038		2185	4281	6466	SO:0001583	missense	3911	exon56			TCGATGGCCCTCT	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.7553C>T	20.37:g.60892038G>A	ENSP00000252999:p.Ala2518Val		Somatic	46	0	0		WXS	Illumina HiSeq		28	0.14	4	NM_005560	130	0.00	0	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	37	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	-	23.4	4.415352	0.83449	.	.	ENSG00000130702	ENST00000252999	T	0.28895	1.59	4.26	4.26	0.50523	.	0.000000	0.64402	U	0.000005	T	0.53932	0.1827	M	0.65498	2.005	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.59947	-0.7358	10	0.66056	D	0.02	.	16.3263	0.82983	0.0:0.0:1.0:0.0	.	2518	O15230	LAMA5_HUMAN	V	2518	ENSP00000252999:A2518V	ENSP00000252999:A2518V	A	-	2	0	LAMA5	60325433	1.000000	0.71417	0.998000	0.56505	0.397000	0.30659	8.230000	0.89793	1.929000	0.55896	0.282000	0.19409	GCC			0.687	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080014.2		NM_005560	
ZNF512B	57473	mdanderson.org	37	20	62594010	62594010	+	Missense_Mutation	SNP	G	G	A	rs528739637		TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr20:62594010G>A	ENST00000450537.1	-	13	2153	c.2093C>T	c.(2092-2094)gCg>gTg	p.A698V	ZNF512B_ENST00000217130.3_Missense_Mutation_p.A698V|ZNF512B_ENST00000369888.1_Missense_Mutation_p.A698V			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	698					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					CTCGTCCTCCGCTATCTCCTG	0.706																																					p.A698V													.	.			0			c.C2093T												16.0	15.0	15.0					20																	62594010		2184	4282	6466	SO:0001583	missense	57473	exon13			TCCTCCGCTATCT	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.2093C>T	20.37:g.62594010G>A	ENSP00000393795:p.Ala698Val		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_020713	49	0.00	0	Q08AK9|Q9ULM4	Missense_Mutation	SNP	ENST00000450537.1	37	CCDS13548.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.199980	0.79015	.	.	ENSG00000196700	ENST00000369888;ENST00000450537;ENST00000217130	T;T;T	0.32753	1.44;1.44;1.44	5.22	4.25	0.50352	.	0.000000	0.85682	D	0.000000	T	0.32526	0.0832	L	0.52126	1.63	0.53005	D	0.999962	P	0.50369	0.934	B	0.42555	0.391	T	0.23762	-1.0179	10	0.87932	D	0	-13.4545	15.6776	0.77341	0.0:0.1375:0.8625:0.0	.	698	Q96KM6	Z512B_HUMAN	V	698	ENSP00000358904:A698V;ENSP00000393795:A698V;ENSP00000217130:A698V	ENSP00000217130:A698V	A	-	2	0	ZNF512B	62064454	1.000000	0.71417	0.478000	0.27316	0.579000	0.36224	7.535000	0.82014	1.156000	0.42514	0.563000	0.77884	GCG			0.706	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080246.1		NM_020713	
BAGE2	85319	broad.mit.edu	37	21	11058603	11058603	+	RNA	DEL	G	G	-	rs201542455|rs57429001		TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr21:11058603delG	ENST00000470054.1	-	0	324							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AAAACCTAAAGATTTTTTTTT	0.269																																					.													.	.			0			.																																											85319	.			CCTAAAGATTTTT	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11058603delG			Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	12	0.42	5	.	0		0	A8K925|Q08ER0	RNA	DEL	ENST00000470054.1	37																																																																																						0.269	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000157417.3		NM_182482	
AC008132.13	0	broad.mit.edu	37	22	18842615	18842615	+	Intron	DEL	T	T	-			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr22:18842615delT	ENST00000412938.1	+	4	2208																											TGGTTATTTATTTTAGAGATG	0.562																																					.													.	.			0			.																																									SO:0001627	intron_variant	0	.			TATTTATTTTAGA																												ENST00000412938.1:c.2209-688T>-	22.37:g.18842615delT			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	DEL	ENST00000412938.1	37																																																																																						0.562	AC008132.13-002	KNOWN	basic	processed_transcript	protein_coding		OTTHUMT00000471615.1			
SMPD4P1	645280	broad.mit.edu	37	22	20976583	20976584	+	RNA	INS	-	-	A			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr22:20976583_20976584insA	ENST00000443839.1	-	0	1539									sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3) pseudogene 1																		agactttgcctaaaaaaaaaaa	0.52																																					.													.	.			0			.																																											0	.			TTTGCCTAAAAAA			22q11.21	2011-03-22			ENSG00000223553	ENSG00000223553			39673	pseudogene	pseudogene							Standard	NG_028286		Approved				OTTHUMG00000030245		22.37:g.20976594_20976594dupA			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	7	0.57	4	.	0		0		RNA	INS	ENST00000443839.1	37																																																																																						0.520	SMPD4P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000319965.1			
VPREB3	29802	mdanderson.org	37	22	24095309	24095309	+	Silent	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr22:24095309G>T	ENST00000248948.3	-	2	230	c.126C>A	c.(124-126)ctC>ctA	p.L42L	VPREB3_ENST00000398465.3_Silent_p.L26L|ZNF70_ENST00000341976.3_5'Flank	NM_013378.2	NP_037510.1	Q9UKI3	VPRE3_HUMAN	pre-B lymphocyte 3	42	Ig-like.					endoplasmic reticulum (GO:0005783)				large_intestine(1)|lung(1)|skin(1)	3		Medulloblastoma(6;7.87e-06)|all_neural(6;0.00334)				GCTGGGGGCTGAGCGTGCAGG	0.622																																					p.L42L													.	.			0			c.C126A												80.0	61.0	67.0					22																	24095309		2203	4300	6503	SO:0001819	synonymous_variant	29802	exon2			GGGGCTGAGCGTG		CCDS13813.1	22q11.23	2013-01-11	2008-09-12		ENSG00000128218	ENSG00000128218		"""Immunoglobulin superfamily / V-set domain containing"""	12710	protein-coding gene	gene with protein product		605017				10702669, 14670953	Standard	NM_013378		Approved	8HS20	uc002zxt.3	Q9UKI3	OTTHUMG00000150738	ENST00000248948.3:c.126C>A	22.37:g.24095309G>T			Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_013378	1	0.00	0	B2R587	Silent	SNP	ENST00000248948.3	37	CCDS13813.1																																																																																					0.622	VPREB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319879.2		NM_013378	
SLC5A4	6527	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	32628901	32628901	+	Missense_Mutation	SNP	G	G	A	rs555124904	byFrequency	TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr22:32628901G>A	ENST00000266086.4	-	9	1017	c.1006C>T	c.(1006-1008)Cgc>Tgc	p.R336C	RP1-90G24.10_ENST00000434942.1_RNA	NM_014227.2	NP_055042.1	Q9NY91	SC5A4_HUMAN	solute carrier family 5 (glucose activated ion channel), member 4	336					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(15)|pancreas(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						TACAGGATGCGGCTGATCATC	0.448													G|||	2	0.000399361	0.0	0.0014	5008	,	,		22644	0.001		0.0	False		,,,				2504	0.0				p.R336C													.	.			0			c.C1006T												112.0	91.0	98.0					22																	32628901		2203	4300	6503	SO:0001583	missense	6527	exon9			GGATGCGGCTGAT	U41897	CCDS13903.1	22q12.3	2013-07-19	2013-07-19		ENSG00000100191	ENSG00000100191		"""Solute carriers"""	11039	protein-coding gene	gene with protein product			"""solute carrier family 5 (low affinity glucose cotransporter), member 4"""			9501190, 12354616	Standard	NM_014227		Approved	SAAT1, SGLT3, DJ90G24.4	uc003ami.3	Q9NY91	OTTHUMG00000150007	ENST00000266086.4:c.1006C>T	22.37:g.32628901G>A	ENSP00000266086:p.Arg336Cys		Somatic	159	0	0		WXS	Illumina HiSeq	.	144	0.35	51	NM_014227	0		0	O15279	Missense_Mutation	SNP	ENST00000266086.4	37	CCDS13903.1	.	.	.	.	.	.	.	.	.	.	.	16.54	3.151371	0.57151	.	.	ENSG00000100191	ENST00000266086	D	0.89196	-2.48	4.74	3.7	0.42460	.	0.000000	0.85682	D	0.000000	D	0.95705	0.8603	H	0.95402	3.665	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96309	0.9227	10	0.87932	D	0	.	12.2746	0.54728	0.0:0.0:0.8287:0.1712	.	336	Q9NY91	SC5A4_HUMAN	C	336	ENSP00000266086:R336C	ENSP00000266086:R336C	R	-	1	0	SLC5A4	30958901	1.000000	0.71417	0.998000	0.56505	0.803000	0.45373	3.973000	0.56845	1.343000	0.45638	-0.311000	0.09066	CGC			0.448	SLC5A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000315724.1		NM_014227	
