#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
PLCH2	9651	broad.mit.edu	37	1	2436149	2436149	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr1:2436149G>T	ENST00000419816.2	+	22	4022	c.3748G>T	c.(3748-3750)Gtg>Ttg	p.V1250L	PLCH2_ENST00000449969.1_3'UTR|PLCH2_ENST00000378486.3_Missense_Mutation_p.V1250L|PLCH2_ENST00000378488.3_Missense_Mutation_p.V1214L			O75038	PLCH2_HUMAN	phospholipase C, eta 2	1250					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(3)|skin(1)	20	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		GGACTGCCCCGTGGCTGCCAA	0.682																																					p.V1250L													.	PLCH2	131		0			c.G3748T												28.0	35.0	33.0					1																	2436149		2052	4166	6218	SO:0001583	missense	9651	exon22			TGCCCCGTGGCTG	AB007919	CCDS59959.1	1p36.32	2013-01-10	2006-03-16	2006-03-16	ENSG00000149527	ENSG00000149527	3.1.4.11	"""EF-hand domain containing"""	29037	protein-coding gene	gene with protein product		612836	"""phospholipase C-like 4"""	PLCL4		15899900	Standard	XM_006711054		Approved	KIAA0450, PLCeta2, RP3-395M20.1, PLC-eta2	uc001aji.1	O75038	OTTHUMG00000000719	ENST00000419816.2:c.3748G>T	1.37:g.2436149G>T	ENSP00000389803:p.Val1250Leu		Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	90	0.03	3	NM_014638	3	0.00	0	A2VCM3|B9DI80|Q3LUA8|Q86XJ2|Q86XU1|Q86YU7|Q8TEH5|Q8WUS6	Missense_Mutation	SNP	ENST00000419816.2	37		.	.	.	.	.	.	.	.	.	.	G	6.856	0.527274	0.13066	.	.	ENSG00000149527	ENST00000378486;ENST00000378488;ENST00000278878	T;T	0.24538	1.98;1.85	4.41	2.35	0.29111	.	.	.	.	.	T	0.14270	0.0345	N	0.19112	0.55	0.09310	N	1	B;B	0.27823	0.19;0.145	B;B	0.23852	0.048;0.049	T	0.19321	-1.0309	9	0.42905	T	0.14	.	5.201	0.15264	0.21:0.1742:0.6158:0.0	.	1002;1250	B9DI82;O75038	.;PLCH2_HUMAN	L	1250;1214;1002	ENSP00000367747:V1250L;ENSP00000367749:V1214L	ENSP00000278878:V1002L	V	+	1	0	PLCH2	2426009	0.005000	0.15991	0.016000	0.15963	0.665000	0.39181	1.424000	0.34848	0.837000	0.34925	0.491000	0.48974	GTG			0.682	PLCH2-009	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000467514.1		NM_014638	
ZBTB48	3104	broad.mit.edu;mdanderson.org	37	1	6647661	6647661	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr1:6647661G>T	ENST00000377674.4	+	7	1506	c.1348G>T	c.(1348-1350)Ggc>Tgc	p.G450C		NM_001278647.1|NM_001278648.1|NM_005341.2	NP_001265576.1|NP_001265577.1|NP_005332.1	P10074	ZBT48_HUMAN	zinc finger and BTB domain containing 48	450					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	11	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.35e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00109)|STAD - Stomach adenocarcinoma(132;0.017)|READ - Rectum adenocarcinoma(331;0.0642)		GAGCCGGAATGGCCTGCAGAT	0.622																																					p.G450C	Esophageal Squamous(125;1449 1657 4031 29866 49542)												.	ZBTB48	33		0			c.G1348T												88.0	83.0	85.0					1																	6647661		2203	4300	6503	SO:0001583	missense	3104	exon7			CGGAATGGCCTGC	BC013573	CCDS84.1	1p36.3	2013-01-08	2006-09-20	2006-09-20	ENSG00000204859	ENSG00000204859		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	4930	protein-coding gene	gene with protein product		165270	"""GLI-Kruppel family member HKR3"""	HKR3		2850480, 8661141	Standard	NM_001278647		Approved	ZNF855	uc001anx.3	P10074	OTTHUMG00000001438	ENST00000377674.4:c.1348G>T	1.37:g.6647661G>T	ENSP00000366902:p.Gly450Cys		Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	66	0.06	4	NM_005341	57	0.00	0	Q5SY19	Missense_Mutation	SNP	ENST00000377674.4	37	CCDS84.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.509972	0.85282	.	.	ENSG00000204859	ENST00000377674	T	0.15487	2.42	5.62	4.7	0.59300	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.30386	0.0763	L	0.28740	0.885	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.03597	-1.1021	10	0.40728	T	0.16	-29.22	16.0133	0.80420	0.0:0.1347:0.8653:0.0	.	450	P10074	ZBT48_HUMAN	C	450	ENSP00000366902:G450C	ENSP00000366902:G450C	G	+	1	0	ZBTB48	6570248	1.000000	0.71417	0.525000	0.27900	0.995000	0.86356	7.804000	0.85993	1.515000	0.48885	0.561000	0.74099	GGC			0.622	ZBTB48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000004193.1		NM_005341	
SDC3	9672	hgsc.bcm.edu	37	1	31347395	31347395	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr1:31347395T>C	ENST00000339394.6	-	4	1085	c.911A>G	c.(910-912)gAg>gGg	p.E304G	SDC3_ENST00000336798.7_Missense_Mutation_p.E246G|SDC3_ENST00000471567.1_5'Flank	NM_014654.3	NP_055469.3	O75056	SDC3_HUMAN	syndecan 3	304					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0393)|Colorectal(325;0.0466)|all_neural(195;0.0966)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)		STAD - Stomach adenocarcinoma(196;0.0197)|READ - Rectum adenocarcinoma(331;0.0649)		AACCTCTGGCTCATCCCGGAT	0.592																																					p.E304G													.	.			0			c.A911G												109.0	109.0	109.0					1																	31347395		2203	4300	6503	SO:0001583	missense	9672	exon4			TCTGGCTCATCCC	AF248634	CCDS30661.1	1p35.2	2013-09-19	2007-02-15		ENSG00000162512	ENSG00000162512		"""Proteoglycans / Cell Surface : Syndecans"""	10660	protein-coding gene	gene with protein product	"""syndecan proteoglycan 3"""	186357	"""syndecan 3 (N-syndecan)"""			1556152, 11527150	Standard	NM_014654		Approved	N-syndecan, SYND3	uc001bse.2	O75056	OTTHUMG00000043646	ENST00000339394.6:c.911A>G	1.37:g.31347395T>C	ENSP00000344468:p.Glu304Gly		Somatic	113	0	0		WXS	Illumina HiSeq	.	88	0.05	4	NM_014654	23	0.00	0	Q5T1Z6|Q5T1Z7|Q96CT3|Q96PR8	Missense_Mutation	SNP	ENST00000339394.6	37	CCDS30661.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.186140	0.78789	.	.	ENSG00000162512	ENST00000336798;ENST00000339394	T;T	0.34667	1.37;1.35	4.7	4.7	0.59300	.	0.092204	0.46145	D	0.000311	T	0.39172	0.1068	N	0.19112	0.55	0.42683	D	0.99355	D;D	0.59767	0.975;0.986	P;P	0.59595	0.766;0.86	T	0.27226	-1.0080	10	0.44086	T	0.13	-20.6923	12.8786	0.58003	0.0:0.0:0.0:1.0	.	304;246	O75056;D3DPN2	SDC3_HUMAN;.	G	246;304	ENSP00000338346:E246G;ENSP00000344468:E304G	ENSP00000338346:E246G	E	-	2	0	SDC3	31119982	0.997000	0.39634	0.997000	0.53966	0.786000	0.44442	3.602000	0.54066	1.986000	0.57962	0.460000	0.39030	GAG			0.592	SDC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000102017.1		NM_014654	
SH3D21	79729	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	36775175	36775175	+	Silent	SNP	G	G	A			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr1:36775175G>A	ENST00000426732.2	+	9	690	c.405G>A	c.(403-405)gtG>gtA	p.V135V	SH3D21_ENST00000453908.2_Silent_p.V251V|SH3D21_ENST00000312808.4_5'UTR|SH3D21_ENST00000505871.1_Silent_p.V140V			A4FU49	SH321_HUMAN	SH3 domain containing 21	135						extracellular vesicular exosome (GO:0070062)				endometrium(1)|large_intestine(6)|lung(4)|pancreas(1)	12						CACGGAAAGTGGTATCTCGGG	0.522																																					p.V251V													.	.			0			c.G753A												118.0	107.0	111.0					1																	36775175		692	1591	2283	SO:0001819	synonymous_variant	79729	exon10			GAAAGTGGTATCT	AK056459	CCDS30674.1, CCDS30674.2	1p34.3	2011-02-21	2011-02-21	2011-02-21	ENSG00000214193	ENSG00000214193			26236	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 113"""	C1orf113		12477932	Standard	NM_024676		Approved	FLJ22938	uc010oia.1	A4FU49	OTTHUMG00000007868	ENST00000426732.2:c.405G>A	1.37:g.36775175G>A			Somatic	60	0	0		WXS	Illumina HiSeq	.	65	0.15	10	NM_001162530	17	0.41	7	B4DLI6|D3DPS6|J3KQM5|Q5VTK7|Q86XZ6|Q8N445|Q96DN4|Q9H5W5	Silent	SNP	ENST00000426732.2	37																																																																																						0.522	SH3D21-202	KNOWN	basic	protein_coding	protein_coding				NM_024676	
HCN3	57657	broad.mit.edu;mdanderson.org	37	1	155258014	155258014	+	Silent	SNP	T	T	C			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr1:155258014T>C	ENST00000368358.3	+	8	2093	c.2085T>C	c.(2083-2085)ggT>ggC	p.G695G	HCN3_ENST00000496230.1_3'UTR	NM_020897.2	NP_065948.1	Q9P1Z3	HCN3_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 3	695					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CCCTGCTGGGTCCCCCTCCAG	0.726																																					p.G695G													.	HCN3	74		0			c.T2085C												8.0	10.0	9.0					1																	155258014		2160	4216	6376	SO:0001819	synonymous_variant	57657	exon8			GCTGGGTCCCCCT	AB040968	CCDS1108.1	1q21.2	2011-07-05			ENSG00000143630	ENSG00000143630		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	19183	protein-coding gene	gene with protein product		609973				16382102	Standard	NM_020897		Approved	KIAA1535	uc001fjz.2	Q9P1Z3	OTTHUMG00000035872	ENST00000368358.3:c.2085T>C	1.37:g.155258014T>C			Somatic	35	0.0285714286	1		WXS	Illumina HiSeq	Phase_I	32	0.09	3	NM_020897	0		0	D3DV90|Q4VX12|Q8N6W6|Q9BWQ2	Silent	SNP	ENST00000368358.3	37	CCDS1108.1																																																																																					0.726	HCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000087388.1		NM_020897	
GON4L	54856	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	155733205	155733205	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr1:155733205C>A	ENST00000368331.1	-	22	4672	c.4624G>T	c.(4624-4626)Gat>Tat	p.D1542Y	GON4L_ENST00000437809.1_Missense_Mutation_p.D1542Y|GON4L_ENST00000271883.5_Missense_Mutation_p.D1542Y|GON4L_ENST00000471341.1_5'Flank	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1542	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					GTCATTTCATCCTCTTTCTGC	0.502																																					p.D1542Y													.	.			0			c.G4624T												49.0	50.0	50.0					1																	155733205		1994	4185	6179	SO:0001583	missense	54856	exon22			TTTCATCCTCTTT	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.4624G>T	1.37:g.155733205C>A	ENSP00000357315:p.Asp1542Tyr		Somatic	80	0	0		WXS	Illumina HiSeq	.	101	0.06	6	NM_001037533	47	0.28	13	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Missense_Mutation	SNP	ENST00000368331.1	37		.	.	.	.	.	.	.	.	.	.	C	19.75	3.885598	0.72410	.	.	ENSG00000116580	ENST00000437809;ENST00000368331;ENST00000271883	T;T;T	0.15952	2.38;2.38;2.38	4.78	3.87	0.44632	.	0.161726	0.43260	D	0.000581	T	0.25044	0.0608	L	0.54323	1.7	0.44024	D	0.99674	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.99;0.994;0.997	T	0.02526	-1.1146	10	0.72032	D	0.01	.	12.577	0.56369	0.0:0.919:0.0:0.081	.	738;1542;1542	Q1ED43;Q3T8J9;Q3T8J9-3	.;GON4L_HUMAN;.	Y	1542	ENSP00000396117:D1542Y;ENSP00000357315:D1542Y;ENSP00000271883:D1542Y	ENSP00000271883:D1542Y	D	-	1	0	GON4L	153999829	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	6.199000	0.72112	1.242000	0.43836	0.561000	0.74099	GAT			0.502	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				NM_032292	
PAPPA2	60676	broad.mit.edu	37	1	176671868	176671868	+	Nonsense_Mutation	SNP	C	C	G			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr1:176671868C>G	ENST00000367662.3	+	9	4526	c.3362C>G	c.(3361-3363)tCa>tGa	p.S1121*		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1121					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GGGAAGGTGTCAGAGTGAGTA	0.507																																					p.S1121X													.	PAPPA2	665		0			c.C3362G												75.0	72.0	73.0					1																	176671868		1971	4159	6130	SO:0001587	stop_gained	60676	exon9			AGGTGTCAGAGTG	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.3362C>G	1.37:g.176671868C>G	ENSP00000356634:p.Ser1121*		Somatic	52	0.0576923077	3		WXS	Illumina HiSeq	Phase_I	43	0.21	9	NM_020318	0		0	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Nonsense_Mutation	SNP	ENST00000367662.3	37	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	C	48	14.803902	0.99810	.	.	ENSG00000116183	ENST00000367662	.	.	.	5.26	0.793	0.18632	.	0.903166	0.09717	N	0.764915	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	3.039	14.0173	0.64531	0.6667:0.3333:0.0:0.0	.	.	.	.	X	1121	.	ENSP00000356634:S1121X	S	+	2	0	PAPPA2	174938491	0.002000	0.14202	0.000000	0.03702	0.342000	0.28953	0.440000	0.21592	-0.118000	0.11851	0.563000	0.77884	TCA			0.507	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000084763.1			
OBSCN	84033	mdanderson.org	37	1	228559278	228559278	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr1:228559278G>T	ENST00000422127.1	+	94	20843	c.20799G>T	c.(20797-20799)caG>caT	p.Q6933H	OBSCN_ENST00000366707.4_Missense_Mutation_p.Q4567H|OBSCN_ENST00000570156.2_Missense_Mutation_p.Q7890H	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	6933					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGGAGGAGCAGGCCACCCTCC	0.697																																					p.Q7890H													.	.			0			c.G23670T												9.0	15.0	13.0					1																	228559278		2055	4172	6227	SO:0001583	missense	84033	exon105			GGAGCAGGCCACC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.20799G>T	1.37:g.228559278G>T	ENSP00000409493:p.Gln6933His		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_001271223	2	0.00	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.87|14.87	2.664411|2.664411	0.47572|0.47572	.|.	.|.	ENSG00000154358|ENSG00000154358	ENST00000441106|ENST00000422127;ENST00000366707	.|T;T	.|0.63417	.|-0.04;-0.0	4.27|4.27	1.12|1.12	0.20585|0.20585	.|.	.|.	.|.	.|.	.|.	T|T	0.45875|0.45875	0.1364|0.1364	L|L	0.29908|0.29908	0.895|0.895	0.21220|0.21220	N|N	0.99976|0.99976	.|B	.|0.02656	.|0.0	.|B	.|0.04013	.|0.001	T|T	0.33420|0.33420	-0.9869|-0.9869	5|9	.|0.41790	.|T	.|0.15	.|.	6.8457|6.8457	0.23987|0.23987	0.1669:0.1435:0.6895:0.0|0.1669:0.1435:0.6895:0.0	.|.	.|6933	.|Q5VST9	.|OBSCN_HUMAN	C|H	1550|6933;4567	.|ENSP00000409493:Q6933H;ENSP00000355668:Q4567H	.|ENSP00000355668:Q4567H	G|Q	+|+	1|3	0|2	OBSCN|OBSCN	226625901|226625901	0.000000|0.000000	0.05858|0.05858	0.106000|0.106000	0.21319|0.21319	0.022000|0.022000	0.10575|0.10575	0.208000|0.208000	0.17415|0.17415	0.435000|0.435000	0.26365|0.26365	0.555000|0.555000	0.69702|0.69702	GGC|CAG			0.697	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding				NM_052843	
RYR2	6262	mdanderson.org	37	1	237789089	237789089	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr1:237789089G>T	ENST00000366574.2	+	40	6468	c.6151G>T	c.(6151-6153)Gac>Tac	p.D2051Y	RYR2_ENST00000542537.1_Missense_Mutation_p.D2035Y|RYR2_ENST00000360064.6_Missense_Mutation_p.D2049Y	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2051	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGTTGAGAGTGACTCCAAAAA	0.433																																					p.D2051Y													.	.			0			c.G6151T												82.0	79.0	80.0					1																	237789089		1929	4141	6070	SO:0001583	missense	6262	exon40			GAGAGTGACTCCA	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.6151G>T	1.37:g.237789089G>T	ENSP00000355533:p.Asp2051Tyr		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_001035	0		0	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	12.79	2.043057	0.36085	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.73575	-0.76;-0.76;-0.76	5.47	3.49	0.39957	.	0.180824	0.34291	U	0.004093	T	0.58409	0.2120	N	0.22421	0.69	0.80722	D	1	B	0.13594	0.008	B	0.09377	0.004	T	0.58194	-0.7679	10	0.87932	D	0	.	8.3862	0.32501	0.0782:0.0:0.7684:0.1534	.	2051	Q92736	RYR2_HUMAN	Y	2051;2049;2035	ENSP00000355533:D2051Y;ENSP00000353174:D2049Y;ENSP00000443798:D2035Y	ENSP00000353174:D2049Y	D	+	1	0	RYR2	235855712	1.000000	0.71417	0.995000	0.50966	0.917000	0.54804	1.843000	0.39259	1.320000	0.45209	0.561000	0.74099	GAC			0.433	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000095402.2		NM_001035	
NAMPTL	646309	bcgsc.ca;mdanderson.org	37	10	36812187	36812187	+	5'UTR	SNP	G	G	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr10:36812187G>T	ENST00000543053.1	-	0	136									nicotinamide phosphoribosyltransferase-like											biliary_tract(1)|breast(3)|lung(9)|stomach(1)	14						AGATAAGGTGGCAGCAACTTG	0.363																																					.													.	.			0			.																																									SO:0001623	5_prime_UTR_variant	646309	.			AAGGTGGCAGCAA			10p11.21	2013-03-27	2008-11-06	2008-11-06	ENSG00000229644	ENSG00000229644			17633	other	unknown			"""pre-B-cell colony enhancing factor 2"""	PBEF2		8289818	Standard	NG_005593		Approved	bA92J19.4			OTTHUMG00000017964	ENST00000543053.1:c.-81C>A	10.37:g.36812187G>T			Somatic	453	0	0		WXS	Illumina HiSeq	Phase_1	425	0.06	24	.	89	0.00	0		Missense_Mutation	SNP	ENST00000543053.1	37		.	.	.	.	.	.	.	.	.	.	g	13.95	2.388718	0.42308	.	.	ENSG00000229644	ENST00000440465	.	.	.	2.07	1.11	0.20524	.	0.000000	0.85682	D	0.000000	T	0.55689	0.1936	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49021	-0.8982	6	0.40728	T	0.16	3.1986	6.6958	0.23197	0.1627:0.0:0.8373:0.0	.	.	.	.	T	326	.	ENSP00000407952:P326T	P	-	1	0	NAMPTL	36852193	1.000000	0.71417	0.724000	0.30704	0.966000	0.64601	4.823000	0.62694	0.245000	0.21373	0.458000	0.33432	CCA			0.363	NAMPTL-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NG_005593	
DBF4P1	645084	bcgsc.ca	37	10	65929122	65929122	+	IGR	SNP	G	G	A			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr10:65929122G>A								RP11-174J11.1 (132082 upstream) : RP11-179K3.2 (731771 downstream)																							AGGTGCTCTTGTGAACTGTTT	0.398																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GCTCTTGTGAACT																													10.37:g.65929122G>A			Somatic	231	0	0		WXS	Illumina HiSeq	Phase_1	218	0.06	12	.	17	0.00	0		RNA	SNP		37																																																																																					0	0.398										
CNNM1	26507	mdanderson.org	37	10	101089340	101089340	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr10:101089340G>T	ENST00000356713.4	+	1	485	c.196G>T	c.(196-198)Gaa>Taa	p.E66*	CNNM1_ENST00000370528.3_Nonsense_Mutation_p.E66*|CNNM1_ENST00000446890.1_Nonsense_Mutation_p.E66*|CNNM1_ENST00000370534.4_5'Flank	NM_020348.2	NP_065081.2	Q9NRU3	CNNM1_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 1	66					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(5)|ovary(1)|prostate(1)|skin(1)	25		Colorectal(252;0.234)		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)		GCGCGCCGCCGAAGGCACCAG	0.746																																					p.E66X													CNNM1_ENST00000356713,right_upper_lobe,carcinoma,0,1	CNNM1_ENST00000356713	0	1	0			c.G196T												8.0	9.0	8.0					10																	101089340		1716	3773	5489	SO:0001587	stop_gained	26507	exon1			GCCGCCGAAGGCA	AF169226	CCDS7478.2	10q24.2	2014-08-08	2014-08-07		ENSG00000119946	ENSG00000119946			102	protein-coding gene	gene with protein product		607802	"""cyclin M1"""	ACDP1		21393841	Standard	NM_020348		Approved		uc001kpp.4	Q9NRU3	OTTHUMG00000018881	ENST00000356713.4:c.196G>T	10.37:g.101089340G>T	ENSP00000349147:p.Glu66*		Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	21	0.14	3	NM_020348	0		0	Q4QQG7|Q4QQH8|Q4QQP9|Q9NT45	Nonsense_Mutation	SNP	ENST00000356713.4	37	CCDS7478.2	.	.	.	.	.	.	.	.	.	.	g	35	5.557665	0.96514	.	.	ENSG00000119946	ENST00000356713;ENST00000446890;ENST00000370528	.	.	.	3.61	3.61	0.41365	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-8.2566	14.1994	0.65693	0.0:0.0:1.0:0.0	.	.	.	.	X	66	.	ENSP00000349147:E66X	E	+	1	0	CNNM1	101079330	1.000000	0.71417	0.967000	0.41034	0.961000	0.63080	7.139000	0.77314	1.873000	0.54277	0.457000	0.33378	GAA			0.746	CNNM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049792.2		NM_020348	
