#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
AHDC1	27245	mdanderson.org	37	1	27875938	27875938	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr1:27875938G>T	ENST00000247087.5	-	5	3285	c.2689C>A	c.(2689-2691)Cca>Aca	p.P897T	AHDC1_ENST00000374011.2_Missense_Mutation_p.P897T			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	897							DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		ACTGCCACTGGGCTGGCCTTG	0.706																																					p.P897T													.	.			0			c.C2689A												19.0	24.0	22.0					1																	27875938		2196	4283	6479	SO:0001583	missense	27245	exon6			CCACTGGGCTGGC	AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.2689C>A	1.37:g.27875938G>T	ENSP00000247087:p.Pro897Thr		Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_001029882	48	0.00	0	Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Missense_Mutation	SNP	ENST00000247087.5	37	CCDS30652.1	.	.	.	.	.	.	.	.	.	.	G	12.72	2.021819	0.35701	.	.	ENSG00000126705	ENST00000247087;ENST00000374011	T;T	0.46451	0.87;0.87	5.77	5.77	0.91146	.	0.101167	0.39274	N	0.001403	T	0.43322	0.1242	N	0.14661	0.345	0.42385	D	0.992503	D	0.58268	0.982	P	0.60236	0.871	T	0.34900	-0.9810	10	0.38643	T	0.18	-7.5982	14.3783	0.66895	0.0:0.1481:0.8519:0.0	.	897	Q5TGY3	AHDC1_HUMAN	T	897	ENSP00000247087:P897T;ENSP00000363123:P897T	ENSP00000247087:P897T	P	-	1	0	AHDC1	27748525	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	2.047000	0.41269	2.723000	0.93209	0.655000	0.94253	CCA			0.706	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000009523.3			
EPHA10	284656	mdanderson.org	37	1	38227156	38227156	+	Silent	SNP	G	G	T	rs140939937	byFrequency	TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr1:38227156G>T	ENST00000373048.4	-	3	770	c.771C>A	c.(769-771)ggC>ggA	p.G257G	EPHA10_ENST00000427468.2_Silent_p.G257G|EPHA10_ENST00000319637.6_Silent_p.G257G	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	257					ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)			NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CGCCGTCGGCGCCGCAGTGCA	0.701																																					p.G257G													.	.			0			c.C771A												21.0	25.0	23.0					1																	38227156		2174	4233	6407	SO:0001819	synonymous_variant	284656	exon3			GTCGGCGCCGCAG	AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.771C>A	1.37:g.38227156G>T			Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	18	0.11	2	NM_173641	0		0	A4FU89|J3KPB5|Q6NW42	Silent	SNP	ENST00000373048.4	37	CCDS41305.1																																																																																					0.701	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000012497.2		NM_173641	
SEC22B	9554	broad.mit.edu	37	1	145109259	145109260	+	RNA	INS	-	-	A	rs61810755|rs11386827		TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr1:145109259_145109260insA	ENST00000453618.1	+	0	512							O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											cactccagcccgggggcagagc	0.48																																					.													.	.			0			.																																											9554	.			CCAGCCCGGGGGC	AF047442		1q21.1	2012-04-20	2010-03-12	2006-04-25	ENSG00000223380				10700	protein-coding gene	gene with protein product		604029	"""SEC22, vesicle trafficking protein (S. cerevisiae)-like 1"", ""SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)"", ""SEC22 vesicle trafficking protein homolog B (S. cerevisiae)"""	SEC22L1		9094723, 16354670	Standard	NM_004892		Approved	sec22b, ERS-24	uc031poa.1	O75396	OTTHUMG00000013745		1.37:g.145109259_145109260insA			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	7	0.29	2	.	0		0	A8K1G0	RNA	INS	ENST00000453618.1	37																																																																																						0.480	SEC22B-001	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000038523.5		NM_004892	
SKIDA1	387640	mdanderson.org	37	10	21805737	21805737	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr10:21805737G>T	ENST00000449193.2	-	4	3267	c.1015C>A	c.(1015-1017)Cac>Aac	p.H339N	SKIDA1_ENST00000444772.3_Missense_Mutation_p.H260N|SKIDA1_ENST00000487107.1_5'Flank	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	258	Glu-rich.|Ser-rich.					nucleus (GO:0005634)											tggtggtggtggtggtgCGGA	0.746																																					p.H339N													.	.			0			c.C1015A												3.0	5.0	4.0					10																	21805737		1604	3527	5131	SO:0001583	missense	387640	exon4			GGTGGTGGTGGTG	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1015C>A	10.37:g.21805737G>T	ENSP00000410041:p.His339Asn		Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	20	0.15	3	NM_207371	9	0.11	1	B1ANA5|Q6ZMX4|Q8N3C3	Missense_Mutation	SNP	ENST00000449193.2	37	CCDS44363.1	.	.	.	.	.	.	.	.	.	.	G	1.329	-0.597267	0.03771	.	.	ENSG00000180592	ENST00000449193;ENST00000444772	.	.	.	3.08	2.15	0.27550	.	0.953192	0.08636	U	0.916266	T	0.17109	0.0411	N	0.08118	0	0.23396	N	0.997765	B	0.29909	0.261	B	0.26416	0.069	T	0.26950	-1.0088	9	0.14252	T	0.57	.	7.6068	0.28107	0.1347:0.0:0.8653:0.0	.	339	E9PAX1	.	N	339;260	.	ENSP00000442432:H260N	H	-	1	0	C10orf140	21845743	1.000000	0.71417	0.984000	0.44739	0.666000	0.39218	4.350000	0.59392	0.383000	0.24910	0.400000	0.26472	CAC			0.746	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000286950.2		NM_207371	
PTCHD3	374308	broad.mit.edu	37	10	27702322	27702322	+	Silent	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr10:27702322G>T	ENST00000438700.3	-	1	975	c.858C>A	c.(856-858)ccC>ccA	p.P286P		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	286					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						GGTTGTAGGCGGGGAAGGAGA	0.627																																					p.P286P													.	PTCHD3	140		0			c.C858A												62.0	67.0	65.0					10																	27702322		2203	4300	6503	SO:0001819	synonymous_variant	374308	exon1			GTAGGCGGGGAAG	AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.858C>A	10.37:g.27702322G>T			Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	78	0.04	3	NM_001034842	0		0	I3L499|Q6ZU28	Silent	SNP	ENST00000438700.3	37	CCDS31173.1																																																																																					0.627	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047325.3		XM_370541	
BMS1	9790	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	43312871	43312871	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr10:43312871G>C	ENST00000374518.5	+	15	2572	c.2509G>C	c.(2509-2511)Gat>Cat	p.D837H		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	837					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						GGAGATGTTTGATGCAGAATA	0.383																																					p.D837H													.	.			0			c.G2509C												39.0	40.0	40.0					10																	43312871		2163	4122	6285	SO:0001583	missense	9790	exon15			ATGTTTGATGCAG	BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.2509G>C	10.37:g.43312871G>C	ENSP00000363642:p.Asp837His		Somatic	58	0	0		WXS	Illumina HiSeq	.	53	0.36	19	NM_014753	78	0.41	32	Q5QPT5|Q86XJ9	Missense_Mutation	SNP	ENST00000374518.5	37	CCDS7199.1	.	.	.	.	.	.	.	.	.	.	G	18.38	3.611254	0.66558	.	.	ENSG00000165733	ENST00000374518	T	0.18502	2.21	5.56	5.56	0.83823	Ribosome biogenesis protein BMS1/TSR1, C-terminal (1);	0.237331	0.49916	D	0.000122	T	0.42832	0.1220	M	0.81682	2.555	0.53688	D	0.999979	D	0.89917	1.0	D	0.97110	1.0	T	0.21759	-1.0236	10	0.41790	T	0.15	.	12.8905	0.58069	0.0742:0.0:0.9258:0.0	.	837	Q14692	BMS1_HUMAN	H	837	ENSP00000363642:D837H	ENSP00000363642:D837H	D	+	1	0	BMS1	42632877	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.603000	0.46266	2.638000	0.89438	0.552000	0.68991	GAT			0.383	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047690.2		NM_014753	
Unknown	0	bcgsc.ca	37	10	67008403	67008403	+	IGR	SNP	G	G	C			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr10:67008403G>C								RP11-179K3.2 (324127 upstream) : RP11-428G2.1 (65139 downstream)																							TGAGTTCCTGGATCTTCCCAC	0.443																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			TTCCTGGATCTTC																													10.37:g.67008403G>C			Somatic	60	0	0		WXS	Illumina HiSeq	Phase_1	47	0.43	20	.	0		0		RNA	SNP		37																																																																																					0	0.443										
MICU1	10367	mdanderson.org	37	10	74128106	74128106	+	Silent	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr10:74128106G>T	ENST00000361114.5	-	12	1374	c.1278C>A	c.(1276-1278)ggC>ggA	p.G426G	MICU1_ENST00000398761.4_Silent_p.G428G|MICU1_ENST00000398763.4_Silent_p.G228G|MICU1_ENST00000418483.2_Silent_p.G228G|MICU1_ENST00000401998.3_Silent_p.G426G	NM_001195518.1|NM_006077.3	NP_001182447.1|NP_006068.2	Q9BPX6	MICU1_HUMAN	mitochondrial calcium uptake 1	426	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				calcium ion import (GO:0070509)|calcium ion transmembrane import into mitochondrion (GO:0036444)|defense response (GO:0006952)|mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|protein homooligomerization (GO:0051260)	calcium channel complex (GO:0034704)|integral component of mitochondrial membrane (GO:0032592)|intracellular (GO:0005622)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										TGCTCAGTTCGCCATTGCCTA	0.458																																					p.G426G													.	.			0			c.C1278A												79.0	73.0	75.0					10																	74128106		1946	4135	6081	SO:0001819	synonymous_variant	10367	exon12			CAGTTCGCCATTG	Y17711	CCDS55714.1, CCDS55715.1	10q22.1	2013-01-10	2011-06-23	2011-06-23	ENSG00000107745	ENSG00000107745		"""EF-hand domain containing"""	1530	protein-coding gene	gene with protein product		605084	"""calcium binding atopy-related autoantigen 1"""	CBARA1		9806765, 20693986	Standard	NM_006077		Approved	CALC, EFHA3, FLJ12684	uc001jtb.2	Q9BPX6	OTTHUMG00000018437	ENST00000361114.5:c.1278C>A	10.37:g.74128106G>T			Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	58	0.05	3	NM_001195518	100	0.00	0	A8MV96|B3KN20|B4DJH9|B4DPI1|B5MBY3|D3YTJ3|O75785|Q9H9N6|Q9UFX0	Silent	SNP	ENST00000361114.5	37	CCDS55715.1																																																																																					0.458	MICU1-002	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000048586.1		NM_006077	