ADSL	158	mdanderson.org	37	22	40759064	40759064	+	Missense_Mutation	SNP	G	G	A	rs370851726		TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr22:40759064G>A	ENST00000216194.7	+	10	1146	c.1090G>A	c.(1090-1092)Gtg>Atg	p.V364M	ADSL_ENST00000454266.2_Missense_Mutation_p.V378M|ADSL_ENST00000342312.6_Missense_Mutation_p.V364M	NM_000026.2	NP_000017.1	P30566	PUR8_HUMAN	adenylosuccinate lyase	364			V -> M (in ADSL deficiency; severe). {ECO:0000269|PubMed:12368987}.		'de novo' AMP biosynthetic process (GO:0044208)|'de novo' IMP biosynthetic process (GO:0006189)|aerobic respiration (GO:0009060)|AMP biosynthetic process (GO:0006167)|metabolic process (GO:0008152)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	(S)-2-(5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxamido)succinate AMP-lyase (fumarate-forming) activity (GO:0070626)|N6-(1,2-dicarboxyethyl)AMP AMP-lyase (fumarate-forming) activity (GO:0004018)	p.V364M(2)		breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(2)|ovary(1)|prostate(1)	19						AGGATTGGTCGTGTACCCCAA	0.458																																					p.V364M	Colon(4;65 130 1097 1516)												ADSL_ENST00000216194,NS,carcinoma,0,2	ADSL_ENST00000216194	0	2	2	Substitution - Missense(2)	endometrium(2)	c.G1090A							G	MET/VAL,MET/VAL	0,4406		0,0,2203	131.0	128.0	129.0		1090,1090	3.5	1.0	22		129	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ADSL	NM_000026.2,NM_001123378.1	21,21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	364/485,364/426	40759064	1,13005	2203	4300	6503	SO:0001583	missense	158	exon10			TTGGTCGTGTACC	X65867	CCDS14001.1, CCDS46714.1	22q13.1	2011-02-17			ENSG00000239900	ENSG00000239900	4.3.2.2		291	protein-coding gene	gene with protein product		608222				8404037	Standard	NM_000026		Approved		uc003ayp.4	P30566	OTTHUMG00000166425	ENST00000216194.7:c.1090G>A	22.37:g.40759064G>A	ENSP00000216194:p.Val364Met		Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_001123378	493	0.00	0	B0QY76|O75495|Q5TI34	Missense_Mutation	SNP	ENST00000216194.7	37	CCDS14001.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.053129	0.75960	0.0	1.16E-4	ENSG00000239900	ENST00000216194;ENST00000454266;ENST00000537028;ENST00000342312	D;D;D	0.96427	-3.98;-3.98;-4.01	5.56	3.45	0.39498	L-Aspartase-like (1);	0.112130	0.64402	D	0.000011	D	0.98385	0.9463	H	0.97516	4.02	0.80722	D	1	D;P;D;D	0.67145	0.996;0.949;0.986;0.986	P;P;P;P	0.59221	0.772;0.854;0.804;0.804	D	0.98304	1.0520	10	0.87932	D	0	-8.1846	11.6583	0.51330	0.0677:0.124:0.8083:0.0	.	378;364;364;364	E7ERF4;P30566-2;Q71UA4;P30566	.;.;.;PUR8_HUMAN	M	364;378;184;364	ENSP00000216194:V364M;ENSP00000390107:V378M;ENSP00000341429:V364M	ENSP00000216194:V364M	V	+	1	0	ADSL	39089010	1.000000	0.71417	0.996000	0.52242	0.802000	0.45316	5.535000	0.67173	0.704000	0.31869	0.462000	0.41574	GTG			0.458	ADSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000321386.1		NM_000026	
DLEC1	9940	mdanderson.org	37	3	38103804	38103804	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr3:38103804G>A	ENST00000308059.6	+	4	839	c.818G>A	c.(817-819)aGc>aAc	p.S273N	DLEC1_ENST00000452631.2_Missense_Mutation_p.S273N|DLEC1_ENST00000346219.3_Missense_Mutation_p.S273N					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		ACTGTGGACAGCCTGACATGG	0.483																																					p.S273N													.	.			0			c.G818A												78.0	73.0	75.0					3																	38103804		1963	4166	6129	SO:0001583	missense	9940	exon4			TGGACAGCCTGAC	AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.818G>A	3.37:g.38103804G>A	ENSP00000308597:p.Ser273Asn		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_007335	4	0.00	0		Missense_Mutation	SNP	ENST00000308059.6	37	CCDS2672.2	.	.	.	.	.	.	.	.	.	.	G	12.93	2.084069	0.36758	.	.	ENSG00000008226	ENST00000308059;ENST00000346219;ENST00000452631	T;T;T	0.05855	3.4;3.38;3.62	3.92	2.08	0.27032	.	0.774957	0.12719	N	0.444893	T	0.11024	0.0269	M	0.71581	2.175	0.25238	N	0.989771	P;P;P	0.41848	0.646;0.763;0.646	B;P;B	0.44990	0.152;0.466;0.152	T	0.14671	-1.0464	10	0.66056	D	0.02	-24.4311	5.3979	0.16278	0.1129:0.2064:0.6807:0.0	.	273;273;273	F8W6T4;Q9Y238-3;Q9Y238	.;.;DLEC1_HUMAN	N	273	ENSP00000308597:S273N;ENSP00000315914:S273N;ENSP00000410427:S273N	ENSP00000308597:S273N	S	+	2	0	DLEC1	38078808	0.821000	0.29204	0.504000	0.27639	0.065000	0.16274	0.705000	0.25675	0.596000	0.29794	0.655000	0.94253	AGC			0.483	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000253745.3		NM_007337	
GMPPB	29925	mdanderson.org	37	3	49759234	49759234	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr3:49759234G>T	ENST00000480687.1	-	10	1150	c.1034C>A	c.(1033-1035)cCc>cAc	p.P345H	GMPPB_ENST00000308388.6_Missense_Mutation_p.P345H|GMPPB_ENST00000308375.6_Missense_Mutation_p.P372H|AMIGO3_ENST00000535833.1_5'UTR|AMIGO3_ENST00000320431.7_5'Flank			Q9Y5P6	GMPPB_HUMAN	GDP-mannose pyrophosphorylase B	345					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|mannose-1-phosphate guanylyltransferase activity (GO:0004475)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		AGACTTGTGGGGCAGCACGCT	0.582																																					p.P372H													.	.			0			c.C1115A												55.0	52.0	53.0					3																	49759234		2203	4300	6503	SO:0001583	missense	29925	exon8			TTGTGGGGCAGCA	AF135421	CCDS2802.1, CCDS2803.1	3p21.31	2008-02-05			ENSG00000173540	ENSG00000173540	2.7.7.22		22932	protein-coding gene	gene with protein product		615320					Standard	NM_013334		Approved	KIAA1851	uc003cxl.1	Q9Y5P6	OTTHUMG00000158151	ENST00000480687.1:c.1034C>A	3.37:g.49759234G>T	ENSP00000418565:p.Pro345His		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_013334	208	0.00	0	A8K6N5|Q9H7U3	Missense_Mutation	SNP	ENST00000480687.1	37	CCDS2803.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.240051	0.79912	.	.	ENSG00000173540	ENST00000480687;ENST00000308375;ENST00000308388	T;D;T	0.82344	-1.0;-1.6;-1.0	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	D	0.93700	0.7987	H	0.94542	3.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95421	0.8507	10	0.87932	D	0	-21.4066	17.5082	0.87753	0.0:0.0:1.0:0.0	.	372;345	Q9Y5P6-2;Q9Y5P6	.;GMPPB_HUMAN	H	345;372;345	ENSP00000418565:P345H;ENSP00000309092:P372H;ENSP00000311130:P345H	ENSP00000309092:P372H	P	-	2	0	GMPPB	49734238	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.815000	0.99349	2.359000	0.80004	0.655000	0.94253	CCC			0.582	GMPPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350291.1		NM_013334	
