#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
TAS1R3	83756	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	1267021	1267023	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	CTC	CTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr1:1267021_1267023delCTC	ENST00000339381.5	+	2	227_229	c.195_197delCTC	c.(193-198)ttctcc>ttc	p.S67del		NM_152228.1	NP_689414	Q7RTX0	TS1R3_HUMAN	taste receptor, type 1, member 3	67					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			kidney(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.88e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.146)		GCCCCAGGTTCTCCTCAAACGGC	0.655																																					p.65_66del													.	TAS1R3	39		0			c.194_196del																																									SO:0001651	inframe_deletion	83756	exon2			CAGGTTCTCCTCA	AC026283	CCDS30556.1	1p36	2012-08-22			ENSG00000169962	ENSG00000169962		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	15661	protein-coding gene	gene with protein product		605865				11319557	Standard	XM_006710939		Approved	T1R3	uc010nyk.2	Q7RTX0	OTTHUMG00000003071	ENST00000339381.5:c.195_197delCTC	1.37:g.1267024_1267026delCTC	ENSP00000344411:p.Ser67del		Somatic	54	0	0		WXS	Illumina HiSeq	.	28	0.43	12	NM_152228	3	0.00	0	Q5TA49|Q8NGW9	In_Frame_Del	DEL	ENST00000339381.5	37	CCDS30556.1																																																																																					0.655	TAS1R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000008493.1			
GABRD	2563	broad.mit.edu	37	1	1961133	1961133	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr1:1961133G>T	ENST00000378585.4	+	8	1074	c.991G>T	c.(991-993)Gct>Tct	p.A331S		NM_000815.4	NP_000806.2	O14764	GBRD_HUMAN	gamma-aminobutyric acid (GABA) A receptor, delta	331					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			central_nervous_system(2)|endometrium(3)|kidney(2)|lung(8)|ovary(2)|prostate(1)|skin(2)	20	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;2.7e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.17e-24)|GBM - Glioblastoma multiforme(42;9.56e-08)|Colorectal(212;4.12e-05)|COAD - Colon adenocarcinoma(227;0.000194)|Kidney(185;0.00231)|BRCA - Breast invasive adenocarcinoma(365;0.00441)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GTACGCCTTTGCTCATTTCAA	0.612																																					p.A331S													.	GABRD	49		0			c.G991T												117.0	104.0	108.0					1																	1961133		2200	4300	6500	SO:0001583	missense	2563	exon8			GCCTTTGCTCATT	BC033801	CCDS36.1	1p36.3	2012-06-22			ENSG00000187730	ENSG00000187730		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4084	protein-coding gene	gene with protein product	"""GABA(A) receptor, delta"""	137163				2176788, 10965146	Standard	NM_000815		Approved		uc001aip.2	O14764	OTTHUMG00000041064	ENST00000378585.4:c.991G>T	1.37:g.1961133G>T	ENSP00000367848:p.Ala331Ser		Somatic	195	0	0		WXS	Illumina HiSeq	Phase_I	105	0.03	3	NM_000815	6	0.00	0	Q8N4N9	Missense_Mutation	SNP	ENST00000378585.4	37	CCDS36.1	.	.	.	.	.	.	.	.	.	.	G	16.27	3.076880	0.55753	.	.	ENSG00000187730	ENST00000378585	D	0.84223	-1.82	4.09	3.17	0.36434	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.89935	0.6859	L	0.58428	1.81	0.58432	D	0.999998	D	0.76494	0.999	D	0.83275	0.996	D	0.90551	0.4509	10	0.87932	D	0	-11.5289	13.2832	0.60228	0.0:0.1602:0.8398:0.0	.	331	O14764	GBRD_HUMAN	S	331	ENSP00000367848:A331S	ENSP00000367848:A331S	A	+	1	0	GABRD	1950993	1.000000	0.71417	0.949000	0.38748	0.134000	0.20937	9.302000	0.96175	1.067000	0.40740	0.561000	0.74099	GCT			0.612	GABRD-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000098493.1		NM_000815	
AGTRAP	57085	mdanderson.org	37	1	11807591	11807591	+	Missense_Mutation	SNP	G	G	T	rs201093684		TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr1:11807591G>T	ENST00000314340.5	+	3	211	c.157G>T	c.(157-159)Gcc>Tcc	p.A53S	AGTRAP_ENST00000376637.3_Missense_Mutation_p.R41L|AGTRAP_ENST00000510878.1_Intron|AGTRAP_ENST00000491346.1_3'UTR|AGTRAP_ENST00000376627.2_Missense_Mutation_p.R97L|AGTRAP_ENST00000400895.2_Missense_Mutation_p.R85L|AGTRAP_ENST00000452018.2_Missense_Mutation_p.R85L|AGTRAP_ENST00000376629.4_Missense_Mutation_p.A53S	NM_020350.4	NP_065083.3	Q6RW13	ATRAP_HUMAN	angiotensin II receptor-associated protein	53					regulation of blood pressure (GO:0008217)|response to hypoxia (GO:0001666)	cell cortex (GO:0005938)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)		AGTRAP/BRAF(2)	endometrium(1)|lung(3)|prostate(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.46e-06)|COAD - Colon adenocarcinoma(227;0.000256)|BRCA - Breast invasive adenocarcinoma(304;0.0003)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)		CTCCATCGACGCCATAAGCAT	0.637													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18442	0.0		0.0	False		,,,				2504	0.0				p.R85L													.	.			0			c.G254T												90.0	89.0	89.0					1																	11807591		2203	4300	6503	SO:0001583	missense	57085	exon4			ATCGACGCCATAA	AF165187	CCDS136.1, CCDS30585.1, CCDS30586.1, CCDS41248.1, CCDS44056.1	1p36.22	2008-02-05			ENSG00000177674	ENSG00000177674			13539	protein-coding gene	gene with protein product		608729				11733189	Standard	NM_001040194		Approved	ATRAP	uc001asv.3	Q6RW13	OTTHUMG00000002230	ENST00000314340.5:c.157G>T	1.37:g.11807591G>T	ENSP00000319713:p.Ala53Ser		Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_001040196	244	0.00	0	A8MVQ5|Q5SNV4|Q5SNV5|Q96AC0|Q96PL4|Q9NRW9	Missense_Mutation	SNP	ENST00000314340.5	37	CCDS136.1	1|1	4.578754578754579E-4|4.578754578754579E-4	1|1	0.0020325203252032522|0.0020325203252032522	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	G|G	15.92|15.92	2.975281|2.975281	0.53720|0.53720	.|.	.|.	ENSG00000177674|ENSG00000177674	ENST00000376629;ENST00000314340|ENST00000376637;ENST00000400895;ENST00000376627;ENST00000452018	T;T|T;T;T;T	0.60797|0.23754	0.16;0.16|1.89;1.89;1.89;1.89	5.16|5.16	5.16|5.16	0.70880|0.70880	.|.	0.000000|.	0.64402|.	U|.	0.000001|.	T|T	0.37073|0.37073	0.0990|0.0990	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	D;D|P;D;D	0.76494|0.57571	0.999;0.999|0.946;0.98;0.98	D;D|P;P;P	0.78314|0.48795	0.977;0.991|0.451;0.59;0.59	T|T	0.28902|0.28902	-1.0029|-1.0029	9|8	0.54805|0.87932	T|D	0.06|0	-0.0368|-0.0368	16.1617|16.1617	0.81721|0.81721	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	53;53|41;85;85	Q6RW13-2;Q6RW13|Q6RW13-4;Q6RW13-5;Q6RW13-3	.;ATRAP_HUMAN|.;.;.	S|L	53|41;85;97;85	ENSP00000365816:A53S;ENSP00000319713:A53S|ENSP00000365824:R41L;ENSP00000383688:R85L;ENSP00000365814:R97L;ENSP00000408505:R85L	ENSP00000319713:A53S|ENSP00000365814:R97L	A|R	+|+	1|2	0|0	AGTRAP|AGTRAP	11730178|11730178	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.242000|0.242000	0.25591|0.25591	8.575000|8.575000	0.90766|0.90766	2.420000|2.420000	0.82092|0.82092	0.561000|0.561000	0.74099|0.74099	GCC|CGC	0		0.637	AGTRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000006335.1		NM_020350	
CROCCP3	114819	broad.mit.edu	37	1	16809784	16809784	+	RNA	SNP	T	T	G	rs564105362	byFrequency	TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr1:16809784T>G	ENST00000263511.4	-	0	2001					NR_023386.1		Q8IVE0	CROL2_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 3						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											CCCGGCACCTTCTCAGGAGCT	0.632													.|||	29	0.00579073	0.0083	0.0043	5008	,	,		12250	0.0069		0.005	False		,,,				2504	0.0031				.													.	.			0			.																																											0	.			GCACCTTCTCAGG	AB067509		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000080947	ENSG00000080947			29405	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 2"""	CROCCL2		11572484	Standard	NR_023386		Approved	KIAA1922	uc001ayt.2	Q8IVE0	OTTHUMG00000037885		1.37:g.16809784T>G			Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	5	0.60	3	.	0		0	Q96PW6	RNA	SNP	ENST00000263511.4	37																																																																																						0.632	CROCCP3-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000458172.1		XM_057040	
LDLRAD2	401944	mdanderson.org	37	1	22142477	22142477	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr1:22142477A>G	ENST00000344642.2	+	3	740	c.553A>G	c.(553-555)Atc>Gtc	p.I185V	LDLRAD2_ENST00000543870.1_Missense_Mutation_p.I185V	NM_001013693.2	NP_001013715.2	Q5SZI1	LRAD2_HUMAN	low density lipoprotein receptor class A domain containing 2	185	LDL-receptor class A. {ECO:0000255|PROSITE-ProRule:PRU00124}.					integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(1)|lung(3)	6		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.00166)|all_lung(284;0.00172)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;5.2e-26)|COAD - Colon adenocarcinoma(152;1.13e-05)|GBM - Glioblastoma multiforme(114;1.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00598)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.197)		TGGCAGGTGCATCCCCTCAAG	0.627																																					p.I185V													.	.			0			c.A553G												81.0	73.0	76.0					1																	22142477		2203	4300	6503	SO:0001583	missense	401944	exon3			AGGTGCATCCCCT	AL590103	CCDS30624.1	1p36.12	2008-02-05	2005-10-07		ENSG00000187942	ENSG00000187942			32071	protein-coding gene	gene with protein product			"""low density lipoprotein receptor A domain containing 2"""				Standard	NM_001013693		Approved		uc001bfg.1	Q5SZI1	OTTHUMG00000002675	ENST00000344642.2:c.553A>G	1.37:g.22142477A>G	ENSP00000340988:p.Ile185Val		Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_001013693	1	0.00	0	B9EJB3|Q6ZSN5	Missense_Mutation	SNP	ENST00000344642.2	37	CCDS30624.1	.	.	.	.	.	.	.	.	.	.	A	13.92	2.381039	0.42207	.	.	ENSG00000187942	ENST00000344642;ENST00000543870	D;D	0.98012	-4.66;-4.66	5.07	2.72	0.32119	.	0.215858	0.27631	N	0.018512	D	0.93943	0.8061	L	0.52573	1.65	0.30632	N	0.757438	P	0.38129	0.619	B	0.29716	0.106	D	0.89783	0.3962	10	0.37606	T	0.19	-12.9114	7.5299	0.27677	0.8131:0.0:0.1869:0.0	.	185	Q5SZI1	LRAD2_HUMAN	V	185	ENSP00000340988:I185V;ENSP00000444097:I185V	ENSP00000340988:I185V	I	+	1	0	LDLRAD2	22015064	1.000000	0.71417	0.945000	0.38365	0.894000	0.52154	3.513000	0.53414	0.282000	0.22254	0.408000	0.27601	ATC			0.627	LDLRAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000007601.1		NM_001013693	
OVGP1	5016	bcgsc.ca	37	1	111957533	111957533	+	Silent	SNP	C	C	T	rs112145355		TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr1:111957533C>T	ENST00000369732.3	-	11	1645	c.1590G>A	c.(1588-1590)caG>caA	p.Q530Q		NM_002557.3	NP_002548.3	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1, 120kDa	530					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|female pregnancy (GO:0007565)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|single fertilization (GO:0007338)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|egg coat (GO:0035805)|perivitelline space (GO:0098595)	chitinase activity (GO:0004568)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	39		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		GGGTCACAGACTGATGACCCA	0.542																																					p.Q530Q													.	OVGP1	177		0			c.G1590A												59.0	57.0	58.0					1																	111957533		2197	4207	6404	SO:0001819	synonymous_variant	5016	exon11			CACAGACTGATGA	U09550	CCDS834.1	1p13.2	2008-07-31	2008-07-31		ENSG00000085465	ENSG00000085465		"""Mucins"""	8524	protein-coding gene	gene with protein product	"""oviductin"""	603578	"""mucin 9"""	MUC9		7819450, 9341614	Standard	NM_002557		Approved	CHIT5	uc001eba.3	Q12889	OTTHUMG00000011746	ENST00000369732.3:c.1590G>A	1.37:g.111957533C>T			Somatic	156	0	0		WXS	Illumina HiSeq	Phase_1	101	0.03	3	NM_002557	11	0.00	0	A0AV19|B9EGE1|Q15841	Silent	SNP	ENST00000369732.3	37	CCDS834.1																																																																																					0.542	OVGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000032461.1		NM_002557	
F5	2153	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	169483622	169483622	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr1:169483622G>A	ENST00000367797.3	-	25	6805	c.6604C>T	c.(6604-6606)Cgt>Tgt	p.R2202C	F5_ENST00000367796.3_Missense_Mutation_p.R2207C	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	2202	F5/8 type C 2. {ECO:0000255|PROSITE- ProRule:PRU00081}.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	GGAATGACACGGATAAACCTG	0.368																																					p.R2202C													F5,colon,carcinoma,+1,1	F5	1	1	0			c.C6604T												83.0	87.0	86.0					1																	169483622		2203	4300	6503	SO:0001583	missense	2153	exon25			TGACACGGATAAA	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.6604C>T	1.37:g.169483622G>A	ENSP00000356771:p.Arg2202Cys		Somatic	124	0	0		WXS	Illumina HiSeq	.	124	0.06	7	NM_000130	0		0	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	ENST00000367797.3	37	CCDS1281.1	.	.	.	.	.	.	.	.	.	.	G	19.28	3.796617	0.70567	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	D;D	0.90324	-2.65;-2.65	5.09	5.09	0.68999	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.96204	0.8762	H	0.95611	3.695	0.49299	D	0.999770	D	0.89917	1.0	D	0.97110	1.0	D	0.97297	0.9928	9	0.87932	D	0	-11.4568	13.0971	0.59200	0.0:0.0:0.8393:0.1606	.	2202	P12259	FA5_HUMAN	C	2202;2207	ENSP00000356771:R2202C;ENSP00000356770:R2207C	ENSP00000356770:R2207C	R	-	1	0	F5	167750246	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.953000	0.56699	2.356000	0.79943	0.591000	0.81541	CGT			0.368	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000083712.1		NM_000130	
GPR52	9293	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	174417851	174417851	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr1:174417851C>T	ENST00000367685.2	+	1	640	c.602C>T	c.(601-603)gCc>gTc	p.A201V	RABGAP1L_ENST00000357444.6_Intron|RABGAP1L_ENST00000367689.3_Intron|RABGAP1L_ENST00000251507.4_Intron	NM_005684.4	NP_005675.3	Q9Y2T5	GPR52_HUMAN	G protein-coupled receptor 52	201					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(3)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|prostate(1)|skin(2)	20						CTCACCAGTGCCTATTTTACT	0.438																																					p.A201V	Ovarian(92;924 1390 1930 16467 40583)												.	GPR52	40		0			c.C602T												325.0	284.0	298.0					1																	174417851		2203	4300	6503	SO:0001583	missense	9293	exon1			CCAGTGCCTATTT	AF096784	CCDS30941.1	1q24	2012-08-21			ENSG00000203737	ENSG00000203737		"""GPCR / Class A : Orphans"""	4508	protein-coding gene	gene with protein product		604106				9931487	Standard	NM_005684		Approved		uc001gka.1	Q9Y2T5	OTTHUMG00000034901	ENST00000367685.2:c.602C>T	1.37:g.174417851C>T	ENSP00000356658:p.Ala201Val		Somatic	139	0.0071942446	1		WXS	Illumina HiSeq	Phase_I	136	0.48	65	NM_005684	0		0	O75654|Q4VBL6|Q6ISM0	Missense_Mutation	SNP	ENST00000367685.2	37	CCDS30941.1	.	.	.	.	.	.	.	.	.	.	C	14.68	2.606503	0.46527	.	.	ENSG00000203737	ENST00000367685	T	0.36878	1.23	5.9	4.99	0.66335	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000002	T	0.24928	0.0605	N	0.11313	0.125	0.41313	D	0.98712	B	0.24092	0.097	B	0.28011	0.085	T	0.08330	-1.0727	10	0.56958	D	0.05	-8.4223	15.3368	0.74263	0.0:0.9332:0.0:0.0668	.	201	Q9Y2T5	GPR52_HUMAN	V	201	ENSP00000356658:A201V	ENSP00000356658:A201V	A	+	2	0	GPR52	172684474	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.720000	0.68470	1.500000	0.48636	0.650000	0.86243	GCC			0.438	GPR52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000084511.1		NM_005684	
NEBL	10529	mdanderson.org	37	10	21141490	21141490	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr10:21141490G>A	ENST00000377122.4	-	10	1388	c.992C>T	c.(991-993)gCc>gTc	p.A331V	NEBL_ENST00000377159.4_Intron|NEBL_ENST00000417816.2_Intron	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette	331					cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TTGGAGGACGGCATTGCCTTT	0.498																																					p.A331V													.	.			0			c.C992T												149.0	107.0	121.0					10																	21141490		2203	4300	6503	SO:0001583	missense	10529	exon10			AGGACGGCATTGC	Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.992C>T	10.37:g.21141490G>A	ENSP00000366326:p.Ala331Val		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	30	0.10	3	NM_006393	0		0	B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Missense_Mutation	SNP	ENST00000377122.4	37	CCDS7134.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.263958	0.80358	.	.	ENSG00000078114	ENST00000377122	T	0.53640	0.61	5.98	5.98	0.97165	.	0.177079	0.48767	D	0.000165	T	0.63331	0.2502	M	0.66939	2.045	0.80722	D	1	P	0.45768	0.866	P	0.53185	0.72	T	0.63292	-0.6670	10	0.66056	D	0.02	.	19.2296	0.93833	0.0:0.0:1.0:0.0	.	331	O76041	NEBL_HUMAN	V	331	ENSP00000366326:A331V	ENSP00000366326:A331V	A	-	2	0	NEBL	21181496	0.999000	0.42202	0.695000	0.30226	0.714000	0.41099	5.077000	0.64419	2.835000	0.97688	0.650000	0.86243	GCC			0.498	NEBL-004	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000047113.1		NM_006393	
ANKRD30A	91074	bcgsc.ca	37	10	37627062	37627062	+	Intron	SNP	T	T	G			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr10:37627062T>G	ENST00000602533.1	+	37	4405				LINC00993_ENST00000426471.1_lincRNA			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A						regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						TCACTGGGGCTTTTTTCACAT	0.368																																					.													.	.			0			.																																									SO:0001627	intron_variant	0	.			TGGGGCTTTTTTC	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.4024-45925T>G	10.37:g.37627062T>G			Somatic	187	0	0		WXS	Illumina HiSeq	Phase_1	84	0.46	39	.	0		0	Q5W025	RNA	SNP	ENST00000602533.1	37																																																																																						0.368	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000047588.2		NM_052997	
GDF2	2658	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	48413904	48413904	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr10:48413904C>T	ENST00000249598.1	-	2	1123	c.964G>A	c.(964-966)Ggg>Agg	p.G322R		NM_016204.1	NP_057288.1	Q9UK05	GDF2_HUMAN	growth differentiation factor 2	322					activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to BMP stimulus (GO:0071773)|growth (GO:0040007)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of DNA replication (GO:0008156)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(2)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	28						CTGCCAGCCCCGGCGCTCCTT	0.612																																					p.G322R													.	.			0			c.G964A												51.0	53.0	52.0					10																	48413904		2203	4300	6503	SO:0001583	missense	2658	exon2			CAGCCCCGGCGCT	AF156891	CCDS73118.1	10q11.22	2014-05-06			ENSG00000128802	ENSG00000263761		"""Endogenous ligands"""	4217	protein-coding gene	gene with protein product		605120				10849432	Standard	NM_016204		Approved	BMP-9, BMP9	uc001jfa.1	Q9UK05	OTTHUMG00000188320	ENST00000249598.1:c.964G>A	10.37:g.48413904C>T	ENSP00000249598:p.Gly322Arg		Somatic	91	0	0		WXS	Illumina HiSeq	.	62	0.26	16	NM_016204	0		0	Q5VSQ9|Q9Y571	Missense_Mutation	SNP	ENST00000249598.1	37	CCDS7219.1	.	.	.	.	.	.	.	.	.	.	C	15.38	2.815623	0.50527	.	.	ENSG00000128802	ENST00000249598	D	0.88975	-2.45	5.46	4.55	0.56014	Transforming growth factor-beta, C-terminal (1);	0.111701	0.64402	D	0.000011	D	0.87888	0.6291	M	0.62723	1.935	0.22666	N	0.99888	D	0.60160	0.987	P	0.47827	0.558	T	0.79897	-0.1609	10	0.14656	T	0.56	.	13.7428	0.62857	0.0:0.9242:0.0:0.0758	.	322	Q9UK05	GDF2_HUMAN	R	322	ENSP00000249598:G322R	ENSP00000249598:G322R	G	-	1	0	GDF2	48033910	0.011000	0.17503	0.808000	0.32385	0.025000	0.11179	1.573000	0.36472	2.571000	0.86741	0.467000	0.42956	GGG			0.612	GDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047891.1		NM_016204	