PDLIM1	9124	bcgsc.ca	37	10	97006973	97006973	+	Splice_Site	SNP	T	T	C			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr10:97006973T>C	ENST00000329399.6	-	5	792	c.684A>G	c.(682-684)aaA>aaG	p.K228K	PDLIM1_ENST00000477757.1_5'UTR	NM_020992.2	NP_066272.1	O00151	PDLI1_HUMAN	PDZ and LIM domain 1	228					regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(5)|lung(1)|ovary(1)|skin(2)	10		Colorectal(252;0.083)		Epithelial(162;1.64e-06)|all cancers(201;3.71e-05)		GCTGATTACCTTTTTCTTCAG	0.468											OREG0020387	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K228K													.	PDLIM1	33		0			c.A684G												145.0	143.0	144.0					10																	97006973		2203	4300	6503	SO:0001630	splice_region_variant	9124	exon5			ATTACCTTTTTCT	U90878	CCDS7441.1	10q23.1	2008-07-29	2008-07-29		ENSG00000107438	ENSG00000107438			2067	protein-coding gene	gene with protein product	"""carboxyl terminal LIM domain protein 1"", ""elfin"""	605900	"""PDZ and LIM domain 1 (elfin)"""	CLIM1		10861853	Standard	NM_020992		Approved	CLP-36, hCLIM1, CLP36	uc001kkh.4	O00151	OTTHUMG00000018810	ENST00000329399.6:c.685+1A>G	10.37:g.97006973T>C			Somatic	56	0	0	1325	WXS	Illumina HiSeq	Phase_1	64	0.06	4	NM_020992	279	0.00	0	B2RBS6|Q5VZH5|Q9BPZ9	Silent	SNP	ENST00000329399.6	37	CCDS7441.1																																																																																					0.468	PDLIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049508.1			Silent
WNT8B	7479	mdanderson.org	37	10	102242248	102242248	+	Missense_Mutation	SNP	G	G	T	rs143970308		TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr10:102242248G>T	ENST00000343737.5	+	6	859	c.731G>T	c.(730-732)cGg>cTg	p.R244L		NM_003393.3	NP_003384.2	Q93098	WNT8B_HUMAN	wingless-type MMTV integration site family, member 8B	244					cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|determination of dorsal identity (GO:0048263)|gastrulation (GO:0007369)|negative regulation of gene expression (GO:0010629)|nervous system development (GO:0007399)|neuron differentiation (GO:0030182)|positive regulation of gene expression (GO:0010628)|response to estradiol (GO:0032355)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(1)|large_intestine(1)|ovary(1)|skin(1)	4		Colorectal(252;0.117)		Epithelial(162;1.87e-10)|all cancers(201;1.64e-08)		ATCTCTACCCGGGAGCTGGTG	0.672											OREG0020440	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R244L													.	.			0			c.G731T												20.0	22.0	21.0					10																	102242248		2201	4298	6499	SO:0001583	missense	7479	exon6			CTACCCGGGAGCT	X91940	CCDS7494.1	10q24	2003-11-12			ENSG00000075290	ENSG00000075290		"""Wingless-type MMTV integration sites"""	12789	protein-coding gene	gene with protein product		601396				8661156	Standard	NM_003393		Approved		uc001krb.3	Q93098	OTTHUMG00000018912	ENST00000343737.5:c.731G>T	10.37:g.102242248G>T	ENSP00000340677:p.Arg244Leu		Somatic	13	0	0	1365	WXS	Illumina HiSeq	Phase_I	8	0.13	1	NM_003393	0		0	O00771|Q5VX55|Q8WYK9	Missense_Mutation	SNP	ENST00000343737.5	37	CCDS7494.1	.	.	.	.	.	.	.	.	.	.	G	15.11	2.736127	0.49045	.	.	ENSG00000075290	ENST00000343737	T	0.76186	-1.0	5.14	5.14	0.70334	.	0.051725	0.64402	D	0.000001	T	0.59945	0.2231	N	0.21240	0.645	0.42849	D	0.994072	B	0.21071	0.051	B	0.31191	0.125	T	0.56944	-0.7895	10	0.33141	T	0.24	.	6.7089	0.23266	0.2231:0.0:0.7769:0.0	.	244	Q93098	WNT8B_HUMAN	L	244	ENSP00000340677:R244L	ENSP00000340677:R244L	R	+	2	0	WNT8B	102232238	1.000000	0.71417	1.000000	0.80357	0.577000	0.36160	6.272000	0.72575	2.398000	0.81561	0.313000	0.20887	CGG			0.672	WNT8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049867.1		NM_003393	
FBXW4	6468	bcgsc.ca	37	10	103371159	103371159	+	Silent	SNP	C	C	T	rs542215742	byFrequency	TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr10:103371159C>T	ENST00000331272.7	-	9	1746	c.1128G>A	c.(1126-1128)ccG>ccA	p.P376P	FBXW4_ENST00000470093.1_5'UTR	NM_022039.3	NP_071322.1	P57775	FBXW4_HUMAN	F-box and WD repeat domain containing 4	376					cartilage development (GO:0051216)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|positive regulation of mesenchymal cell proliferation (GO:0002053)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)	ubiquitin ligase complex (GO:0000151)				breast(3)|endometrium(2)|large_intestine(4)|lung(4)|skin(1)|stomach(1)	15		Colorectal(252;0.123)		Epithelial(162;4.35e-08)|all cancers(201;1.92e-06)		TCGACGTCAGCGGGAAGGCCT	0.597													C|||	2	0.000399361	0.0015	0.0	5008	,	,		20643	0.0		0.0	False		,,,				2504	0.0				p.P376P													.	FBXW4	39		0			c.G1128A												67.0	60.0	63.0					10																	103371159		2203	4300	6503	SO:0001819	synonymous_variant	6468	exon9			CGTCAGCGGGAAG	AF281859	CCDS31271.1	10q24	2013-01-09	2007-02-08	2005-03-12	ENSG00000107829	ENSG00000107829		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	10847	protein-coding gene	gene with protein product		608071	"""split hand/foot malformation (ectrodactyly) type 3"", ""F-box and WD-40 domain protein 4"""	SHFM3		8723077, 7912888	Standard	XM_005270053		Approved	Fbw4, dactylin	uc001kto.3	P57775	OTTHUMG00000018938	ENST00000331272.7:c.1128G>A	10.37:g.103371159C>T			Somatic	68	0	0		WXS	Illumina HiSeq	Phase_1	55	0.07	4	NM_022039	186	0.00	0	Q5SVS1|Q96IM6	Silent	SNP	ENST00000331272.7	37	CCDS31271.1																																																																																					0.597	FBXW4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049979.2		NM_022039	
MUC2	4583	mdanderson.org	37	11	1093342	1093342	+	Missense_Mutation	SNP	C	C	A	rs55695633		TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr11:1093342C>A	ENST00000441003.2	+	30	5188	c.5161C>A	c.(5161-5163)Ccg>Acg	p.P1721T	MUC2_ENST00000333592.6_Missense_Mutation_p.P9T|MUC2_ENST00000359061.5_Missense_Mutation_p.P1688T|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	gaccccaaccccgacacccat	0.642																																					p.P1721T													MUC2_ENST00000441003,NS,carcinoma,-2,2	MUC2_ENST00000441003	-2	2	0			c.C5161A												234.0	273.0	260.0					11																	1093342		1973	3751	5724	SO:0001583	missense	4583	exon30			CCAACCCCGACAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5161C>A	11.37:g.1093342C>A	ENSP00000415183:p.Pro1721Thr		Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_002457	0		0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	5.758	0.324335	0.10900	.	.	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000333592	T;T;T	0.04917	3.53;3.69;3.76	1.4	0.392	0.16288	.	2.679550	0.04278	N	0.343350	T	0.06325	0.0163	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42832	-0.9428	9	0.87932	D	0	.	6.4437	0.21865	0.291:0.709:0.0:0.0	.	1721	E7EUV1	.	T	1721;1688;9	ENSP00000415183:P1721T;ENSP00000351956:P1688T;ENSP00000331373:P9T	ENSP00000331373:P9T	P	+	1	0	MUC2	1083342	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-2.316000	0.01123	-0.071000	0.12886	-1.119000	0.02030	CCG			0.642	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
TSSC2	650368	broad.mit.edu	37	11	3424836	3424836	+	RNA	SNP	G	G	T	rs558279755		TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr11:3424836G>T	ENST00000529482.1	+	0	845									tumor suppressing subtransferable candidate 2 pseudogene																		TTGAACAACTGACTCTTGATG	0.443													N|||	1	0.000199681	0.0	0.0	5008	,	,		17922	0.0		0.001	False		,,,				2504	0.0				.													.	.			0			.																																											0	.			ACAACTGACTCTT			11p15.4	2014-06-05	2008-06-30		ENSG00000223756	ENSG00000223756			12384	pseudogene	pseudogene	"""tumor-supressing STF cDNA 2"", ""asparagine-linked glycosylation 1 homolog (yeast, beta-1,4-mannosyltransferase) (ALG1) pseudogene"""	608999	"""tumor suppressing subtransferable candidate 2"""			9403053	Standard	NR_024248		Approved				OTTHUMG00000011705		11.37:g.3424836G>T			Somatic	375	0.0053333333	2		WXS	Illumina HiSeq	Phase_I	273	0.02	6	.	0		0		RNA	SNP	ENST00000529482.1	37																																																																																						0.443	TSSC2-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000392020.1			
PGAP2	27315	mdanderson.org	37	11	3845201	3845201	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr11:3845201C>T	ENST00000463452.2	+	3	337	c.254C>T	c.(253-255)tCg>tTg	p.S85L	PGAP2_ENST00000465307.2_Silent_p.L88L|PGAP2_ENST00000493547.2_Missense_Mutation_p.S85L|PGAP2_ENST00000300730.6_Missense_Mutation_p.S142L|PGAP2_ENST00000278243.4_Missense_Mutation_p.S146L|PGAP2_ENST00000532017.1_3'UTR|PGAP2_ENST00000479072.1_5'UTR|PGAP2_ENST00000496834.2_5'UTR|AC090587.2_ENST00000507938.1_RNA|PGAP2_ENST00000396991.2_Missense_Mutation_p.S146L|PGAP2_ENST00000396986.2_Missense_Mutation_p.S142L|PGAP2_ENST00000396993.4_Silent_p.L38L	NM_001256240.1	NP_001243169.1	Q9UHJ9	PGAP2_HUMAN	post-GPI attachment to proteins 2	85					GPI anchor biosynthetic process (GO:0006506)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|signal transduction in response to DNA damage (GO:0042770)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			NS(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|urinary_tract(1)	11						GGCCTGCACTCGGCGCCTCGC	0.642																																					p.S203L													.	.			0			c.C608T												101.0	94.0	96.0					11																	3845201		2201	4298	6499	SO:0001583	missense	27315	exon5			TGCACTCGGCGCC	AF159615	CCDS7747.1, CCDS44523.1, CCDS58112.1, CCDS58113.1, CCDS73244.1, CCDS73245.1	11p15.4	2014-01-31			ENSG00000148985	ENSG00000148985			17893	protein-coding gene	gene with protein product	"""FGF receptor activating protein 1"", ""cell wall biogenesis 43 N-terminal homolog (S. cerevisiae)"""	615187	"""mental retardation, non-syndromic, autosomal recessive, 21"""	MRT21		10585768, 16407401, 23561846	Standard	NM_014489		Approved	FRAG1, CWH43-N	uc010qxw.3	Q9UHJ9	OTTHUMG00000012238	ENST00000463452.2:c.254C>T	11.37:g.3845201C>T	ENSP00000435223:p.Ser85Leu		Somatic	67	0.0149253731	1		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_001256236	47	0.00	0	E9PJG5|H7BXL9|Q6UC77|Q96G66|Q9UF01|Q9Y4N1	Missense_Mutation	SNP	ENST00000463452.2	37	CCDS58112.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.2|22.2	4.257870|4.257870	0.80246|0.80246	.|.	.|.	ENSG00000148985|ENSG00000148985	ENST00000459679;ENST00000464906|ENST00000396986;ENST00000300730;ENST00000396991;ENST00000464261;ENST00000493547;ENST00000278243;ENST00000463452;ENST00000469307	.|T;T;T;T;T;T;T;T	.|0.40225	.|1.04;1.04;1.04;1.04;1.04;1.04;1.04;1.04	5.86|5.86	5.86|5.86	0.93980|0.93980	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.59418|0.59418	0.2192|0.2192	L|L	0.56769|0.56769	1.78|1.78	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D	.|0.97110	.|1.0;0.978;1.0;0.998;0.965	T|T	0.50136|0.50136	-0.8863|-0.8863	5|10	.|0.21540	.|T	.|0.41	-6.6468|-6.6468	15.6769|15.6769	0.77336|0.77336	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|142;85;146;85;85	.|A8MYS5;Q9UHJ9-3;Q9UHJ9;E9PJG5;Q9UHJ9-2	.|.;.;PGAP2_HUMAN;.;.	W|L	116;176|142;142;146;115;85;146;85;85	.|ENSP00000380183:S142L;ENSP00000300730:S142L;ENSP00000380188:S146L;ENSP00000434088:S115L;ENSP00000431851:S85L;ENSP00000278243:S146L;ENSP00000435223:S85L;ENSP00000434507:S85L	.|ENSP00000278243:S146L	R|S	+|+	1|2	2|0	PGAP2|PGAP2	3801777|3801777	1.000000|1.000000	0.71417|0.71417	0.974000|0.974000	0.42286|0.42286	0.942000|0.942000	0.58702|0.58702	6.983000|6.983000	0.76180|0.76180	2.766000|2.766000	0.95052|0.95052	0.655000|0.655000	0.94253|0.94253	CGG|TCG			0.642	PGAP2-049	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000383260.1			