GPR78	27201	mdanderson.org	37	4	8582800	8582800	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr4:8582800G>T	ENST00000382487.4	+	1	508	c.91G>T	c.(91-93)Gcc>Tcc	p.A31S	GPR78_ENST00000509216.1_Intron	NM_080819.4	NP_543009.2	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	31					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(4)|kidney(4)|large_intestine(1)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	26						GCTTTGTTGCGCCTACAGCGC	0.672																																					p.A31S													.	.			0			c.G91T												35.0	38.0	37.0					4																	8582800		2202	4300	6502	SO:0001583	missense	27201	exon1			TGTTGCGCCTACA	AF411107	CCDS3403.1	4p16.1	2012-08-21			ENSG00000155269	ENSG00000155269		"""GPCR / Class A : Orphans"""	4528	protein-coding gene	gene with protein product		606921				11574155	Standard	NM_080819		Approved		uc003glk.4	Q96P69	OTTHUMG00000128483	ENST00000382487.4:c.91G>T	4.37:g.8582800G>T	ENSP00000371927:p.Ala31Ser		Somatic	27	0.037037037	1		WXS	Illumina HiSeq	Phase_I	26	0.12	3	NM_080819	19	0.00	0	Q8NGV3	Missense_Mutation	SNP	ENST00000382487.4	37	CCDS3403.1	.	.	.	.	.	.	.	.	.	.	G	14.01	2.408100	0.42715	.	.	ENSG00000155269	ENST00000382487	T	0.36878	1.23	2.55	1.54	0.23209	GPCR, rhodopsin-like superfamily (1);	0.736194	0.10829	U	0.629505	T	0.34716	0.0907	L	0.29908	0.895	0.22511	N	0.999038	D	0.55800	0.973	P	0.55303	0.773	T	0.17531	-1.0366	10	0.23302	T	0.38	.	7.1686	0.25706	0.0:0.196:0.6358:0.1682	.	31	Q96P69	GPR78_HUMAN	S	31	ENSP00000371927:A31S	ENSP00000371927:A31S	A	+	1	0	GPR78	8633700	0.494000	0.26043	0.819000	0.32651	0.200000	0.23975	0.202000	0.17295	0.938000	0.37419	0.313000	0.20887	GCC			0.672	GPR78-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000359201.1			
BOD1L1	259282	mdanderson.org	37	4	13629060	13629060	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr4:13629060G>T	ENST00000040738.5	-	1	287	c.152C>A	c.(151-153)cCg>cAg	p.P51Q	MIR5091_ENST00000578707.1_RNA	NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	51						nucleus (GO:0005634)	DNA binding (GO:0003677)										CACGAGCTGCGGGTccccggc	0.776																																					p.P51Q													.	.			0			c.C152A												9.0	9.0	9.0					4																	13629060		2190	4284	6474	SO:0001583	missense	259282	exon1			AGCTGCGGGTCCC	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.152C>A	4.37:g.13629060G>T	ENSP00000040738:p.Pro51Gln		Somatic	19	0	0		WXS	Illumina HiSeq	Phase_I	19	0.16	3	NM_148894	0		0	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	37	CCDS3411.2	.	.	.	.	.	.	.	.	.	.	g	19.61	3.859444	0.71834	.	.	ENSG00000038219	ENST00000040738	T	0.10477	2.87	3.29	3.29	0.37713	.	0.259962	0.20409	U	0.092897	T	0.26484	0.0647	L	0.53561	1.675	0.41178	D	0.986216	D	0.76494	0.999	D	0.68943	0.961	T	0.04053	-1.0981	10	0.54805	T	0.06	-2.1695	14.6762	0.68981	0.0:0.0:1.0:0.0	.	51	Q8NFC6	BOD1L_HUMAN	Q	51	ENSP00000040738:P51Q	ENSP00000040738:P51Q	P	-	2	0	BOD1L	13238158	1.000000	0.71417	0.998000	0.56505	0.954000	0.61252	7.532000	0.81985	1.824000	0.53156	0.298000	0.19748	CCG			0.776	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207321.1		NM_148894	
Unknown	0	bcgsc.ca	37	4	49553004	49553004	+	IGR	SNP	T	T	C			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr4:49553004T>C								AC118282.4 (341539 upstream) : AC119751.5 (32037 downstream)																							TTAGAGCAGTTAAACAAGGAT	0.269																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			AGCAGTTAAACAA																													4.37:g.49553004T>C			Somatic	86	0.023255814	2		WXS	Illumina HiSeq	Phase_1	72	0.14	10	.	0		0		RNA	SNP		37																																																																																					0	0.269										
ICE1	23379	mdanderson.org	37	5	5464309	5464309	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr5:5464309T>C	ENST00000296564.7	+	13	5084	c.4862T>C	c.(4861-4863)cTg>cCg	p.L1621P		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1621					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						CCTGACACACTGAGTAAAATA	0.468																																					p.L1621P													.	.			0			c.T4862C												76.0	80.0	79.0					5																	5464309		1954	4158	6112	SO:0001583	missense	23379	exon13			ACACACTGAGTAA																												ENST00000296564.7:c.4862T>C	5.37:g.5464309T>C	ENSP00000296564:p.Leu1621Pro		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_015325	27	0.00	0	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	ENST00000296564.7	37	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	T	19.02	3.746893	0.69418	.	.	ENSG00000164151	ENST00000296564	T	0.20200	2.09	5.27	5.27	0.74061	.	.	.	.	.	T	0.42017	0.1184	L	0.56769	1.78	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.30880	-0.9963	9	0.72032	D	0.01	-6.9369	13.135	0.59403	0.0:0.0:0.0:1.0	.	1621	Q9Y2F5	K0947_HUMAN	P	1621	ENSP00000296564:L1621P	ENSP00000296564:L1621P	L	+	2	0	KIAA0947	5517309	1.000000	0.71417	0.825000	0.32803	0.908000	0.53690	6.825000	0.75293	1.984000	0.57885	0.377000	0.23210	CTG			0.468	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000365575.1			
AMACR	23600	broad.mit.edu	37	5	34004802	34004802	+	Silent	SNP	C	C	A	rs368427062		TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr5:34004802C>A	ENST00000335606.6	-	3	517	c.429G>T	c.(427-429)ccG>ccT	p.P143P	AMACR_ENST00000502637.1_Silent_p.P143P|RP11-1084J3.4_ENST00000382079.3_Intron|AMACR_ENST00000512079.1_Silent_p.P143P|AMACR_ENST00000382072.2_Intron|AMACR_ENST00000426255.2_Silent_p.P143P|AMACR_ENST00000382068.3_Intron|AMACR_ENST00000441713.2_Intron|AMACR_ENST00000382085.3_Silent_p.P143P|AMACR_ENST00000514195.1_Intron	NM_001167595.1|NM_014324.5	NP_001161067.1|NP_055139.4	Q9UHK6	AMACR_HUMAN	alpha-methylacyl-CoA racemase	143					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	alpha-methylacyl-CoA racemase activity (GO:0008111)|receptor binding (GO:0005102)			endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|stomach(1)|urinary_tract(1)	19						GCGGGGCATACGGATTCTCAC	0.408																																					p.P143P													.	AMACR	38		0			c.G429T												97.0	89.0	92.0					5																	34004802		2203	4300	6503	SO:0001819	synonymous_variant	23600	exon3			GGCATACGGATTC	AF047020	CCDS3902.1, CCDS3903.1, CCDS54836.1	5p13.2	2012-05-16			ENSG00000242110	ENSG00000242110	5.1.99.4		451	protein-coding gene	gene with protein product		604489				9307041	Standard	NM_014324		Approved	RACE	uc003jij.3	Q9UHK6	OTTHUMG00000090734	ENST00000335606.6:c.429G>T	5.37:g.34004802C>A			Somatic	483	0	0		WXS	Illumina HiSeq	Phase_I	376	0.01	5	NM_014324	33	0.00	0	A5YM47|B8Y916|B8Y918|F8W9N1|O43673|Q3KT79|Q96GH1|Q9Y3Q1	Silent	SNP	ENST00000335606.6	37	CCDS3902.1																																																																																					0.408	AMACR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207467.1		NM_014324	
FEM1C	56929	mdanderson.org	37	5	114860256	114860256	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr5:114860256C>T	ENST00000274457.3	-	3	2164	c.1603G>A	c.(1603-1605)Gct>Act	p.A535T		NM_020177.2	NP_064562.1	Q96JP0	FEM1C_HUMAN	fem-1 homolog c (C. elegans)	535					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				breast(5)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|liver(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	18		all_cancers(142;0.000575)|all_epithelial(76;9.98e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;2.5e-07)|Epithelial(69;2.66e-07)|all cancers(49;1.39e-05)		TTAAGAGCAGCGATATGCAGG	0.413																																					p.A535T													.	.			0			c.G1603A												205.0	190.0	195.0					5																	114860256		2202	4300	6502	SO:0001583	missense	56929	exon3			GAGCAGCGATATG		CCDS4118.1	5q22	2013-01-10	2006-11-08		ENSG00000145780	ENSG00000145780		"""Ankyrin repeat domain containing"""	16933	protein-coding gene	gene with protein product		608767				14527725, 11733146	Standard	NM_020177		Approved	KIAA1785, EUROIMAGE686608, EUROIMAGE783647, FEM1A	uc003krb.1	Q96JP0	OTTHUMG00000128895	ENST00000274457.3:c.1603G>A	5.37:g.114860256C>T	ENSP00000274457:p.Ala535Thr		Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	68	0.06	4	NM_020177	21	0.00	0	B2RE47|Q8N3V8|Q9H704|Q9NPL6|Q9NPL9	Missense_Mutation	SNP	ENST00000274457.3	37	CCDS4118.1	.	.	.	.	.	.	.	.	.	.	C	17.93	3.509137	0.64410	.	.	ENSG00000145780	ENST00000274457	T	0.80909	-1.43	5.22	5.22	0.72569	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	D	0.84759	0.5543	M	0.72118	2.19	0.58432	D	0.999996	P	0.45531	0.86	P	0.50590	0.645	D	0.86194	0.1614	10	0.59425	D	0.04	-16.7352	14.5028	0.67734	0.1474:0.8526:0.0:0.0	.	535	Q96JP0	FEM1C_HUMAN	T	535	ENSP00000274457:A535T	ENSP00000274457:A535T	A	-	1	0	FEM1C	114888155	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.938000	0.70170	2.415000	0.81967	0.563000	0.77884	GCT			0.413	FEM1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250857.3		NM_020177	