HPS6	79803	mdanderson.org	37	10	103826173	103826173	+	Silent	SNP	T	T	C			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr10:103826173T>C	ENST00000299238.5	+	1	1027	c.942T>C	c.(940-942)tcT>tcC	p.S314S		NM_024747.5	NP_079023.2	Q86YV9	HPS6_HUMAN	Hermansky-Pudlak syndrome 6	314					blood coagulation (GO:0007596)|melanocyte differentiation (GO:0030318)|organelle organization (GO:0006996)|protein localization to membrane (GO:0072657)	BLOC-2 complex (GO:0031084)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|Rab GTPase binding (GO:0017137)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|prostate(1)	11		Colorectal(252;0.122)		Epithelial(162;5.93e-08)|all cancers(201;1.03e-06)		CGTGGGGGTCTGCAGCCCTAG	0.637									Hermansky-Pudlak syndrome																												p.S314S													.	.			0			c.T942C												55.0	59.0	57.0					10																	103826173		2203	4300	6503	SO:0001819	synonymous_variant	79803	exon1	Familial Cancer Database	HPS, HPS1-8	GGGGTCTGCAGCC	BC009258	CCDS7527.1	10q24.32	2014-06-18			ENSG00000166189	ENSG00000166189			18817	protein-coding gene	gene with protein product		607522				12548288	Standard	NM_024747		Approved	FLJ22501	uc001kuj.3	Q86YV9	OTTHUMG00000018945	ENST00000299238.5:c.942T>C	10.37:g.103826173T>C			Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_024747	22	0.00	0	Q5VV69|Q9H685	Silent	SNP	ENST00000299238.5	37	CCDS7527.1																																																																																					0.637	HPS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050018.2		NM_024747	
PPRC1	23082	mdanderson.org	37	10	103892852	103892852	+	Silent	SNP	C	C	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr10:103892852C>T	ENST00000278070.2	+	1	66	c.27C>T	c.(25-27)gaC>gaT	p.D9D	PPRC1_ENST00000413464.2_Silent_p.D9D	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	9					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		GACGGAGAGACGGAGTCGCGC	0.716																																					p.D9D													.	.			0			c.C27T												3.0	4.0	4.0					10																	103892852		1832	3656	5488	SO:0001819	synonymous_variant	23082	exon1			GAGAGACGGAGTC	AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.27C>T	10.37:g.103892852C>T			Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	19	0.16	3	NM_015062	7	0.00	0	Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Silent	SNP	ENST00000278070.2	37	CCDS7529.1																																																																																					0.716	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050021.1		NM_015062	
FAM160A2	84067	mdanderson.org	37	11	6245294	6245294	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr11:6245294C>T	ENST00000449352.2	-	3	586	c.323G>A	c.(322-324)cGt>cAt	p.R108H	FAM160A2_ENST00000265978.4_Missense_Mutation_p.R108H|FAM160A2_ENST00000524416.1_Missense_Mutation_p.R108H			Q8N612	F16A2_HUMAN	family with sequence similarity 160, member A2	108					early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	FHF complex (GO:0070695)				NS(1)|endometrium(3)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TGTCAACACACGGGTCAGCAG	0.592																																					p.R108H													.	.			0			c.G323A												48.0	39.0	42.0					11																	6245294		2201	4296	6497	SO:0001583	missense	84067	exon3			AACACACGGGTCA		CCDS7760.1, CCDS44530.1	11p15.4	2008-06-05	2008-06-05	2008-06-05	ENSG00000051009	ENSG00000051009			25378	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 56"""	C11orf56		11230166, 11214970	Standard	NM_001098794		Approved	FLJ22665, KIAA1759, DKFZP566M1046	uc001mck.4	Q8N612	OTTHUMG00000133379	ENST00000449352.2:c.323G>A	11.37:g.6245294C>T	ENSP00000416918:p.Arg108His		Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	75	0.05	4	NM_032127	12	0.00	0	Q9C0A4|Q9H0N3|Q9H624	Missense_Mutation	SNP	ENST00000449352.2	37	CCDS44530.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.308430	0.81247	.	.	ENSG00000051009	ENST00000449352;ENST00000442917;ENST00000265978;ENST00000524416	T;T;T	0.30448	1.53;1.53;1.53	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.47801	0.1465	L	0.60455	1.87	0.43246	D	0.995168	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.75020	0.98;0.985;0.982	T	0.32903	-0.9889	10	0.41790	T	0.15	-9.3444	10.679	0.45802	0.0:0.9127:0.0:0.0873	.	108;108;108	E9PJK5;Q8N612;Q8N612-2	.;F16A2_HUMAN;.	H	108;33;108;108	ENSP00000416918:R108H;ENSP00000265978:R108H;ENSP00000431773:R108H	ENSP00000265978:R108H	R	-	2	0	FAM160A2	6201870	0.163000	0.22920	1.000000	0.80357	0.990000	0.78478	0.859000	0.27858	2.642000	0.89623	0.655000	0.94253	CGT			0.592	FAM160A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000383759.1		NM_032127	
HNRNPUL2	221092	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	62490079	62490079	+	Silent	SNP	G	G	A			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr11:62490079G>A	ENST00000301785.5	-	6	1281	c.1089C>T	c.(1087-1089)tgC>tgT	p.C363C	HNRNPUL2-BSCL2_ENST00000403734.2_Silent_p.C363C	NM_001079559.2	NP_001073027.1	Q1KMD3	HNRL2_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 2	363	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						TTACAGCAAAGCAGCCAATAA	0.453																																					p.C363C													HNRNPUL2,NS,carcinoma,-1,1	HNRNPUL2	-1	1	0			c.C1089T												112.0	103.0	106.0					11																	62490079		1943	4135	6078	SO:0001819	synonymous_variant	221092	exon6			AGCAAAGCAGCCA		CCDS41659.1	11q12	2013-07-16		2008-04-18	ENSG00000214753	ENSG00000214753			25451	protein-coding gene	gene with protein product				HNRPUL2			Standard	NM_001079559		Approved	DKFZp762N1910	uc001nuw.3	Q1KMD3	OTTHUMG00000167773	ENST00000301785.5:c.1089C>T	11.37:g.62490079G>A			Somatic	180	0	0		WXS	Illumina HiSeq	.	148	0.10	15	NM_001079559	121	0.24	29	Q8N3B3	Silent	SNP	ENST00000301785.5	37	CCDS41659.1																																																																																					0.453	HNRNPUL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396208.2		XM_495877	
C11orf68	83638	mdanderson.org	37	11	65685142	65685142	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr11:65685142G>A	ENST00000530188.1	-	1	689	c.544C>T	c.(544-546)Cgc>Tgc	p.R182C	DRAP1_ENST00000312515.2_5'Flank|C11orf68_ENST00000449692.3_Missense_Mutation_p.R223C|DRAP1_ENST00000376991.2_5'Flank|C11orf68_ENST00000438576.2_Missense_Mutation_p.R224C|DRAP1_ENST00000532933.1_5'Flank|DRAP1_ENST00000527119.1_5'Flank			Q9H3H3	CK068_HUMAN	chromosome 11 open reading frame 68	182							poly(A) RNA binding (GO:0044822)			large_intestine(1)|lung(3)	4				READ - Rectum adenocarcinoma(159;0.166)		ACACCCAAGCGGTCCGTGAAG	0.607																																					p.R224C													.	.			0			c.C670T												63.0	58.0	60.0					11																	65685142		2201	4296	6497	SO:0001583	missense	83638	exon2			CCAAGCGGTCCGT	AF073483	CCDS8122.2, CCDS44652.1	11q13.1	2012-08-09			ENSG00000175573	ENSG00000175573			28801	protein-coding gene	gene with protein product	"""basophilic leukemia-expressed protein"""					16511166	Standard	NM_031450		Approved	P5326, BLES03	uc001ogi.3	Q9H3H3	OTTHUMG00000157153	ENST00000530188.1:c.544C>T	11.37:g.65685142G>A	ENSP00000433914:p.Arg182Cys		Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	55	0.05	3	NM_001135635	106	0.00	0	J3KQG9|Q9BT13	Missense_Mutation	SNP	ENST00000530188.1	37		.	.	.	.	.	.	.	.	.	.	G	21.8	4.198989	0.79015	.	.	ENSG00000175573	ENST00000438576;ENST00000449692;ENST00000530188	T;T;T	0.48201	0.82;0.82;0.82	4.72	3.8	0.43715	Translation Initiation factor eIF- 4e-like  domain (2);	0.133153	0.49916	D	0.000122	T	0.49677	0.1571	L	0.52573	1.65	0.50313	D	0.999861	D;D	0.71674	0.997;0.998	P;P	0.52424	0.572;0.698	T	0.51395	-0.8711	10	0.72032	D	0.01	-13.903	8.4033	0.32599	0.0:0.1698:0.6546:0.1756	.	223;182	Q9H3H3-2;Q9H3H3	.;CK068_HUMAN	C	224;223;182	ENSP00000398350:R224C;ENSP00000409681:R223C;ENSP00000433914:R182C	ENSP00000398350:R224C	R	-	1	0	C11orf68	65441718	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.766000	0.68843	1.112000	0.41740	0.462000	0.41574	CGC			0.607	C11orf68-003	PUTATIVE	basic	protein_coding	protein_coding		OTTHUMT00000391173.1		NM_031450	
CST6	1474	mdanderson.org	37	11	65779678	65779678	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr11:65779678G>A	ENST00000312134.2	+	1	367	c.163G>A	c.(163-165)Gcc>Acc	p.A55T		NM_001323.3	NP_001314.1	Q15828	CYTM_HUMAN	cystatin E/M	55					anatomical structure morphogenesis (GO:0009653)|epidermis development (GO:0008544)|negative regulation of endopeptidase activity (GO:0010951)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			large_intestine(1)|lung(1)|ovary(1)	3						GGCGCAGGCGGCCGTGGCCAG	0.701																																					p.A55T													.	.			0			c.G163A												11.0	10.0	10.0					11																	65779678		2006	4035	6041	SO:0001583	missense	1474	exon1			CAGGCGGCCGTGG	U62800	CCDS8126.1	11q13	2005-09-29			ENSG00000175315	ENSG00000175315			2478	protein-coding gene	gene with protein product		601891				9154125, 9099741	Standard	NM_001323		Approved		uc001ogr.3	Q15828	OTTHUMG00000166750	ENST00000312134.2:c.163G>A	11.37:g.65779678G>A	ENSP00000311313:p.Ala55Thr		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_001323	0		0	Q540N7	Missense_Mutation	SNP	ENST00000312134.2	37	CCDS8126.1	.	.	.	.	.	.	.	.	.	.	G	14.92	2.678175	0.47886	.	.	ENSG00000175315	ENST00000312134	T	0.29917	1.55	5.21	4.29	0.51040	Proteinase inhibitor I25, cystatin (2);	0.061508	0.64402	D	0.000006	T	0.53674	0.1811	M	0.82630	2.6	0.19575	N	0.999969	D	0.63046	0.992	P	0.62649	0.905	T	0.50882	-0.8775	10	0.51188	T	0.08	-19.936	11.8167	0.52216	0.0:0.177:0.823:0.0	.	55	Q15828	CYTM_HUMAN	T	55	ENSP00000311313:A55T	ENSP00000311313:A55T	A	+	1	0	CST6	65536254	0.803000	0.28956	0.130000	0.21974	0.007000	0.05969	3.314000	0.51943	1.182000	0.42928	0.655000	0.94253	GCC			0.701	CST6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000391348.1		NM_001323	
C11orf73	51501	broad.mit.edu;mdanderson.org	37	11	86013506	86013506	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr11:86013506G>T	ENST00000278483.3	+	1	242	c.16G>T	c.(16-18)Gtg>Ttg	p.V6L	C11orf73_ENST00000533986.1_Missense_Mutation_p.V6L	NM_016401.3	NP_057485.2	Q53FT3	HIKES_HUMAN	chromosome 11 open reading frame 73	6					cellular response to heat (GO:0034605)|Golgi organization (GO:0007030)|lung development (GO:0030324)|protein import into nucleus (GO:0006606)|protein transport (GO:0015031)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	Hsp70 protein binding (GO:0030544)|protein transporter activity (GO:0008565)			kidney(1)|large_intestine(1)|urinary_tract(1)	3		Acute lymphoblastic leukemia(157;1.17e-07)|all_hematologic(158;0.000556)				TGGCTGCTTGGTGGCGGGGAG	0.647																																					p.V6L													.	C11orf73	9		0			c.G16T												29.0	23.0	25.0					11																	86013506		2185	4269	6454	SO:0001583	missense	51501	exon1			TGCTTGGTGGCGG	BC015991	CCDS8275.1	11q14.2	2013-03-12			ENSG00000149196	ENSG00000149196			26938	protein-coding gene	gene with protein product		614908				11042152, 22541429	Standard	NM_016401		Approved	HSPC138, HSPC179, Hikeshi, OPI10	uc001pbu.3	Q53FT3	OTTHUMG00000167212	ENST00000278483.3:c.16G>T	11.37:g.86013506G>T	ENSP00000278483:p.Val6Leu		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	58	0.07	4	NM_016401	162	0.00	0	Q8WVE8|Q9NVQ2|Q9NZZ1|Q9P022|Q9P0N1	Missense_Mutation	SNP	ENST00000278483.3	37	CCDS8275.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.460034	0.84317	.	.	ENSG00000149196	ENST00000533986;ENST00000278483	T;T	0.42513	0.97;0.97	4.98	4.98	0.66077	.	0.058227	0.64402	D	0.000002	T	0.51873	0.1700	M	0.66506	2.035	0.80722	D	1	B;P	0.39443	0.109;0.674	B;P	0.45428	0.177;0.48	T	0.48614	-0.9020	9	.	.	.	-9.9551	18.8064	0.92038	0.0:0.0:1.0:0.0	.	6;6	Q53FT3;E9PPG8	CK073_HUMAN;.	L	6	ENSP00000432699:V6L;ENSP00000278483:V6L	.	V	+	1	0	C11orf73	85691154	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.379000	0.79691	2.741000	0.93983	0.585000	0.79938	GTG			0.647	C11orf73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393747.1		NM_016401	
FOLH1B	219595	broad.mit.edu	37	11	89403957	89403958	+	RNA	INS	-	-	T	rs376959171|rs79229961|rs36065337|rs397849265	byFrequency	TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr11:89403957_89403958insT	ENST00000532352.1	+	0	994							Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(26)|ovary(4)|skin(4)|urinary_tract(2)	48						AGTTTTCTGAATTTTTTTTTAC	0.332													TTTTTTTTT|TTTTTTTTT|TTTTTTTTTT|insertion	1085	0.216653	0.1195	0.2464	5008	,	,		18626	0.1379		0.3718	False		,,,				2504	0.2485				.													.	FOLH1B	93		0			.																																											219595	.			TTCTGAATTTTTT	AF261715		11q14.3	2014-03-18			ENSG00000134612	ENSG00000134612			13636	protein-coding gene	gene with protein product	"""prostate specific membrane antigen like protein"", ""Cell growth-inhibiting gene 26 protein"", ""glutamate carboxypeptidase III"""	609020	"""folate hydrolase 2"""	FOLH2, FOLHP		9838072, 14716746	Standard	NM_153696		Approved	PSMAL, GCPIII	uc001pda.3	Q9HBA9	OTTHUMG00000167376		11.37:g.89403966_89403966dupT			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	6	0.50	3	.	0		0		RNA	INS	ENST00000532352.1	37																																																																																						0.332	FOLH1B-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000395421.1		NM_153696	
ZC3H12C	85463	mdanderson.org	37	11	110035632	110035632	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr11:110035632G>A	ENST00000278590.3	+	6	1873	c.1822G>A	c.(1822-1824)Gaa>Aaa	p.E608K	ZC3H12C_ENST00000528673.1_Missense_Mutation_p.E609K|ZC3H12C_ENST00000453089.2_Missense_Mutation_p.E577K	NM_033390.1	NP_203748.1	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	608							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		ACGAAGCCCTGAAAGGCGTTT	0.458																																					p.E608K													.	.			0			c.G1822A												51.0	49.0	50.0					11																	110035632		1973	4155	6128	SO:0001583	missense	85463	exon6			AGCCCTGAAAGGC		CCDS44727.1	11q22.3	2012-07-05			ENSG00000149289	ENSG00000149289		"""Zinc fingers, CCCH-type domain containing"""	29362	protein-coding gene	gene with protein product	"""MCP induced protein 3"""	615001				11214970, 18178554	Standard	NM_033390		Approved	KIAA1726, MCPIP3	uc009yxw.3	Q9C0D7	OTTHUMG00000166572	ENST00000278590.3:c.1822G>A	11.37:g.110035632G>A	ENSP00000278590:p.Glu608Lys		Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	84	0.05	4	NM_033390	1	0.00	0	B4DI65|B4DR47	Missense_Mutation	SNP	ENST00000278590.3	37	CCDS44727.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.726302	0.89298	.	.	ENSG00000149289	ENST00000278590;ENST00000528673;ENST00000453089	T;T;T	0.38401	1.14;1.14;1.17	5.84	5.84	0.93424	.	0.113869	0.64402	D	0.000007	T	0.52058	0.1711	L	0.43152	1.355	0.46849	D	0.999224	D;D;D	0.67145	0.979;0.996;0.988	P;P;P	0.60415	0.525;0.874;0.76	T	0.48906	-0.8993	10	0.66056	D	0.02	-26.7913	20.1386	0.98045	0.0:0.0:1.0:0.0	.	609;608;608	B4DR47;B4DI65;Q9C0D7	.;.;ZC12C_HUMAN	K	608;609;577	ENSP00000278590:E608K;ENSP00000431821:E609K;ENSP00000413094:E577K	ENSP00000278590:E608K	E	+	1	0	ZC3H12C	109540842	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.476000	0.97823	2.767000	0.95098	0.561000	0.74099	GAA			0.458	ZC3H12C-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000390491.1		NM_033390	
KCNJ5	3762	broad.mit.edu	37	11	128781827	128781827	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr11:128781827G>T	ENST00000338350.4	+	3	1011	c.659G>T	c.(658-660)cGg>cTg	p.R220L	KCNJ5_ENST00000529694.1_Missense_Mutation_p.R220L|KCNJ5_ENST00000533599.1_Missense_Mutation_p.R220L			P48544	KCNJ5_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 5	220					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)			NS(1)|breast(1)|endometrium(4)|large_intestine(4)|liver(2)|lung(9)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	26	all_hematologic(175;0.0641)	Lung NSC(97;0.00038)|all_lung(97;0.000817)|Breast(109;0.00123)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0059)|LUSC - Lung squamous cell carcinoma(976;0.021)|Lung(977;0.0215)	Glyburide(DB01016)	CTCATGTTCCGGGTGGGCGAC	0.587																																					p.R220L	Pancreas(108;2548 5082)|Esophageal Squamous(165;4544 6231)												KCNJ5,NS,carcinoma,+1,1	KCNJ5	560	1	0			c.G659T												100.0	100.0	100.0					11																	128781827		2201	4297	6498	SO:0001583	missense	3762	exon2			TGTTCCGGGTGGG	D50134	CCDS8479.1	11q24	2014-09-17				ENSG00000120457		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6266	protein-coding gene	gene with protein product		600734				16382105	Standard	NM_000890		Approved	Kir3.4, CIR, KATP1, GIRK4, LQT13	uc001qet.3	P48544		ENST00000338350.4:c.659G>T	11.37:g.128781827G>T	ENSP00000339960:p.Arg220Leu		Somatic	137	0	0		WXS	Illumina HiSeq	Phase_I	116	0.03	4	NM_000890	7	0.00	0	B2R744|Q6DK13|Q6DK14|Q92807	Missense_Mutation	SNP	ENST00000338350.4	37	CCDS8479.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.937429	0.92458	.	.	ENSG00000120457	ENST00000529694;ENST00000338350;ENST00000533599	D;D;D	0.97256	-4.31;-4.31;-4.31	5.46	5.46	0.80206	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.99137	0.9702	H	0.97682	4.055	0.58432	D	0.999994	D	0.89917	1.0	D	0.97110	1.0	D	0.99060	1.0830	10	0.87932	D	0	.	19.3054	0.94161	0.0:0.0:1.0:0.0	.	220	P48544	IRK5_HUMAN	L	220	ENSP00000433295:R220L;ENSP00000339960:R220L;ENSP00000434266:R220L	ENSP00000339960:R220L	R	+	2	0	KCNJ5	128287037	1.000000	0.71417	0.995000	0.50966	0.920000	0.55202	9.869000	0.99810	2.556000	0.86216	0.561000	0.74099	CGG			0.587	KCNJ5-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000386239.1		NM_000890	