ARHGAP1	392	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	46717282	46717282	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr11:46717282C>G	ENST00000311956.4	-	3	254	c.157G>C	c.(157-159)Gaa>Caa	p.E53Q		NM_004308.3	NP_004299.1	Q07960	RHG01_HUMAN	Rho GTPase activating protein 1	53					positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	Rac GTPase activator activity (GO:0030675)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	11		Lung NSC(402;1.76e-12)|all_lung(304;1.3e-11)		GBM - Glioblastoma multiforme(35;5.17e-06)|BRCA - Breast invasive adenocarcinoma(625;0.00112)|Lung(87;0.153)		GTGACAAGTTCCGGGGAGCTG	0.577																																					p.E53Q													.	.			0			c.G157C												116.0	101.0	106.0					11																	46717282		2153	4166	6319	SO:0001583	missense	392	exon3			CAAGTTCCGGGGA	BC018118	CCDS7922.1	11p11.2	2006-04-11			ENSG00000175220	ENSG00000175220		"""Rho GTPase activating proteins"""	673	protein-coding gene	gene with protein product		602732				8288572	Standard	NM_004308		Approved	RhoGAP, p50rhoGAP, CDC42GAP, Cdc42GAP	uc001ndd.4	Q07960	OTTHUMG00000166567	ENST00000311956.4:c.157G>C	11.37:g.46717282C>G	ENSP00000310491:p.Glu53Gln		Somatic	114	0	0		WXS	Illumina HiSeq	.	111	0.32	36	NM_004308	67	0.27	18	D3DQQ6	Missense_Mutation	SNP	ENST00000311956.4	37	CCDS7922.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.76|16.76	3.212642|3.212642	0.58452|0.58452	.|.	.|.	ENSG00000175220|ENSG00000175220	ENST00000311956;ENST00000443332;ENST00000525488|ENST00000528837	T;T|.	0.32023|.	2.22;1.47|.	5.02|5.02	5.02|5.02	0.67125|0.67125	.|.	0.718937|.	0.13297|.	N|.	0.398551|.	T|T	0.50377|0.50377	0.1612|0.1612	N|N	0.14661|0.14661	0.345|0.345	0.43313|0.43313	D|D	0.995326|0.995326	B;B|.	0.31730|.	0.337;0.037|.	B;B|.	0.26770|.	0.073;0.032|.	T|T	0.46884|0.46884	-0.9159|-0.9159	10|5	0.15952|.	T|.	0.53|.	.|.	18.347|18.347	0.90326|0.90326	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	53;53|.	B4DPZ4;Q07960|.	.;RHG01_HUMAN|.	Q|A	53|50	ENSP00000310491:E53Q;ENSP00000432794:E53Q|.	ENSP00000310491:E53Q|.	E|G	-|-	1|2	0|0	ARHGAP1|ARHGAP1	46673858|46673858	0.997000|0.997000	0.39634|0.39634	0.975000|0.975000	0.42487|0.42487	0.970000|0.970000	0.65996|0.65996	4.987000|4.987000	0.63857|0.63857	2.350000|2.350000	0.79820|0.79820	0.561000|0.561000	0.74099|0.74099	GAA|GGA			0.577	ARHGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390472.1		NM_004308	
TENM4	26011	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	78380844	78380844	+	Silent	SNP	C	C	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr11:78380844C>T	ENST00000278550.7	-	32	7008	c.6546G>A	c.(6544-6546)aaG>aaA	p.K2182K		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	2182					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										AGGGTCCTACCTTCAGCTCCT	0.522																																					p.K2182K													.	.			0			c.G6546A												93.0	100.0	97.0					11																	78380844		2119	4238	6357	SO:0001819	synonymous_variant	26011	exon32			TCCTACCTTCAGC	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.6546G>A	11.37:g.78380844C>T			Somatic	212	0	0		WXS	Illumina HiSeq	.	160	0.35	56	NM_001098816	16	0.63	10	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Silent	SNP	ENST00000278550.7	37	CCDS44688.1																																																																																					0.522	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000391406.2			
PICALM	8301	mdanderson.org	37	11	85701308	85701308	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr11:85701308G>T	ENST00000393346.3	-	13	1541	c.1393C>A	c.(1393-1395)Cat>Aat	p.H465N	PICALM_ENST00000528398.1_Intron|PICALM_ENST00000532317.1_Intron|PICALM_ENST00000526033.1_Missense_Mutation_p.H458N|PICALM_ENST00000356360.5_Missense_Mutation_p.H465N			Q13492	PICAL_HUMAN	phosphatidylinositol binding clathrin assembly protein	465					axonogenesis (GO:0007409)|cargo loading into vesicle (GO:0035459)|cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|hemopoiesis (GO:0030097)|iron ion homeostasis (GO:0055072)|iron ion import into cell (GO:0097459)|negative regulation of gene expression (GO:0010629)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of receptor-mediated endocytosis (GO:0048261)|positive regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902961)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of neuron death (GO:1901216)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902959)|regulation of endocytosis (GO:0030100)|regulation of protein localization (GO:0032880)|synaptic vesicle maturation (GO:0016188)|vesicle-mediated transport (GO:0016192)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neurofibrillary tangle (GO:0097418)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|vesicle (GO:0031982)	1-phosphatidylinositol binding (GO:0005545)|clathrin adaptor activity (GO:0035615)|clathrin binding (GO:0030276)|clathrin heavy chain binding (GO:0032050)			endometrium(1)|kidney(2)|large_intestine(2)|liver(1)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	19		Acute lymphoblastic leukemia(157;7.42e-07)|all_hematologic(158;0.00092)				AACATTTCATGAGTAGGTGTC	0.323			T	"""MLLT10, MLL"""	"""TALL, AML, """																																p.H465N				Dom	yes		11	11q14	8301	phosphatidylinositol binding clathrin assembly protein (CALM)		L	.	.			0			c.C1393A												121.0	121.0	121.0					11																	85701308		2203	4299	6502	SO:0001583	missense	8301	exon13			TTTCATGAGTAGG	BC048259	CCDS8272.1, CCDS31653.1, CCDS55783.1, CCDS55784.1	11q14	2008-02-01			ENSG00000073921	ENSG00000073921			15514	protein-coding gene	gene with protein product		603025				8643484	Standard	NM_001206947		Approved	CALM, CLTH	uc001pbm.3	Q13492	OTTHUMG00000166981	ENST00000393346.3:c.1393C>A	11.37:g.85701308G>T	ENSP00000377015:p.His465Asn		Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	36	0.08	3	NM_007166	13	0.00	0	B4DTM3|E9PN05|F8VPG7|O60700|Q4LE54|Q6GMQ6|Q86XZ9	Missense_Mutation	SNP	ENST00000393346.3	37	CCDS8272.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.42|11.42	1.633731|1.633731	0.29068|0.29068	.|.	.|.	ENSG00000073921|ENSG00000073921	ENST00000526033;ENST00000447890;ENST00000393346;ENST00000356360|ENST00000526961;ENST00000530542	T;T;T|.	0.36157|.	1.27;1.27;1.27|.	6.07|6.07	6.07|6.07	0.98685|0.98685	.|.	0.134111|.	0.49305|.	D|.	0.000144|.	T|.	0.69663|.	0.3136|.	L|L	0.44542|0.44542	1.39|1.39	0.50313|0.50313	D|D	0.999864|0.999864	D;P;P|.	0.57899|.	0.981;0.908;0.851|.	D;D;P|.	0.67900|.	0.954;0.922;0.838|.	T|.	0.62416|.	-0.6859|.	9|.	.|.	.|.	.|.	-10.0695|-10.0695	20.6593|20.6593	0.99626|0.99626	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	465;458;465|.	A8MX97;F8VPG7;Q13492|.	.;.;PICAL_HUMAN|.	N|X	458;465;465;465|73;167	ENSP00000433846:H458N;ENSP00000377015:H465N;ENSP00000348718:H465N|.	.|.	H|S	-|-	1|2	0|0	PICALM|PICALM	85378956|85378956	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.476000|9.476000	0.97823|0.97823	2.885000|2.885000	0.99019|0.99019	0.655000|0.655000	0.94253|0.94253	CAT|TCA			0.323	PICALM-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000392224.1		NM_007166	
FAT3	120114	hgsc.bcm.edu;mdanderson.org	37	11	92535075	92535075	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr11:92535075G>T	ENST00000298047.6	+	9	8913	c.8896G>T	c.(8896-8898)Gga>Tga	p.G2966*	FAT3_ENST00000409404.2_Splice_Site_p.G2966*|FAT3_ENST00000525166.1_Splice_Site_p.G2816*			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2966	Cadherin 27. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CCATATTACAGGTGAGTAAAT	0.498										TCGA Ovarian(4;0.039)																											p.G2966X													.	.			0			c.G8896T												42.0	43.0	43.0					11																	92535075		1929	4140	6069	SO:0001630	splice_region_variant	120114	exon9			ATTACAGGTGAGT	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.8896+1G>T	11.37:g.92535075G>T			Somatic	115	0	0		WXS	Illumina HiSeq	.	92	0.04	4	NM_001008781	0		0	B5MDB0|Q96AU6	Nonsense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	G	50	16.770059	0.99871	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	19.6287	0.95691	0.0:0.0:1.0:0.0	.	.	.	.	X	2966;2966;2816	.	ENSP00000298047:G2966X	G	+	1	0	FAT3	92174723	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	9.787000	0.99055	2.652000	0.90054	0.563000	0.77884	GGA			0.498	FAT3-201	KNOWN	basic	protein_coding	protein_coding				NM_001008781	Nonsense_Mutation
ELMOD1	55531	broad.mit.edu	37	11	107521086	107521086	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr11:107521086G>T	ENST00000265840.7	+	8	845	c.580G>T	c.(580-582)Gca>Tca	p.A194S	ELMOD1_ENST00000443271.2_Missense_Mutation_p.A194S|ELMOD1_ENST00000531234.1_Missense_Mutation_p.A188S	NM_018712.3	NP_061182.3	Q8N336	ELMD1_HUMAN	ELMO/CED-12 domain containing 1	194	ELMO. {ECO:0000255|PROSITE- ProRule:PRU00664}.				phagocytosis (GO:0006909)|positive regulation of GTPase activity (GO:0043547)	cytoskeleton (GO:0005856)	GTPase activator activity (GO:0005096)			endometrium(2)|large_intestine(5)|liver(2)|lung(7)|pancreas(2)|prostate(1)	19		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)		GGATGCCACAGCAGCTCAGCA	0.413																																					p.A194S													.	ELMOD1	40		0			c.G580T												50.0	53.0	52.0					11																	107521086		1968	4177	6145	SO:0001583	missense	55531	exon8			GCCACAGCAGCTC	AL359601	CCDS44723.1, CCDS44724.1	11q23.1	2012-10-15	2006-01-20		ENSG00000110675	ENSG00000110675			25334	protein-coding gene	gene with protein product		615456	"""ELMO domain containing 1"""			12477932	Standard	NM_018712		Approved	DKFZp547C176	uc010rvs.2	Q8N336	OTTHUMG00000166361	ENST00000265840.7:c.580G>T	11.37:g.107521086G>T	ENSP00000265840:p.Ala194Ser		Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	66	0.05	3	NM_018712	2	0.00	0	B4E167|G5E9S5|Q9NPW3	Missense_Mutation	SNP	ENST00000265840.7	37	CCDS44723.1	.	.	.	.	.	.	.	.	.	.	G	10.94	1.493858	0.26774	.	.	ENSG00000110675	ENST00000531234;ENST00000265840;ENST00000443271	T;T;T	0.30714	1.52;1.52;1.52	5.31	4.2	0.49525	Engulfment/cell motility, ELMO (2);	0.556881	0.20382	N	0.093429	T	0.14442	0.0349	N	0.12611	0.24	0.22489	N	0.999057	B;B	0.06786	0.0;0.001	B;B	0.10450	0.005;0.003	T	0.22941	-1.0202	10	0.09338	T	0.73	.	8.6493	0.34025	0.1316:0.0:0.73:0.1384	.	194;194	Q8N336;G5E9S5	ELMD1_HUMAN;.	S	188;194;194	ENSP00000433232:A188S;ENSP00000265840:A194S;ENSP00000412257:A194S	ENSP00000265840:A194S	A	+	1	0	ELMOD1	107026296	0.037000	0.19845	0.974000	0.42286	0.978000	0.69477	0.721000	0.25911	2.477000	0.83638	0.563000	0.77884	GCA			0.413	ELMOD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000389406.1		NM_018712	
