#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
PLEKHN1	84069	broad.mit.edu;mdanderson.org	37	1	909421	909421	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr1:909421C>A	ENST00000379409.2	+	13	1829	c.1799C>A	c.(1798-1800)gCc>gAc	p.A600D	PLEKHN1_ENST00000379410.3_Missense_Mutation_p.A548D|PLEKHN1_ENST00000379407.3_Missense_Mutation_p.A513D			Q494U1	PKHN1_HUMAN	pleckstrin homology domain containing, family N member 1	600										central_nervous_system(1)|endometrium(3)|kidney(1)|lung(2)|skin(1)|urinary_tract(1)	9	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.93e-23)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.00095)|Kidney(185;0.0023)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.199)		CCCCCAGACGCCCCTCAGCTT	0.711																																					p.A548D													.	PLEKHN1	49		0			c.C1643A												5.0	6.0	6.0					1																	909421		2027	4076	6103	SO:0001583	missense	84069	exon14			CAGACGCCCCTCA	AL136730	CCDS4.1, CCDS53256.1	1p36.33	2013-01-11			ENSG00000187583	ENSG00000187583		"""Pleckstrin homology (PH) domain containing"""	25284	protein-coding gene	gene with protein product						11230166	Standard	NM_032129		Approved	DKFZP434H2010	uc001acd.3	Q494U1	OTTHUMG00000040756	ENST00000379409.2:c.1799C>A	1.37:g.909421C>A	ENSP00000368719:p.Ala600Asp		Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	30	0.17	5	NM_032129	0		0	Q494U2|Q5SV98|Q9H0M7	Missense_Mutation	SNP	ENST00000379409.2	37		.	.	.	.	.	.	.	.	.	.	C	3.967	-0.009207	0.07727	.	.	ENSG00000187583	ENST00000379410;ENST00000379407;ENST00000379409	T;T;T	0.44482	0.93;0.92;0.93	4.26	3.33	0.38152	.	0.620727	0.16539	N	0.210056	T	0.20333	0.0489	N	0.08118	0	0.09310	N	1	B;B;B	0.26258	0.062;0.145;0.062	B;B;B	0.18561	0.022;0.022;0.015	T	0.11494	-1.0585	10	0.36615	T	0.2	-8.8721	7.3669	0.26779	0.0:0.8759:0.0:0.1241	.	513;600;548	Q494U1-3;Q494U1;Q494U1-2	.;PKHN1_HUMAN;.	D	548;513;600	ENSP00000368720:A548D;ENSP00000368717:A513D;ENSP00000368719:A600D	ENSP00000368717:A513D	A	+	2	0	PLEKHN1	899284	0.000000	0.05858	0.008000	0.14137	0.061000	0.15899	0.663000	0.25053	1.119000	0.41883	0.472000	0.43445	GCC			0.711	PLEKHN1-005	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000473256.1		NM_032129	
ASAP3	55616	hgsc.bcm.edu;mdanderson.org	37	1	23760787	23760787	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr1:23760787G>T	ENST00000336689.3	-	19	1955	c.1911C>A	c.(1909-1911)tgC>tgA	p.C637*	ASAP3_ENST00000495646.1_Nonsense_Mutation_p.C141*|ASAP3_ENST00000437606.2_Nonsense_Mutation_p.C628*	NM_017707.3	NP_060177.2	Q8TDY4	ASAP3_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 3	637					cell migration (GO:0016477)|positive regulation of ARF GTPase activity (GO:0032850)|regulation of stress fiber assembly (GO:0051492)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	24						GCAGCTTGAGGCAGTCGGGCT	0.582																																					p.C637X													.	.			0			c.C1911A												128.0	113.0	118.0					1																	23760787		2203	4300	6503	SO:0001587	stop_gained	55616	exon19			CTTGAGGCAGTCG	AK000206	CCDS235.1, CCDS44087.1	1p36.13	2013-01-10	2008-10-09	2008-09-22	ENSG00000088280	ENSG00000088280		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	14987	protein-coding gene	gene with protein product	"""centaurin, beta 6"""		"""development and differentiation enhancing factor-like 1"""	DDEFL1		14654939	Standard	NM_017707		Approved	FLJ20199, UPLC1, CENTB6	uc001bha.2	Q8TDY4	OTTHUMG00000003234	ENST00000336689.3:c.1911C>A	1.37:g.23760787G>T	ENSP00000338769:p.Cys637*		Somatic	129	0	0		WXS	Illumina HiSeq	.	107	0.05	5	NM_017707	332	0.00	0	B3KRW0|B4DHH4|Q6P9F4|Q86UY1|Q9NXK2	Nonsense_Mutation	SNP	ENST00000336689.3	37	CCDS235.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.799197	0.90538	.	.	ENSG00000088280	ENST00000538685;ENST00000495646;ENST00000336689;ENST00000437606	.	.	.	4.0	3.08	0.35506	.	0.069931	0.56097	D	0.000039	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.4214	0.44352	0.0997:0.0:0.9003:0.0	.	.	.	.	X	160;141;637;628	.	ENSP00000338769:C637X	C	-	3	2	ASAP3	23633374	1.000000	0.71417	1.000000	0.80357	0.268000	0.26511	2.833000	0.48159	1.020000	0.39573	0.297000	0.19635	TGC			0.582	ASAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000008916.2		NM_017707	
SNRNP40	9410	mdanderson.org	37	1	31744283	31744283	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr1:31744283C>T	ENST00000263694.4	-	6	736	c.718G>A	c.(718-720)Ggc>Agc	p.G240S	SNRNP40_ENST00000373720.3_5'Flank|SNRNP40_ENST00000489853.1_5'UTR|SNRNP40_ENST00000446633.2_Missense_Mutation_p.G240S	NM_004814.2	NP_004805.2	Q96DI7	SNR40_HUMAN	small nuclear ribonucleoprotein 40kDa (U5)	240					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	7						AAACTCAGGCCAGTCACTGAA	0.453																																					p.G240S													.	.			0			c.G718A												78.0	79.0	78.0					1																	31744283		2203	4300	6503	SO:0001583	missense	9410	exon6			TCAGGCCAGTCAC	AF090988	CCDS340.1	1p35.2	2013-01-09	2008-10-29	2008-10-29	ENSG00000060688	ENSG00000060688		"""WD repeat domain containing"""	30857	protein-coding gene	gene with protein product		607797	"""WD repeat domain 57 (U5 snRNP specific)"""	WDR57		9774689, 9731529, 10788320	Standard	NM_004814		Approved	PRP8BP, SPF38, PRPF8BP, HPRP8BP	uc009vtt.3	Q96DI7	OTTHUMG00000003790	ENST00000263694.4:c.718G>A	1.37:g.31744283C>T	ENSP00000263694:p.Gly240Ser		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_004814	150	0.00	0	B4DQJ1|O75938|O95320	Missense_Mutation	SNP	ENST00000263694.4	37	CCDS340.1	.	.	.	.	.	.	.	.	.	.	C	17.81	3.480167	0.63849	.	.	ENSG00000060688	ENST00000263694;ENST00000446633	T;T	0.54479	0.57;0.57	5.76	5.76	0.90799	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.34861	0.0912	N	0.05351	-0.065	0.80722	D	1	P;B	0.37158	0.585;0.299	B;B	0.39299	0.277;0.296	T	0.25950	-1.0117	10	0.02654	T	1	.	19.9813	0.97326	0.0:1.0:0.0:0.0	.	240;240	B4DQJ1;Q96DI7	.;SNR40_HUMAN	S	240	ENSP00000263694:G240S;ENSP00000406841:G240S	ENSP00000263694:G240S	G	-	1	0	SNRNP40	31516870	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.570000	0.82390	2.726000	0.93360	0.655000	0.94253	GGC			0.453	SNRNP40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000010657.1		NM_004814	
HIVEP3	59269	broad.mit.edu	37	1	42047076	42047076	+	Silent	SNP	T	T	G			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr1:42047076T>G	ENST00000372583.1	-	4	4278	c.3393A>C	c.(3391-3393)acA>acC	p.T1131T	HIVEP3_ENST00000372584.1_Silent_p.T1131T|HIVEP3_ENST00000429157.2_Silent_p.T1131T|HIVEP3_ENST00000247584.5_Silent_p.T1131T|HIVEP3_ENST00000460604.1_5'Flank	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	1131					positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				CATGCAGGGGTGTCTGGGCAA	0.617																																					p.T1131T													.	HIVEP3	235		0			c.A3393C												86.0	94.0	92.0					1																	42047076		2203	4300	6503	SO:0001819	synonymous_variant	59269	exon4			CAGGGGTGTCTGG	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.3393A>C	1.37:g.42047076T>G			Somatic	87	0.1954022989	17		WXS	Illumina HiSeq	Phase_I	64	0.17	11	NM_024503	1	0.00	0	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Silent	SNP	ENST00000372583.1	37	CCDS463.1																																																																																					0.617	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000016978.1		NM_024503	
SEC22B	9554	broad.mit.edu	37	1	145116193	145116193	+	RNA	DEL	G	G	-	rs66989703|rs372891418	byFrequency	TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr1:145116193delG	ENST00000453618.1	+	0	1279							O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											AGCACTGGCTGGGGCATTCTC	0.428													GGGG|GGGG|GGG|deletion	1833	0.366014	0.3116	0.4294	5008	,	,		69780	0.3502		0.3847	False		,,,				2504	0.3916				.													.	.			0			.																																											9554	.			CTGGCTGGGGCAT	AF047442		1q21.1	2012-04-20	2010-03-12	2006-04-25	ENSG00000223380				10700	protein-coding gene	gene with protein product		604029	"""SEC22, vesicle trafficking protein (S. cerevisiae)-like 1"", ""SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)"", ""SEC22 vesicle trafficking protein homolog B (S. cerevisiae)"""	SEC22L1		9094723, 16354670	Standard	NM_004892		Approved	sec22b, ERS-24	uc031poa.1	O75396	OTTHUMG00000013745		1.37:g.145116193delG			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	69	0.00	0	A8K1G0	RNA	DEL	ENST00000453618.1	37																																																																																						0.428	SEC22B-001	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000038523.5		NM_004892	
SELP	6403	bcgsc.ca	37	1	169581527	169581527	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr1:169581527C>T	ENST00000263686.6	-	6	926	c.889G>A	c.(889-891)Gca>Aca	p.A297T	SELP_ENST00000367794.2_Missense_Mutation_p.A297T|SELP_ENST00000367791.2_Missense_Mutation_p.A297T|SELP_ENST00000367792.2_Missense_Mutation_p.A297T|SELP_ENST00000367786.2_Missense_Mutation_p.A297T|SELP_ENST00000458599.2_Missense_Mutation_p.A297T|SELP_ENST00000367788.2_Intron|SELP_ENST00000367793.2_Intron	NM_003005.3	NP_002996.2	P16109	LYAM3_HUMAN	selectin P (granule membrane protein 140kDa, antigen CD62)	297	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|defense response to Gram-negative bacterium (GO:0050829)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of platelet activation (GO:0010572)|regulation of integrin activation (GO:0033623)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|platelet dense granule membrane (GO:0031088)	fucose binding (GO:0042806)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|lipopolysaccharide binding (GO:0001530)|oligosaccharide binding (GO:0070492)|sialic acid binding (GO:0033691)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(32)|ovary(4)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(923;0.208)				Dalteparin(DB06779)|Heparin(DB01109)|Nadroparin(DB08813)	CCAACTAATGCAAATCCCTCT	0.502																																					p.A297T													.	SELP	132		0			c.G889A												128.0	112.0	118.0					1																	169581527		2203	4300	6503	SO:0001583	missense	6403	exon6			CTAATGCAAATCC	BC068533	CCDS1282.1	1q22-q25	2008-02-05	2002-08-29		ENSG00000174175	ENSG00000174175		"""CD molecules"""	10721	protein-coding gene	gene with protein product		173610	"""selectin P (granule membrane protein 140kD, antigen CD62)"""	GRMP		1375831	Standard	NM_003005		Approved	CD62, PSEL, PADGEM, GMP140, CD62P	uc001ggi.4	P16109	OTTHUMG00000034685	ENST00000263686.6:c.889G>A	1.37:g.169581527C>T	ENSP00000263686:p.Ala297Thr		Somatic	131	0	0		WXS	Illumina HiSeq	Phase_1	96	0.00	0	NM_003005	1	0.00	0	Q5R344|Q8IVD1	Missense_Mutation	SNP	ENST00000263686.6	37	CCDS1282.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.508|1.508	-0.550162|-0.550162	0.03996|0.03996	.|.	.|.	ENSG00000174175|ENSG00000174175	ENST00000367795;ENST00000367790;ENST00000426706;ENST00000367789;ENST00000263686;ENST00000544572;ENST00000367794;ENST00000367792;ENST00000367791;ENST00000367786;ENST00000458599|ENST00000446728	T;T;T;T;T|.	0.63744|.	-0.06;-0.06;-0.06;-0.06;-0.06|.	5.39|5.39	-0.798|-0.798	0.10905|0.10905	Complement control module (2);Sushi/SCR/CCP (3);|.	1.575510|.	0.03852|.	N|.	0.272385|.	T|T	0.02267|0.02267	0.0070|0.0070	N|N	0.01267|0.01267	-0.92|-0.92	0.09310|0.09310	N|N	1|1	B;B;B|.	0.10296|.	0.001;0.003;0.002|.	B;B;B|.	0.15870|.	0.005;0.014;0.003|.	T|T	0.46275|0.46275	-0.9203|-0.9203	10|5	0.15066|.	T|.	0.55|.	.|.	6.8958|6.8958	0.24255|0.24255	0.0:0.4467:0.1198:0.4335|0.0:0.4467:0.1198:0.4335	.|.	297;297;297|.	Q6NUL9;P16109;G3V1U2|.	.;LYAM3_HUMAN;.|.	T|Y	297;297;296;297;297;297;297;297;297;297;282|296	ENSP00000263686:A297T;ENSP00000356768:A297T;ENSP00000356766:A297T;ENSP00000356765:A297T;ENSP00000356760:A297T|.	ENSP00000263686:A297T|.	A|C	-|-	1|2	0|0	SELP|SELP	167848151|167848151	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.104000|0.104000	0.19210|0.19210	-0.955000|-0.955000	0.03869|0.03869	-0.042000|-0.042000	0.13535|0.13535	-0.157000|-0.157000	0.13467|0.13467	GCA|TGC			0.502	SELP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000083916.4		NM_003005	
TOR1AIP2	163590	bcgsc.ca	37	1	179820097	179820097	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr1:179820097C>T	ENST00000367612.3	-	4	823	c.436G>A	c.(436-438)Gga>Aga	p.G146R	TOR1AIP2_ENST00000609928.1_Missense_Mutation_p.G146R	NM_145034.4	NP_659471.1	Q9H496	IFG15_HUMAN	torsin A interacting protein 2	0										cervix(1)|endometrium(3)|large_intestine(1)|lung(10)|ovary(1)|skin(2)	18						GCTCCAGTTCCGTCACTCGCT	0.562																																					p.G146R													.	TOR1AIP2	38		0			c.G436A												108.0	105.0	106.0					1																	179820097		2203	4300	6503	SO:0001583	missense	163590	exon5			CAGTTCCGTCACT		CCDS1334.1	1q25.2	2012-02-09			ENSG00000169905	ENSG00000169905			24055	protein-coding gene	gene with protein product		614513				15767459	Standard	NM_145034		Approved	LULL1, NET9, IFRG15	uc001gnk.3	Q8NFQ8	OTTHUMG00000035265	ENST00000367612.3:c.436G>A	1.37:g.179820097C>T	ENSP00000356584:p.Gly146Arg		Somatic	152	0	0		WXS	Illumina HiSeq	Phase_1	137	0.00	0	NM_001199260	5	0.00	0	Q05BU2	Missense_Mutation	SNP	ENST00000367612.3	37	CCDS1334.1	.	.	.	.	.	.	.	.	.	.	C	2.371	-0.344239	0.05208	.	.	ENSG00000169905	ENST00000367612	T	0.24538	1.85	5.49	-3.57	0.04612	.	1.704950	0.02906	N	0.136024	T	0.17534	0.0421	N	0.22421	0.69	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.30297	-0.9983	10	0.11794	T	0.64	0.1127	12.4933	0.55912	0.0:0.6513:0.0:0.3487	.	146	Q8NFQ8	TOIP2_HUMAN	R	146	ENSP00000356584:G146R	ENSP00000356584:G146R	G	-	1	0	TOR1AIP2	178086720	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-0.755000	0.04782	-1.000000	0.03438	-0.471000	0.05019	GGA			0.562	TOR1AIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000085304.1		NM_145034	
LINC00862	554279	broad.mit.edu;mdanderson.org	37	1	200337836	200337836	+	lincRNA	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr1:200337836G>T	ENST00000367355.1	-	0	506					NR_040064.1		A6NCI5	SIM16_HUMAN	long intergenic non-protein coding RNA 862							integral component of membrane (GO:0016021)											ACAATCTCTAGCAGACAATGT	0.413																																					.													.	.			0			.																																											0	.			TCTCTAGCAGACA	BC040731		1q32.1	2014-04-09	2013-02-22	2013-02-22	ENSG00000203721	ENSG00000203721		"""Long non-coding RNAs"""	21901	other	unknown			"""chromosome 1 open reading frame 98"", ""small integral membrane protein 16"""	C1orf98, SMIM16			Standard	NR_040064		Approved		uc001gvd.1	A6NCI5	OTTHUMG00000035722		1.37:g.200337836G>T			Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	87	0.05	4	.	0		0		RNA	SNP	ENST00000367355.1	37		.	.	.	.	.	.	.	.	.	.	G	4.900	0.167305	0.09339	.	.	ENSG00000203721	ENST00000367355	.	.	.	3.01	2.05	0.26809	.	.	.	.	.	T	0.43233	0.1238	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36456	-0.9747	5	0.87932	D	0	.	8.2846	0.31922	0.0:0.2785:0.7215:0.0	.	.	.	.	D	23	.	ENSP00000356324:A23D	A	-	2	0	C1orf98	198604459	0.001000	0.12720	0.001000	0.08648	0.002000	0.02628	0.646000	0.24797	0.759000	0.33084	0.655000	0.94253	GCT			0.413	LINC00862-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000086877.1		NR_040064	
KISS1	3814	mdanderson.org	37	1	204159627	204159627	+	Missense_Mutation	SNP	G	G	T	rs370191198		TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr1:204159627G>T	ENST00000367194.4	-	3	550	c.402C>A	c.(400-402)agC>agA	p.S134R		NM_002256.3	NP_002247.3	Q15726	KISS1_HUMAN	KiSS-1 metastasis-suppressor	134					cytoskeleton organization (GO:0007010)|generation of ovulation cycle rhythm (GO:0060112)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of luteinizing hormone secretion (GO:0033686)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of synaptic transmission (GO:0050806)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				large_intestine(1)|lung(1)|ovary(1)	3	all_cancers(21;0.0165)|Breast(84;0.179)|all_epithelial(62;0.242)	Breast(1374;9.42e-05)	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.069)|Kidney(21;0.0934)|Epithelial(59;0.239)	Colorectal(1306;0.0129)		CCCGCCCAGCGCTTCTGCCGT	0.692																																					p.S134R													.	.			0			c.C402A												8.0	9.0	9.0					1																	204159627		1798	3948	5746	SO:0001583	missense	3814	exon3			CCCAGCGCTTCTG	U43527	CCDS41454.1	1q32	2014-01-30			ENSG00000170498	ENSG00000170498		"""Endogenous ligands"""	6341	protein-coding gene	gene with protein product	"""prepro-kisspeptin"", ""kisspeptin"""	603286				9192814, 9806840	Standard	NM_002256		Approved		uc001har.3	Q15726	OTTHUMG00000036060	ENST00000367194.4:c.402C>A	1.37:g.204159627G>T	ENSP00000356162:p.Ser134Arg		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_002256	2	0.00	0	A8K6N0|Q9HBP1	Missense_Mutation	SNP	ENST00000367194.4	37	CCDS41454.1	.	.	.	.	.	.	.	.	.	.	G	7.913	0.736841	0.15574	.	.	ENSG00000170498	ENST00000367194	T	0.69561	-0.41	1.49	-2.1	0.07210	.	.	.	.	.	T	0.37839	0.1018	N	0.08118	0	0.09310	N	1	B	0.24483	0.104	B	0.16289	0.015	T	0.14200	-1.0481	9	0.52906	T	0.07	-0.0889	2.6982	0.05141	0.3782:0.2568:0.365:0.0	.	134	Q15726	KISS1_HUMAN	R	134	ENSP00000356162:S134R	ENSP00000356162:S134R	S	-	3	2	KISS1	202426250	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.205000	0.09411	-0.663000	0.05331	0.561000	0.74099	AGC			0.692	KISS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000087892.1		NM_002256	
AVPR1B	553	bcgsc.ca	37	1	206224555	206224555	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr1:206224555G>A	ENST00000367126.4	+	1	580	c.115G>A	c.(115-117)Gga>Aga	p.G39R	RP11-38J22.3_ENST00000425896.1_RNA	NM_000707.3	NP_000698.1	P47901	V1BR_HUMAN	arginine vasopressin receptor 1B	39					activation of phospholipase C activity (GO:0007202)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	protein kinase C binding (GO:0005080)|vasopressin receptor activity (GO:0005000)			breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)|skin(2)	20			BRCA - Breast invasive adenocarcinoma(75;0.0312)		Desmopressin(DB00035)|Terlipressin(DB02638)|Vasopressin(DB00067)	GGTGGAGATCGGAGTCCTGGC	0.687																																					p.G39R													.	AVPR1B	47		0			c.G115A												80.0	93.0	89.0					1																	206224555		2203	4300	6503	SO:0001583	missense	553	exon1			GAGATCGGAGTCC	D31833	CCDS73015.1	1q32	2014-05-06			ENSG00000198049	ENSG00000198049		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	896	protein-coding gene	gene with protein product		600264		AVPR3		7929452, 8586456	Standard	NM_000707		Approved		uc001hds.2	P47901	OTTHUMG00000184377	ENST00000367126.4:c.115G>A	1.37:g.206224555G>A	ENSP00000356094:p.Gly39Arg		Somatic	157	0	0		WXS	Illumina HiSeq	Phase_1	100	0.00	0	NM_000707	0		0	B0M0J6|Q5TZ00	Missense_Mutation	SNP	ENST00000367126.4	37	CCDS30994.1	.	.	.	.	.	.	.	.	.	.	G	12.96	2.093761	0.36952	.	.	ENSG00000198049	ENST00000367126	T	0.28069	1.63	5.06	5.06	0.68205	.	0.426066	0.21507	N	0.073440	T	0.37046	0.0989	L	0.59436	1.845	0.09310	N	0.999999	P	0.42827	0.791	B	0.41412	0.356	T	0.36768	-0.9734	10	0.72032	D	0.01	-1.8765	18.211	0.89869	0.0:0.0:1.0:0.0	.	39	P47901	V1BR_HUMAN	R	39	ENSP00000356094:G39R	ENSP00000356094:G39R	G	+	1	0	AVPR1B	204391178	0.813000	0.29090	0.176000	0.23000	0.661000	0.39034	4.831000	0.62752	2.633000	0.89246	0.609000	0.83330	GGA			0.687	AVPR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000087996.1		NM_000707	