PRB3	5544	broad.mit.edu	37	12	11420652	11420652	+	Silent	SNP	C	C	T	rs74786167	byFrequency	TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr12:11420652C>T	ENST00000279573.7	-	3	666	c.531G>A	c.(529-531)ccG>ccA	p.P177P	PRB3_ENST00000381842.3_Silent_p.P177P|PRB3_ENST00000440870.3_Intron|PRB3_ENST00000538488.1_Silent_p.P156P			Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	177	10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|Pro-rich.		Missing (in allele S).		defense response to Gram-negative bacterium (GO:0050829)	extracellular region (GO:0005576)				breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(5)	25			OV - Ovarian serous cystadenocarcinoma(49;0.201)			CCGGATGAGGCGGGGGACCTT	0.642																																					p.P177P													.	PRB3	84		0			c.G531A																																									SO:0001819	synonymous_variant	5544	exon3			ATGAGGCGGGGGA			12p13.2	2012-10-02				ENSG00000197870			9339	protein-coding gene	gene with protein product		168840				1894623	Standard	NM_006249		Approved	PRG	uc001qzs.3	Q04118		ENST00000279573.7:c.531G>A	12.37:g.11420652C>T			Somatic	251	0.0119521912	3		WXS	Illumina HiSeq	Phase_I	343	0.04	13	NM_006249	6	0.00	0	Q15188|Q4VAY3|Q4VAY4|Q7M4M9|Q9UCT9	RNA	SNP	ENST00000279573.7	37																																																																																						0.642	PRB3-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000402119.5		NM_006249	
DDX11	1663	broad.mit.edu	37	12	31237980	31237980	+	Silent	SNP	G	G	A			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr12:31237980G>A	ENST00000407793.2	+	5	809	c.558G>A	c.(556-558)cgG>cgA	p.R186R	DDX11_ENST00000542838.1_Silent_p.R186R|DDX11_ENST00000350437.4_Silent_p.R186R|DDX11_ENST00000228264.6_Silent_p.R160R|DDX11_ENST00000545668.1_Silent_p.R186R|DDX11_ENST00000251758.5_Silent_p.R186R	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	186	Glu-rich.|Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					AGGCTGAGCGGCTGGAGCAGC	0.602										Multiple Myeloma(12;0.14)																											p.R186R													.	DDX11	188		0			c.G558A												25.0	27.0	27.0					12																	31237980		2203	4299	6502	SO:0001819	synonymous_variant	1663	exon5			TGAGCGGCTGGAG	U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.558G>A	12.37:g.31237980G>A			Somatic	414	0.0048309179	2		WXS	Illumina HiSeq	Phase_I	531	0.01	6	NM_030653	60	0.00	0	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Silent	SNP	ENST00000407793.2	37	CCDS44856.1																																																																																					0.602	DDX11-202	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000399728.1		NM_030653	
MRPS31P5	100887750	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	52741936	52741936	+	RNA	SNP	C	C	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr13:52741936C>T	ENST00000451298.1	-	0	3703				MRPS31P5_ENST00000416599.1_RNA																							TAATTTCTTCCTTGTGAATTC	0.328																																					.													.	.			0			.																																											100887750	.			TTCTTCCTTGTGA																													13.37:g.52741936C>T			Somatic	71	0	0		WXS	Illumina HiSeq	.	65	0.12	8	.	4	0.00	0		RNA	SNP	ENST00000451298.1	37																																																																																						0.328	RP11-248G5.8-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript		OTTHUMT00000471093.1			
SAMD4A	23034	mdanderson.org	37	14	55034821	55034821	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr14:55034821A>G	ENST00000554335.1	+	2	850	c.187A>G	c.(187-189)Aac>Gac	p.N63D	SAMD4A_ENST00000251091.5_Missense_Mutation_p.N63D|SAMD4A_ENST00000555112.1_3'UTR|SAMD4A_ENST00000357634.3_Missense_Mutation_p.N62D|SAMD4A_ENST00000392067.3_Missense_Mutation_p.N63D			Q9UPU9	SMAG1_HUMAN	sterile alpha motif domain containing 4A	63					negative regulation of translation (GO:0017148)|positive regulation of translation (GO:0045727)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)|translation repressor activity (GO:0030371)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)	29						ACGCGAGGCCAACAGCCCCGG	0.736																																					p.N63D													.	.			0			c.A187G												8.0	9.0	9.0					14																	55034821		2170	4255	6425	SO:0001583	missense	23034	exon1			GAGGCCAACAGCC	AB028976	CCDS32084.1, CCDS55917.1, CCDS55918.1, CCDS32084.2, CCDS55917.2	14q22.2	2013-01-10	2006-01-27	2006-01-27	ENSG00000020577	ENSG00000020577		"""Sterile alpha motif (SAM) domain containing"""	23023	protein-coding gene	gene with protein product	"""smaug homolog (Drosophila)"""	610747	"""sterile alpha motif domain containing 4"""	SAMD4		16221671	Standard	NM_001161577		Approved	KIAA1053, DKFZP434H0350, Smaug, SMG, SMGA, hSmaug1	uc001xbb.4	Q9UPU9	OTTHUMG00000170999	ENST00000554335.1:c.187A>G	14.37:g.55034821A>G	ENSP00000452535:p.Asn63Asp		Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	11	0.18	2	NM_001161576	5	0.00	0	A8MPZ5|Q0VA96|Q6PEW4	Missense_Mutation	SNP	ENST00000554335.1	37	CCDS32084.2	.	.	.	.	.	.	.	.	.	.	A	22.1	4.238139	0.79800	.	.	ENSG00000020577	ENST00000554335;ENST00000392067;ENST00000305831;ENST00000251091;ENST00000357634	T;T;T	0.74106	-0.81;-0.81;-0.81	5.4	5.4	0.78164	.	0.126392	0.49305	D	0.000144	D	0.86222	0.5881	M	0.81497	2.545	0.33359	D	0.572065	D;D	0.63880	0.991;0.993	P;D	0.70935	0.801;0.971	D	0.91334	0.5092	10	0.72032	D	0.01	-18.6227	15.4128	0.74941	1.0:0.0:0.0:0.0	.	63;63	Q9UPU9-3;Q9UPU9	.;SMAG1_HUMAN	D	63;63;63;62;62	ENSP00000452535:N63D;ENSP00000375919:N63D;ENSP00000350261:N62D	ENSP00000306381:N63D	N	+	1	0	SAMD4A	54104571	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.062000	0.93920	2.047000	0.60756	0.443000	0.29094	AAC			0.736	SAMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000411186.1		NM_015589	
RBM25	58517	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	73577750	73577750	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr14:73577750C>G	ENST00000261973.7	+	15	2189	c.1904C>G	c.(1903-1905)cCt>cGt	p.P635R	RBM25_ENST00000532483.1_3'UTR|RBM25_ENST00000527432.1_Missense_Mutation_p.P635R	NM_021239.2	NP_067062.1	P49756	RBM25_HUMAN	RNA binding motif protein 25	635	Necessary for nuclear speckle localization.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of apoptotic process (GO:0042981)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(6)|ovary(2)|pancreas(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		AATGCAACACCTAACACTCCT	0.488																																					p.P635R													.	.			0			c.C1904G												99.0	87.0	92.0					14																	73577750		2203	4300	6503	SO:0001583	missense	58517	exon15			CAACACCTAACAC	BX647116	CCDS32113.1	14q24.3	2013-02-12	2004-04-23	2004-04-29	ENSG00000119707	ENSG00000119707		"""RNA binding motif (RRM) containing"""	23244	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 94"""	612427	"""RNA-binding region (RNP1, RRM) containing 7"""	RNPC7		9847074, 7596406	Standard	NM_021239		Approved	S164, fSAP94, NET52, Snu71	uc001xno.3	P49756	OTTHUMG00000167540	ENST00000261973.7:c.1904C>G	14.37:g.73577750C>G	ENSP00000261973:p.Pro635Arg		Somatic	60	0	0		WXS	Illumina HiSeq	.	90	0.07	6	NM_021239	116	0.26	30	A0PJL9|B2RNA8|B3KT03|Q2TA72|Q5XJ17|Q6P665|Q9H6A1|Q9UEQ5|Q9UIE9	Missense_Mutation	SNP	ENST00000261973.7	37	CCDS32113.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.020160	0.75275	.	.	ENSG00000119707	ENST00000261973;ENST00000527432	T;T	0.12672	2.66;2.66	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.35278	0.0926	M	0.68952	2.095	0.80722	D	1	D	0.69078	0.997	D	0.66196	0.942	T	0.01496	-1.1340	10	0.27785	T	0.31	.	19.2568	0.93949	0.0:1.0:0.0:0.0	.	635	P49756	RBM25_HUMAN	R	635	ENSP00000261973:P635R;ENSP00000431150:P635R	ENSP00000261973:P635R	P	+	2	0	RBM25	72647503	1.000000	0.71417	0.990000	0.47175	0.886000	0.51366	7.487000	0.81328	2.554000	0.86153	0.467000	0.42956	CCT			0.488	RBM25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394966.1		XM_027330	
ATXN3	4287	hgsc.bcm.edu	37	14	92537354	92537355	+	In_Frame_Ins	INS	-	-	CTGCTGCTGCTGCTGCTG	rs12895357	byFrequency	TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr14:92537354_92537355insCTGCTGCTGCTGCTGCTG	ENST00000532032.1	-	10	924_925	c.915_916insCAGCAGCAGCAGCAGCAG	c.(913-918)cagggg>cagCAGCAGCAGCAGCAGCAGggg	p.304_305insQQQQQQ	ATXN3_ENST00000554491.1_5'UTR|ATXN3_ENST00000429774.2_In_Frame_Ins_p.297_298insQQQQQQ|ATXN3_ENST00000545170.1_In_Frame_Ins_p.313_314insQQQQQQ|ATXN3_ENST00000393287.5_In_Frame_Ins_p.304_305insQQQQQQ|ATXN3_ENST00000340660.6_In_Frame_Ins_p.249_250insQQQQQQ|ATXN3_ENST00000502250.1_In_Frame_Ins_p.125_126insQQQQQQ|ATXN3_ENST00000503767.1_In_Frame_Ins_p.289_290insQQQQQQ			P54252	ATX3_HUMAN	ataxin 3	304	Poly-Gln.				actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|cellular response to misfolded protein (GO:0071218)|intermediate filament cytoskeleton organization (GO:0045104)|microtubule cytoskeleton organization (GO:0000226)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|monoubiquitinated protein deubiquitination (GO:0035520)|nervous system development (GO:0007399)|nucleotide-excision repair (GO:0006289)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of cell-substrate adhesion (GO:0010810)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATPase binding (GO:0051117)|identical protein binding (GO:0042802)|Lys48-specific deubiquitinase activity (GO:1990380)|Lys63-specific deubiquitinase activity (GO:0061578)|omega peptidase activity (GO:0008242)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.G306R(1)		endometrium(2)|large_intestine(1)|lung(7)|prostate(1)|stomach(1)	12		all_cancers(154;0.0768)		COAD - Colon adenocarcinoma(157;0.224)		GATAGGTCCCCctgctgctgct	0.446																																					p.G306delinsQQQQQQG	Esophageal Squamous(190;752 2094 29897 44875 49530)												ATXN3,NS,carcinoma,0,7	ATXN3	46		1	Substitution - Missense(1)	lung(1)	c.916_917insCAGCAGCAGCAGCAGCAG																																									SO:0001652	inframe_insertion	4287	exon10			GGTCCCCCTGCTG	U64820	CCDS9900.1, CCDS32143.1, CCDS45154.1, CCDS53908.1, CCDS73680.1	14q21	2014-09-17	2004-08-12	2004-08-13	ENSG00000066427	ENSG00000066427		"""Ataxins"""	7106	protein-coding gene	gene with protein product		607047	"""Machado-Joseph disease (spinocerebellar ataxia 3, olivopontocerebellar ataxia 3, autosomal dominant, ataxin 3)"""	SCA3, MJD		8358439	Standard	NM_004993		Approved	ATX3, JOS	uc001yac.4	P54252	OTTHUMG00000162212	ENST00000532032.1:c.898_915dupCAGCAGCAGCAGCAGCAG	14.37:g.92537354_92537355insCTGCTGCTGCTGCTGCTG	ENSP00000437157:p.Gln299_Gln304dup		Somatic	79	0	0		WXS	Illumina HiSeq	.	59	0.00	0	NM_004993	107	0.00	0	A7LFZ5|D6RDL9|E9PB63|O15284|O15285|O15286|Q8N189|Q96TC3|Q96TC4|Q9H3N0	In_Frame_Ins	INS	ENST00000532032.1	37																																																																																						0.446	ATXN3-015	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000388065.1		NM_004993	
HERC1	8925	hgsc.bcm.edu;broad.mit.edu	37	15	63904544	63904545	+	Frame_Shift_Del	DEL	CG	CG	-			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	CG	CG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr15:63904544_63904545delCG	ENST00000443617.2	-	77	14392_14393	c.14305_14306delCG	c.(14305-14307)cggfs	p.R4769fs		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	4769	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						GAAAAGCACCCGCTCCTCATTG	0.495																																					p.4769_4769del													.	HERC1	624		0			c.14306_14307del																																									SO:0001589	frameshift_variant	8925	exon77			AGCACCCGCTCCT	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.14305_14306delCG	15.37:g.63904544_63904545delCG	ENSP00000390158:p.Arg4769fs		Somatic	177	0	0		WXS	Illumina HiSeq	.	172	0.09	16	NM_003922	73	0.00	0	Q8IW65	Frame_Shift_Del	DEL	ENST00000443617.2	37	CCDS45277.1																																																																																					0.495	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000418523.1		NM_003922	
WHAMM	123720	mdanderson.org	37	15	83478717	83478717	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr15:83478717G>A	ENST00000286760.4	+	1	338	c.239G>A	c.(238-240)gGc>gAc	p.G80D		NM_001080435.1	NP_001073904.1	Q8TF30	WHAMM_HUMAN	WAS protein homolog associated with actin, golgi membranes and microtubules	80	Mediates association with membranes. {ECO:0000269|PubMed:18614018}.				actin filament organization (GO:0007015)|actin filament reorganization (GO:0090527)|ER to Golgi vesicle-mediated transport (GO:0006888)|focal adhesion assembly (GO:0048041)|lamellipodium assembly (GO:0030032)|membrane tubulation (GO:0097320)|positive regulation of actin nucleation (GO:0051127)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|Golgi membrane (GO:0000139)	Arp2/3 complex binding (GO:0071933)|GTP-Rho binding (GO:0017049)|microtubule binding (GO:0008017)			endometrium(6)|large_intestine(5)|lung(1)|prostate(1)	13						AGCTGGGCCGGCCTGCTCTCG	0.801																																					p.G80D													.	.			0			c.G239A												3.0	3.0	3.0					15																	83478717		633	1595	2228	SO:0001583	missense	123720	exon1			GGGCCGGCCTGCT	AK126887	CCDS45333.1	15q25.2	2009-02-18	2009-02-18	2009-02-18	ENSG00000156232	ENSG00000156232			30493	protein-coding gene	gene with protein product		612393	"""WAS protein homology region 2 domain containing 1"""	WHDC1		11853319, 18226259, 18614018, 18812086	Standard	XM_005272422		Approved	KIAA1971	uc002bje.3	Q8TF30		ENST00000286760.4:c.239G>A	15.37:g.83478717G>A	ENSP00000286760:p.Gly80Asp		Somatic	12	0	0		WXS	Illumina HiSeq	Phase_I	10	0.20	2	NM_001080435	0		0	Q8N1J9	Missense_Mutation	SNP	ENST00000286760.4	37	CCDS45333.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.964264	0.74131	.	.	ENSG00000156232	ENST00000286760;ENST00000234505	T	0.11495	2.77	4.35	4.35	0.52113	.	0.239997	0.41396	D	0.000881	T	0.35128	0.0921	M	0.79926	2.475	0.58432	D	0.999999	D	0.89917	1.0	D	0.75020	0.985	T	0.29579	-1.0007	10	0.87932	D	0	.	16.0126	0.80413	0.0:0.0:1.0:0.0	.	80	Q8TF30	WHAMM_HUMAN	D	80	ENSP00000286760:G80D	ENSP00000234505:G80D	G	+	2	0	WHAMM	81275771	1.000000	0.71417	0.997000	0.53966	0.205000	0.24178	3.266000	0.51569	2.253000	0.74438	0.585000	0.79938	GGC			0.801	WHAMM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000418463.1			
PRSS33	260429	mdanderson.org	37	16	2835065	2835065	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr16:2835065G>T	ENST00000293851.5	-	5	781	c.622C>A	c.(622-624)Cgc>Agc	p.R208S	PRSS33_ENST00000576886.1_3'UTR|PRSS33_ENST00000570702.1_Missense_Mutation_p.R208S	NM_152891.2	NP_690851.2	Q8NF86	PRS33_HUMAN	protease, serine, 33	208	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)			prostate(1)	1						AGCACAATGCGCTCAGCCTGG	0.701																																					p.R208S	NSCLC(194;489 2153 16702 19171 27758)												.	.			0			c.C622A												7.0	10.0	9.0					16																	2835065		2059	4187	6246	SO:0001583	missense	260429	exon5			CAATGCGCTCAGC	AF536382	CCDS42110.1	16p13.3	2014-09-04			ENSG00000103355	ENSG00000103355		"""Serine peptidases / Serine peptidases"""	30405	protein-coding gene	gene with protein product		613797				12795636	Standard	NM_152891		Approved	EOS	uc002cro.1	Q8NF86	OTTHUMG00000177360	ENST00000293851.5:c.622C>A	16.37:g.2835065G>T	ENSP00000293851:p.Arg208Ser		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	29	0.10	3	NM_152891	27	0.00	0	A6NNQ3|Q8N171	Missense_Mutation	SNP	ENST00000293851.5	37	CCDS42110.1	.	.	.	.	.	.	.	.	.	.	G	0.571	-0.841091	0.02692	.	.	ENSG00000103355	ENST00000293851	D	0.88354	-2.37	4.42	3.38	0.38709	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.410909	0.20571	N	0.089738	T	0.72906	0.3519	N	0.02142	-0.665	0.09310	N	1	B	0.16396	0.017	B	0.27262	0.078	T	0.65360	-0.6187	10	0.46703	T	0.11	.	8.9556	0.35816	0.0:0.0:0.6389:0.3611	.	208	Q8NF86	PRS33_HUMAN	S	208	ENSP00000293851:R208S	ENSP00000293851:R208S	R	-	1	0	PRSS33	2775066	0.729000	0.28090	0.333000	0.25482	0.004000	0.04260	3.274000	0.51631	2.005000	0.58758	0.486000	0.48141	CGC			0.701	PRSS33-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000436446.1		NM_152891	
SMG1	23049	broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	18844390	18844390	+	Silent	SNP	G	G	A			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr16:18844390G>A	ENST00000446231.2	-	51	9076	c.8664C>T	c.(8662-8664)gaC>gaT	p.D2888D	SMG1_ENST00000389467.3_Silent_p.D2888D			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	2888					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						CAATAAGACCGTCCAGTTCAT	0.443																																					p.D2888D													.	SMG1	401		0			c.C8664T												192.0	183.0	186.0					16																	18844390		1928	4133	6061	SO:0001819	synonymous_variant	23049	exon51			AAGACCGTCCAGT	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.8664C>T	16.37:g.18844390G>A			Somatic	196	0	0		WXS	Illumina HiSeq	Phase_I	205	0.03	7	NM_015092	4	0.00	0	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Silent	SNP	ENST00000446231.2	37	CCDS45430.1																																																																																					0.443	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000391817.1		NM_015092	
CD19	930	broad.mit.edu	37	16	28944670	28944670	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr16:28944670G>T	ENST00000324662.3	+	4	719	c.675G>T	c.(673-675)ttG>ttT	p.L225F	CD19_ENST00000538922.1_Missense_Mutation_p.L225F|CD19_ENST00000567541.1_Missense_Mutation_p.L225F			P15391	CD19_HUMAN	CD19 molecule	225	Ig-like C2-type 2.				B cell receptor signaling pathway (GO:0050853)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor signaling protein activity (GO:0005057)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(4)|urinary_tract(1)	29						CTAAGTCATTGCTGAGCCTAG	0.617																																					p.L225F													.	CD19	65		0			c.G675T												67.0	66.0	66.0					16																	28944670		2197	4300	6497	SO:0001583	missense	930	exon4			GTCATTGCTGAGC		CCDS10644.1, CCDS53998.1	16p11.2	2014-09-17	2006-03-28		ENSG00000177455	ENSG00000177455		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1633	protein-coding gene	gene with protein product		107265	"""CD19 antigen"""				Standard	NM_001770		Approved		uc010byo.2	P15391	OTTHUMG00000097049	ENST00000324662.3:c.675G>T	16.37:g.28944670G>T	ENSP00000313419:p.Leu225Phe		Somatic	114	0	0		WXS	Illumina HiSeq	Phase_I	109	0.04	4	NM_001178098	1	0.00	0	A0N0P9|F5H635|Q96S68|Q9BRD6	Missense_Mutation	SNP	ENST00000324662.3	37	CCDS10644.1	.	.	.	.	.	.	.	.	.	.	G	15.96	2.986891	0.53934	.	.	ENSG00000177455	ENST00000538922;ENST00000324662;ENST00000537306	T;T	0.56611	0.45;0.45	3.73	1.5	0.22942	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.266531	0.18084	N	0.152220	T	0.57519	0.2059	M	0.62723	1.935	0.23016	N	0.998428	D;D	0.61080	0.989;0.982	P;P	0.58820	0.846;0.706	T	0.43829	-0.9367	10	0.49607	T	0.09	-0.3095	4.1196	0.10099	0.1422:0.2446:0.6132:0.0	.	225;225	F5H635;P15391	.;CD19_HUMAN	F	225;225;74	ENSP00000437940:L225F;ENSP00000313419:L225F	ENSP00000313419:L225F	L	+	3	2	CD19	28852171	1.000000	0.71417	0.206000	0.23566	0.065000	0.16274	2.002000	0.40835	0.874000	0.35823	0.313000	0.20887	TTG			0.617	CD19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000214152.2			