MUC6	4588	bcgsc.ca	37	11	1016870	1016871	+	Missense_Mutation	DNP	GG	GG	AT	rs554068781|rs76307106		TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	GG	GG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr11:1016870_1016871GG>AT	ENST00000421673.2	-	31	5980_5981	c.5930_5931CC>AT	c.(5929-5931)cCC>cAT	p.P1977H		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1977	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGGAAGAGAAGGGACTGCTCCC	0.589																																					p.P1977H													.	MUC6	408		0			c.C5930A																																									SO:0001583	missense	4588	exon31			AGAGAAGGGACTG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5930_5931delinsAT	11.37:g.1016870_1016871delinsAT	ENSP00000406861:p.Pro1977His		Somatic	610	0.0049180328	3		WXS	Illumina HiSeq	Phase_1	280	0.05	13	NM_005961	1	0.00	0	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	DNP	ENST00000421673.2	37	CCDS44513.1																																																																																					0.589	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382120.2		XM_290540	
MUC6	4588	bcgsc.ca	37	11	1017363	1017363	+	Missense_Mutation	SNP	C	C	G	rs199783663		TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr11:1017363C>G	ENST00000421673.2	-	31	5488	c.5438G>C	c.(5437-5439)gGt>gCt	p.G1813A		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1813	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGTGACAGGACCTGTGGAAGA	0.592																																					p.G1813A													.	MUC6	408		0			c.G5438C												800.0	792.0	795.0					11																	1017363		2202	4298	6500	SO:0001583	missense	4588	exon31			ACAGGACCTGTGG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5438G>C	11.37:g.1017363C>G	ENSP00000406861:p.Gly1813Ala		Somatic	462	0.0173160173	8		WXS	Illumina HiSeq	Phase_1	231	0.05	11	NM_005961	1	1.00	1	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	C	2.223	-0.377906	0.05000	.	.	ENSG00000184956	ENST00000421673	T	0.26223	1.75	3.21	1.11	0.20524	.	.	.	.	.	T	0.22513	0.0543	L	0.46741	1.465	0.09310	N	1	P	0.50272	0.933	P	0.50082	0.63	T	0.10800	-1.0614	9	0.07990	T	0.79	.	3.5014	0.07674	0.1733:0.553:0.1691:0.1047	.	1813	Q6W4X9	MUC6_HUMAN	A	1813	ENSP00000406861:G1813A	ENSP00000406861:G1813A	G	-	2	0	MUC6	1007363	0.000000	0.05858	0.002000	0.10522	0.026000	0.11368	-1.411000	0.02478	0.136000	0.18733	0.313000	0.20887	GGT			0.592	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382120.2		XM_290540	
MUC2	4583	mdanderson.org	37	11	1093050	1093050	+	Silent	SNP	C	C	A			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr11:1093050C>A	ENST00000441003.2	+	30	4896	c.4869C>A	c.(4867-4869)ggC>ggA	p.G1623G	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	cacccactggcacacagaccc	0.632																																					p.G1623G													.	.			0			c.C4869A												129.0	166.0	153.0					11																	1093050		1883	3610	5493	SO:0001819	synonymous_variant	4583	exon30			CACTGGCACACAG	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4869C>A	11.37:g.1093050C>A			Somatic	33	0.0303030303	1		WXS	Illumina HiSeq	Phase_I	33	0.12	4	NM_002457	0		0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																						0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
SLC15A3	51296	mdanderson.org	37	11	60718892	60718892	+	Silent	SNP	C	C	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr11:60718892C>T	ENST00000227880.3	-	1	365	c.132G>A	c.(130-132)ctG>ctA	p.L44L		NM_016582.2	NP_057666.1	Q8IY34	S15A3_HUMAN	solute carrier family 15 (oligopeptide transporter), member 3	44					ion transport (GO:0006811)|peptide transport (GO:0015833)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	symporter activity (GO:0015293)			central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(9)|prostate(2)	17						CGGCGCGCTCCAGCATCTCCA	0.756																																					p.L44L													.	.			0			c.G132A												6.0	5.0	5.0					11																	60718892		1838	3723	5561	SO:0001819	synonymous_variant	51296	exon1			GCGCTCCAGCATC	AB020598	CCDS7998.1	11q12.2	2013-07-18	2013-07-18		ENSG00000110446	ENSG00000110446		"""Solute carriers"""	18068	protein-coding gene	gene with protein product		610408	"""solute carrier family 15, member 3"""			11336635, 11741232	Standard	NM_016582		Approved	PHT2, hPTR3	uc001nqn.2	Q8IY34	OTTHUMG00000167804	ENST00000227880.3:c.132G>A	11.37:g.60718892C>T			Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_016582	2	0.00	0	Q9P2X9	Silent	SNP	ENST00000227880.3	37	CCDS7998.1																																																																																					0.756	SLC15A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396366.1		NM_016582	
IGHMBP2	3508	mdanderson.org	37	11	68704480	68704480	+	Silent	SNP	G	G	T	rs2228207	byFrequency	TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr11:68704480G>T	ENST00000255078.3	+	13	2643	c.2532G>T	c.(2530-2532)gcG>gcT	p.A844A		NM_002180.2	NP_002171.2	P38935	SMBP2_HUMAN	immunoglobulin mu binding protein 2	844	Gln/Pro-rich.				ATP catabolic process (GO:0006200)|cell death (GO:0008219)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|protein homooligomerization (GO:0051260)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)	axon (GO:0030424)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent 5'-3' RNA helicase activity (GO:0032575)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|RNA-dependent ATPase activity (GO:0008186)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)|tRNA binding (GO:0000049)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|liver(1)|lung(15)|ovary(2)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			TCAGGAGCGCGCAGGGGCAGC	0.587																																					p.A844A													.	.			0			c.G2532T												13.0	16.0	15.0					11																	68704480		2135	4194	6329	SO:0001819	synonymous_variant	3508	exon13			GAGCGCGCAGGGG	L14754	CCDS8187.1	11q13.3	2014-09-17			ENSG00000132740	ENSG00000132740		"""Zinc fingers, AN1-type domain containing"""	5542	protein-coding gene	gene with protein product	"""cardiac transcription factor 1"", ""zinc finger, AN1-type domain 7"""	600502				8349627	Standard	NM_002180		Approved	ZFAND7, SMUBP2, CATF1, SMARD1, HCSA, HMN6	uc001ook.1	P38935	OTTHUMG00000167894	ENST00000255078.3:c.2532G>T	11.37:g.68704480G>T			Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	20	0.10	2	NM_002180	13	0.00	0	A0PJD2|Q00443|Q14177	Silent	SNP	ENST00000255078.3	37	CCDS8187.1																																																																																					0.587	IGHMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396862.1		NM_002180	
FZD4	8322	mdanderson.org	37	11	86662968	86662968	+	Missense_Mutation	SNP	C	C	T	rs148970041		TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr11:86662968C>T	ENST00000531380.1	-	2	1135	c.830G>A	c.(829-831)cGg>cAg	p.R277Q	PRSS23_ENST00000533902.2_3'UTR	NM_012193.3	NP_036325.2	Q9ULV1	FZD4_HUMAN	frizzled class receptor 4	277					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|cerebellum vasculature morphogenesis (GO:0061301)|extracellular matrix-cell signaling (GO:0035426)|locomotion involved in locomotory behavior (GO:0031987)|negative regulation of cell-substrate adhesion (GO:0010812)|neuron differentiation (GO:0030182)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal blood vessel morphogenesis (GO:0061304)|sensory perception of sound (GO:0007605)|substrate adhesion-dependent cell spreading (GO:0034446)|vasculogenesis (GO:0001570)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine binding (GO:0019955)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|kidney(1)|large_intestine(3)|lung(9)|prostate(6)|skin(1)	21		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TATCCTTTCCCGGCCTACAGT	0.413																																					p.R277Q													.	.			0			c.G830A							C	GLN/ARG	0,4402		0,0,2201	33.0	34.0	34.0		830	5.7	1.0	11	dbSNP_134	34	1,8597	1.2+/-3.3	0,1,4298	no	missense	FZD4	NM_012193.3	43	0,1,6499	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	277/538	86662968	1,12999	2201	4299	6500	SO:0001583	missense	8322	exon2			CTTTCCCGGCCTA	AB032417	CCDS8279.1	11q14-q21	2014-01-29	2014-01-29			ENSG00000174804		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4042	protein-coding gene	gene with protein product		604579	"""frizzled (Drosophila) homolog 4"", ""exudative vitreoretinopathy 1"", ""frizzled homolog 4 (Drosophila)"", ""frizzled 4, seven transmembrane spanning receptor"", ""frizzled family receptor 4"""	EVR1		10544037, 15024691	Standard	NM_012193		Approved	CD344	uc001pce.3	Q9ULV1		ENST00000531380.1:c.830G>A	11.37:g.86662968C>T	ENSP00000434034:p.Arg277Gln		Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_012193	2	0.00	0	A8K9Q3|Q14C97|Q6S9E4	Missense_Mutation	SNP	ENST00000531380.1	37	CCDS8279.1	.	.	.	.	.	.	.	.	.	.	C	16.57	3.159730	0.57368	0.0	1.16E-4	ENSG00000174804	ENST00000531380	D	0.82255	-1.59	5.72	5.72	0.89469	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	D	0.89626	0.6769	M	0.73372	2.23	0.80722	D	1	D	0.69078	0.997	P	0.59703	0.862	D	0.88675	0.3198	9	.	.	.	.	19.8946	0.96949	0.0:1.0:0.0:0.0	.	277	Q9ULV1	FZD4_HUMAN	Q	277	ENSP00000434034:R277Q	.	R	-	2	0	FZD4	86340616	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.072000	0.57563	2.711000	0.92665	0.655000	0.94253	CGG	0		0.413	FZD4-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393818.2		NM_012193	
FOXJ2	55810	broad.mit.edu	37	12	8196601	8196601	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr12:8196601G>T	ENST00000162391.3	+	5	1677	c.532G>T	c.(532-534)Gca>Tca	p.A178S	FOXJ2_ENST00000428177.2_Missense_Mutation_p.A178S	NM_018416.2	NP_060886.1	Q9P0K8	FOXJ2_HUMAN	forkhead box J2	178					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			autonomic_ganglia(1)|large_intestine(2)|lung(6)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	16				Kidney(36;0.0944)		GGGAGGCGTTGCAGGGAGTGG	0.532																																					p.A178S													.	FOXJ2	43		0			c.G532T												76.0	74.0	75.0					12																	8196601		2203	4300	6503	SO:0001583	missense	55810	exon5			GGCGTTGCAGGGA	AF155132	CCDS8587.1	12p13.31	2006-12-15				ENSG00000065970		"""Forkhead boxes"""	24818	protein-coding gene	gene with protein product						10777590, 10966786	Standard	NM_018416		Approved	FHX	uc001qtu.3	Q9P0K8		ENST00000162391.3:c.532G>T	12.37:g.8196601G>T	ENSP00000162391:p.Ala178Ser		Somatic	109	0	0		WXS	Illumina HiSeq	Phase_I	317	0.02	5	NM_018416	6	0.00	0	A0AVK4|B2RMP3|Q96PS9|Q9NSN5	Missense_Mutation	SNP	ENST00000162391.3	37	CCDS8587.1	.	.	.	.	.	.	.	.	.	.	G	4.160	0.028217	0.08054	.	.	ENSG00000065970	ENST00000162391;ENST00000428177	D;D	0.95103	-3.41;-3.61	5.11	4.22	0.49857	.	0.703396	0.12805	N	0.437649	D	0.85716	0.5761	N	0.08118	0	0.19945	N	0.999941	B;B	0.16396	0.01;0.017	B;B	0.18561	0.008;0.022	T	0.68515	-0.5388	10	0.07030	T	0.85	.	11.8574	0.52446	0.0:0.8233:0.1767:0.0	.	178;178	Q9P0K8;Q9P0K8-2	FOXJ2_HUMAN;.	S	178	ENSP00000162391:A178S;ENSP00000403411:A178S	ENSP00000162391:A178S	A	+	1	0	FOXJ2	8087868	0.998000	0.40836	0.707000	0.30419	0.750000	0.42670	1.892000	0.39748	1.159000	0.42565	-0.228000	0.12330	GCA			0.532	FOXJ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000400088.1		NM_018416	
KIAA1551	55196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	32138197	32138197	+	Silent	SNP	T	T	C			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr12:32138197T>C	ENST00000312561.4	+	4	4722	c.4308T>C	c.(4306-4308)agT>agC	p.S1436S	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	1436																	CGAAAGCGAGTTCATCTAAAT	0.348																																					p.S1436S													.	.			0			c.T4308C												75.0	84.0	81.0					12																	32138197		2203	4300	6503	SO:0001819	synonymous_variant	55196	exon4			AGCGAGTTCATCT	AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.4308T>C	12.37:g.32138197T>C			Somatic	149	0	0		WXS	Illumina HiSeq	.	372	0.41	154	NM_018169	445	0.48	213	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Silent	SNP	ENST00000312561.4	37	CCDS8725.2																																																																																					0.348	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250307.2		NM_018169	
KIF21A	55605	broad.mit.edu	37	12	39735383	39735383	+	Silent	SNP	C	C	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr12:39735383C>T	ENST00000361418.5	-	14	1860	c.1845G>A	c.(1843-1845)gaG>gaA	p.E615E	KIF21A_ENST00000395670.3_Silent_p.E615E|KIF21A_ENST00000361961.3_Silent_p.E602E|KIF21A_ENST00000544797.2_Silent_p.E602E|KIF21A_ENST00000541463.2_Silent_p.E602E			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	615					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.E602D(1)|p.E602E(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				cctcctcctcctcttcttcat	0.398																																					p.E615E													KIF21A,NS,carcinoma,0,2	KIF21A	238	2	2	Substitution - Missense(1)|Substitution - coding silent(1)	lung(1)|kidney(1)	c.G1845A												85.0	82.0	83.0					12																	39735383		2203	4299	6502	SO:0001819	synonymous_variant	55605	exon14			CTCCTCCTCTTCT	AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.1845G>A	12.37:g.39735383C>T			Somatic	138	0.0072463768	1		WXS	Illumina HiSeq	Phase_I	334	0.01	5	NM_001173464	23	0.00	0	A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Silent	SNP	ENST00000361418.5	37	CCDS53776.1																																																																																					0.398	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000403581.1		NM_017641	
DDX23	9416	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	49231066	49231066	+	Silent	SNP	G	G	A			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr12:49231066G>A	ENST00000308025.3	-	8	943	c.864C>T	c.(862-864)ccC>ccT	p.P288P	DDX23_ENST00000553182.1_5'Flank	NM_004818.2	NP_004809.2	Q9BUQ8	DDX23_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23	288					ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|kidney(4)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(3)	36						CCACTCACAGGGGGTTGTAGT	0.507																																					p.P288P													.	.			0			c.C864T												99.0	96.0	97.0					12																	49231066		2203	4300	6503	SO:0001819	synonymous_variant	9416	exon8			TCACAGGGGGTTG	AF026402	CCDS8770.1	12q13.11	2013-07-16				ENSG00000174243		"""DEAD-boxes"""	17347	protein-coding gene	gene with protein product		612172	"""PRP28 homolog, yeast"""			9409622, 9539711	Standard	NM_004818		Approved	prp28, U5-100K, PRPF28, SNRNP100	uc001rsm.3	Q9BUQ8		ENST00000308025.3:c.864C>T	12.37:g.49231066G>A			Somatic	148	0	0		WXS	Illumina HiSeq	.	143	0.31	44	NM_004818	174	0.34	60	B2R600|B4DH15|O43188	Silent	SNP	ENST00000308025.3	37	CCDS8770.1																																																																																					0.507	DDX23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000408897.2		NM_004818	
TROAP	10024	ucsc.edu	37	12	49718012	49718012	+	Intron	SNP	A	A	G			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr12:49718012A>G	ENST00000257909.3	+	3	413				TROAP_ENST00000380327.5_Missense_Mutation_p.R138G|TROAP_ENST00000551245.1_Intron|RP11-161H23.9_ENST00000553259.1_RNA|TROAP_ENST00000548311.1_Splice_Site|TROAP_ENST00000549275.1_Silent_p.P54P|TROAP_ENST00000550709.1_3'UTR|TROAP_ENST00000547923.1_5'Flank|TROAP_ENST00000549534.1_3'UTR	NM_005480.3	NP_005471.3	Q12815	TROAP_HUMAN	trophinin associated protein						cell adhesion (GO:0007155)	cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	32						TCATCTCgccaggtgccatgg	0.532																																					p.R138G													.	TROAP	80		0			c.A412G												51.0	52.0	52.0					12																	49718012		2102	4247	6349	SO:0001627	intron_variant	10024	exon4			CTCGCCAGGTGCC	U04810	CCDS8784.1, CCDS41779.1, CCDS61117.1	12q13.12	2012-10-17	2012-10-17		ENSG00000135451	ENSG00000135451			12327	protein-coding gene	gene with protein product	"""tastin"""	603872				7758945	Standard	NM_005480		Approved	TASTIN	uc001rtx.4	Q12815	OTTHUMG00000169486	ENST00000257909.3:c.337+192A>G	12.37:g.49718012A>G			Somatic	208	0	0		RNA-Seq	Illumina HiSeq		166	0.01	1	NM_001100620	109	0.14	15	F8VSF9|Q6PJU7|Q8N5B2	Missense_Mutation	SNP	ENST00000257909.3	37	CCDS8784.1	.	.	.	.	.	.	.	.	.	.	A	3.195	-0.164892	0.06502	.	.	ENSG00000135451	ENST00000380327	.	.	.	1.03	-2.05	0.07321	.	.	.	.	.	T	0.19604	0.0471	.	.	.	0.09310	N	1	B	0.31193	0.312	B	0.21708	0.036	T	0.16247	-1.0409	7	0.87932	D	0	.	1.4047	0.02278	0.4045:0.0:0.2673:0.3282	.	138	Q6PJU7	.	G	138	.	ENSP00000369684:R138G	R	+	1	2	TROAP	48004279	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.122000	0.10627	-0.791000	0.04486	0.260000	0.18958	AGG			0.532	TROAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000404300.1		NM_005480	