PCDHGA12	26025	mdanderson.org	37	5	140812465	140812465	+	Silent	SNP	G	G	A			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr5:140812465G>A	ENST00000252085.3	+	1	2281	c.2139G>A	c.(2137-2139)gcG>gcA	p.A713A	PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12	713					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCTGCTGGCGCTCAGGCTGC	0.652																																					p.A713A													.	.			0			c.G2139A												73.0	83.0	79.0					5																	140812465		2203	4300	6503	SO:0001819	synonymous_variant	26025	exon1			GCTGGCGCTCAGG	AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.2139G>A	5.37:g.140812465G>A			Somatic	103	0	0		WXS	Illumina HiSeq	Phase_I	71	0.06	4	NM_003735	1	0.00	0	O15100|Q6UW70|Q9Y5D7	Silent	SNP	ENST00000252085.3	37	CCDS4260.1																																																																																					0.652	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251806.2		NM_003735	
DPCR1	135656	mdanderson.org	37	6	30919170	30919170	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr6:30919170T>C	ENST00000462446.1	+	2	2957	c.2929T>C	c.(2929-2931)Tca>Cca	p.S977P	DPCR1_ENST00000304311.2_5'UTR|HCG21_ENST00000419481.1_RNA			Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	329						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)	10						CACACCATCCTCAGCAGAGCC	0.498																																					p.S977P													.	.			0			c.T2929C												275.0	256.0	262.0					6																	30919170		692	1591	2283	SO:0001583	missense	135656	exon2			CCATCCTCAGCAG	AB064272	CCDS4692.1, CCDS4692.2	6p21.32	2008-02-05			ENSG00000168631	ENSG00000168631			21666	protein-coding gene	gene with protein product		613928				12185533, 10677310	Standard	NM_080870		Approved	PBLT, bCX105N19.6	uc003nsg.2	Q3MIW9	OTTHUMG00000031104	ENST00000462446.1:c.2929T>C	6.37:g.30919170T>C	ENSP00000417182:p.Ser977Pro		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_080870	2	0.00	0	C9IZC0|Q658M7|Q8WYN2	Missense_Mutation	SNP	ENST00000462446.1	37	CCDS4692.2	.	.	.	.	.	.	.	.	.	.	t	2.697	-0.271835	0.05716	.	.	ENSG00000168631	ENST00000462446	T	0.29397	1.57	2.5	-1.15	0.09709	.	.	.	.	.	T	0.00906	0.0030	N	0.00074	-2.255	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.40887	-0.9539	9	0.02654	T	1	.	2.5079	0.04649	0.4016:0.3358:0.0:0.2626	.	977	E9PEI6	.	P	977	ENSP00000417182:S977P	ENSP00000417182:S977P	S	+	1	0	DPCR1	31027149	0.000000	0.05858	0.000000	0.03702	0.062000	0.15995	-2.761000	0.00786	-0.418000	0.07450	-0.854000	0.03029	TCA			0.498	DPCR1-001	NOVEL	not_organism_supported|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000076173.3		NM_080870	
HSP90AB1	3326	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	44218796	44218798	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	AGA	AGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr6:44218796_44218798delAGA	ENST00000371554.1	+	7	1183_1185	c.969_971delAGA	c.(967-972)gtagaa>gta	p.E324del	HSP90AB1_ENST00000353801.3_In_Frame_Del_p.E324del|HSP90AB1_ENST00000371646.5_In_Frame_Del_p.E324del			P08238	HS90B_HUMAN	heat shock protein 90kDa alpha (cytosolic), class B member 1	324					axon guidance (GO:0007411)|cellular response to interleukin-4 (GO:0071353)|cellular response to organic cyclic compound (GO:0071407)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|placenta development (GO:0001890)|positive regulation of cell size (GO:0045793)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein folding (GO:0006457)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to salt stress (GO:0009651)|response to unfolded protein (GO:0006986)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP binding (GO:0002135)|dATP binding (GO:0032564)|double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|poly(A) RNA binding (GO:0044822)|TPR domain binding (GO:0030911)|UTP binding (GO:0002134)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(12)|prostate(2)|skin(2)|urinary_tract(2)	33	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			ACTTTTCTGTAGAAGGTCAGTTG	0.384																																					p.323_324del													.	HSP90AB1	83		0			c.968_970del																																									SO:0001651	inframe_deletion	3326	exon7			TTCTGTAGAAGGT	AF275719	CCDS4909.1	6p12	2011-09-02	2006-02-24	2006-02-24	ENSG00000096384	ENSG00000096384		"""Heat shock proteins / HSPC"""	5258	protein-coding gene	gene with protein product		140572	"""heat shock 90kD protein 1, beta"", ""heat shock 90kDa protein 1, beta"""	HSPC2, HSPCB		2768249, 16269234	Standard	NM_001271969		Approved		uc031sor.1	P08238	OTTHUMG00000014761	ENST00000371554.1:c.969_971delAGA	6.37:g.44218796_44218798delAGA	ENSP00000360609:p.Glu324del		Somatic	94	0	0		WXS	Illumina HiSeq	.	109	0.41	45	NM_001271969	3495	0.00	0	B2R5P0|Q5T9W7|Q9NQW0|Q9NTK6	In_Frame_Del	DEL	ENST00000371554.1	37	CCDS4909.1																																																																																					0.384	HSP90AB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040730.1		NM_007355	
TMEM184A	202915	mdanderson.org	37	7	1586698	1586698	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr7:1586698C>T	ENST00000297477.5	-	9	1448	c.1132G>A	c.(1132-1134)Gcc>Acc	p.A378T	TMEM184A_ENST00000449955.1_5'Flank	NM_001097620.1	NP_001091089.1	Q6ZMB5	T184A_HUMAN	transmembrane protein 184A	378					germ-line sex determination (GO:0018992)|regulation of protein localization (GO:0032880)|regulation of secretion (GO:0051046)	early endosome membrane (GO:0031901)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	12		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;5.88e-15)		TCGTGCGTGGCCTGCTGCGTG	0.692																																					p.A378T													.	.			0			c.G1132A												34.0	38.0	37.0					7																	1586698		2201	4300	6501	SO:0001583	missense	202915	exon9			GCGTGGCCTGCTG		CCDS43537.1	7p22.3	2008-05-02			ENSG00000164855	ENSG00000164855			28797	protein-coding gene	gene with protein product						12477932	Standard	NM_001097620		Approved	MGC9712	uc003skv.4	Q6ZMB5	OTTHUMG00000119025	ENST00000297477.5:c.1132G>A	7.37:g.1586698C>T	ENSP00000297477:p.Ala378Thr		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_001097620	23	0.00	0	Q8TBQ6	Missense_Mutation	SNP	ENST00000297477.5	37	CCDS43537.1	.	.	.	.	.	.	.	.	.	.	C	15.58	2.874391	0.51695	.	.	ENSG00000164855	ENST00000297477	T	0.32023	1.47	5.47	2.22	0.28083	.	0.196398	0.44902	U	0.000405	T	0.33089	0.0851	L	0.60455	1.87	0.33700	D	0.614452	B	0.31174	0.311	B	0.35813	0.211	T	0.49624	-0.8920	10	0.42905	T	0.14	-26.2822	14.2955	0.66311	0.5811:0.4189:0.0:0.0	.	378	Q6ZMB5	T184A_HUMAN	T	378	ENSP00000297477:A378T	ENSP00000297477:A378T	A	-	1	0	TMEM184A	1553224	1.000000	0.71417	1.000000	0.80357	0.508000	0.34012	3.041000	0.49807	0.611000	0.30052	0.549000	0.68633	GCC			0.692	TMEM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000239229.4		NM_152689	