SRCAP	10847	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	30734457	30734457	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr16:30734457C>G	ENST00000262518.4	+	24	4451	c.4066C>G	c.(4066-4068)Cct>Gct	p.P1356A	SRCAP_ENST00000395059.2_Missense_Mutation_p.P1294A|SRCAP_ENST00000344771.4_Missense_Mutation_p.P1198A	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1356	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			GCTACCCACACCTACTCTGGG	0.622																																					p.P1356A													.	.			0			c.C4066G												92.0	89.0	90.0					16																	30734457		2197	4300	6497	SO:0001583	missense	10847	exon24			CCCACACCTACTC	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.4066C>G	16.37:g.30734457C>G	ENSP00000262518:p.Pro1356Ala		Somatic	120	0	0		WXS	Illumina HiSeq	.	129	0.07	9	NM_006662	9	0.11	1	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	37	CCDS10689.2	.	.	.	.	.	.	.	.	.	.	C	12.92	2.083397	0.36758	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.91894	-2.93;-2.81;-2.83	5.83	3.89	0.44902	.	0.000000	0.56097	D	0.000035	D	0.83991	0.5374	N	0.19112	0.55	0.23956	N	0.996353	B;B;B	0.30914	0.144;0.3;0.089	B;B;B	0.26094	0.066;0.066;0.03	T	0.76179	-0.3054	10	0.66056	D	0.02	-5.1549	9.8677	0.41154	0.0:0.8409:0.0:0.1591	.	1198;1294;1356	Q6ZRS2-3;Q6ZRS2-2;Q6ZRS2	.;.;SRCAP_HUMAN	A	1356;1294;1198	ENSP00000262518:P1356A;ENSP00000378499:P1294A;ENSP00000343042:P1198A	ENSP00000262518:P1356A	P	+	1	0	SRCAP	30641958	0.950000	0.32346	1.000000	0.80357	0.923000	0.55619	2.585000	0.46111	0.826000	0.34661	0.655000	0.94253	CCT			0.622	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255523.1		NM_006662	
FBXL19	54620	mdanderson.org	37	16	30953750	30953750	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr16:30953750G>A	ENST00000380310.2	+	9	1738	c.1580G>A	c.(1579-1581)gGc>gAc	p.G527D	FBXL19_ENST00000338343.4_Missense_Mutation_p.G507D|FBXL19_ENST00000562319.1_Missense_Mutation_p.G507D|FBXL19_ENST00000565690.1_Missense_Mutation_p.G391D|FBXL19_ENST00000471231.2_Missense_Mutation_p.G215D	NM_001099784.2	NP_001093254.2	Q6PCT2	FXL19_HUMAN	F-box and leucine-rich repeat protein 19	527					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)	SCF ubiquitin ligase complex (GO:0019005)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16						TCTGCCCTGGGCTCAGCCCCA	0.652											OREG0023741	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G527D													.	.			0			c.G1580A												15.0	17.0	17.0					16																	30953750		2048	4196	6244	SO:0001583	missense	54620	exon9			CCCTGGGCTCAGC	AK127701	CCDS45465.1, CCDS73873.1	16p11.2	2014-02-20			ENSG00000099364	ENSG00000099364		"""F-boxes / Leucine-rich repeats"""	25300	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1C"""	609085					Standard	NM_001099784		Approved	DKFZp434K0410, Fbl19, JHDM1C, CXXC11	uc002eab.2	Q6PCT2	OTTHUMG00000132403	ENST00000380310.2:c.1580G>A	16.37:g.30953750G>A	ENSP00000369666:p.Gly527Asp		Somatic	50	0	0	821	WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_001099784	62	0.00	0	A8MT10|Q8N789|Q9NT14	Missense_Mutation	SNP	ENST00000380310.2	37	CCDS45465.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.161929	0.78226	.	.	ENSG00000099364	ENST00000338343;ENST00000380310	T;T	0.26660	1.72;1.72	4.49	4.49	0.54785	.	0.125937	0.53938	D	0.000054	T	0.19886	0.0478	N	0.24115	0.695	0.49213	D	0.999767	B;P	0.42518	0.293;0.782	B;B	0.40534	0.306;0.332	T	0.02942	-1.1091	10	0.30854	T	0.27	-16.5884	16.4668	0.84081	0.0:0.0:1.0:0.0	.	527;484	Q6PCT2;Q6PCT2-2	FXL19_HUMAN;.	D	507;527	ENSP00000339712:G507D;ENSP00000369666:G527D	ENSP00000339712:G507D	G	+	2	0	FBXL19	30861251	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.597000	0.98273	2.515000	0.84797	0.655000	0.94253	GGC			0.652	FBXL19-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_019085	
CES2	8824	hgsc.bcm.edu;broad.mit.edu	37	16	66977848	66977848	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr16:66977848A>G	ENST00000317091.4	+	12	2776	c.1792A>G	c.(1792-1794)Agg>Ggg	p.R598G	RP11-361L15.4_ENST00000566869.1_RNA|CES2_ENST00000417689.1_Missense_Mutation_p.R582G	NM_003869.5	NP_003860.2	O00748	EST2_HUMAN	carboxylesterase 2	534					catabolic process (GO:0009056)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)			breast(1)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|prostate(1)|urinary_tract(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0663)|Epithelial(162;0.166)	Dabigatran etexilate(DB06695)|Irinotecan(DB00762)|Mycophenolate mofetil(DB00688)|Prasugrel(DB06209)	GAAGGCCCACAGGCTCCAGTT	0.627																																					p.R598G	Ovarian(70;1230 1691 37888 38351)												.	.			0			c.A1792G												24.0	25.0	25.0					16																	66977848		2200	4300	6500	SO:0001583	missense	8824	exon12			GCCCACAGGCTCC	BC032095	CCDS10825.1, CCDS45507.1	16q22.1	2010-10-12	2010-10-12		ENSG00000172831	ENSG00000172831		"""Carboxylesterases"""	1864	protein-coding gene	gene with protein product		605278	"""carboxylesterase 2 (intestine, liver)"""			9169443, 9144407, 20931200	Standard	NM_198061		Approved	CE-2, iCE, CES2A1	uc002eqr.3	O00748	OTTHUMG00000137517	ENST00000317091.4:c.1792A>G	16.37:g.66977848A>G	ENSP00000317842:p.Arg598Gly		Somatic	104	0	0		WXS	Illumina HiSeq	.	98	0.04	4	NM_003869	42	0.00	0	A8K367|Q16859|Q5MAB8|Q7Z366|Q8IUP4|Q8TCP8	Missense_Mutation	SNP	ENST00000317091.4	37	CCDS10825.1	.	.	.	.	.	.	.	.	.	.	A	20.1	3.939962	0.73557	.	.	ENSG00000172831	ENST00000417689;ENST00000317091	T;T	0.67523	-0.27;-0.27	4.98	3.85	0.44370	Carboxylesterase, type B (1);	0.285457	0.25511	N	0.030180	T	0.76976	0.4063	M	0.78223	2.4	0.09310	N	1	P;P	0.49559	0.925;0.925	P;P	0.57776	0.827;0.827	T	0.68899	-0.5287	10	0.87932	D	0	.	9.9772	0.41791	0.8294:0.1706:0.0:0.0	.	534;598	O00748;A8K367	EST2_HUMAN;.	G	582;598	ENSP00000394452:R582G;ENSP00000317842:R598G	ENSP00000317842:R598G	R	+	1	2	CES2	65535349	0.154000	0.22792	0.900000	0.35374	0.961000	0.63080	2.154000	0.42291	0.874000	0.35823	0.529000	0.55759	AGG			0.627	CES2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000268838.2		NM_003869	
KRT37	8688	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	39578411	39578411	+	Silent	SNP	G	G	A	rs147477673		TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr17:39578411G>A	ENST00000225550.3	-	5	929	c.930C>T	c.(928-930)tcC>tcT	p.S310S	AC003958.2_ENST00000432258.1_RNA	NM_003770.4	NP_003761.3	O76014	KRT37_HUMAN	keratin 37	310	Coil 2.|Rod.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	25		Breast(137;0.000496)				GCAGCTCCTCGGAGCAGGACA	0.612																																					p.S310S													.	KRT37	61		0			c.C930T							G		0,4406		0,0,2203	127.0	96.0	107.0		930	-9.1	0.3	17	dbSNP_134	107	1,8599		0,1,4299	no	coding-synonymous	KRT37	NM_003770.4		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		310/450	39578411	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8688	exon5			CTCCTCGGAGCAG	Y16793	CCDS32653.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000108417	ENSG00000108417		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6455	protein-coding gene	gene with protein product		604541	"""keratin, hair, acidic, 7"""	KRTHA7		9756910, 16831889	Standard	NM_003770		Approved		uc002hwp.1	O76014	OTTHUMG00000133606	ENST00000225550.3:c.930C>T	17.37:g.39578411G>A			Somatic	116	0.0086206897	1		WXS	Illumina HiSeq	Phase_I	136	0.08	11	NM_003770	0		0		Silent	SNP	ENST00000225550.3	37	CCDS32653.1																																																																																					0.612	KRT37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257714.2		NM_003770	
AARSD1	80755	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	41108298	41108298	+	Missense_Mutation	SNP	T	T	G	rs199585384		TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr17:41108298T>G	ENST00000427569.2	-	6	621	c.586A>C	c.(586-588)Att>Ctt	p.I196L	PTGES3L-AARSD1_ENST00000360221.4_Missense_Mutation_p.I309L|AARSD1_ENST00000416949.1_5'Flank|PTGES3L-AARSD1_ENST00000409103.1_Missense_Mutation_p.I279L|PTGES3L-AARSD1_ENST00000409399.1_Missense_Mutation_p.I370L|PTGES3L-AARSD1_ENST00000421990.2_Missense_Mutation_p.I370L	NM_001261434.1	NP_001248363.1	Q9BTE6	AASD1_HUMAN	alanyl-tRNA synthetase domain containing 1	196					alanyl-tRNA aminoacylation (GO:0006419)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	alanine-tRNA ligase activity (GO:0004813)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|Ser-tRNA(Ala) hydrolase activity (GO:0002196)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|skin(1)	17		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.161)		ACAACCCGAATGGGCCCAGCA	0.542																																					p.I370L													.	.			0			c.A1108C												126.0	115.0	118.0					17																	41108298		2203	4300	6503	SO:0001583	missense	100885850	exon11			CCCGAATGGGCCC	BC004172	CCDS11447.1, CCDS45691.1, CCDS58552.1	17q21.31	2012-10-05			ENSG00000266967	ENSG00000266967			28417	protein-coding gene	gene with protein product		613212					Standard	NM_001261434		Approved	MGC2744		Q9BTE6	OTTHUMG00000153515	ENST00000427569.2:c.586A>C	17.37:g.41108298T>G	ENSP00000400870:p.Ile196Leu		Somatic	118	0	0		WXS	Illumina HiSeq	.	112	0.04	5	NM_001136042	236	0.25	60	B4DI73	Missense_Mutation	SNP	ENST00000427569.2	37	CCDS58552.1	.	.	.	.	.	.	.	.	.	.	T	8.089	0.773996	0.16051	.	.	ENSG00000108825	ENST00000360221;ENST00000409399;ENST00000421990;ENST00000427569;ENST00000409103;ENST00000423601	T;T	0.46819	0.86;0.86	5.51	-2.12	0.07165	Threonyl/alanyl tRNA synthetase, SAD (2);Alanyl-tRNA synthetase, class IIc, core domain (1);Threonyl/alanyl tRNA synthetase, class II-like, putative editing domain (1);	0.270121	0.35805	N	0.002970	T	0.37652	0.1011	L	0.35487	1.065	0.23238	N	0.998067	B;P;B;B;B	0.34546	0.103;0.456;0.248;0.248;0.187	B;B;B;B;B	0.37346	0.104;0.247;0.208;0.247;0.126	T	0.32322	-0.9911	9	0.59425	D	0.04	-1.6764	15.3289	0.74190	0.0:0.5774:0.0:0.4226	.	309;370;279;327;196	Q9BTE6-2;B4DI73;C9J5N1;B3KSP9;Q9BTE6	.;.;.;.;AASD1_HUMAN	L	309;370;370;196;279;78	ENSP00000386621:I370L;ENSP00000409924:I370L	ENSP00000353355:I309L	I	-	1	0	AARSD1	38361824	0.997000	0.39634	0.521000	0.27850	0.232000	0.25224	1.171000	0.31896	-1.248000	0.02503	-1.477000	0.00996	ATT			0.542	AARSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000467729.1		NM_001261434	
COG1	9382	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	71204453	71204453	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr17:71204453G>T	ENST00000299886.4	+	14	2886	c.2806G>T	c.(2806-2808)Gtt>Ttt	p.V936F	FAM104A_ENST00000405159.3_3'UTR|FAM104A_ENST00000583178.1_5'Flank|FAM104A_ENST00000403627.3_3'UTR	NM_018714.2	NP_061184.1	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1	936					Golgi organization (GO:0007030)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18			LUSC - Lung squamous cell carcinoma(166;0.197)			CCAATGGCAGGTTGTCCCCCC	0.592																																					p.V936F													.	.			0			c.G2806T												94.0	77.0	83.0					17																	71204453		2203	4300	6503	SO:0001630	splice_region_variant	9382	exon14			TGGCAGGTTGTCC		CCDS11692.1	17q25.1	2008-05-14	2002-05-28	2002-05-31		ENSG00000166685		"""Components of oligomeric golgi complex"""	6545	protein-coding gene	gene with protein product		606973	"""low density lipoprotein receptor defect B complementing"""	LDLB		9927668	Standard	NM_018714		Approved	KIAA1381	uc002jjg.3	Q8WTW3		ENST00000299886.4:c.2806-1G>T	17.37:g.71204453G>T			Somatic	77	0	0		WXS	Illumina HiSeq	.	65	0.11	7	NM_018714	178	0.18	32	Q9NPV9|Q9P2G6	Missense_Mutation	SNP	ENST00000299886.4	37	CCDS11692.1	.	.	.	.	.	.	.	.	.	.	G	18.88	3.717596	0.68844	.	.	ENSG00000166685	ENST00000299886	T	0.24723	1.84	6.17	6.17	0.99709	.	0.874983	0.10235	N	0.699193	T	0.32941	0.0846	L	0.56769	1.78	0.80722	D	1	P	0.39717	0.684	B	0.38106	0.265	T	0.09684	-1.0663	9	.	.	.	-4.7325	18.0353	0.89301	0.0:0.0:1.0:0.0	.	936	Q8WTW3	COG1_HUMAN	F	936	ENSP00000299886:V936F	.	V	+	1	0	COG1	68716048	1.000000	0.71417	0.971000	0.41717	0.937000	0.57800	5.745000	0.68672	2.941000	0.99782	0.655000	0.94253	GTT			0.592	COG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000441638.1			Missense_Mutation
ZNF236	7776	mdanderson.org	37	18	74580747	74580747	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr18:74580747G>A	ENST00000253159.8	+	4	662	c.464G>A	c.(463-465)tGc>tAc	p.C155Y	ZNF236_ENST00000320610.9_Missense_Mutation_p.C157Y|ZNF236_ENST00000583095.1_3'UTR	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	155					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		CAGCATGCCTGCAAGGCCTGC	0.527																																					p.C155Y													.	.			0			c.G464A												95.0	100.0	98.0					18																	74580747		2000	4187	6187	SO:0001583	missense	7776	exon4			ATGCCTGCAAGGC	AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.464G>A	18.37:g.74580747G>A	ENSP00000253159:p.Cys155Tyr		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	33	0.09	3	NM_007345	1	0.00	0	B2RTX9|Q9UL37	Missense_Mutation	SNP	ENST00000253159.8	37	CCDS42447.1	.	.	.	.	.	.	.	.	.	.	G	19.71	3.878253	0.72294	.	.	ENSG00000130856	ENST00000253159;ENST00000543926;ENST00000320610	D;D	0.99974	-10.2;-10.2	5.17	5.17	0.71159	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.99975	0.9992	M	0.87900	2.915	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.95710	0.8757	10	0.87932	D	0	.	18.6623	0.91475	0.0:0.0:1.0:0.0	.	155;155	Q9NWI2;Q9UL36	.;ZN236_HUMAN	Y	155	ENSP00000253159:C155Y;ENSP00000444524:C155Y	ENSP00000253159:C155Y	C	+	2	0	ZNF236	72709735	1.000000	0.71417	0.955000	0.39395	0.456000	0.32438	9.496000	0.97967	2.394000	0.81467	0.563000	0.77884	TGC			0.527	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000445776.1			
HNRNPM	4670	mdanderson.org	37	19	8550553	8550553	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr19:8550553C>T	ENST00000325495.4	+	14	1282	c.1241C>T	c.(1240-1242)gCc>gTc	p.A414V	HNRNPM_ENST00000348943.3_Missense_Mutation_p.A375V	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M	414	27 X 6 AA repeats of [GEVSTPAN]-[ILMV]- [DE]-[RH]-[MLVI]-[GAV].				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						CTCGGGGGTGCCGGCATGGAG	0.667																																					p.A414V													.	.			0			c.C1241T												91.0	99.0	96.0					19																	8550553		2203	4300	6503	SO:0001583	missense	4670	exon14			GGGGTGCCGGCAT	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.1241C>T	19.37:g.8550553C>T	ENSP00000325376:p.Ala414Val		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	13	0.23	3	NM_005968	509	0.00	1	Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Missense_Mutation	SNP	ENST00000325495.4	37	CCDS12203.1	.	.	.	.	.	.	.	.	.	.	C	16.30	3.085340	0.55861	.	.	ENSG00000099783	ENST00000325495;ENST00000348943;ENST00000544159	T;T	0.15139	2.45;2.77	5.76	5.76	0.90799	.	0.215268	0.49305	D	0.000154	T	0.23572	0.0570	L	0.47716	1.5	0.44611	D	0.99758	P;B;P;P	0.47545	0.799;0.18;0.897;0.704	B;B;P;B	0.44946	0.252;0.035;0.465;0.079	T	0.00322	-1.1818	10	0.54805	T	0.06	.	18.534	0.91002	0.0:1.0:0.0:0.0	.	254;414;375;299	Q7KYM9;P52272;P52272-2;Q59ES8	.;HNRPM_HUMAN;.;.	V	414;375;299	ENSP00000325376:A414V;ENSP00000325732:A375V	ENSP00000325376:A414V	A	+	2	0	HNRNPM	8456553	0.995000	0.38212	0.974000	0.42286	0.591000	0.36615	5.329000	0.65892	2.724000	0.93272	0.491000	0.48974	GCC			0.667	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000460894.1			
LRP3	4037	mdanderson.org	37	19	33696438	33696438	+	Silent	SNP	C	C	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr19:33696438C>T	ENST00000253193.7	+	5	964	c.762C>T	c.(760-762)tgC>tgT	p.C254C	CTD-2540B15.13_ENST00000609744.1_RNA	NM_002333.3	NP_002324.2	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein 3	254	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				receptor-mediated endocytosis (GO:0006898)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)	15	Esophageal squamous(110;0.137)					ACCTGGCGTGCGGCCGGCGGC	0.731																																					p.C254C													.	.			0			c.C762T												5.0	6.0	6.0					19																	33696438		1668	3561	5229	SO:0001819	synonymous_variant	4037	exon5			GGCGTGCGGCCGG	AB009462	CCDS12430.1	19q13.11	2013-05-30			ENSG00000130881	ENSG00000130881		"""Low density lipoprotein receptors"""	6695	protein-coding gene	gene with protein product		603159				9693042, 7959795	Standard	NM_002333		Approved	LRP-3, hLRp105	uc010edh.3	O75074	OTTHUMG00000180343	ENST00000253193.7:c.762C>T	19.37:g.33696438C>T			Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	31	0.06	2	NM_002333	17	0.00	0	B3KQD6|B4DKF2	Silent	SNP	ENST00000253193.7	37	CCDS12430.1																																																																																					0.731	LRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450842.4			
WDR87	83889	hgsc.bcm.edu;broad.mit.edu	37	19	38377122	38377124	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	TTC	TTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr19:38377122_38377124delTTC	ENST00000303868.5	-	6	7294_7296	c.7070_7072delGAA	c.(7069-7074)agaaag>aag	p.R2357del	WDR87_ENST00000447313.2_In_Frame_Del_p.R2396del	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	2357										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						CTTAGGCTCTTTCTTCTTTGTTC	0.404																																					p.2357_2358del													.	WDR87	191		0			c.7071_7073del																																									SO:0001651	inframe_deletion	83889	exon6			GGCTCTTTCTTCT	AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.7070_7072delGAA	19.37:g.38377125_38377127delTTC	ENSP00000368025:p.Arg2357del		Somatic	257	0	0		WXS	Illumina HiSeq	.	232	0.06	15	NM_031951	0		0	Q9BWV9	In_Frame_Del	DEL	ENST00000303868.5	37	CCDS46063.1																																																																																					0.404	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000314628.2		XM_940478	