PIGR	5284	bcgsc.ca	37	1	207110937	207110937	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr1:207110937A>C	ENST00000356495.4	-	4	731	c.548T>G	c.(547-549)gTa>gGa	p.V183G		NM_002644.3	NP_002635.2	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor	183	Ig-like V-type 2.				detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc receptor signaling pathway (GO:0038093)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|receptor clustering (GO:0043113)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	polymeric immunoglobulin receptor activity (GO:0001792)			central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GTTGGGATTTACATAACCACT	0.478																																					p.V183G													.	PIGR	98		0			c.T548G												92.0	79.0	84.0					1																	207110937		2203	4300	6503	SO:0001583	missense	5284	exon4			GGATTTACATAAC		CCDS1474.1	1q31-q41	2013-01-11			ENSG00000162896	ENSG00000162896		"""Immunoglobulin superfamily / V-set domain containing"""	8968	protein-coding gene	gene with protein product		173880					Standard	NM_002644		Approved		uc001hez.3	P01833	OTTHUMG00000036581	ENST00000356495.4:c.548T>G	1.37:g.207110937A>C	ENSP00000348888:p.Val183Gly		Somatic	132	0	0		WXS	Illumina HiSeq	Phase_1	118	0.00	0	NM_002644	0		0	Q68D81|Q8IZY7	Missense_Mutation	SNP	ENST00000356495.4	37	CCDS1474.1	.	.	.	.	.	.	.	.	.	.	A	16.44	3.123703	0.56613	.	.	ENSG00000162896	ENST00000356495	T	0.04454	3.62	6.08	-4.25	0.03766	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	1.521620	0.03537	N	0.223364	T	0.14485	0.0350	M	0.73962	2.25	0.19945	N	0.999947	D	0.69078	0.997	D	0.66847	0.947	T	0.37009	-0.9724	10	0.66056	D	0.02	-24.6357	0.9742	0.01422	0.2926:0.1065:0.1874:0.4135	.	183	P01833	PIGR_HUMAN	G	183	ENSP00000348888:V183G	ENSP00000348888:V183G	V	-	2	0	PIGR	205177560	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.393000	0.07305	-1.099000	0.03034	-0.256000	0.11100	GTA			0.478	PIGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000088975.1		NM_002644	
OBSCN	84033	mdanderson.org	37	1	228528833	228528833	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr1:228528833G>A	ENST00000422127.1	+	73	17779	c.17735G>A	c.(17734-17736)cGc>cAc	p.R5912H	OBSCN_ENST00000366709.4_Missense_Mutation_p.R3031H|OBSCN_ENST00000284548.11_Missense_Mutation_p.R5912H|OBSCN_ENST00000366707.4_Missense_Mutation_p.R3546H|OBSCN_ENST00000570156.2_Missense_Mutation_p.R6869H	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5912	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CCGGGGGCCCGCATGCCCTGG	0.677																																					p.R6869H													.	.			0			c.G20606A												24.0	28.0	27.0					1																	228528833		2028	4173	6201	SO:0001583	missense	84033	exon84			GGGCCCGCATGCC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.17735G>A	1.37:g.228528833G>A	ENSP00000409493:p.Arg5912His		Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	20	0.10	2	NM_001271223	1	0.00	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.782185	0.90282	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.65549	0.18;-0.16;-0.11;0.32	5.58	5.58	0.84498	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.64402	D	0.000001	T	0.81814	0.4902	M	0.82517	2.595	0.38269	D	0.942102	D;D	0.89917	1.0;1.0	D;D	0.76575	0.974;0.988	D	0.85125	0.0971	10	0.72032	D	0.01	.	19.5555	0.95345	0.0:0.0:1.0:0.0	.	5912;5912	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	H	5912;5912;3546;3031	ENSP00000284548:R5912H;ENSP00000409493:R5912H;ENSP00000355668:R3546H;ENSP00000355670:R3031H	ENSP00000284548:R5912H	R	+	2	0	OBSCN	226595456	1.000000	0.71417	0.787000	0.31911	0.252000	0.25951	6.688000	0.74557	2.638000	0.89438	0.561000	0.74099	CGC			0.677	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding				NM_052843	
DIP2C	22982	mdanderson.org	37	10	415572	415572	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr10:415572G>T	ENST00000280886.6	-	18	2080	c.1993C>A	c.(1993-1995)Ccc>Acc	p.P665T	DIP2C_ENST00000381496.3_Splice_Site_p.P558T|DIP2C_ENST00000540204.1_5'UTR	NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	665						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		TCATCCGTGGGCCTGTAATGA	0.552																																					p.P665T													.	.			0			c.C1993A												68.0	74.0	72.0					10																	415572		2203	4300	6503	SO:0001630	splice_region_variant	22982	exon18			CCGTGGGCCTGTA	BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.1992-1C>A	10.37:g.415572G>T			Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	67	0.09	6	NM_014974	21	0.00	0	B4DPI5|Q5SS78	Missense_Mutation	SNP	ENST00000280886.6	37	CCDS7054.1	.	.	.	.	.	.	.	.	.	.	G	18.11	3.550021	0.65311	.	.	ENSG00000151240	ENST00000280886;ENST00000381496	T;T	0.11169	2.8;2.8	5.09	5.09	0.68999	AMP-dependent synthetase/ligase (1);	0.173903	0.51477	D	0.000090	T	0.36054	0.0953	M	0.86651	2.83	0.80722	D	1	P	0.49559	0.925	P	0.59825	0.864	T	0.15009	-1.0452	10	0.32370	T	0.25	-10.9011	18.8772	0.92343	0.0:0.0:1.0:0.0	.	665	Q9Y2E4	DIP2C_HUMAN	T	665;558	ENSP00000280886:P665T;ENSP00000370907:P558T	ENSP00000280886:P665T	P	-	1	0	DIP2C	405572	1.000000	0.71417	1.000000	0.80357	0.302000	0.27658	9.784000	0.99039	2.526000	0.85167	0.561000	0.74099	CCC			0.552	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046389.1		NM_014974	Missense_Mutation
VWA2	340706	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	10	116044682	116044682	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr10:116044682G>A	ENST00000392982.3	+	10	1200	c.950G>A	c.(949-951)gGc>gAc	p.G317D	VWA2_ENST00000603594.1_Missense_Mutation_p.G317D			Q5GFL6	VWA2_HUMAN	von Willebrand factor A domain containing 2	317	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				calcium-independent cell-matrix adhesion (GO:0007161)|protein homooligomerization (GO:0051260)|regulation of insulin receptor signaling pathway (GO:0046626)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)	26				Epithelial(162;0.036)|all cancers(201;0.0793)		GGACTGGACGGCTACCAGTGC	0.602																																					p.G317D													.	.			0			c.G950A												82.0	64.0	70.0					10																	116044682		2203	4300	6503	SO:0001583	missense	340706	exon10			TGGACGGCTACCA	AK127756	CCDS7589.1, CCDS7589.2	10q25.3	2009-11-06			ENSG00000165816	ENSG00000165816			24709	protein-coding gene	gene with protein product						15580307, 14506275	Standard	NM_001272046		Approved	FLJ45857, FLJ16213, CCSP-2, AMACO, NET42	uc001lbl.2	Q5GFL6	OTTHUMG00000019082	ENST00000392982.3:c.950G>A	10.37:g.116044682G>A	ENSP00000376708:p.Gly317Asp		Somatic	59	0	0		WXS	Illumina HiSeq	.	40	0.45	18	NM_001272046	2	1.00	2	A1A5D4|B5MDJ8|Q6ZS39|Q6ZWJ7|Q708C5|Q70UZ8	Missense_Mutation	SNP	ENST00000392982.3	37		.	.	.	.	.	.	.	.	.	.	G	0.333	-0.954988	0.02285	.	.	ENSG00000165816	ENST00000392982;ENST00000298715	D	0.92965	-3.14	5.49	0.402	0.16344	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.865563	0.10687	N	0.645644	D	0.84955	0.5587	L	0.41415	1.275	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.14023	0.01;0.006	T	0.68307	-0.5443	10	0.17832	T	0.49	.	5.4069	0.16326	0.3714:0.1514:0.4772:0.0	.	317;317	Q5GFL6;Q5GFL6-2	VWA2_HUMAN;.	D	317	ENSP00000376708:G317D	ENSP00000298715:G317D	G	+	2	0	VWA2	116034672	0.000000	0.05858	0.002000	0.10522	0.007000	0.05969	0.118000	0.15605	0.242000	0.21303	0.655000	0.94253	GGC			0.602	VWA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000050456.3		NM_198496	
LMNTD2	256329	mdanderson.org	37	11	557478	557478	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr11:557478G>T	ENST00000329451.3	-	7	696	c.634C>A	c.(634-636)Ctg>Atg	p.L212M	RP11-496I9.1_ENST00000527113.1_RNA|RASSF7_ENST00000431809.1_5'Flank|RP11-496I9.1_ENST00000527620.1_RNA	NM_173573.2	NP_775844.2	Q8IXW0	LMTD2_HUMAN		212										NS(1)|breast(1)|central_nervous_system(1)|lung(4)|pancreas(1)	8		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		ACGTCCTCCAGCCGAAAGCCC	0.612																																					p.L212M													.	.			0			c.C634A												64.0	56.0	59.0					11																	557478		2200	4298	6498	SO:0001583	missense	256329	exon7			CCTCCAGCCGAAA																												ENST00000329451.3:c.634C>A	11.37:g.557478G>T	ENSP00000331167:p.Leu212Met		Somatic	116	0	0		WXS	Illumina HiSeq	Phase_I	75	0.05	4	NM_173573	3	0.00	0		Missense_Mutation	SNP	ENST00000329451.3	37	CCDS7701.1	.	.	.	.	.	.	.	.	.	.	G	13.03	2.116196	0.37339	.	.	ENSG00000185522	ENST00000329451;ENST00000441853;ENST00000486629	T;T;T	0.39592	1.07;1.07;1.07	4.23	-0.779	0.10973	.	0.000000	0.32608	N	0.005870	T	0.41213	0.1149	L	0.27053	0.805	0.21740	N	0.999566	D	0.76494	0.999	D	0.68765	0.96	T	0.28364	-1.0046	10	0.59425	D	0.04	-14.4724	5.6021	0.17359	0.2697:0.151:0.5793:0.0	.	212	Q8IXW0	CK035_HUMAN	M	212;219;222	ENSP00000331167:L212M;ENSP00000393529:L219M;ENSP00000435529:L222M	ENSP00000331167:L212M	L	-	1	2	C11orf35	547478	0.949000	0.32298	0.984000	0.44739	0.124000	0.20399	0.035000	0.13797	-0.341000	0.08376	0.456000	0.33151	CTG			0.612	C11orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254973.2			
MUC5B	727897	mdanderson.org	37	11	1272873	1272873	+	Silent	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr11:1272873G>T	ENST00000529681.1	+	31	14821	c.14763G>T	c.(14761-14763)gtG>gtT	p.V4921V	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Silent_p.V4924V	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4921	Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		TGTCCACTGTGTCCTCCTCAG	0.637																																					p.V4921V													.	.			0			c.G14763T												62.0	72.0	68.0					11																	1272873		2171	4259	6430	SO:0001819	synonymous_variant	727897	exon31			CACTGTGTCCTCC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.14763G>T	11.37:g.1272873G>T			Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_002458	0		0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																					0.637	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000390041.2		XM_001126093	
OR52L1	338751	mdanderson.org	37	11	6007839	6007839	+	Missense_Mutation	SNP	G	G	T	rs373752876		TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr11:6007839G>T	ENST00000332249.4	-	1	376	c.322C>A	c.(322-324)Cac>Aac	p.H108N		NM_001005173.2	NP_001005173.2	Q8NGH7	O52L1_HUMAN	olfactory receptor, family 52, subfamily L, member 1	108						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|pancreas(1)|skin(3)|soft_tissue(1)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.98e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCAATCTCGTGGGCATGAACC	0.542																																					p.H108N	Melanoma(121;653 1666 10547 22796 51255)												.	.			0			c.C322A												64.0	66.0	66.0					11																	6007839		2125	4244	6369	SO:0001583	missense	338751	exon1			TCTCGTGGGCATG	AB065819	CCDS44529.1	11p15.4	2012-08-09			ENSG00000183313	ENSG00000183313		"""GPCR / Class A : Olfactory receptors"""	14785	protein-coding gene	gene with protein product							Standard	NM_001005173		Approved		uc001mcd.2	Q8NGH7	OTTHUMG00000165374	ENST00000332249.4:c.322C>A	11.37:g.6007839G>T	ENSP00000330338:p.His108Asn		Somatic	109	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_001005173	0		0	B2RPA6|Q6IFK9	Missense_Mutation	SNP	ENST00000332249.4	37	CCDS44529.1	.	.	.	.	.	.	.	.	.	.	G	2.542	-0.305963	0.05458	.	.	ENSG00000183313	ENST00000332249	T	0.36340	1.26	3.64	2.69	0.31865	GPCR, rhodopsin-like superfamily (1);	0.377649	0.19454	N	0.113876	T	0.18923	0.0454	N	0.17474	0.49	0.09310	N	1	B	0.28128	0.201	B	0.16722	0.016	T	0.11397	-1.0589	10	0.51188	T	0.08	.	6.9238	0.24403	0.1094:0.1804:0.7102:0.0	.	108	Q8NGH7	O52L1_HUMAN	N	108	ENSP00000330338:H108N	ENSP00000330338:H108N	H	-	1	0	OR52L1	5964415	0.000000	0.05858	0.996000	0.52242	0.115000	0.19883	-0.273000	0.08548	1.747000	0.51819	0.313000	0.20887	CAC			0.542	OR52L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000383754.1		NM_001005173	
RTN4RL2	349667	mdanderson.org	37	11	57243916	57243916	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr11:57243916C>A	ENST00000335099.3	+	3	1112	c.795C>A	c.(793-795)tgC>tgA	p.C265*	RP11-624G17.3_ENST00000528885.1_RNA	NM_178570.1	NP_848665.1			reticulon 4 receptor-like 2											NS(1)|endometrium(1)|large_intestine(2)|lung(2)	6						CCTGGGCGTGCGACTGCCGCG	0.736																																					p.C265X													.	.			0			c.C795A												5.0	7.0	6.0					11																	57243916		2054	4092	6146	SO:0001587	stop_gained	349667	exon3			GGCGTGCGACTGC	BK001302	CCDS7957.1	11q12.1	2008-02-05			ENSG00000186907	ENSG00000186907			23053	protein-coding gene	gene with protein product		610462					Standard	NM_178570		Approved	NgR2, NGRH1	uc010rjt.2	Q86UN3	OTTHUMG00000167028	ENST00000335099.3:c.795C>A	11.37:g.57243916C>A	ENSP00000335397:p.Cys265*		Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	13	0.23	3	NM_178570	2	0.00	0		Nonsense_Mutation	SNP	ENST00000335099.3	37	CCDS7957.1	.	.	.	.	.	.	.	.	.	.	C	37	6.414639	0.97546	.	.	ENSG00000186907	ENST00000335099	.	.	.	4.43	3.37	0.38596	.	0.000000	0.42682	U	0.000677	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.5671	0.33547	0.0:0.7829:0.0:0.2171	.	.	.	.	X	265	.	ENSP00000335397:C265X	C	+	3	2	RTN4RL2	57000492	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.854000	0.27791	1.991000	0.58162	0.491000	0.48974	TGC			0.736	RTN4RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000392537.1		NM_178570	
OR10V1	390201	mdanderson.org	37	11	59480841	59480841	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr11:59480841G>T	ENST00000307552.2	-	1	496	c.478C>A	c.(478-480)Ctc>Atc	p.L160I	STX3_ENST00000300150.7_5'Flank	NM_001005324.1	NP_001005324.1	Q8NGI7	O10V1_HUMAN	olfactory receptor, family 10, subfamily V, member 1	160						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(3)|liver(1)|lung(10)|skin(1)	16						AAAATGGTGAGTGGCAGTGAC	0.527																																					p.L160I													.	.			0			c.C478A												87.0	75.0	79.0					11																	59480841		2201	4295	6496	SO:0001583	missense	390201	exon1			TGGTGAGTGGCAG	AB065807	CCDS31565.1	11q12.1	2012-08-09			ENSG00000172289	ENSG00000172289		"""GPCR / Class A : Olfactory receptors"""	15136	protein-coding gene	gene with protein product							Standard	NM_001005324		Approved		uc001nof.1	Q8NGI7	OTTHUMG00000167406	ENST00000307552.2:c.478C>A	11.37:g.59480841G>T	ENSP00000302199:p.Leu160Ile		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	22	0.09	2	NM_001005324	0		0	Q6IFD9|Q96R50	Missense_Mutation	SNP	ENST00000307552.2	37	CCDS31565.1	.	.	.	.	.	.	.	.	.	.	G	10.27	1.303363	0.23736	.	.	ENSG00000172289	ENST00000307552	T	0.00107	8.72	4.57	3.65	0.41850	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41500	D	0.000878	T	0.00271	0.0008	L	0.48935	1.535	0.09310	N	1	D	0.64830	0.994	P	0.60541	0.876	T	0.57780	-0.7752	10	0.38643	T	0.18	.	10.774	0.46340	0.0936:0.0:0.9064:0.0	.	160	Q8NGI7	O10V1_HUMAN	I	160	ENSP00000302199:L160I	ENSP00000302199:L160I	L	-	1	0	OR10V1	59237417	0.000000	0.05858	0.037000	0.18230	0.130000	0.20726	0.415000	0.21181	1.299000	0.44798	0.543000	0.68304	CTC			0.527	OR10V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394517.1		NM_001005324	
MS4A15	219995	hgsc.bcm.edu;mdanderson.org	37	11	60535051	60535051	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr11:60535051G>T	ENST00000405633.3	+	3	350	c.271G>T	c.(271-273)Gtg>Ttg	p.V91L	MS4A15_ENST00000528170.1_Intron|MS4A15_ENST00000337911.4_5'UTR	NM_001098835.1	NP_001092305.1	Q8N5U1	M4A15_HUMAN	membrane-spanning 4-domains, subfamily A, member 15	91						integral component of membrane (GO:0016021)				breast(1)|large_intestine(2)|lung(3)	6						CTTTGGCAGCGTGCTGCTCAT	0.687																																					p.V91L													MS4A15_ENST00000405633,caecum,carcinoma,0,1	MS4A15_ENST00000405633	0	1	0			c.G271T												38.0	31.0	33.0					11																	60535051		2170	4245	6415	SO:0001583	missense	219995	exon3			GGCAGCGTGCTGC	AY584608	CCDS7991.1, CCDS44617.1, CCDS60802.1	11q12.2	2008-03-25							28573	protein-coding gene	gene with protein product							Standard	NM_001098835		Approved		uc009ynf.1	Q8N5U1		ENST00000405633.3:c.271G>T	11.37:g.60535051G>T	ENSP00000386022:p.Val91Leu		Somatic	104	0	0		WXS	Illumina HiSeq	.	51	0.06	3	NM_001098835	1	0.00	0	A9UJY6|A9UJY7|F2Z2J5	Missense_Mutation	SNP	ENST00000405633.3	37	CCDS44617.1	.	.	.	.	.	.	.	.	.	.	G	16.19	3.054316	0.55218	.	.	ENSG00000166961	ENST00000405633	T	0.02258	4.37	4.8	3.88	0.44766	.	.	.	.	.	T	0.06645	0.0170	L	0.35341	1.055	0.28620	N	0.908232	D	0.76494	0.999	D	0.83275	0.996	T	0.18871	-1.0323	9	0.54805	T	0.06	-15.922	10.4266	0.44383	0.0:0.0:0.8048:0.1952	.	91	Q8N5U1	M4A15_HUMAN	L	91	ENSP00000386022:V91L	ENSP00000386022:V91L	V	+	1	0	MS4A15	60291627	1.000000	0.71417	0.821000	0.32701	0.235000	0.25334	4.760000	0.62235	0.992000	0.38840	0.462000	0.41574	GTG			0.687	MS4A15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000395618.1			
CCDC87	55231	mdanderson.org	37	11	66359164	66359164	+	Silent	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr11:66359164G>T	ENST00000333861.3	-	1	1390	c.1323C>A	c.(1321-1323)gtC>gtA	p.V441V	CCS_ENST00000533244.1_5'Flank|CCS_ENST00000310190.4_5'Flank	NM_018219.2	NP_060689.2	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	441					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						CAGCCGCCTGGACCACGACCT	0.547																																					p.V441V													.	.			0			c.C1323A												42.0	48.0	46.0					11																	66359164		2200	4294	6494	SO:0001819	synonymous_variant	55231	exon1			CGCCTGGACCACG	BC034469	CCDS8145.1	11q13.2	2006-03-15			ENSG00000182791	ENSG00000182791			25579	protein-coding gene	gene with protein product						12477932	Standard	NM_018219		Approved	FLJ10786	uc001oiq.4	Q9NVE4	OTTHUMG00000167237	ENST00000333861.3:c.1323C>A	11.37:g.66359164G>T			Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	43	0.07	3	NM_018219	8	0.00	0	Q8NE76	Silent	SNP	ENST00000333861.3	37	CCDS8145.1																																																																																					0.547	CCDC87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393825.1		NM_018219	