LRCH4	4034	mdanderson.org	37	7	100174944	100174944	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr7:100174944C>T	ENST00000310300.6	-	11	1299	c.1247G>A	c.(1246-1248)cGg>cAg	p.R416Q	LRCH4_ENST00000497245.1_5'UTR	NM_002319.3	NP_002310.2	O75427	LRCH4_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 4	416					nervous system development (GO:0007399)	PML body (GO:0016605)				NS(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	23	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CTGCTGCCGCCGTTCCCGCTC	0.721																																					p.R416Q													.	.			0			c.G1247A												6.0	9.0	8.0					7																	100174944		2021	4015	6036	SO:0001583	missense	4034	exon11			TGCCGCCGTTCCC	AF053356	CCDS34706.1	7q22	2008-05-20	2004-05-27	2004-05-28	ENSG00000077454	ENSG00000077454			6691	protein-coding gene	gene with protein product				LRN, LRRN1		9799793	Standard	XM_005250346		Approved		uc003uvj.3	O75427	OTTHUMG00000159544	ENST00000310300.6:c.1247G>A	7.37:g.100174944C>T	ENSP00000309689:p.Arg416Gln		Somatic	14	0.0714285714	1		WXS	Illumina HiSeq	Phase_I	11	0.18	2	NM_002319	101	0.00	0	A4D2D5|Q8WV85|Q96ID0	Missense_Mutation	SNP	ENST00000310300.6	37	CCDS34706.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.262248	0.80358	.	.	ENSG00000077454	ENST00000310300	T	0.35973	1.28	5.23	3.29	0.37713	.	0.137566	0.48767	D	0.000178	T	0.51041	0.1651	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.50634	-0.8805	10	0.19590	T	0.45	-21.9972	6.1766	0.20447	0.1821:0.7226:0.0:0.0954	.	416	O75427	LRCH4_HUMAN	Q	416	ENSP00000309689:R416Q	ENSP00000309689:R416Q	R	-	2	0	LRCH4	100012880	1.000000	0.71417	0.997000	0.53966	0.955000	0.61496	3.299000	0.51826	1.210000	0.43336	0.549000	0.68633	CGG			0.721	LRCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356110.1		NM_002319	
ING3	54556	broad.mit.edu;mdanderson.org	37	7	120609078	120609078	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr7:120609078G>T	ENST00000315870.5	+	9	876	c.728G>T	c.(727-729)cGa>cTa	p.R243L	ING3_ENST00000431467.1_Missense_Mutation_p.R228L	NM_019071.2	NP_061944.2	Q9NXR8	ING3_HUMAN	inhibitor of growth family, member 3	243					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|positive regulation of apoptotic process (GO:0043065)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)|Swr1 complex (GO:0000812)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	12	all_neural(327;0.117)					AAGGAGGGACGAAGAACATCA	0.299																																					p.R243L													ING3,NS,carcinoma,0,1	ING3	36	1	0			c.G728T												94.0	91.0	92.0					7																	120609078		2203	4300	6503	SO:0001583	missense	54556	exon9			AGGGACGAAGAAC	AF074968	CCDS5778.1, CCDS35497.1	7q31	2013-01-28			ENSG00000071243	ENSG00000071243		"""Zinc fingers, PHD-type"""	14587	protein-coding gene	gene with protein product		607493				12080476	Standard	NM_019071		Approved	p47ING3, FLJ20089, Eaf4, MEAF4	uc003vjn.3	Q9NXR8	OTTHUMG00000141270	ENST00000315870.5:c.728G>T	7.37:g.120609078G>T	ENSP00000320566:p.Arg243Leu		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	81	0.05	4	NM_019071	35	0.00	0	A8K790|O60394|Q567P3|Q6GMT3|Q7Z762|Q969G0|Q96DT4|Q9HC99|Q9P081	Missense_Mutation	SNP	ENST00000315870.5	37	CCDS5778.1	.	.	.	.	.	.	.	.	.	.	g	25.7	4.669872	0.88348	.	.	ENSG00000071243	ENST00000315870;ENST00000431467	T;T	0.39056	1.1;1.1	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.65719	0.2718	M	0.79475	2.455	0.80722	D	1	D;D	0.63880	0.993;0.987	D;D	0.74023	0.982;0.931	T	0.59847	-0.7377	10	0.20519	T	0.43	-10.8003	19.6916	0.96005	0.0:0.0:1.0:0.0	.	243;243	Q5GRH6;Q9NXR8	.;ING3_HUMAN	L	243;228	ENSP00000320566:R243L;ENSP00000388506:R228L	ENSP00000320566:R243L	R	+	2	0	ING3	120396314	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	9.224000	0.95209	2.659000	0.90383	0.484000	0.47621	CGA			0.299	ING3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000280453.2		NM_019071	
DLGAP2	9228	mdanderson.org	37	8	1626714	1626714	+	Silent	SNP	C	C	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr8:1626714C>T	ENST00000421627.2	+	9	2517	c.2383C>T	c.(2383-2385)Ctg>Ttg	p.L795L	DLGAP2_ENST00000524065.1_3'UTR	NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	874					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		TTTGAAGCTGCTGCACGCAGA	0.607																																					p.L795L													.	.			0			c.C2383T												23.0	25.0	24.0					8																	1626714		1976	4178	6154	SO:0001819	synonymous_variant	9228	exon9			AAGCTGCTGCACG	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.2383C>T	8.37:g.1626714C>T			Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	22	0.14	3	NM_004745	0		0	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Silent	SNP	ENST00000421627.2	37	CCDS47760.1																																																																																					0.607	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000374478.1		NM_004745	
FAM66E	100132103	broad.mit.edu	37	8	7829133	7829134	+	lincRNA	DEL	TG	TG	-			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr8:7829133_7829134delTG	ENST00000533615.1	+	0	1153							P0C841	FA66E_HUMAN	family with sequence similarity 66, member E																		tatttgtgtttgtgtgtgtgtg	0.49																																					.													.	.			0			.																																											0	.			TGTGTTTGTGTGT			8p23.1	2013-07-05			ENSG00000225725	ENSG00000225725		"""Long non-coding RNAs"""	18735	non-coding RNA	RNA, long non-coding							Standard	NR_027424		Approved		uc011kws.1	P0C841	OTTHUMG00000165403		8.37:g.7829143_7829144delTG			Somatic	25	0.08	2		WXS	Illumina HiSeq	Phase_I	10	0.30	3	.	0		0		RNA	DEL	ENST00000533615.1	37																																																																																						0.490	FAM66E-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	lincRNA		OTTHUMT00000383841.1			
MFHAS1	9258	bcgsc.ca	37	8	8750409	8750409	+	Missense_Mutation	SNP	G	G	T	rs569422501		TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr8:8750409G>T	ENST00000276282.6	-	1	746	c.160C>A	c.(160-162)Ccc>Acc	p.P54T	RNU6-682P_ENST00000363843.1_RNA	NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	54										endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		ACGAGCTGGGGGGAGGCGGGG	0.746													G|||	1	0.000199681	0.0008	0.0	5008	,	,		9345	0.0		0.0	False		,,,				2504	0.0				p.P54T	Melanoma(103;1201 2045 17515 28966)												.	MFHAS1	58		0			c.C160A												7.0	8.0	8.0					8																	8750409		2136	4208	6344	SO:0001583	missense	9258	exon1			GCTGGGGGGAGGC	AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.160C>A	8.37:g.8750409G>T	ENSP00000276282:p.Pro54Thr		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_1	41	0.10	4	NM_004225	2	0.00	0	Q96CI0	Missense_Mutation	SNP	ENST00000276282.6	37	CCDS34844.1	.	.	.	.	.	.	.	.	.	.	G	9.332	1.060776	0.19987	.	.	ENSG00000147324	ENST00000276282	T	0.35421	1.31	4.54	2.69	0.31865	.	0.480009	0.20041	N	0.100518	T	0.19805	0.0476	N	0.14661	0.345	0.28660	N	0.906168	B	0.23650	0.089	B	0.14578	0.011	T	0.15093	-1.0449	10	0.15952	T	0.53	.	12.4685	0.55773	0.0:0.3237:0.6763:0.0	.	54	Q9Y4C4	MFHA1_HUMAN	T	54	ENSP00000276282:P54T	ENSP00000276282:P54T	P	-	1	0	MFHAS1	8787819	0.033000	0.19621	0.981000	0.43875	0.405000	0.30901	0.706000	0.25690	0.325000	0.23359	-0.257000	0.10917	CCC			0.746	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000374724.2		NM_004225	