ZNF880	400713	hgsc.bcm.edu	37	19	52887146	52887146	+	Nonsense_Mutation	SNP	A	A	T	rs398101268|rs34470614		TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr19:52887146A>T	ENST00000422689.2	+	4	328	c.313A>T	c.(313-315)Aaa>Taa	p.K105*	ZNF880_ENST00000424032.2_3'UTR	NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	105					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						CAAGTCTCTTAAAAATCAACT	0.368																																					p.K105X													ZNF880,colon,carcinoma,-1,1	ZNF880	-1	1	0			c.A313T												61.0	45.0	50.0					19																	52887146		690	1569	2259	SO:0001587	stop_gained	400713	exon4			TCTCTTAAAAATC	BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.313A>T	19.37:g.52887146A>T	ENSP00000406318:p.Lys105*		Somatic	276	0	0		WXS	Illumina HiSeq	.	242	0.05	11	NM_001145434	27	0.00	0	B4DNA6	Nonsense_Mutation	SNP	ENST00000422689.2	37	CCDS46164.1	.	.	.	.	.	.	.	.	.	.	A	8.517	0.867766	0.17250	.	.	ENSG00000221923	ENST00000422689	.	.	.	1.6	-2.54	0.06307	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	1.7816	0.03033	0.4842:0.0:0.2398:0.276	.	.	.	.	X	105	.	ENSP00000406318:K105X	K	+	1	0	ZNF880	57578958	0.000000	0.05858	0.006000	0.13384	0.124000	0.20399	-1.231000	0.02939	-0.761000	0.04670	0.368000	0.22195	AAA			0.368	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000397374.1		NM_001145434	
TTC27	55622	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	33012134	33012134	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr2:33012134G>A	ENST00000317907.4	+	16	2147	c.1916G>A	c.(1915-1917)aGc>aAc	p.S639N		NM_001193509.1|NM_017735.4	NP_001180438.1|NP_060205.3	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27	639										breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38						ATCCTCACCAGCACTGACGTT	0.393																																					p.S639N													.	.			0			c.G1916A												101.0	98.0	99.0					2																	33012134		2203	4300	6503	SO:0001583	missense	55622	exon16			TCACCAGCACTGA	BC063791, AK000279	CCDS33176.1	2p22.3	2013-01-10			ENSG00000018699	ENSG00000018699		"""Tetratricopeptide (TTC) repeat domain containing"""	25986	protein-coding gene	gene with protein product							Standard	NM_001193509		Approved	FLJ20272	uc002rom.3	Q6P3X3	OTTHUMG00000152134	ENST00000317907.4:c.1916G>A	2.37:g.33012134G>A	ENSP00000313953:p.Ser639Asn		Somatic	131	0	0		WXS	Illumina HiSeq	.	135	0.05	7	NM_017735	77	0.30	23	A6NKJ0|Q96SS5|Q9BVF1|Q9NWR4|Q9NXG4	Missense_Mutation	SNP	ENST00000317907.4	37	CCDS33176.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.863712	0.91511	.	.	ENSG00000018699	ENST00000317907	T	0.37411	1.2	4.84	4.84	0.62591	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.081135	0.85682	D	0.000000	T	0.51176	0.1659	M	0.61703	1.905	0.58432	D	0.999998	D	0.67145	0.996	P	0.56216	0.794	T	0.45249	-0.9274	10	0.28530	T	0.3	-9.2931	18.3386	0.90297	0.0:0.0:1.0:0.0	.	639	Q6P3X3	TTC27_HUMAN	N	639	ENSP00000313953:S639N	ENSP00000313953:S639N	S	+	2	0	TTC27	32865638	1.000000	0.71417	0.999000	0.59377	0.949000	0.60115	9.813000	0.99286	2.411000	0.81874	0.591000	0.81541	AGC			0.393	TTC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000325395.1		NM_017735	
HK2	3099	mdanderson.org	37	2	75113795	75113795	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr2:75113795G>T	ENST00000290573.2	+	15	2814	c.2214G>T	c.(2212-2214)aaG>aaT	p.K738N	HK2_ENST00000409174.1_Missense_Mutation_p.K710N	NM_000189.4	NP_000180.2	P52789	HXK2_HUMAN	hexokinase 2	738	Catalytic.|Hexokinase type-2 2.				apoptotic mitochondrial changes (GO:0008637)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|lactation (GO:0007595)|regulation of glucose import (GO:0046324)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	43						ACCCCGGCAAGCAGAGGTAGG	0.552																																					p.K738N													.	.			0			c.G2214T												59.0	61.0	60.0					2																	75113795		2203	4300	6503	SO:0001583	missense	3099	exon15			CGGCAAGCAGAGG		CCDS1956.1	2p13	2010-03-19			ENSG00000159399	ENSG00000159399	2.7.1.1		4923	protein-coding gene	gene with protein product		601125					Standard	NM_000189		Approved		uc002snd.3	P52789	OTTHUMG00000129972	ENST00000290573.2:c.2214G>T	2.37:g.75113795G>T	ENSP00000290573:p.Lys738Asn		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_000189	63	0.00	0	D6W5J2|Q8WU87|Q9UN82	Missense_Mutation	SNP	ENST00000290573.2	37	CCDS1956.1	.	.	.	.	.	.	.	.	.	.	G	18.52	3.641143	0.67244	.	.	ENSG00000159399	ENST00000290573;ENST00000535740;ENST00000409174	D;D	0.96554	-4.05;-4.05	5.49	0.204	0.15199	Hexokinase, C-terminal (1);	0.170278	0.64402	D	0.000007	D	0.97629	0.9223	M	0.87971	2.92	0.52099	D	0.999942	D	0.89917	1.0	D	0.83275	0.996	D	0.96330	0.9243	10	0.66056	D	0.02	-14.5611	9.1948	0.37222	0.4536:0.0:0.5464:0.0	.	738	P52789	HXK2_HUMAN	N	738;738;710	ENSP00000290573:K738N;ENSP00000387140:K710N	ENSP00000290573:K738N	K	+	3	2	HK2	74967303	0.064000	0.20934	0.997000	0.53966	0.996000	0.88848	-0.522000	0.06237	-0.018000	0.14079	0.655000	0.94253	AAG			0.552	HK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252238.2		NM_000189	
CTNNA2	1496	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	80772149	80772149	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr2:80772149G>T	ENST00000402739.4	+	9	1338	c.1333G>T	c.(1333-1335)Gtg>Ttg	p.V445L	CTNNA2_ENST00000343114.3_Missense_Mutation_p.V124L|CTNNA2_ENST00000466387.1_Missense_Mutation_p.V445L|CTNNA2_ENST00000361291.4_Missense_Mutation_p.V479L|CTNNA2_ENST00000496558.1_Missense_Mutation_p.V445L|CTNNA2_ENST00000540488.1_Missense_Mutation_p.V445L|CTNNA2_ENST00000541047.1_Missense_Mutation_p.V445L	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	445					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						TGAAGAAGGGGTGAAATTAGT	0.453																																					p.V445L													.	.			0			c.G1333T												93.0	94.0	94.0					2																	80772149		1950	4176	6126	SO:0001583	missense	1496	exon10			GAAGGGGTGAAAT		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.1333G>T	2.37:g.80772149G>T	ENSP00000384638:p.Val445Leu		Somatic	78	0	0		WXS	Illumina HiSeq	.	76	0.11	8	NM_001164883	0		0	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	ENST00000402739.4	37		.	.	.	.	.	.	.	.	.	.	G	19.80	3.895067	0.72639	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488;ENST00000343114;ENST00000409550	T;T;T;T;T;T;T;T	0.55930	0.49;0.49;0.49;0.49;0.49;0.49;0.49;0.49	4.87	4.87	0.63330	.	0.000000	0.64402	D	0.000001	T	0.71492	0.3346	M	0.87758	2.905	0.80722	D	1	B;P;B;B	0.48694	0.226;0.914;0.286;0.286	B;P;B;B	0.53549	0.104;0.729;0.105;0.14	T	0.76745	-0.2846	9	.	.	.	.	18.3791	0.90444	0.0:0.0:1.0:0.0	.	77;445;445;445	F6KRI5;P26232;P26232-3;P26232-2	.;CTNA2_HUMAN;.;.	L	445;445;479;445;445;445;124;110	ENSP00000418191:V445L;ENSP00000419295:V445L;ENSP00000355398:V479L;ENSP00000384638:V445L;ENSP00000444675:V445L;ENSP00000441705:V445L;ENSP00000341500:V124L;ENSP00000386587:V110L	.	V	+	1	0	CTNNA2	80625660	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.476000	0.97823	2.393000	0.81446	0.655000	0.94253	GTG			0.453	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000328511.4		NM_004389	
PGAP1	80055	broad.mit.edu	37	2	197711758	197711758	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr2:197711758G>T	ENST00000354764.4	-	22	2233	c.2119C>A	c.(2119-2121)Ctt>Att	p.L707I		NM_024989.3	NP_079265.2	Q75T13	PGAP1_HUMAN	post-GPI attachment to proteins 1	707					anterior/posterior axis specification (GO:0009948)|attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|embryonic pattern specification (GO:0009880)|forebrain regionalization (GO:0021871)|head development (GO:0060322)|intracellular protein transport (GO:0006886)|myo-inositol transport (GO:0015798)|post-translational protein modification (GO:0043687)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	nuclease activity (GO:0004518)|phosphoric ester hydrolase activity (GO:0042578)			breast(4)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|ovary(6)|stomach(1)|urinary_tract(1)	40						GAAGAAAGAAGTCTCACAGAT	0.383																																					p.L707I													.	PGAP1	84		0			c.C2119A												94.0	91.0	92.0					2																	197711758		2203	4300	6503	SO:0001583	missense	80055	exon22			AAAGAAGTCTCAC		CCDS2318.1	2q33.1	2014-03-03			ENSG00000197121	ENSG00000197121			25712	protein-coding gene	gene with protein product	"""GPI inositol-deacylase"""	611655				14734546, 17711852, 24482476	Standard	XM_005246866		Approved	FLJ12377, Bst1, SPG67	uc002utw.3	Q75T13	OTTHUMG00000132743	ENST00000354764.4:c.2119C>A	2.37:g.197711758G>T	ENSP00000346809:p.Leu707Ile		Somatic	299	0	0		WXS	Illumina HiSeq	Phase_I	292	0.02	6	NM_024989	1	0.00	0	Q4G0R8|Q4ZG47|Q53SM0|Q6AW92|Q6UWV4|Q9HA24	Missense_Mutation	SNP	ENST00000354764.4	37	CCDS2318.1	.	.	.	.	.	.	.	.	.	.	G	7.520	0.656448	0.14580	.	.	ENSG00000197121	ENST00000354764	.	.	.	4.82	2.98	0.34508	.	0.231621	0.37623	N	0.002004	T	0.25121	0.0610	N	0.08118	0	0.58432	D	0.999998	B	0.12013	0.005	B	0.09377	0.004	T	0.05115	-1.0905	9	0.13853	T	0.58	-4.6631	5.9773	0.19387	0.1485:0.0:0.6012:0.2503	.	707	Q75T13	PGAP1_HUMAN	I	707	.	ENSP00000346809:L707I	L	-	1	0	PGAP1	197420003	0.947000	0.32204	0.933000	0.37362	0.926000	0.56050	1.279000	0.33191	1.261000	0.44149	0.655000	0.94253	CTT			0.383	PGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256103.5		NM_024989	
AOX1	316	broad.mit.edu	37	2	201485446	201485446	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr2:201485446C>T	ENST00000374700.2	+	17	2019	c.1778C>T	c.(1777-1779)gCc>gTc	p.A593V	AOX1_ENST00000485106.1_Intron	NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1	593					inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)			breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	GTGAAGCATGCCACGGGGGAG	0.448																																					p.A593V													.	AOX1	152		0			c.C1778T												123.0	106.0	111.0					2																	201485446		2203	4300	6503	SO:0001583	missense	316	exon17			AGCATGCCACGGG	AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.1778C>T	2.37:g.201485446C>T	ENSP00000363832:p.Ala593Val		Somatic	222	0	0		WXS	Illumina HiSeq	Phase_I	230	0.02	5	NM_001159	1	0.00	0	O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Missense_Mutation	SNP	ENST00000374700.2	37	CCDS33360.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344108	0.61073	.	.	ENSG00000138356	ENST00000374700	T	0.07216	3.21	5.19	5.19	0.71726	Aldehyde oxidase/xanthine dehydrogenase, a/b hammerhead (2);	0.053488	0.85682	D	0.000000	T	0.16128	0.0388	M	0.77616	2.38	0.80722	D	1	B	0.15141	0.012	B	0.18263	0.021	T	0.02505	-1.1149	10	0.40728	T	0.16	-23.5563	18.9025	0.92448	0.0:1.0:0.0:0.0	.	593	Q06278	ADO_HUMAN	V	593	ENSP00000363832:A593V	ENSP00000363832:A593V	A	+	2	0	AOX1	201193691	1.000000	0.71417	0.991000	0.47740	0.624000	0.37722	5.330000	0.65899	2.709000	0.92574	0.655000	0.94253	GCC			0.448	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000335844.1		NM_001159	
DEFB125	245938	mdanderson.org	37	20	77023	77023	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr20:77023C>T	ENST00000382410.2	+	2	436	c.436C>T	c.(436-438)Cca>Tca	p.P146S	DEFB125_ENST00000608838.1_3'UTR	NM_153325.2	NP_697020.2	Q8N687	DB125_HUMAN	defensin, beta 125	146					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				central_nervous_system(1)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	12		all_cancers(10;7.65e-05)|Lung NSC(37;0.0417)|all_epithelial(17;0.0676)|all_lung(30;0.0713)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.156)			CGAGACTATGCCACCACCTTC	0.433																																					p.P146S													.	.			0			c.C436T												215.0	201.0	206.0					20																	77023		2203	4300	6503	SO:0001583	missense	245938	exon2			ACTATGCCACCAC	AA935636	CCDS12989.2	20p13	2008-07-17			ENSG00000178591	ENSG00000178591		"""Defensins, beta"""	18105	protein-coding gene	gene with protein product	"""beta defensin 25"""					11854508	Standard	NM_153325		Approved	DEFB-25	uc002wcw.3	Q8N687	OTTHUMG00000031614	ENST00000382410.2:c.436C>T	20.37:g.77023C>T	ENSP00000371847:p.Pro146Ser		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_153325	0		0	A1A502|Q7Z7B9	Missense_Mutation	SNP	ENST00000382410.2	37	CCDS12989.2	.	.	.	.	.	.	.	.	.	.	.	11.15	1.552675	0.27739	.	.	ENSG00000178591	ENST00000382410	T	0.14144	2.53	2.7	-5.39	0.02664	.	.	.	.	.	T	0.05090	0.0136	N	0.14661	0.345	0.09310	N	1	B	0.18741	0.03	B	0.12837	0.008	T	0.33979	-0.9847	9	0.23891	T	0.37	.	0.6573	0.00837	0.1647:0.2894:0.2134:0.3325	.	146	Q8N687	DB125_HUMAN	S	146	ENSP00000371847:P146S	ENSP00000371847:P146S	P	+	1	0	DEFB125	25023	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.319000	0.02702	-2.514000	0.00502	-0.300000	0.09419	CCA			0.433	DEFB125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077426.2		NM_153325	
LINC01598	105379478	broad.mit.edu	37	20	29572402	29572403	+	RNA	INS	-	-	AC	rs58615714|rs112353720|rs200824028|rs527353404|rs71333757	byFrequency	TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr20:29572402_29572403insAC	ENST00000445151.1	-	0	0				RP4-610C12.1_ENST00000432067.1_RNA																							gagagaACGGGacacacacaca	0.495														1343	0.268171	0.3805	0.2233	5008	,	,		15046	0.2123		0.2207	False		,,,				2504	0.2546				.													.	.			0			.																																											0	.			GAACGGGACACAC																													20.37:g.29572411_29572412dupAC			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	7	0.43	3	.	0		0		RNA	INS	ENST00000445151.1	37																																																																																						0.495	RP4-610C12.1-003	KNOWN	non_canonical_polymorphism|basic	antisense	antisense		OTTHUMT00000078491.2			
TRPC4AP	26133	mdanderson.org	37	20	33609143	33609143	+	Silent	SNP	A	A	G			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr20:33609143A>G	ENST00000252015.2	-	9	1157	c.1068T>C	c.(1066-1068)ccT>ccC	p.P356P	TRPC4AP_ENST00000432634.2_Silent_p.P317P|TRPC4AP_ENST00000539834.1_Intron|TRPC4AP_ENST00000451813.2_Intron			Q8TEL6	TP4AP_HUMAN	transient receptor potential cation channel, subfamily C, member 4 associated protein	356	Interaction with TNFRSF1A. {ECO:0000250}.				calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|protein ubiquitination (GO:0016567)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process (GO:0006511)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|skin(1)|stomach(1)|urinary_tract(1)	32			BRCA - Breast invasive adenocarcinoma(18;0.00936)			CCCCTGGAGGAGGGAACACAA	0.537																																					p.P356P													.	.			0			c.T1068C												76.0	67.0	70.0					20																	33609143		2203	4300	6503	SO:0001819	synonymous_variant	26133	exon9			TGGAGGAGGGAAC	AF055022	CCDS13246.1, CCDS46591.1	20q11.23	2014-06-13	2003-10-06	2003-10-08	ENSG00000100991	ENSG00000100991			16181	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 158"""	608430	"""chromosome 20 open reading frame 188"""	C20orf188			Standard	NM_015638		Approved	DKFZP727M231, DKFZp586C1223, dJ756N5.2, TRRP4AP, PPP1R158	uc002xbk.3	Q8TEL6	OTTHUMG00000032319	ENST00000252015.2:c.1068T>C	20.37:g.33609143A>G			Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_015638	41	0.00	0	E1P5Q0|E1P5Q1|Q96H82|Q9BVB8|Q9H429|Q9UFS6	Silent	SNP	ENST00000252015.2	37	CCDS13246.1																																																																																					0.537	TRPC4AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078832.2		NM_015638	
MIR3687-2	103504728	broad.mit.edu	37	21	9825838	9825839	+	RNA	INS	-	-	GCG	rs372061766|rs369177681|rs563875271	byFrequency	TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr21:9825838_9825839insGCG	ENST00000577708.1	+	0	0				MIR3648_ENST00000581792.1_RNA	NR_037458.1																						cggccgcgactgcggcggcggt	0.842																																					.													.	.			0			.																																											0	.			CGCGACTGCGGCG																													21.37:g.9825845_9825847dupGCG			Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	8	0.75	6	.	0		0		RNA	INS	ENST00000577708.1	37																																																																																						0.842	MIR3687-201	KNOWN	basic	miRNA	miRNA					
GGT1	2678	broad.mit.edu	37	22	25016921	25016921	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr22:25016921A>G	ENST00000400382.1	+	9	1372	c.617A>G	c.(616-618)gAg>gGg	p.E206G	GGT1_ENST00000248923.4_Missense_Mutation_p.E206G|GGT1_ENST00000466310.1_Intron|GGT1_ENST00000406383.2_Missense_Mutation_p.E206G|GGT1_ENST00000400380.1_Missense_Mutation_p.E206G|GGT1_ENST00000400383.1_Missense_Mutation_p.E206G			P19440	GGT1_HUMAN	gamma-glutamyltransferase 1	206					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|cysteine biosynthetic process (GO:0019344)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione catabolic process (GO:0006751)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|regulation of immune system process (GO:0002682)|regulation of inflammatory response (GO:0050727)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|xenobiotic metabolic process (GO:0006805)|zymogen activation (GO:0031638)	anchored component of external side of plasma membrane (GO:0031362)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			breast(1)|endometrium(2)|kidney(14)|large_intestine(2)|lung(6)|pancreas(1)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	40					Glutathione(DB00143)	CGGGAGGGGGAGAGACTGACC	0.642																																					p.E206G													.	GGT1	68		0			c.A617G												22.0	24.0	23.0					22																	25016921		2016	4166	6182	SO:0001583	missense	2678	exon9			AGGGGGAGAGACT	M24903	CCDS42992.1	22q11.23	2008-08-15			ENSG00000100031	ENSG00000100031	2.3.2.2	"""CD molecules"", ""Gamma-glutamyltransferases"""	4250	protein-coding gene	gene with protein product		612346		GGT		8104871, 18357469	Standard	NM_001288833		Approved	D22S672, D22S732, CD224	uc003aan.1	P19440	OTTHUMG00000030859	ENST00000400382.1:c.617A>G	22.37:g.25016921A>G	ENSP00000383232:p.Glu206Gly		Somatic	319	0.0031347962	1		WXS	Illumina HiSeq	Phase_I	277	0.02	6	NM_013430	33	0.03	1	Q08247|Q14404|Q8TBS1|Q9UMK1	Missense_Mutation	SNP	ENST00000400382.1	37	CCDS42992.1	.	.	.	.	.	.	.	.	.	.	.	12.86	2.065977	0.36470	.	.	ENSG00000100031	ENST00000248923;ENST00000412658;ENST00000400382;ENST00000400383;ENST00000400380;ENST00000406383	T;T;T;T;T;T	0.08720	3.06;3.06;3.06;3.06;3.06;3.06	3.94	3.94	0.45596	.	0.195110	0.42172	U	0.000746	T	0.13500	0.0327	M	0.66297	2.02	0.26890	N	0.967348	B	0.22146	0.065	B	0.31337	0.128	T	0.10109	-1.0644	10	0.72032	D	0.01	-37.9999	12.3003	0.54870	1.0:0.0:0.0:0.0	.	206	P19440	GGT1_HUMAN	G	206	ENSP00000248923:E206G;ENSP00000393537:E206G;ENSP00000383232:E206G;ENSP00000383233:E206G;ENSP00000383231:E206G;ENSP00000385975:E206G	ENSP00000248923:E206G	E	+	2	0	GGT1	23346921	1.000000	0.71417	0.226000	0.23910	0.399000	0.30720	5.763000	0.68818	1.564000	0.49628	0.454000	0.30748	GAG			0.642	GGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250797.1		NM_013430	