FAM118B	79607	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	126126463	126126463	+	Splice_Site	SNP	G	G	C			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr11:126126463G>C	ENST00000533050.1	+	7	1191	c.698G>C	c.(697-699)aGa>aCa	p.R233T	FAM118B_ENST00000360194.4_Splice_Site_p.R233T|FAM118B_ENST00000529731.1_Splice_Site_p.R157T	NM_024556.3	NP_078832.1	Q9BPY3	F118B_HUMAN	family with sequence similarity 118, member B	233										breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(1)	13	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00948)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0784)		TCCTTCCAGAGAGAAATTCAG	0.448																																					p.R233T													.	.			0			c.G698C												49.0	49.0	49.0					11																	126126463		2201	4299	6500	SO:0001630	splice_region_variant	79607	exon7			TCCAGAGAGAAAT	BC001340	CCDS8470.1	11q24.2	2014-03-13				ENSG00000197798			26110	protein-coding gene	gene with protein product						24569877	Standard	NM_024556		Approved	FLJ21103	uc001qdf.3	Q9BPY3		ENST00000533050.1:c.697-1G>C	11.37:g.126126463G>C			Somatic	53	0	0		WXS	Illumina HiSeq	.	47	0.36	17	NM_024556	41	0.51	21	Q9H7B0	Missense_Mutation	SNP	ENST00000533050.1	37	CCDS8470.1	.	.	.	.	.	.	.	.	.	.	G	16.72	3.200836	0.58234	.	.	ENSG00000197798	ENST00000533050;ENST00000528985;ENST00000529731;ENST00000360194;ENST00000525338	T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.32704	0.0838	N	0.08118	0	0.80722	D	1	D;P;P	0.57899	0.981;0.901;0.948	D;P;P	0.66351	0.943;0.537;0.765	T	0.14282	-1.0478	10	0.12103	T	0.63	-14.7296	18.5746	0.91150	0.0:0.0:1.0:0.0	.	157;233;233	G3V179;E9PMJ2;Q9BPY3	.;.;F118B_HUMAN	T	233;233;157;233;157	ENSP00000433343:R233T;ENSP00000434952:R233T;ENSP00000432712:R157T;ENSP00000353321:R233T;ENSP00000435754:R157T	ENSP00000353321:R233T	R	+	2	0	FAM118B	125631673	1.000000	0.71417	1.000000	0.80357	0.268000	0.26511	5.945000	0.70226	2.606000	0.88127	0.491000	0.48974	AGA			0.448	FAM118B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000386346.1		NM_024556	Missense_Mutation
GPR162	27239	broad.mit.edu	37	12	6933730	6933730	+	Silent	SNP	T	T	G			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr12:6933730T>G	ENST00000311268.3	+	2	1453	c.666T>G	c.(664-666)ggT>ggG	p.G222G	GPR162_ENST00000428545.2_Intron|GPR162_ENST00000382315.3_Intron	NM_019858.1	NP_062832.1	Q16538	GP162_HUMAN	G protein-coupled receptor 162	222						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(1)	18						TGGGGGGTGGTGGGGGGACCA	0.677																																					p.G222G													.	GPR162	55		0			c.T666G												25.0	31.0	29.0					12																	6933730		2202	4298	6500	SO:0001819	synonymous_variant	27239	exon2			GGGTGGTGGGGGG	U47928, U47929, U47924, U47925	CCDS8563.1, CCDS44819.1	12p13	2012-08-21						"""GPCR / Class A : Orphans"""	16693	protein-coding gene	gene with protein product						15777626	Standard	NM_014449		Approved	A-2, GRCA	uc001qqw.1	Q16538		ENST00000311268.3:c.666T>G	12.37:g.6933730T>G			Somatic	55	0.1272727273	7		WXS	Illumina HiSeq	Phase_I	189	0.14	26	NM_019858	0		0	Q16664|Q59EH5|Q66K56	Silent	SNP	ENST00000311268.3	37	CCDS8563.1																																																																																					0.677	GPR162-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000399478.1		NM_019858	
GYS2	2998	broad.mit.edu	37	12	21690032	21690032	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr12:21690032G>T	ENST00000261195.2	-	16	2222	c.1968C>A	c.(1966-1968)agC>agA	p.S656R		NM_021957.3	NP_068776.2	P54840	GYS2_HUMAN	glycogen synthase 2 (liver)	656					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|ectoplasm (GO:0043265)	glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein homodimerization activity (GO:0042803)			NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(14)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						CCACATCACTGCTCTGAGGAC	0.473																																					p.S656R	Colon(149;9 1820 3690 10544 50424)												GYS2,NS,carcinoma,0,1	GYS2	110	1	0			c.C1968A												151.0	111.0	124.0					12																	21690032		2203	4300	6503	SO:0001583	missense	2998	exon16			ATCACTGCTCTGA		CCDS8690.1	12p12.2-p11.2	2013-02-22			ENSG00000111713	ENSG00000111713	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4707	protein-coding gene	gene with protein product		138571					Standard	NM_021957		Approved		uc001rfb.3	P54840	OTTHUMG00000169135	ENST00000261195.2:c.1968C>A	12.37:g.21690032G>T	ENSP00000261195:p.Ser656Arg		Somatic	392	0.0025510204	1		WXS	Illumina HiSeq	Phase_I	978	0.01	7	NM_021957	0		0	A0AVD8	Missense_Mutation	SNP	ENST00000261195.2	37	CCDS8690.1	.	.	.	.	.	.	.	.	.	.	G	15.59	2.877583	0.51801	.	.	ENSG00000111713	ENST00000261195	T	0.63913	-0.07	4.93	4.93	0.64822	.	0.323074	0.37393	N	0.002106	T	0.51873	0.1700	L	0.38175	1.15	0.30811	N	0.738831	B	0.19935	0.04	B	0.25614	0.062	T	0.49670	-0.8915	10	0.19590	T	0.45	-15.9331	14.14	0.65313	0.0:0.0:0.7873:0.2127	.	656	P54840	GYS2_HUMAN	R	656	ENSP00000261195:S656R	ENSP00000261195:S656R	S	-	3	2	GYS2	21581299	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.957000	0.40392	2.539000	0.85634	0.655000	0.94253	AGC			0.473	GYS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000402396.1		NM_021957	
FGD4	121512	broad.mit.edu	37	12	32764204	32764204	+	Missense_Mutation	SNP	G	G	T	rs281865063		TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr12:32764204G>T	ENST00000427716.2	+	10	1749	c.1325G>T	c.(1324-1326)cGc>cTc	p.R442L	FGD4_ENST00000534526.2_Missense_Mutation_p.R579L|FGD4_ENST00000546442.1_Missense_Mutation_p.R349L|FGD4_ENST00000525053.1_Missense_Mutation_p.R554L|FGD4_ENST00000531134.1_Missense_Mutation_p.R527L|FGD4_ENST00000266482.3_Missense_Mutation_p.R194L|FGD4_ENST00000381025.3_Missense_Mutation_p.R194L	NM_139241.2	NP_640334.2	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	442	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|microspike assembly (GO:0030035)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	27	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					GCACAAGAACGCTACCTTTTC	0.398																																					p.R442L													FGD4,NS,carcinoma,0,1	FGD4	86	1	0			c.G1325T												84.0	86.0	86.0					12																	32764204		2203	4300	6503	SO:0001583	missense	121512	exon10			AAGAACGCTACCT	AK057294	CCDS8727.1	12p11.1	2014-09-17	2004-08-24		ENSG00000139132	ENSG00000139132		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19125	protein-coding gene	gene with protein product		611104	"""FGD1 family, member 4"""			11527409	Standard	NM_139241		Approved	FRABP, frabin, ZFYVE6, CMT4H	uc001rkz.3	Q96M96	OTTHUMG00000137374	ENST00000427716.2:c.1325G>T	12.37:g.32764204G>T	ENSP00000394487:p.Arg442Leu		Somatic	107	0	0		WXS	Illumina HiSeq	Phase_I	272	0.01	4	NM_139241	5	0.00	0	Q6ULS2|Q8TCP6	Missense_Mutation	SNP	ENST00000427716.2	37	CCDS8727.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.012108	0.93346	.	.	ENSG00000139132	ENST00000534526;ENST00000531134;ENST00000427716;ENST00000266482;ENST00000546442;ENST00000525053;ENST00000381025	D;D;D;D;D;D;D	0.91945	-2.94;-2.94;-2.94;-2.94;-2.94;-2.94;-2.94	5.51	5.51	0.81932	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.52532	D	0.000073	D	0.96947	0.9003	M	0.90542	3.125	0.80722	D	1	D;D;D;D	0.89917	0.99;0.99;1.0;0.998	D;D;D;D	0.83275	0.939;0.939;0.996;0.963	D	0.97128	0.9816	10	0.59425	D	0.04	-10.9254	19.4328	0.94778	0.0:0.0:1.0:0.0	.	554;527;442;194	E9PJX4;B7Z493;Q96M96;G3XA97	.;.;FGD4_HUMAN;.	L	579;527;442;194;349;554;194	ENSP00000449273:R579L;ENSP00000431323:R527L;ENSP00000394487:R442L;ENSP00000266482:R194L;ENSP00000446695:R349L;ENSP00000433666:R554L;ENSP00000370413:R194L	ENSP00000266482:R194L	R	+	2	0	FGD4	32655471	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.611000	0.98342	2.584000	0.87258	0.563000	0.77884	CGC			0.398	FGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268017.1		NM_139241	
CPSF6	11052	broad.mit.edu	37	12	69646900	69646900	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr12:69646900delT	ENST00000435070.2	+	3	450	c.340delT	c.(340-342)tttfs	p.F115fs	CPSF6_ENST00000456847.3_Frame_Shift_Del_p.F115fs|CPSF6_ENST00000266679.8_Frame_Shift_Del_p.F115fs|CPSF6_ENST00000551516.1_Intron|CPSF6_ENST00000550987.1_3'UTR	NM_007007.2	NP_008938.2	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6, 68kDa	115	Necessary for interaction with NUDT21/CPSF5.|RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA polyadenylation (GO:0006378)|mRNA processing (GO:0006397)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(7)|lung(8)	16	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)			GGAGATAAAATTTTTTGAAAA	0.328																																					p.F114fs													.	CPSF6	96		0			c.340delT												60.0	65.0	63.0					12																	69646900		2203	4299	6502	SO:0001589	frameshift_variant	11052	exon3			ATAAAATTTTTTG	X67336	CCDS8988.1, CCDS73494.1	12q15	2013-06-18	2002-08-29			ENSG00000111605		"""RNA binding motif (RRM) containing"""	13871	protein-coding gene	gene with protein product	"""cleavage factor Im complex 68 kDa subunit"""	604979	"""cleavage and polyadenylation specific factor 6, 68kD subunit"""			9659921, 17267687	Standard	NM_007007		Approved	CFIM, HPBRII-4, HPBRII-7, CFIM68	uc001sut.4	Q16630		ENST00000435070.2:c.340delT	12.37:g.69646900delT	ENSP00000391774:p.Phe115fs		Somatic	513	0	0		WXS	Illumina HiSeq	Phase_I	2833	0.00	7	NM_007007	70	0.00	0	A8K7K9|Q53ES1|Q9BSJ7|Q9BW18	Frame_Shift_Del	DEL	ENST00000435070.2	37	CCDS8988.1																																																																																					0.328	CPSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000403609.1		NM_007007	
MED13L	23389	hgsc.bcm.edu	37	12	116586420	116586420	+	Intron	SNP	A	A	C			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr12:116586420A>C	ENST00000281928.3	-	3	517				MIR620_ENST00000385232.1_RNA|MED13L_ENST00000551197.1_Intron	NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like							mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		atatctatatatatatatata	0.259																																					.													.	.			0			.												7.0	6.0	6.0					12																	116586420		1281	2963	4244	SO:0001627	intron_variant	693205	.			CTATATATATATA	AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.311-37103T>G	12.37:g.116586420A>C			Somatic	365	0	0		WXS	Illumina HiSeq	.	422	0.06	26	.	0		0	A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	RNA	SNP	ENST00000281928.3	37	CCDS9177.1																																																																																					0.259	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000403879.3			