RAB5B	5869	broad.mit.edu	37	12	56383797	56383797	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr12:56383797C>T	ENST00000360299.5	+	3	451	c.230C>T	c.(229-231)gCt>gTt	p.A77V	RAB5B_ENST00000448789.2_Missense_Mutation_p.A77V|RAB5B_ENST00000553116.1_Missense_Mutation_p.A77V	NM_002868.3	NP_002859.1	P61020	RAB5B_HUMAN	RAB5B, member RAS oncogene family	77					antigen processing and presentation (GO:0019882)|endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|plasma membrane to endosome transport (GO:0048227)|protein transport (GO:0015031)|regulation of endocytosis (GO:0030100)|small GTPase mediated signal transduction (GO:0007264)	endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTP-dependent protein binding (GO:0030742)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(1)|liver(2)|lung(4)|upper_aerodigestive_tract(1)	9			UCEC - Uterine corpus endometrioid carcinoma (6;0.0471)|OV - Ovarian serous cystadenocarcinoma(18;0.235)			TGGGACACAGCTGGGCAGGAG	0.502																																					p.A77V													.	RAB5B	22		0			c.C230T												161.0	134.0	143.0					12																	56383797		2203	4300	6503	SO:0001583	missense	5869	exon3			ACACAGCTGGGCA		CCDS8900.1, CCDS58244.1	12q13	2008-07-30						"""RAB, member RAS oncogene"""	9784	protein-coding gene	gene with protein product		179514				1541686, 10403367	Standard	NM_001252037		Approved		uc001siw.3	P61020		ENST00000360299.5:c.230C>T	12.37:g.56383797C>T	ENSP00000353444:p.Ala77Val		Somatic	285	0	0		WXS	Illumina HiSeq	Phase_I	429	0.02	7	NM_002868	49	0.00	0	A8K982|B4DKD7|P35239|P35277|Q6PIK9|Q86TH0|Q8IXL2	Missense_Mutation	SNP	ENST00000360299.5	37	CCDS8900.1	.	.	.	.	.	.	.	.	.	.	C	34	5.292363	0.95546	.	.	ENSG00000111540	ENST00000553116;ENST00000360299;ENST00000548068;ENST00000551459;ENST00000448789	D;D;D;D;D	0.88818	-2.43;-2.43;-2.43;-2.43;-2.43	4.66	4.66	0.58398	Small GTP-binding protein domain (1);	0.000000	0.64402	D	0.000012	D	0.96411	0.8829	H	0.96604	3.85	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.80764	0.99;0.994	D	0.97670	1.0166	10	0.87932	D	0	-6.5585	16.8397	0.85965	0.0:1.0:0.0:0.0	.	77;77	B4DKD7;P61020	.;RAB5B_HUMAN	V	77	ENSP00000450168:A77V;ENSP00000353444:A77V;ENSP00000447895:A77V;ENSP00000449554:A77V;ENSP00000391319:A77V	ENSP00000353444:A77V	A	+	2	0	RAB5B	54670064	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.606000	0.82863	2.599000	0.87857	0.585000	0.79938	GCT			0.502	RAB5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000405396.1			
CCDC64	92558	broad.mit.edu;bcgsc.ca	37	12	120427911	120427911	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr12:120427911C>T	ENST00000397558.2	+	1	239	c.239C>T	c.(238-240)cCt>cTt	p.P80L		NM_207311.2	NP_997194.2	Q6ZP65	BICR1_HUMAN	coiled-coil domain containing 64	80				Missing (in Ref. 1; BAC85259). {ECO:0000305}.	Golgi to secretory granule transport (GO:0055107)|neuron projection development (GO:0031175)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	dynactin binding (GO:0034452)|Rab GTPase binding (GO:0017137)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	22	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CAGGCCGAGCCTGGGTCTCTG	0.726																																					p.P80L													.	CCDC64	40		0			c.C239T												2.0	3.0	3.0					12																	120427911		1394	3370	4764	SO:0001583	missense	92558	exon1			CCGAGCCTGGGTC	U88834, AK129960	CCDS41845.1	12q24.23	2006-01-24				ENSG00000135127			28095	protein-coding gene	gene with protein product							Standard	NM_207311		Approved	FLJ26450	uc001txl.1	Q6ZP65	OTTHUMG00000169311	ENST00000397558.2:c.239C>T	12.37:g.120427911C>T	ENSP00000380690:p.Pro80Leu		Somatic	60	0.0166666667	1		WXS	Illumina HiSeq	Phase_I	74	0.31	23	NM_207311	2	1.00	2	A8MUC8|B4DWL0|B5MDJ0|O95000	Missense_Mutation	SNP	ENST00000397558.2	37	CCDS41845.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.17|11.17	1.560274|1.560274	0.27827|0.27827	.|.	.|.	ENSG00000135127|ENSG00000135127	ENST00000357093|ENST00000397558	.|T	.|0.31510	.|1.49	4.11|4.11	3.21|3.21	0.36854|0.36854	.|.	.|0.912281	.|0.08862	.|U	.|0.882936	.|T	.|0.17280	.|0.0415	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	.|B	.|0.06786	.|0.001	.|B	.|0.06405	.|0.002	.|T	.|0.04467	.|-1.0949	.|10	.|0.62326	.|D	.|0.03	.|5.0E-4	7.5743|7.5743	0.27926|0.27926	0.0:0.7364:0.1668:0.0968|0.0:0.7364:0.1668:0.0968	.|.	.|80	.|Q6ZP65	.|BICR1_HUMAN	.|L	-1|80	.|ENSP00000380690:P80L	.|ENSP00000380690:P80L	.|P	+|+	.|2	.|0	CCDC64|CCDC64	118912294|118912294	0.004000|0.004000	0.15560|0.15560	0.896000|0.896000	0.35187|0.35187	0.448000|0.448000	0.32197|0.32197	0.681000|0.681000	0.25320|0.25320	0.737000|0.737000	0.32582|0.32582	0.558000|0.558000	0.71614|0.71614	.|CCT			0.726	CCDC64-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000403390.2		NM_207311	
PARP4	143	mdanderson.org	37	13	25052312	25052312	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr13:25052312G>T	ENST00000381989.3	-	13	1656	c.1551C>A	c.(1549-1551)gaC>gaA	p.D517E		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	517	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		TTAAGGAAAAGTCCTTCTCAT	0.473																																					p.D517E													.	.			0			c.C1551A												110.0	90.0	97.0					13																	25052312		2203	4300	6503	SO:0001583	missense	143	exon13			GGAAAAGTCCTTC	AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.1551C>A	13.37:g.25052312G>T	ENSP00000371419:p.Asp517Glu		Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_006437	8	0.00	0	O75903|Q14682|Q5QNZ9|Q9H1M6	Missense_Mutation	SNP	ENST00000381989.3	37	CCDS9307.1	.	.	.	.	.	.	.	.	.	.	G	13.35	2.210393	0.39003	.	.	ENSG00000102699	ENST00000381989	T	0.13901	2.55	3.91	2.65	0.31530	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.061993	0.64402	D	0.000008	T	0.31765	0.0807	M	0.75884	2.315	0.28209	N	0.927038	D	0.76494	0.999	D	0.85130	0.997	T	0.04509	-1.0946	10	0.72032	D	0.01	-8.559	7.0948	0.25303	0.2268:0.0:0.7732:0.0	.	517	Q9UKK3	PARP4_HUMAN	E	517	ENSP00000371419:D517E	ENSP00000371419:D517E	D	-	3	2	PARP4	23950312	1.000000	0.71417	0.436000	0.26797	0.195000	0.23768	0.920000	0.28705	0.872000	0.35775	0.644000	0.83932	GAC			0.473	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044189.1		NM_006437	
MCF2L	23263	mdanderson.org	37	13	113718631	113718631	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr13:113718631G>T	ENST00000375608.3	+	7	651	c.593G>T	c.(592-594)aGc>aTc	p.S198I	MCF2L_ENST00000421756.1_Missense_Mutation_p.S172I|MCF2L_ENST00000375604.2_Missense_Mutation_p.S225I|MCF2L_ENST00000423482.2_Missense_Mutation_p.S166I|MCF2L_ENST00000375597.4_Missense_Mutation_p.S166I|MCF2L_ENST00000397030.1_Missense_Mutation_p.S201I|MCF2L_ENST00000442652.2_Missense_Mutation_p.S198I|MCF2L_ENST00000375601.3_Missense_Mutation_p.S172I|MCF2L_ENST00000535094.2_Missense_Mutation_p.S168I|MCF2L_ENST00000434480.2_Missense_Mutation_p.S174I			O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming sequence-like	198	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular space (GO:0005615)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			kidney(1)|large_intestine(5)|ovary(1)|stomach(1)	8	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				ATAATGCTGAGCTCCGTACCA	0.567																																					p.S168I													.	.			0			c.G503T												170.0	137.0	148.0					13																	113718631		2203	4300	6503	SO:0001583	missense	23263	exon6			TGCTGAGCTCCGT	AB002360	CCDS9527.2, CCDS45070.1, CCDS9527.3, CCDS45070.2	13q34	2013-01-10			ENSG00000126217	ENSG00000126217		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14576	protein-coding gene	gene with protein product		609499				9205841	Standard	NM_001112732		Approved	KIAA0362, DBS, OST, ARHGEF14	uc010tjr.2	O15068	OTTHUMG00000017377	ENST00000375608.3:c.593G>T	13.37:g.113718631G>T	ENSP00000364758:p.Ser198Ile		Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_001112732	5	0.00	0	A2A2X1|A2A2X2|A2A3G6|A2A3G8|B4DHD6|B4DIL6|E9PDN8|Q5JU56|Q5VXT1|Q6ZWD4|Q765G8|Q765G9|Q8N679	Missense_Mutation	SNP	ENST00000375608.3	37		.	.	.	.	.	.	.	.	.	.	G	16.49	3.138263	0.56936	.	.	ENSG00000126217	ENST00000375608;ENST00000442652;ENST00000375604;ENST00000397030;ENST00000430480;ENST00000535094;ENST00000421756;ENST00000375601;ENST00000434480;ENST00000423482;ENST00000375597;ENST00000423251;ENST00000440749	T;T;T;T;T;T;T;T;T;T;T	0.61392	2.52;2.52;2.52;2.52;2.52;2.52;2.52;2.52;2.52;2.52;0.11	5.26	5.26	0.73747	Cellular retinaldehyde-binding/triple function, C-terminal (3);	0.127500	0.64402	D	0.000001	T	0.72003	0.3407	M	0.66939	2.045	0.46564	D	0.999106	D;D;D;D;D;D	0.69078	0.996;0.996;0.996;0.993;0.996;0.997	D;D;D;D;D;D	0.70227	0.945;0.945;0.945;0.956;0.956;0.968	T	0.74844	-0.3526	10	0.87932	D	0	.	12.2614	0.54652	0.0777:0.0:0.9223:0.0	.	166;168;225;130;166;198	E9PDN8;O15068-9;G5E9A1;E2QRA2;O15068-4;O15068	.;.;.;.;.;MCF2L_HUMAN	I	198;198;225;201;168;168;172;172;174;166;166;88;9	ENSP00000364758:S198I;ENSP00000401422:S198I;ENSP00000364754:S225I;ENSP00000380225:S201I;ENSP00000440374:S168I;ENSP00000397285:S172I;ENSP00000364751:S172I;ENSP00000407722:S174I;ENSP00000405639:S166I;ENSP00000364747:S166I;ENSP00000405996:S88I	ENSP00000364747:S166I	S	+	2	0	MCF2L	112766632	1.000000	0.71417	1.000000	0.80357	0.178000	0.23041	6.173000	0.71937	2.456000	0.83038	0.555000	0.69702	AGC			0.567	MCF2L-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000045849.4			
NFATC4	4776	broad.mit.edu	37	14	24841659	24841659	+	Silent	SNP	A	A	C			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr14:24841659A>C	ENST00000250373.4	+	3	1350	c.1209A>C	c.(1207-1209)ctA>ctC	p.L403L	NFATC4_ENST00000554473.1_5'Flank|NFATC4_ENST00000554050.1_Silent_p.L403L|NFATC4_ENST00000539237.2_Silent_p.L435L|NFATC4_ENST00000553708.1_Silent_p.L403L|NFATC4_ENST00000553469.1_Silent_p.L435L|NFATC4_ENST00000555393.1_5'Flank|NFATC4_ENST00000555453.1_Silent_p.L391L|NFATC4_ENST00000554661.1_Silent_p.L333L|NFATC4_ENST00000556279.1_Silent_p.L435L|NFATC4_ENST00000557767.1_5'Flank|NFATC4_ENST00000554966.1_Silent_p.L416L|NFATC4_ENST00000422617.3_Silent_p.L391L|NFATC4_ENST00000555590.1_Silent_p.L416L|NFATC4_ENST00000554591.1_Silent_p.L466L|NFATC4_ENST00000555802.1_5'Flank|NFATC4_ENST00000556759.1_5'Flank|NFATC4_ENST00000557451.1_Silent_p.L333L|NFATC4_ENST00000555167.1_5'Flank|NFATC4_ENST00000554344.1_Silent_p.L333L|NFATC4_ENST00000553879.1_Silent_p.L333L|NFATC4_ENST00000424781.2_Silent_p.L416L|NFATC4_ENST00000413692.2_Silent_p.L466L|NFATC4_ENST00000556169.1_Silent_p.L391L	NM_004554.4	NP_004545.2	Q14934	NFAC4_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4	403	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				cellular respiration (GO:0045333)|cellular response to lithium ion (GO:0071285)|cellular response to UV (GO:0034644)|heart development (GO:0007507)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of synaptic plasticity (GO:0048167)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription coactivator activity (GO:0003713)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(7)|liver(4)|lung(12)|ovary(1)|skin(2)	34				GBM - Glioblastoma multiforme(265;0.018)		CCTCTGCCCTACCCCCACTGG	0.612																																					p.L466L													.	NFATC4	115		0			c.A1398C												46.0	50.0	48.0					14																	24841659		2203	4300	6503	SO:0001819	synonymous_variant	4776	exon4			TGCCCTACCCCCA	BC053855	CCDS9629.1, CCDS45089.1, CCDS55909.1, CCDS55910.1, CCDS55911.1, CCDS73625.1	14q11.2	2009-11-24			ENSG00000100968	ENSG00000100968		"""Nuclear factor of activated T-cells"""	7778	protein-coding gene	gene with protein product		602699				7749981	Standard	NM_004554		Approved	NFAT3	uc010tok.2	Q14934	OTTHUMG00000029351	ENST00000250373.4:c.1209A>C	14.37:g.24841659A>C			Somatic	59	0.1355932203	8		WXS	Illumina HiSeq	Phase_I	46	0.22	10	NM_001198967	1	1.00	1	B4DDG5|B4DY55|B5B2U7|B5B2U8|B5B2U9|B5B2V0|B5B2V1|B5B2V2|B5B2V3|B5B2V4|B5B2V5|B5B2V7|B5B2V8|B5B2V9|B5B2W0|B5B2W1|B5B2W2|B5B2W3|B5B2W4|B5B2W5|B5B2W6|B5B2W7|B5B2W8|B5B2W9|B5B2X0|Q7Z598|Q96H68	Silent	SNP	ENST00000250373.4	37	CCDS9629.1																																																																																					0.612	NFATC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000073206.6		NM_004554	
ATXN3	4287	hgsc.bcm.edu	37	14	92537354	92537355	+	In_Frame_Ins	INS	-	-	CTGCTGCTGCTGCTGCTGCTG	rs12895357	byFrequency	TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr14:92537354_92537355insCTGCTGCTGCTGCTGCTGCTG	ENST00000532032.1	-	10	924_925	c.915_916insCAGCAGCAGCAGCAGCAGCAG	c.(913-918)cagggg>cagCAGCAGCAGCAGCAGCAGCAGggg	p.304_305insQQQQQQQ	ATXN3_ENST00000340660.6_In_Frame_Ins_p.249_250insQQQQQQQ|ATXN3_ENST00000545170.1_In_Frame_Ins_p.313_314insQQQQQQQ|ATXN3_ENST00000393287.5_In_Frame_Ins_p.304_305insQQQQQQQ|ATXN3_ENST00000554491.1_5'UTR|ATXN3_ENST00000429774.2_In_Frame_Ins_p.297_298insQQQQQQQ|ATXN3_ENST00000502250.1_In_Frame_Ins_p.125_126insQQQQQQQ|ATXN3_ENST00000503767.1_In_Frame_Ins_p.289_290insQQQQQQQ			P54252	ATX3_HUMAN	ataxin 3	304	Poly-Gln.				actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|cellular response to misfolded protein (GO:0071218)|intermediate filament cytoskeleton organization (GO:0045104)|microtubule cytoskeleton organization (GO:0000226)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|monoubiquitinated protein deubiquitination (GO:0035520)|nervous system development (GO:0007399)|nucleotide-excision repair (GO:0006289)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of cell-substrate adhesion (GO:0010810)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATPase binding (GO:0051117)|identical protein binding (GO:0042802)|Lys48-specific deubiquitinase activity (GO:1990380)|Lys63-specific deubiquitinase activity (GO:0061578)|omega peptidase activity (GO:0008242)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.G306R(1)		endometrium(2)|large_intestine(1)|lung(7)|prostate(1)|stomach(1)	12		all_cancers(154;0.0768)		COAD - Colon adenocarcinoma(157;0.224)		GATAGGTCCCCctgctgctgct	0.446																																					p.G306delinsQQQQQQQG	Esophageal Squamous(190;752 2094 29897 44875 49530)												ATXN3,NS,carcinoma,0,7	ATXN3	46		1	Substitution - Missense(1)	lung(1)	c.916_917insCAGCAGCAGCAGCAGCAGCAG																																									SO:0001652	inframe_insertion	4287	exon10			GGTCCCCCTGCTG	U64820	CCDS9900.1, CCDS32143.1, CCDS45154.1, CCDS53908.1, CCDS73680.1	14q21	2014-09-17	2004-08-12	2004-08-13	ENSG00000066427	ENSG00000066427		"""Ataxins"""	7106	protein-coding gene	gene with protein product		607047	"""Machado-Joseph disease (spinocerebellar ataxia 3, olivopontocerebellar ataxia 3, autosomal dominant, ataxin 3)"""	SCA3, MJD		8358439	Standard	NM_004993		Approved	ATX3, JOS	uc001yac.4	P54252	OTTHUMG00000162212	ENST00000532032.1:c.895_915dupCAGCAGCAGCAGCAGCAGCAG	14.37:g.92537354_92537355insCTGCTGCTGCTGCTGCTGCTG	ENSP00000437157:p.Gln298_Gln304dup		Somatic	83	0	0		WXS	Illumina HiSeq	.	60	0.00	0	NM_004993	53	0.00	0	A7LFZ5|D6RDL9|E9PB63|O15284|O15285|O15286|Q8N189|Q96TC3|Q96TC4|Q9H3N0	In_Frame_Ins	INS	ENST00000532032.1	37																																																																																						0.446	ATXN3-015	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000388065.1		NM_004993	
LOC645752	645752	broad.mit.edu	37	15	78217296	78217296	+	lincRNA	SNP	A	A	G			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr15:78217296A>G	ENST00000565869.1	+	0	706				RP11-114H24.2_ENST00000567226.1_RNA																							GTGAGTGGCAACCACCAGAAG	0.527																																					.													.	.			0			.																																											0	.			GTGGCAACCACCA																													15.37:g.78217296A>G			Somatic	117	0.0256410256	3		WXS	Illumina HiSeq	Phase_I	135	0.06	8	.	0		0		RNA	SNP	ENST00000565869.1	37																																																																																						0.527	RP11-114H24.7-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000421587.1			
TICRR	90381	broad.mit.edu	37	15	90168410	90168410	+	Silent	SNP	A	A	C			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr15:90168410A>C	ENST00000268138.7	+	20	4974	c.4869A>C	c.(4867-4869)tcA>tcC	p.S1623S	TICRR_ENST00000560985.1_Silent_p.S1622S|KIF7_ENST00000558928.1_Intron			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	1623					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.S1623S(1)									CCTATGTGTCACCCCCCTGCC	0.627																																					p.S1623S													C15orf42,NS,carcinoma,0,1	.		1	1	Substitution - coding silent(1)	lung(1)	c.A4869C												40.0	38.0	39.0					15																	90168410		2200	4299	6499	SO:0001819	synonymous_variant	90381	exon20			TGTGTCACCCCCC	AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.4869A>C	15.37:g.90168410A>C			Somatic	56	0.1607142857	9		WXS	Illumina HiSeq	Phase_I	67	0.16	11	NM_152259	49	0.16	8	B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Silent	SNP	ENST00000268138.7	37	CCDS10352.2																																																																																					0.627	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000312856.1		NM_152259	
TBL3	10607	mdanderson.org	37	16	2024674	2024674	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr16:2024674G>T	ENST00000568546.1	+	5	501	c.373G>T	c.(373-375)Gcc>Tcc	p.A125S		NM_006453.2	NP_006444.2	Q12788	TBL3_HUMAN	transducin (beta)-like 3	125					G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|intracellular signal transduction (GO:0035556)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)|receptor signaling protein activity (GO:0005057)			breast(1)|endometrium(2)|kidney(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	18						CACTCTGCTAGCCACAGGTAG	0.662																																					p.A125S	Melanoma(118;616 1651 35077 38081 48633)												.	.			0			c.G373T												27.0	31.0	30.0					16																	2024674		2198	4297	6495	SO:0001583	missense	10607	exon5			CTGCTAGCCACAG	U02609	CCDS10453.1	16p13.3	2013-01-10			ENSG00000183751	ENSG00000183751		"""WD repeat domain containing"""	11587	protein-coding gene	gene with protein product		605915				8307582	Standard	NM_006453		Approved	SAZD, UTP13	uc002cnu.1	Q12788	OTTHUMG00000128710	ENST00000568546.1:c.373G>T	16.37:g.2024674G>T	ENSP00000454836:p.Ala125Ser		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_006453	72	0.00	0	Q59GD6|Q8IVB7|Q96A78	Missense_Mutation	SNP	ENST00000568546.1	37	CCDS10453.1	.	.	.	.	.	.	.	.	.	.	G	32	5.146066	0.94603	.	.	ENSG00000183751	ENST00000332704	.	.	.	4.97	4.97	0.65823	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.467502	0.24454	N	0.038387	D	0.83788	0.5330	M	0.85041	2.73	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86500	0.1803	9	0.66056	D	0.02	-25.8239	17.2223	0.86961	0.0:0.0:1.0:0.0	.	125	Q12788	TBL3_HUMAN	S	125	.	ENSP00000331815:A125S	A	+	1	0	TBL3	1964675	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.375000	0.97178	2.301000	0.77427	0.561000	0.74099	GCC			0.662	TBL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250615.3		NM_006453	
FAM86A	196483	bcgsc.ca	37	16	5141852	5141852	+	Silent	SNP	C	C	T	rs540885158	byFrequency	TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr16:5141852C>T	ENST00000427587.4	-	4	353	c.285G>A	c.(283-285)gcG>gcA	p.A95A	FAM86A_ENST00000458008.4_Intron|FAM86A_ENST00000587133.1_Intron	NM_201400.2	NP_958802.1	Q96G04	FA86A_HUMAN	family with sequence similarity 86, member A	95						cytoplasm (GO:0005737)				endometrium(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	12						TCTCCGCCAGCGCTTCATACA	0.577													c|||	30	0.00599042	0.0219	0.0014	5008	,	,		19555	0.0		0.0	False		,,,				2504	0.0				p.A95A													.	FAM86A	32		0			c.G285A												45.0	43.0	44.0					16																	5141852		2197	4300	6497	SO:0001819	synonymous_variant	196483	exon4			CGCCAGCGCTTCA	BC010084	CCDS10529.1, CCDS10530.1, CCDS73823.1	16p13.3	2012-11-07			ENSG00000118894	ENSG00000118894			32221	protein-coding gene	gene with protein product		615263					Standard	NM_201400		Approved	SB153, MGC19636	uc002cyo.2	Q96G04	OTTHUMG00000129527	ENST00000427587.4:c.285G>A	16.37:g.5141852C>T			Somatic	357	0.0140056022	5		WXS	Illumina HiSeq	Phase_1	236	0.10	23	NM_201400	23	0.00	0	D3DUF0|Q96S85	Silent	SNP	ENST00000427587.4	37	CCDS10529.1																																																																																					0.577	FAM86A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251713.1		NM_201400	