KRTAP5-8	57830	hgsc.bcm.edu;ucsc.edu	37	11	71249545	71249545	+	Silent	SNP	C	C	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr11:71249545C>T	ENST00000398534.3	+	1	475	c.444C>T	c.(442-444)tgC>tgT	p.C148C		NM_021046.2	NP_066384.2	O75690	KRA58_HUMAN	keratin associated protein 5-8	148	9 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			cervix(1)|endometrium(1)|lung(2)|skin(1)|stomach(1)	6						AGTCCAGCTGCTGTAAGCCCT	0.607																																					p.C148C													KRTAP5-8,NS,carcinoma,0,1	KRTAP5-8	0	1	0			c.C444T												173.0	178.0	177.0					11																	71249545		2200	4294	6494	SO:0001819	synonymous_variant	57830	exon1			CAGCTGCTGTAAG	AB126077	CCDS41683.1	11q13.4	2008-02-05			ENSG00000241233	ENSG00000241233		"""Keratin associated proteins"""	23603	protein-coding gene	gene with protein product						15144888	Standard	NM_021046		Approved	KRTAP5.8, UHSKerB, KRTAP5-2	uc001oqr.1	O75690	OTTHUMG00000057571	ENST00000398534.3:c.444C>T	11.37:g.71249545C>T			Somatic	54	0	0		WXS	Illumina HiSeq	.	38	0.18	7	NM_021046	0		0	Q6L8G7|Q6UTX6	Silent	SNP	ENST00000398534.3	37	CCDS41683.1																																																																																					0.607	KRTAP5-8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000127954.1		NM_021046	
CCDC81	60494	broad.mit.edu;mdanderson.org	37	11	86119254	86119254	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr11:86119254A>G	ENST00000445632.2	+	9	1327	c.1055A>G	c.(1054-1056)gAg>gGg	p.E352G	CCDC81_ENST00000278487.3_Intron|CCDC81_ENST00000528728.1_Intron|CCDC81_ENST00000354755.1_Missense_Mutation_p.E262G	NM_001156474.1	NP_001149946.1	Q6ZN84	CCD81_HUMAN	coiled-coil domain containing 81	352										kidney(3)|large_intestine(8)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	20		Acute lymphoblastic leukemia(157;5.51e-06)|all_hematologic(158;0.00535)				ATAGAAGATGAGAGACTCATA	0.423																																					p.E352G													.	CCDC81	89		0			c.A1055G												116.0	106.0	110.0					11																	86119254		2202	4299	6501	SO:0001583	missense	60494	exon9			AAGATGAGAGACT	AK131331	CCDS8276.1, CCDS53691.1	11q14.2	2006-03-09			ENSG00000149201	ENSG00000149201			26281	protein-coding gene	gene with protein product							Standard	NM_001156474		Approved	FLJ16339, FLJ23514	uc001pbx.2	Q6ZN84	OTTHUMG00000167213	ENST00000445632.2:c.1055A>G	11.37:g.86119254A>G	ENSP00000415528:p.Glu352Gly		Somatic	108	0	0		WXS	Illumina HiSeq	Phase_I	80	0.05	4	NM_001156474	4	0.00	0	A0AVL7|Q53FW3|Q9H5E5	Missense_Mutation	SNP	ENST00000445632.2	37	CCDS53691.1	.	.	.	.	.	.	.	.	.	.	A	19.57	3.852630	0.71719	.	.	ENSG00000149201	ENST00000354755;ENST00000445632	T;T	0.45668	0.89;0.89	5.28	4.08	0.47627	.	0.323592	0.26400	N	0.024584	T	0.48466	0.1501	M	0.72118	2.19	0.80722	D	1	P;P	0.47545	0.897;0.884	P;P	0.48677	0.548;0.586	T	0.49808	-0.8900	9	.	.	.	-10.909	10.2054	0.43109	0.8511:0.0:0.0:0.1489	.	352;262	Q6ZN84;Q6ZN84-2	CCD81_HUMAN;.	G	262;352	ENSP00000346800:E262G;ENSP00000415528:E352G	.	E	+	2	0	CCDC81	85796902	0.976000	0.34144	0.899000	0.35326	0.770000	0.43624	2.611000	0.46334	1.975000	0.57531	0.460000	0.39030	GAG			0.423	CCDC81-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393756.1		NM_021827	
ELMOD1	55531	mdanderson.org	37	11	107463073	107463073	+	Intron	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr11:107463073G>T	ENST00000265840.7	+	1	180				ELMOD1_ENST00000443271.2_Intron|ELMOD1_ENST00000529675.1_3'UTR|AP000889.3_ENST00000600612.1_Missense_Mutation_p.A91S|ELMOD1_ENST00000531234.1_Intron	NM_018712.3	NP_061182.3	Q8N336	ELMD1_HUMAN	ELMO/CED-12 domain containing 1						phagocytosis (GO:0006909)|positive regulation of GTPase activity (GO:0043547)	cytoskeleton (GO:0005856)	GTPase activator activity (GO:0005096)			endometrium(2)|large_intestine(5)|liver(2)|lung(7)|pancreas(2)|prostate(1)	19		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)		CCCCCAGTGGGCCGTAGATTG	0.478																																					.													.	.			0			.												88.0	87.0	87.0					11																	107463073		1923	4130	6053	SO:0001627	intron_variant	0	.			CAGTGGGCCGTAG	AL359601	CCDS44723.1, CCDS44724.1	11q23.1	2012-10-15	2006-01-20		ENSG00000110675	ENSG00000110675			25334	protein-coding gene	gene with protein product		615456	"""ELMO domain containing 1"""			12477932	Standard	NM_018712		Approved	DKFZp547C176	uc010rvs.2	Q8N336	OTTHUMG00000166361	ENST00000265840.7:c.-86+938G>T	11.37:g.107463073G>T			Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	.	0		0	B4E167|G5E9S5|Q9NPW3	RNA	SNP	ENST00000265840.7	37	CCDS44723.1																																																																																					0.478	ELMOD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000389406.1		NM_018712	
NPAT	4863	mdanderson.org	37	11	108032512	108032512	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr11:108032512G>T	ENST00000278612.8	-	17	3406	c.3301C>A	c.(3301-3303)Ccc>Acc	p.P1101T		NM_002519.2	NP_002510.2	Q14207	NPAT_HUMAN	nuclear protein, ataxia-telangiectasia locus	1101					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(21)|ovary(2)|prostate(2)|skin(5)	46		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		GACACATTGGGTGAGTCAAGA	0.438																																					p.P1101T													.	.			0			c.C3301A												90.0	82.0	84.0					11																	108032512		1903	4131	6034	SO:0001583	missense	4863	exon17			CATTGGGTGAGTC	X97186	CCDS41710.1	11q22-q23	2008-02-01			ENSG00000149308	ENSG00000149308			7896	protein-coding gene	gene with protein product		601448				9205109	Standard	NM_002519		Approved	E14	uc001pjz.4	Q14207	OTTHUMG00000166385	ENST00000278612.8:c.3301C>A	11.37:g.108032512G>T	ENSP00000278612:p.Pro1101Thr		Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_002519	24	0.00	0	A8K1V5|A8K6M2|Q13632|Q14967|Q16580|Q86W55|Q8IWE9	Missense_Mutation	SNP	ENST00000278612.8	37	CCDS41710.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.55|13.55	2.270825|2.270825	0.40194|0.40194	.|.	.|.	ENSG00000149308|ENSG00000149308	ENST00000527296|ENST00000278612	.|T	.|0.03860	.|3.78	6.17|6.17	3.32|3.32	0.38043|0.38043	.|.	.|0.446106	.|0.21663	.|N	.|0.070986	T|T	0.10766|0.10766	0.0263|0.0263	M|M	0.65975|0.65975	2.015|2.015	0.09310|0.09310	N|N	1|1	.|P	.|0.52842	.|0.956	.|P	.|0.51016	.|0.656	T|T	0.07868|0.07868	-1.0750|-1.0750	5|10	.|0.49607	.|T	.|0.09	-0.006|-0.006	9.0492|9.0492	0.36365|0.36365	0.2844:0.0:0.7156:0.0|0.2844:0.0:0.7156:0.0	.|.	.|1101	.|Q14207	.|NPAT_HUMAN	Q|T	99|1101	.|ENSP00000278612:P1101T	.|ENSP00000278612:P1101T	H|P	-|-	3|1	2|0	NPAT|NPAT	107537722|107537722	0.042000|0.042000	0.20092|0.20092	0.014000|0.014000	0.15608|0.15608	0.728000|0.728000	0.41692|0.41692	0.671000|0.671000	0.25172|0.25172	0.486000|0.486000	0.27676|0.27676	0.655000|0.655000	0.94253|0.94253	CAC|CCC			0.438	NPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000389506.2		NM_002519	
KMT2A	4297	mdanderson.org	37	11	118375220	118375220	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr11:118375220G>T	ENST00000389506.5	+	27	8604	c.8604G>T	c.(8602-8604)gaG>gaT	p.E2868D	KMT2A_ENST00000534358.1_Missense_Mutation_p.E2871D|KMT2A_ENST00000354520.4_Missense_Mutation_p.E2830D			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	2868					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										AGAGCCCAGAGTCATCTTCAT	0.428																																					p.E2871D													.	.			0			c.G8613T												137.0	129.0	132.0					11																	118375220		2200	4295	6495	SO:0001583	missense	4297	exon27			CCCAGAGTCATCT	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.8604G>T	11.37:g.118375220G>T	ENSP00000374157:p.Glu2868Asp		Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_001197104	7	0.00	0	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	37	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	G	12.66	2.005928	0.35415	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.87887	-2.31;-2.31;-2.26	6.06	5.15	0.70609	.	0.000000	0.85682	D	0.000000	D	0.90212	0.6940	L	0.48642	1.525	0.51233	D	0.999913	D;D	0.69078	0.997;0.997	D;D	0.72625	0.978;0.978	D	0.90743	0.4651	10	0.87932	D	0	.	11.2008	0.48741	0.1387:0.0:0.8613:0.0	.	2871;2868	E9PQG7;Q03164	.;MLL1_HUMAN	D	2871;2868;2830;1778	ENSP00000436786:E2871D;ENSP00000374157:E2868D;ENSP00000346516:E2830D	ENSP00000346516:E2830D	E	+	3	2	MLL	117880430	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.304000	0.59104	1.570000	0.49709	0.655000	0.94253	GAG			0.428	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000399085.2		NM_005933	
NCAPD3	23310	mdanderson.org	37	11	134047261	134047261	+	Silent	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr11:134047261G>T	ENST00000534548.2	-	23	2938	c.2874C>A	c.(2872-2874)cgC>cgA	p.R958R	RP11-700F16.3_ENST00000531710.1_RNA	NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	958					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		TGACGTTGTTGCGGACAGCCA	0.527																																					p.R958R													NCAPD3,colon,carcinoma,-1,1	NCAPD3	-1	1	0			c.C2874A												234.0	177.0	196.0					11																	134047261		2201	4297	6498	SO:0001819	synonymous_variant	23310	exon23			GTTGTTGCGGACA	AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.2874C>A	11.37:g.134047261G>T			Somatic	81	0.012345679	1		WXS	Illumina HiSeq	Phase_I	31	0.10	3	NM_015261	31	0.03	1	A6NFS2|Q4KMQ9	Silent	SNP	ENST00000534548.2	37	CCDS31723.1																																																																																					0.527	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393575.2		NM_015261	
SLC38A1	81539	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	46622952	46622952	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr12:46622952C>T	ENST00000398637.5	-	5	992	c.298G>A	c.(298-300)Gga>Aga	p.G100R	SLC38A1_ENST00000549633.1_5'UTR|SLC38A1_ENST00000549049.1_Missense_Mutation_p.G100R|SLC38A1_ENST00000439706.1_Missense_Mutation_p.G100R|SLC38A1_ENST00000552197.1_Missense_Mutation_p.G100R|SLC38A1_ENST00000546893.1_Missense_Mutation_p.G100R	NM_001077484.1|NM_001278387.1|NM_001278388.1|NM_001278389.1|NM_030674.3	NP_001070952.1|NP_001265316.1|NP_001265317.1|NP_001265318.1|NP_109599.3	Q9H2H9	S38A1_HUMAN	solute carrier family 38, member 1	100					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|neutral amino acid transport (GO:0015804)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neutral amino acid transmembrane transporter activity (GO:0015175)|sodium:amino acid symporter activity (GO:0005283)			NS(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(2)	23	Lung SC(27;0.137)|Renal(347;0.236)		all cancers(1;0.00805)|OV - Ovarian serous cystadenocarcinoma(5;0.0106)|Epithelial(2;0.0344)			AGTAGGATTCCAGTGTTTGCC	0.403																																					p.G100R													.	.			0			c.G298A												56.0	51.0	52.0					12																	46622952		1872	4109	5981	SO:0001583	missense	81539	exon5			GGATTCCAGTGTT	AF271070	CCDS41774.1, CCDS61106.1	12q13.11	2013-05-22				ENSG00000111371		"""Solute carriers"""	13447	protein-coding gene	gene with protein product		608490				10891391	Standard	NM_030674		Approved	ATA1, NAT2, SAT1	uc001rpc.3	Q9H2H9		ENST00000398637.5:c.298G>A	12.37:g.46622952C>T	ENSP00000381634:p.Gly100Arg		Somatic	144	0	0		WXS	Illumina HiSeq	.	108	0.47	51	NM_030674	1	0.00	0	Q8NC61|Q8NCF8|Q96JX2|Q9H2Q2	Missense_Mutation	SNP	ENST00000398637.5	37	CCDS41774.1	.	.	.	.	.	.	.	.	.	.	C	34	5.310675	0.95629	.	.	ENSG00000111371	ENST00000549049;ENST00000439706;ENST00000398637;ENST00000546893;ENST00000552197	T;T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09;-0.09	5.13	5.13	0.70059	.	0.187376	0.39475	N	0.001353	D	0.82554	0.5062	M	0.86864	2.845	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.85524	0.1205	10	0.87932	D	0	-12.3139	18.7708	0.91892	0.0:1.0:0.0:0.0	.	100;100;100	B5MEC5;F8VX04;Q9H2H9	.;.;S38A1_HUMAN	R	100	ENSP00000449607:G100R;ENSP00000398142:G100R;ENSP00000381634:G100R;ENSP00000447853:G100R;ENSP00000449756:G100R	ENSP00000381634:G100R	G	-	1	0	SLC38A1	44909219	1.000000	0.71417	0.933000	0.37362	0.997000	0.91878	7.609000	0.82925	2.669000	0.90835	0.591000	0.81541	GGA			0.403	SLC38A1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404218.2			
HNRNPA1	3178	bcgsc.ca	37	12	54677642	54677642	+	Silent	SNP	C	C	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr12:54677642C>T	ENST00000340913.6	+	9	1007	c.954C>T	c.(952-954)taC>taT	p.Y318Y	HNRNPA1_ENST00000547276.1_Silent_p.Y213Y|HNRNPA1_ENST00000330752.8_Silent_p.Y253Y|RP11-968A15.8_ENST00000553061.1_RNA|HNRNPA1_ENST00000546500.1_Silent_p.Y266Y	NM_002136.2|NM_031157.2	NP_002127.1|NP_112420.1	P09651	ROA1_HUMAN	heterogeneous nuclear ribonucleoprotein A1	318	Gly-rich.				cell death (GO:0008219)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|nuclear export (GO:0051168)|nuclear import (GO:0051170)|RNA export from nucleus (GO:0006405)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)|single-stranded RNA binding (GO:0003727)			endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20						TTGGGAATTACAACAATCAGT	0.448																																					p.Y318Y	Colon(83;502 1289 8436 16406 24870)												.	HNRNPA1	72		0			c.C954T												124.0	129.0	127.0					12																	54677642		2018	4181	6199	SO:0001819	synonymous_variant	3178	exon9			GAATTACAACAAT	BC009600	CCDS41793.1, CCDS44909.1	12q13.1	2013-10-11		2007-08-16	ENSG00000135486	ENSG00000135486		"""RNA binding motif (RRM) containing"""	5031	protein-coding gene	gene with protein product		164017		HNRPA1		1733858	Standard	XR_245923		Approved	hnRNPA1, hnRNP-A1	uc001sfl.3	P09651		ENST00000340913.6:c.954C>T	12.37:g.54677642C>T			Somatic	56	0	0		WXS	Illumina HiSeq	Phase_1	50	0.00	0	NM_031157	3860	0.00	0	A8K4Z8|Q3MIB7|Q6PJZ7	Silent	SNP	ENST00000340913.6	37	CCDS44909.1																																																																																					0.448	HNRNPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000405480.1		NM_031157	
MPHOSPH8	54737	mdanderson.org	37	13	20242564	20242564	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr13:20242564G>T	ENST00000361479.5	+	11	2290	c.2222G>T	c.(2221-2223)cGc>cTc	p.R741L	MPHOSPH8_ENST00000414242.2_Missense_Mutation_p.R741L	NM_017520.3	NP_059990.2	Q99549	MPP8_HUMAN	M-phase phosphoprotein 8	741					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of DNA methylation (GO:0044030)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nuclear nucleosome (GO:0000788)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	methylated histone binding (GO:0035064)			breast(2)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(29;2.83e-16)|all_lung(29;1.16e-17)|all_epithelial(30;8.13e-16)|Lung NSC(5;6.91e-15)|Lung SC(185;0.0367)		all cancers(112;8.43e-05)|Epithelial(112;0.000426)|OV - Ovarian serous cystadenocarcinoma(117;0.00596)|Lung(94;0.015)|LUSC - Lung squamous cell carcinoma(192;0.0795)		TTTGAAGCTCGCCTTGCTCTG	0.383																																					p.R741L													MPHOSPH8,NS,carcinoma,+1,1	MPHOSPH8	1	1	0			c.G2222T												101.0	99.0	100.0					13																	20242564		2203	4300	6503	SO:0001583	missense	54737	exon11			AAGCTCGCCTTGC	AK056785, AJ293409	CCDS9287.1	13q12.11	2013-01-10			ENSG00000196199	ENSG00000196199		"""Ankyrin repeat domain containing"""	29810	protein-coding gene	gene with protein product		611626				8885239	Standard	NM_017520		Approved	mpp8, HSMPP8	uc001umh.3	Q99549	OTTHUMG00000016498	ENST00000361479.5:c.2222G>T	13.37:g.20242564G>T	ENSP00000355388:p.Arg741Leu		Somatic	112	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_017520	85	0.00	0	B7Z6F9|Q5JPE5|Q5JTQ0|Q86TK3|Q96MK4|Q9BTP1	Missense_Mutation	SNP	ENST00000361479.5	37	CCDS9287.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.54|18.54	3.646503|3.646503	0.67358|0.67358	.|.	.|.	ENSG00000196199|ENSG00000196199	ENST00000449056|ENST00000414242;ENST00000360754;ENST00000361479	.|T;T	.|0.38401	.|1.19;1.14	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	.|0.175143	.|0.49305	.|D	.|0.000142	T|T	0.49490|0.49490	0.1560|0.1560	N|N	0.24115|0.24115	0.695|0.695	0.49798|0.49798	D|D	0.999826|0.999826	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.78314	.|0.98;0.991	T|T	0.53129|0.53129	-0.8482|-0.8482	5|10	.|0.87932	.|D	.|0	.|.	19.7301|19.7301	0.96179|0.96179	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|741;741	.|Q99549;Q99549-2	.|MPP8_HUMAN;.	S|L	12|741;70;741	.|ENSP00000414663:R741L;ENSP00000355388:R741L	.|ENSP00000353982:R70L	A|R	+|+	1|2	0|0	MPHOSPH8|MPHOSPH8	19140564|19140564	1.000000|1.000000	0.71417|0.71417	0.944000|0.944000	0.38274|0.38274	0.775000|0.775000	0.43874|0.43874	7.447000|7.447000	0.80620|0.80620	2.670000|2.670000	0.90874|0.90874	0.585000|0.585000	0.79938|0.79938	GCC|CGC			0.383	MPHOSPH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044028.2		NM_017520	
FRY	10129	mdanderson.org	37	13	32869364	32869364	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr13:32869364G>T	ENST00000380250.3	+	61	9305	c.8809G>T	c.(8809-8811)Gga>Tga	p.G2937*	FRY_ENST00000542859.1_Nonsense_Mutation_p.G307*|RP11-37E23.5_ENST00000418076.1_RNA|FRY_ENST00000380217.1_Nonsense_Mutation_p.G119*	NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	2937						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		TGACATCTTTGGAAGCAGTTC	0.443																																					p.G2937X													.	.			0			c.G8809T												125.0	113.0	117.0					13																	32869364		1886	4127	6013	SO:0001587	stop_gained	10129	exon61			ATCTTTGGAAGCA	AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.8809G>T	13.37:g.32869364G>T	ENSP00000369600:p.Gly2937*		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_023037	16	0.00	0	Q9Y3N6	Nonsense_Mutation	SNP	ENST00000380250.3	37	CCDS41875.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.383252	0.82792	.	.	ENSG00000073910	ENST00000380250;ENST00000542859;ENST00000380217	.	.	.	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.5525	0.95326	0.0:0.0:1.0:0.0	.	.	.	.	X	2937;307;119	.	ENSP00000369565:G119X	G	+	1	0	FRY	31767364	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.663000	0.98605	2.626000	0.88956	0.650000	0.86243	GGA			0.443	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044405.1		NM_023037	
RPL10L	140801	broad.mit.edu	37	14	47120796	47120796	+	Silent	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr14:47120796G>T	ENST00000298283.3	-	1	232	c.144C>A	c.(142-144)ctC>ctA	p.L48L		NM_080746.2	NP_542784.1	Q96L21	RL10L_HUMAN	ribosomal protein L10-like	48					spermatogenesis (GO:0007283)|translation (GO:0006412)	cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)	structural constituent of ribosome (GO:0003735)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(20)|ovary(1)	27						TGTGGCCACCGAGTGGGAACT	0.512																																					p.L48L													.	RPL10L	64		0			c.C144A												94.0	96.0	95.0					14																	47120796		2203	4300	6503	SO:0001819	synonymous_variant	140801	exon1			GCCACCGAGTGGG	AB063608	CCDS32071.1	14q21.2	2011-09-15			ENSG00000165496	ENSG00000165496		"""L ribosomal proteins"""	17976	protein-coding gene	gene with protein product						19123937	Standard	NM_080746		Approved		uc001wwg.3	Q96L21	OTTHUMG00000157869	ENST00000298283.3:c.144C>A	14.37:g.47120796G>T			Somatic	134	0	0		WXS	Illumina HiSeq	Phase_I	125	0.03	4	NM_080746	30	0.00	0	Q8IUD1	Silent	SNP	ENST00000298283.3	37	CCDS32071.1																																																																																					0.512	RPL10L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000349819.1			