NCOR2	9612	broad.mit.edu	37	12	124887093	124887093	+	Silent	SNP	C	C	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr12:124887093C>T	ENST00000405201.1	-	14	1497	c.1497G>A	c.(1495-1497)caG>caA	p.Q499Q	NCOR2_ENST00000397355.1_Silent_p.Q499Q|NCOR2_ENST00000356219.3_Silent_p.Q499Q|NCOR2_ENST00000404621.1_Silent_p.Q498Q|NCOR2_ENST00000429285.2_Silent_p.Q498Q|NCOR2_ENST00000404121.2_Silent_p.Q69Q			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	499	Poly-Gln.				cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)	p.Q499Q(9)		breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		gctgctgctgctgttgttgct	0.617																																					p.Q499Q													NCOR2_ENST00000405201,NS,carcinoma,0,11	NCOR2	475	11	9	Substitution - coding silent(9)	endometrium(4)|large_intestine(3)|kidney(2)	c.G1497A												9.0	10.0	10.0					12																	124887093		2051	4183	6234	SO:0001819	synonymous_variant	9612	exon16			CTGCTGCTGTTGT	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1497G>A	12.37:g.124887093C>T			Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	63	0.05	3	NM_006312	39	0.00	0	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Silent	SNP	ENST00000405201.1	37	CCDS41858.2																																																																																					0.617	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000318173.2		NM_006312	
STOML3	161003	mdanderson.org	37	13	39542579	39542579	+	Silent	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr13:39542579G>T	ENST00000379631.4	-	6	953	c.609C>A	c.(607-609)tcC>tcA	p.S203S	STOML3_ENST00000423210.1_Silent_p.S194S	NM_145286.2	NP_660329.1	Q8TAV4	STML3_HUMAN	stomatin (EPB72)-like 3	203					signal transduction (GO:0007165)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)				breast(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	11		Lung NSC(96;1.42e-05)|Prostate(109;0.00851)|Breast(139;0.0199)|Lung SC(185;0.0743)		all cancers(112;2.93e-08)|Epithelial(112;3.64e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00107)|BRCA - Breast invasive adenocarcinoma(63;0.00349)|GBM - Glioblastoma multiforme(144;0.0137)		CGGCTGCCATGGATCTCTGCA	0.562																																					p.S203S													.	.			0			c.C609A												104.0	98.0	100.0					13																	39542579		2203	4300	6503	SO:0001819	synonymous_variant	161003	exon6			TGCCATGGATCTC	BC025760	CCDS9367.1, CCDS45040.1	13q13.2	2004-03-05			ENSG00000133115	ENSG00000133115			19420	protein-coding gene	gene with protein product		608327				12122055	Standard	NM_145286		Approved	SRO, Epb7.2l	uc001uwx.3	Q8TAV4	OTTHUMG00000016763	ENST00000379631.4:c.609C>A	13.37:g.39542579G>T			Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_145286	1	0.00	0	B4E285|Q5JS35	Silent	SNP	ENST00000379631.4	37	CCDS9367.1																																																																																					0.562	STOML3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000044604.2			
TPTE2P2	644623	broad.mit.edu	37	13	52855307	52855308	+	RNA	DEL	GC	GC	-	rs8001092|rs142640757|rs57152321		TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	GC	GC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr13:52855307_52855308delGC	ENST00000451298.1	-	0	333																											gtgtgtgtgtgcgcgcgcatgc	0.465																																					.													.	.			0			.																																											0	.			GTGTGTGCGCGCG																													13.37:g.52855313_52855314delGC			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	7	0.43	3	.	0		0		RNA	DEL	ENST00000451298.1	37																																																																																						0.465	RP11-248G5.8-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript		OTTHUMT00000471093.1			
HERC2	8924	broad.mit.edu	37	15	28483779	28483779	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr15:28483779C>A	ENST00000261609.7	-	24	3825	c.3717G>T	c.(3715-3717)caG>caT	p.Q1239H		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		ACGACTGTGTCTGGAAGTCCT	0.368																																					p.Q1239H													.	HERC2	501		0			c.G3717T												58.0	54.0	56.0					15																	28483779		2203	4298	6501	SO:0001583	missense	8924	exon24			CTGTGTCTGGAAG	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.3717G>T	15.37:g.28483779C>A	ENSP00000261609:p.Gln1239His		Somatic	465	0	0		WXS	Illumina HiSeq	Phase_I	530	0.01	7	NM_004667	3	0.00	0		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	C	18.57	3.652274	0.67472	.	.	ENSG00000128731	ENST00000261609	T	0.80033	-1.33	5.7	5.7	0.88788	Cytochrome b5 (4);	0.000000	0.85682	D	0.000000	T	0.77545	0.4146	M	0.62723	1.935	0.80722	D	1	B	0.25007	0.116	B	0.24974	0.057	T	0.75348	-0.3349	10	0.59425	D	0.04	.	10.8774	0.46919	0.0:0.8863:0.0:0.1137	.	1239	O95714	HERC2_HUMAN	H	1239	ENSP00000261609:Q1239H	ENSP00000261609:Q1239H	Q	-	3	2	HERC2	26157374	1.000000	0.71417	1.000000	0.80357	0.760000	0.43138	2.108000	0.41854	2.704000	0.92352	0.650000	0.86243	CAG			0.368	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251358.2		NM_004667	
NEIL1	79661	ucsc.edu	37	15	75646086	75646086	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr15:75646086A>G	ENST00000564784.1	+	7	1354	c.725A>G	c.(724-726)aAa>aGa	p.K242R	MIR631_ENST00000384904.1_RNA|NEIL1_ENST00000569035.1_Missense_Mutation_p.K242R|RP11-817O13.6_ENST00000563660.1_lincRNA|NEIL1_ENST00000355059.4_Missense_Mutation_p.K242R			Q96FI4	NEIL1_HUMAN	nei endonuclease VIII-like 1 (E. coli)	242			K -> R (in RNA edited version).		base-excision repair (GO:0006284)|negative regulation of nuclease activity (GO:0032074)|nucleotide-excision repair (GO:0006289)|response to oxidative stress (GO:0006979)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|hydrolase activity, acting on glycosyl bonds (GO:0016798)|protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|large_intestine(4)|lung(4)|ovary(1)	13						ACAGGGGGCAAAGGCTACGGG	0.632								Base excision repair (BER), DNA glycosylases																													p.K328R													.	NEIL1	36		0			c.A983G												78.0	77.0	77.0					15																	75646086		2197	4294	6491	SO:0001583	missense	79661	exon6			GGGGCAAAGGCTA	AK026055	CCDS10278.1	15q33.33	2008-07-18			ENSG00000140398	ENSG00000140398			18448	protein-coding gene	gene with protein product		608844				11904416	Standard	NM_024608		Approved	FLJ22402, hFPG1, NEI1, FPG1	uc002bae.4	Q96FI4	OTTHUMG00000142821	ENST00000564784.1:c.725A>G	15.37:g.75646086A>G	ENSP00000457352:p.Lys242Arg		Somatic	83	0	0		RNA-Seq	Illumina HiSeq		82	0.02	2	NM_001256552	13	0.77	10	D3DW75|Q6ZRA7|Q86XW7|Q9H6C3	Missense_Mutation	SNP	ENST00000564784.1	37	CCDS10278.1	.	.	.	.	.	.	.	.	.	.	A	16.54	3.151899	0.57151	.	.	ENSG00000140398	ENST00000355059	T	0.13901	2.55	5.15	5.15	0.70609	Ribosomal protein S13-like, H2TH (1);	0.089658	0.85682	D	0.000000	T	0.14657	0.0354	L	0.55481	1.735	0.46823	D	0.99921	B	0.19445	0.036	B	0.15870	0.014	T	0.05305	-1.0893	10	0.19147	T	0.46	-15.0349	14.1437	0.65336	1.0:0.0:0.0:0.0	.	242	Q96FI4	NEIL1_HUMAN	R	242	ENSP00000347170:K242R	ENSP00000347170:K242R	K	+	2	0	NEIL1	73433139	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	6.112000	0.71547	1.947000	0.56498	0.459000	0.35465	AAA			0.632	NEIL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000419885.1	rescued with RNA-seq	NM_024608	
CAPN15	6650	mdanderson.org	37	16	602443	602443	+	Missense_Mutation	SNP	G	G	A	rs148952789		TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr16:602443G>A	ENST00000219611.2	+	11	3013	c.2650G>A	c.(2650-2652)Gtc>Atc	p.V884I	LA16c-366D1.3_ENST00000565879.1_RNA	NM_005632.2	NP_005623.1	O75808	CAN15_HUMAN	calpain 15	884					proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										CAGCTGCGACGTCATGCTGGA	0.711																																					p.V884I													.	.			0			c.G2650A							G	ILE/VAL	0,4342		0,0,2171	22.0	28.0	26.0		2650	5.5	1.0	16	dbSNP_134	26	3,8565		0,3,4281	no	missense	SOLH	NM_005632.2	29	0,3,6452	AA,AG,GG		0.035,0.0,0.0232	possibly-damaging	884/1087	602443	3,12907	2171	4284	6455	SO:0001583	missense	6650	exon11			TGCGACGTCATGC	U85647	CCDS10410.1	16p13.3	2013-06-27	2013-06-27	2013-06-27	ENSG00000103326	ENSG00000103326			11182	protein-coding gene	gene with protein product		603267	"""small optic lobes (Drosophila) homolog"", ""small optic lobes homolog (Drosophila)"""	SOLH		9722942	Standard	NM_005632		Approved		uc002chi.3	O75808	OTTHUMG00000119059	ENST00000219611.2:c.2650G>A	16.37:g.602443G>A	ENSP00000219611:p.Val884Ile		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_005632	34	0.00	0	B1B1M4|Q2KHS2|Q8WTY9|Q9BUW0	Missense_Mutation	SNP	ENST00000219611.2	37	CCDS10410.1	.	.	.	.	.	.	.	.	.	.	g	17.79	3.475442	0.63737	0.0	3.5E-4	ENSG00000103326	ENST00000219611	D	0.89196	-2.48	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	D	0.92211	0.7530	L	0.54323	1.7	0.50467	D	0.99987	D	0.76494	0.999	D	0.75020	0.985	D	0.88888	0.3344	10	0.13853	T	0.58	.	17.9079	0.88925	0.0:0.0:1.0:0.0	.	884	O75808	CAN15_HUMAN	I	884	ENSP00000219611:V884I	ENSP00000219611:V884I	V	+	1	0	SOLH	542444	1.000000	0.71417	0.990000	0.47175	0.924000	0.55760	6.408000	0.73285	2.580000	0.87095	0.556000	0.70494	GTC	0		0.711	CAPN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000239271.1		NM_005632	
UBN1	29855	mdanderson.org	37	16	4924755	4924755	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr16:4924755A>G	ENST00000396658.4	+	14	3047	c.2344A>G	c.(2344-2346)Aag>Gag	p.K782E	UBN1_ENST00000590769.1_Missense_Mutation_p.K782E|UBN1_ENST00000262376.6_Missense_Mutation_p.K782E|UBN1_ENST00000545171.1_Missense_Mutation_p.K782E	NM_016936.3	NP_058632.2	Q9NPG3	UBN1_HUMAN	ubinuclein 1	782					chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of phosphatase activity (GO:0010923)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(6)|kidney(4)|large_intestine(10)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38						GTCCAAAGCTAAGCACCACAG	0.567																																					p.K782E													.	.			0			c.A2344G												68.0	72.0	71.0					16																	4924755		2197	4300	6497	SO:0001583	missense	29855	exon15			AAAGCTAAGCACC	AF108460	CCDS10525.1, CCDS73822.1	16p13.3	2010-11-09			ENSG00000118900	ENSG00000118900			12506	protein-coding gene	gene with protein product		609771				10725330	Standard	XM_005255277		Approved		uc002cyb.3	Q9NPG3	OTTHUMG00000129531	ENST00000396658.4:c.2344A>G	16.37:g.4924755A>G	ENSP00000379894:p.Lys782Glu		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_001079514	25	0.00	0	B7Z6D3|D3DUE8|Q13079|Q9P1P7	Missense_Mutation	SNP	ENST00000396658.4	37	CCDS10525.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.974369	0.74246	.	.	ENSG00000118900	ENST00000262376;ENST00000545171;ENST00000396658	T;T;T	0.39229	1.09;1.09;1.09	4.92	4.92	0.64577	.	0.000000	0.64402	D	0.000011	T	0.48040	0.1478	L	0.32530	0.975	0.35992	D	0.836803	D;D	0.67145	0.996;0.995	D;D	0.77004	0.987;0.989	T	0.45264	-0.9273	10	0.08381	T	0.77	-16.1182	13.2946	0.60290	1.0:0.0:0.0:0.0	.	782;782	Q9NPG3-2;Q9NPG3	.;UBN1_HUMAN	E	782	ENSP00000262376:K782E;ENSP00000442379:K782E;ENSP00000379894:K782E	ENSP00000262376:K782E	K	+	1	0	UBN1	4864756	1.000000	0.71417	0.966000	0.40874	0.891000	0.51852	6.212000	0.72188	2.079000	0.62486	0.379000	0.24179	AAG			0.567	UBN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251719.1		NM_016936	