SMPD3	55512	broad.mit.edu	37	16	68397765	68397767	+	In_Frame_Del	DEL	GTC	GTC	-	rs372180117		TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	GTC	GTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr16:68397765_68397767delGTC	ENST00000219334.5	-	6	2161_2163	c.1558_1560delGAC	c.(1558-1560)gacdel	p.D520del	SMPD3_ENST00000568373.1_In_Frame_Del_p.D520del|SMPD3_ENST00000566009.1_5'Flank|SMPD3_ENST00000563226.1_In_Frame_Del_p.D520del	NM_018667.3	NP_061137.1	Q9NY59	NSMA2_HUMAN	sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II)	520					cell cycle (GO:0007049)|glycosphingolipid metabolic process (GO:0006687)|hematopoietic progenitor cell differentiation (GO:0002244)|peptide hormone secretion (GO:0030072)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	Golgi cis cisterna (GO:0000137)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	Phosphatidylserine(DB00144)	GCTCCAGCTTGTCGTCTGTGCGG	0.66																																					p.520_520del													.	SMPD3	52		0			c.1558_1560del																																									SO:0001651	inframe_deletion	55512	exon6			CAGCTTGTCGTCT	AJ250460	CCDS10867.1	16q22.1	2008-02-05			ENSG00000103056	ENSG00000103056			14240	protein-coding gene	gene with protein product		605777				10823942	Standard	NM_018667		Approved	NSMASE2	uc002ewa.3	Q9NY59	OTTHUMG00000137559	ENST00000219334.5:c.1558_1560delGAC	16.37:g.68397768_68397770delGTC	ENSP00000219334:p.Asp520del		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	27	0.30	8	NM_018667	0		0	B7ZL82|Q2M1S8	In_Frame_Del	DEL	ENST00000219334.5	37	CCDS10867.1																																																																																					0.660	SMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268895.3		NM_018667	
USP32P3	347716	broad.mit.edu	37	17	20322623	20322624	+	RNA	INS	-	-	T	rs560760293	byFrequency	TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr17:20322623_20322624insT	ENST00000583574.2	+	0	333									ubiquitin specific peptidase 32 pseudogene 3																		cacccagctgattttttttttt	0.47													|||unknown(HR)	14	0.00279553	0.0053	0.0014	5008	,	,		17392	0.0		0.001	False		,,,				2504	0.0051				.													.	.			0			.																																											0	.			CAGCTGATTTTTT			17p11.2	2013-02-15			ENSG00000189423	ENSG00000189423			43576	pseudogene	pseudogene							Standard	NG_002719		Approved				OTTHUMG00000179809		17.37:g.20322634_20322634dupT			Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	35	0.20	7	.	0		0		RNA	INS	ENST00000583574.2	37																																																																																						0.470	USP32P3-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000467714.1		NG_002719	
KRT18P55	284085	broad.mit.edu	37	17	26633346	26633347	+	RNA	INS	-	-	TG	rs35679432|rs200356502	byFrequency	TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr17:26633346_26633347insTG	ENST00000577198.1	-	0	407					NR_028334.1				keratin 18 pseudogene 55																		gttgttgttgtttttttttttt	0.267																																					.													.	.			0			.																																											0	.			TTGTTGTTTTTTT			17q11.2	2013-06-25			ENSG00000265480	ENSG00000265480			26874	pseudogene	pseudogene							Standard	NR_028334		Approved		uc002has.3		OTTHUMG00000179422		17.37:g.26633346_26633347insTG			Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	16	0.38	6	.	0		0		RNA	INS	ENST00000577198.1	37																																																																																						0.267	KRT18P55-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000446194.1		NR_028334	
SLFN5	162394	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	33591734	33591734	+	Silent	SNP	A	A	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr17:33591734A>T	ENST00000299977.4	+	4	1819	c.1671A>T	c.(1669-1671)acA>acT	p.T557T	SLFN5_ENST00000542451.1_Intron	NM_144975.3	NP_659412.3	Q08AF3	SLFN5_HUMAN	schlafen family member 5	557					cell differentiation (GO:0030154)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(8)|liver(2)|lung(6)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	34		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0191)		ACCTACTGACAAATAAACAGT	0.448																																					p.T557T													.	.			0			c.A1671T												137.0	134.0	135.0					17																	33591734		2203	4300	6503	SO:0001819	synonymous_variant	162394	exon4			ACTGACAAATAAA	BX647942	CCDS32619.1	17q12	2006-04-05				ENSG00000166750			28286	protein-coding gene	gene with protein product		614952				9846487	Standard	NM_144975		Approved	MGC19764	uc002hjf.4	Q08AF3		ENST00000299977.4:c.1671A>T	17.37:g.33591734A>T			Somatic	135	0	0		WXS	Illumina HiSeq	.	126	0.13	17	NM_144975	1	0.00	0	Q08AF2|Q8WU54|Q96A82	Silent	SNP	ENST00000299977.4	37	CCDS32619.1																																																																																					0.448	SLFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000448649.2		NM_144975	
KRTAP4-6	81871	hgsc.bcm.edu	37	17	39296317	39296317	+	Silent	SNP	A	A	G			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr17:39296317A>G	ENST00000345847.4	-	1	422	c.423T>C	c.(421-423)cgT>cgC	p.R141R		NM_030976.1	NP_112238.1	Q9BYQ5	KRA46_HUMAN	keratin associated protein 4-6	141	30 X 5 AA repeats of C-C-[IRQVEL]-[SPTR]- [STVQRCP].					keratin filament (GO:0045095)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(1)|prostate(1)|urinary_tract(1)	9						agcagctgggacggcagcagG	0.672																																					p.R141R													KRTAP4-6,NS,carcinoma,-1,1	KRTAP4-6	-1	1	0			c.T423C																																									SO:0001819	synonymous_variant	81871	exon1			GCTGGGACGGCAG	AJ406938	CCDS54125.1	17q21.2	2013-06-25			ENSG00000198090	ENSG00000198090		"""Keratin associated proteins"""	18909	protein-coding gene	gene with protein product			"""keratin associated protein 4-15"""	KRTAP4-15			Standard	NM_030976		Approved	KAP4.6, KAP4.15	uc010cxk.2	Q9BYQ5	OTTHUMG00000133634	ENST00000345847.4:c.423T>C	17.37:g.39296317A>G			Somatic	68	0	0		WXS	Illumina HiSeq	.	67	0.07	5	NM_030976	0		0	Q9BYR1	Silent	SNP	ENST00000345847.4	37	CCDS54125.1																																																																																					0.672	KRTAP4-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257779.1			
KCNH4	23415	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	40323897	40323897	+	Silent	SNP	G	G	A			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr17:40323897G>A	ENST00000264661.3	-	7	1436	c.1104C>T	c.(1102-1104)gtC>gtT	p.V368V	KCNH4_ENST00000607371.1_Silent_p.V368V	NM_012285.2	NP_036417.1	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 4	368					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|urinary_tract(1)	32		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GGAGCGCAAAGACCGACATGA	0.617																																					p.V368V	NSCLC(117;707 1703 2300 21308 31858)												KCNH4,bladder,carcinoma,0,1	KCNH4	0	1	0			c.C1104T												97.0	79.0	85.0					17																	40323897		2203	4300	6503	SO:0001819	synonymous_variant	23415	exon7			CGCAAAGACCGAC	AB022698	CCDS11420.1	17q21	2012-07-05				ENSG00000089558		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6253	protein-coding gene	gene with protein product		604528				10455180, 16382104	Standard	NM_012285		Approved	Kv12.3, elk1	uc002hzb.2	Q9UQ05		ENST00000264661.3:c.1104C>T	17.37:g.40323897G>A			Somatic	111	0	0		WXS	Illumina HiSeq	.	86	0.30	26	NM_012285	0		0		Silent	SNP	ENST00000264661.3	37	CCDS11420.1																																																																																					0.617	KCNH4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000449791.2		NM_012285	
GNAL	2774	broad.mit.edu	37	18	11824997	11824997	+	Silent	SNP	G	G	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr18:11824997G>T	ENST00000423027.3	+	5	795	c.474G>T	c.(472-474)ctG>ctT	p.L158L	GNAL_ENST00000535121.1_Silent_p.L158L|GNAL_ENST00000334049.6_Silent_p.L235L|GNAL_ENST00000269162.5_Silent_p.L158L|GNAL_ENST00000590972.1_3'UTR			P38405	GNAL_HUMAN	guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type	158					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|response to amphetamine (GO:0001975)|response to caffeine (GO:0031000)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(4)|ovary(1)	12						AATACCAGCTGATTGACTGTG	0.413																																					p.L235L													.	GNAL	59		0			c.G705T												171.0	147.0	155.0					18																	11824997		2203	4300	6503	SO:0001819	synonymous_variant	2774	exon5			CCAGCTGATTGAC	AF493893	CCDS11851.1, CCDS11852.1, CCDS58614.1	18p11.22-p11.21	2003-12-17			ENSG00000141404	ENSG00000141404			4388	protein-coding gene	gene with protein product		139312				1302014	Standard	NM_182978		Approved		uc002kqc.3	P38405	OTTHUMG00000131660	ENST00000423027.3:c.474G>T	18.37:g.11824997G>T			Somatic	130	0	0		WXS	Illumina HiSeq	Phase_I	64	0.05	3	NM_182978	20	0.00	0	B7ZA26|Q86XU3	Silent	SNP	ENST00000423027.3	37	CCDS11852.1																																																																																					0.413	GNAL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254561.2		NM_182978, NM_002071	
ASXL3	80816	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	31324017	31324017	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr18:31324017C>T	ENST00000269197.5	+	12	4205	c.4205C>T	c.(4204-4206)gCg>gTg	p.A1402V		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1402					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						GATTCTGTAGCGGTCACAGAC	0.488											OREG0024911	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A1402V													.	.			0			c.C4205T												121.0	123.0	123.0					18																	31324017		1998	4160	6158	SO:0001583	missense	80816	exon12			CTGTAGCGGTCAC	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.4205C>T	18.37:g.31324017C>T	ENSP00000269197:p.Ala1402Val		Somatic	149	0	0	823	WXS	Illumina HiSeq	.	72	0.44	32	NM_030632	0		0	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	C	2.906	-0.226524	0.06022	.	.	ENSG00000141431	ENST00000269197	T	0.16073	2.37	6.17	1.27	0.21489	.	.	.	.	.	T	0.10551	0.0258	L	0.27053	0.805	0.09310	N	1	B	0.13594	0.008	B	0.06405	0.002	T	0.30909	-0.9962	9	0.37606	T	0.19	.	5.3566	0.16065	0.1245:0.5247:0.0:0.3508	.	1402	Q9C0F0	ASXL3_HUMAN	V	1402	ENSP00000269197:A1402V	ENSP00000269197:A1402V	A	+	2	0	ASXL3	29578015	0.000000	0.05858	0.000000	0.03702	0.091000	0.18340	0.307000	0.19296	0.149000	0.19098	-0.783000	0.03347	GCG			0.488	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000441865.2			
TSHZ1	10194	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	72999575	72999575	+	Missense_Mutation	SNP	C	C	T	rs370322226		TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr18:72999575C>T	ENST00000580243.1	+	2	2561	c.2213C>T	c.(2212-2214)cCg>cTg	p.P738L	TSHZ1_ENST00000322038.5_Missense_Mutation_p.P693L			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	738					anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		GACCACTCACCGGAGCCTTCC	0.592																																					p.P693L													TSHZ1,NS,lymphoid_neoplasm,0,1	TSHZ1	0	1	0			c.C2078T							C	LEU/PRO	0,4406		0,0,2203	107.0	93.0	98.0		2078	5.1	0.0	18		98	2,8598	2.2+/-6.3	0,2,4298	no	missense	TSHZ1	NM_005786.4	98	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	693/1033	72999575	2,13004	2203	4300	6503	SO:0001583	missense	10194	exon2			ACTCACCGGAGCC	AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	ENST00000580243.1:c.2213C>T	18.37:g.72999575C>T	ENSP00000464391:p.Pro738Leu		Somatic	46	0	0		WXS	Illumina HiSeq	.	32	0.25	8	NM_005786	2	0.00	0	O60534|Q4LE29|Q53EU4	Missense_Mutation	SNP	ENST00000580243.1	37		.	.	.	.	.	.	.	.	.	.	C	6.156	0.397022	0.11638	0.0	2.33E-4	ENSG00000179981	ENST00000322038	T	0.61040	0.14	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.78521	0.4296	M	0.81341	2.54	0.36106	D	0.844503	D	0.89917	1.0	D	0.64506	0.926	T	0.72100	-0.4392	10	0.87932	D	0	-31.9241	18.5502	0.91062	0.0:1.0:0.0:0.0	.	738	Q6ZSZ6	TSH1_HUMAN	L	693	ENSP00000323584:P693L	ENSP00000323584:P693L	P	+	2	0	TSHZ1	71128563	1.000000	0.71417	0.015000	0.15790	0.093000	0.18481	7.426000	0.80270	-3.609000	0.00133	-1.267000	0.01435	CCG			0.592	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000444913.1		NM_005786	
SAFB2	9667	mdanderson.org	37	19	5593989	5593989	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr19:5593989C>A	ENST00000252542.4	-	15	2384	c.2120G>T	c.(2119-2121)cGc>cTc	p.R707L		NM_014649.2	NP_055464.1	Q14151	SAFB2_HUMAN	scaffold attachment factor B2	707	Arg-rich.|Glu-rich.|Interacts with SAFB1.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;0.000228)		CTCGCGCTCGCGGTGGATGCG	0.751																																					p.R707L	Ovarian(127;888 1728 23957 44128 52668)												.	.			0			c.G2120T												6.0	6.0	6.0					19																	5593989		2060	4042	6102	SO:0001583	missense	9667	exon15			CGCTCGCGGTGGA	D50928	CCDS32879.1	19p13.3	2013-02-12				ENSG00000130254		"""RNA binding motif (RRM) containing"""	21605	protein-coding gene	gene with protein product		608066				12660241	Standard	NM_014649		Approved	KIAA0138	uc002mcd.3	Q14151		ENST00000252542.4:c.2120G>T	19.37:g.5593989C>A	ENSP00000252542:p.Arg707Leu		Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	10	0.20	2	NM_014649	67	0.00	0	B4DKG3|Q8TB13	Missense_Mutation	SNP	ENST00000252542.4	37	CCDS32879.1	.	.	.	.	.	.	.	.	.	.	C	18.70	3.679472	0.68042	.	.	ENSG00000130254	ENST00000252542	T	0.21191	2.02	4.46	4.46	0.54185	.	0.000000	0.51477	D	0.000085	T	0.40956	0.1138	L	0.51914	1.62	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.15065	-1.0450	10	0.35671	T	0.21	-14.4668	17.1287	0.86721	0.0:1.0:0.0:0.0	.	707	Q14151	SAFB2_HUMAN	L	707	ENSP00000252542:R707L	ENSP00000252542:R707L	R	-	2	0	SAFB2	5544989	0.999000	0.42202	0.071000	0.20095	0.015000	0.08874	7.537000	0.82033	2.018000	0.59344	0.543000	0.68304	CGC			0.751	SAFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000451016.1		NM_014649	
NOTCH3	4854	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	15299844	15299844	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr19:15299844G>C	ENST00000263388.2	-	8	1409	c.1334C>G	c.(1333-1335)aCg>aGg	p.T445R		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	445	EGF-like 11; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GTCGAGGCACGTGGCCTGGTT	0.657																																					p.T445R													.	NOTCH3	340		0			c.C1334G												36.0	30.0	32.0					19																	15299844		2203	4300	6503	SO:0001583	missense	4854	exon8			AGGCACGTGGCCT	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.1334C>G	19.37:g.15299844G>C	ENSP00000263388:p.Thr445Arg		Somatic	103	0.0097087379	1		WXS	Illumina HiSeq	Phase_I	86	0.19	16	NM_000435	10	0.10	1	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	37	CCDS12326.1	.	.	.	.	.	.	.	.	.	.	G	14.36	2.513531	0.44763	.	.	ENSG00000074181	ENST00000263388;ENST00000539383	D	0.92965	-3.14	4.92	3.87	0.44632	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.33199	N	0.005163	D	0.95188	0.8440	M	0.71296	2.17	0.58432	D	0.999993	D;D	0.89917	1.0;0.997	D;D	0.97110	1.0;0.996	D	0.95228	0.8340	10	0.72032	D	0.01	.	13.5553	0.61756	0.0:0.0:0.8429:0.1571	.	448;445	Q59FL3;Q9UM47	.;NOTC3_HUMAN	R	445;447	ENSP00000263388:T445R	ENSP00000263388:T445R	T	-	2	0	NOTCH3	15160844	1.000000	0.71417	0.915000	0.36163	0.006000	0.05464	9.655000	0.98512	1.061000	0.40601	-0.310000	0.09108	ACG			0.657	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465714.1		NM_000435	
ZNF536	9745	mdanderson.org	37	19	30934497	30934497	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr19:30934497G>T	ENST00000355537.3	+	2	175	c.28G>T	c.(28-30)Gtg>Ttg	p.V10L		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	10					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GTGCCTTGGAGTGTCTTCGGC	0.607																																					p.V10L													.	.			0			c.G28T												97.0	99.0	99.0					19																	30934497		2203	4300	6503	SO:0001583	missense	9745	exon2			CTTGGAGTGTCTT		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.28G>T	19.37:g.30934497G>T	ENSP00000347730:p.Val10Leu		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	31	0.10	3	NM_014717	0		0	A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	g	14.23	2.473300	0.43942	.	.	ENSG00000198597	ENST00000355537	T	0.15139	2.45	5.16	4.13	0.48395	.	0.061458	0.64402	N	0.000004	T	0.31040	0.0784	L	0.32530	0.975	0.40759	D	0.982986	D;D	0.64830	0.994;0.994	D;D	0.72625	0.978;0.978	T	0.11941	-1.0567	10	0.66056	D	0.02	-17.726	15.5526	0.76164	0.0:0.0:0.8607:0.1393	.	10;10	A7E228;O15090	.;ZN536_HUMAN	L	10	ENSP00000347730:V10L	ENSP00000347730:V10L	V	+	1	0	ZNF536	35626337	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	7.575000	0.82447	1.335000	0.45486	-0.358000	0.07595	GTG			0.607	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000459667.2		NM_014717	
APOB	338	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	21239410	21239410	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr2:21239410C>G	ENST00000233242.1	-	21	3360	c.3233G>C	c.(3232-3234)aGa>aCa	p.R1078T		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1078					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATCATTAACTCTGAGGATTGT	0.448																																					p.R1078T													.	.			0			c.G3233C												131.0	118.0	122.0					2																	21239410		2203	4300	6503	SO:0001583	missense	338	exon21			TTAACTCTGAGGA	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.3233G>C	2.37:g.21239410C>G	ENSP00000233242:p.Arg1078Thr		Somatic	235	0	0		WXS	Illumina HiSeq	.	162	0.14	23	NM_000384	0		0	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	C	9.169	1.020657	0.19433	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00753	5.74	5.03	4.15	0.48705	.	0.092240	0.44483	D	0.000456	T	0.01454	0.0047	M	0.64997	1.995	0.80722	D	1	P	0.50272	0.933	P	0.44860	0.462	T	0.66048	-0.6020	10	0.59425	D	0.04	.	10.0422	0.42164	0.0:0.8455:0.0:0.1545	.	1078	P04114	APOB_HUMAN	T	1078	ENSP00000233242:R1078T	ENSP00000233242:R1078T	R	-	2	0	APOB	21092915	0.997000	0.39634	0.998000	0.56505	0.016000	0.09150	1.294000	0.33365	1.272000	0.44329	0.561000	0.74099	AGA			0.448	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207571.1			