SLC8A3	6547	bcgsc.ca	37	14	70633871	70633871	+	Silent	SNP	T	T	C			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr14:70633871T>C	ENST00000381269.2	-	2	2022	c.1269A>G	c.(1267-1269)ggA>ggG	p.G423G	SLC8A3_ENST00000356921.2_Silent_p.G423G|SLC8A3_ENST00000357887.3_Silent_p.G423G|SLC8A3_ENST00000534137.1_Silent_p.G423G|SLC8A3_ENST00000528359.1_Silent_p.G423G	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	423	Calx-beta 1.				blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		TTGACATGTCTCCCCCTTTCC	0.507																																					p.G423G													.	SLC8A3	234		0			c.A1269G												128.0	119.0	122.0					14																	70633871		2203	4300	6503	SO:0001819	synonymous_variant	6547	exon2			CATGTCTCCCCCT	AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.1269A>G	14.37:g.70633871T>C			Somatic	103	0	0		WXS	Illumina HiSeq	Phase_1	93	0.00	0	NM_183002	0		0	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Silent	SNP	ENST00000381269.2	37	CCDS35498.1																																																																																					0.507	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000390736.1			
EIF3J	8669	broad.mit.edu	37	15	44829415	44829415	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr15:44829415C>G	ENST00000535391.1	+	1	35	c.23C>G	c.(22-24)gCg>gGg	p.A8G	EIF3J-AS1_ENST00000313807.4_lincRNA|EIF3J_ENST00000424492.3_Missense_Mutation_p.A8G|EIF3J_ENST00000261868.5_Missense_Mutation_p.A8G					eukaryotic translation initiation factor 3, subunit J											endometrium(1)|large_intestine(5)|liver(2)|skin(1)	9		all_cancers(109;2.81e-14)|all_epithelial(112;2.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;3.13e-20)|GBM - Glioblastoma multiforme(94;9.81e-07)|COAD - Colon adenocarcinoma(120;0.0754)|Colorectal(105;0.0758)		gcggcggcggcggGGGACTCG	0.701																																					p.A8G													.	EIF3J	29		0			c.C23G												6.0	8.0	7.0					15																	44829415		1994	4063	6057	SO:0001583	missense	8669	exon1			CGGCGGCGGGGGA	U97670	CCDS10111.1, CCDS61612.1, CCDS61613.1	15q21.1	2014-05-13	2007-07-27	2007-07-27	ENSG00000104131	ENSG00000104131			3270	protein-coding gene	gene with protein product		603910	"""eukaryotic translation initiation factor 3, subunit 1 alpha, 35kDa"""	EIF3S1		9822659	Standard	NM_001284335		Approved	eIF3-p35, eIF3-alpha, eIF3j	uc001ztv.3	O75822	OTTHUMG00000131158	ENST00000535391.1:c.23C>G	15.37:g.44829415C>G	ENSP00000440221:p.Ala8Gly		Somatic	381	0.0104986877	4		WXS	Illumina HiSeq	Phase_I	366	0.02	9	NM_003758	76	0.01	1		Missense_Mutation	SNP	ENST00000535391.1	37		.	.	.	.	.	.	.	.	.	.	c	6.646	0.487769	0.12641	.	.	ENSG00000104131	ENST00000261868;ENST00000535391;ENST00000424492	T;T	0.52754	0.85;0.65	4.22	2.26	0.28386	.	0.604873	0.14767	N	0.299634	T	0.20740	0.0499	N	0.08118	0	0.21950	N	0.999458	B;P;B	0.35780	0.385;0.52;0.385	B;B;B	0.25614	0.028;0.062;0.019	T	0.07829	-1.0752	10	0.40728	T	0.16	.	6.2247	0.20701	0.1833:0.7184:0.0:0.0984	.	8;8;8	B4DUI3;F5H425;O75822	.;.;EIF3J_HUMAN	G	8	ENSP00000261868:A8G;ENSP00000414548:A8G	ENSP00000261868:A8G	A	+	2	0	EIF3J	42616707	0.995000	0.38212	0.983000	0.44433	0.005000	0.04900	1.766000	0.38491	0.505000	0.28104	-0.150000	0.13652	GCG			0.701	EIF3J-002	NOVEL	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000396804.1		NM_003758	
NR2E3	10002	mdanderson.org	37	15	72105863	72105863	+	RNA	SNP	G	G	A	rs1805024		TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr15:72105863G>A	ENST00000398840.2	+	0	1072							Q9Y5X4	NR2E3_HUMAN	nuclear receptor subfamily 2, group E, member 3						eye photoreceptor cell development (GO:0042462)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction (GO:0007602)|positive regulation of rhodopsin gene expression (GO:0045872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|lung(1)	3						GCCGGCTCACGCTGGCCAGCA	0.662													G|||	1	0.000199681	0.0	0.0	5008	,	,		18394	0.001		0.0	False		,,,				2504	0.0				p.T294T													.	.			0			c.G882A												39.0	42.0	41.0					15																	72105863		1970	4151	6121			10002	exon6			GCTCACGCTGGCC		CCDS73750.1, CCDS73751.1	15q23	2013-01-16			ENSG00000031544	ENSG00000278570		"""Nuclear hormone receptors"""	7974	protein-coding gene	gene with protein product		604485				10220376	Standard	NM_016346		Approved	PNR, rd7, RP37	uc002ath.1	Q9Y5X4	OTTHUMG00000172841		15.37:g.72105863G>A			Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	50	0.08	4	NM_014249	0		0	B6ZGU0|Q9UHM4	Silent	SNP	ENST00000398840.2	37																																																																																						0.662	NR2E3-202	KNOWN	basic	processed_transcript	processed_transcript				NM_014249	
LOC645752	645752	broad.mit.edu	37	15	78217296	78217296	+	lincRNA	SNP	A	A	G			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr15:78217296A>G	ENST00000565869.1	+	0	706				RP11-114H24.2_ENST00000567226.1_RNA																							GTGAGTGGCAACCACCAGAAG	0.527																																					.													.	.			0			.																																											0	.			GTGGCAACCACCA																													15.37:g.78217296A>G			Somatic	124	0.0161290323	2		WXS	Illumina HiSeq	Phase_I	144	0.08	11	.	0		0		RNA	SNP	ENST00000565869.1	37																																																																																						0.527	RP11-114H24.7-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000421587.1			
ADAMTS7	11173	ucsc.edu	37	15	79069120	79069120	+	Missense_Mutation	SNP	C	C	T	rs146326084		TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr15:79069120C>T	ENST00000388820.4	-	10	1741	c.1531G>A	c.(1531-1533)Gtg>Atg	p.V511M	ADAMTS7_ENST00000566303.1_Intron	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	511	Disintegrin.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						GTGCCGTCCACAGCTGCATCC	0.632																																					p.V511M													.	ADAMTS7	142		0			c.G1531A												77.0	57.0	64.0					15																	79069120		2133	4168	6301	SO:0001583	missense	11173	exon10			CGTCCACAGCTGC	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.1531G>A	15.37:g.79069120C>T	ENSP00000373472:p.Val511Met		Somatic	57	0.0526315789	3		WXS	Illumina HiSeq		49	0.16	8	NM_014272	2	0.00	0	Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	37	CCDS32303.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.110561	0.77210	.	.	ENSG00000136378	ENST00000388820	T	0.60797	0.16	4.09	4.09	0.47781	.	0.000000	0.64402	D	0.000002	T	0.69415	0.3108	L	0.47190	1.495	0.54753	D	0.999984	D;D	0.89917	0.997;1.0	D;D	0.83275	0.973;0.996	T	0.72991	-0.4123	10	0.66056	D	0.02	.	15.0607	0.71951	0.0:1.0:0.0:0.0	.	511;511	A8MQ00;Q9UKP4	.;ATS7_HUMAN	M	511	ENSP00000373472:V511M	ENSP00000373472:V511M	V	-	1	0	ADAMTS7	76856175	1.000000	0.71417	0.986000	0.45419	0.699000	0.40488	5.468000	0.66743	2.097000	0.63578	0.555000	0.69702	GTG			0.632	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000421331.1		NM_014272	
AKAP13	11214	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	15	86118561	86118561	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr15:86118561G>T	ENST00000394518.2	+	6	956		c.e6+1		AKAP13_ENST00000361243.2_Splice_Site	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13						apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						GCAACTAATGGTAAGTCAGAA	0.383																																					.	Melanoma(94;603 1453 3280 32295 32951)												.	.			0			c.861+1G>T												90.0	89.0	89.0					15																	86118561		2202	4299	6501	SO:0001630	splice_region_variant	11214	exon6			CTAATGGTAAGTC	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.861+1G>T	15.37:g.86118561G>T			Somatic	116	0	0		WXS	Illumina HiSeq	.	160	0.18	29	NM_006738	1	0.00	0	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Splice_Site	SNP	ENST00000394518.2	37	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	G	16.14	3.038798	0.55003	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7506	0.69522	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AKAP13	83919565	1.000000	0.71417	1.000000	0.80357	0.630000	0.37929	4.162000	0.58177	2.941000	0.99782	0.655000	0.94253	.			0.383	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000417318.1		NM_007200	Intron
NME4	4833	mdanderson.org	37	16	450302	450302	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr16:450302G>A	ENST00000219479.2	+	5	538	c.524G>A	c.(523-525)tGg>tAg	p.W175*	DECR2_ENST00000424398.2_5'Flank|DECR2_ENST00000219481.5_5'Flank|NME4_ENST00000450036.1_Nonsense_Mutation_p.W105*|DECR2_ENST00000397710.1_5'Flank|NME4_ENST00000382940.4_Nonsense_Mutation_p.W183*|NME4_ENST00000397722.1_Nonsense_Mutation_p.W105*	NM_005009.2	NP_005000.1	O00746	NDKM_HUMAN	NME/NM23 nucleoside diphosphate kinase 4	175					CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|small molecule metabolic process (GO:0044281)|UTP biosynthetic process (GO:0006228)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			NS(1)|lung(1)|stomach(1)|urinary_tract(1)	4		Hepatocellular(16;0.00015)				CTGGTGAGCTGGGCAGACGGG	0.652																																					p.W175X													.	.			0			c.G524A												48.0	52.0	51.0					16																	450302		2202	4297	6499	SO:0001587	stop_gained	4833	exon5			TGAGCTGGGCAGA	Y07604	CCDS10408.1, CCDS66886.1, CCDS73797.1	16p13.3	2013-04-29	2012-05-18		ENSG00000103202	ENSG00000103202			7852	protein-coding gene	gene with protein product		601818	"""non-metastatic cells 4, protein expressed in"""			9099850, 19852809	Standard	NM_005009		Approved	nm23-H4, NM23H4, NDPKD	uc002cgz.3	O00746	OTTHUMG00000047995	ENST00000219479.2:c.524G>A	16.37:g.450302G>A	ENSP00000219479:p.Trp175*		Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	15	0.13	2	NM_005009	191	0.00	0	A2IDD0|Q5U0M9	Nonsense_Mutation	SNP	ENST00000219479.2	37	CCDS10408.1	.	.	.	.	.	.	.	.	.	.	G	39	7.880636	0.98539	.	.	ENSG00000103202	ENST00000397722;ENST00000219479;ENST00000382940;ENST00000450036	.	.	.	4.58	4.58	0.56647	.	0.125811	0.64402	D	0.000018	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.2912	16.1265	0.81400	0.0:0.0:1.0:0.0	.	.	.	.	X	105;175;183;105	.	ENSP00000219479:W175X	W	+	2	0	NME4	390303	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	5.549000	0.67261	2.366000	0.80165	0.561000	0.74099	TGG			0.652	NME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000109256.2		NM_005009	
ZNF174	7727	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	16	3458752	3458752	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr16:3458752C>A	ENST00000268655.4	+	3	1642	c.1057C>A	c.(1057-1059)Ccc>Acc	p.P353T	ZNF174_ENST00000571936.1_Missense_Mutation_p.P353T	NM_003450.2	NP_003441.1	Q15697	ZN174_HUMAN	zinc finger protein 174	353					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|urinary_tract(2)	12						AGGAGAGAGACCCTACACGTG	0.532																																					p.P353T													.	.			0			c.C1057A												57.0	63.0	61.0					16																	3458752		2197	4300	6497	SO:0001583	missense	7727	exon3			GAGAGACCCTACA	U31248	CCDS10504.1, CCDS32380.1	16p13	2013-01-09			ENSG00000103343	ENSG00000103343		"""-"", ""Zinc fingers, C2H2-type"""	12963	protein-coding gene	gene with protein product		603900					Standard	NM_003450		Approved	ZSCAN8	uc002cvc.3	Q15697	OTTHUMG00000129358	ENST00000268655.4:c.1057C>A	16.37:g.3458752C>A	ENSP00000268655:p.Pro353Thr		Somatic	142	0	0		WXS	Illumina HiSeq	.	111	0.23	25	NM_003450	22	0.27	6	Q53Y68|Q9BQ34	Missense_Mutation	SNP	ENST00000268655.4	37	CCDS10504.1	.	.	.	.	.	.	.	.	.	.	C	15.60	2.880733	0.51801	.	.	ENSG00000103343	ENST00000268655	T	0.56275	0.47	4.72	4.72	0.59763	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.46442	D	0.000286	T	0.71264	0.3319	M	0.71036	2.16	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73069	-0.4099	10	0.66056	D	0.02	.	16.0081	0.80377	0.0:1.0:0.0:0.0	.	353	Q15697	ZN174_HUMAN	T	353	ENSP00000268655:P353T	ENSP00000268655:P353T	P	+	1	0	ZNF174	3398753	1.000000	0.71417	0.998000	0.56505	0.367000	0.29736	5.888000	0.69758	2.906000	0.99361	0.655000	0.94253	CCC			0.532	ZNF174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251510.1		NM_003450	
SRCAP	10847	broad.mit.edu;mdanderson.org	37	16	30732548	30732548	+	Missense_Mutation	SNP	C	C	T	rs556230791		TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr16:30732548C>T	ENST00000262518.4	+	21	3677	c.3292C>T	c.(3292-3294)Cgg>Tgg	p.R1098W	SRCAP_ENST00000395059.2_Missense_Mutation_p.R1098W|SRCAP_ENST00000344771.4_Intron	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1098	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			TGGGACCTCACGGCCTCCCAC	0.607																																					p.R1098W													.	SRCAP	298		0			c.C3292T												105.0	114.0	111.0					16																	30732548		2197	4300	6497	SO:0001583	missense	10847	exon21			ACCTCACGGCCTC	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.3292C>T	16.37:g.30732548C>T	ENSP00000262518:p.Arg1098Trp		Somatic	117	0.0085470085	1		WXS	Illumina HiSeq	Phase_I	86	0.05	4	NM_006662	71	0.00	0	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	37	CCDS10689.2	.	.	.	.	.	.	.	.	.	.	C	11.85	1.761665	0.31228	.	.	ENSG00000080603	ENST00000262518;ENST00000395059	D;D	0.92249	-3.0;-2.94	5.36	0.871	0.19107	.	.	.	.	.	D	0.83774	0.5327	N	0.14661	0.345	0.80722	D	1	B;B	0.18461	0.028;0.016	B;B	0.13407	0.009;0.004	T	0.74349	-0.3694	9	0.37606	T	0.19	-4.7484	13.881	0.63682	0.6358:0.3642:0.0:0.0	.	1098;1098	Q6ZRS2-2;Q6ZRS2	.;SRCAP_HUMAN	W	1098	ENSP00000262518:R1098W;ENSP00000378499:R1098W	ENSP00000262518:R1098W	R	+	1	2	SRCAP	30640049	0.999000	0.42202	1.000000	0.80357	0.981000	0.71138	0.338000	0.19858	0.361000	0.24292	0.557000	0.71058	CGG			0.607	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255523.1		NM_006662	
HSD3B7	80270	mdanderson.org	37	16	30999089	30999089	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr16:30999089G>T	ENST00000297679.5	+	7	788	c.695G>T	c.(694-696)gGc>gTc	p.G232V	AC135048.1_ENST00000602217.1_5'Flank|HSD3B7_ENST00000262520.6_Splice_Site_p.A178S|HSD3B7_ENST00000353250.5_Splice_Site_p.A178S	NM_025193.3	NP_079469.2	Q9H2F3	3BHS7_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7	232					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|cholest-5-ene-3-beta,7-alpha-diol 3-beta-dehydrogenase activity (GO:0047016)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						CCACCGGCAGGCAATGTTGCC	0.642																																					p.G232V													.	.			0			c.G695T												58.0	59.0	58.0					16																	30999089		2174	4262	6436	SO:0001630	splice_region_variant	80270	exon7			CGGCAGGCAATGT	AF277719	CCDS10698.1, CCDS45466.1	16p11.2	2011-09-14			ENSG00000099377	ENSG00000099377	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	18324	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 3"""	607764				11067870, 19027726	Standard	NM_001142777		Approved	C(27)-3BETA-HSD, SDR11E3	uc002eaf.2	Q9H2F3	OTTHUMG00000132417	ENST00000297679.5:c.695-1G>T	16.37:g.30999089G>T			Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_025193	13	0.00	0	Q96M28|Q9BSN9	Missense_Mutation	SNP	ENST00000297679.5	37	CCDS10698.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.623|7.623	0.677191|0.677191	0.14841|0.14841	.|.	.|.	ENSG00000099377|ENSG00000099377	ENST00000262520;ENST00000353250|ENST00000297679	D;D|D	0.84298|0.86164	-1.83;-1.83|-2.08	5.1|5.1	4.15|4.15	0.48705|0.48705	.|3-beta hydroxysteroid dehydrogenase/isomerase (1);NAD(P)-binding domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.94650|0.94650	0.8275|0.8275	M|M	0.93283|0.93283	3.4|3.4	0.80722|0.80722	D|D	1|1	B|D	0.13594|0.89917	0.008|1.0	B|D	0.19946|0.97110	0.027|1.0	D|D	0.95240|0.95240	0.8350|0.8350	8|9	.|.	.|.	.|.	.|.	12.4484|12.4484	0.55664|0.55664	0.083:0.0:0.917:0.0|0.083:0.0:0.917:0.0	.|.	178|232	Q96M28|Q9H2F3	.|3BHS7_HUMAN	S|V	178|232	ENSP00000262520:A178S;ENSP00000370662:A178S|ENSP00000297679:G232V	.|.	A|G	+|+	1|2	0|0	HSD3B7|HSD3B7	30906590|30906590	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.395000|0.395000	0.30598|0.30598	8.931000|8.931000	0.92884|0.92884	1.144000|1.144000	0.42321|0.42321	0.655000|0.655000	0.94253|0.94253	GCA|GGC			0.642	HSD3B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255554.2			Missense_Mutation
PARD6A	50855	mdanderson.org	37	16	67695453	67695453	+	Silent	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr16:67695453G>T	ENST00000219255.3	+	2	239	c.159G>T	c.(157-159)ccG>ccT	p.P53P	ENKD1_ENST00000602409.1_5'Flank|PARD6A_ENST00000602551.1_Silent_p.P53P|PARD6A_ENST00000458121.2_Silent_p.P53P|ACD_ENST00000219251.8_5'Flank|ACD_ENST00000393919.4_5'Flank			Q9NPB6	PAR6A_HUMAN	par-6 family cell polarity regulator alpha	53	Interaction with PRKCI and PRKCZ.|OPR.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell junction assembly (GO:0034329)|cell-cell junction maintenance (GO:0045217)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|cell projection (GO:0042995)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	GTP-dependent protein binding (GO:0030742)|Rho GTPase binding (GO:0017048)|transcription factor binding (GO:0008134)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(2)	6		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)		ACCAGATCCCGGGCCTGGACG	0.687																																					p.P53P													.	.			0			c.G159T												66.0	72.0	70.0					16																	67695453		2198	4300	6498	SO:0001819	synonymous_variant	50855	exon2			GATCCCGGGCCTG		CCDS10843.1, CCDS45514.1	16q22.1-q22.3	2013-08-28	2013-08-28		ENSG00000102981	ENSG00000102981			15943	protein-coding gene	gene with protein product		607484	"""par-6 (partitioning defective 6, C.elegans) homolog alpha"", ""par-6 partitioning defective 6 homolog alpha (C. elegans)"""			9482110, 11260256	Standard	XM_005255977		Approved	PAR-6, PAR-6A, TAX40, PAR6alpha, TIP-40	uc002ett.3	Q9NPB6	OTTHUMG00000137534	ENST00000219255.3:c.159G>T	16.37:g.67695453G>T			Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	30	0.10	3	NM_016948	5	0.00	0	O14911|Q9NPJ7	Silent	SNP	ENST00000219255.3	37	CCDS10843.1																																																																																					0.687	PARD6A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000268863.2		NM_016948	
HYDIN	54768	bcgsc.ca	37	16	70913326	70913326	+	Silent	SNP	C	C	G			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr16:70913326C>G	ENST00000393567.2	-	62	10581	c.10431G>C	c.(10429-10431)gtG>gtC	p.V3477V		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	3477					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GCACAACCGTCACTCGAGGGA	0.552																																					p.V3477V													.	HYDIN	788		0			c.G10431C												21.0	24.0	23.0					16																	70913326		1839	4087	5926	SO:0001819	synonymous_variant	54768	exon62			AACCGTCACTCGA	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.10431G>C	16.37:g.70913326C>G			Somatic	81	0	0		WXS	Illumina HiSeq	Phase_1	69	0.00	0	NM_001270974	0		0	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	ENST00000393567.2	37	CCDS59269.1																																																																																					0.552	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000398624.3			