CDR2	1039	broad.mit.edu	37	16	22359014	22359014	+	Silent	SNP	G	G	T	rs372632705		TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr16:22359014G>T	ENST00000268383.2	-	5	944	c.637C>A	c.(637-639)Cgg>Agg	p.R213R		NM_001802.1	NP_001793.1	Q01850	CDR2_HUMAN	cerebellar degeneration-related protein 2, 62kDa	213						cytoplasm (GO:0005737)				endometrium(3)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	11				GBM - Glioblastoma multiforme(48;0.0188)		CGCTTCTGCCGCTCCAGGCTC	0.542																																					p.R213R													.	CDR2	34		0			c.C637A												141.0	137.0	139.0					16																	22359014		2197	4300	6497	SO:0001819	synonymous_variant	1039	exon5			TCTGCCGCTCCAG	M63256	CCDS32404.1	16p13.1-p12	2008-02-05	2002-08-29			ENSG00000140743			1799	protein-coding gene	gene with protein product	"""Yo paraneoplastic antigen"""	117340	"""cerebellar degeneration-related protein (62kD)"""			2014264	Standard	NM_001802		Approved	CDR62, Yo	uc002dkn.3	Q01850		ENST00000268383.2:c.637C>A	16.37:g.22359014G>T			Somatic	122	0	0		WXS	Illumina HiSeq	Phase_I	128	0.02	3	NM_001802	73	0.00	0	A8K8A8|Q13977	Silent	SNP	ENST00000268383.2	37	CCDS32404.1																																																																																					0.542	CDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000430081.1			
ZNF629	23361	mdanderson.org	37	16	30793488	30793488	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr16:30793488G>T	ENST00000262525.4	-	3	2368	c.2161C>A	c.(2161-2163)Caa>Aaa	p.Q721K	RP11-2C24.6_ENST00000575562.1_RNA	NM_001080417.1	NP_001073886.1	Q9UEG4	ZN629_HUMAN	zinc finger protein 629	721					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(3)|urinary_tract(1)	22			Colorectal(24;0.198)			CCAAAGCTTTGTTTGCATTCA	0.542																																					p.Q721K													.	.			0			c.C2161A												45.0	47.0	46.0					16																	30793488		1917	4124	6041	SO:0001583	missense	23361	exon3			AGCTTTGTTTGCA	AB002324	CCDS45463.1	16p11.2	2013-01-08				ENSG00000102870		"""Zinc fingers, C2H2-type"""	29008	protein-coding gene	gene with protein product			"""zinc finger protein 65"""	ZNF65		9205841	Standard	NM_001080417		Approved	KIAA0326	uc002dzs.1	Q9UEG4		ENST00000262525.4:c.2161C>A	16.37:g.30793488G>T	ENSP00000262525:p.Gln721Lys		Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	56	0.07	4	NM_001080417	29	0.00	0	Q15938	Missense_Mutation	SNP	ENST00000262525.4	37	CCDS45463.1	.	.	.	.	.	.	.	.	.	.	G	0.011	-1.710075	0.00712	.	.	ENSG00000102870	ENST00000262525	T	0.35973	1.28	5.65	3.37	0.38596	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.141866	0.32081	N	0.006611	T	0.08447	0.0210	N	0.00621	-1.32	0.22330	N	0.99919	B	0.02656	0.0	B	0.01281	0.0	T	0.37731	-0.9693	10	0.02654	T	1	-6.6998	5.9927	0.19476	0.0:0.1493:0.1429:0.7078	.	721	Q9UEG4	ZN629_HUMAN	K	721	ENSP00000262525:Q721K	ENSP00000262525:Q721K	Q	-	1	0	ZNF629	30700989	0.077000	0.21312	1.000000	0.80357	0.907000	0.53573	-0.014000	0.12656	0.424000	0.26061	-1.492000	0.00969	CAA			0.542	ZNF629-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000434291.1		NM_015309	
CES2	8824	broad.mit.edu	37	16	66974255	66974255	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr16:66974255T>C	ENST00000317091.4	+	4	1730	c.746T>C	c.(745-747)tTc>tCc	p.F249S	RP11-361L15.4_ENST00000566869.1_RNA|CES2_ENST00000417689.1_Missense_Mutation_p.F249S	NM_003869.5	NP_003860.2	O00748	EST2_HUMAN	carboxylesterase 2	185					catabolic process (GO:0009056)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)			breast(1)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|prostate(1)|urinary_tract(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0663)|Epithelial(162;0.166)	Dabigatran etexilate(DB06695)|Irinotecan(DB00762)|Mycophenolate mofetil(DB00688)|Prasugrel(DB06209)	CTGGGCTTCTTCAGGTGAGAC	0.597																																					p.F249S	Ovarian(70;1230 1691 37888 38351)												.	CES2	43		0			c.T746C												166.0	139.0	148.0					16																	66974255		2200	4300	6500	SO:0001583	missense	8824	exon4			GCTTCTTCAGGTG	BC032095	CCDS10825.1, CCDS45507.1	16q22.1	2010-10-12	2010-10-12		ENSG00000172831	ENSG00000172831		"""Carboxylesterases"""	1864	protein-coding gene	gene with protein product		605278	"""carboxylesterase 2 (intestine, liver)"""			9169443, 9144407, 20931200	Standard	NM_198061		Approved	CE-2, iCE, CES2A1	uc002eqr.3	O00748	OTTHUMG00000137517	ENST00000317091.4:c.746T>C	16.37:g.66974255T>C	ENSP00000317842:p.Phe249Ser		Somatic	120	0.0083333333	1		WXS	Illumina HiSeq	Phase_I	182	0.02	3	NM_003869	68	0.00	0	A8K367|Q16859|Q5MAB8|Q7Z366|Q8IUP4|Q8TCP8	Missense_Mutation	SNP	ENST00000317091.4	37	CCDS10825.1	.	.	.	.	.	.	.	.	.	.	T	26.5	4.746438	0.89663	.	.	ENSG00000172831	ENST00000417689;ENST00000317091	T;T	0.68624	-0.34;-0.34	5.35	4.23	0.50019	Carboxylesterase, type B (1);	0.157061	0.42172	D	0.000742	T	0.81721	0.4882	M	0.85859	2.78	0.36554	D	0.872019	D;D	0.89917	1.0;0.998	D;D	0.85130	0.997;0.993	D	0.86171	0.1600	10	0.87932	D	0	.	10.574	0.45217	0.1445:0.0:0.0:0.8555	.	185;249	O00748;A8K367	EST2_HUMAN;.	S	249	ENSP00000394452:F249S;ENSP00000317842:F249S	ENSP00000317842:F249S	F	+	2	0	CES2	65531756	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.485000	0.66850	1.015000	0.39444	0.529000	0.55759	TTC			0.597	CES2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000268838.2		NM_003869	
ANKRD11	29123	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	89347466	89347466	+	Silent	SNP	C	C	T	rs140164595		TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr16:89347466C>T	ENST00000301030.4	-	9	5944	c.5484G>A	c.(5482-5484)tcG>tcA	p.S1828S	ANKRD11_ENST00000378330.2_Silent_p.S1828S	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	1828	Pro-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		TGTCTTCCATCGAGGGTGGCA	0.627																																					p.S1828S													.	.			0			c.G5484A							C		0,4396		0,0,2198	31.0	35.0	34.0		5484	1.0	0.4	16	dbSNP_134	34	1,8599		0,1,4299	no	coding-synonymous	ANKRD11	NM_013275.4		0,1,6497	TT,TC,CC		0.0116,0.0,0.0077		1828/2664	89347466	1,12995	2198	4300	6498	SO:0001819	synonymous_variant	29123	exon9			TTCCATCGAGGGT	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.5484G>A	16.37:g.89347466C>T			Somatic	41	0	0		WXS	Illumina HiSeq	.	56	0.45	25	NM_001256183	92	0.36	33	Q6NTG1|Q6QMF8	Silent	SNP	ENST00000301030.4	37	CCDS32513.1																																																																																			0		0.627	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000430462.3		NM_013275	
CDK10	8558	mdanderson.org	37	16	89762054	89762054	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr16:89762054C>T	ENST00000353379.7	+	13	1080	c.1037C>T	c.(1036-1038)gCc>gTc	p.A346V	CDK10_ENST00000331006.8_Missense_Mutation_p.A299V|CDK10_ENST00000505473.1_Intron	NM_001098533.2|NM_001160367.1|NM_052988.4	NP_001092003.2|NP_001153839.1|NP_443714.3	Q15131	CDK10_HUMAN	cyclin-dependent kinase 10	346					negative regulation of cell proliferation (GO:0008285)|traversing start control point of mitotic cell cycle (GO:0007089)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			ovary(1)	1		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0276)		AACAAGCGGGCCGCCCCAGCC	0.662																																					p.A346V													.	.			0			c.C1037T												20.0	26.0	24.0					16																	89762054		2192	4294	6486	SO:0001583	missense	8558	exon13			AGCGGGCCGCCCC	L33264	CCDS10984.2, CCDS32514.1, CCDS32514.2	16q24.3	2011-11-08	2007-11-21		ENSG00000185324	ENSG00000185324		"""Cyclin-dependent kinases"""	1770	protein-coding gene	gene with protein product		603464	"""cyclin-dependent kinase (CDC2-like) 10"""			8208557, 8084611	Standard	NM_052988		Approved	PISSLRE	uc010cio.3	Q15131	OTTHUMG00000138049	ENST00000353379.7:c.1037C>T	16.37:g.89762054C>T	ENSP00000338673:p.Ala346Val		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	41	0.07	3	NM_052988	238	0.00	1	A8K370|A8K8I6|A8MXU6|B3KQJ3|B7Z420|D3DX82|D3DX83|Q0VGZ7|Q15130|Q6PJC0	Missense_Mutation	SNP	ENST00000353379.7	37	CCDS10984.2	.	.	.	.	.	.	.	.	.	.	C	19.32	3.804341	0.70682	.	.	ENSG00000185324	ENST00000331006;ENST00000353379	T;T	0.71698	-0.59;-0.53	4.63	4.63	0.57726	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.56543	0.1992	N	0.14661	0.345	0.80722	D	1	B;B	0.21688	0.059;0.058	B;B	0.17722	0.014;0.019	T	0.55296	-0.8163	10	0.46703	T	0.11	-14.0806	17.4935	0.87711	0.0:1.0:0.0:0.0	.	346;269	Q15131;Q15131-3	CDK10_HUMAN;.	V	299;346	ENSP00000329957:A299V;ENSP00000338673:A346V	ENSP00000329957:A299V	A	+	2	0	CDK10	88289555	0.995000	0.38212	0.912000	0.35992	0.922000	0.55478	2.218000	0.42889	2.122000	0.65172	0.650000	0.86243	GCC			0.662	CDK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000269925.2			
FBXW10	10517	broad.mit.edu	37	17	18659367	18659367	+	Missense_Mutation	SNP	A	A	G	rs201169182		TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr17:18659367A>G	ENST00000395665.4	+	6	1353	c.1132A>G	c.(1132-1134)Aac>Gac	p.N378D	FBXW10_ENST00000308799.4_Missense_Mutation_p.N407D|FBXW10_ENST00000301938.4_Missense_Mutation_p.N378D|FBXW10_ENST00000395667.1_Missense_Mutation_p.N378D			Q5XX13	FBW10_HUMAN	F-box and WD repeat domain containing 10	378								p.N378D(2)		NS(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42						GAATGAGTACAACCTGTGGAC	0.478																																					p.N378D													FBXW10,NS,carcinoma,0,1	FBXW10	82	1	2	Substitution - Missense(2)	urinary_tract(1)|endometrium(1)	c.A1132G												57.0	55.0	56.0					17																	18659367		2203	4298	6501	SO:0001583	missense	10517	exon6			GAGTACAACCTGT	BC028364	CCDS11199.2, CCDS11199.3, CCDS58524.1	17p11	2013-01-09	2007-02-08	2004-07-21	ENSG00000171931	ENSG00000171931		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1211	protein-coding gene	gene with protein product		611679	"""chromosome 17 open reading frame 1A"", ""F-box and WD-40 domain protein 10"""	C17orf1, C17orf1A		9787083, 7586531	Standard	NM_001267585		Approved	SM2SH2, HREP, Fbw10	uc002guk.3	Q5XX13	OTTHUMG00000059048	ENST00000395665.4:c.1132A>G	17.37:g.18659367A>G	ENSP00000379025:p.Asn378Asp		Somatic	113	0.0088495575	1		WXS	Illumina HiSeq	Phase_I	175	0.27	47	NM_001267585	0		0	C9JRY8|C9JZD7|Q8TC00|Q9H0F0	Missense_Mutation	SNP	ENST00000395665.4	37	CCDS11199.3	183	0.08379120879120878	29	0.05894308943089431	37	0.10220994475138122	78	0.13636363636363635	39	0.051451187335092345	A	10.78	1.445868	0.25987	.	.	ENSG00000171931	ENST00000395667;ENST00000308799;ENST00000301938;ENST00000395665	T;T;T;T	0.21734	1.99;1.99;1.99;1.99	2.89	1.73	0.24493	F-box domain, Skp2-like (1);	1.275070	0.05828	U	0.617083	T	0.00210	0.0006	M	0.69823	2.125	0.27147	N	0.961514	P;B;P;P	0.50272	0.933;0.136;0.89;0.744	B;B;B;B	0.41510	0.359;0.046;0.197;0.21	T	0.12708	-1.0537	10	0.54805	T	0.06	.	6.9765	0.24679	0.7659:0.2341:0.0:0.0	.	378;407;378;378	Q5XX13-3;Q5XX13-2;Q5XX13;Q5XX13-4	.;.;FBW10_HUMAN;.	D	378;407;378;378	ENSP00000379026:N378D;ENSP00000310382:N407D;ENSP00000306937:N378D;ENSP00000379025:N378D	ENSP00000306937:N378D	N	+	1	0	FBXW10	18600092	0.996000	0.38824	0.997000	0.53966	0.221000	0.24807	2.989000	0.49393	0.191000	0.20236	0.155000	0.16302	AAC			0.478	FBXW10-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000313531.2		NM_031456	