ZNF513	130557	mdanderson.org	37	2	27601026	27601026	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr2:27601026G>T	ENST00000323703.6	-	4	1210	c.1012C>A	c.(1012-1014)Cgc>Agc	p.R338S	ZNF513_ENST00000491924.1_Intron|ZNF513_ENST00000407879.1_Missense_Mutation_p.R276S	NM_144631.5	NP_653232.3	Q8N8E2	ZN513_HUMAN	zinc finger protein 513	338					regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			endometrium(5)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	17	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGCATGCAGCGCCCACACATG	0.647																																					p.R338S													.	.			0			c.C1012A												38.0	45.0	42.0					2																	27601026		2203	4300	6503	SO:0001583	missense	130557	exon4			TGCAGCGCCCACA	AL833946	CCDS1751.1, CCDS56114.1	2p23.3	2014-01-28			ENSG00000163795	ENSG00000163795		"""Zinc fingers, C2H2-type"""	26498	protein-coding gene	gene with protein product		613598				12477932	Standard	NM_001201459		Approved	FLJ32203, RP58	uc002rkk.3	Q8N8E2	OTTHUMG00000097783	ENST00000323703.6:c.1012C>A	2.37:g.27601026G>T	ENSP00000318373:p.Arg338Ser		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_144631	88	0.00	0	A8K3S5|B7WP71|Q3ZCU1|Q68CJ1|Q86UZ3|Q8NDL8|Q96ML3	Missense_Mutation	SNP	ENST00000323703.6	37	CCDS1751.1	.	.	.	.	.	.	.	.	.	.	G	13.29	2.192692	0.38707	.	.	ENSG00000163795	ENST00000323703;ENST00000407879	T;T	0.06608	3.32;3.28	4.99	4.99	0.66335	.	0.000000	0.52532	D	0.000068	T	0.06554	0.0168	L	0.34521	1.04	0.37607	D	0.920802	P	0.52842	0.956	B	0.42798	0.398	T	0.16958	-1.0385	10	0.62326	D	0.03	-16.6217	10.5762	0.45229	0.0882:0.0:0.9118:0.0	.	338	Q8N8E2	ZN513_HUMAN	S	338;276	ENSP00000318373:R338S;ENSP00000384874:R276S	ENSP00000318373:R338S	R	-	1	0	ZNF513	27454530	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.390000	0.59646	2.591000	0.87537	0.561000	0.74099	CGC			0.647	ZNF513-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000215026.2		NM_144631	
SPDYA	245711	broad.mit.edu	37	2	29063247	29063247	+	Silent	SNP	G	G	T	rs142885879		TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr2:29063247G>T	ENST00000334056.5	+	7	951	c.762G>T	c.(760-762)ggG>ggT	p.G254G	SPDYA_ENST00000462832.1_3'UTR|SPDYA_ENST00000379579.4_Silent_p.G254G	NM_182756.3	NP_877433.2			speedy/RINGO cell cycle regulator family member A											cervix(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9	Acute lymphoblastic leukemia(172;0.155)					ATACAGCAGGGGTGACAGAAA	0.393																																					p.G254G													.	SPDYA	41		0			c.G762T												89.0	87.0	88.0					2																	29063247		2203	4300	6503	SO:0001819	synonymous_variant	245711	exon6			AGCAGGGGTGACA	AA424209	CCDS1767.2	2p23	2013-05-08	2013-05-08	2006-03-31	ENSG00000163806	ENSG00000163806		"""Speedy homologs"""	30613	protein-coding gene	gene with protein product		614029	"""speedy homolog 1 (Drosophila)"", ""speedy homolog A (Xenopus laevis)"""	SPDY1		11980914, 12839962, 15611625	Standard	NM_182756		Approved	SPY1, Ringo3	uc002rmk.3	Q5MJ70	OTTHUMG00000074041	ENST00000334056.5:c.762G>T	2.37:g.29063247G>T			Somatic	289	0	0		WXS	Illumina HiSeq	Phase_I	268	0.02	5	NM_001142634	0		0		Silent	SNP	ENST00000334056.5	37	CCDS1767.2																																																																																					0.393	SPDYA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000157171.1		NM_182756	
CAPN13	92291	ucsc.edu;bcgsc.ca	37	2	30955408	30955408	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr2:30955408C>T	ENST00000295055.8	-	20	1999	c.1823G>A	c.(1822-1824)aGc>aAc	p.S608N	CAPN13_ENST00000534090.2_Missense_Mutation_p.S608N	NM_144575.2	NP_653176.2	Q6MZZ7	CAN13_HUMAN	calpain 13	608					proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	30	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					CAGCTCACGGCTGATGAAGAT	0.612																																					p.S608N													.	CAPN13	70		0			c.G1823A												26.0	29.0	28.0					2																	30955408		2066	4207	6273	SO:0001583	missense	92291	exon20			TCACGGCTGATGA		CCDS46252.1	2p22-p21	2008-02-05			ENSG00000162949	ENSG00000162949			16663	protein-coding gene	gene with protein product		610228				11675017	Standard	NM_144575		Approved	FLJ23523	uc021vfm.1	Q6MZZ7	OTTHUMG00000152053	ENST00000295055.8:c.1823G>A	2.37:g.30955408C>T	ENSP00000295055:p.Ser608Asn		Somatic	33	0	0		WXS	Illumina HiSeq		39	0.10	4	NM_144575	0		0	Q17RF0|Q580X1|Q8TE80	Missense_Mutation	SNP	ENST00000295055.8	37	CCDS46252.1	.	.	.	.	.	.	.	.	.	.	c	3.450	-0.112223	0.06881	.	.	ENSG00000162949	ENST00000295055;ENST00000534090	T;T	0.34072	1.38;1.38	5.61	-0.105	0.13601	EF-hand-like domain (1);	0.207700	0.56097	D	0.000021	T	0.17408	0.0418	L	0.31065	0.9	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.32561	-0.9902	10	0.02654	T	1	.	6.555	0.22456	0.0:0.4963:0.2599:0.2438	.	608	Q6MZZ7	CAN13_HUMAN	N	608	ENSP00000295055:S608N;ENSP00000431298:S608N	ENSP00000295055:S608N	S	-	2	0	CAPN13	30808912	0.003000	0.15002	0.000000	0.03702	0.001000	0.01503	-0.084000	0.11268	0.034000	0.15491	-0.141000	0.14075	AGC			0.612	CAPN13-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000325101.2		NM_144575	
QPCT	25797	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	37599594	37599594	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr2:37599594C>A	ENST00000338415.3	+	6	1077	c.919C>A	c.(919-921)Cat>Aat	p.H307N	QPCT_ENST00000537448.1_Missense_Mutation_p.H258N	NM_012413.3	NP_036545.1	Q16769	QPCT_HUMAN	glutaminyl-peptide cyclotransferase	307					cellular protein modification process (GO:0006464)|peptidyl-pyroglutamic acid biosynthetic process, using glutaminyl-peptide cyclotransferase (GO:0017186)	extracellular vesicular exosome (GO:0070062)	glutaminyl-peptide cyclotransferase activity (GO:0016603)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|stomach(2)	17		Ovarian(717;0.051)|all_hematologic(82;0.21)				TCAGGATGACCATATTCCATT	0.428																																					p.H307N													.	.			0			c.C919A												155.0	152.0	153.0					2																	37599594		2203	4300	6503	SO:0001583	missense	25797	exon6			GATGACCATATTC	X71125	CCDS1790.1	2p22	2008-07-31	2008-07-31		ENSG00000115828	ENSG00000115828	2.3.2.5		9753	protein-coding gene	gene with protein product	"""glutaminyl cyclase"""	607065				7999256	Standard	NM_012413		Approved	QC, GCT	uc002rqg.3	Q16769	OTTHUMG00000100963	ENST00000338415.3:c.919C>A	2.37:g.37599594C>A	ENSP00000344829:p.His307Asn		Somatic	136	0	0		WXS	Illumina HiSeq	.	125	0.14	18	NM_012413	42	0.17	7	Q16770|Q3KRG6|Q53TR4	Missense_Mutation	SNP	ENST00000338415.3	37	CCDS1790.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.198530	0.79015	.	.	ENSG00000115828	ENST00000338415;ENST00000404976;ENST00000537448;ENST00000444022	T;T;T;T	0.55588	0.51;0.51;0.51;0.51	5.3	5.3	0.74995	Peptidase M28 (1);	0.000000	0.85682	D	0.000000	T	0.80132	0.4567	H	0.96943	3.91	0.80722	D	1	D;D	0.69078	0.996;0.997	D;D	0.71184	0.952;0.972	D	0.85695	0.1309	10	0.87932	D	0	4.0526	12.3244	0.55003	0.0:0.9211:0.0:0.0789	.	258;307	Q16769-2;Q16769	.;QPCT_HUMAN	N	307;258;258;72	ENSP00000344829:H307N;ENSP00000385391:H258N;ENSP00000441606:H258N;ENSP00000389227:H72N	ENSP00000344829:H307N	H	+	1	0	QPCT	37453098	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.284000	0.65627	2.626000	0.88956	0.563000	0.77884	CAT			0.428	QPCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000218572.2			
ARID5A	10865	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	97217882	97217882	+	Silent	SNP	G	G	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr2:97217882G>T	ENST00000357485.3	+	7	1695	c.1617G>T	c.(1615-1617)ctG>ctT	p.L539L	ARID5A_ENST00000454558.2_Silent_p.L471L	NM_212481.1	NP_997646.1	Q03989	ARI5A_HUMAN	AT rich interactive domain 5A (MRF1-like)	539					chondrocyte differentiation (GO:0002062)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)|skin(1)|urinary_tract(2)	14						CCCACTTCCTGGCCACCGCAG	0.692																																					p.L539L													.	.			0			c.G1617T												67.0	75.0	72.0					2																	97217882		2203	4299	6502	SO:0001819	synonymous_variant	10865	exon7			CTTCCTGGCCACC	M62324	CCDS33251.1	2p11.1	2013-02-07			ENSG00000196843	ENSG00000196843		"""-"""	17361	protein-coding gene	gene with protein product	"""modulator recognition factor 1"""	611583				8649988	Standard	NM_212481		Approved	MRF-1, RP11-363D14	uc002swe.3	Q03989	OTTHUMG00000155229	ENST00000357485.3:c.1617G>T	2.37:g.97217882G>T			Somatic	69	0	0		WXS	Illumina HiSeq	.	77	0.21	16	NM_212481	24	0.13	3	Q6NX37	Silent	SNP	ENST00000357485.3	37	CCDS33251.1																																																																																					0.692	ARID5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000338888.2		NM_212481	
ANKRD30BL	554226	broad.mit.edu	37	2	132919171	132919171	+	Silent	SNP	A	A	G	rs199695856		TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr2:132919171A>G	ENST00000409867.1	-	1	357	c.108T>C	c.(106-108)caT>caC	p.H36H	ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	36										endometrium(1)|kidney(3)	4						TGAGATCCCCATGGTGAATCA	0.582																																					.													.	ANKRD30BL	36		0			.																																									SO:0001819	synonymous_variant	554226	.			ATCCCCATGGTGA			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.108T>C	2.37:g.132919171A>G			Somatic	187	0.0053475936	1		WXS	Illumina HiSeq	Phase_I	161	0.05	8	.	0		0	B8ZZL7	Silent	SNP	ENST00000409867.1	37																																																																																						0.582	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000331353.2		NR_027019	
ANKRD30BL	554226	broad.mit.edu	37	2	132919192	132919192	+	Silent	SNP	G	G	A	rs111295191		TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr2:132919192G>A	ENST00000409867.1	-	1	336	c.87C>T	c.(85-87)aaC>aaT	p.N29N	ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	29										endometrium(1)|kidney(3)	4						CGTAAGAGTCGTTGTTGGTGT	0.602																																					.													.	ANKRD30BL	36		0			.																																									SO:0001819	synonymous_variant	554226	.			AGAGTCGTTGTTG			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.87C>T	2.37:g.132919192G>A			Somatic	211	0	0		WXS	Illumina HiSeq	Phase_I	182	0.03	6	.	0		0	B8ZZL7	Silent	SNP	ENST00000409867.1	37																																																																																						0.602	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000331353.2		NR_027019	
ZEB2	9839	mdanderson.org	37	2	145147409	145147409	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr2:145147409G>T	ENST00000558170.2	-	10	4438	c.3254C>A	c.(3253-3255)gCg>gAg	p.A1085E	ZEB2_ENST00000539609.3_Missense_Mutation_p.A1061E|ZEB2_ENST00000409487.3_Missense_Mutation_p.A1085E|ZEB2_ENST00000303660.4_Missense_Mutation_p.A1085E	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	1085	Glu-rich (acidic).				cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		CCGCTCCTCCGCCTCCCGCTT	0.592																																					p.A1085E	Melanoma(33;1235 1264 5755 16332)												.	.			0			c.C3254A												49.0	50.0	50.0					2																	145147409		2203	4300	6503	SO:0001583	missense	9839	exon10			TCCTCCGCCTCCC	AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.3254C>A	2.37:g.145147409G>T	ENSP00000454157:p.Ala1085Glu		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_014795	0		0	A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	ENST00000558170.2	37	CCDS2186.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.029238	0.93518	.	.	ENSG00000169554	ENST00000539609;ENST00000303660;ENST00000409487	T;T;T	0.14893	2.48;2.47;2.47	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.44973	0.1319	M	0.69823	2.125	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.998	D;P;P	0.91635	0.999;0.846;0.846	T	0.34030	-0.9845	10	0.87932	D	0	-8.0186	19.7945	0.96474	0.0:0.0:1.0:0.0	.	1061;1084;1085	F5H814;A0JP08;O60315	.;.;ZEB2_HUMAN	E	1061;1085;1085	ENSP00000443792:A1061E;ENSP00000302501:A1085E;ENSP00000386854:A1085E	ENSP00000302501:A1085E	A	-	2	0	ZEB2	144863879	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.969000	0.87988	2.746000	0.94184	0.591000	0.81541	GCG			0.592	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254778.5		NM_014795	
RBCK1	10616	ucsc.edu;bcgsc.ca	37	20	409639	409639	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr20:409639G>T	ENST00000356286.5	+	11	2058	c.1353G>T	c.(1351-1353)caG>caT	p.Q451H	RBCK1_ENST00000353660.3_Missense_Mutation_p.Q409H|RBCK1_ENST00000382181.2_Missense_Mutation_p.Q281H	NM_031229.2	NP_112506.2	Q9BYM8	HOIL1_HUMAN	RanBP-type and C3HC4-type zinc finger containing 1	451					negative regulation of necroptotic process (GO:0060546)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein linear polyubiquitination (GO:0097039)|protein polyubiquitination (GO:0000209)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	LUBAC complex (GO:0071797)	ligase activity (GO:0016874)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q409Q(1)|p.Q451Q(1)		kidney(1)|lung(4)	5		all_epithelial(17;0.172)|Lung NSC(37;0.191)|Breast(17;0.231)				CCCAGTGCCAGATCGTGGTAC	0.701																																					p.Q451H													RBCK1,NS,carcinoma,0,1	RBCK1	38	1	2	Substitution - coding silent(2)	lung(2)	c.G1353T												32.0	32.0	32.0					20																	409639		2203	4299	6502	SO:0001583	missense	10616	exon11			GTGCCAGATCGTG	U67322	CCDS12998.1, CCDS13000.2	20p13	2014-09-17	2006-06-28	2006-06-28	ENSG00000125826	ENSG00000125826		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, RAN-binding domain containing"""	15864	protein-coding gene	gene with protein product	"""heme-oxidized IRP2 ubiquitin ligase 1"""	610924	"""chromosome 20 open reading frame 18"""	C20orf18			Standard	NM_031229		Approved	RBCK2, XAP4, RNF54, ZRANB4, UBCE7IP3, HOIL1	uc002wdp.4	Q9BYM8	OTTHUMG00000031634	ENST00000356286.5:c.1353G>T	20.37:g.409639G>T	ENSP00000348632:p.Gln451His		Somatic	73	0	0		WXS	Illumina HiSeq		38	0.11	4	NM_031229	49	0.00	0	O95623|Q86SL2|Q96BS3|Q9BYM9	Missense_Mutation	SNP	ENST00000356286.5	37	CCDS13000.2	.	.	.	.	.	.	.	.	.	.	G	18.88	3.717308	0.68844	.	.	ENSG00000125826	ENST00000356286;ENST00000353660;ENST00000382181	D;D;D	0.81659	-1.52;-1.52;-1.52	5.03	3.07	0.35406	Zinc finger, C6HC-type (1);	0.525058	0.20571	N	0.089737	T	0.76933	0.4057	N	0.17800	0.525	0.80722	D	1	D;P;B	0.64830	0.994;0.508;0.173	P;B;B	0.59595	0.86;0.404;0.421	T	0.73949	-0.3821	10	0.44086	T	0.13	-2.1427	8.2866	0.31932	0.0868:0.1586:0.7546:0.0	.	281;409;451	A6PVK0;Q9BYM8-3;Q9BYM8	.;.;HOIL1_HUMAN	H	451;409;281	ENSP00000348632:Q451H;ENSP00000254960:Q409H;ENSP00000371616:Q281H	ENSP00000254960:Q409H	Q	+	3	2	RBCK1	357639	0.993000	0.37304	1.000000	0.80357	0.998000	0.95712	1.148000	0.31614	0.705000	0.31890	0.650000	0.86243	CAG			0.701	RBCK1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077461.3		NM_031229	
TRMT6	51605	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	5923280	5923280	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr20:5923280T>C	ENST00000203001.2	-	7	950	c.820A>G	c.(820-822)Atg>Gtg	p.M274V	TRMT6_ENST00000473131.1_5'UTR|TRMT6_ENST00000453074.2_Missense_Mutation_p.M104V	NM_015939.3	NP_057023.2	Q9UJA5	TRM6_HUMAN	tRNA methyltransferase 6 homolog (S. cerevisiae)	274					regulation of translational initiation (GO:0006446)|tRNA processing (GO:0008033)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(2)|endometrium(4)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)	15						GAAGATAACATCTTGGCAGAA	0.408																																					p.M274V													.	.			0			c.A820G												141.0	139.0	140.0					20																	5923280		2203	4300	6503	SO:0001583	missense	51605	exon7			ATAACATCTTGGC	AK000613	CCDS13093.1, CCDS63225.1	20p12.3	2009-01-12			ENSG00000089195	ENSG00000089195			20900	protein-coding gene	gene with protein product						16043508	Standard	NM_001281467		Approved	GCD10, MGC5029, Gcd10p, CGI-09	uc002wmh.1	Q9UJA5	OTTHUMG00000031816	ENST00000203001.2:c.820A>G	20.37:g.5923280T>C	ENSP00000203001:p.Met274Val		Somatic	208	0	0		WXS	Illumina HiSeq	.	116	0.64	74	NM_015939	57	0.49	28	B4DUV6|Q76P92|Q9BQV5|Q9ULR7|Q9Y2Z8	Missense_Mutation	SNP	ENST00000203001.2	37	CCDS13093.1	.	.	.	.	.	.	.	.	.	.	T	8.061	0.768038	0.15983	.	.	ENSG00000089195	ENST00000203001;ENST00000453074	T;T	0.20738	2.05;2.05	6.17	2.0	0.26442	.	0.366396	0.30134	N	0.010337	T	0.10551	0.0258	N	0.14661	0.345	0.24525	N	0.994142	B;B	0.12013	0.005;0.003	B;B	0.14578	0.011;0.008	T	0.33369	-0.9871	10	0.16420	T	0.52	-2.7143	9.6518	0.39902	0.0:0.4018:0.0:0.5982	.	104;274	B4DUV6;Q9UJA5	.;TRM6_HUMAN	V	274;104	ENSP00000203001:M274V;ENSP00000392070:M104V	ENSP00000203001:M274V	M	-	1	0	TRMT6	5871280	0.995000	0.38212	0.990000	0.47175	0.984000	0.73092	0.798000	0.27014	0.476000	0.27440	0.533000	0.62120	ATG			0.408	TRMT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077889.2			
TANGO2	128989	bcgsc.ca	37	22	20030887	20030887	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr22:20030887G>T	ENST00000327374.4	+	3	244	c.66G>T	c.(64-66)ttG>ttT	p.L22F	TANGO2_ENST00000432883.1_Missense_Mutation_p.L22F|TANGO2_ENST00000401886.1_Missense_Mutation_p.L22F|TANGO2_ENST00000479679.1_3'UTR|TANGO2_ENST00000434570.2_Missense_Mutation_p.L63F|TANGO2_ENST00000456048.1_Missense_Mutation_p.L27F|TANGO2_ENST00000447208.2_Missense_Mutation_p.L22F|TANGO2_ENST00000401833.1_Missense_Mutation_p.L63F|TANGO2_ENST00000420290.2_5'UTR|TANGO2_ENST00000398042.2_Missense_Mutation_p.L22F	NM_001283106.1|NM_001283116.1|NM_001283148.1|NM_001283154.1|NM_152906.4	NP_001270035.1|NP_001270045.1|NP_001270077.1|NP_001270083.1|NP_690870.3	Q6ICL3	TNG2_HUMAN	transport and golgi organization 2 homolog (Drosophila)	22																	GGCTCATCTTGGCAGCCAACA	0.512																																					p.L22F													.	TANGO2	4		0			c.G66T												130.0	132.0	132.0					22																	20030887		2203	4300	6503	SO:0001583	missense	128989	exon3			CATCTTGGCAGCC		CCDS13772.1, CCDS63404.1, CCDS63405.1, CCDS63406.1, CCDS63407.1, CCDS74821.1, CCDS74822.1	22q11.21	2012-12-13	2012-12-13	2012-12-13	ENSG00000183597	ENSG00000183597			25439	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 25"""	C22orf25		12477932	Standard	XM_005261222		Approved	DKFZp761P1121	uc002zrc.1	Q6ICL3	OTTHUMG00000150510	ENST00000327374.4:c.66G>T	22.37:g.20030887G>T	ENSP00000332721:p.Leu22Phe		Somatic	96	0	0		WXS	Illumina HiSeq	Phase_1	61	0.08	5	NM_152906	10	0.00	0	A8MUE9|B7WNV6|B7Z583|B7Z730|D3DX23|Q8IW05|Q8NAL0|Q8TCS0|Q96M16	Missense_Mutation	SNP	ENST00000327374.4	37	CCDS13772.1	.	.	.	.	.	.	.	.	.	.	G	17.38	3.376037	0.61735	.	.	ENSG00000183597	ENST00000401886;ENST00000432198;ENST00000447208;ENST00000398042;ENST00000450664;ENST00000327374;ENST00000432883;ENST00000401833;ENST00000434168;ENST00000434570;ENST00000456048	T;T;T;T;T;T;T;T;T;T;T	0.35789	1.29;1.29;1.29;1.29;1.29;1.29;1.29;1.29;1.29;1.29;1.29	4.89	1.42	0.22433	.	0.000000	0.64402	D	0.000003	T	0.55721	0.1938	M	0.87180	2.865	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.994;0.998;0.999;0.998;0.997	D;D;D;D;D;D;D	0.79784	0.988;0.993;0.954;0.98;0.989;0.979;0.943	T	0.51857	-0.8652	10	0.62326	D	0.03	-12.8091	3.1747	0.06564	0.4773:0.218:0.3047:0.0	.	22;63;22;63;22;22;22	B7Z9Q5;B7Z730;B7Z4A5;B7WNV6;Q6AHY1;Q6ICL3;Q6ICL3-2	.;.;.;.;.;CV025_HUMAN;.	F	22;22;22;22;22;22;22;63;22;63;27	ENSP00000385662:L22F;ENSP00000413850:L22F;ENSP00000389797:L22F;ENSP00000381122:L22F;ENSP00000415450:L22F;ENSP00000332721:L22F;ENSP00000402926:L22F;ENSP00000384827:L63F;ENSP00000411602:L22F;ENSP00000391262:L63F;ENSP00000403645:L27F	ENSP00000332721:L22F	L	+	3	2	C22orf25	18410887	1.000000	0.71417	0.998000	0.56505	0.866000	0.49608	3.826000	0.55738	0.107000	0.17824	-0.258000	0.10820	TTG			0.512	TANGO2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318689.2		NM_152906	