GSR	2936	mdanderson.org	37	8	30539555	30539555	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr8:30539555G>T	ENST00000221130.5	-	11	1267	c.1177C>A	c.(1177-1179)Ctt>Att	p.L393I	GSR_ENST00000414019.1_Missense_Mutation_p.L350I|GSR_ENST00000537535.1_Missense_Mutation_p.L311I|GSR_ENST00000541648.1_Missense_Mutation_p.L340I|GSR_ENST00000546342.1_Missense_Mutation_p.L364I	NM_000637.3|NM_001195102.1|NM_001195103.1	NP_000628.2|NP_001182031.1|NP_001182032.1	P00390	GSHR_HUMAN	glutathione reductase	393					cell redox homeostasis (GO:0045454)|glutathione metabolic process (GO:0006749)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|glutathione-disulfide reductase activity (GO:0004362)|NADP binding (GO:0050661)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(2)	23				KIRC - Kidney renal clear cell carcinoma(542;0.105)|Kidney(114;0.125)	Carmustine(DB00262)|Flavin adenine dinucleotide(DB03147)|Glutathione(DB00143)	CGATGGGCAAGTTTTCGGCCA	0.383																																					p.L393I													.	.			0			c.C1177A												100.0	107.0	105.0					8																	30539555		2203	4300	6503	SO:0001583	missense	2936	exon11			GGGCAAGTTTTCG		CCDS34877.1, CCDS56530.1, CCDS56531.1, CCDS56532.1	8p21.1	2012-10-02			ENSG00000104687	ENSG00000104687	1.8.1.7		4623	protein-coding gene	gene with protein product		138300					Standard	NM_000637		Approved		uc003xih.2	P00390	OTTHUMG00000163946	ENST00000221130.5:c.1177C>A	8.37:g.30539555G>T	ENSP00000221130:p.Leu393Ile		Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_000637	115	0.00	0	C8KIL8|C8KIL9|C8KIM0|D3DSV3|Q7Z5C9|Q9NP63	Missense_Mutation	SNP	ENST00000221130.5	37	CCDS34877.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.633460	0.87660	.	.	ENSG00000104687	ENST00000221130;ENST00000414019;ENST00000546342;ENST00000541648;ENST00000537535	T;T;T;D;T	0.82526	1.62;1.62;-0.34;-1.62;-0.73	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	D	0.92718	0.7685	H	0.94183	3.505	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.93553	0.6888	10	0.66056	D	0.02	-25.322	10.5143	0.44881	0.0875:0.0:0.9125:0.0	.	393	P00390	GSHR_HUMAN	I	393;350;364;340;311	ENSP00000221130:L393I;ENSP00000390065:L350I;ENSP00000445516:L364I;ENSP00000444559:L340I;ENSP00000438845:L311I	ENSP00000221130:L393I	L	-	1	0	GSR	30659097	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.817000	0.69229	2.622000	0.88805	0.644000	0.83932	CTT			0.383	GSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000376519.1			
TEX15	56154	mdanderson.org	37	8	30704648	30704648	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr8:30704648G>T	ENST00000256246.2	-	1	1960	c.1886C>A	c.(1885-1887)tCt>tAt	p.S629Y	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	629					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		ACTTTCAGAAGAACAAGTTTC	0.338																																					p.S629Y													.	.			0			c.C1886A												68.0	67.0	67.0					8																	30704648		2203	4300	6503	SO:0001583	missense	56154	exon1			TCAGAAGAACAAG	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.1886C>A	8.37:g.30704648G>T	ENSP00000256246:p.Ser629Tyr		Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_031271	0		0		Missense_Mutation	SNP	ENST00000256246.2	37	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	G	19.16	3.774742	0.70107	.	.	ENSG00000133863	ENST00000256246	T	0.13420	2.59	5.13	2.32	0.28847	.	0.752143	0.12300	N	0.481208	T	0.20820	0.0501	L	0.34521	1.04	0.09310	N	1	D	0.64830	0.994	P	0.62740	0.906	T	0.08743	-1.0707	10	0.87932	D	0	.	6.7593	0.23532	0.2802:0.0:0.7198:0.0	.	629	Q9BXT5	TEX15_HUMAN	Y	629	ENSP00000256246:S629Y	ENSP00000256246:S629Y	S	-	2	0	TEX15	30824190	0.001000	0.12720	0.001000	0.08648	0.817000	0.46193	0.754000	0.26390	0.659000	0.30945	0.655000	0.94253	TCT			0.338	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000376193.1			
RGS22	26166	broad.mit.edu	37	8	100990176	100990177	+	Frame_Shift_Ins	INS	-	-	G	rs7841915	byFrequency	TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr8:100990176_100990177insG	ENST00000360863.6	-	23	3681_3682	c.3487_3488insC	c.(3487-3489)ttgfs	p.L1163fs	RGS22_ENST00000523287.1_Frame_Shift_Ins_p.L982fs|RGS22_ENST00000523437.1_Frame_Shift_Ins_p.L1151fs	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	1163					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)		RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			TAGGACTGCCAATTTTTTTTTC	0.312																																					p.L1163fs													.	RGS22	319		0			c.3488_3489insC																																									SO:0001589	frameshift_variant	26166	exon23			ACTGCCAATTTTT	AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.3487_3488insC	8.37:g.100990176_100990177insG	ENSP00000354109:p.Leu1163fs		Somatic	395	0.0025316456	1		WXS	Illumina HiSeq	Phase_I	368	0.05	18	NM_015668	1	0.00	0	A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Frame_Shift_Ins	INS	ENST00000360863.6	37	CCDS43758.1																																																																																					0.312	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000380365.1		NM_015668	
FBXO10	26267	broad.mit.edu	37	9	37516034	37516034	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr9:37516034G>A	ENST00000432825.2	-	10	2611	c.2563C>T	c.(2563-2565)Cgg>Tgg	p.R855W	RP11-613M10.8_ENST00000544475.1_5'UTR|FBXO10_ENST00000541829.1_Missense_Mutation_p.R380W	NM_012166.2	NP_036298.2	Q9UK96	FBX10_HUMAN	F-box protein 10	855					apoptotic process (GO:0006915)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.R861W(1)		breast(1)|endometrium(5)|large_intestine(11)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	34				GBM - Glioblastoma multiforme(29;0.0107)		GCACGGCCCCGCACGGCGATG	0.542																																					p.R855W													FBXO10,NS,carcinoma,0,1	FBXO10	75	1	1	Substitution - Missense(1)	lung(1)	c.C2563T												154.0	132.0	139.0					9																	37516034		1913	4124	6037	SO:0001583	missense	26267	exon10			GGCCCCGCACGGC	AF174598	CCDS47966.1	9p13.1	2014-01-29	2004-06-15		ENSG00000147912	ENSG00000147912		"""F-boxes /  ""other"""""	13589	protein-coding gene	gene with protein product		609092	"""F-box only protein 10"""			10531035, 10531037, 19300908	Standard	NM_012166		Approved	FBX10	uc004aab.3	Q9UK96	OTTHUMG00000019926	ENST00000432825.2:c.2563C>T	9.37:g.37516034G>A	ENSP00000403802:p.Arg855Trp		Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	116	0.03	4	NM_012166	28	0.00	0	Q08AL3|Q08AL4|Q5JRT8|Q9UKC3	Missense_Mutation	SNP	ENST00000432825.2	37	CCDS47966.1	.	.	.	.	.	.	.	.	.	.	G	16.13	3.035907	0.54896	.	.	ENSG00000147912	ENST00000432825;ENST00000541829	T;T	0.80480	-1.38;-1.38	5.43	5.43	0.79202	Pectin lyase fold/virulence factor (1);Pectin lyase fold (1);	0.609950	0.15903	N	0.238991	T	0.74921	0.3780	N	0.08118	0	0.36695	D	0.879781	D;P;P	0.61697	0.99;0.91;0.91	P;P;P	0.51101	0.659;0.448;0.448	T	0.82014	-0.0667	10	0.59425	D	0.04	-15.3349	17.9996	0.89195	0.0:0.0:1.0:0.0	.	734;380;855	Q59F51;Q08AL4;Q9UK96	.;.;FBX10_HUMAN	W	855;380	ENSP00000403802:R855W;ENSP00000441307:R380W	ENSP00000403802:R855W	R	-	1	2	FBXO10	37506034	1.000000	0.71417	1.000000	0.80357	0.701000	0.40568	2.613000	0.46351	2.552000	0.86080	0.511000	0.50034	CGG			0.542	FBXO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052472.3			