NTN1	9423	bcgsc.ca	37	17	9086578	9086578	+	Intron	SNP	C	C	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr17:9086578C>T	ENST00000173229.2	+	5	1518				NTN1_ENST00000546090.1_Intron|NTN1_ENST00000538852.1_Intron	NM_004822.2	NP_004813.2	O95631	NET1_HUMAN	netrin 1						anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|establishment of nucleus localization (GO:0040023)|inner ear morphogenesis (GO:0042472)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of axon extension (GO:0030517)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of cell proliferation (GO:0008284)|regulation of cell migration (GO:0030334)|single organismal cell-cell adhesion (GO:0016337)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)			NTN1/ACLY(2)	central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(5)	13						CCCGCCAGCCCAACACCTTCC	0.557																																					.													.	NTN1	31		0			.																																									SO:0001627	intron_variant	9423	.			CCAGCCCAACACC	U75586	CCDS11148.1	17p13-p12	2013-03-01			ENSG00000065320	ENSG00000065320		"""Netrins"""	8029	protein-coding gene	gene with protein product	"""Netrin-1"""	601614				9950216	Standard	NM_004822		Approved	NTN1L	uc002glw.4	O95631	OTTHUMG00000130257	ENST00000173229.2:c.1411+292C>T	17.37:g.9086578C>T			Somatic	196	0.0102040816	2		WXS	Illumina HiSeq	Phase_1	163	0.00	0	.	0		0	E9KL51	Silent	SNP	ENST00000173229.2	37	CCDS11148.1																																																																																					0.557	NTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252583.1			
KRT35	3886	mdanderson.org	37	17	39637213	39637213	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr17:39637213G>T	ENST00000393989.1	-	1	179	c.137C>A	c.(136-138)gCc>gAc	p.A46D	KRT35_ENST00000246639.2_Missense_Mutation_p.A16D	NM_002280.4	NP_002271.3	Q92764	KRT35_HUMAN	keratin 35	46	Head.				anatomical structure morphogenesis (GO:0009653)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	29		Breast(137;0.000286)				GAAACTTCTGGCCACAGGGGA	0.627																																					p.A46D													.	.			0			c.C137A												42.0	51.0	48.0					17																	39637213		2055	4218	6273	SO:0001583	missense	3886	exon1			CTTCTGGCCACAG	X90762	CCDS11394.2	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000197079	ENSG00000197079		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6453	protein-coding gene	gene with protein product	"""hard keratin type I 5"""	602764	"""keratin, hair, acidic, 5"""	KRTHA5		8823373, 16831889	Standard	NM_002280		Approved	Ha-5	uc002hws.3	Q92764	OTTHUMG00000133425	ENST00000393989.1:c.137C>A	17.37:g.39637213G>T	ENSP00000377558:p.Ala46Asp		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	55	0.05	3	NM_002280	0		0	O76012|Q92651	Missense_Mutation	SNP	ENST00000393989.1	37	CCDS11394.2	.	.	.	.	.	.	.	.	.	.	G	6.712	0.500062	0.12762	.	.	ENSG00000197079	ENST00000246639;ENST00000393989	D;T	0.81739	-1.53;-1.45	5.17	4.16	0.48862	.	0.906693	0.09327	N	0.817386	T	0.77558	0.4148	L	0.53249	1.67	0.09310	N	1	B	0.26935	0.164	B	0.24155	0.051	T	0.65043	-0.6264	10	0.35671	T	0.21	.	13.9463	0.64086	0.0:0.2352:0.7648:0.0	.	46	Q92764	KRT35_HUMAN	D	16;46	ENSP00000246639:A16D;ENSP00000377558:A46D	ENSP00000246639:A16D	A	-	2	0	KRT35	36890739	0.000000	0.05858	0.009000	0.14445	0.071000	0.16799	-0.434000	0.06939	2.695000	0.91970	0.462000	0.41574	GCC			0.627	KRT35-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_002280	
ASB16	92591	mdanderson.org	37	17	42249642	42249642	+	Missense_Mutation	SNP	C	C	T	rs146107168		TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr17:42249642C>T	ENST00000293414.1	+	2	614	c.530C>T	c.(529-531)aCg>aTg	p.T177M		NM_080863.4	NP_543139.4	Q96NS5	ASB16_HUMAN	ankyrin repeat and SOCS box containing 16	177					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|liver(2)|lung(2)|prostate(1)	14		Breast(137;0.00765)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.114)		GAGGAGGGCACGACTCCTTTG	0.602																																					p.T177M													.	.			0			c.C530T												81.0	67.0	71.0					17																	42249642		2203	4300	6503	SO:0001583	missense	92591	exon2			AGGGCACGACTCC	AK054727	CCDS11478.1	17q21.31	2013-01-10	2011-01-25		ENSG00000161664	ENSG00000161664		"""Ankyrin repeat domain containing"""	19768	protein-coding gene	gene with protein product		615056	"""ankyrin repeat and SOCS box-containing 16"""			12076535	Standard	NM_080863		Approved	FLJ30165	uc002ifl.1	Q96NS5	OTTHUMG00000181809	ENST00000293414.1:c.530C>T	17.37:g.42249642C>T	ENSP00000293414:p.Thr177Met		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_080863	1	0.00	0	B2RBC0|Q8WXK0	Missense_Mutation	SNP	ENST00000293414.1	37	CCDS11478.1	.	.	.	.	.	.	.	.	.	.	C	1.784	-0.481255	0.04383	.	.	ENSG00000161664	ENST00000293414	T	0.64991	-0.13	5.47	-6.21	0.02065	Ankyrin repeat-containing domain (4);	0.756330	0.13462	N	0.386062	T	0.36082	0.0954	N	0.12182	0.205	0.09310	N	1	B	0.16166	0.016	B	0.14023	0.01	T	0.11991	-1.0565	10	0.30854	T	0.27	-0.0024	11.1634	0.48528	0.0915:0.2286:0.0:0.6799	.	177	Q96NS5	ASB16_HUMAN	M	177	ENSP00000293414:T177M	ENSP00000293414:T177M	T	+	2	0	ASB16	39605168	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.154000	0.10130	-1.320000	0.02283	-1.934000	0.00508	ACG			0.602	ASB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000457703.1			
BZRAP1	9256	bcgsc.ca	37	17	56387403	56387403	+	Silent	SNP	T	T	C	rs146816897		TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr17:56387403T>C	ENST00000343736.4	-	21	3979	c.3816A>G	c.(3814-3816)gaA>gaG	p.E1272E	BZRAP1_ENST00000268893.6_Silent_p.E1212E|BZRAP1_ENST00000355701.3_Silent_p.E1272E			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	1272	Poly-Glu.					cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CCAGctcctcttcctcctcct	0.587																																					p.E1272E													.	BZRAP1	287		0			c.A3816G							T	,	0,4406		0,0,2203	98.0	87.0	91.0		3816,3636	-7.0	0.1	17	dbSNP_134	91	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	BZRAP1	NM_004758.2,NM_024418.1	,	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	,	1272/1858,1212/1798	56387403	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9256	exon21			CTCCTCTTCCTCC	AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.3816A>G	17.37:g.56387403T>C			Somatic	61	0	0		WXS	Illumina HiSeq	Phase_1	39	0.00	0	NM_004758	2	0.00	0	O75111|Q8N5W3	Silent	SNP	ENST00000343736.4	37	CCDS11605.1																																																																																					0.587	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000443980.1		NM_004758	
SDK2	54549	mdanderson.org	37	17	71354245	71354245	+	Missense_Mutation	SNP	G	G	T	rs371296779		TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr17:71354245G>T	ENST00000392650.3	-	40	5566	c.5566C>A	c.(5566-5568)Cgc>Agc	p.R1856S	SDK2_ENST00000388726.3_Missense_Mutation_p.R1837S|SDK2_ENST00000410094.1_5'UTR	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1856	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						ATGACGTAGCGGGTGATGGGC	0.657																																					p.R1856S													.	.			0			c.C5566A												149.0	139.0	143.0					17																	71354245		2203	4300	6503	SO:0001583	missense	54549	exon40			CGTAGCGGGTGAT	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.5566C>A	17.37:g.71354245G>T	ENSP00000376421:p.Arg1856Ser		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_001144952	7	0.00	0	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	37	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	G	16.84	3.233575	0.58886	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893;ENST00000410094	T;T;T	0.56275	0.47;0.47;0.47	5.12	5.12	0.69794	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.30479	0.0766	N	0.04090	-0.28	0.47659	D	0.999486	P;B;B	0.42409	0.779;0.437;0.383	B;B;B	0.39379	0.225;0.298;0.284	T	0.25187	-1.0139	10	0.45353	T	0.12	.	11.6929	0.51527	0.0:0.0:0.7015:0.2985	.	1856;1856;1837	Q58EX2-2;Q58EX2;Q58EX2-3	.;SDK2_HUMAN;.	S	1480;1856;1837;1013;1856;197	ENSP00000376421:R1856S;ENSP00000373378:R1837S;ENSP00000407098:R1013S	ENSP00000324967:R1856S	R	-	1	0	SDK2	68865840	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.164000	0.50770	2.377000	0.81083	0.655000	0.94253	CGC			0.657	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000327598.2		NM_019064	
SDK2	54549	ucsc.edu	37	17	71354282	71354282	+	Missense_Mutation	SNP	G	G	T	rs199537367		TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr17:71354282G>T	ENST00000392650.3	-	40	5529	c.5529C>A	c.(5527-5529)caC>caA	p.H1843Q	SDK2_ENST00000388726.3_Missense_Mutation_p.H1824Q|SDK2_ENST00000410094.1_5'UTR	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1843	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						CGCTGGACCAGTGAATGGCGA	0.662																																					p.H1843Q													.	SDK2	219		0			c.C5529A												146.0	133.0	138.0					17																	71354282		2203	4300	6503	SO:0001583	missense	54549	exon40			GGACCAGTGAATG	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.5529C>A	17.37:g.71354282G>T	ENSP00000376421:p.His1843Gln		Somatic	71	0	0		WXS	Illumina HiSeq		43	0.09	4	NM_001144952	13	0.00	0	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	37	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	G	10.19	1.281923	0.23392	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893;ENST00000410094	T;T;T	0.55588	0.51;0.51;0.51	5.12	4.14	0.48551	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.23846	0.0577	N	0.03177	-0.4	0.48185	D	0.999604	B;B;B	0.33103	0.397;0.06;0.104	B;B;B	0.26517	0.042;0.07;0.042	T	0.15206	-1.0445	10	0.13470	T	0.59	.	11.6969	0.51548	0.1418:0.0:0.8582:0.0	.	1843;1843;1824	Q58EX2-2;Q58EX2;Q58EX2-3	.;SDK2_HUMAN;.	Q	1467;1843;1824;1000;1843;184	ENSP00000376421:H1843Q;ENSP00000373378:H1824Q;ENSP00000407098:H1000Q	ENSP00000324967:H1843Q	H	-	3	2	SDK2	68865877	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.484000	0.60271	2.377000	0.81083	0.655000	0.94253	CAC			0.662	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000327598.2		NM_019064	
CXXC1	30827	mdanderson.org	37	18	47810404	47810404	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr18:47810404G>T	ENST00000285106.6	-	10	1987	c.1273C>A	c.(1273-1275)Cac>Aac	p.H425N	MBD1_ENST00000382948.5_5'Flank|MBD1_ENST00000591416.1_5'Flank|MBD1_ENST00000585672.1_5'Flank|MBD1_ENST00000590208.1_5'Flank|MBD1_ENST00000269468.5_5'Flank|MBD1_ENST00000587605.1_5'Flank|CXXC1_ENST00000587396.1_5'Flank|MBD1_ENST00000339998.6_5'Flank|CXXC1_ENST00000412036.2_Missense_Mutation_p.H429N|MBD1_ENST00000457839.2_5'Flank|MBD1_ENST00000398493.1_5'Flank|MBD1_ENST00000585595.1_5'Flank|MBD1_ENST00000424334.2_5'Flank|MBD1_ENST00000436910.1_5'Flank|MBD1_ENST00000269471.5_5'Flank|CXXC1_ENST00000589940.1_Missense_Mutation_p.H425N|MBD1_ENST00000349085.2_5'Flank|MBD1_ENST00000353909.3_5'Flank|MBD1_ENST00000347968.3_5'Flank	NM_001101654.1|NM_014593.3	NP_001095124.1|NP_055408.2	Q9P0U4	CXXC1_HUMAN	CXXC finger protein 1	425					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|histone H3-K4 methylation (GO:0051568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	24						TTCTTGCCGTGCTCTTCAGCA	0.582																																					p.H429N													.	.			0			c.C1285A												71.0	65.0	67.0					18																	47810404		2203	4300	6503	SO:0001583	missense	30827	exon10			TGCCGTGCTCTTC	BC014940	CCDS11945.1, CCDS45866.1	18q12	2014-02-20	2014-02-20		ENSG00000154832	ENSG00000154832		"""Zinc fingers, PHD-type"""	24343	protein-coding gene	gene with protein product	"""CpG binding protein"", ""DNA-binding protein with PHD finger and CXXC domain"", ""zinc finger, CpG binding-type containing 1"""	609150	"""CXXC finger 1 (PHD domain)"""			10799292, 10688657	Standard	NM_014593		Approved	HsT2645, PCCX1, hCGBP, PHF18, CGBP, SPP1, CFP1, ZCGPC1	uc002ler.4	Q9P0U4	OTTHUMG00000132670	ENST00000285106.6:c.1273C>A	18.37:g.47810404G>T	ENSP00000285106:p.His425Asn		Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	NM_001101654	68	0.00	0	B2RC03|Q8N2W4|Q96BC8|Q9P2V7	Missense_Mutation	SNP	ENST00000285106.6	37	CCDS11945.1	.	.	.	.	.	.	.	.	.	.	G	11.41	1.631384	0.28978	.	.	ENSG00000154832	ENST00000285106;ENST00000412036	T;T	0.21031	2.03;2.04	4.63	4.63	0.57726	CpG binding protein, C-terminal (1);	0.117153	0.64402	U	0.000018	T	0.10423	0.0255	N	0.04203	-0.255	0.48830	D	0.999715	B;B;B;B	0.19445	0.036;0.013;0.016;0.029	B;B;B;B	0.18561	0.014;0.013;0.022;0.022	T	0.18429	-1.0337	10	0.15066	T	0.55	-26.254	15.3385	0.74277	0.0:0.0:1.0:0.0	.	425;429;425;292	B2RC03;Q9P0U4-2;Q9P0U4;Q59EC8	.;.;CXXC1_HUMAN;.	N	425;429	ENSP00000285106:H425N;ENSP00000390475:H429N	ENSP00000285106:H425N	H	-	1	0	CXXC1	46064402	1.000000	0.71417	0.988000	0.46212	0.755000	0.42902	8.933000	0.92911	2.281000	0.76405	0.453000	0.30009	CAC			0.582	CXXC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000255927.2		NM_014593	
FBXL12	54850	broad.mit.edu	37	19	9929381	9929381	+	Intron	SNP	T	T	C			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr19:9929381T>C	ENST00000247977.4	-	1	328				AC008752.1_ENST00000401283.1_RNA|FBXL12_ENST00000585379.1_Intron|FBXL12_ENST00000586651.1_Missense_Mutation_p.K37E|FBXL12_ENST00000586073.1_Intron|FBXL12_ENST00000586469.1_Intron|FBXL12_ENST00000592067.1_Intron|SNORA70_ENST00000363367.1_RNA|FBXL12_ENST00000588922.1_Intron|FBXL12_ENST00000589626.1_Intron	NM_017703.1	NP_060173.1	Q9NXK8	FXL12_HUMAN	F-box and leucine-rich repeat protein 12						protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|ubiquitin ligase complex (GO:0000151)				endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(2)	10						GCCCTGCCCTTCCCCCCGGAG	0.697																																					.													.	FBXL12	17		0			.												10.0	11.0	10.0					19																	9929381		2097	4093	6190	SO:0001627	intron_variant	54850	.			TGCCCTTCCCCCC	AK000195	CCDS12218.1	19p13.2	2011-06-09				ENSG00000127452		"""F-boxes / Leucine-rich repeats"""	13611	protein-coding gene	gene with protein product		609079				10531037	Standard	XM_005259964		Approved	FLJ20188, Fbl12	uc002mme.3	Q9NXK8		ENST00000247977.4:c.86+22A>G	19.37:g.9929381T>C			Somatic	119	0.0084033613	1		WXS	Illumina HiSeq	Phase_I	124	0.06	8	.	5	0.00	0	B3KSJ8|Q9H5K4	Missense_Mutation	SNP	ENST00000247977.4	37	CCDS12218.1																																																																																					0.697	FBXL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450265.1		NM_017703	
S1PR5	53637	mdanderson.org	37	19	10625621	10625621	+	Missense_Mutation	SNP	C	C	T	rs377292940		TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr19:10625621C>T	ENST00000439028.3	-	2	192	c.67G>A	c.(67-69)Ggc>Agc	p.G23S	S1PR5_ENST00000333430.4_Missense_Mutation_p.G23S	NM_001166215.1	NP_001159687.1	Q9H228	S1PR5_HUMAN	sphingosine-1-phosphate receptor 5	23					regulation of neuron differentiation (GO:0045664)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sphingosine-1-phosphate receptor activity (GO:0038036)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	12					Fingolimod(DB08868)	CGGAGCTTGCCGGTGTAGTTG	0.697																																					p.G23S													.	.			0			c.G67A								SER/GLY,SER/GLY	0,4362		0,0,2181	23.0	25.0	24.0		67,67	3.4	0.7	19		24	2,8496		0,2,4247	no	missense,missense	S1PR5	NM_001166215.1,NM_030760.4	56,56	0,2,6428	TT,TC,CC		0.0235,0.0,0.0156	probably-damaging,probably-damaging	23/399,23/399	10625621	2,12858	2181	4249	6430	SO:0001583	missense	53637	exon2			GCTTGCCGGTGTA	AK074661	CCDS12240.1	19p13.2	2012-08-08	2008-04-30	2008-04-30		ENSG00000180739		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	14299	protein-coding gene	gene with protein product		605146	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 8"""	EDG8		10799507	Standard	NM_030760		Approved	Edg-8	uc002mou.2	Q9H228		ENST00000439028.3:c.67G>A	19.37:g.10625621C>T	ENSP00000416915:p.Gly23Ser		Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	22	0.09	2	NM_001166215	0		0	Q6NW11	Missense_Mutation	SNP	ENST00000439028.3	37	CCDS12240.1	.	.	.	.	.	.	.	.	.	.	c	32	5.130252	0.94473	0.0	2.35E-4	ENSG00000180739	ENST00000439028;ENST00000333430;ENST00000359134	D;D	0.82081	-1.57;-1.57	4.44	3.4	0.38934	.	0.000000	0.85682	U	0.000000	D	0.87931	0.6302	M	0.82056	2.57	0.43555	D	0.995866	D	0.65815	0.995	P	0.55923	0.787	D	0.88729	0.3235	10	0.87932	D	0	.	11.1285	0.48333	0.0:0.9078:0.0:0.0922	.	23	Q9H228	S1PR5_HUMAN	S	23	ENSP00000416915:G23S;ENSP00000328472:G23S	ENSP00000328472:G23S	G	-	1	0	S1PR5	10486621	1.000000	0.71417	0.685000	0.30070	0.922000	0.55478	7.428000	0.80296	1.075000	0.40932	0.586000	0.80456	GGC			0.697	S1PR5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452015.1		NM_030760	
NFIX	4784	broad.mit.edu	37	19	13135824	13135824	+	Intron	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr19:13135824G>T	ENST00000592199.1	+	2	27				NFIX_ENST00000358552.3_Missense_Mutation_p.C5F|NFIX_ENST00000585575.1_Intron|NFIX_ENST00000587260.1_Missense_Mutation_p.C5F|NFIX_ENST00000588228.1_Intron|NFIX_ENST00000397661.2_Intron|NFIX_ENST00000360105.4_Intron|NFIX_ENST00000587760.1_Intron			Q14938	NFIX_HUMAN	nuclear factor I/X (CCAAT-binding transcription factor)						astrocyte differentiation (GO:0048708)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell layer development (GO:0021680)|DNA replication (GO:0006260)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(19;8.2e-22)			CTCCCGGCTTGCCGCCTGCAG	0.632																																					.													.	NFIX	61		0			.												11.0	10.0	10.0					19																	13135824		2192	4293	6485	SO:0001627	intron_variant	4784	.			CGGCTTGCCGCCT	U18761	CCDS45996.1, CCDS59359.1	19p13.3	2008-02-05				ENSG00000008441			7788	protein-coding gene	gene with protein product		164005				8340106, 7590749	Standard	NM_001271043		Approved	NF1A	uc010xmx.2	Q14938		ENST00000592199.1:c.28-11G>T	19.37:g.13135824G>T			Somatic	70	0.1428571429	10		WXS	Illumina HiSeq	Phase_I	70	0.21	15	.	0		0	B4DM25|O60413|Q0VG09|Q12859|Q13050|Q13052|Q5U094|Q9UPH1|Q9Y6R8	Missense_Mutation	SNP	ENST00000592199.1	37		.	.	.	.	.	.	.	.	.	.	G	14.23	2.474419	0.43942	.	.	ENSG00000008441	ENST00000358552	T	0.55413	0.52	4.92	4.92	0.64577	.	.	.	.	.	T	0.51109	0.1655	.	.	.	0.39990	D	0.975039	P	0.40794	0.729	B	0.41988	0.372	T	0.59096	-0.7518	8	0.87932	D	0	.	12.0512	0.53507	0.0:0.0:0.8272:0.1728	.	5	Q14938-5	.	F	5	ENSP00000351354:C5F	ENSP00000351354:C5F	C	+	2	0	NFIX	12996824	0.378000	0.25114	1.000000	0.80357	0.999000	0.98932	1.005000	0.29834	2.288000	0.76882	0.655000	0.94253	TGC			0.632	NFIX-013	NOVEL	basic	protein_coding	protein_coding		OTTHUMT00000452763.1		NM_002501	