SCAP	22937	hgsc.bcm.edu	37	3	47459292	47459292	+	Silent	SNP	C	C	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr3:47459292C>T	ENST00000265565.5	-	17	2884	c.2472G>A	c.(2470-2472)gtG>gtA	p.V824V	SCAP_ENST00000465628.1_5'Flank|SCAP_ENST00000441517.2_Silent_p.V568V|SCAP_ENST00000545718.1_Silent_p.V431V	NM_012235.2	NP_036367.2	Q12770	SCAP_HUMAN	SREBF chaperone	824	Interaction with SREBF2. {ECO:0000250}.				aging (GO:0007568)|cholesterol metabolic process (GO:0008203)|negative regulation of cholesterol biosynthetic process (GO:0045541)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of fatty acid biosynthetic process (GO:0042304)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)	unfolded protein binding (GO:0051082)			endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	26				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		GCCCGCTGCCCACGCCACTGT	0.721																																					p.V824V	Pancreas(149;978 1908 29304 37806 46700)												SCAP,caecum,carcinoma,-2,1	SCAP	-2	1	0			c.G2472A												16.0	19.0	18.0					3																	47459292		2083	4114	6197	SO:0001819	synonymous_variant	22937	exon17			GCTGCCCACGCCA	BC020987	CCDS2755.2	3p21.31	2013-01-10			ENSG00000114650	ENSG00000114650		"""WD repeat domain containing"""	30634	protein-coding gene	gene with protein product	"""SREBP cleavage activating protein"""	601510				8898195, 8724849, 10570913	Standard	XM_005264967		Approved	KIAA0199	uc003crh.1	Q12770	OTTHUMG00000125539	ENST00000265565.5:c.2472G>A	3.37:g.47459292C>T			Somatic	141	0.0070921986	1		WXS	Illumina HiSeq	.	101	0.21	21	NM_012235	16	0.13	2	Q8N2E0|Q8WUA1	Silent	SNP	ENST00000265565.5	37	CCDS2755.2	.	.	.	.	.	.	.	.	.	.	c	6.114	0.389279	0.11581	.	.	ENSG00000114650	ENST00000383739	.	.	.	3.38	-0.498	0.12019	.	.	.	.	.	T	0.27524	0.0676	.	.	.	0.20821	N	0.999846	.	.	.	.	.	.	T	0.35943	-0.9768	5	0.87932	D	0	-0.001	0.5758	0.00703	0.4456:0.2181:0.1284:0.2079	.	.	.	.	R	349	.	ENSP00000373245:G349R	G	-	1	0	SCAP	47434296	0.063000	0.20901	0.008000	0.14137	0.837000	0.47467	-0.272000	0.08560	-0.076000	0.12775	-0.422000	0.05995	GGG			0.721	SCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000246872.2		NM_012235	
EPHA6	285220	hgsc.bcm.edu	37	3	97194255	97194255	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr3:97194255G>A	ENST00000514100.1	+	5	372	c.130G>A	c.(130-132)Gga>Aga	p.G44R	EPHA6_ENST00000389672.5_Missense_Mutation_p.G652R|EPHA6_ENST00000502694.1_Missense_Mutation_p.G44R|EPHA6_ENST00000442602.2_Missense_Mutation_p.G18R	NM_001278300.1	NP_001265229.1	Q9UF33	EPHA6_HUMAN	EPH receptor A6	558	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.					integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						CGCTGTTGGCGGATTCACTCT	0.428																																					p.G652R													EPHA6_ENST00000502694,extremity,malignant_melanoma,-1,2	EPHA6_ENST00000502694	-1	2	0			c.G1954A												84.0	86.0	86.0					3																	97194255		1924	4129	6053	SO:0001583	missense	285220	exon8			GTTGGCGGATTCA	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000514100.1:c.130G>A	3.37:g.97194255G>A	ENSP00000421711:p.Gly44Arg		Somatic	124	0	0		WXS	Illumina HiSeq	.	100	0.04	4	NM_001080448	1	0.00	0	D6RAL5	Missense_Mutation	SNP	ENST00000514100.1	37		.	.	.	.	.	.	.	.	.	.	G	20.7	4.028433	0.75390	.	.	ENSG00000080224	ENST00000389672;ENST00000514100;ENST00000502694;ENST00000442602	T;T;T;T	0.10763	2.84;2.84;2.84;2.84	6.07	6.07	0.98685	.	.	.	.	.	T	0.43656	0.1257	M	0.89414	3.03	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;1.0	T	0.42050	-0.9474	9	0.72032	D	0.01	.	20.2544	0.98414	0.0:0.0:1.0:0.0	.	18;557;44;44	B4DXQ6;Q9UF33;Q9UF33-2;D6RAL5	.;EPHA6_HUMAN;.;.	R	652;44;44;18	ENSP00000374323:G652R;ENSP00000421711:G44R;ENSP00000423950:G44R;ENSP00000403100:G18R	ENSP00000374323:G652R	G	+	1	0	EPHA6	98676945	1.000000	0.71417	0.972000	0.41901	0.172000	0.22775	8.689000	0.91265	2.885000	0.99019	0.655000	0.94253	GGA			0.428	EPHA6-007	NOVEL	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000359997.1		NM_001080448	
TMEM39A	55254	broad.mit.edu	37	3	119156690	119156690	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr3:119156690G>T	ENST00000319172.5	-	6	1256	c.836C>A	c.(835-837)gCa>gAa	p.A279E	TMEM39A_ENST00000486159.1_5'Flank	NM_018266.1	NP_060736.1	Q9NV64	TM39A_HUMAN	transmembrane protein 39A	279						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	13				GBM - Glioblastoma multiforme(114;0.244)		GTTGAAATCTGCTTTCAGACA	0.448																																					p.A279E													.	TMEM39A	36		0			c.C836A												128.0	112.0	117.0					3																	119156690		2203	4300	6503	SO:0001583	missense	55254	exon6			AAATCTGCTTTCA	BC021277	CCDS2987.1	3q13.33	2005-01-10			ENSG00000176142	ENSG00000176142			25600	protein-coding gene	gene with protein product						12477932	Standard	NM_018266		Approved	FLJ10902	uc003eck.2	Q9NV64	OTTHUMG00000159361	ENST00000319172.5:c.836C>A	3.37:g.119156690G>T	ENSP00000326063:p.Ala279Glu		Somatic	149	0	0		WXS	Illumina HiSeq	Phase_I	111	0.04	4	NM_018266	56	0.00	0	D3DN80|Q53FN4|Q53GI1|Q6PKB5	Missense_Mutation	SNP	ENST00000319172.5	37	CCDS2987.1	.	.	.	.	.	.	.	.	.	.	G	13.96	2.393460	0.42410	.	.	ENSG00000176142	ENST00000319172;ENST00000491685	T	0.42513	0.97	5.5	5.5	0.81552	.	0.098936	0.64402	D	0.000001	T	0.33962	0.0881	L	0.40543	1.245	0.50313	D	0.999863	B	0.31413	0.322	B	0.32342	0.144	T	0.15122	-1.0448	10	0.02654	T	1	-8.3074	18.3899	0.90479	0.0:0.0:1.0:0.0	.	279	Q9NV64	TM39A_HUMAN	E	279;125	ENSP00000326063:A279E	ENSP00000326063:A279E	A	-	2	0	TMEM39A	120639380	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.906000	0.63293	2.584000	0.87258	0.650000	0.86243	GCA			0.448	TMEM39A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000354941.3		NM_018266	
PLXND1	23129	mdanderson.org	37	3	129325111	129325111	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr3:129325111G>T	ENST00000324093.4	-	1	550	c.372C>A	c.(370-372)taC>taA	p.Y124*	PLXND1_ENST00000393239.1_Nonsense_Mutation_p.Y124*	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	124	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						GGATCTTGTTGTAGTTGTCCG	0.716																																					p.Y124X	Ovarian(97;366 1484 3738 22084 39045)												.	.			0			c.C372A												6.0	6.0	6.0					3																	129325111		2085	4103	6188	SO:0001587	stop_gained	23129	exon1			CTTGTTGTAGTTG	AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.372C>A	3.37:g.129325111G>T	ENSP00000317128:p.Tyr124*		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_015103	9	0.00	0	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Nonsense_Mutation	SNP	ENST00000324093.4	37	CCDS33854.1	.	.	.	.	.	.	.	.	.	.	g	38	6.751748	0.97813	.	.	ENSG00000004399	ENST00000324093;ENST00000393239	.	.	.	3.36	3.36	0.38483	.	0.188970	0.36519	U	0.002558	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	.	14.9375	0.70967	0.0:0.0:1.0:0.0	.	.	.	.	X	124	.	ENSP00000317128:Y124X	Y	-	3	2	PLXND1	130807801	1.000000	0.71417	1.000000	0.80357	0.702000	0.40608	8.983000	0.93477	1.745000	0.51790	0.299000	0.19835	TAC			0.716	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356132.4		NM_015103	
DOK7	285489	mdanderson.org	37	4	3494689	3494689	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr4:3494689C>T	ENST00000340083.5	+	7	1041	c.976C>T	c.(976-978)Cag>Tag	p.Q326*	DOK7_ENST00000507039.1_3'UTR|DOK7_ENST00000512714.1_3'UTR|DOK7_ENST00000389653.2_Nonsense_Mutation_p.Q326*	NM_173660.4	NP_775931.3	Q18PE1	DOK7_HUMAN	docking protein 7	326	Ser-rich.				neuromuscular junction development (GO:0007528)|positive regulation of protein tyrosine kinase activity (GO:0061098)|receptor clustering (GO:0043113)	cell junction (GO:0030054)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)			kidney(1)|large_intestine(1)|skin(2)|upper_aerodigestive_tract(1)	5				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		GCGTCCGCGGCAGCTGCAGGA	0.701																																					p.Q326X													.	.			0			c.C976T												5.0	6.0	5.0					4																	3494689		2056	4062	6118	SO:0001587	stop_gained	285489	exon7			CCGCGGCAGCTGC	AK091037	CCDS3370.2, CCDS54717.1	4p16.2	2014-09-17	2006-08-24	2006-08-24	ENSG00000175920	ENSG00000175920			26594	protein-coding gene	gene with protein product		610285	"""chromosome 4 open reading frame 25"""	C4orf25		16794080	Standard	NM_173660		Approved	FLJ33718, FLJ39137, Dok-7	uc003ghd.3	Q18PE1	OTTHUMG00000122087	ENST00000340083.5:c.976C>T	4.37:g.3494689C>T	ENSP00000344432:p.Gln326*		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	20	0.10	2	NM_173660	8	0.00	0	A2A499|A2RRD4|E9PB56|Q6P6A6|Q86XG5|Q8N2J3|Q8NBC1	Nonsense_Mutation	SNP	ENST00000340083.5	37	CCDS3370.2	.	.	.	.	.	.	.	.	.	.	C	17.26	3.343729	0.61073	.	.	ENSG00000175920	ENST00000389653;ENST00000340083	.	.	.	4.11	4.11	0.48088	.	0.470359	0.22950	N	0.053675	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-10.005	15.513	0.75798	0.0:1.0:0.0:0.0	.	.	.	.	X	326	.	ENSP00000344432:Q326X	Q	+	1	0	DOK7	3464487	1.000000	0.71417	0.996000	0.52242	0.007000	0.05969	2.832000	0.48152	2.124000	0.65301	0.561000	0.74099	CAG			0.701	DOK7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000313538.1		NM_173660	
MSX1	4487	mdanderson.org	37	4	4861868	4861868	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr4:4861868C>T	ENST00000382723.4	+	1	476	c.242C>T	c.(241-243)gCg>gTg	p.A81V		NM_002448.3	NP_002439.2	P28360	MSX1_HUMAN	msh homeobox 1	81					activation of meiosis (GO:0090427)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway involved in heart development (GO:0061312)|bone morphogenesis (GO:0060349)|cartilage morphogenesis (GO:0060536)|cell morphogenesis (GO:0000902)|cellular response to nicotine (GO:0071316)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic nail plate morphogenesis (GO:0035880)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|mammary gland epithelium development (GO:0061180)|mesenchymal cell proliferation (GO:0010463)|midbrain development (GO:0030901)|middle ear morphogenesis (GO:0042474)|muscle organ development (GO:0007517)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pituitary gland development (GO:0021983)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902255)|positive regulation of mesenchymal cell apoptotic process (GO:2001055)|protein localization to nucleus (GO:0034504)|protein stabilization (GO:0050821)|regulation of odontogenesis (GO:0042481)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			endometrium(3)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	11				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		AGCGCCCTGGCGCCCTCCGAG	0.766																																					p.A81V													.	.			0			c.C242T												5.0	7.0	6.0					4																	4861868		1531	2796	4327	SO:0001583	missense	4487	exon1			CCCTGGCGCCCTC	M97676	CCDS3378.2	4p16.2	2011-06-20	2006-11-21		ENSG00000163132	ENSG00000163132		"""Homeoboxes / ANTP class : NKL subclass"""	7391	protein-coding gene	gene with protein product		142983	"""msh (Drosophila) homeo box homolog 1 (formerly homeo box 7)"", ""msh homeobox homolog 1 (Drosophila)"""	HOX7		1685479, 1973146	Standard	NM_002448		Approved	HYD1, OFC5	uc003gif.3	P28360	OTTHUMG00000090335	ENST00000382723.4:c.242C>T	4.37:g.4861868C>T	ENSP00000372170:p.Ala81Val		Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	18	0.11	2	NM_002448	1	0.00	0	A0SZU5|A8K3M1|Q96NY4	Missense_Mutation	SNP	ENST00000382723.4	37	CCDS3378.2	.	.	.	.	.	.	.	.	.	.	C	12.18	1.859574	0.32884	.	.	ENSG00000163132	ENST00000382723	D	0.95307	-3.67	5.17	2.37	0.29283	.	0.659654	0.15920	N	0.238147	D	0.86719	0.6000	N	0.16478	0.41	0.47245	D	0.999368	B	0.02656	0.0	B	0.01281	0.0	T	0.75059	-0.3451	10	0.22706	T	0.39	-6.7835	8.1361	0.31056	0.0:0.7214:0.0:0.2786	.	75	P28360	MSX1_HUMAN	V	81	ENSP00000372170:A81V	ENSP00000372170:A81V	A	+	2	0	MSX1	4912769	0.000000	0.05858	0.970000	0.41538	0.491000	0.33493	-0.378000	0.07446	0.158000	0.19367	0.556000	0.70494	GCG			0.766	MSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206700.3			
EPHA5	2044	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	66201775	66201775	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr4:66201775C>A	ENST00000273854.3	-	16	3327	c.2727G>T	c.(2725-2727)caG>caT	p.Q909H	EPHA5_ENST00000354839.4_Missense_Mutation_p.Q887H|EPHA5_ENST00000432638.2_Missense_Mutation_p.Q746H|EPHA5_ENST00000511294.1_Missense_Mutation_p.Q910H	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	909	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						CCAGCATTAACTGATAGAGAG	0.463										TSP Lung(17;0.13)																											p.Q909H													.	.			0			c.G2727T												122.0	106.0	111.0					4																	66201775		2203	4299	6502	SO:0001583	missense	2044	exon16			CATTAACTGATAG	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.2727G>T	4.37:g.66201775C>A	ENSP00000273854:p.Gln909His		Somatic	207	0	0		WXS	Illumina HiSeq	.	270	0.07	18	NM_004439	0		0	Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	37	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	C	12.42	1.932559	0.34096	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	T;T;T;T	0.62364	0.03;0.03;0.03;0.03	5.8	-4.9	0.03094	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.56097	D	0.000030	T	0.55673	0.1935	L	0.47190	1.495	0.41676	D	0.989267	B;P;B;B	0.35050	0.084;0.482;0.069;0.231	B;B;B;B	0.39217	0.066;0.294;0.039;0.051	T	0.57648	-0.7775	10	0.72032	D	0.01	.	18.1447	0.89651	0.0:0.7375:0.0:0.2625	.	888;910;887;909	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	H	909;746;887;910	ENSP00000273854:Q909H;ENSP00000389208:Q746H;ENSP00000346899:Q887H;ENSP00000427638:Q910H	ENSP00000273854:Q909H	Q	-	3	2	EPHA5	65884370	0.003000	0.15002	0.953000	0.39169	0.431000	0.31685	-1.363000	0.02592	-0.752000	0.04728	-1.166000	0.01754	CAG			0.463	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000251388.2		NM_004439	
PALLD	23022	broad.mit.edu;ucsc.edu	37	4	169589444	169589444	+	Missense_Mutation	SNP	G	G	C	rs148155834		TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr4:169589444G>C	ENST00000505667.1	+	3	1185	c.1012G>C	c.(1012-1014)Gac>Cac	p.D338H	PALLD_ENST00000512127.1_5'UTR|PALLD_ENST00000261509.6_Missense_Mutation_p.D338H|PALLD_ENST00000333488.4_Missense_Mutation_p.D215H|PALLD_ENST00000335742.7_5'UTR			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein	338	Ig-like C2-type 1.				cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)			breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		CTTTGAGGACGACACAGGTCG	0.522									Pancreatic Cancer, Familial Clustering of																												p.D338H	Esophageal Squamous(109;1482 1532 18347 40239 51172)												PALLD,NS,carcinoma,0,1	PALLD	179	1	0			c.G1012C												153.0	137.0	143.0					4																	169589444		2203	4300	6503	SO:0001583	missense	23022	exon3	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	GAGGACGACACAG	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.1012G>C	4.37:g.169589444G>C	ENSP00000425556:p.Asp338His		Somatic	120	0.025	3		WXS	Illumina HiSeq	Phase_I	75	0.24	18	NM_001166108	0		0	B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Missense_Mutation	SNP	ENST00000505667.1	37	CCDS54818.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.961288	0.92791	.	.	ENSG00000129116	ENST00000261509;ENST00000505667;ENST00000508898;ENST00000333488	D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54	5.77	5.77	0.91146	.	0.000000	0.33712	U	0.004636	D	0.91549	0.7331	M	0.87038	2.855	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91888	0.5521	10	0.62326	D	0.03	.	19.9983	0.97395	0.0:0.0:1.0:0.0	.	338;338	B7ZMM5;B2RTX2	.;.	H	338;338;317;215	ENSP00000261509:D338H;ENSP00000425556:D338H;ENSP00000423063:D317H;ENSP00000328945:D215H	ENSP00000261509:D338H	D	+	1	0	PALLD	169826019	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.869000	0.99810	2.724000	0.93272	0.561000	0.74099	GAC			0.522	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000363762.1		NM_016081	
DAB2	1601	broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	39377194	39377194	+	Silent	SNP	A	A	G			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr5:39377194A>G	ENST00000320816.6	-	12	2162	c.1695T>C	c.(1693-1695)acT>acC	p.T565T	DAB2_ENST00000545653.1_Silent_p.T544T|DAB2_ENST00000339788.6_Silent_p.T347T|DAB2_ENST00000509337.1_Silent_p.T544T	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	565					activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			CTGGAGGGGGAGTTGAGGCTG	0.512											OREG0016586	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T565T													.	DAB2	124		0			c.T1695C												69.0	69.0	69.0					5																	39377194		2203	4300	6503	SO:0001819	synonymous_variant	1601	exon12			AGGGGGAGTTGAG	U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.1695T>C	5.37:g.39377194A>G			Somatic	214	0.0046728972	1	885	WXS	Illumina HiSeq	Phase_I	120	0.04	5	NM_001343	8	0.00	0	A6NES5|Q13598|Q9BTY0|Q9UK04	Silent	SNP	ENST00000320816.6	37	CCDS34149.1																																																																																					0.512	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000367014.1		NM_001343	
LMNB1	4001	broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	126141339	126141339	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr5:126141339G>T	ENST00000261366.5	+	3	954	c.593G>T	c.(592-594)tGt>tTt	p.C198F	LMNB1_ENST00000460265.1_3'UTR|LMNB1_ENST00000395354.1_Missense_Mutation_p.C198F	NM_001198557.1|NM_005573.3	NP_001185486.1|NP_005564.1	P20700	LMNB1_HUMAN	lamin B1	198	Coil 1B.|Rod.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	lamin filament (GO:0005638)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(142;0.103)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.033)|OV - Ovarian serous cystadenocarcinoma(64;0.0398)|all cancers(49;0.0903)		GAGAATCGTTGTCAGAGCCTT	0.373																																					p.C198F													.	LMNB1	49		0			c.G593T												133.0	139.0	137.0					5																	126141339		2203	4300	6503	SO:0001583	missense	4001	exon3			ATCGTTGTCAGAG	L37737	CCDS4140.1	5q23.2	2013-01-16			ENSG00000113368	ENSG00000113368		"""Intermediate filaments type V, lamins"""	6637	protein-coding gene	gene with protein product		150340				7557986, 8838815	Standard	NM_005573		Approved		uc003kud.2	P20700	OTTHUMG00000128969	ENST00000261366.5:c.593G>T	5.37:g.126141339G>T	ENSP00000261366:p.Cys198Phe		Somatic	112	0	0		WXS	Illumina HiSeq	Phase_I	99	0.05	5	NM_005573	280	0.00	0	B2R6J6|Q3SYN7|Q96EI6	Missense_Mutation	SNP	ENST00000261366.5	37	CCDS4140.1	.	.	.	.	.	.	.	.	.	.	G	18.82	3.704459	0.68615	.	.	ENSG00000113368	ENST00000261366;ENST00000395354	D;D	0.88586	-2.4;-2.4	4.83	4.83	0.62350	Filament (1);	0.133263	0.64402	D	0.000001	D	0.90539	0.7035	M	0.71581	2.175	0.80722	D	1	P	0.34662	0.462	B	0.41412	0.356	D	0.89761	0.3947	10	0.41790	T	0.15	.	18.8196	0.92090	0.0:0.0:1.0:0.0	.	198	P20700	LMNB1_HUMAN	F	198	ENSP00000261366:C198F;ENSP00000378761:C198F	ENSP00000261366:C198F	C	+	2	0	LMNB1	126169238	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.174000	0.50847	2.627000	0.88993	0.561000	0.74099	TGT			0.373	LMNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250956.2		NM_005573	