FBXW10	10517	broad.mit.edu;mdanderson.org	37	17	18673363	18673363	+	Silent	SNP	T	T	C			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr17:18673363T>C	ENST00000395665.4	+	11	2192	c.1971T>C	c.(1969-1971)ggT>ggC	p.G657G	FBXW10_ENST00000308799.4_Silent_p.G686G|FBXW10_ENST00000301938.4_Intron|FBXW10_ENST00000573605.1_Splice_Site|FBXW10_ENST00000395667.1_Silent_p.G657G			Q5XX13	FBW10_HUMAN	F-box and WD repeat domain containing 10	657										NS(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42						ATGGCAGAGGTGATCCTGTGC	0.468																																					p.G657G													.	FBXW10	82		0			c.T1971C												302.0	292.0	295.0					17																	18673363		2203	4300	6503	SO:0001819	synonymous_variant	10517	exon11			CAGAGGTGATCCT	BC028364	CCDS11199.2, CCDS11199.3, CCDS58524.1	17p11	2013-01-09	2007-02-08	2004-07-21	ENSG00000171931	ENSG00000171931		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1211	protein-coding gene	gene with protein product		611679	"""chromosome 17 open reading frame 1A"", ""F-box and WD-40 domain protein 10"""	C17orf1, C17orf1A		9787083, 7586531	Standard	NM_001267585		Approved	SM2SH2, HREP, Fbw10	uc002guk.3	Q5XX13	OTTHUMG00000059048	ENST00000395665.4:c.1971T>C	17.37:g.18673363T>C			Somatic	205	0.0048780488	1		WXS	Illumina HiSeq	Phase_I	178	0.06	10	NM_001267585	0		0	C9JRY8|C9JZD7|Q8TC00|Q9H0F0	Splice_Site	SNP	ENST00000395665.4	37	CCDS11199.3																																																																																					0.468	FBXW10-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000313531.2		NM_031456	
CDRT15L2	256223	bcgsc.ca	37	17	20483760	20483760	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr17:20483760C>G	ENST00000399044.1	+	2	584	c.564C>G	c.(562-564)gaC>gaG	p.D188E	RP11-434D2.12_ENST00000580931.1_lincRNA	NM_001190790.1	NP_001177719.1	A8MXV6	CD15L_HUMAN	CMT1A duplicated region transcript 15-like 2	188						integral component of membrane (GO:0016021)				central_nervous_system(1)	1						GAGGCGGAGACCAGGGCATTC	0.602																																					p.D188E													.	CDRT15L2	5		0			c.C564G																																									SO:0001583	missense	256223	exon2			CGGAGACCAGGGC		CCDS54096.1	17p11.2	2008-10-30			ENSG00000214819	ENSG00000214819			34075	protein-coding gene	gene with protein product							Standard	NM_001190790		Approved		uc021tsn.1	A8MXV6	OTTHUMG00000059557	ENST00000399044.1:c.564C>G	17.37:g.20483760C>G	ENSP00000382000:p.Asp188Glu		Somatic	108	0.0740740741	8		WXS	Illumina HiSeq	Phase_1	168	0.53	89	NM_001190790	0		0		Missense_Mutation	SNP	ENST00000399044.1	37	CCDS54096.1	.	.	.	.	.	.	.	.	.	.	.	4.503	0.093371	0.08632	.	.	ENSG00000214819	ENST00000399044	T	0.53640	0.61	0.118	0.118	0.14667	.	.	.	.	.	T	0.26810	0.0656	N	0.14661	0.345	0.09310	N	1	.	.	.	.	.	.	T	0.24012	-1.0172	6	0.23891	T	0.37	.	.	.	.	.	.	.	.	E	188	ENSP00000382000:D188E	ENSP00000382000:D188E	D	+	3	2	CDRT15L2	20424352	0.004000	0.15560	0.016000	0.15963	0.016000	0.09150	0.733000	0.26087	0.191000	0.20236	0.194000	0.17425	GAC			0.602	CDRT15L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000132432.3		XM_170840	
SUPT6H	6830	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	27026839	27026839	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr17:27026839C>T	ENST00000314616.6	+	33	4772	c.4489C>T	c.(4489-4491)Cgg>Tgg	p.R1497W	SUPT6H_ENST00000347486.4_Missense_Mutation_p.R1497W	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1497					chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					ATTCCGGTACCGGGGCCAGAT	0.498																																					p.R1497W													.	SUPT6H	165		0			c.C4489T												197.0	199.0	198.0					17																	27026839		2203	4300	6503	SO:0001583	missense	6830	exon33			CGGTACCGGGGCC	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.4489C>T	17.37:g.27026839C>T	ENSP00000319104:p.Arg1497Trp		Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	136	0.04	5	NM_003170	202	0.00	0	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	ENST00000314616.6	37	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.178870	0.78564	.	.	ENSG00000109111	ENST00000314616	.	.	.	4.62	3.63	0.41609	.	0.117394	0.64402	D	0.000014	T	0.78861	0.4350	M	0.84219	2.685	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81508	-0.0901	9	0.72032	D	0.01	-14.0015	12.0945	0.53747	0.3122:0.6878:0.0:0.0	.	1497	Q7KZ85	SPT6H_HUMAN	W	1497	.	ENSP00000319104:R1497W	R	+	1	2	SUPT6H	24050966	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.420000	0.52735	1.154000	0.42482	0.462000	0.41574	CGG			0.498	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000446422.2		NM_003170	
SLFN14	342618	broad.mit.edu	37	17	33875849	33875849	+	Silent	SNP	A	A	G			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr17:33875849A>G	ENST00000415846.3	-	4	2183	c.2148T>C	c.(2146-2148)ctT>ctC	p.L716L		NM_001129820.1	NP_001123292.1	P0C7P3	SLN14_HUMAN	schlafen family member 14	716							ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(3)	9						ATGGAGGGGGAAGGCCATTGA	0.463																																					p.L716L													.	SLFN14	43		0			c.T2148C												92.0	82.0	85.0					17																	33875849		692	1591	2283	SO:0001819	synonymous_variant	342618	exon4			AGGGGGAAGGCCA		CCDS45650.1	17q12	2009-09-22				ENSG00000236320			32689	protein-coding gene	gene with protein product		614958				9846487	Standard	NM_001129820		Approved		uc010ctu.1	P0C7P3		ENST00000415846.3:c.2148T>C	17.37:g.33875849A>G			Somatic	109	0	0		WXS	Illumina HiSeq	Phase_I	140	0.02	3	NM_001129820	0		0	B2RTW9	Silent	SNP	ENST00000415846.3	37	CCDS45650.1																																																																																					0.463	SLFN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000448928.1		NM_001129820	
AOC2	314	broad.mit.edu	37	17	40997660	40997660	+	Silent	SNP	C	C	T	rs149144895	byFrequency	TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr17:40997660C>T	ENST00000253799.3	+	1	1044	c.1017C>T	c.(1015-1017)agC>agT	p.S339S	AOC2_ENST00000452774.2_Silent_p.S339S	NM_009590.2	NP_033720.2	O75106	AOC2_HUMAN	amine oxidase, copper containing 2 (retina-specific)	339					amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(14)|ovary(4)|skin(2)	30		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		GGGTGTTCAGCGGCCTGAGGA	0.527													C|||	2	0.000399361	0.0015	0.0	5008	,	,		20058	0.0		0.0	False		,,,				2504	0.0				p.S339S													.	AOC2	61		0			c.C1017T							C	,	6,4400	11.4+/-27.6	0,6,2197	137.0	133.0	134.0		1017,1017	1.7	0.8	17	dbSNP_134	134	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	AOC2	NM_001158.3,NM_009590.2	,	0,7,6496	TT,TC,CC		0.0116,0.1362,0.0538	,	339/730,339/757	40997660	7,12999	2203	4300	6503	SO:0001819	synonymous_variant	314	exon1			GTTCAGCGGCCTG	AF081363	CCDS11443.1, CCDS45690.1	17q21	2012-07-13				ENSG00000131480	1.4.3.21		549	protein-coding gene	gene with protein product		602268				9119395, 9722954	Standard	NM_001158		Approved	RAO, DAO2	uc002ibu.3	O75106		ENST00000253799.3:c.1017C>T	17.37:g.40997660C>T			Somatic	219	0	0		WXS	Illumina HiSeq	Phase_I	282	0.02	6	NM_009590	3	0.00	0	A5PKW2|O00120|O75105|Q4TTW5|Q9UNY0	Silent	SNP	ENST00000253799.3	37	CCDS11443.1																																																																																					0.527	AOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452442.1		NM_009590, NM_001158	
KIF2B	84643	broad.mit.edu	37	17	51902397	51902397	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr17:51902397T>C	ENST00000268919.4	+	1	2159	c.2003T>C	c.(2002-2004)gTg>gCg	p.V668A		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	668					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						GACCTCCACGTGAAGAGCAAG	0.438																																					p.V668A													KIF2B,right_upper_lobe,carcinoma,+1,1	KIF2B	254	1	0			c.T2003C												51.0	51.0	51.0					17																	51902397		2203	4300	6503	SO:0001583	missense	84643	exon1			TCCACGTGAAGAG	AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.2003T>C	17.37:g.51902397T>C	ENSP00000268919:p.Val668Ala		Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	83	0.06	5	NM_032559	0		0	Q96MA2|Q9BXG6	Missense_Mutation	SNP	ENST00000268919.4	37	CCDS32685.1	.	.	.	.	.	.	.	.	.	.	T	0.641	-0.813404	0.02798	.	.	ENSG00000141200	ENST00000268919;ENST00000416491	T	0.73258	-0.73	5.13	1.62	0.23740	.	0.944627	0.08628	N	0.917370	T	0.46386	0.1390	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.30416	-0.9979	10	0.10902	T	0.67	.	2.9376	0.05819	0.5803:0.0:0.2007:0.219	.	668	Q8N4N8	KIF2B_HUMAN	A	668;556	ENSP00000268919:V668A	ENSP00000268919:V668A	V	+	2	0	KIF2B	49257396	0.954000	0.32549	0.056000	0.19401	0.012000	0.07955	1.141000	0.31528	0.445000	0.26639	-0.313000	0.08912	GTG			0.438	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000438854.1		NM_032559	
C17orf58	284018	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	65989082	65989082	+	Intron	SNP	C	C	G			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr17:65989082C>G	ENST00000449250.2	-	2	293				C17orf58_ENST00000334461.7_Missense_Mutation_p.V61L|C17orf58_ENST00000536693.1_Missense_Mutation_p.V61L|RP11-855A2.5_ENST00000580729.1_lincRNA			Q2M2W7	CQ058_HUMAN	chromosome 17 open reading frame 58											lung(2)	2	all_cancers(12;4.57e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			GGGCGACCTACAGCCCGGGCT	0.488																																					p.V61L													.	.			0			c.G181C												60.0	61.0	60.0					17																	65989082		1888	4108	5996	SO:0001627	intron_variant	284018	exon2			GACCTACAGCCCG	AK026583	CCDS42375.1, CCDS45765.1	17q24.2	2012-10-11			ENSG00000186665	ENSG00000186665			27568	protein-coding gene	gene with protein product						12477932	Standard	NM_181656		Approved		uc002jgi.4	Q2M2W7	OTTHUMG00000179782	ENST00000449250.2:c.103+77G>C	17.37:g.65989082C>G			Somatic	213	0	0		WXS	Illumina HiSeq	.	285	0.29	83	NM_181656	9	0.33	3	A8MQV2	Missense_Mutation	SNP	ENST00000449250.2	37	CCDS45765.1	.	.	.	.	.	.	.	.	.	.	C	6.022	0.372478	0.11409	.	.	ENSG00000186665	ENST00000334461;ENST00000536693	.	.	.	1.95	-3.9	0.04181	.	0.349077	0.27176	N	0.020569	T	0.11153	0.0272	.	.	.	0.09310	N	1	B	0.16396	0.017	B	0.06405	0.002	T	0.25916	-1.0118	8	0.10377	T	0.69	.	0.1435	0.00086	0.3379:0.2397:0.1678:0.2546	.	61	Q2M2W7-2	.	L	61	.	ENSP00000334741:V61L	V	-	1	0	C17orf58	63419544	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.082000	0.03400	-1.660000	0.01486	-0.337000	0.08149	GTA			0.488	C17orf58-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000448104.1		NM_181656	