C9orf84	158401	bcgsc.ca;mdanderson.org	37	9	114480523	114480523	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr9:114480523A>G	ENST00000318737.4	-	14	2113	c.1985T>C	c.(1984-1986)tTa>tCa	p.L662S	C9orf84_ENST00000394777.4_Intron|C9orf84_ENST00000374287.3_Missense_Mutation_p.L662S|C9orf84_ENST00000394779.3_Missense_Mutation_p.L623S	NM_173521.3	NP_775792.3	Q5VXU9	CI084_HUMAN	chromosome 9 open reading frame 84	662										breast(1)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(10)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						CAGAAGATGTAAGAGAGCGGC	0.333																																					p.L662S													.	C9orf84	207		0			c.T1985C												106.0	100.0	102.0					9																	114480523		2203	4300	6503	SO:0001583	missense	158401	exon14			AGATGTAAGAGAG	AL833535	CCDS6781.3, CCDS43863.1	9q32	2012-03-16			ENSG00000165181	ENSG00000165181			26535	protein-coding gene	gene with protein product							Standard	XM_005251738		Approved	FLJ32779	uc004bfr.3	Q5VXU9	OTTHUMG00000020495	ENST00000318737.4:c.1985T>C	9.37:g.114480523A>G	ENSP00000322108:p.Leu662Ser		Somatic	74	0	0		WXS	Illumina HiSeq	Phase_1	41	0.10	4	NM_173521	0		0	A2A2V3|Q2M1H8|Q96M73	Missense_Mutation	SNP	ENST00000318737.4	37	CCDS6781.3	.	.	.	.	.	.	.	.	.	.	A	12.14	1.847760	0.32606	.	.	ENSG00000165181	ENST00000394779;ENST00000394778;ENST00000374287;ENST00000318737	T;T;T	0.10288	2.89;2.9;2.9	5.25	4.09	0.47781	.	0.437819	0.17377	N	0.176453	T	0.21307	0.0513	L	0.32530	0.975	0.23107	N	0.998288	D;D	0.76494	0.999;0.999	D;D	0.72075	0.943;0.976	T	0.04454	-1.0950	10	0.87932	D	0	-5.1589	11.4023	0.49876	0.8643:0.0:0.0:0.1357	.	662;623	Q5VXU9;A2A2V3	CI084_HUMAN;.	S	623;276;662;662	ENSP00000378259:L623S;ENSP00000363405:L662S;ENSP00000322108:L662S	ENSP00000322108:L662S	L	-	2	0	C9orf84	113520344	0.962000	0.33011	0.998000	0.56505	0.023000	0.10783	5.885000	0.69736	0.816000	0.34421	-0.468000	0.05107	TTA			0.333	C9orf84-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000053656.2		NM_173521	
CDK5RAP2	55755	mdanderson.org	37	9	123215780	123215780	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr9:123215780G>T	ENST00000349780.4	-	21	2926	c.2747C>A	c.(2746-2748)cCt>cAt	p.P916H	CDK5RAP2_ENST00000359309.3_Missense_Mutation_p.P916H|CDK5RAP2_ENST00000360190.4_Missense_Mutation_p.P916H|CDK5RAP2_ENST00000360822.3_Missense_Mutation_p.P884H	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	916					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						CTGCCACCCAGGCACCCCGTG	0.473																																					p.P916H													.	.			0			c.C2747A												80.0	85.0	83.0					9																	123215780		2203	4300	6503	SO:0001583	missense	55755	exon21			CACCCAGGCACCC	BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.2747C>A	9.37:g.123215780G>T	ENSP00000343818:p.Pro916His		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	45	0.09	4	NM_018249	48	0.00	0	Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Missense_Mutation	SNP	ENST00000349780.4	37	CCDS6823.1	.	.	.	.	.	.	.	.	.	.	G	14.68	2.608594	0.46527	.	.	ENSG00000136861	ENST00000360822;ENST00000359309;ENST00000349780;ENST00000360190;ENST00000416449	T;T;T;T;T	0.18502	3.88;3.62;3.9;3.8;2.21	5.42	3.6	0.41247	.	0.327733	0.26594	N	0.023505	T	0.24236	0.0587	L	0.32530	0.975	0.09310	N	1	D;D;D;D	0.76494	0.997;0.999;0.996;0.999	D;D;P;D	0.65874	0.912;0.939;0.819;0.912	T	0.04165	-1.0972	10	0.87932	D	0	.	5.9369	0.19171	0.171:0.1566:0.6724:0.0	.	685;916;916;310	Q6MZT4;Q96SN8-4;Q96SN8;B1AMJ5	.;.;CK5P2_HUMAN;.	H	884;916;916;916;310	ENSP00000354065:P884H;ENSP00000352258:P916H;ENSP00000343818:P916H;ENSP00000353317:P916H;ENSP00000400395:P310H	ENSP00000343818:P916H	P	-	2	0	CDK5RAP2	122255601	0.022000	0.18835	0.004000	0.12327	0.004000	0.04260	1.698000	0.37794	0.665000	0.31066	0.650000	0.86243	CCT			0.473	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000055535.1		NM_018249	
ENTPD8	377841	mdanderson.org	37	9	140329512	140329512	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chr9:140329512G>T	ENST00000472938.1	-	9	1358	c.1342C>A	c.(1342-1344)Ctg>Atg	p.L448M	ENTPD8_ENST00000344119.2_Missense_Mutation_p.L411M|ENTPD8_ENST00000371506.2_Missense_Mutation_p.L448M			Q5MY95	ENTP8_HUMAN	ectonucleoside triphosphate diphosphohydrolase 8	448					nucleoside diphosphate biosynthetic process (GO:0009133)|nucleoside monophosphate biosynthetic process (GO:0009124)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			biliary_tract(1)|lung(4)|prostate(1)|skin(1)	7	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000224)|Epithelial(140;0.000898)		ATCCCGGTCAGGTTCAGCATG	0.682																																					p.L448M													.	.			0			c.C1342A												56.0	53.0	54.0					9																	140329512		2195	4299	6494	SO:0001583	missense	377841	exon10			CGGTCAGGTTCAG	AY359088	CCDS7043.1, CCDS43913.1	9q34.3	2013-09-20			ENSG00000188833	ENSG00000188833			24860	protein-coding gene	gene with protein product	"""GLSR2492"""					12975309	Standard	NM_198585		Approved	UNQ2492, NTPDase-8	uc004cmw.3	Q5MY95	OTTHUMG00000131831	ENST00000472938.1:c.1342C>A	9.37:g.140329512G>T	ENSP00000420531:p.Leu448Met		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	42	0.07	3	NM_001033113	3	0.00	0	A2BG17|Q6UVZ0	Missense_Mutation	SNP	ENST00000472938.1	37	CCDS43913.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.120503	0.77323	.	.	ENSG00000188833	ENST00000344119;ENST00000371506;ENST00000472938	T;T;T	0.14893	2.47;2.47;2.47	5.06	4.13	0.48395	.	0.101398	0.41097	D	0.000951	T	0.44767	0.1309	M	0.87971	2.92	0.48236	D	0.999612	D;D	0.71674	0.997;0.998	P;D	0.68353	0.747;0.957	T	0.51810	-0.8658	10	0.59425	D	0.04	-0.4294	13.6066	0.62050	0.0:0.0:0.8445:0.1555	.	411;448	Q5MY95-2;Q5MY95	.;ENTP8_HUMAN	M	411;448;448	ENSP00000344089:L411M;ENSP00000360561:L448M;ENSP00000420531:L448M	ENSP00000344089:L411M	L	-	1	2	ENTPD8	139449333	1.000000	0.71417	1.000000	0.80357	0.839000	0.47603	2.267000	0.43329	2.349000	0.79799	0.561000	0.74099	CTG			0.682	ENTPD8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000355991.1		NM_198585	
MT-ND1	4535	hgsc.bcm.edu	37	M	983	983	+	5'Flank	SNP	C	C	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chrM:983C>T	ENST00000361390.2	+	0	0				MT-TL1_ENST00000386347.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	AGCTAAAACTCACCTGAGTTG	0.428																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	6052	.			AACTCACCTGAGT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886			M.37:g.983C>T	Exception_encountered		Somatic	39	0	0		WXS	Illumina HiSeq	.	20	0.60	12	.	0		0	C0JKH6|Q37523	RNA	SNP	ENST00000361390.2	37																																																																																						0.428	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024026	
AKAP17A	8227	mdanderson.org	37	X	1719834	1719834	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chrX:1719834G>T	ENST00000313871.3	+	5	1631	c.1435G>T	c.(1435-1437)Gtg>Ttg	p.V479L		NM_005088.2	NP_005079.2	Q02040	AK17A_HUMAN	A kinase (PRKA) anchor protein 17A	479					B cell activation (GO:0042113)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)			breast(2)|endometrium(5)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)	26						GTCCGGCTGTGTGAGCGCCAC	0.726																																					p.V479L													.	.			0			c.G1435T												16.0	15.0	16.0					X																	1719834		2165	4191	6356	SO:0001583	missense	8227	exon5			GGCTGTGTGAGCG	L03426	CCDS14116.1	Xp22.33 and Yp11.32	2010-09-08	2010-09-08	2010-09-08	ENSG00000197976	ENSG00000197976		"""Pseudoautosomal regions / PAR1"", ""A-kinase anchor proteins"""	18783	protein-coding gene	gene with protein product		312095, 465000	"""chromosome X and Y open reading frame 3"", ""splicing factor, arginine/serine-rich 17A"""	CXYorf3, SFRS17A		9736779, 1438229, 19840947	Standard	NR_027383		Approved	XE7, XE7Y, DXYS155E, MGC39904, 721P, CCDC133	uc004cqa.3	Q02040	OTTHUMG00000021063	ENST00000313871.3:c.1435G>T	X.37:g.1719834G>T	ENSP00000324827:p.Val479Leu		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	19	0.11	2	NM_005088	86	0.00	0	Q02832|Q2TB98|Q5JQ74|Q5JQ76|Q8N6U9	Missense_Mutation	SNP	ENST00000313871.3	37	CCDS14116.1	.	.	.	.	.	.	.	.	.	.	g	12.42	1.933858	0.34096	.	.	ENSG00000197976	ENST00000313871	T	0.46819	0.86	1.41	1.41	0.22369	.	0.629715	0.11839	U	0.524430	T	0.32675	0.0837	.	.	.	0.09310	N	0.999999	B	0.27882	0.192	B	0.34180	0.177	T	0.30387	-0.9980	9	0.25106	T	0.35	.	5.5248	0.16953	0.2388:0.0:0.7612:0.0	.	479	Q02040	AK17A_HUMAN	L	479	ENSP00000324827:V479L	ENSP00000324827:V479L	V	+	1	0	AKAP17A	1679834	0.026000	0.19158	0.003000	0.11579	0.004000	0.04260	0.500000	0.22562	0.367000	0.24454	0.367000	0.22151	GTG			0.726	AKAP17A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055609.2		NM_005088	