APBB3	10307	ucsc.edu	37	5	139937054	139937054	+	IGR	SNP	C	C	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr5:139937054C>T	ENST00000357560.4	-	0	2218				SRA1_ENST00000336283.6_Missense_Mutation_p.G7D|SRA1_ENST00000520427.1_5'UTR	NM_006051.3|NM_133173.2	NP_006042.3|NP_573419.2	O95704	APBB3_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 3							actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCCGCTTGGCCAGCGGGGCA	0.711																																					p.G7D													.	SRA1	24		0			c.G20A												7.0	8.0	8.0					5																	139937054		2127	4188	6315	SO:0001628	intergenic_variant	10011	exon1			GCTTGGCCAGCGG	AB018247	CCDS4227.1, CCDS4228.1, CCDS4229.1, CCDS47279.1	5q31	2008-02-05			ENSG00000113108	ENSG00000113108			20708	protein-coding gene	gene with protein product		602711				9407065	Standard	NM_133172		Approved	FE65L2	uc003lgd.1	O95704	OTTHUMG00000129504		5.37:g.139937054C>T			Somatic	33	0	0		WXS	Illumina HiSeq		40	0.10	4	NM_001035235	5	0.00	0	B3KQN9|Q08AG4|Q96Q18|Q9BYD4|Q9NYX6|Q9NYX7|Q9NYX8	Missense_Mutation	SNP	ENST00000357560.4	37	CCDS4229.1	.	.	.	.	.	.	.	.	.	.	C	19.58	3.854207	0.71719	.	.	ENSG00000213523	ENST00000336283	T	0.59772	0.24	4.6	3.7	0.42460	.	0.569653	0.13713	N	0.367933	T	0.40015	0.1100	N	0.22421	0.69	0.80722	D	1	B	0.21225	0.053	B	0.15484	0.013	T	0.12293	-1.0553	9	.	.	.	.	9.1968	0.37233	0.0:0.8913:0.0:0.1087	.	7	Q9HD15	SRA1_HUMAN	D	7	ENSP00000337513:G7D	.	G	-	2	0	SRA1	139917238	1.000000	0.71417	1.000000	0.80357	0.726000	0.41606	1.471000	0.35365	1.073000	0.40885	0.484000	0.47621	GGC			0.711	APBB3-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000251677.2		NM_006051	
PCDHA3	56145	mdanderson.org	37	5	140182666	140182666	+	Silent	SNP	G	G	T	rs368819593		TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr5:140182666G>T	ENST00000522353.2	+	1	1884	c.1884G>T	c.(1882-1884)acG>acT	p.T628T	PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000532566.2_Silent_p.T628T|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000520672.2_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	628	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCTGTACACGGGAGAGATCA	0.657																																					p.T628T													PCDHA3_ENST00000522353,colon,carcinoma,+1,2	PCDHA3_ENST00000522353	1	2	0			c.G1884T												78.0	77.0	77.0					5																	140182666		2203	4299	6502	SO:0001819	synonymous_variant	56145	exon1			GTACACGGGAGAG	AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.1884G>T	5.37:g.140182666G>T			Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	57	0.05	3	NM_018906	0		0	O75286	Silent	SNP	ENST00000522353.2	37	CCDS54915.1																																																																																					0.657	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000372848.2		NM_018906	
PDGFRB	5159	mdanderson.org	37	5	149502625	149502625	+	Silent	SNP	G	G	T	rs146967726		TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr5:149502625G>T	ENST00000261799.4	-	15	2632	c.2163C>A	c.(2161-2163)ccC>ccA	p.P721P		NM_002609.3	NP_002600.1	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor, beta polypeptide	721	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adrenal gland development (GO:0030325)|aorta morphogenesis (GO:0035909)|cardiac myofibril assembly (GO:0055003)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in coronary angiogenesis (GO:0060981)|cell migration involved in vasculogenesis (GO:0035441)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glycosaminoglycan biosynthetic process (GO:0006024)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerular capillary formation (GO:0072277)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|metanephric mesenchymal cell migration (GO:0035789)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to estradiol (GO:0032355)|response to fluid shear stress (GO:0034405)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to retinoic acid (GO:0032526)|response to toxic substance (GO:0009636)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|smooth muscle cell chemotaxis (GO:0071670)|smooth muscle tissue development (GO:0048745)|tissue homeostasis (GO:0001894)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet activating factor receptor activity (GO:0004992)|platelet-derived growth factor beta-receptor activity (GO:0005019)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|platelet-derived growth factor-activated receptor activity (GO:0005017)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|vascular endothelial growth factor binding (GO:0038085)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(3)|prostate(3)|skin(3)|stomach(6)|urinary_tract(1)	75		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GGAGCCCAACGGGCAGAGCAT	0.637			T	"""ETV6, TRIP11, HIP1, RAB5EP, H4, NIN, HCMOGT-1, PDE4DIP"""	"""MPD, AML, CMML, CML"""																																p.P721P				Dom	yes		5	5q31-q32	5159	"""platelet-derived growth factor receptor, beta polypeptide"""		L	.	.			0			c.C2163A												86.0	88.0	87.0					5																	149502625		2203	4300	6503	SO:0001819	synonymous_variant	5159	exon15			CCCAACGGGCAGA	M21616	CCDS4303.1	5q33.1	2013-01-29			ENSG00000113721	ENSG00000113721		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8804	protein-coding gene	gene with protein product		173410		PDGFR			Standard	XM_005268464		Approved	JTK12, CD140b, PDGFR1	uc003lro.3	P09619	OTTHUMG00000130053	ENST00000261799.4:c.2163C>A	5.37:g.149502625G>T			Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	57	0.05	3	NM_002609	7	0.00	0	B5A957|Q8N5L4	Silent	SNP	ENST00000261799.4	37	CCDS4303.1																																																																																					0.637	PDGFRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252332.1		NM_002609	
SKIV2L	6499	mdanderson.org	37	6	31931719	31931719	+	Silent	SNP	C	C	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr6:31931719C>T	ENST00000375394.2	+	16	1790	c.1677C>T	c.(1675-1677)gcC>gcT	p.A559A	SKIV2L_ENST00000544581.1_Silent_p.A366A	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	559					ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						CCCTCCTGGCCTCCCTCCGCA	0.617																																					p.A559A													.	.			0			c.C1677T												190.0	221.0	210.0					6																	31931719		1508	2708	4216	SO:0001819	synonymous_variant	6499	exon16			CCTGGCCTCCCTC		CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.1677C>T	6.37:g.31931719C>T			Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_006929	43	0.02	1	O15005|Q12902|Q15476|Q5ST66	Silent	SNP	ENST00000375394.2	37	CCDS4731.1																																																																																					0.617	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076264.3			
RUNX2	860	hgsc.bcm.edu	37	6	45390482	45390482	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr6:45390482C>G	ENST00000371438.1	+	2	569	c.211C>G	c.(211-213)Cag>Gag	p.Q71E	RUNX2_ENST00000371432.3_Missense_Mutation_p.Q57E|RUNX2_ENST00000359524.5_Missense_Mutation_p.Q57E|RUNX2_ENST00000541979.1_Missense_Mutation_p.Q139E|RUNX2_ENST00000465038.2_Missense_Mutation_p.Q71E|RP1-244F24.1_ENST00000606796.1_RNA|RUNX2_ENST00000371436.6_Missense_Mutation_p.Q71E|RUNX2_ENST00000576263.1_Missense_Mutation_p.Q71E|RUNX2_ENST00000352853.5_Missense_Mutation_p.Q139E	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	71	Poly-Gln.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						gcagcagcagcaggaggcggc	0.716																																					p.Q71E													RUNX2_ENST00000352853,NS,carcinoma,0,2	RUNX2_ENST00000352853	0	2	0			c.C211G												6.0	10.0	9.0					6																	45390482		1279	2789	4068	SO:0001583	missense	860	exon3			CAGCAGCAGGAGG	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.211C>G	6.37:g.45390482C>G	ENSP00000360493:p.Gln71Glu		Somatic	28	0	0		WXS	Illumina HiSeq	.	29	0.07	2	NM_001024630	1	0.00	0	O14614|O14615|O95181	Missense_Mutation	SNP	ENST00000371438.1	37	CCDS43467.2	.	.	.	.	.	.	.	.	.	.	C	12.60	1.985548	0.35036	.	.	ENSG00000124813	ENST00000465038;ENST00000352853;ENST00000541979;ENST00000371438;ENST00000371436;ENST00000359524;ENST00000371432	T;T;T;T;T;T;T	0.61742	0.08;0.08;0.08;0.08;0.08;0.08;0.08	3.45	3.45	0.39498	.	1.972660	0.03402	N	0.203449	T	0.19248	0.0462	N	0.14661	0.345	0.27094	N	0.962779	B;B;B	0.23806	0.033;0.055;0.091	B;B;B	0.20384	0.029;0.013;0.029	T	0.13818	-1.0495	10	0.02654	T	1	.	14.8379	0.70197	0.0:1.0:0.0:0.0	.	139;71;57	F6RGB9;Q13950;Q13950-2	.;RUNX2_HUMAN;.	E	71;139;139;71;71;57;57	ENSP00000420707:Q71E;ENSP00000319087:Q139E;ENSP00000446290:Q139E;ENSP00000360493:Q71E;ENSP00000360491:Q71E;ENSP00000352514:Q57E;ENSP00000360486:Q57E	ENSP00000319087:Q139E	Q	+	1	0	RUNX2	45498460	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	1.268000	0.33062	1.622000	0.50330	0.407000	0.27541	CAG			0.716	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000040755.2		NM_004348	
SLC25A27	9481	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	46623642	46623642	+	Silent	SNP	C	C	A	rs200951505		TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr6:46623642C>A	ENST00000371347.5	+	2	421	c.169C>A	c.(169-171)Cgg>Agg	p.R57R	SLC25A27_ENST00000452689.2_5'UTR|SLC25A27_ENST00000411689.2_Silent_p.R57R	NM_001204051.1|NM_004277.4	NP_001190980.1|NP_004268.3	O95847	UCP4_HUMAN	solute carrier family 25, member 27	57					cellular triglyceride homeostasis (GO:0035356)|generation of precursor metabolites and energy (GO:0006091)|inner ear development (GO:0048839)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mitochondrial calcium ion concentration (GO:0051562)|negative regulation of mitochondrial membrane potential (GO:0010917)|neuron death (GO:0070997)|positive regulation of cell proliferation (GO:0008284)|regulation of glucose import (GO:0046324)|transport (GO:0006810)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)				central_nervous_system(1)|kidney(1)|lung(4)|prostate(1)|urinary_tract(1)	8			Lung(136;0.192)			AGCTCTTGCTCGGTTGGGAGA	0.488																																					p.R57R													.	SLC25A27	22		0			c.C169A												82.0	83.0	82.0					6																	46623642		1871	4108	5979	SO:0001819	synonymous_variant	9481	exon2			CTTGCTCGGTTGG	AK090871	CCDS43470.1, CCDS56431.1	6p12.3	2013-05-22			ENSG00000153291	ENSG00000153291		"""Solute carriers"""	21065	protein-coding gene	gene with protein product		613725				10025957, 10772343	Standard	NM_004277		Approved	UCP4, FLJ33552	uc003oyh.3	O95847	OTTHUMG00000014786	ENST00000371347.5:c.169C>A	6.37:g.46623642C>A			Somatic	121	0.0082644628	1		WXS	Illumina HiSeq	Phase_I	113	0.21	24	NM_001204051	1	0.00	0	F5GWR4|Q5VTS9|Q8N518	Silent	SNP	ENST00000371347.5	37	CCDS43470.1																																																																																					0.488	SLC25A27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040791.1		NM_004277	
COL21A1	81578	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	56035583	56035583	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr6:56035583A>G	ENST00000244728.5	-	5	1287	c.890T>C	c.(889-891)tTa>tCa	p.L297S	COL21A1_ENST00000370819.1_Missense_Mutation_p.L297S|COL21A1_ENST00000535941.1_Missense_Mutation_p.L297S	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	297	Laminin G-like.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			TATTCTCCATAAATCCCAAAT	0.338																																					p.L297S													.	.			0			c.T890C												72.0	64.0	67.0					6																	56035583		1830	4076	5906	SO:0001583	missense	81578	exon5			CTCCATAAATCCC	AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.890T>C	6.37:g.56035583A>G	ENSP00000244728:p.Leu297Ser		Somatic	230	0	0		WXS	Illumina HiSeq	.	261	0.09	24	NM_030820	2	0.00	0	A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Missense_Mutation	SNP	ENST00000244728.5	37	CCDS55025.1	.	.	.	.	.	.	.	.	.	.	A	14.88	2.666704	0.47677	.	.	ENSG00000124749	ENST00000244728;ENST00000370819;ENST00000535941;ENST00000370811	T;T;T	0.04970	3.52;3.52;3.52	4.66	4.66	0.58398	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.000000	0.41605	D	0.000850	T	0.17619	0.0423	M	0.79926	2.475	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.961;0.994	T	0.01225	-1.1413	10	0.87932	D	0	.	14.0857	0.64954	1.0:0.0:0.0:0.0	.	297;297	Q96P44-3;Q96P44	.;COLA1_HUMAN	S	297	ENSP00000244728:L297S;ENSP00000359855:L297S;ENSP00000444384:L297S	ENSP00000244728:L297S	L	-	2	0	COL21A1	56143542	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	8.651000	0.91078	1.727000	0.51537	0.482000	0.46254	TTA			0.338	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000041004.2			
WDR27	253769	mdanderson.org	37	6	170043874	170043874	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr6:170043874G>T	ENST00000448612.1	-	17	1775	c.1666C>A	c.(1666-1668)Cag>Aag	p.Q556K	WDR27_ENST00000333572.6_Missense_Mutation_p.Q556K|WDR27_ENST00000546525.1_5'UTR|WDR27_ENST00000423258.1_Missense_Mutation_p.Q429K	NM_182552.4	NP_872358.4	A2RRH5	WDR27_HUMAN	WD repeat domain 27	526						nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	12		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)		GCCAGCCACTGCCCATCTCCT	0.428																																					p.Q556K													.	.			0			c.C1666A												38.0	43.0	41.0					6																	170043874		1840	4089	5929	SO:0001583	missense	253769	exon17			GCCACTGCCCATC	AK131435	CCDS47520.1, CCDS47520.2, CCDS56459.1	6q27	2013-01-09	2003-06-18		ENSG00000184465	ENSG00000184465		"""WD repeat domain containing"""	21248	protein-coding gene	gene with protein product							Standard	NM_182552		Approved	MGC43690	uc003qwx.3	A2RRH5	OTTHUMG00000016061	ENST00000448612.1:c.1666C>A	6.37:g.170043874G>T	ENSP00000416289:p.Gln556Lys		Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_182552	3	0.00	0	A5PLM8|C9JGV0|Q5T066	Missense_Mutation	SNP	ENST00000448612.1	37	CCDS47520.2	.	.	.	.	.	.	.	.	.	.	G	0.902	-0.721869	0.03182	.	.	ENSG00000184465	ENST00000448612;ENST00000333572;ENST00000423258	T;T;D	0.95307	5.11;1.15;-3.67	5.19	4.32	0.51571	.	0.908661	0.09240	N	0.829370	D	0.83147	0.5191	L	0.40543	1.245	0.18873	N	0.999986	B;P;B	0.43287	0.013;0.802;0.169	B;B;B	0.40677	0.014;0.337;0.03	T	0.73148	-0.4074	10	0.12430	T	0.62	-5.18	7.2837	0.26326	0.0922:0.1711:0.7367:0.0	.	556;429;556	F2Z2U5;A2RRH5-2;C9JGV0	.;.;.	K	556;556;429	ENSP00000416289:Q556K;ENSP00000330265:Q556K;ENSP00000397869:Q429K	ENSP00000330265:Q556K	Q	-	1	0	WDR27	169785799	0.005000	0.15991	0.009000	0.14445	0.335000	0.28730	1.508000	0.35769	1.184000	0.42957	0.591000	0.81541	CAG			0.428	WDR27-010	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000407334.1		NM_182552	
TNRC18	84629	broad.mit.edu	37	7	5410781	5410781	+	Silent	SNP	C	C	T	rs374062653		TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr7:5410781C>T	ENST00000430969.1	-	11	3792	c.3444G>A	c.(3442-3444)ccG>ccA	p.P1148P	TNRC18_ENST00000399537.4_Silent_p.P1148P	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1148	Pro-rich.						chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GTTCTTCCTCCGGGCCCTCCC	0.692																																					p.P1148P													.	TNRC18	311		0			c.G3444A							C		0,4002		0,0,2001	14.0	17.0	16.0		3444	-8.4	0.0	7		16	3,8293		0,3,4145	no	coding-synonymous	TNRC18	NM_001080495.2		0,3,6146	TT,TC,CC		0.0362,0.0,0.0244		1148/2969	5410781	3,12295	2001	4148	6149	SO:0001819	synonymous_variant	84629	exon11			TTCCTCCGGGCCC	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.3444G>A	7.37:g.5410781C>T			Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	116	0.03	4	NM_001080495	119	0.00	0	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	37	CCDS47534.1																																																																																					0.692	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding					
DBNL	28988	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	44098556	44098556	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr7:44098556C>A	ENST00000448521.1	+	9	907	c.809C>A	c.(808-810)aCc>aAc	p.T270N	DBNL_ENST00000456905.1_Missense_Mutation_p.T222N|DBNL_ENST00000490734.2_Missense_Mutation_p.T176N|DBNL_ENST00000497184.1_3'UTR|DBNL_ENST00000452943.1_Missense_Mutation_p.T246N|DBNL_ENST00000468694.1_Missense_Mutation_p.T279N|DBNL_ENST00000494774.1_Missense_Mutation_p.T271N|DBNL_ENST00000440166.1_Missense_Mutation_p.T167N	NM_001014436.2	NP_001014436.1	Q9UJU6	DBNL_HUMAN	drebrin-like	270					activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|endocytosis (GO:0006897)|immune system process (GO:0002376)|neuron projection morphogenesis (GO:0048812)|podosome assembly (GO:0071800)|Rac protein signal transduction (GO:0016601)|synapse assembly (GO:0007416)	cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|podosome (GO:0002102)|postsynaptic density (GO:0014069)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|enzyme activator activity (GO:0008047)			breast(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|stomach(1)	12						GCCATGTCCACCACCTCCATC	0.617																																					p.T279N	NSCLC(68;573 1327 18604 34760 37992)												.	.			0			c.C836A												106.0	94.0	98.0					7																	44098556		2203	4300	6503	SO:0001583	missense	28988	exon9			TGTCCACCACCTC	AF151364	CCDS34622.1, CCDS34623.1, CCDS47579.1, CCDS64633.1, CCDS64634.1	7p13	2004-07-22			ENSG00000136279	ENSG00000136279			2696	protein-coding gene	gene with protein product		610106				10087302	Standard	NM_014063		Approved	SH3P7, HIP-55	uc003tjq.4	Q9UJU6	OTTHUMG00000155350	ENST00000448521.1:c.809C>A	7.37:g.44098556C>A	ENSP00000411701:p.Thr270Asn		Somatic	96	0	0		WXS	Illumina HiSeq	.	101	0.20	20	NM_001122956	141	0.29	41	A4D2I9|B4DEM2|C9J7P1|P84070|Q6IAI8|Q96F30|Q96K74|Q9HBN8|Q9NR72	Missense_Mutation	SNP	ENST00000448521.1	37	CCDS34623.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	16.01|16.01|16.01	3.002288|3.002288|3.002288	0.54254|0.54254|0.54254	.|.|.	.|.|.	ENSG00000136279|ENSG00000136279|ENSG00000136279	ENST00000432854|ENST00000452661|ENST00000448521;ENST00000456905;ENST00000440166;ENST00000452943;ENST00000468694;ENST00000494774;ENST00000490734;ENST00000539475	.|.|T;T;T;T;T;T;T	.|.|0.30714	.|.|1.91;2.23;2.22;2.24;1.52;1.92;2.23	5.67|5.67|5.67	5.67|5.67|5.67	0.87782|0.87782|0.87782	.|.|.	.|.|0.543746	.|.|0.18543	.|.|N	.|.|0.138154	T|T|T	0.43523|0.43523|0.43523	0.1251|0.1251|0.1251	L|L|L	0.48362|0.48362|0.48362	1.52|1.52|1.52	0.45867|0.45867|0.45867	D|D|D	0.998723|0.998723|0.998723	.|.|D;D;B;D;B;D;D;B;P	.|.|0.67145	.|.|0.996;0.978;0.06;0.987;0.24;0.978;0.987;0.126;0.848	.|.|P;P;B;P;B;P;P;B;P	.|.|0.56916	.|.|0.719;0.649;0.05;0.698;0.123;0.649;0.809;0.05;0.549	T|T|T	0.04635|0.04635|0.04635	-1.0937|-1.0937|-1.0937	5|5|10	.|.|0.29301	.|.|T	.|.|0.29	-59.8959|-59.8959|-59.8959	16.5603|16.5603|16.5603	0.84551|0.84551|0.84551	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	.|.|167;219;200;222;176;246;279;270;271	.|.|B4DEM2;B4DXL9;B4DDU5;B4DDP6;C9J7P1;B4DDD6;Q9UJU6-3;Q9UJU6;Q9UJU6-2	.|.|.;.;.;.;.;.;.;DBNL_HUMAN;.	Q|T|N	198|10|270;222;167;246;279;271;176;200	.|.|ENSP00000411701:T270N;ENSP00000416421:T222N;ENSP00000415173:T167N;ENSP00000405343:T246N;ENSP00000417653:T279N;ENSP00000419992:T271N;ENSP00000417749:T176N	.|.|ENSP00000415173:T167N	H|P|T	+|+|+	3|1|2	2|0|0	DBNL|DBNL|DBNL	44065081|44065081|44065081	0.000000|0.000000|0.000000	0.05858|0.05858|0.05858	0.997000|0.997000|0.997000	0.53966|0.53966|0.53966	0.903000|0.903000|0.903000	0.53119|0.53119|0.53119	0.536000|0.536000|0.536000	0.23129|0.23129|0.23129	2.684000|2.684000|2.684000	0.91462|0.91462|0.91462	0.650000|0.650000|0.650000	0.86243|0.86243|0.86243	CAC|CCA|ACC			0.617	DBNL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000339572.2		NM_014063	