ARHGEF1	9138	bcgsc.ca	37	19	42406941	42406941	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr19:42406941A>G	ENST00000354532.3	+	18	1779	c.1631A>G	c.(1630-1632)gAg>gGg	p.E544G	ARHGEF1_ENST00000599846.1_Missense_Mutation_p.E600G|ARHGEF1_ENST00000347545.4_Missense_Mutation_p.E511G|ARHGEF1_ENST00000337665.4_Missense_Mutation_p.E559G|ARHGEF1_ENST00000378152.4_Missense_Mutation_p.E526G	NM_004706.3	NP_004697.2	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor (GEF) 1	544	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				cell proliferation (GO:0008283)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of axonogenesis (GO:0050770)|Rho protein signal transduction (GO:0007266)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|poly(A) RNA binding (GO:0044822)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		CAGGAAGCTGAGAGCCGCCCG	0.672																																					p.E559G													.	ARHGEF1	95		0			c.A1676G												36.0	41.0	39.0					19																	42406941		2203	4298	6501	SO:0001583	missense	9138	exon18			AAGCTGAGAGCCG	U64105	CCDS12590.1, CCDS12591.1, CCDS12592.1	19q13.13	2014-06-19			ENSG00000076928	ENSG00000076928		"""Rho guanine nucleotide exchange factors"""	681	protein-coding gene	gene with protein product		601855				8810315, 9135076	Standard	NM_004706		Approved	P115-RHOGEF, SUB1.5, LBCL2	uc002osa.3	Q92888	OTTHUMG00000182679	ENST00000354532.3:c.1631A>G	19.37:g.42406941A>G	ENSP00000346532:p.Glu544Gly		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_1	44	0.00	0	NM_199002	96	0.00	0	O00513|Q8N4J4|Q96BF4|Q96F17|Q9BSB1	Missense_Mutation	SNP	ENST00000354532.3	37	CCDS12591.1	.	.	.	.	.	.	.	.	.	.	A	17.65	3.441248	0.63067	.	.	ENSG00000076928	ENST00000354532;ENST00000347545;ENST00000337665;ENST00000378152	T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23	4.26	4.26	0.50523	Dbl homology (DH) domain (5);	0.000000	0.64402	D	0.000001	T	0.78553	0.4301	M	0.66939	2.045	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;1.0	T	0.80772	-0.1233	10	0.87932	D	0	-26.7291	11.6608	0.51345	1.0:0.0:0.0:0.0	.	203;526;559;511;544	Q49AN3;Q6NX52;Q92888-3;Q92888-2;Q92888	.;.;.;.;ARHG1_HUMAN	G	544;511;559;526	ENSP00000346532:E544G;ENSP00000344429:E511G;ENSP00000337261:E559G;ENSP00000367394:E526G	ENSP00000337261:E559G	E	+	2	0	ARHGEF1	47098781	1.000000	0.71417	0.991000	0.47740	0.286000	0.27126	8.956000	0.93066	1.696000	0.51158	0.374000	0.22700	GAG			0.672	ARHGEF1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000463360.1		NM_199002	
OPA3	80207	mdanderson.org	37	19	46056931	46056931	+	Silent	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr19:46056931G>T	ENST00000263275.4	-	2	435	c.381C>A	c.(379-381)ggC>ggA	p.G127G	OPA3_ENST00000544371.1_Silent_p.G74G|OPA3_ENST00000323060.3_Intron	NM_025136.3	NP_079412.1	Q9H6K4	OPA3_HUMAN	optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia)	127					growth (GO:0040007)|mitochondrion morphogenesis (GO:0070584)|neuromuscular process (GO:0050905)|regulation of lipid metabolic process (GO:0019216)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	mitochondrion (GO:0005739)				cervix(1)|large_intestine(1)|lung(2)	4		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00778)|GBM - Glioblastoma multiforme(486;0.0976)|Epithelial(262;0.242)		GCGCCAGGTGGCCCACCTCGT	0.726																																					p.G127G													.	.			0			c.C381A												11.0	14.0	13.0					19																	46056931		2170	4248	6418	SO:0001819	synonymous_variant	80207	exon2			CAGGTGGCCCACC	AK025840	CCDS12668.1, CCDS33052.1	19q13.2-q13.3	2014-01-28				ENSG00000125741			8142	protein-coding gene	gene with protein product		606580				9097959, 11668429	Standard	NM_001017989		Approved	FLJ22187, MGA3	uc002pcj.4	Q9H6K4		ENST00000263275.4:c.381C>A	19.37:g.46056931G>T			Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	18	0.11	2	NM_025136	17	0.00	0	Q6P384|Q8N784	Silent	SNP	ENST00000263275.4	37	CCDS12668.1																																																																																					0.726	OPA3-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000459601.1			
PRPF31	26121	bcgsc.ca	37	19	54629912	54629912	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr19:54629912C>T	ENST00000321030.4	+	9	1214	c.865C>T	c.(865-867)Cgg>Tgg	p.R289W	PRPF31_ENST00000419967.1_Missense_Mutation_p.R289W|PRPF31_ENST00000498612.1_3'UTR|PRPF31_ENST00000391755.1_Missense_Mutation_p.R289W|AC012314.8_ENST00000452097.1_RNA	NM_015629.3	NP_056444.3	Q8WWY3	PRP31_HUMAN	pre-mRNA processing factor 31	289	Nop. {ECO:0000255|PROSITE- ProRule:PRU00690}.				mRNA splicing, via spliceosome (GO:0000398)|spliceosomal tri-snRNP complex assembly (GO:0000244)	Cajal body (GO:0015030)|MLL1 complex (GO:0071339)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|U2-type spliceosomal complex (GO:0005684)|U4 snRNP (GO:0005687)|U4/U6 x U5 tri-snRNP complex (GO:0046540)|U4atac snRNP (GO:0005690)	poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|snRNP binding (GO:0070990)			breast(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(2)|urinary_tract(3)	12	all_cancers(19;0.00681)|all_epithelial(19;0.00362)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GGATCTGCGGCGGAAAGCGGC	0.617																																					p.R289W													.	PRPF31	48		0			c.C865T												23.0	25.0	24.0					19																	54629912		2202	4299	6501	SO:0001583	missense	26121	exon9			CTGCGGCGGAAAG	AL050369	CCDS12879.1	19q13.4	2013-07-16	2013-06-10		ENSG00000105618	ENSG00000105618			15446	protein-coding gene	gene with protein product		606419	"""PRP31 pre-mRNA processing factor 31 homolog (yeast)"", ""PRP31 pre-mRNA processing factor 31 homolog (S. cerevisiae)"""	RP11		11545739	Standard	NM_015629		Approved	NY-BR-99, PRP31, hPrp31, SNRNP61	uc002qdh.2	Q8WWY3	OTTHUMG00000066040	ENST00000321030.4:c.865C>T	19.37:g.54629912C>T	ENSP00000324122:p.Arg289Trp		Somatic	84	0	0		WXS	Illumina HiSeq	Phase_1	86	0.00	0	NM_015629	191	0.00	0	Q17RB4|Q8N7F9|Q9H271|Q9Y439	Missense_Mutation	SNP	ENST00000321030.4	37	CCDS12879.1	.	.	.	.	.	.	.	.	.	.	C	19.83	3.899757	0.72754	.	.	ENSG00000105618	ENST00000321030;ENST00000263436;ENST00000419967;ENST00000391755	T;T;T	0.63744	-0.06;-0.06;-0.06	5.56	4.51	0.55191	Pre-mRNA processing ribonucleoprotein, snoRNA-binding domain (1);	0.049113	0.85682	D	0.000000	T	0.81856	0.4911	M	0.91300	3.195	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.992	D	0.85385	0.1122	10	0.66056	D	0.02	-44.8434	12.3604	0.55199	0.4162:0.5838:0.0:0.0	.	289;289	E7ESA8;Q8WWY3	.;PRP31_HUMAN	W	289	ENSP00000324122:R289W;ENSP00000405166:R289W;ENSP00000375635:R289W	ENSP00000263436:R289W	R	+	1	2	PRPF31	59321724	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.885000	0.48570	1.474000	0.48178	0.655000	0.94253	CGG			0.617	PRPF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000141417.2			
ZNF135	7694	hgsc.bcm.edu	37	19	58578756	58578756	+	Nonsense_Mutation	SNP	G	G	T	rs536588023	byFrequency	TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr19:58578756G>T	ENST00000313434.5	+	5	1005	c.904G>T	c.(904-906)Gaa>Taa	p.E302*	ZNF135_ENST00000506786.1_Nonsense_Mutation_p.E260*|ZNF135_ENST00000439855.2_Nonsense_Mutation_p.E302*|RN7SL526P_ENST00000469492.2_RNA|ZNF135_ENST00000511556.1_Nonsense_Mutation_p.E314*|ZNF135_ENST00000401053.4_Nonsense_Mutation_p.E326*|ZNF135_ENST00000359978.6_Nonsense_Mutation_p.E314*	NM_003436.3	NP_003427.3	P52742	ZN135_HUMAN	zinc finger protein 135	302					cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E302K(1)		breast(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(26)|ovary(1)|skin(1)|urinary_tract(1)	41		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		TGAATGCAGCGAATGTGGGAA	0.522																																					p.E326X													ZNF135,caecum,carcinoma,0,1	ZNF135	0	1	1	Substitution - Missense(1)	large_intestine(1)	c.G976T												78.0	76.0	77.0					19																	58578756		2203	4300	6503	SO:0001587	stop_gained	7694	exon4			TGCAGCGAATGTG	U09413	CCDS12970.1, CCDS12970.2, CCDS54329.1, CCDS54330.1, CCDS74471.1, CCDS74472.1	19q13.4	2013-01-08	2006-05-12			ENSG00000176293		"""Zinc fingers, C2H2-type"", ""-"""	12919	protein-coding gene	gene with protein product		604077	"""zinc finger protein 61"", ""zinc finger protein 135 (clone pHZ-17)"""	ZNF61, ZNF78L1		7557990, 1505991	Standard	NM_003436		Approved	pHZ-17	uc002qrg.3	P52742		ENST00000313434.5:c.904G>T	19.37:g.58578756G>T	ENSP00000321406:p.Glu302*		Somatic	87	0	0		WXS	Illumina HiSeq	.	72	0.04	3	NM_007134	14	0.00	0	B4DHH9|E9PEV2|F5GYY9|I3L0B3|Q5U5L3|Q8N1I7	Nonsense_Mutation	SNP	ENST00000313434.5	37		.	.	.	.	.	.	.	.	.	.	G	10.39	1.336593	0.24253	.	.	ENSG00000176293	ENST00000504540;ENST00000401053;ENST00000359978;ENST00000439855;ENST00000313434;ENST00000511556;ENST00000506786	.	.	.	3.19	0.757	0.18427	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	4.1875	0.10405	0.2535:0.1975:0.549:0.0	.	.	.	.	X	314;326;314;302;302;314;260	.	ENSP00000321406:E302X	E	+	1	0	ZNF135	63270568	0.000000	0.05858	0.372000	0.25991	0.025000	0.11179	-1.104000	0.03326	0.652000	0.30806	0.563000	0.77884	GAA			0.522	ZNF135-003	KNOWN	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000361899.2		NM_003436	
ASAP2	8853	mdanderson.org	37	2	9467997	9467997	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr2:9467997G>T	ENST00000281419.3	+	7	983	c.643G>T	c.(643-645)Gat>Tat	p.D215Y	ASAP2_ENST00000315273.4_Missense_Mutation_p.D215Y	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	215					positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						AAAGGGAGTAGATTTACTTCA	0.348																																					p.D215Y													.	.			0			c.G643T												136.0	130.0	132.0					2																	9467997		2203	4300	6503	SO:0001583	missense	8853	exon7			GGAGTAGATTTAC	AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.643G>T	2.37:g.9467997G>T	ENSP00000281419:p.Asp215Tyr		Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_001135191	22	0.00	0	D6W4Y8	Missense_Mutation	SNP	ENST00000281419.3	37	CCDS1661.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.777345	0.90195	.	.	ENSG00000151693	ENST00000281419;ENST00000315273	T;T	0.05081	3.5;3.5	5.13	5.13	0.70059	.	0.046528	0.85682	D	0.000000	T	0.26340	0.0643	M	0.73217	2.22	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.00234	-1.1893	10	0.87932	D	0	.	18.7446	0.91788	0.0:0.0:1.0:0.0	.	215;215	O43150-2;O43150	.;ASAP2_HUMAN	Y	215	ENSP00000281419:D215Y;ENSP00000316404:D215Y	ENSP00000281419:D215Y	D	+	1	0	ASAP2	9385448	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	8.893000	0.92498	2.827000	0.97445	0.650000	0.86243	GAT			0.348	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000237522.1		NM_003887	
SPTBN1	6711	broad.mit.edu;mdanderson.org	37	2	54753700	54753700	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr2:54753700G>T	ENST00000356805.4	+	2	426	c.145G>T	c.(145-147)Gca>Tca	p.A49S	AC092839.3_ENST00000433475.1_RNA	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	49	Actin-binding.				actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			CAAGGCTCTGGCAGGTGAGTC	0.547																																					p.A49S													.	SPTBN1	378		0			c.G145T												79.0	73.0	75.0					2																	54753700		2203	4300	6503	SO:0001583	missense	0	exon2			GCTCTGGCAGGTG		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.145G>T	2.37:g.54753700G>T	ENSP00000349259:p.Ala49Ser		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_003128	109	0.00	0	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	ENST00000356805.4	37	CCDS33198.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.629713	0.87660	.	.	ENSG00000115306	ENST00000356805;ENST00000389980	T;T	0.58940	0.3;0.3	5.77	5.77	0.91146	Calponin homology domain (2);	0.167223	0.52532	D	0.000064	T	0.58906	0.2155	L	0.49513	1.565	0.80722	D	1	B	0.20887	0.049	B	0.27887	0.084	T	0.56323	-0.7998	10	0.72032	D	0.01	.	20.0007	0.97408	0.0:0.0:1.0:0.0	.	49	Q01082	SPTB2_HUMAN	S	49	ENSP00000349259:A49S;ENSP00000374630:A49S	ENSP00000349259:A49S	A	+	1	0	SPTBN1	54607204	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.837000	0.99465	2.726000	0.93360	0.650000	0.86243	GCA			0.547	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000258115.3			
MAT2A	4144	bcgsc.ca	37	2	85769043	85769043	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr2:85769043A>G	ENST00000306434.3	+	5	620	c.497A>G	c.(496-498)gAa>gGa	p.E166G	MAT2A_ENST00000409017.1_Missense_Mutation_p.E103G|MAT2A_ENST00000490878.1_3'UTR	NM_005911.5	NP_005902.1	P31153	METK2_HUMAN	methionine adenosyltransferase II, alpha	166					cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|methionine adenosyltransferase complex (GO:0048269)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)			breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	9					L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	AAACTGGCAGAACTACGCCGT	0.418																																					p.E166G													.	MAT2A	23		0			c.A497G												111.0	92.0	98.0					2																	85769043		2203	4300	6503	SO:0001583	missense	4144	exon5			TGGCAGAACTACG		CCDS1977.1	2p11.2	2008-06-03			ENSG00000168906	ENSG00000168906			6904	protein-coding gene	gene with protein product		601468				1426236, 9703951	Standard	NM_005911		Approved	SAMS2, MATA2, MATII	uc002spr.3	P31153	OTTHUMG00000130174	ENST00000306434.3:c.497A>G	2.37:g.85769043A>G	ENSP00000303147:p.Glu166Gly		Somatic	88	0	0		WXS	Illumina HiSeq	Phase_1	107	0.00	0	NM_005911	270	0.00	0	A8K511|B4DN45|D6W5L1|Q53SP5	Missense_Mutation	SNP	ENST00000306434.3	37	CCDS1977.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.563306	0.86335	.	.	ENSG00000168906	ENST00000306434;ENST00000409017	D;D	0.83992	-1.79;-1.79	5.89	5.89	0.94794	S-adenosylmethionine synthetase, central domain (1);S-adenosylmethionine synthetase superfamily (1);	0.000000	0.85682	D	0.000000	D	0.89639	0.6773	M	0.89214	3.015	0.80722	D	1	P;P	0.43701	0.557;0.815	P;P	0.50231	0.635;0.635	D	0.91283	0.5053	10	0.87932	D	0	-19.9176	14.263	0.66097	1.0:0.0:0.0:0.0	.	166;166	B4DEX8;P31153	.;METK2_HUMAN	G	166;103	ENSP00000303147:E166G;ENSP00000386353:E103G	ENSP00000303147:E166G	E	+	2	0	MAT2A	85622554	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.962000	0.93254	2.257000	0.74773	0.460000	0.39030	GAA			0.418	MAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252491.2		NM_005911	
AC027612.3	0	broad.mit.edu	37	2	91887904	91887905	+	RNA	INS	-	-	T	rs374250838|rs373336109|rs369805878|rs199562278	byFrequency	TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr2:91887904_91887905insT	ENST00000436174.1	-	0	540																											AGCTATTTTCCATTTTTTTTTT	0.292																																					.													.	.			0			.																																											0	.			ATTTTCCATTTTT																													2.37:g.91887904_91887905insT			Somatic	153	0.0392156863	6		WXS	Illumina HiSeq	Phase_I	174	0.13	23	.	0		0		RNA	INS	ENST00000436174.1	37																																																																																						0.292	AC027612.3-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000338339.1			
RAB6C-AS1	100131320	broad.mit.edu	37	2	130726529	130726529	+	RNA	DEL	A	A	-	rs112755128		TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr2:130726529delA	ENST00000412425.1	-	0	615					NR_036537.1																						AACGAAGTGCAAAAAAAAAAA	0.343																																					.													.	.			0			.																																											0	.			AAGTGCAAAAAAA																													2.37:g.130726529delA			Somatic	10	0	0		WXS	Illumina HiSeq	Phase_I	9	0.33	3	.	1	0.00	0		RNA	DEL	ENST00000412425.1	37																																																																																						0.343	AC079776.7-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000331383.1			
COL6A3	1293	mdanderson.org	37	2	238253730	238253730	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr2:238253730G>T	ENST00000295550.4	-	34	7585	c.7133C>A	c.(7132-7134)gCc>gAc	p.A2378D	COL6A3_ENST00000347401.3_Missense_Mutation_p.A2177D|COL6A3_ENST00000409809.1_Missense_Mutation_p.A2172D|COL6A3_ENST00000353578.4_Missense_Mutation_p.A2172D|COL6A3_ENST00000472056.1_Missense_Mutation_p.A1771D|COL6A3_ENST00000346358.4_Missense_Mutation_p.A2178D	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2378	Nonhelical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TTGGATGAGGGCACATTGCTT	0.348																																					p.A2378D													.	.			0			c.C7133A												86.0	84.0	85.0					2																	238253730		2203	4300	6503	SO:0001583	missense	1293	exon34			ATGAGGGCACATT	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.7133C>A	2.37:g.238253730G>T	ENSP00000295550:p.Ala2378Asp		Somatic	164	0.006097561	1		WXS	Illumina HiSeq	Phase_I	94	0.05	5	NM_004369	8	0.00	0	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	G	9.579	1.123127	0.20959	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.87966	-2.32;-2.3;-2.28;-2.28;-2.28;-2.27	5.31	1.05	0.20165	.	0.815598	0.10724	N	0.641347	T	0.82061	0.4955	N	0.12502	0.225	0.38948	D	0.958284	B;B;B;D	0.60575	0.003;0.0;0.005;0.988	B;B;B;P	0.55965	0.003;0.002;0.004;0.788	T	0.74106	-0.3772	10	0.11794	T	0.64	.	12.765	0.57386	0.0:0.5148:0.3699:0.1152	.	1771;1771;2172;2378	E9PFQ6;B7ZMJ7;P12111-2;P12111	.;.;.;CO6A3_HUMAN	D	2378;2177;2172;1771;2172;2178	ENSP00000295550:A2378D;ENSP00000315609:A2177D;ENSP00000315873:A2172D;ENSP00000418285:A1771D;ENSP00000386844:A2172D;ENSP00000295546:A2178D	ENSP00000295550:A2378D	A	-	2	0	COL6A3	237918469	0.930000	0.31532	0.837000	0.33122	0.772000	0.43724	2.028000	0.41088	0.611000	0.30052	-0.165000	0.13383	GCC			0.348	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000315790.2		NM_004369	
CENPB	1059	broad.mit.edu	37	20	3766757	3766757	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr20:3766757C>T	ENST00000379751.4	-	1	580	c.374G>A	c.(373-375)cGc>cAc	p.R125H	CDC25B_ENST00000344256.6_5'Flank|CDC25B_ENST00000379598.5_5'Flank	NM_001810.5	NP_001801.1	P07199	CENPB_HUMAN	centromere protein B, 80kDa	125	HTH CENPB-type. {ECO:0000255|PROSITE- ProRule:PRU00583}.				regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)	centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|satellite DNA binding (GO:0003696)|sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(2)|lung(4)|skin(1)	8						CCGGCGGAAGCGGTCCAGCCA	0.746																																					p.R125H													.	CENPB	24		0			c.G374A												26.0	32.0	30.0					20																	3766757		2201	4294	6495	SO:0001583	missense	1059	exon1			CGGAAGCGGTCCA	X05299	CCDS13064.1	20p13	2013-11-05	2002-08-29		ENSG00000125817	ENSG00000125817			1852	protein-coding gene	gene with protein product		117140	"""centromere protein B (80kD)"""			8406460, 11884609	Standard	NM_001810		Approved		uc002wjk.3	P07199	OTTHUMG00000031761	ENST00000379751.4:c.374G>A	20.37:g.3766757C>T	ENSP00000369075:p.Arg125His		Somatic	12	0	0		WXS	Illumina HiSeq	Phase_I	5	0.40	2	NM_001810	8	0.00	0	Q96EI4	Missense_Mutation	SNP	ENST00000379751.4	37	CCDS13064.1	.	.	.	.	.	.	.	.	.	.	c	24.5	4.535476	0.85812	.	.	ENSG00000125817	ENST00000379751	T	0.22945	1.93	3.26	3.26	0.37387	Homeodomain-related (1);Pogo transposase / Cenp-B / PDC2, DNA-binding HTH domain (3);Homeodomain-like (1);	0.000000	0.35615	U	0.003081	T	0.49184	0.1542	M	0.81682	2.555	0.44207	D	0.997037	D	0.71674	0.998	D	0.66716	0.946	T	0.56475	-0.7973	10	0.87932	D	0	-6.4494	11.9646	0.53027	0.0:1.0:0.0:0.0	.	125	P07199	CENPB_HUMAN	H	125	ENSP00000369075:R125H	ENSP00000369075:R125H	R	-	2	0	CENPB	3714757	1.000000	0.71417	1.000000	0.80357	0.775000	0.43874	1.020000	0.30027	1.366000	0.46076	0.197000	0.17608	CGC			0.746	CENPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077772.2		NM_001810	