TAB3	257397	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	30870899	30870899	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chrX:30870899G>A	ENST00000378933.1	-	4	1883	c.1706C>T	c.(1705-1707)cCt>cTt	p.P569L	TAB3_ENST00000288422.2_Missense_Mutation_p.P569L|TAB3_ENST00000378930.3_Missense_Mutation_p.P569L|TAB3_ENST00000378928.1_Missense_Mutation_p.P20L|TAB3_ENST00000378932.2_Missense_Mutation_p.P569L|TAB3-AS2_ENST00000445240.1_RNA	NM_152787.3	NP_690000.2	Q8N5C8	TAB3_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 3	569					activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|skin(1)	27						ACTTACCGTAGGGATCGCAGT	0.478																																					p.P569L	Pancreas(164;1598 1985 29022 43301 49529)												.	.			0			c.C1706T												148.0	106.0	120.0					X																	30870899		2202	4300	6502	SO:0001583	missense	257397	exon7			ACCGTAGGGATCG	AY331591	CCDS14226.1	Xp21.2	2010-02-05	2010-02-05	2010-02-05	ENSG00000157625	ENSG00000157625			30681	protein-coding gene	gene with protein product	"""TAK1 binding protein 3"""	300480	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 3"""	MAP3K7IP3		14633987, 14670075	Standard	XM_005274482		Approved		uc004dcj.3	Q8N5C8	OTTHUMG00000021329	ENST00000378933.1:c.1706C>T	X.37:g.30870899G>A	ENSP00000368215:p.Pro569Leu		Somatic	40	0	0		WXS	Illumina HiSeq	.	60	0.15	9	NM_152787	15	0.07	1	A6NDD9|Q6VQR0	Missense_Mutation	SNP	ENST00000378933.1	37	CCDS14226.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.796360	0.90453	.	.	ENSG00000157625	ENST00000378933;ENST00000378930;ENST00000288422;ENST00000378932;ENST00000378928	D;D;D;D	0.83506	-1.7;-1.7;-1.7;-1.73	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.90126	0.6915	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	D	0.90701	0.4620	10	0.87932	D	0	-2.8232	19.0103	0.92870	0.0:0.0:1.0:0.0	.	569;569	Q8N5C8-2;Q8N5C8	.;TAB3_HUMAN	L	569;569;569;569;20	ENSP00000368215:P569L;ENSP00000368212:P569L;ENSP00000288422:P569L;ENSP00000368214:P569L	ENSP00000288422:P569L	P	-	2	0	TAB3	30780820	1.000000	0.71417	0.593000	0.28771	0.818000	0.46254	9.450000	0.97607	2.438000	0.82558	0.506000	0.49869	CCT			0.478	TAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056173.1		NM_152787	
OPHN1	4983	mdanderson.org	37	X	67333029	67333029	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chrX:67333029C>T	ENST00000355520.5	-	17	2055	c.1414G>A	c.(1414-1416)Gct>Act	p.A472T	OPHN1_ENST00000540071.1_Missense_Mutation_p.A472T|OPHN1_ENST00000484842.1_5'Flank	NM_002547.2	NP_002538.1	O60890	OPHN1_HUMAN	oligophrenin 1	472	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|negative regulation of proteasomal protein catabolic process (GO:1901799)|nervous system development (GO:0007399)|regulation of endocytosis (GO:0030100)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of synaptic transmission, glutamatergic (GO:0051966)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|substrate-dependent cell migration, cell extension (GO:0006930)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|terminal bouton (GO:0043195)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|skin(2)	31						TTACTGGCAGCAGAGACCAGC	0.383																																					p.A472T													.	.			0			c.G1414A												74.0	65.0	68.0					X																	67333029		2203	4300	6503	SO:0001583	missense	4983	exon17			TGGCAGCAGAGAC	AJ001189	CCDS14388.1	Xq12	2011-07-04			ENSG00000079482	ENSG00000079482		"""Rho GTPase activating proteins"""	8148	protein-coding gene	gene with protein product		300127	"""mental retardation, X-linked 60"""	MRX60		9195162, 9582072	Standard	NM_002547		Approved	OPN1, ARHGAP41	uc004dww.4	O60890	OTTHUMG00000021744	ENST00000355520.5:c.1414G>A	X.37:g.67333029C>T	ENSP00000347710:p.Ala472Thr		Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_002547	2	0.00	0	B9EIP8|Q5JQ81|Q6PCC1|Q8WX47	Missense_Mutation	SNP	ENST00000355520.5	37	CCDS14388.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.641368	0.87859	.	.	ENSG00000079482	ENST00000355520;ENST00000540071	T;T	0.25250	1.81;1.81	4.32	4.32	0.51571	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.49966	0.1588	M	0.76170	2.325	0.80722	D	1	D;D	0.89917	0.993;1.0	D;D	0.91635	0.993;0.999	T	0.54977	-0.8212	10	0.72032	D	0.01	.	13.2242	0.59905	0.0:1.0:0.0:0.0	.	472;472	F5H2E3;O60890	.;OPHN1_HUMAN	T	472	ENSP00000347710:A472T;ENSP00000438617:A472T	ENSP00000347710:A472T	A	-	1	0	OPHN1	67249754	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.641000	0.74324	1.975000	0.57531	0.594000	0.82650	GCT			0.383	OPHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057011.1		NM_002547	
KIAA2022	340533	broad.mit.edu	37	X	73962573	73962573	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chrX:73962573delA	ENST00000055682.6	-	3	2430	c.1819delT	c.(1819-1821)tccfs	p.S607fs		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	607					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						TGCTTTTGGGAAAAAGGTGTC	0.458																																					p.S607fs													.	KIAA2022	262		0			c.1819delT												100.0	81.0	87.0					X																	73962573		2203	4300	6503	SO:0001589	frameshift_variant	340533	exon3			TTTGGGAAAAAGG		CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.1819delT	X.37:g.73962573delA	ENSP00000055682:p.Ser607fs		Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	128	0.05	7	NM_001008537	0		0	A7YY87|Q5JUX9|Q8IVE9	Frame_Shift_Del	DEL	ENST00000055682.6	37	CCDS35337.1																																																																																					0.458	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057270.2		NM_001008537	
ZFY	7544	mdanderson.org	37	Y	2829598	2829598	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGT-01A-11D-A42Y-10	TCGA-2G-AAGT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	980913b0-79a2-4582-993d-61a244cf931f	f4d496a2-1051-4956-a38a-5992eea441c2	g.chrY:2829598C>T	ENST00000155093.3	+	3	866	c.545C>T	c.(544-546)gCc>gTc	p.A182V	ZFY_ENST00000449237.1_Missense_Mutation_p.A156V|ZFY_ENST00000383052.1_Missense_Mutation_p.A182V|ZFY_ENST00000431102.1_Intron	NM_003411.3	NP_003402.2	P08048	ZFY_HUMAN	zinc finger protein, Y-linked	182					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			biliary_tract(1)|kidney(3)|large_intestine(1)|lung(3)	8						GCAGACTGTGCCCCTGAAGCA	0.453																																					p.A182V													.	.			0			c.C545T																																									SO:0001583	missense	7544	exon3			ACTGTGCCCCTGA	L10393	CCDS14774.1, CCDS48200.1, CCDS48201.1	Yp11.3	2013-01-08			ENSG00000067646	ENSG00000067646		"""Zinc fingers, C2H2-type"""	12870	protein-coding gene	gene with protein product		490000				2497060	Standard	NM_001145275		Approved	ZNF911	uc004fqj.3	P08048	OTTHUMG00000036159	ENST00000155093.3:c.545C>T	Y.37:g.2829598C>T	ENSP00000155093:p.Ala182Val		Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_003411	9	0.00	0	B4DVF7|Q14021|Q15558|Q1RME9|Q24JR0|Q96TF3	Missense_Mutation	SNP	ENST00000155093.3	37	CCDS14774.1																																																																																					0.453	ZFY-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000088063.1		NM_003411	