TPST2	8459	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	26936904	26936906	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	CTC	CTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr22:26936904_26936906delCTC	ENST00000338754.4	-	3	961_963	c.691_693delGAG	c.(691-693)gagdel	p.E231del	TPST2_ENST00000403880.1_In_Frame_Del_p.E231del|TPST2_ENST00000398110.2_In_Frame_Del_p.E231del	NM_003595.3	NP_003586.3	O60704	TPST2_HUMAN	tyrosylprotein sulfotransferase 2	231					fusion of sperm to egg plasma membrane (GO:0007342)|peptidyl-tyrosine sulfation (GO:0006478)|prevention of polyspermy (GO:0060468)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein-tyrosine sulfotransferase activity (GO:0008476)			central_nervous_system(1)|large_intestine(1)|lung(5)	7						GCAGGCACTTCTCCTTGCCTACC	0.606																																					p.231_232del													.	TPST2	23		0			c.692_694del																																									SO:0001651	inframe_deletion	8459	exon3			GCACTTCTCCTTG	AF049891	CCDS13839.1	22q12.1	2012-12-13			ENSG00000128294	ENSG00000128294	2.8.2.20	"""Sulfotransferases, membrane-bound"""	12021	protein-coding gene	gene with protein product	"""transport and golgi organization 13 homolog B (Drosophila)"""	603126				9736702, 9733778	Standard	NM_003595		Approved	TANGO13B	uc003acx.3	O60704	OTTHUMG00000150987	ENST00000338754.4:c.691_693delGAG	22.37:g.26936904_26936906delCTC	ENSP00000339813:p.Glu231del		Somatic	105	0	0		WXS	Illumina HiSeq	.	102	0.10	10	NM_003595	589	0.00	0	B3KQA7|Q6FI98|Q9H0V4	In_Frame_Del	DEL	ENST00000338754.4	37	CCDS13839.1																																																																																					0.606	TPST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320820.3		NM_003595	
AP1B1	162	mdanderson.org	37	22	29730383	29730383	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr22:29730383A>G	ENST00000405198.1	-	16	2211	c.2180T>C	c.(2179-2181)aTg>aCg	p.M727T	AP1B1_ENST00000356015.2_Missense_Mutation_p.M720T|AP1B1_ENST00000432560.2_Missense_Mutation_p.M720T|AP1B1_ENST00000317368.7_Intron|SNORD125_ENST00000459538.1_RNA|AP1B1_ENST00000472057.1_5'UTR|AP1B1_ENST00000415447.1_Missense_Mutation_p.M720T|AP1B1_ENST00000402502.1_Missense_Mutation_p.M720T|AP1B1_ENST00000357586.2_Missense_Mutation_p.M727T			Q10567	AP1B1_HUMAN	adaptor-related protein complex 1, beta 1 subunit	727					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						CTTAGCCTTCATGGCTGGGAG	0.622																																					p.M727T													.	.			0			c.T2180C												54.0	49.0	51.0					22																	29730383		2203	4300	6503	SO:0001583	missense	162	exon17			GCCTTCATGGCTG	L13939	CCDS13855.1, CCDS13856.1, CCDS13856.2, CCDS54515.1	22q12.2	2010-06-18			ENSG00000100280	ENSG00000100280			554	protein-coding gene	gene with protein product		600157		ADTB1, CLAPB2		7987321, 8812422	Standard	NM_145730		Approved	BAM22, AP105A	uc003afj.3	Q10567	OTTHUMG00000151109	ENST00000405198.1:c.2180T>C	22.37:g.29730383A>G	ENSP00000384194:p.Met727Thr		Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	54	0.06	3	NM_001127	97	0.00	0	C9JRD1|F8WDL0|P78436|Q20WL3|Q86X54	Missense_Mutation	SNP	ENST00000405198.1	37	CCDS13855.1	.	.	.	.	.	.	.	.	.	.	A	4.083	0.013343	0.07912	.	.	ENSG00000100280	ENST00000357586;ENST00000356015;ENST00000432560;ENST00000405198;ENST00000402502;ENST00000415447	T;T;T;T;T;T	0.39592	1.07;1.07;1.07;1.07;1.07;1.07	5.56	5.56	0.83823	Coatomer/clathrin adaptor appendage, Ig-like subdomain (1);Clathrin adaptor, alpha/beta/gamma-adaptin, appendage, Ig-like subdomain (2);Clathrin adaptor, beta-adaptin, appendage, Ig-like subdomain (1);	0.000000	0.85682	D	0.000000	T	0.29945	0.0749	N	0.24115	0.695	0.80722	D	1	B;B;B;B	0.12013	0.003;0.0;0.005;0.004	B;B;B;B	0.19946	0.007;0.001;0.027;0.023	T	0.10543	-1.0625	10	0.12103	T	0.63	-43.3469	15.3711	0.74564	1.0:0.0:0.0:0.0	.	280;720;727;720	B4DS79;Q10567-2;Q10567;Q10567-3	.;.;AP1B1_HUMAN;.	T	727;720;720;727;720;720	ENSP00000350199:M727T;ENSP00000348297:M720T;ENSP00000400065:M720T;ENSP00000384194:M727T;ENSP00000386071:M720T;ENSP00000387612:M720T	ENSP00000348297:M720T	M	-	2	0	AP1B1	28060383	1.000000	0.71417	1.000000	0.80357	0.073000	0.16967	9.251000	0.95483	2.113000	0.64589	0.460000	0.39030	ATG			0.622	AP1B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000321374.1		NM_001127	
MTFP1	51537	mdanderson.org	37	22	30822783	30822783	+	Missense_Mutation	SNP	G	G	T	rs373693838		TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr22:30822783G>T	ENST00000266263.5	+	2	496	c.146G>T	c.(145-147)aGc>aTc	p.S49I	MTFP1_ENST00000355143.4_Missense_Mutation_p.S49I|MTFP1_ENST00000407550.3_Missense_Mutation_p.S49I|RP4-539M6.19_ENST00000439838.1_Missense_Mutation_p.S221I	NM_016498.4	NP_057582.2	Q9UDX5	MTFP1_HUMAN	mitochondrial fission process 1	49					apoptotic process (GO:0006915)|mitochondrial fission (GO:0000266)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(1)|large_intestine(1)|lung(2)	4						GGCGTGGCCAGCTCCTACGTG	0.567											OREG0026460	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S49I													.	.			0			c.G146T							G	ILE/SER,ILE/SER	0,4406		0,0,2203	70.0	69.0	70.0		146,146	4.4	1.0	22		70	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	MTFP1	NM_001003704.2,NM_016498.4	142,142	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	,	49/136,49/167	30822783	1,13005	2203	4300	6503	SO:0001583	missense	51537	exon2			TGGCCAGCTCCTA	AF151076	CCDS33634.1, CCDS33635.1	22q	2010-09-02			ENSG00000242114	ENSG00000242114			26945	protein-coding gene	gene with protein product		610235				15155745, 15985469	Standard	NM_016498		Approved	MTP18, HSPC242		Q9UDX5	OTTHUMG00000151057	ENST00000266263.5:c.146G>T	22.37:g.30822783G>T	ENSP00000266263:p.Ser49Ile		Somatic	32	0	0	820	WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_016498	68	0.00	0	A6NFQ5|Q9H3K1|Q9P0N6	Missense_Mutation	SNP	ENST00000266263.5	37	CCDS33635.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.580603	0.86645	0.0	1.16E-4	ENSG00000249590;ENSG00000242114;ENSG00000242114;ENSG00000242114	ENST00000439838;ENST00000266263;ENST00000355143;ENST00000407550	T	0.66099	-0.19	5.44	4.38	0.52667	.	0.052651	0.64402	D	0.000001	T	0.58192	0.2105	N	0.12527	0.23	0.80722	D	1	D;B	0.67145	0.996;0.024	P;B	0.62089	0.898;0.028	T	0.54569	-0.8274	10	0.21540	T	0.41	-12.8995	14.1051	0.65083	0.0:0.3596:0.6404:0.0	.	49;49	Q9UDX5-2;Q9UDX5	.;MTFP1_HUMAN	I	221;49;49;49	ENSP00000415178:S221I	ENSP00000266263:S49I	S	+	2	0	MTFP1;RP4-539M6.19	29152783	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.177000	0.58276	2.557000	0.86248	0.655000	0.94253	AGC			0.567	MTFP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000321126.3		NM_016498	
PLA2G6	8398	broad.mit.edu	37	22	38565263	38565263	+	Silent	SNP	G	G	A	rs150718378	byFrequency	TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr22:38565263G>A	ENST00000332509.3	-	2	354	c.171C>T	c.(169-171)tgC>tgT	p.C57C	PLA2G6_ENST00000417303.2_Silent_p.C57C|PLA2G6_ENST00000335539.3_Silent_p.C57C|PLA2G6_ENST00000435484.1_Silent_p.C57C|PLA2G6_ENST00000402064.1_Silent_p.C57C|PLA2G6_ENST00000447598.2_Silent_p.C57C|PLA2G6_ENST00000436218.1_Silent_p.C57C	NM_003560.2	NP_003551.2	O60733	PLPL9_HUMAN	phospholipase A2, group VI (cytosolic, calcium-independent)	57					cardiolipin acyl-chain remodeling (GO:0035965)|cardiolipin biosynthetic process (GO:0032049)|cell death (GO:0008219)|chemotaxis (GO:0006935)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phospholipid metabolic process (GO:0006644)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of ceramide biosynthetic process (GO:2000304)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of exocytosis (GO:0045921)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of vasodilation (GO:0045909)|regulation of store-operated calcium channel activity (GO:1901339)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|urinary bladder smooth muscle contraction (GO:0014832)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipase A2 activity (GO:0004623)			breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|liver(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	24	Melanoma(58;0.045)				Quinacrine(DB01103)	TGACCAGGACGCAGTCCCAGG	0.587													G|||	3	0.000599042	0.0	0.0029	5008	,	,		19065	0.0		0.001	False		,,,				2504	0.0				p.C57C													.	PLA2G6	54		0			c.C171T							G	,,	1,4405	2.1+/-5.4	0,1,2202	90.0	81.0	84.0		171,171,171	2.7	0.9	22	dbSNP_134	84	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous,coding-synonymous	PLA2G6	NM_001004426.1,NM_001199562.1,NM_003560.2	,,	0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231	,,	57/753,57/753,57/807	38565263	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	8398	exon2			CAGGACGCAGTCC	AF064594	CCDS13967.1, CCDS33645.1	22q13.1	2013-01-10			ENSG00000184381	ENSG00000184381	3.1.1.4	"""Patatin-like phospholipase domain containing"", ""Parkinson disease"", ""Ankyrin repeat domain containing"""	9039	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 2"""	603604				9417066, 16799181, 19029121	Standard	NM_001199562		Approved	iPLA2, PNPLA9, PARK14, iPLA2beta, NBIA2	uc003aux.1	O60733	OTTHUMG00000151246	ENST00000332509.3:c.171C>T	22.37:g.38565263G>A			Somatic	242	0.0041322314	1		WXS	Illumina HiSeq	Phase_I	223	0.03	6	NM_003560	13	0.00	0	A8K597|B0QYE8|O75645|Q8N452|Q9UG29|Q9UIT0|Q9Y671	Silent	SNP	ENST00000332509.3	37	CCDS13967.1																																																																																					0.587	PLA2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000321860.1		NM_001004426	
EP300	2033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	41573417	41573417	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr22:41573417C>T	ENST00000263253.7	+	31	6921	c.5702C>T	c.(5701-5703)gCa>gTa	p.A1901V	RP1-85F18.6_ENST00000415054.1_RNA|RP1-85F18.5_ENST00000420537.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1901					apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						CAGGGTAAGGCAGCAGGCCAG	0.627			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.A1901V				Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	.			0			c.C5702T												81.0	74.0	76.0					22																	41573417		2203	4300	6503	SO:0001583	missense	2033	exon31	Familial Cancer Database	Broad Thumb-Hallux syndrome	GTAAGGCAGCAGG	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.5702C>T	22.37:g.41573417C>T	ENSP00000263253:p.Ala1901Val		Somatic	172	0	0		WXS	Illumina HiSeq	.	215	0.11	23	NM_001429	59	0.37	22	B1AKC2	Missense_Mutation	SNP	ENST00000263253.7	37	CCDS14010.1	.	.	.	.	.	.	.	.	.	.	C	13.84	2.355833	0.41700	.	.	ENSG00000100393	ENST00000263253	D	0.83755	-1.76	5.34	5.34	0.76211	.	0.000000	0.48286	D	0.000194	T	0.82245	0.4995	M	0.62723	1.935	0.40343	D	0.979052	P	0.43477	0.808	B	0.39706	0.307	T	0.83188	-0.0085	10	0.38643	T	0.18	-8.0629	19.043	0.93008	0.0:1.0:0.0:0.0	.	1901	Q09472	EP300_HUMAN	V	1901	ENSP00000263253:A1901V	ENSP00000263253:A1901V	A	+	2	0	EP300	39903363	0.991000	0.36638	1.000000	0.80357	0.837000	0.47467	7.500000	0.81588	2.504000	0.84457	0.462000	0.41574	GCA			0.627	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320600.1		NM_001429	
SBF1	6305	broad.mit.edu;mdanderson.org	37	22	50906112	50906112	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr22:50906112G>T	ENST00000390679.3	-	4	471	c.287C>A	c.(286-288)aCg>aAg	p.T96K	SBF1_ENST00000348911.6_Missense_Mutation_p.T97K|SBF1_ENST00000380817.3_Missense_Mutation_p.T96K			O95248	MTMR5_HUMAN	SET binding factor 1	96					cell death (GO:0008219)|positive regulation of Rab GTPase activity (GO:0032851)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.T96R(2)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(8)|large_intestine(3)|lung(18)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	43		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		CTCCACGCGCGTCGTTTCCTG	0.652																																					p.T96K													SBF1_ENST00000380817,NS,carcinoma,0,2	SBF1	211	2	2	Substitution - Missense(2)	lung(2)	c.C287A												48.0	47.0	47.0					22																	50906112		2022	4141	6163	SO:0001583	missense	6305	exon4			ACGCGCGTCGTTT	U93181	CCDS14091.1, CCDS14091.2	22q13.33	2013-01-10			ENSG00000100241	ENSG00000100241		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	10542	protein-coding gene	gene with protein product	"""myotubularin related 5"", ""DENN/MADD domain containing 7A"""	603560				9537414, 9736772	Standard	NM_002972		Approved	MTMR5, DENND7A	uc003blh.3	O95248	OTTHUMG00000150204	ENST00000390679.3:c.287C>A	22.37:g.50906112G>T	ENSP00000375097:p.Thr96Lys		Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	78	0.05	4	NM_002972	12	0.00	0	A6PVG9|O60228|Q5JXD8|Q5PPM2|Q96GR9|Q9UGB8	Missense_Mutation	SNP	ENST00000390679.3	37		.	.	.	.	.	.	.	.	.	.	G	0.004	-2.343529	0.00222	.	.	ENSG00000100241	ENST00000380817;ENST00000348911;ENST00000356279;ENST00000337034;ENST00000390679	D;D;D	0.85773	-2.03;-1.98;-2.03	4.39	-1.68	0.08212	.	0.969423	0.08472	N	0.940833	T	0.63177	0.2489	N	0.08118	0	0.09310	N	1	B;B	0.14012	0.009;0.0	B;B	0.14578	0.011;0.001	T	0.53222	-0.8469	10	0.05436	T	0.98	.	6.0462	0.19762	0.4415:0.1456:0.4129:0.0	.	97;96	G5E933;O95248-4	.;.	K	96;97;107;106;96	ENSP00000370196:T96K;ENSP00000252027:T97K;ENSP00000375097:T96K	ENSP00000336522:T106K	T	-	2	0	SBF1	49252978	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.021000	0.13489	-0.235000	0.09767	-0.258000	0.10820	ACG			0.652	SBF1-201	KNOWN	basic	protein_coding	protein_coding					
NEK10	152110	broad.mit.edu	37	3	27350472	27350472	+	Silent	SNP	G	G	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr3:27350472G>T	ENST00000429845.2	-	11	1023	c.661C>A	c.(661-663)Cga>Aga	p.R221R	NEK10_ENST00000341435.5_Silent_p.R221R			Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10	221					positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein autophosphorylation (GO:0031954)|protein phosphorylation (GO:0006468)|regulation of cell cycle G2/M phase transition (GO:1902749)|regulation of ERK1 and ERK2 cascade (GO:0070372)	protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						TTAGTATCTCGGGCACCAAGT	0.308																																					p.R221R													.	NEK10	271		0			c.C661A												57.0	52.0	53.0					3																	27350472		1567	3580	5147	SO:0001819	synonymous_variant	152110	exon11			TATCTCGGGCACC	AK123061, AK057247	CCDS46781.1	3p24.1	2012-11-15	2012-11-15		ENSG00000163491	ENSG00000163491			18592	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)- related kinase 10"""			15289607	Standard	NM_199347		Approved	FLJ32685	uc003cdt.2	Q6ZWH5	OTTHUMG00000130571	ENST00000429845.2:c.661C>A	3.37:g.27350472G>T			Somatic	379	0	0		WXS	Illumina HiSeq	Phase_I	463	0.01	4	NM_199347	0		0	A8MWG1|B9ZVR0|Q45VJ4|Q6ZR11|Q7Z671|Q86XB1|Q96MB3	Silent	SNP	ENST00000429845.2	37																																																																																						0.308	NEK10-016	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000438156.1		NM_152534	
ARHGAP31	57514	broad.mit.edu	37	3	119120673	119120673	+	Silent	SNP	A	A	G			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr3:119120673A>G	ENST00000264245.4	+	10	1606	c.1074A>G	c.(1072-1074)aaA>aaG	p.K358K		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	358					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						TACTAGGAAAAGAAACCAAGG	0.478																																					p.K358K	Pancreas(7;176 297 5394 51128 51241)												.	ARHGAP31	175		0			c.A1074G												22.0	25.0	24.0					3																	119120673		1921	4119	6040	SO:0001819	synonymous_variant	57514	exon10			AGGAAAAGAAACC		CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.1074A>G	3.37:g.119120673A>G			Somatic	184	0	0		WXS	Illumina HiSeq	Phase_I	170	0.03	5	NM_020754	4	0.00	0	Q9ULL6	Silent	SNP	ENST00000264245.4	37	CCDS43135.1																																																																																					0.478	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000354942.2			
CASR	846	mdanderson.org	37	3	121981253	121981253	+	Silent	SNP	G	G	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr3:121981253G>T	ENST00000490131.1	+	4	1743	c.1371G>T	c.(1369-1371)gcG>gcT	p.A457A	CASR_ENST00000498619.1_Silent_p.A457A|CASR_ENST00000296154.5_Silent_p.A457A	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	457					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	AAGTTGAGGCGTGGCAGGTGC	0.468																																					p.A457A													.	.			0			c.G1371T												65.0	66.0	66.0					3																	121981253		2203	4300	6503	SO:0001819	synonymous_variant	846	exon4			TGAGGCGTGGCAG	U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.1371G>T	3.37:g.121981253G>T			Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	28	0.11	3	NM_001178065	0		0	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Silent	SNP	ENST00000490131.1	37	CCDS3010.1																																																																																					0.468	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000355761.1		NM_000388	