TMX4	56255	broad.mit.edu	37	20	8000252	8000252	+	Silent	SNP	A	A	C			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr20:8000252A>C	ENST00000246024.2	-	1	224	c.9T>G	c.(7-9)ggT>ggG	p.G3G	RP5-971N18.3_ENST00000457707.1_RNA|RP5-971N18.3_ENST00000607924.1_RNA	NM_021156.2	NP_066979.2	Q9H1E5	TMX4_HUMAN	thioredoxin-related transmembrane protein 4	3					cell redox homeostasis (GO:0045454)|oxidation-reduction process (GO:0055114)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			endometrium(3)|large_intestine(2)|lung(11)|skin(1)	17						CGCAGCGCCCACCCGCCATGT	0.761																																					p.G3G													.	TMX4	39		0			c.T9G												1.0	1.0	1.0					20																	8000252		958	2169	3127	SO:0001819	synonymous_variant	56255	exon1			GCGCCCACCCGCC		CCDS13101.1	20p12	2011-10-19	2009-02-23	2009-02-23	ENSG00000125827	ENSG00000125827		"""Protein disulfide isomerases"""	25237	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 14"""		"""thioredoxin domain containing 13"""	TXNDC13			Standard	NM_021156		Approved	DJ971N18.2, KIAA1162, PDIA14	uc002wmx.1	Q9H1E5	OTTHUMG00000031843	ENST00000246024.2:c.9T>G	20.37:g.8000252A>C			Somatic	45	0.4666666667	21		WXS	Illumina HiSeq	Phase_I	26	0.42	11	NM_021156	16	0.06	1	Q8N4P7|Q8NCC1|Q9UJA1|Q9ULQ8	Silent	SNP	ENST00000246024.2	37	CCDS13101.1																																																																																					0.761	TMX4-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000077928.2		NM_021156	
BACE2	25825	hgsc.bcm.edu	37	21	42551433	42551433	+	Intron	SNP	G	G	A			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr21:42551433G>A	ENST00000330333.6	+	1	775				PLAC4_ENST00000430327.2_RNA|BACE2-IT1_ENST00000433378.1_RNA|PLAC4_ENST00000414699.1_RNA|PLAC4_ENST00000440221.2_RNA|PLAC4_ENST00000536486.1_RNA|BACE2_ENST00000347667.5_Intron|BACE2_ENST00000328735.6_Intron	NM_012105.3	NP_036237.2	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2						membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				GACGGTGTCTGGGGTGAGTGA	0.607																																					p.P41P													.	.			0			c.C123T												124.0	109.0	114.0					21																	42551433		2196	4275	6471	SO:0001627	intron_variant	191585	exon1			GTGTCTGGGGTGA	AF117892	CCDS13668.1, CCDS13669.1, CCDS13670.1	21q22.3	2011-08-11			ENSG00000182240	ENSG00000182240			934	protein-coding gene	gene with protein product		605668		AEPLC		10965118, 10830953	Standard	NM_138991		Approved	CEAP1, DRAP, ALP56	uc002yyw.3	Q9Y5Z0	OTTHUMG00000086742	ENST00000330333.6:c.312+10931G>A	21.37:g.42551433G>A			Somatic	118	0	0		WXS	Illumina HiSeq	.	104	0.18	19	NM_182832	9	0.00	0	A8K7P1|Q5DIH8|Q8N2D4|Q9H2V8|Q9NZL1|Q9NZL2|Q9UJT6	Silent	SNP	ENST00000330333.6	37	CCDS13668.1																																																																																					0.607	BACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000195056.1			
GAB4	128954	broad.mit.edu;mdanderson.org	37	22	17488891	17488891	+	Silent	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr22:17488891G>T	ENST00000400588.1	-	1	221	c.114C>A	c.(112-114)ggC>ggA	p.G38G	GAB4_ENST00000523144.1_5'Flank	NM_001037814.1	NP_001032903.1	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member 4	38										breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(24)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44		all_epithelial(15;0.112)|Lung NSC(13;0.248)				ACAGCACGTGGCCACTTCTCG	0.682																																					p.G38G													.	GAB4	95		0			c.C114A												16.0	21.0	19.0					22																	17488891		2081	4220	6301	SO:0001819	synonymous_variant	128954	exon1			CACGTGGCCACTT	AK057252	CCDS42976.1	22q11.2	2013-01-10			ENSG00000215568	ENSG00000215568		"""Pleckstrin homology (PH) domain containing"""	18325	protein-coding gene	gene with protein product							Standard	NM_001037814		Approved		uc002zlw.3	Q2WGN9	OTTHUMG00000149992	ENST00000400588.1:c.114C>A	22.37:g.17488891G>T			Somatic	176	0.0056818182	1		WXS	Illumina HiSeq	Phase_I	124	0.05	6	NM_001037814	0		0		Silent	SNP	ENST00000400588.1	37	CCDS42976.1																																																																																					0.682	GAB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000315426.1		XM_372882	
BPIFC	254240	mdanderson.org	37	22	32831697	32831697	+	Silent	SNP	G	G	T	rs375648599		TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr22:32831697G>T	ENST00000397452.1	-	9	1028	c.918C>A	c.(916-918)acC>acA	p.T306T	BPIFC_ENST00000432451.2_Silent_p.T120T|BPIFC_ENST00000300399.3_Silent_p.T306T|BPIFC_ENST00000534972.1_Silent_p.T30T			Q8NFQ6	BPIFC_HUMAN	BPI fold containing family C	306						extracellular region (GO:0005576)	lipopolysaccharide binding (GO:0001530)|phospholipid binding (GO:0005543)	p.T306T(1)									TCACCTCTTCGGTGGAGAGAG	0.423																																					p.T306T													BPIL2,NS,carcinoma,-2,2	BPIL2	-2	2	1	Substitution - coding silent(1)	large_intestine(1)	c.C918A												60.0	61.0	61.0					22																	32831697		2203	4300	6503	SO:0001819	synonymous_variant	254240	exon8			CTCTTCGGTGGAG	AF465766	CCDS13906.1	22q12.3	2011-08-04	2011-08-01	2011-08-01	ENSG00000184459	ENSG00000184459		"""BPI fold containing"""	16503	protein-coding gene	gene with protein product		614109	"""bactericidal/permeability-increasing protein-like 2"""	BPIL2			Standard	NM_174932		Approved	dJ149A16.7	uc003amn.2	Q8NFQ6	OTTHUMG00000058273	ENST00000397452.1:c.918C>A	22.37:g.32831697G>T			Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_174932	0		0	A2RRF1	Silent	SNP	ENST00000397452.1	37	CCDS13906.1																																																																																					0.423	BPIFC-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000129029.2		NM_174932	
MRPS25	64432	hgsc.bcm.edu;broad.mit.edu	37	3	15094113	15094115	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	CTC	CTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr3:15094113_15094115delCTC	ENST00000253686.2	-	4	495_497	c.355_357delGAG	c.(355-357)gagdel	p.E119del	MRPS25_ENST00000449354.2_Intron|MRPS25_ENST00000496484.1_5'Flank|MRPS25_ENST00000444840.2_In_Frame_Del_p.89_90RR>R	NM_022497.3	NP_071942.1	P82663	RT25_HUMAN	mitochondrial ribosomal protein S25	119						mitochondrion (GO:0005739)|ribosome (GO:0005840)				large_intestine(1)|lung(1)	2						GCTGCTTTTTCTCCTCCTCCTCT	0.586																																					p.119_120del													.	MRPS25	14		0			c.356_358del									1,4265		0,1,2132						4.7	0.8			140	1,8253		0,1,4126	no	coding	MRPS25	NM_022497.3		0,2,6258	A1A1,A1R,RR		0.0121,0.0234,0.016				2,12518				SO:0001651	inframe_deletion	64432	exon4			CTTTTTCTCCTCC	AB061208	CCDS2622.1	3p25	2012-09-13			ENSG00000131368	ENSG00000131368		"""Mitochondrial ribosomal proteins / small subunits"""	14511	protein-coding gene	gene with protein product	"""mitochondrial 28S ribosomal protein S25"""	611987				11279123	Standard	NM_022497		Approved	MRP-S25, FLJ00023, DKFZp313H0817, RPMS25	uc003bzl.3	P82663	OTTHUMG00000129836	ENST00000253686.2:c.355_357delGAG	3.37:g.15094122_15094124delCTC	ENSP00000253686:p.Glu119del		Somatic	106	0	0		WXS	Illumina HiSeq	.	75	0.28	21	NM_022497	163	0.00	0	B4DFJ5|B4DQG6|Q9H7P5	In_Frame_Del	DEL	ENST00000253686.2	37	CCDS2622.1																																																																																					0.586	MRPS25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252076.2		NM_022497	
EOMES	8320	mdanderson.org	37	3	27763618	27763618	+	Silent	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr3:27763618G>T	ENST00000295743.4	-	1	371	c.168C>A	c.(166-168)tcC>tcA	p.S56S	EOMES_ENST00000461503.1_Intron|EOMES_ENST00000449599.1_Silent_p.S56S|EOMES_ENST00000537516.1_Intron			O95936	EOMES_HUMAN	eomesodermin	56					brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell differentiation involved in embryonic placenta development (GO:0060706)|cerebral cortex neuron differentiation (GO:0021895)|cerebral cortex regionalization (GO:0021796)|endoderm formation (GO:0001706)|endodermal cell fate specification (GO:0001714)|interferon-gamma production (GO:0032609)|mesoderm formation (GO:0001707)|mesodermal to mesenchymal transition involved in gastrulation (GO:0060809)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|olfactory bulb development (GO:0021772)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|skeletal muscle cell differentiation (GO:0035914)|stem cell maintenance (GO:0019827)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)	21						AGAGACTGCCGGAAAACTTCT	0.697																																					p.S56S													.	.			0			c.C168A												2.0	3.0	3.0					3																	27763618		1750	3630	5380	SO:0001819	synonymous_variant	8320	exon1			ACTGCCGGAAAAC	BC025363	CCDS2646.1, CCDS63585.1	3p24.1	2011-06-13	2010-06-24		ENSG00000163508	ENSG00000163508		"""T-boxes"""	3372	protein-coding gene	gene with protein product	"""T-box brain2"""	604615	"""eomesodermin (Xenopus laevis) homolog"""			9888994, 9434949	Standard	NM_005442		Approved	TBR2	uc003cdy.4	O95936	OTTHUMG00000130570	ENST00000295743.4:c.168C>A	3.37:g.27763618G>T			Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	21	0.14	3	NM_005442	2	0.00	0	B7Z4I2|B7ZA51|G3XAI5|Q8TAZ2|Q9UPM7	Silent	SNP	ENST00000295743.4	37	CCDS2646.1																																																																																					0.697	EOMES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252995.1		NM_005442	
ZBTB20	26137	mdanderson.org	37	3	114070357	114070357	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr3:114070357T>C	ENST00000474710.1	-	4	746	c.568A>G	c.(568-570)Acg>Gcg	p.T190A	ZBTB20-AS1_ENST00000475939.1_RNA|ZBTB20_ENST00000357258.3_Missense_Mutation_p.T117A|ZBTB20_ENST00000471418.1_Missense_Mutation_p.T117A|ZBTB20_ENST00000464560.1_Missense_Mutation_p.T117A|ZBTB20_ENST00000462705.1_Missense_Mutation_p.T117A|ZBTB20-AS1_ENST00000496219.1_RNA|ZBTB20_ENST00000393785.2_Missense_Mutation_p.T117A|ZBTB20-AS1_ENST00000467304.1_RNA|ZBTB20_ENST00000481632.1_Missense_Mutation_p.T117A	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	190						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		ACGATGCGCGTGCACTCGTCG	0.637																																					p.T190A	NSCLC(69;748 1344 9802 11203 30933)												ZBTB20,NS,carcinoma,+2,1	ZBTB20	2	1	0			c.A568G												74.0	59.0	64.0					3																	114070357		2203	4300	6503	SO:0001583	missense	26137	exon4			TGCGCGTGCACTC	AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.568A>G	3.37:g.114070357T>C	ENSP00000419153:p.Thr190Ala		Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_001164342	0		0	Q63HP6|Q8N6R5|Q9Y410	Missense_Mutation	SNP	ENST00000474710.1	37	CCDS54626.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.140015	0.77775	.	.	ENSG00000181722	ENST00000462705;ENST00000393785;ENST00000481632;ENST00000471418;ENST00000474710;ENST00000357258;ENST00000464560	T;T;T;T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25;-0.25;-0.25;-0.25	5.19	5.19	0.71726	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.73713	0.3622	L	0.33668	1.02	0.80722	D	1	D	0.63046	0.992	D	0.74348	0.983	T	0.77070	-0.2724	10	0.87932	D	0	.	15.2172	0.73277	0.0:0.0:0.0:1.0	.	190	Q9HC78	ZBT20_HUMAN	A	117;117;117;117;190;117;117	ENSP00000420324:T117A;ENSP00000377375:T117A;ENSP00000418092:T117A;ENSP00000419902:T117A;ENSP00000419153:T190A;ENSP00000349803:T117A;ENSP00000417307:T117A	ENSP00000349803:T117A	T	-	1	0	ZBTB20	115553047	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.525000	0.81892	2.186000	0.69663	0.528000	0.53228	ACG			0.637	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000354951.1		NM_015642	
LINC00969	440993	bcgsc.ca	37	3	195400814	195400815	+	lincRNA	INS	-	-	TT	rs371598334		TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr3:195400814_195400815insTT	ENST00000445430.1	+	0	1410_1411									long intergenic non-protein coding RNA 969																		ACCTGGTTGTCTGGTCAGGCAT	0.574																																					.													.	.			0			.																																											727956	.			GGTTGTCTGGTCA	AK128346		3q29	2013-06-07			ENSG00000242086	ENSG00000242086		"""Long non-coding RNAs"""	48729	non-coding RNA	RNA, long non-coding							Standard	XR_427455		Approved				OTTHUMG00000155834		3.37:g.195400814_195400815insTT			Somatic	45	0	0		WXS	Illumina HiSeq	Phase_1	74	0.03	2	.	27	0.00	0		Splice_Site	INS	ENST00000445430.1	37																																																																																						0.574	LINC00969-038	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000341951.1			
CLGN	1047	mdanderson.org	37	4	141311836	141311836	+	Silent	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr4:141311836G>T	ENST00000325617.5	-	14	2138	c.1698C>A	c.(1696-1698)atC>atA	p.I566I	CLGN_ENST00000537281.1_Silent_p.I566I|CLGN_ENST00000414773.1_Silent_p.I566I	NM_004362.2	NP_004353.1	O14967	CLGN_HUMAN	calmegin	566					binding of sperm to zona pellucida (GO:0007339)|protein complex assembly (GO:0006461)|protein folding (GO:0006457)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	calcium ion binding (GO:0005509)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(5)|ovary(2)|prostate(3)|skin(4)|urinary_tract(1)	25	all_hematologic(180;0.162)					GCCCTTCTATGATTTCAATTT	0.323																																					p.I566I													.	.			0			c.C1698A												180.0	165.0	170.0					4																	141311836		2202	4298	6500	SO:0001819	synonymous_variant	1047	exon14			TTCTATGATTTCA	D86322	CCDS3751.1	4q28.3-q31.1	2008-02-05			ENSG00000153132	ENSG00000153132			2060	protein-coding gene	gene with protein product		601858					Standard	NM_004362		Approved		uc003iii.3	O14967	OTTHUMG00000133414	ENST00000325617.5:c.1698C>A	4.37:g.141311836G>T			Somatic	186	0	0		WXS	Illumina HiSeq	Phase_I	107	0.05	5	NM_004362	0		0	B3KS90|B4DXV8|D3DNY8	Silent	SNP	ENST00000325617.5	37	CCDS3751.1																																																																																					0.323	CLGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257272.2		NM_004362	
IRF2	3660	broad.mit.edu	37	4	185340674	185340674	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr4:185340674A>C	ENST00000393593.3	-	3	343	c.136T>G	c.(136-138)Tgg>Ggg	p.W46G	IRF2_ENST00000512020.1_5'UTR	NM_002199.3	NP_002190.2	P14316	IRF2_HUMAN	interferon regulatory factor 2	46					blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(2)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	22		all_lung(41;7.86e-14)|Lung NSC(41;1.87e-13)|Colorectal(36;0.00146)|Hepatocellular(41;0.00826)|Renal(120;0.00992)|Prostate(90;0.0115)|all_neural(102;0.0573)|all_hematologic(60;0.0592)		all cancers(43;3.94e-27)|Epithelial(43;5.3e-24)|OV - Ovarian serous cystadenocarcinoma(60;1.06e-10)|Colorectal(24;7.98e-07)|STAD - Stomach adenocarcinoma(60;3.95e-05)|GBM - Glioblastoma multiforme(59;8.3e-05)|COAD - Colon adenocarcinoma(29;0.000106)|BRCA - Breast invasive adenocarcinoma(30;0.000311)|LUSC - Lung squamous cell carcinoma(40;0.0128)|READ - Rectum adenocarcinoma(43;0.0419)		TCCACATCCCACCCATGTCTA	0.423																																					p.W46G													.	IRF2	53		0			c.T136G												127.0	128.0	127.0					4																	185340674		2203	4300	6503	SO:0001583	missense	3660	exon3			CATCCCACCCATG		CCDS3835.1	4q34.1-q35.1	2008-07-29				ENSG00000168310			6117	protein-coding gene	gene with protein product		147576				2475256	Standard	NM_002199		Approved		uc003iwf.4	P14316		ENST00000393593.3:c.136T>G	4.37:g.185340674A>C	ENSP00000377218:p.Trp46Gly		Somatic	104	0.1057692308	11		WXS	Illumina HiSeq	Phase_I	73	0.19	14	NM_002199	12	0.00	0	D6RCK5|H0Y8S3|Q6IAS7|Q96B99	Missense_Mutation	SNP	ENST00000393593.3	37	CCDS3835.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.080283	0.76528	.	.	ENSG00000168310	ENST00000393593;ENST00000507523;ENST00000510814;ENST00000506230;ENST00000505316	D;D;D;D	0.97791	-4.54;-4.54;-4.54;-4.54	4.99	4.99	0.66335	Interferon regulatory factor, conserved site (1);Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.115849	0.64402	D	0.000005	D	0.98639	0.9544	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99802	1.1036	10	0.87932	D	0	-19.9984	14.8642	0.70401	1.0:0.0:0.0:0.0	.	46	P14316	IRF2_HUMAN	G	46	ENSP00000377218:W46G;ENSP00000427204:W46G;ENSP00000424552:W46G;ENSP00000422860:W46G	ENSP00000377218:W46G	W	-	1	0	IRF2	185577668	1.000000	0.71417	0.995000	0.50966	0.973000	0.67179	9.128000	0.94424	2.088000	0.63022	0.533000	0.62120	TGG			0.423	IRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000361393.1			
ADCY2	108	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	7743791	7743791	+	Silent	SNP	C	C	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr5:7743791C>T	ENST00000338316.4	+	15	1971	c.1882C>T	c.(1882-1884)Ctg>Ttg	p.L628L	ADCY2_ENST00000537121.1_Silent_p.L448L|RP11-711G10.1_ENST00000514105.2_RNA	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	628					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						AACGTCCGTCCTGGGCATCTC	0.498																																					p.L628L													.	.			0			c.C1882T												360.0	321.0	334.0					5																	7743791		2203	4300	6503	SO:0001819	synonymous_variant	108	exon15			TCCGTCCTGGGCA	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.1882C>T	5.37:g.7743791C>T			Somatic	201	0	0		WXS	Illumina HiSeq	.	182	0.50	91	NM_020546	0		0	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Silent	SNP	ENST00000338316.4	37	CCDS3872.2																																																																																					0.498	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206930.2		NM_020546	