H2AFV	94239	mdanderson.org	37	7	44874113	44874113	+	Missense_Mutation	SNP	T	T	C	rs1802437		TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr7:44874113T>C	ENST00000308153.4	-	5	465	c.374A>G	c.(373-375)cAg>cGg	p.Q125R	H2AFV_ENST00000437072.1_Intron|H2AFV_ENST00000222690.6_Intron|H2AFV_ENST00000350771.3_Missense_Mutation_p.Q99R|H2AFV_ENST00000381124.5_3'UTR|H2AFV_ENST00000349299.3_Missense_Mutation_p.Q87R|H2AFV_ENST00000521529.1_3'UTR	NM_012412.4	NP_036544.1	Q71UI9	H2AV_HUMAN	H2A histone family, member V	125			Q -> R (in dbSNP:rs1802437).			extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|urinary_tract(1)	9						AGCAGTTTTCTGCTGTCCCTT	0.373																																					p.Q125R													.	.			0			c.A374G												90.0	79.0	83.0					7																	44874113		2203	4300	6503	SO:0001583	missense	94239	exon5			GTTTTCTGCTGTC	AF081192	CCDS5495.1, CCDS5496.1, CCDS5497.1, CCDS5498.1, CCDS47581.1	7p13	2011-01-27		2004-03-26	ENSG00000105968	ENSG00000105968		"""Histones / Replication-independent"""	20664	protein-coding gene	gene with protein product				H2AV			Standard	NM_012412		Approved	MGC10170, MGC10831, MGC1947	uc003tma.2	Q71UI9	OTTHUMG00000129217	ENST00000308153.4:c.374A>G	7.37:g.44874113T>C	ENSP00000308405:p.Gln125Arg		Somatic	133	0.007518797	1		WXS	Illumina HiSeq	Phase_I	150	0.07	10	NM_012412	1146	0.00	3	A6NFA8|A6NKY0|A6NN01|A8MQC5|Q59GV8|Q6PK98	Missense_Mutation	SNP	ENST00000308153.4	37	CCDS5496.1	.	.	.	.	.	.	.	.	.	.	T	17.73	3.461982	0.63513	.	.	ENSG00000105968	ENST00000349299;ENST00000308153;ENST00000350771	T;D;T	0.82619	0.93;-1.63;0.94	5.91	5.91	0.95273	Histone-fold (1);Histone H2A (1);	.	.	.	.	T	0.71600	0.3359	N	0.17474	0.49	0.80722	D	1	B;B;P	0.41673	0.0;0.029;0.759	B;B;B	0.37267	0.001;0.009;0.245	T	0.76405	-0.2971	9	0.59425	D	0.04	-19.8855	14.2973	0.66321	0.0:0.0:0.0:1.0	rs1802437	99;87;125	A6NKY0;A6NFA8;Q71UI9	.;.;H2AV_HUMAN	R	87;125;99	ENSP00000342714:Q87R;ENSP00000308405:Q125R;ENSP00000340708:Q99R	ENSP00000308405:Q125R	Q	-	2	0	H2AFV	44840638	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.465000	0.80898	2.261000	0.74972	0.533000	0.62120	CAG	0.001		0.373	H2AFV-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000251305.1		NM_012412	
KMT2C	58508	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	151874328	151874328	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr7:151874328delT	ENST00000262189.6	-	38	8428	c.8210delA	c.(8209-8211)aatfs	p.N2737fs	KMT2C_ENST00000355193.2_Frame_Shift_Del_p.N2737fs	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	2737	Asp-rich.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										AGTTTCCAAATTATCTAAAGT	0.368																																					p.N2737fs													.	MLL3	1564		0			c.8211delT												75.0	76.0	76.0					7																	151874328		2203	4300	6503	SO:0001589	frameshift_variant	58508	exon38			TCCAAATTATCTA	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.8210delA	7.37:g.151874328delT	ENSP00000262189:p.Asn2737fs		Somatic	97	0	0		WXS	Illumina HiSeq	.	59	0.34	20	NM_170606	1	0.00	0	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Del	DEL	ENST00000262189.6	37	CCDS5931.1																																																																																					0.368	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000318887.3			
CSMD1	64478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	8	3855559	3855559	+	Nonsense_Mutation	SNP	G	G	C	rs372509834		TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr8:3855559G>C	ENST00000520002.1	-	5	1239	c.684C>G	c.(682-684)taC>taG	p.Y228*	CSMD1_ENST00000539096.1_Nonsense_Mutation_p.Y228*|CSMD1_ENST00000542608.1_Nonsense_Mutation_p.Y228*|CSMD1_ENST00000602557.1_Nonsense_Mutation_p.Y228*|CSMD1_ENST00000537824.1_Nonsense_Mutation_p.Y228*|CSMD1_ENST00000602723.1_Nonsense_Mutation_p.Y228*|CSMD1_ENST00000400186.3_Nonsense_Mutation_p.Y228*			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	228	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CGTTGTTCTCGTACTCTGAAG	0.567																																					p.Y228X													.	.			0			c.C684G												47.0	50.0	49.0					8																	3855559		2117	4267	6384	SO:0001587	stop_gained	64478	exon5			GTTCTCGTACTCT			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.684C>G	8.37:g.3855559G>C	ENSP00000430733:p.Tyr228*		Somatic	144	0	0		WXS	Illumina HiSeq	.	117	0.11	13	NM_033225	0		0	Q0H0J5|Q96QU9|Q96RM4	Nonsense_Mutation	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	G	20.7	4.030486	0.75504	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	.	.	.	5.45	-7.76	0.01232	.	0.000000	0.27451	U	0.019319	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-26.5574	18.6326	0.91366	0.7793:0.0:0.2207:0.0	.	.	.	.	X	228;228;90;228;228;228	.	ENSP00000320445:Y90X	Y	-	3	2	CSMD1	3842967	0.009000	0.17119	0.007000	0.13788	0.012000	0.07955	-0.742000	0.04850	-1.750000	0.01328	-1.578000	0.00866	TAC			0.567	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000374500.2		NM_033225	
SULF1	23213	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	70533339	70533339	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr8:70533339C>T	ENST00000260128.4	+	14	2164	c.1447C>T	c.(1447-1449)Ctc>Ttc	p.L483F	SULF1_ENST00000521946.1_3'UTR|SULF1_ENST00000402687.4_Missense_Mutation_p.L483F|SULF1_ENST00000458141.2_Missense_Mutation_p.L483F|SULF1_ENST00000419716.3_Missense_Mutation_p.L483F	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	483					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			CAGTGACCTGCTCACAGTCCG	0.522																																					p.L483F													.	.			0			c.C1447T												86.0	86.0	86.0					8																	70533339		2203	4300	6503	SO:0001583	missense	23213	exon14			GACCTGCTCACAG	AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.1447C>T	8.37:g.70533339C>T	ENSP00000260128:p.Leu483Phe		Somatic	92	0	0		WXS	Illumina HiSeq	.	164	0.30	49	NM_001128205	0		0	Q86YV8|Q8NCA2|Q9UPS5	Missense_Mutation	SNP	ENST00000260128.4	37	CCDS6204.1	.	.	.	.	.	.	.	.	.	.	C	14.58	2.577276	0.45902	.	.	ENSG00000137573	ENST00000458141;ENST00000260128;ENST00000402687;ENST00000419716	D;D;D;D	0.98901	-5.22;-5.22;-5.22;-5.22	5.95	5.95	0.96441	Alkaline-phosphatase-like, core domain (1);	0.232981	0.44285	D	0.000466	D	0.96377	0.8818	N	0.22421	0.69	0.36162	D	0.848175	P	0.50369	0.934	P	0.47528	0.549	D	0.96033	0.9018	10	0.10111	T	0.7	.	15.1469	0.72662	0.1412:0.8588:0.0:0.0	.	483	Q8IWU6	SULF1_HUMAN	F	483	ENSP00000403040:L483F;ENSP00000260128:L483F;ENSP00000385704:L483F;ENSP00000390315:L483F	ENSP00000260128:L483F	L	+	1	0	SULF1	70695893	1.000000	0.71417	0.999000	0.59377	0.946000	0.59487	2.662000	0.46766	2.824000	0.97209	0.655000	0.94253	CTC			0.522	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378885.2		NM_015170	
UBAP2	55833	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	33953311	33953311	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr9:33953311G>A	ENST00000379238.1	-	12	1145	c.1028C>T	c.(1027-1029)gCc>gTc	p.A343V	UBAP2_ENST00000539807.1_Missense_Mutation_p.A98V|UBAP2_ENST00000449054.1_Missense_Mutation_p.A343V|SNORD121A_ENST00000459386.1_RNA|UBAP2_ENST00000379239.4_Missense_Mutation_p.A76V|UBAP2_ENST00000360802.1_Missense_Mutation_p.A343V|UBAP2_ENST00000418786.2_Missense_Mutation_p.A290V					ubiquitin associated protein 2											endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(13)|ovary(3)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		GGAGTTGACGGCAGTGGAGCT	0.443																																					p.A343V													.	.			0			c.C1028T												67.0	71.0	70.0					9																	33953311		2203	4300	6503	SO:0001583	missense	55833	exon12			TTGACGGCAGTGG	AB040924	CCDS6547.1, CCDS75828.1	9p11.2	2008-02-05			ENSG00000137073	ENSG00000137073			14185	protein-coding gene	gene with protein product						8871400	Standard	NM_018449		Approved	KIAA1491, bA176F3.5, FLJ22435	uc003ztq.1	Q5T6F2	OTTHUMG00000000427	ENST00000379238.1:c.1028C>T	9.37:g.33953311G>A	ENSP00000368540:p.Ala343Val		Somatic	164	0	0		WXS	Illumina HiSeq	.	131	0.16	21	NM_018449	48	0.25	12		Missense_Mutation	SNP	ENST00000379238.1	37	CCDS6547.1	.	.	.	.	.	.	.	.	.	.	G	8.562	0.877942	0.17395	.	.	ENSG00000137073	ENST00000379238;ENST00000449054;ENST00000360802;ENST00000431417;ENST00000379260;ENST00000379239;ENST00000539807;ENST00000418786;ENST00000412543;ENST00000421278	T;T;T;T;T;T;T	0.33216	2.7;2.7;2.7;2.4;2.39;2.14;1.42	5.85	4.02	0.46733	.	0.421503	0.30593	N	0.009293	T	0.25827	0.0629	L	0.47716	1.5	0.32604	N	0.525491	B;B;B;B;B;B;B	0.29766	0.007;0.256;0.007;0.007;0.007;0.166;0.101	B;B;B;B;B;B;B	0.20955	0.011;0.023;0.006;0.006;0.006;0.01;0.032	T	0.24225	-1.0166	10	0.36615	T	0.2	-0.4541	12.976	0.58538	0.132:0.0:0.868:0.0	.	290;268;98;76;252;268;343	E7EWG4;F5H4D5;F5H2U4;A6NCA8;F5H2C8;B4DH66;Q5T6F2	.;.;.;.;.;.;UBAP2_HUMAN	V	343;343;343;252;261;76;98;290;290;197	ENSP00000368540:A343V;ENSP00000416932:A343V;ENSP00000354039:A343V;ENSP00000368541:A76V;ENSP00000439329:A98V;ENSP00000404436:A290V;ENSP00000414800:A290V	ENSP00000354039:A343V	A	-	2	0	UBAP2	33943311	0.996000	0.38824	0.244000	0.24202	0.004000	0.04260	2.935000	0.48963	0.816000	0.34421	-0.422000	0.05995	GCC			0.443	UBAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000001071.1		NM_018449	
DOLPP1	57171	ucsc.edu	37	9	131851281	131851281	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr9:131851281C>T	ENST00000372546.4	+	8	744	c.712C>T	c.(712-714)Cag>Tag	p.Q238*	DOLPP1_ENST00000540102.1_Nonsense_Mutation_p.Q97*|DOLPP1_ENST00000406974.3_Nonsense_Mutation_p.Q195*	NM_020438.4	NP_065171.2	Q86YN1	DOPP1_HUMAN	dolichyldiphosphatase 1	238					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|lipid biosynthetic process (GO:0008610)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	dolichyldiphosphatase activity (GO:0047874)			endometrium(3)|kidney(2)|lung(7)|skin(1)	13						GACGAAACTGCAGTGACCAGT	0.587																																					p.Q238X													.	DOLPP1	17		0			c.C712T												136.0	100.0	112.0					9																	131851281		2203	4300	6503	SO:0001587	stop_gained	57171	exon8			AAACTGCAGTGAC	BC009493	CCDS6918.1, CCDS48039.1	9q34.1	2013-05-21	2013-05-21		ENSG00000167130	ENSG00000167130	3.6.1.43		29565	protein-coding gene	gene with protein product	"""linked to Surfeit genes in Fugu rubripes 2"""	614516	"""dolichyl pyrophosphate phosphatase 1"""			10369878, 12198133	Standard	NM_020438		Approved	LSFR2	uc004bxc.3	Q86YN1	OTTHUMG00000020771	ENST00000372546.4:c.712C>T	9.37:g.131851281C>T	ENSP00000361625:p.Gln238*		Somatic	47	0	0		WXS	Illumina HiSeq		37	0.11	4	NM_020438	76	0.00	0	A8K3U8|B0QZG4|Q96GF8|Q9Y3G1	Nonsense_Mutation	SNP	ENST00000372546.4	37	CCDS6918.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.391807	0.83011	.	.	ENSG00000167130	ENST00000372546;ENST00000406974;ENST00000540102	.	.	.	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.41564	D	0.98864	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-9.8899	18.1107	0.89534	0.0:1.0:0.0:0.0	.	.	.	.	X	238;195;97	.	ENSP00000361625:Q238X	Q	+	1	0	DOLPP1	130891102	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	7.433000	0.80362	2.619000	0.88677	0.561000	0.74099	CAG			0.587	DOLPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054548.4		NM_020438	
C9orf139	401563	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	139927646	139927646	+	Missense_Mutation	SNP	C	C	A	rs368472017		TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chr9:139927646C>A	ENST00000314330.2	+	2	1645	c.131C>A	c.(130-132)gCg>gAg	p.A44E	FUT7_ENST00000314412.6_5'Flank	NM_207511.1	NP_997394.1	Q6ZV77	CI139_HUMAN	chromosome 9 open reading frame 139	44										cervix(1)|lung(2)	3	all_cancers(76;0.0893)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.99e-05)|Epithelial(140;0.000493)		TGGTCCCAGGCGTGGCCAGAC	0.552																																					p.A44E													.	.			0			c.C131A							C	GLU/ALA	1,4405	2.1+/-5.4	0,1,2202	145.0	123.0	131.0		131	-0.3	0.0	9		131	0,8590		0,0,4295	no	missense	C9orf139	NM_207511.1	107	0,1,6497	AA,AC,CC		0.0,0.0227,0.0077	probably-damaging	44/191	139927646	1,12995	2203	4295	6498	SO:0001583	missense	401563	exon2			CCCAGGCGTGGCC		CCDS7023.1	9q34.3	2008-02-05			ENSG00000180539	ENSG00000180539			31426	protein-coding gene	gene with protein product							Standard	NM_207511		Approved	FLJ36268, FLJ42909	uc004ckp.1	Q6ZV77	OTTHUMG00000020959	ENST00000314330.2:c.131C>A	9.37:g.139927646C>A	ENSP00000318119:p.Ala44Glu		Somatic	103	0	0		WXS	Illumina HiSeq	.	57	0.30	17	NM_207511	0		0	A2RUA3|B9EGW2|Q5SPY0|Q8N224	Missense_Mutation	SNP	ENST00000314330.2	37	CCDS7023.1	.	.	.	.	.	.	.	.	.	.	C	4.324	0.059506	0.08339	2.27E-4	0.0	ENSG00000180539	ENST00000314330	T	0.55588	0.51	1.78	-0.292	0.12839	.	.	.	.	.	T	0.30510	0.0767	N	0.08118	0	0.09310	N	1	D	0.56968	0.978	P	0.45099	0.469	T	0.18493	-1.0335	9	0.87932	D	0	.	4.4589	0.11656	0.0:0.6171:0.0:0.3829	.	44	Q6ZV77	CI139_HUMAN	E	44	ENSP00000318119:A44E	ENSP00000318119:A44E	A	+	2	0	C9orf139	139047467	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-2.523000	0.00949	-0.075000	0.12798	0.205000	0.17691	GCG			0.552	C9orf139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055213.2		NM_207511	
MT-ND6	4541	broad.mit.edu;bcgsc.ca	37	M	14612	14612	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chrM:14612G>A	ENST00000361681.2	-	1	61	c.62C>T	c.(61-63)tCt>tTt	p.S21F	MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TL2_ENST00000387456.1_RNA			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	21					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						GAGAAGGCTTAGAAGAAAACC	0.413																																					p.S21F													.	.			0			c.C62T																																									SO:0001583	missense	4541	exon1			GGCTTAGAAGAAA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.62C>T	M.37:g.14612G>A	ENSP00000354665:p.Ser21Phe		Somatic	117	0.0085470085	1		WXS	Illumina HiSeq	Phase_I	155	0.74	114	ENST00000361681	0		0	Q34774|Q8HG30	Missense_Mutation	SNP	ENST00000361681.2	37																																																																																						0.413	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024037	
PKMP2	402408	bcgsc.ca	37	X	65718100	65718100	+	IGR	SNP	G	G	A			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chrX:65718100G>A								HEPH (229391 upstream) : EDA2R (97378 downstream)																							CCTGAAGAAGGGAGCCACTCT	0.502																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	402408	.			AAGAAGGGAGCCA																													X.37:g.65718100G>A			Somatic	17	0	0		WXS	Illumina HiSeq	Phase_1	21	0.29	6	.	0		0		RNA	SNP		37																																																																																					0	0.502										
ACTR3P2	100129013	bcgsc.ca	37	X	67992110	67992110	+	IGR	SNP	A	A	G			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chrX:67992110A>G								STARD8 (46428 upstream) : EFNB1 (56729 downstream)																							CGGCCTCTCTATAAGAATATG	0.383																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	100129013	.			CTCTCTATAAGAA																													X.37:g.67992110A>G			Somatic	84	0	0		WXS	Illumina HiSeq	Phase_1	83	0.49	41	.	0		0		RNA	SNP		37																																																																																					0	0.383										
FLNA	2316	broad.mit.edu;mdanderson.org	37	X	153589789	153589789	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGW-01A-11D-A42Y-10	TCGA-2G-AAGW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74fc9dbc-9462-4d14-ab52-51016b37351f	ec835e9e-7490-4325-8e2d-0823a9bfd9be	g.chrX:153589789G>A	ENST00000369850.3	-	21	3330	c.3094C>T	c.(3094-3096)Cgc>Tgc	p.R1032C	FLNA_ENST00000344736.4_Missense_Mutation_p.R1032C|FLNA_ENST00000422373.1_Missense_Mutation_p.R1032C|FLNA_ENST00000360319.4_Missense_Mutation_p.R1032C	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	1032					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGCAGGAAGCGCACCACACTG	0.657																																					p.R1032C													.	FLNA	373		0			c.C3094T												64.0	67.0	66.0					X																	153589789		2127	4212	6339	SO:0001583	missense	0	exon21			GGAAGCGCACCAC	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.3094C>T	X.37:g.153589789G>A	ENSP00000358866:p.Arg1032Cys		Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	80	0.05	4	NM_001456	111	0.00	0	E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	ENST00000369850.3	37	CCDS48194.1	.	.	.	.	.	.	.	.	.	.	G	19.69	3.873776	0.72180	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.85773	-2.03;-2.03;-2.03;-2.03	5.51	4.57	0.56435	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.071450	0.48767	D	0.000175	D	0.90998	0.7169	M	0.88241	2.94	0.80722	D	1	D;P	0.67145	0.996;0.952	P;P	0.57846	0.828;0.773	D	0.92051	0.5648	10	0.87932	D	0	.	10.1813	0.42970	0.0:0.0:0.5127:0.4873	.	1032;1032	P21333-2;P21333	.;FLNA_HUMAN	C	1032;1005;1032;1032;1032	ENSP00000353467:R1032C;ENSP00000416926:R1032C;ENSP00000358866:R1032C;ENSP00000358863:R1032C	ENSP00000358863:R1032C	R	-	1	0	FLNA	153242983	0.309000	0.24518	1.000000	0.80357	0.800000	0.45204	2.947000	0.49058	2.313000	0.78055	0.523000	0.50628	CGC			0.657	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000058942.3			