IFT122	55764	mdanderson.org	37	3	129239065	129239065	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr3:129239065G>T	ENST00000348417.2	+	30	3760	c.3683G>T	c.(3682-3684)tGc>tTc	p.C1228F	IFT122_ENST00000347300.2_Missense_Mutation_p.C1169F|IFT122_ENST00000296266.3_Missense_Mutation_p.C1279F|IFT122_ENST00000349441.2_Missense_Mutation_p.C1118F|IFT122_ENST00000507564.1_Missense_Mutation_p.C1221F|IFT122_ENST00000440957.2_Missense_Mutation_p.C1019F|IFT122_ENST00000504021.1_Missense_Mutation_p.C1105F|IFT122_ENST00000431818.2_Missense_Mutation_p.C1078F	NM_052989.1	NP_443715.1	Q9HBG6	IF122_HUMAN	intraflagellar transport 122	1228					camera-type eye morphogenesis (GO:0048593)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|establishment of protein localization to organelle (GO:0072594)|intraciliary anterograde transport (GO:0035720)|intraciliary retrograde transport (GO:0035721)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|protein localization to cilium (GO:0061512)|signal transduction downstream of smoothened (GO:0007227)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intraciliary transport particle A (GO:0030991)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)				breast(3)|cervix(1)|endometrium(9)|large_intestine(10)|lung(21)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	52						CAGCATGGCTGCTGCCCCTAC	0.602																																					p.C1279F													.	.			0			c.G3836T												85.0	68.0	74.0					3																	129239065		2203	4300	6503	SO:0001583	missense	55764	exon31			ATGGCTGCTGCCC	AF244930	CCDS3059.1, CCDS3060.1, CCDS3061.1, CCDS3062.1, CCDS63770.1, CCDS63772.1, CCDS63773.1	3q21	2014-07-03	2014-07-03	2005-11-02	ENSG00000163913	ENSG00000163913		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	13556	protein-coding gene	gene with protein product		606045	"""WD repeat domain 10"", ""intraflagellar transport 122 homolog (Chlamydomonas)"""	WDR10		11242542	Standard	NM_052985		Approved	WDR140, WDR10p, SPG	uc003emm.3	Q9HBG6	OTTHUMG00000159516	ENST00000348417.2:c.3683G>T	3.37:g.129239065G>T	ENSP00000324005:p.Cys1228Phe		Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_052985	68	0.00	0	B3KW53|B4DEY9|B4DPW7|E7EQF4|E9PDG2|E9PDX2|G3XAB1|H7C3C0|Q53G36|Q8TC06|Q9BTB9|Q9BTY4|Q9HAT9|Q9HBG5|Q9NV68|Q9UF80	Missense_Mutation	SNP	ENST00000348417.2	37	CCDS3061.1	.	.	.	.	.	.	.	.	.	.	G	10.09	1.254241	0.22965	.	.	ENSG00000163913	ENST00000347300;ENST00000296266;ENST00000507564;ENST00000431818;ENST00000504021;ENST00000349441;ENST00000348417;ENST00000446384;ENST00000440957	T;T;T;T;T;T;T;T	0.60920	0.8;0.15;0.29;0.34;0.95;0.94;0.79;0.36	5.82	4.95	0.65309	.	0.085942	0.85682	D	0.000000	T	0.69655	0.3135	M	0.62723	1.935	0.80722	D	1	D;B;D;B;B;B;B;B;P;D	0.63046	0.958;0.156;0.992;0.416;0.105;0.173;0.044;0.074;0.93;0.958	P;B;D;B;B;B;B;B;P;P	0.74023	0.804;0.146;0.982;0.275;0.025;0.056;0.035;0.056;0.641;0.804	T	0.66496	-0.5909	10	0.10377	T	0.69	-14.4648	14.9208	0.70835	0.0686:0.0:0.9313:0.0	.	1019;554;1221;616;1105;1070;1118;1169;1228;1279	E9PDG2;B3KUD1;E7EQF4;B3KT43;B4DEY9;B4DPW7;Q9BTY4;Q9HBG6-3;Q9HBG6;G3XAB1	.;.;.;.;.;.;.;.;IF122_HUMAN;.	F	1169;1279;1221;1078;1105;1118;1228;1070;1019	ENSP00000323973:C1169F;ENSP00000296266:C1279F;ENSP00000425536:C1221F;ENSP00000410946:C1078F;ENSP00000422179:C1105F;ENSP00000324165:C1118F;ENSP00000324005:C1228F;ENSP00000401569:C1019F	ENSP00000296266:C1279F	C	+	2	0	IFT122	130721755	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.942000	0.87708	1.469000	0.48083	0.655000	0.94253	TGC			0.602	IFT122-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000355852.1		NM_018262	
LRRC66	339977	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	4	52861139	52861139	+	Silent	SNP	G	G	A			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr4:52861139G>A	ENST00000343457.3	-	4	2055	c.2049C>T	c.(2047-2049)aaC>aaT	p.N683N		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	683						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						CTGGTTCCTTGTTAGCAGGAG	0.527																																					p.N683N													.	.			0			c.C2049T												86.0	83.0	84.0					4																	52861139		2012	4173	6185	SO:0001819	synonymous_variant	339977	exon4			TTCCTTGTTAGCA	BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.2049C>T	4.37:g.52861139G>A			Somatic	80	0	0		WXS	Illumina HiSeq	.	80	0.09	7	NM_001024611	0		0		Silent	SNP	ENST00000343457.3	37	CCDS43229.1																																																																																					0.527	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000361473.1		NM_001024611	
CNOT6L	246175	mdanderson.org	37	4	78678099	78678099	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr4:78678099G>T	ENST00000504123.1	-	5	537	c.407C>A	c.(406-408)cCt>cAt	p.P136H	CNOT6L_ENST00000264903.4_Missense_Mutation_p.P136H|CNOT6L_ENST00000506166.1_5'UTR			Q96LI5	CNO6L_HUMAN	CCR4-NOT transcription complex, subunit 6-like	136	Required for interaction with CNOT1, CNOT3 and CNOT7.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA destabilization (GO:0061157)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)			kidney(1)|large_intestine(1)|lung(6)|urinary_tract(1)	9						CTGTGATAAAGGATTGCCTAA	0.338																																					p.P136H													.	.			0			c.C407A												66.0	61.0	62.0					4																	78678099		1813	4076	5889	SO:0001583	missense	246175	exon5			GATAAAGGATTGC	AL133112	CCDS68731.1	4q13.3	2014-06-17				ENSG00000138767			18042	protein-coding gene	gene with protein product							Standard	NM_144571		Approved	DKFZp434K098, Ccr4b	uc003hks.3	Q96LI5		ENST00000504123.1:c.407C>A	4.37:g.78678099G>T	ENSP00000424896:p.Pro136His		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_144571	0		0	Q9UF92	Missense_Mutation	SNP	ENST00000504123.1	37		.	.	.	.	.	.	.	.	.	.	G	25.0	4.595102	0.86953	.	.	ENSG00000138767	ENST00000504123;ENST00000264903;ENST00000512485;ENST00000515441	T;T;T;T	0.80033	-1.33;-1.33;-1.33;-1.33	5.18	5.18	0.71444	.	0.000000	0.85682	U	0.000000	D	0.92586	0.7645	H	0.94734	3.575	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.988	D	0.94574	0.7773	10	0.87932	D	0	-4.6895	17.4677	0.87638	0.0:0.0:1.0:0.0	.	136;136	B4E2S0;Q96LI5	.;CNO6L_HUMAN	H	136;136;143;136	ENSP00000424896:P136H;ENSP00000264903:P136H;ENSP00000425571:P143H;ENSP00000426269:P136H	ENSP00000264903:P136H	P	-	2	0	CNOT6L	78897123	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.747000	0.91610	2.432000	0.82394	0.460000	0.39030	CCT			0.338	CNOT6L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000362515.1			
CDS1	1040	broad.mit.edu;mdanderson.org	37	4	85560085	85560085	+	Silent	SNP	T	T	C			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr4:85560085T>C	ENST00000295887.5	+	9	1242	c.819T>C	c.(817-819)ccT>ccC	p.P273P		NM_001263.3	NP_001254.2	O96017	CHK2_HUMAN	CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|liver(2)|lung(5)|ovary(1)	20		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.00101)		AGTTGTCTCCTAAAAAGACTT	0.274																																					p.P273P													.	CDS1	58		0			c.T819C												95.0	92.0	93.0					4																	85560085		2202	4297	6499	SO:0001819	synonymous_variant	1040	exon9			GTCTCCTAAAAAG	U65887	CCDS3608.1	4q21	2008-02-05			ENSG00000163624	ENSG00000163624	2.7.7.41		1800	protein-coding gene	gene with protein product		603548				9806839, 9115637	Standard	NM_001263		Approved		uc011ccv.2	Q92903	OTTHUMG00000130428	ENST00000295887.5:c.819T>C	4.37:g.85560085T>C			Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	97	0.04	4	NM_001263	0		0	A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Silent	SNP	ENST00000295887.5	37	CCDS3608.1																																																																																					0.274	CDS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252817.2			
DAB2	1601	bcgsc.ca;mdanderson.org	37	5	39376964	39376964	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr5:39376964G>T	ENST00000320816.6	-	12	2392	c.1925C>A	c.(1924-1926)cCa>cAa	p.P642Q	DAB2_ENST00000545653.1_Missense_Mutation_p.P621Q|DAB2_ENST00000339788.6_Missense_Mutation_p.P424Q|DAB2_ENST00000509337.1_Missense_Mutation_p.P621Q	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	642	Sufficient for interaction with GRB2. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			ATCCCCAAGTGGGTCTAAGGC	0.557											OREG0016586	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P642Q													.	DAB2	124		0			c.C1925A												60.0	66.0	64.0					5																	39376964		2203	4300	6503	SO:0001583	missense	1601	exon12			CCAAGTGGGTCTA	U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.1925C>A	5.37:g.39376964G>T	ENSP00000313391:p.Pro642Gln		Somatic	130	0	0	885	WXS	Illumina HiSeq	Phase_1	82	0.06	5	NM_001343	20	0.00	0	A6NES5|Q13598|Q9BTY0|Q9UK04	Missense_Mutation	SNP	ENST00000320816.6	37	CCDS34149.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.426172	0.83667	.	.	ENSG00000153071	ENST00000320816;ENST00000339788;ENST00000545653;ENST00000509337	T;T;T;T	0.54479	0.57;0.57;0.57;0.57	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.72969	0.3527	M	0.70275	2.135	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.76575	-0.2909	10	0.87932	D	0	-9.1457	18.5286	0.90983	0.0:0.0:1.0:0.0	.	642;621	P98082;P98082-3	DAB2_HUMAN;.	Q	642;424;621;621	ENSP00000313391:P642Q;ENSP00000345508:P424Q;ENSP00000439919:P621Q;ENSP00000426245:P621Q	ENSP00000313391:P642Q	P	-	2	0	DAB2	39412721	1.000000	0.71417	0.989000	0.46669	0.996000	0.88848	9.244000	0.95423	2.366000	0.80165	0.655000	0.94253	CCA			0.557	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000367014.1		NM_001343	
PCDHGB1	56104	broad.mit.edu	37	5	140729996	140729996	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr5:140729996C>T	ENST00000523390.1	+	1	169	c.169C>T	c.(169-171)Cgg>Tgg	p.R57W	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	57	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTCAGTGTCCGGGAGTTGCC	0.542											OREG0016856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R57W													.	PCDHGB1	198		0			c.C169T												69.0	69.0	69.0					5																	140729996		1897	4112	6009	SO:0001583	missense	0	exon1			AGTGTCCGGGAGT	AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.169C>T	5.37:g.140729996C>T	ENSP00000429273:p.Arg57Trp		Somatic	165	0	0	1658	WXS	Illumina HiSeq	Phase_I	149	0.03	4	NM_018922	1	0.00	0	Q3SY75|Q9Y5C8	Missense_Mutation	SNP	ENST00000523390.1	37	CCDS54923.1	.	.	.	.	.	.	.	.	.	.	.	11.29	1.593691	0.28445	.	.	ENSG00000254221	ENST00000523390	T	0.38560	1.13	5.52	4.65	0.58169	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.41719	0.1171	M	0.62209	1.925	0.09310	N	1	B;B	0.21821	0.061;0.059	B;B	0.23852	0.049;0.035	T	0.38308	-0.9667	9	0.56958	D	0.05	.	9.5078	0.39058	0.3814:0.4923:0.1263:0.0	.	57;57	Q9Y5G3-2;Q9Y5G3	.;PCDGD_HUMAN	W	57	ENSP00000429273:R57W	ENSP00000429273:R57W	R	+	1	2	PCDHGB1	140710180	0.000000	0.05858	0.448000	0.26945	0.944000	0.59088	0.245000	0.18142	1.454000	0.47793	0.563000	0.77884	CGG			0.542	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000374740.1		NM_018922	
RUNX2	860	hgsc.bcm.edu;mdanderson.org	37	6	45390457	45390457	+	Silent	SNP	G	G	A			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr6:45390457G>A	ENST00000371438.1	+	2	544	c.186G>A	c.(184-186)caG>caA	p.Q62Q	RUNX2_ENST00000359524.5_Silent_p.Q48Q|RUNX2_ENST00000576263.1_Silent_p.Q62Q|RUNX2_ENST00000352853.5_Silent_p.Q130Q|RUNX2_ENST00000371432.3_Silent_p.Q48Q|RUNX2_ENST00000371436.6_Silent_p.Q62Q|RUNX2_ENST00000541979.1_Silent_p.Q130Q|RUNX2_ENST00000465038.2_Silent_p.Q62Q|RP1-244F24.1_ENST00000606796.1_RNA	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	62	Poly-Gln.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						agcagcagcagcagcagcaac	0.736																																					p.Q62Q													.	.			0			c.G186A												12.0	19.0	17.0					6																	45390457		1471	3153	4624	SO:0001819	synonymous_variant	860	exon3			GCAGCAGCAGCAG	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.186G>A	6.37:g.45390457G>A			Somatic	45	0	0		WXS	Illumina HiSeq	.	48	0.17	8	NM_001024630	0		0	O14614|O14615|O95181	Silent	SNP	ENST00000371438.1	37	CCDS43467.2																																																																																					0.736	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000040755.2		NM_004348	
MMS22L	253714	broad.mit.edu	37	6	97609923	97609923	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr6:97609923G>T	ENST00000275053.4	-	22	3605	c.3340C>A	c.(3340-3342)Ctc>Atc	p.L1114I	MMS22L_ENST00000369251.2_Missense_Mutation_p.L1074I	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	1114					double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)				breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						ATGCCAGGGAGGAGTAGTTCA	0.393																																					p.L1114I													.	MMS22L	102		0			c.C3340A												114.0	111.0	112.0					6																	97609923		2203	4300	6503	SO:0001583	missense	253714	exon22			CAGGGAGGAGTAG		CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.3340C>A	6.37:g.97609923G>T	ENSP00000275053:p.Leu1114Ile		Somatic	151	0	0		WXS	Illumina HiSeq	Phase_I	109	0.03	3	NM_198468	6	0.00	0	D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Missense_Mutation	SNP	ENST00000275053.4	37	CCDS5039.1	.	.	.	.	.	.	.	.	.	.	g	20.2	3.955583	0.73902	.	.	ENSG00000146263	ENST00000275053;ENST00000369251	T;T	0.36340	3.29;1.26	5.87	4.82	0.62117	.	0.000000	0.85682	D	0.000000	T	0.52996	0.1769	M	0.69823	2.125	0.46478	D	0.999061	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	T	0.55231	-0.8173	10	0.87932	D	0	-17.4786	15.8879	0.79264	0.0752:0.0:0.9248:0.0	.	1074;1114	E2QRD4;Q6ZRQ5	.;MMS22_HUMAN	I	1114;1074	ENSP00000275053:L1114I;ENSP00000358254:L1074I	ENSP00000275053:L1114I	L	-	1	0	MMS22L	97716644	1.000000	0.71417	0.986000	0.45419	0.885000	0.51271	4.737000	0.62066	2.785000	0.95823	0.650000	0.86243	CTC			0.393	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041573.3		NM_198468	
EIF3B	8662	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	2404052	2404052	+	Silent	SNP	C	C	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr7:2404052C>T	ENST00000360876.4	+	6	1101	c.1045C>T	c.(1045-1047)Ctg>Ttg	p.L349L	EIF3B_ENST00000397011.2_Silent_p.L349L	NM_001037283.1	NP_001032360.1			eukaryotic translation initiation factor 3, subunit B											breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	24		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		GGGCACCTACCTGGCTACCTT	0.468																																					p.L349L													.	.			0			c.C1045T												128.0	131.0	130.0					7																	2404052		2203	4300	6503	SO:0001819	synonymous_variant	8662	exon6			ACCTACCTGGCTA	U62583	CCDS5332.1	7p22	2013-02-12	2007-07-27	2007-07-27	ENSG00000106263	ENSG00000106263		"""RNA binding motif (RRM) containing"""	3280	protein-coding gene	gene with protein product		603917	"""eukaryotic translation initiation factor 3, subunit 9 eta, 116kDa"""	EIF3S9		8995410	Standard	NM_001037283		Approved	PRT1, eIF3b	uc003sly.3	P55884	OTTHUMG00000022839	ENST00000360876.4:c.1045C>T	7.37:g.2404052C>T			Somatic	111	0	0		WXS	Illumina HiSeq	.	100	0.04	4	NM_001037283	706	0.18	126		Silent	SNP	ENST00000360876.4	37	CCDS5332.1																																																																																					0.468	EIF3B-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207006.1			
COBL	23242	broad.mit.edu;mdanderson.org	37	7	51095412	51095412	+	Silent	SNP	G	G	C			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr7:51095412G>C	ENST00000265136.7	-	10	3546	c.3381C>G	c.(3379-3381)cgC>cgG	p.R1127R	COBL_ENST00000395542.2_Silent_p.R1209R	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	1127	WH2 1. {ECO:0000255|PROSITE- ProRule:PRU00406}.				actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)			NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					TCCTCACCTTGCGTAGTCTGT	0.567																																					p.R1127R	NSCLC(189;2119 2138 12223 30818 34679)												.	COBL	167		0			c.C3381G												89.0	77.0	81.0					7																	51095412		2203	4300	6503	SO:0001819	synonymous_variant	23242	exon10			CACCTTGCGTAGT	AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.3381C>G	7.37:g.51095412G>C			Somatic	138	0	0		WXS	Illumina HiSeq	Phase_I	141	0.04	5	NM_015198	21	0.14	3	A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Silent	SNP	ENST00000265136.7	37	CCDS34637.1																																																																																					0.567	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000342682.1	rescued with RNA-seq	NM_015198	
TNRC18P3	340221	bcgsc.ca	37	7	57076653	57076653	+	IGR	SNP	T	T	C	rs111384738	byFrequency	TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr7:57076653T>C								RN7SL816P (43439 upstream) : ZNF479 (110667 downstream)																							GTGCCCGCAGTGCGCGCTATA	0.642													N|||	3049	0.608826	0.5333	0.6484	5008	,	,		7990	0.6915		0.494	False		,,,				2504	0.7157				.													.	.			0			.																																									SO:0001628	intergenic_variant	340221	.			CCGCAGTGCGCGC																													7.37:g.57076653T>C			Somatic	92	0	0		WXS	Illumina HiSeq	Phase_1	105	0.09	9	.	0		0		RNA	SNP		37																																																																																					0	0.642										
CCT6P3	643180	broad.mit.edu	37	7	64530103	64530103	+	RNA	SNP	G	G	A	rs369683052		TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr7:64530103G>A	ENST00000426828.1	+	0	923				SNORA15_ENST00000384334.1_RNA	NR_033416.1				chaperonin containing TCP1, subunit 6 (zeta) pseudogene 3																		TGACTGCTTGGGACATGCAGG	0.388																																					.													.	.			0			.																																											0	.			TGCTTGGGACATG			7q11.21	2010-06-29			ENSG00000234585	ENSG00000234585			35137	pseudogene	pseudogene							Standard	NR_033416		Approved		uc010kzt.1		OTTHUMG00000156630		7.37:g.64530103G>A			Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	37	0.08	3	.	13	0.00	0		RNA	SNP	ENST00000426828.1	37																																																																																						0.388	CCT6P3-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000344862.1			
CACNA2D1	781	broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	81693631	81693631	+	Silent	SNP	A	A	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr7:81693631A>T	ENST00000356253.5	-	9	1023	c.768T>A	c.(766-768)atT>atA	p.I256I	CACNA2D1_ENST00000423588.1_Silent_p.I256I|CACNA2D1_ENST00000356860.3_Silent_p.I256I			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	256	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	CATCCACCAGAATAAGCATGT	0.328																																					p.I256I													.	CACNA2D1	191		0			c.T768A												84.0	80.0	81.0					7																	81693631		2203	4299	6502	SO:0001819	synonymous_variant	781	exon9			CACCAGAATAAGC	M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.768T>A	7.37:g.81693631A>T			Somatic	381	0.0026246719	1		WXS	Illumina HiSeq	Phase_I	368	0.05	17	NM_000722	0		0	Q17R45|Q9UD80|Q9UD81|Q9UD82	Silent	SNP	ENST00000356253.5	37																																																																																						0.328	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding					