NADK2	133686	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	36211999	36211999	+	Silent	SNP	A	A	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr5:36211999A>T	ENST00000381937.4	-	7	806	c.807T>A	c.(805-807)ctT>ctA	p.L269L	NADK2_ENST00000397338.1_Silent_p.L106L|NADK2_ENST00000282512.3_Silent_p.L106L|NADK2_ENST00000511613.1_5'UTR|NADK2_ENST00000506945.1_Silent_p.L106L|NADK2_ENST00000514504.1_Silent_p.L269L	NM_001085411.1	NP_001078880.1	Q4G0N4	NAKD2_HUMAN	NAD kinase 2, mitochondrial	269					NAD metabolic process (GO:0019674)|NADP biosynthetic process (GO:0006741)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|NAD+ kinase activity (GO:0003951)|protein homodimerization activity (GO:0042803)										TCACTGGCAGAAGTTGGGGTC	0.368																																					p.L269L													.	.			0			c.T807A												121.0	125.0	124.0					5																	36211999		2203	4300	6503	SO:0001819	synonymous_variant	133686	exon7			TGGCAGAAGTTGG	BC062567	CCDS3917.1, CCDS47197.1, CCDS75235.1	5p13.2	2013-04-30	2013-04-30	2013-04-30	ENSG00000152620	ENSG00000152620			26404	protein-coding gene	gene with protein product	"""mitochondrial NAD kinase"""	615787	"""chromosome 5 open reading frame 33"", ""NAD kinase domain containing 1"""	C5orf33, NADKD1		23616928	Standard	NM_001085411		Approved	FLJ30596, MNADK	uc003jkf.4	Q4G0N4	OTTHUMG00000131105	ENST00000381937.4:c.807T>A	5.37:g.36211999A>T			Somatic	82	0	0		WXS	Illumina HiSeq	.	47	0.34	16	NM_001085411	35	0.46	16	B5MC93|Q6UTX5|Q96NM0	Silent	SNP	ENST00000381937.4	37	CCDS47197.1																																																																																					0.368	NADK2-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000367541.1		NM_153013	
EGFLAM	133584	mdanderson.org	37	5	38409201	38409201	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr5:38409201G>T	ENST00000354891.3	+	10	1690	c.1344G>T	c.(1342-1344)caG>caT	p.Q448H	EGFLAM_ENST00000336740.6_Missense_Mutation_p.Q214H|EGFLAM_ENST00000322350.5_Missense_Mutation_p.Q448H|EGFLAM_ENST00000397202.2_Intron	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	448	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					GCTCCCTGCAGTTCAGGTAAT	0.448																																					p.Q448H	Colon(62;485 1295 3347 17454)												.	.			0			c.G1344T												66.0	56.0	59.0					5																	38409201		2203	4299	6502	SO:0001583	missense	133584	exon10			CCTGCAGTTCAGG	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.1344G>T	5.37:g.38409201G>T	ENSP00000346964:p.Gln448His		Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_152403	40	0.00	0	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	ENST00000354891.3	37	CCDS56363.1	.	.	.	.	.	.	.	.	.	.	G	11.38	1.622321	0.28889	.	.	ENSG00000164318	ENST00000354891;ENST00000322350;ENST00000336740;ENST00000339580	T;T;T	0.76578	-1.03;-1.03;-1.03	5.82	-0.926	0.10455	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.164638	0.56097	N	0.000039	T	0.59266	0.2181	N	0.25789	0.76	0.80722	D	1	B;B;B	0.09022	0.001;0.001;0.002	B;B;B	0.13407	0.003;0.009;0.005	T	0.26883	-1.0090	10	0.29301	T	0.29	-4.0904	7.4574	0.27274	0.3031:0.1073:0.5896:0.0	.	214;448;448	Q63HQ2-4;Q63HQ2;Q63HQ2-2	.;EGFLA_HUMAN;.	H	448;448;214;214	ENSP00000346964:Q448H;ENSP00000313084:Q448H;ENSP00000337607:Q214H	ENSP00000313084:Q448H	Q	+	3	2	EGFLAM	38444958	0.995000	0.38212	0.869000	0.34112	0.911000	0.54048	0.327000	0.19663	-0.545000	0.06224	0.655000	0.94253	CAG			0.448	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000367323.1		NM_152403	
BTN2A3P	54718	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	6	26422353	26422353	+	RNA	SNP	C	C	T	rs571530750	byFrequency	TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr6:26422353C>T	ENST00000466808.2	+	0	7							Q96KV6	BT2A3_HUMAN	butyrophilin, subfamily 2, member A3, pseudogene							integral component of membrane (GO:0016021)		p.P3S(2)									GCTCATGGAACCAGCTGCTGC	0.622													C|||	7	0.00139776	0.0023	0.0	5008	,	,		16376	0.001		0.0	False		,,,				2504	0.0031				.													BTN2A3,NS,carcinoma,0,9	BTN2A3	0	9	2	Substitution - Missense(2)	endometrium(1)|kidney(1)	.																																											54718	.			ATGGAACCAGCTG	AL021917		6p22.1	2014-01-14	2011-09-06	2011-09-06	ENSG00000124549	ENSG00000124549		"""Butyrophilins"""	13229	pseudogene	pseudogene		613592	"""butyrophilin, subfamily 2, member A3"""	BTN2A3			Standard	NR_027795		Approved	BTN2.3	uc011dkl.1	Q96KV6	OTTHUMG00000014453		6.37:g.26422353C>T			Somatic	111	0	0		WXS	Illumina HiSeq	.	82	0.07	6	.	3	0.00	0	A6NEF4	RNA	SNP	ENST00000466808.2	37																																																																																						0.622	BTN2A3P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000040118.4		NR_027795	
ADCY1	107	mdanderson.org	37	7	45701792	45701792	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr7:45701792G>T	ENST00000297323.7	+	8	1606	c.1584G>T	c.(1582-1584)atG>atT	p.M528I	ADCY1_ENST00000432715.1_Missense_Mutation_p.M303I	NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	528					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CCAATGTCATGACCTGCGAGG	0.577																																					p.M528I													.	.			0			c.G1584T												66.0	53.0	58.0					7																	45701792		2203	4300	6503	SO:0001583	missense	107	exon8			TGTCATGACCTGC	L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.1584G>T	7.37:g.45701792G>T	ENSP00000297323:p.Met528Ile		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_021116	139	0.00	0	A4D2L8|Q75MI1	Missense_Mutation	SNP	ENST00000297323.7	37	CCDS34631.1	.	.	.	.	.	.	.	.	.	.	G	16.88	3.243547	0.58995	.	.	ENSG00000164742	ENST00000432715;ENST00000297323;ENST00000545300	T;T	0.81163	-1.46;-1.2	4.57	4.57	0.56435	.	0.044283	0.85682	D	0.000000	T	0.73040	0.3536	L	0.41236	1.265	0.58432	D	0.999997	B;B	0.22480	0.044;0.07	B;B	0.14578	0.002;0.011	T	0.69847	-0.5034	10	0.35671	T	0.21	.	14.8481	0.70275	0.0:0.0:1.0:0.0	.	528;303	Q08828;C9J1J0	ADCY1_HUMAN;.	I	303;528;528	ENSP00000392721:M303I;ENSP00000297323:M528I	ENSP00000297323:M528I	M	+	3	0	ADCY1	45668317	1.000000	0.71417	0.998000	0.56505	0.964000	0.63967	9.198000	0.94994	2.097000	0.63578	0.591000	0.81541	ATG			0.577	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000340055.2		NM_021116	
CCT6P3	643180	broad.mit.edu	37	7	64530103	64530103	+	RNA	SNP	G	G	A	rs369683052		TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr7:64530103G>A	ENST00000426828.1	+	0	923				SNORA15_ENST00000384334.1_RNA	NR_033416.1				chaperonin containing TCP1, subunit 6 (zeta) pseudogene 3																		TGACTGCTTGGGACATGCAGG	0.388																																					.													.	.			0			.																																											0	.			TGCTTGGGACATG			7q11.21	2010-06-29			ENSG00000234585	ENSG00000234585			35137	pseudogene	pseudogene							Standard	NR_033416		Approved		uc010kzt.1		OTTHUMG00000156630		7.37:g.64530103G>A			Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	.	25	0.04	1		RNA	SNP	ENST00000426828.1	37																																																																																						0.388	CCT6P3-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000344862.1			
ZNF3	7551	broad.mit.edu	37	7	99669374	99669374	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr7:99669374G>T	ENST00000424697.1	-	6	1039	c.733C>A	c.(733-735)Cag>Aag	p.Q245K	ZNF3_ENST00000299667.4_Missense_Mutation_p.Q245K|ZNF3_ENST00000303915.6_Missense_Mutation_p.Q245K|ZNF3_ENST00000413658.2_Intron	NM_001278284.1|NM_001278287.1|NM_001278290.1|NM_001278291.1|NM_001278292.1|NM_032924.3	NP_001265213.1|NP_001265216.1|NP_001265219.1|NP_001265220.1|NP_001265221.1|NP_116313.3	P17036	ZNF3_HUMAN	zinc finger protein 3	245					cell differentiation (GO:0030154)|leukocyte activation (GO:0045321)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(8)|ovary(1)|skin(2)	25	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)	Ovarian(593;2.06e-05)|Myeloproliferative disorder(862;0.0122)|Breast(660;0.029)	STAD - Stomach adenocarcinoma(171;0.129)			CTCTGATGCTGAATAAGGTGT	0.463																																					p.Q245K													.	ZNF3	54		0			c.C733A												84.0	94.0	91.0					7																	99669374		2201	4300	6501	SO:0001583	missense	7551	exon6			GATGCTGAATAAG	AF027136	CCDS43618.1, CCDS43619.1	7q22.1	2013-01-08	2006-05-05					"""Zinc fingers, C2H2-type"", ""-"""	13089	protein-coding gene	gene with protein product		194510	"""zinc finger protein 3 (A8-51)"""				Standard	NM_032924		Approved	A8-51, KOX25, PP838, FLJ20216, HF.12, Zfp113	uc003usr.4	P17036		ENST00000424697.1:c.733C>A	7.37:g.99669374G>T	ENSP00000415358:p.Gln245Lys		Somatic	133	0	0		WXS	Illumina HiSeq	Phase_I	222	0.02	4	NM_032924	112	0.00	0	D6W5U0|P13683|Q9HBR4|Q9NNX8|Q9NXJ1|Q9UC15|Q9UC16	Missense_Mutation	SNP	ENST00000424697.1	37	CCDS43619.1	.	.	.	.	.	.	.	.	.	.	G	9.747	1.166386	0.21621	.	.	ENSG00000166526	ENST00000424697;ENST00000303915;ENST00000299667	T;T;T	0.15017	2.46;2.46;2.46	4.6	4.6	0.57074	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.49916	D	0.000121	T	0.09291	0.0229	N	0.03903	-0.33	0.23550	N	0.99743	P;B	0.48162	0.906;0.127	P;B	0.49752	0.621;0.137	T	0.21143	-1.0254	10	0.05721	T	0.95	-21.0458	11.0623	0.47955	0.0:0.1881:0.8119:0.0	.	228;245	B3KRP4;P17036	.;ZNF3_HUMAN	K	245	ENSP00000415358:Q245K;ENSP00000306372:Q245K;ENSP00000299667:Q245K	ENSP00000299667:Q245K	Q	-	1	0	ZNF3	99507310	0.000000	0.05858	0.999000	0.59377	0.995000	0.86356	-1.269000	0.02834	2.568000	0.86640	0.655000	0.94253	CAG			0.463	ZNF3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000336247.3		NM_017715	
JAK2	3717	mdanderson.org	37	9	5126786	5126786	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr9:5126786G>T	ENST00000381652.3	+	25	3888	c.3394G>T	c.(3394-3396)Gga>Tga	p.G1132*	JAK2_ENST00000544510.1_Nonsense_Mutation_p.G983*|JAK2_ENST00000539801.1_Nonsense_Mutation_p.G1132*|JAK2_ENST00000487310.1_3'UTR	NM_004972.3	NP_004963.1	O60674	JAK2_HUMAN	Janus kinase 2	1132					actin filament polymerization (GO:0030041)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone receptor signaling pathway (GO:0060396)|histone H3-Y41 phosphorylation (GO:0035409)|hormone-mediated signaling pathway (GO:0009755)|host programmed cell death induced by symbiont (GO:0034050)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-12-mediated signaling pathway (GO:0035722)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|mammary gland epithelium development (GO:0061180)|mesoderm development (GO:0007498)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA binding (GO:0043392)|negative regulation of heart contraction (GO:0045822)|negative regulation of neuron apoptotic process (GO:0043524)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell activation (GO:0050867)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA binding (GO:0043388)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of inflammatory response (GO:0050729)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to antibiotic (GO:0046677)|response to hydroperoxide (GO:0033194)|response to interleukin-12 (GO:0070671)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|tyrosine phosphorylation of STAT protein (GO:0007260)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome lumen (GO:0031904)|membrane raft (GO:0045121)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|heme binding (GO:0020037)|histone binding (GO:0042393)|histone kinase activity (H3-Y41 specific) (GO:0035401)|interleukin-12 receptor binding (GO:0005143)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)		BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)|ETV6/JAK2(11)|PCM1/JAK2(30)|PAX5/JAK2(18)	breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(32944)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(4)|skin(2)|urinary_tract(1)	32998	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	TAACATGGCTGGATGAAAGAA	0.348		1	"""T, Mis, O"""	"""ETV6, PCM1, BCR"""	"""ALL, AML, MPD,  CML"""				Polycythemia Vera, Familial																												p.G1132X				Dom	yes		9	9p24	3717	Janus kinase 2		L	JAK2,NS,carcinoma,-1,1	JAK2	-1	1	0			c.G3394T												58.0	55.0	56.0					9																	5126786		2203	4300	6503	SO:0001587	stop_gained	3717	exon25	Familial Cancer Database		ATGGCTGGATGAA		CCDS6457.1	9p24	2014-09-17	2009-04-23		ENSG00000096968	ENSG00000096968	2.7.10.1	"""SH2 domain containing"""	6192	protein-coding gene	gene with protein product		147796				1848670	Standard	NM_004972		Approved	JTK10	uc003ziw.3	O60674	OTTHUMG00000019490	ENST00000381652.3:c.3394G>T	9.37:g.5126786G>T	ENSP00000371067:p.Gly1132*		Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	50	0.06	3	NM_004972	12	0.00	0	O14636|O75297	Nonsense_Mutation	SNP	ENST00000381652.3	37	CCDS6457.1	.	.	.	.	.	.	.	.	.	.	G	42	9.611479	0.99219	.	.	ENSG00000096968	ENST00000539801;ENST00000381652;ENST00000544510	.	.	.	5.27	5.27	0.74061	.	0.402294	0.26307	N	0.025124	.	.	.	.	.	.	0.47511	D	0.99944	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.2579	0.93952	0.0:0.0:1.0:0.0	.	.	.	.	X	1132;1132;983	.	ENSP00000371067:G1132X	G	+	1	0	JAK2	5116786	1.000000	0.71417	0.964000	0.40570	0.799000	0.45148	3.938000	0.56583	2.622000	0.88805	0.655000	0.94253	GGA			0.348	JAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051609.1			
PCSK5	5125	broad.mit.edu	37	9	78808163	78808163	+	Intron	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr9:78808163G>T	ENST00000545128.1	+	20	3164				PCSK5_ENST00000376752.4_Missense_Mutation_p.E879D	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						CAACGGAAGAGTCCTGGGCGG	0.463																																					p.E879D													.	PCSK5	329		0			c.G2637T												86.0	80.0	82.0					9																	78808163		2203	4300	6503	SO:0001627	intron_variant	5125	exon21			GGAAGAGTCCTGG		CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.2626+3501G>T	9.37:g.78808163G>T			Somatic	137	0	0		WXS	Illumina HiSeq	Phase_I	98	0.04	4	NM_006200	47	0.00	0	F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	ENST00000545128.1	37	CCDS55320.1	.	.	.	.	.	.	.	.	.	.	G	10.35	1.326071	0.24080	.	.	ENSG00000099139	ENST00000376752	T	0.47869	0.83	5.79	3.73	0.42828	.	.	.	.	.	T	0.28366	0.0701	.	.	.	0.80722	D	1	B	0.26400	0.148	B	0.24394	0.053	T	0.05616	-1.0874	8	0.15066	T	0.55	.	7.5707	0.27907	0.3324:0.0:0.6676:0.0	.	879	Q92824-2	.	D	879	ENSP00000365943:E879D	ENSP00000365943:E879D	E	+	3	2	PCSK5	77997983	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.391000	0.59652	1.449000	0.47699	0.655000	0.94253	GAG			0.463	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding					
DFNB31	25861	mdanderson.org	37	9	117185777	117185777	+	Silent	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr9:117185777G>T	ENST00000362057.3	-	7	1611	c.1443C>A	c.(1441-1443)ggC>ggA	p.G481G	DFNB31_ENST00000265134.6_Silent_p.G98G|DFNB31_ENST00000374059.3_Silent_p.G130G	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	481					inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)				central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GGGAAATGGTGCCTCTCACCT	0.642																																					p.G481G													.	.			0			c.C1443A												65.0	63.0	64.0					9																	117185777		2203	4300	6503	SO:0001819	synonymous_variant	25861	exon7			AATGGTGCCTCTC	AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.1443C>A	9.37:g.117185777G>T			Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	88	0.06	5	NM_001173425	17	0.00	0	A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Silent	SNP	ENST00000362057.3	37	CCDS6806.1																																																																																					0.642	DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053776.2		NM_015404	
SEC16A	9919	bcgsc.ca	37	9	139370740	139370740	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr9:139370740G>T	ENST00000371706.3	-	1	827	c.794C>A	c.(793-795)aCa>aAa	p.T265K	SEC16A_ENST00000313050.7_Missense_Mutation_p.T443K|SEC16A_ENST00000431893.2_Missense_Mutation_p.T265K|SEC16A_ENST00000290037.6_Missense_Mutation_p.T265K			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	265					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		TGTGCTCGCTGTGTCACCCCA	0.607																																					p.T443K													.	SEC16A	249		0			c.C1328A												49.0	58.0	55.0					9																	139370740		2105	4244	6349	SO:0001583	missense	9919	exon3			CTCGCTGTGTCAC	AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.794C>A	9.37:g.139370740G>T	ENSP00000360771:p.Thr265Lys		Somatic	137	0	0		WXS	Illumina HiSeq	Phase_1	106	0.00	0	NM_014866	79	0.00	0	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Missense_Mutation	SNP	ENST00000371706.3	37		.	.	.	.	.	.	.	.	.	.	G	7.188	0.590941	0.13812	.	.	ENSG00000148396	ENST00000313050;ENST00000371706;ENST00000290037;ENST00000431893;ENST00000404925	T;T;T;T	0.22539	1.98;1.95;1.95;1.95	5.46	-1.44	0.08856	.	1.360100	0.04382	N	0.360888	T	0.14056	0.0340	L	0.34521	1.04	0.09310	N	0.999997	B;B;B;B	0.06786	0.0;0.001;0.001;0.0	B;B;B;B	0.06405	0.001;0.002;0.002;0.001	T	0.27502	-1.0072	10	0.29301	T	0.29	0.7021	2.8997	0.05701	0.1658:0.4283:0.2272:0.1787	.	443;265;265;70	F1T0I1;O15027-5;O15027-4;A4QN19	.;.;.;.	K	443;265;265;265;70	ENSP00000325827:T443K;ENSP00000360771:T265K;ENSP00000290037:T265K;ENSP00000387583:T265K	ENSP00000290037:T265K	T	-	2	0	SEC16A	138490561	0.006000	0.16342	0.000000	0.03702	0.001000	0.01503	0.873000	0.28052	0.053000	0.16036	-0.136000	0.14681	ACA			0.607	SEC16A-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000055077.1		XM_088459	
Unknown	0	bcgsc.ca	37	X	48073977	48073977	+	IGR	SNP	C	C	A			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chrX:48073977C>A								RNA5SP503 (8168 upstream) : SSX1 (40774 downstream)																							GGAAATGATTCAAAGGAAGTG	0.458																																					.													.	.			0			.												217.0	207.0	210.0					X																	48073977		876	1991	2867	SO:0001628	intergenic_variant	0	.			ATGATTCAAAGGA																													X.37:g.48073977C>A			Somatic	200	0.015	3		WXS	Illumina HiSeq	Phase_1	207	0.00	0	.	0		0		RNA	SNP		37																																																																																					0	0.458										
WNK3	65267	mdanderson.org	37	X	54360093	54360093	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-05A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62c0fe0a-7fa7-47b2-bf44-88ec999c398c	83598a70-86fa-44e5-833c-6d397c4dd186	g.chrX:54360093G>T	ENST00000375159.2	-	1	13	c.14C>A	c.(13-15)tCa>tAa	p.S5*	WNK3_ENST00000354646.2_Nonsense_Mutation_p.S5*|WNK3_ENST00000375169.3_Nonsense_Mutation_p.S5*			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	5					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						TGGATCCCCTGAATCAGTGGC	0.408																																					p.S5X													.	.			0			c.C14A												26.0	26.0	26.0					X																	54360093		2185	4195	6380	SO:0001587	stop_gained	65267	exon2			TCCCCTGAATCAG	AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.14C>A	X.37:g.54360093G>T	ENSP00000364301:p.Ser5*		Somatic	10	0	0		WXS	Illumina HiSeq	Phase_I	19	0.11	2	NM_001002838	5	0.00	0	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Nonsense_Mutation	SNP	ENST00000375159.2	37	CCDS14357.1	.	.	.	.	.	.	.	.	.	.	G	38	7.162316	0.98107	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159;ENST00000458404	.	.	.	5.57	5.57	0.84162	.	0.000000	0.46145	D	0.000303	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.0818	17.2318	0.86987	0.0:0.0:1.0:0.0	.	.	.	.	X	5	.	ENSP00000346667:S5X	S	-	2	0	WNK3	54376818	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.001000	0.76297	2.336000	0.79503	0.544000	0.68410	TCA			0.408	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000056799.2		NM_020922	