CAV1	857	ucsc.edu	37	7	116166628	116166628	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr7:116166628C>G	ENST00000341049.2	+	2	358	c.80C>G	c.(79-81)cCc>cGc	p.P27R	CAV1_ENST00000405348.1_5'UTR|CAV1_ENST00000393467.1_5'UTR|CAV1_ENST00000393470.1_Missense_Mutation_p.P16R|CAV1_ENST00000393468.1_5'UTR	NM_001753.4	NP_001744.2	Q03135	CAV1_HUMAN	caveolin 1, caveolae protein, 22kDa	27					angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion transport (GO:0006816)|caveola assembly (GO:0070836)|caveolin-mediated endocytosis (GO:0072584)|cellular calcium ion homeostasis (GO:0006874)|cellular response to hyperoxia (GO:0071455)|cellular response to starvation (GO:0009267)|cholesterol homeostasis (GO:0042632)|cholesterol transport (GO:0030301)|cytosolic calcium ion homeostasis (GO:0051480)|inactivation of MAPK activity (GO:0000188)|lactation (GO:0007595)|leukocyte migration (GO:0050900)|lipid storage (GO:0019915)|maintenance of protein location in cell (GO:0032507)|mammary gland development (GO:0030879)|mammary gland involution (GO:0060056)|MAPK cascade (GO:0000165)|membrane depolarization (GO:0051899)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of pinocytosis (GO:0048550)|negative regulation of protein binding (GO:0032091)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|nitric oxide homeostasis (GO:0033484)|nitric oxide metabolic process (GO:0046209)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of vasoconstriction (GO:0045907)|protein homooligomerization (GO:0051260)|protein localization (GO:0008104)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)|regulation of blood coagulation (GO:0030193)|regulation of fatty acid metabolic process (GO:0019217)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidase activity (GO:0052547)|regulation of smooth muscle contraction (GO:0006940)|regulation of the force of heart contraction by chemical signal (GO:0003057)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to ischemia (GO:0002931)|response to progesterone (GO:0032570)|skeletal muscle tissue development (GO:0007519)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|vasculogenesis (GO:0001570)|vasoconstriction (GO:0042310)|vesicle organization (GO:0016050)|viral process (GO:0016032)	acrosomal membrane (GO:0002080)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|cell cortex (GO:0005938)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lipid particle (GO:0005811)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cholesterol binding (GO:0015485)|enzyme binding (GO:0019899)|nitric-oxide synthase binding (GO:0050998)|patched binding (GO:0005113)|peptidase activator activity (GO:0016504)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4	all_epithelial(6;1.42e-06)|Lung NSC(10;0.0056)|all_lung(10;0.00609)		STAD - Stomach adenocarcinoma(10;0.00878)			ATCTACAAGCCCAACAACAAG	0.627											OREG0018273	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P27R													.	CAV1	13		0			c.C80G												183.0	131.0	148.0					7																	116166628		2203	4300	6503	SO:0001583	missense	857	exon2			ACAAGCCCAACAA	AF125348	CCDS5767.1, CCDS55156.1	7q31	2006-02-09	2002-08-29		ENSG00000105974	ENSG00000105974			1527	protein-coding gene	gene with protein product		601047	"""caveolin 1, caveolae protein, 22kD"""	CAV		10087206	Standard	NM_001753		Approved		uc003vif.2	Q03135	OTTHUMG00000023413	ENST00000341049.2:c.80C>G	7.37:g.116166628C>G	ENSP00000339191:p.Pro27Arg		Somatic	115	0	0	1471	RNA-Seq	Illumina HiSeq		84	0.07	6	NM_001753	301	0.30	89	Q9UGP1|Q9UNG1|Q9UQH6	Missense_Mutation	SNP	ENST00000341049.2	37	CCDS5767.1	.	.	.	.	.	.	.	.	.	.	C	34	5.364989	0.95877	.	.	ENSG00000105974	ENST00000341049;ENST00000393470	D;D	0.94046	-3.34;-3.31	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	D	0.96074	0.8721	M	0.69823	2.125	0.80722	D	1	D	0.62365	0.991	P	0.62382	0.901	D	0.96227	0.9165	10	0.72032	D	0.01	-0.3198	19.0444	0.93013	0.0:1.0:0.0:0.0	.	27	Q03135	CAV1_HUMAN	R	27;16	ENSP00000339191:P27R;ENSP00000377113:P16R	ENSP00000339191:P27R	P	+	2	0	CAV1	115953864	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.227000	0.78070	2.645000	0.89757	0.650000	0.86243	CCC			0.627	CAV1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000059734.4		NM_001753	
GRM8	2918	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	126086148	126086148	+	Intron	SNP	C	C	G			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr7:126086148C>G	ENST00000339582.2	-	10	3486				GRM8_ENST00000444921.2_Intron|GRM8_ENST00000358373.3_Missense_Mutation_p.K903N			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8						adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				TGCTCCCGCTCTTGACCATCG	0.448										HNSCC(24;0.065)																											p.K903N													.	.			0			c.G2709C												150.0	141.0	144.0					7																	126086148		2203	4300	6503	SO:0001627	intron_variant	2918	exon10			CCCGCTCTTGACC		CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.2677+31G>C	7.37:g.126086148C>G			Somatic	97	0	0		WXS	Illumina HiSeq	.	66	0.08	5	NM_001127323	0		0	A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	ENST00000339582.2	37	CCDS5794.1	.	.	.	.	.	.	.	.	.	.	C	12.91	2.080138	0.36662	.	.	ENSG00000179603	ENST00000358373	D	0.88896	-2.44	6.07	6.07	0.98685	.	.	.	.	.	T	0.80297	0.4597	N	0.08118	0	0.80722	D	1	B	0.22146	0.065	B	0.22152	0.038	T	0.74447	-0.3662	9	0.34782	T	0.22	.	17.8085	0.88608	0.0:1.0:0.0:0.0	.	903	O00222-2	.	N	903	ENSP00000351142:K903N	ENSP00000351142:K903N	K	-	3	2	GRM8	125873384	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.054000	0.57434	2.890000	0.99128	0.585000	0.79938	AAG			0.448	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000059209.4			
PYCRL	65263	broad.mit.edu;bcgsc.ca	37	8	144689164	144689175	+	In_Frame_Del	DEL	CCAAGATGTGTT	CCAAGATGTGTT	-			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	CCAAGATGTGTT	CCAAGATGTGTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr8:144689164_144689175delCCAAGATGTGTT	ENST00000220966.6	-	3	349_360	c.320_331delAACACATCTTGG	c.(319-333)gaacacatcttggtg>gtg	p.EHIL107del	PYCRL_ENST00000377579.3_5'UTR|PYCRL_ENST00000495276.1_5'UTR	NM_023078.3	NP_075566.2	Q53H96	P5CR3_HUMAN	pyrroline-5-carboxylate reductase-like	95					L-proline biosynthetic process (GO:0055129)		pyrroline-5-carboxylate reductase activity (GO:0004735)			central_nervous_system(1)|endometrium(1)|lung(2)|ovary(1)	5	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.17e-38)|Epithelial(56;7.17e-37)|all cancers(56;2.46e-32)|Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)		L-Proline(DB00172)	GCCACGGACACCAAGATGTGTTCAGTGGTGAC	0.608																																					p.107_111del													.	PYCRL	14		0			c.320_331del																																									SO:0001651	inframe_deletion	65263	exon3			CGGACACCAAGAT	AF086378	CCDS6407.2	8q24.3	2011-09-30	2011-09-30	2011-09-30	ENSG00000104524	ENSG00000104524			25846	protein-coding gene	gene with protein product							Standard	NM_023078		Approved	FLJ13852	uc003yyy.3	Q53H96	OTTHUMG00000157010	ENST00000220966.6:c.320_331delAACACATCTTGG	8.37:g.144689164_144689175delCCAAGATGTGTT	ENSP00000220966:p.Glu107_Leu110del		Somatic	269	0	0		WXS	Illumina HiSeq	Phase_I	277	0.04	11	NM_023078	11	0.00	0	B3KMB5|B4DVT6|H0Y6C3|Q8N3N9|Q96HX4|Q9H896	In_Frame_Del	DEL	ENST00000220966.6	37	CCDS6407.2																																																																																					0.608	PYCRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347081.2		NM_023078	
OPLAH	26873	mdanderson.org	37	8	145114512	145114512	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr8:145114512A>G	ENST00000426825.1	-	3	434	c.353T>C	c.(352-354)cTc>cCc	p.L118P	OPLAH_ENST00000534424.1_5'UTR	NM_017570.3	NP_060040.1	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	118					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	5-oxoprolinase (ATP-hydrolyzing) activity (GO:0017168)|ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CAGGTCAAAGAGGTCCCCACG	0.632																																					p.L118P													.	.			0			c.T353C												36.0	44.0	41.0					8																	145114512		2181	4267	6448	SO:0001583	missense	26873	exon3			TCAAAGAGGTCCC	AF024672, AB122018	CCDS75802.1	8q24.3	2010-11-23			ENSG00000178814	ENSG00000178814	3.5.2.9		8149	protein-coding gene	gene with protein product		614243				14993790	Standard	NM_017570		Approved	OPLA, 5-Opase	uc003zar.3	O14841		ENST00000426825.1:c.353T>C	8.37:g.145114512A>G	ENSP00000475943:p.Leu118Pro		Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	53	0.06	3	NM_017570	4	0.00	0	A5PKY8|Q75W65|Q9Y4Q0	Missense_Mutation	SNP	ENST00000426825.1	37		.	.	.	.	.	.	.	.	.	.	A	18.39	3.614396	0.66672	.	.	ENSG00000178814	ENST00000426825	.	.	.	5.37	5.37	0.77165	Hydantoinaseoxoprolinase, N-terminal (1);	0.060746	0.64402	D	0.000002	T	0.78013	0.4217	.	.	.	0.44547	D	0.997500	D	0.60160	0.987	D	0.68483	0.958	D	0.84433	0.0578	7	0.87932	D	0	.	13.3064	0.60355	1.0:0.0:0.0:0.0	.	118	O14841	OPLA_HUMAN	P	118	.	ENSP00000412071:L118P	L	-	2	0	OPLAH	145186500	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.735000	0.62051	2.037000	0.60232	0.459000	0.35465	CTC			0.632	OPLAH-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_017570	
MFSD3	113655	mdanderson.org	37	8	145735026	145735026	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr8:145735026T>G	ENST00000301327.4	+	1	570	c.310T>G	c.(310-312)Ttg>Gtg	p.L104V	CTD-2517M22.17_ENST00000580385.1_RNA|RECQL4_ENST00000532237.1_5'Flank	NM_138431.1	NP_612440.1	Q96ES6	MFSD3_HUMAN	major facilitator superfamily domain containing 3	104	Leu-rich.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			TGTGGCGGGGTTGCTGCTGTT	0.731											OREG0019059	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L104V													.	.			0			c.T310G																																									SO:0001583	missense	113655	exon1			GCGGGGTTGCTGC		CCDS6431.1	8q24.3	2005-11-17			ENSG00000167700	ENSG00000167700			25157	protein-coding gene	gene with protein product							Standard	NM_138431		Approved		uc003zdi.1	Q96ES6	OTTHUMG00000165177	ENST00000301327.4:c.310T>G	8.37:g.145735026T>G	ENSP00000301327:p.Leu104Val		Somatic	10	0.6	6	1696	WXS	Illumina HiSeq	Phase_I	14	0.43	6	NM_138431	11	0.45	5		Missense_Mutation	SNP	ENST00000301327.4	37	CCDS6431.1	.	.	.	.	.	.	.	.	.	.	T	9.469	1.095202	0.20471	.	.	ENSG00000167700	ENST00000301327	T	0.81078	-1.45	5.24	1.74	0.24563	Major facilitator superfamily domain, general substrate transporter (1);	0.439280	0.22611	N	0.057836	T	0.79828	0.4513	L	0.46819	1.47	0.27957	N	0.936909	D	0.57571	0.98	P	0.57244	0.816	T	0.69591	-0.5104	10	0.38643	T	0.18	-21.193	6.6076	0.22734	0.0:0.6675:0.1444:0.1881	.	104	Q96ES6	MFSD3_HUMAN	V	104	ENSP00000301327:L104V	ENSP00000301327:L104V	L	+	1	2	MFSD3	145705834	0.006000	0.16342	0.377000	0.26055	0.018000	0.09664	0.094000	0.15107	0.564000	0.29238	-0.337000	0.08149	TTG			0.731	MFSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382478.2		NM_138431	
PRSS3	5646	broad.mit.edu;bcgsc.ca	37	9	33797853	33797855	+	In_Frame_Del	DEL	ACA	ACA	-	rs532977255		TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	ACA	ACA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr9:33797853_33797855delACA	ENST00000361005.5	+	3	398_400	c.398_400delACA	c.(397-402)cacaac>cac	p.N134del	PRSS3_ENST00000429677.3_In_Frame_Del_p.N70del|PRSS3_ENST00000342836.4_In_Frame_Del_p.N91del|PRSS3_ENST00000379405.3_In_Frame_Del_p.N77del|RP11-133O22.6_ENST00000454429.2_RNA	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3	134	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			CTGGGAGAGCACAACATCAAAGT	0.571																																					p.133_134del													.	PRSS3	79		0			c.398_400del																																									SO:0001651	inframe_deletion	5646	exon3			GAGAGCACAACAT		CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.398_400delACA	9.37:g.33797856_33797858delACA	ENSP00000354280:p.Asn134del		Somatic	142	0	0		WXS	Illumina HiSeq	Phase_I	101	0.10	10	NM_007343	0		0	A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	In_Frame_Del	DEL	ENST00000361005.5	37	CCDS47958.1																																																																																					0.571	PRSS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000052121.1		NM_002771	
LINC01410	103352539	broad.mit.edu	37	9	66461548	66461549	+	lincRNA	INS	-	-	C	rs112610171|rs145539079|rs28877596		TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr9:66461548_66461549insC	ENST00000424345.1	+	0	224																											agcttaaggagttttgggtcac	0.356																																					.													.	.			0			.																																											0	.			TAAGGAGTTTTGG																													9.37:g.66461548_66461549insC			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	7	0.43	3	.	0		0		RNA	INS	ENST00000424345.1	37																																																																																						0.356	RP11-262H14.1-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000128851.1			
COL27A1	85301	broad.mit.edu	37	9	117037945	117037945	+	Missense_Mutation	SNP	A	A	G	rs533652508		TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr9:117037945A>G	ENST00000356083.3	+	37	4005	c.3614A>G	c.(3613-3615)gAc>gGc	p.D1205G		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	1205	Collagen-like 10.|Pro-rich.|Triple-helical region.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						ACCCAGGGGGACAGGGGAGAC	0.622													A|||	1	0.000199681	0.0008	0.0	5008	,	,		18665	0.0		0.0	False		,,,				2504	0.0				p.D1205G													.	COL27A1	200		0			c.A3614G												21.0	18.0	19.0					9																	117037945		1907	3745	5652	SO:0001583	missense	85301	exon37			AGGGGGACAGGGG	AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.3614A>G	9.37:g.117037945A>G	ENSP00000348385:p.Asp1205Gly		Somatic	83	0.0120481928	1		WXS	Illumina HiSeq	Phase_I	105	0.05	5	NM_032888	20	0.00	0	Q66K43|Q96JF7	Missense_Mutation	SNP	ENST00000356083.3	37	CCDS6802.1	.	.	.	.	.	.	.	.	.	.	A	15.11	2.734880	0.48939	.	.	ENSG00000196739	ENST00000356083;ENST00000357257	T	0.53423	0.62	4.83	4.83	0.62350	.	.	.	.	.	T	0.59101	0.2169	L	0.49126	1.545	0.44652	D	0.997635	D	0.89917	1.0	D	0.87578	0.998	T	0.55166	-0.8183	9	0.27082	T	0.32	.	11.088	0.48099	1.0:0.0:0.0:0.0	.	1205	Q8IZC6	CORA1_HUMAN	G	1205	ENSP00000348385:D1205G	ENSP00000348385:D1205G	D	+	2	0	COL27A1	116077766	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	5.630000	0.67805	1.934000	0.56057	0.379000	0.24179	GAC			0.622	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053763.1		NM_032888	
RAPGEF1	2889	mdanderson.org	37	9	134497191	134497191	+	Silent	SNP	G	G	T			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chr9:134497191G>T	ENST00000372189.3	-	11	1969	c.1846C>A	c.(1846-1848)Cgg>Agg	p.R616R	RAPGEF1_ENST00000372190.3_Silent_p.R634R|RAPGEF1_ENST00000372195.1_Silent_p.R633R	NM_005312.2	NP_005303.2	Q13905	RPGF1_HUMAN	Rap guanine nucleotide exchange factor (GEF) 1	616					activation of MAPKK activity (GO:0000186)|blood vessel development (GO:0001568)|cellular response to cAMP (GO:0071320)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of Ras protein signal transduction (GO:0046580)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of neuron projection development (GO:0010976)|positive regulation of Rap GTPase activity (GO:0032854)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)	Rap guanyl-nucleotide exchange factor activity (GO:0017034)			NS(2)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	39		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		ACCAGCTGCCGCTGCTTGGGG	0.612																																					p.R634R													.	.			0			c.C1900A												19.0	22.0	21.0					9																	134497191		1936	4130	6066	SO:0001819	synonymous_variant	2889	exon11			GCTGCCGCTGCTT	BC041710	CCDS48047.1	9q34.3	2008-02-05	2004-03-01	2004-03-02	ENSG00000107263	ENSG00000107263			4568	protein-coding gene	gene with protein product		600303	"""guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene)"""	GRF2		7959692, 7512734	Standard	NM_005312		Approved	C3G	uc022bos.1	Q13905	OTTHUMG00000020829	ENST00000372189.3:c.1846C>A	9.37:g.134497191G>T			Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	55	0.05	3	NM_198679	32	0.00	0	Q5JUE4|Q8IV73	Silent	SNP	ENST00000372189.3	37	CCDS48047.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.44|10.44	1.352029|1.352029	0.24512|0.24512	.|.	.|.	ENSG00000107263|ENSG00000107263	ENST00000414781|ENST00000419442	.|.	.|.	.|.	5.57|5.57	2.26|2.26	0.28386|0.28386	.|.	.|.	.|.	.|.	.|.	T|T	0.67335|0.67335	0.2882|0.2882	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.65307|0.65307	-0.6200|-0.6200	4|4	.|.	.|.	.|.	.|.	13.6655|13.6655	0.62393|0.62393	0.0:0.0:0.4796:0.5204|0.0:0.0:0.4796:0.5204	.|.	.|.	.|.	.|.	E|R	12|74	.|.	.|.	A|S	-|-	2|3	0|2	RAPGEF1|RAPGEF1	133487012|133487012	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.941000|0.941000	0.58515|0.58515	1.878000|1.878000	0.39608|0.39608	0.637000|0.637000	0.30526|0.30526	0.561000|0.561000	0.74099|0.74099	GCG|AGC			0.612	RAPGEF1-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000054759.2		NM_005312	
VSIG4	11326	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	65238810	65238810	+	IGR	SNP	C	C	G			TCGA-2G-AAGZ-01A-11D-A42Y-10	TCGA-2G-AAGZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9e36af2-c8cd-436c-9de1-408317d4f0a0	3de3355b-52d4-4275-a1e4-991e15876ae6	g.chrX:65238810C>G	ENST00000374737.4	-	0	1834				MIR223_ENST00000385204.1_RNA	NM_001257403.1|NM_007268.2	NP_001244332.1|NP_009199.1	Q9Y279	VSIG4_HUMAN	V-set and immunoglobulin domain containing 4						complement activation, alternative pathway (GO:0006957)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of T cell proliferation (GO:0042130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						AAGTGCGGCACATGCTTACCA	0.522																																					.													.	.			0			.												41.0	32.0	35.0					X																	65238810		1567	3580	5147	SO:0001628	intergenic_variant	407008	.			GCGGCACATGCTT	AJ132502	CCDS14383.1, CCDS48132.1, CCDS55435.1	Xq12-q13.3	2013-01-29			ENSG00000155659	ENSG00000155659		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17032	protein-coding gene	gene with protein product		300353				10899594, 11004523, 17016555, 17016562	Standard	NM_007268		Approved	Z39IG	uc004dwh.2	Q9Y279	OTTHUMG00000021727		X.37:g.65238810C>G			Somatic	168	0	0		WXS	Illumina HiSeq	.	166	0.17	28	.	1	0.00	0	Q6UXI4	RNA	SNP	ENST00000374737.4	37	CCDS14383.1																																																																																					0.522	VSIG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000056986.1		NM_007268	