SOCS3	9021	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	76354724	76354724	+	Silent	SNP	C	C	T	rs371734270		TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr17:76354724C>T	ENST00000330871.2	-	2	868	c.453G>A	c.(451-453)ccG>ccA	p.P151P	RP11-806H10.4_ENST00000592569.1_lincRNA	NM_003955.3	NP_003946.3	O14543	SOCS3_HUMAN	suppressor of cytokine signaling 3	151					branching involved in labyrinthine layer morphogenesis (GO:0060670)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein kinase activity (GO:0006469)|placenta blood vessel development (GO:0060674)|positive regulation of cell differentiation (GO:0045597)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|spongiotrophoblast differentiation (GO:0060708)|trophoblast giant cell differentiation (GO:0060707)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)	protein kinase inhibitor activity (GO:0004860)			kidney(1)|lung(2)|ovary(1)|pancreas(1)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(99;0.000688)|OV - Ovarian serous cystadenocarcinoma(97;0.0554)			GCTGGGCAGACGGCTGCTCGG	0.662																																					p.P151P													.	SOCS3	16		0			c.G453A							C		1,4379		0,1,2189	16.0	20.0	19.0		453	-4.3	0.8	17		19	0,8560		0,0,4280	no	coding-synonymous	SOCS3	NM_003955.3		0,1,6469	TT,TC,CC		0.0,0.0228,0.0077		151/226	76354724	1,12939	2190	4280	6470	SO:0001819	synonymous_variant	0	exon2			GGCAGACGGCTGC	AB004904	CCDS11756.1	17q25.3	2014-09-17						"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19391	protein-coding gene	gene with protein product		604176				9266833, 9344848	Standard	NM_003955		Approved	SSI-3, CIS3, SOCS-3, Cish3	uc002jvl.2	O14543		ENST00000330871.2:c.453G>A	17.37:g.76354724C>T			Somatic	90	0.0111111111	1		WXS	Illumina HiSeq	Phase_I	76	0.25	19	NM_003955	221	0.26	58	O14509	Silent	SNP	ENST00000330871.2	37	CCDS11756.1																																																																																					0.662	SOCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000437300.1			
CARD14	79092	broad.mit.edu	37	17	78172269	78172269	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr17:78172269A>G	ENST00000573882.1	+	15	2266	c.1730A>G	c.(1729-1731)gAt>gGt	p.D577G	RP11-334C17.5_ENST00000570309.1_RNA|CARD14_ENST00000573754.1_3'UTR|CARD14_ENST00000392434.2_Missense_Mutation_p.D340G|CARD14_ENST00000570421.1_Missense_Mutation_p.D577G|CARD14_ENST00000344227.2_Missense_Mutation_p.D577G			Q9BXL6	CAR14_HUMAN	caspase recruitment domain family, member 14	577	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)			NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(5)|prostate(1)|skin(1)	23	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			TTCCAGGGGGATGCATTGCTG	0.692																																					p.D577G													.	CARD14	98		0			c.A1730G												55.0	53.0	54.0					17																	78172269		2203	4299	6502	SO:0001583	missense	79092	exon13			AGGGGGATGCATT	AF322642	CCDS11768.1, CCDS58605.1	17q25.3	2014-09-04			ENSG00000141527	ENSG00000141527			16446	protein-coding gene	gene with protein product		607211	"""psoriasis susceptibility 2"""	PSORS2		11278692, 11356195, 22521418	Standard	NM_052819		Approved	CARMA2, BIMP2	uc031res.1	Q9BXL6	OTTHUMG00000177549	ENST00000573882.1:c.1730A>G	17.37:g.78172269A>G	ENSP00000458715:p.Asp577Gly		Somatic	130	0.0076923077	1		WXS	Illumina HiSeq	Phase_I	191	0.02	4	NM_024110	2	0.00	0	B8QQJ3|Q9BVB5	Missense_Mutation	SNP	ENST00000573882.1	37	CCDS11768.1	.	.	.	.	.	.	.	.	.	.	A	14.04	2.415975	0.42817	.	.	ENSG00000141527	ENST00000344227;ENST00000392434;ENST00000309710	T;T	0.28666	1.6;1.96	4.86	-1.89	0.07689	PDZ/DHR/GLGF (1);	0.443241	0.23714	N	0.045296	T	0.36496	0.0969	M	0.72479	2.2	0.09310	N	1	D;B	0.57571	0.98;0.025	P;B	0.53146	0.719;0.031	T	0.29027	-1.0025	10	0.72032	D	0.01	-4.2425	5.3238	0.15895	0.5431:0.227:0.23:0.0	.	340;577	E7ETJ2;Q9BXL6	.;CAR14_HUMAN	G	577;340;340	ENSP00000344549:D577G;ENSP00000376229:D340G	ENSP00000308507:D340G	D	+	2	0	CARD14	75786864	0.000000	0.05858	0.000000	0.03702	0.268000	0.26511	0.328000	0.19681	-0.770000	0.04614	0.482000	0.46254	GAT			0.692	CARD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000437507.1			
DSC2	1824	broad.mit.edu	37	18	28671012	28671012	+	Silent	SNP	A	A	G			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr18:28671012A>G	ENST00000280904.6	-	4	896	c.453T>C	c.(451-453)ccT>ccC	p.P151P	DSC2_ENST00000251081.6_Silent_p.P151P	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	151	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			AAAGTGGAAAAGGACCCAAGG	0.403																																					p.P151P													.	DSC2	168		0			c.T453C												116.0	106.0	110.0					18																	28671012		2203	4300	6503	SO:0001819	synonymous_variant	1824	exon4			TGGAAAAGGACCC	X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.453T>C	18.37:g.28671012A>G			Somatic	103	0	0		WXS	Illumina HiSeq	Phase_I	203	0.02	4	NM_024422	47	0.00	0		Silent	SNP	ENST00000280904.6	37	CCDS11892.1																																																																																					0.403	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000254943.1		NM_004949	
GALR1	2587	mdanderson.org	37	18	74962637	74962637	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr18:74962637G>T	ENST00000299727.3	+	1	133	c.133G>T	c.(133-135)Gcg>Tcg	p.A45S		NM_001480.3	NP_001471.2	P47211	GALR1_HUMAN	galanin receptor 1	45					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|digestion (GO:0007586)|negative regulation of adenylate cyclase activity (GO:0007194)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galanin receptor activity (GO:0004966)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)		CCTGATCTTCGCGCTGGGTGT	0.682																																					p.A45S													.	.			0			c.G133T												32.0	30.0	31.0					18																	74962637		2202	4299	6501	SO:0001583	missense	2587	exon1			ATCTTCGCGCTGG	U90658	CCDS12012.1	18q23	2012-08-08			ENSG00000166573	ENSG00000166573		"""GPCR / Class A : Galanin receptors"""	4132	protein-coding gene	gene with protein product		600377		GALNR1, GALNR		7524088	Standard	NM_001480		Approved		uc002lms.4	P47211	OTTHUMG00000132875	ENST00000299727.3:c.133G>T	18.37:g.74962637G>T	ENSP00000299727:p.Ala45Ser		Somatic	61	0.0163934426	1		WXS	Illumina HiSeq	Phase_I	30	0.07	2	NM_001480	1	0.00	0	Q4VBL7	Missense_Mutation	SNP	ENST00000299727.3	37	CCDS12012.1	.	.	.	.	.	.	.	.	.	.	G	14.61	2.587588	0.46110	.	.	ENSG00000166573	ENST00000299727	T	0.37584	1.19	4.76	0.881	0.19166	.	0.287868	0.38492	N	0.001674	T	0.30665	0.0772	L	0.55481	1.735	0.33215	D	0.553915	B	0.10296	0.003	B	0.10450	0.005	T	0.30794	-0.9966	10	0.56958	D	0.05	.	9.1693	0.37072	0.3873:0.0:0.6127:0.0	.	45	P47211	GALR1_HUMAN	S	45	ENSP00000299727:A45S	ENSP00000299727:A45S	A	+	1	0	GALR1	73091625	0.001000	0.12720	0.998000	0.56505	0.998000	0.95712	-0.347000	0.07750	0.105000	0.17753	0.585000	0.79938	GCG			0.682	GALR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256362.1			
ADAMTSL5	339366	mdanderson.org	37	19	1506169	1506169	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr19:1506169C>T	ENST00000413997.2	-	12	1290	c.1291G>A	c.(1291-1293)Gca>Aca	p.A431T	ADAMTSL5_ENST00000330475.4_Missense_Mutation_p.A421T|CTB-25B13.9_ENST00000590252.1_RNA|ADAMTSL5_ENST00000590562.1_5'UTR|ADAMTSL5_ENST00000395467.2_3'UTR			Q6ZMM2	ATL5_HUMAN	ADAMTS-like 5	431	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.					extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGTGGGGTGCCAGCATCGGG	0.697																																					p.A421T													.	.			0			c.G1261A												28.0	31.0	30.0					19																	1506169		2201	4299	6500	SO:0001583	missense	339366	exon12			GGGGTGCCAGCAT	BC040620	CCDS12071.1	19p13.3	2008-02-05	2006-02-07	2006-02-07		ENSG00000185761			27912	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain containing 6"""	THSD6			Standard	NM_213604		Approved		uc002ltd.2	Q6ZMM2		ENST00000413997.2:c.1291G>A	19.37:g.1506169C>T	ENSP00000399364:p.Ala431Thr		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	59	0.07	4	NM_213604	11	0.00	0	B4DXK7|Q8IW95	Missense_Mutation	SNP	ENST00000413997.2	37		.	.	.	.	.	.	.	.	.	.	C	4.574	0.106590	0.08780	.	.	ENSG00000185761	ENST00000413997;ENST00000330475	T;T	0.28069	1.63;1.63	3.61	2.56	0.30785	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);Netrin module, non-TIMP type (1);	0.748973	0.12247	N	0.486003	T	0.17534	0.0421	N	0.22421	0.69	0.58432	D	0.999998	B;B	0.22146	0.065;0.065	B;B	0.21917	0.037;0.037	T	0.07829	-1.0752	10	0.20046	T	0.44	.	5.2463	0.15498	0.0:0.6716:0.21:0.1184	.	431;421	B4DXK7;Q6ZMM2	.;ATL5_HUMAN	T	431;421	ENSP00000399364:A431T;ENSP00000327608:A421T	ENSP00000327608:A421T	A	-	1	0	ADAMTSL5	1457169	0.462000	0.25791	0.710000	0.30468	0.225000	0.24961	0.255000	0.18333	0.863000	0.35553	-0.391000	0.06502	GCA			0.697	ADAMTSL5-202	KNOWN	basic	protein_coding	protein_coding				XM_294919	
MAP1S	55201	mdanderson.org	37	19	17837039	17837039	+	Silent	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr19:17837039G>T	ENST00000324096.4	+	5	997	c.846G>T	c.(844-846)ctG>ctT	p.L282L	MAP1S_ENST00000544059.2_Silent_p.L256L|MAP1S_ENST00000597681.1_Intron|CTD-3149D2.4_ENST00000595363.1_RNA	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	282	Necessary for the microtubule-organizing center localization.				apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						TGCGGCACCTGGACCGCGTGG	0.672																																					p.L282L													.	.			0			c.G846T												29.0	24.0	26.0					19																	17837039		2202	4299	6501	SO:0001819	synonymous_variant	55201	exon5			GCACCTGGACCGC	BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.846G>T	19.37:g.17837039G>T			Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	57	0.05	3	NM_018174	100	0.00	0	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Silent	SNP	ENST00000324096.4	37	CCDS32954.1																																																																																					0.672	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466027.1		NM_018174	
IRGQ	126298	mdanderson.org	37	19	44097051	44097051	+	Silent	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr19:44097051G>T	ENST00000602269.1	-	2	1184	c.999C>A	c.(997-999)ggC>ggA	p.G333G	IRGQ_ENST00000422989.1_Silent_p.G333G|L34079.2_ENST00000594374.1_Silent_p.G46G|IRGQ_ENST00000601520.1_5'UTR			Q8WZA9	IRGQ_HUMAN	immunity-related GTPase family, Q	333	IRG-type G.							p.G333G(1)		endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(3)	18		Prostate(69;0.0199)				CCTCGCCCTCGCCGTCTGTGC	0.617																																					p.G333G													IRGQ,colon,carcinoma,0,1	IRGQ	0	1	1	Substitution - coding silent(1)	large_intestine(1)	c.C999A												142.0	138.0	139.0					19																	44097051		2203	4300	6503	SO:0001819	synonymous_variant	126298	exon3			GCCCTCGCCGTCT	AF322648	CCDS33040.1	19q13.31	2013-07-03	2005-10-31	2005-10-31		ENSG00000167378			24868	protein-coding gene	gene with protein product			"""immunity-related GTPase family, Q1"""	IRGQ1		16277747	Standard	NM_001007561		Approved	FKSG27	uc010eiv.2	Q8WZA9		ENST00000602269.1:c.999C>A	19.37:g.44097051G>T			Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_001007561	6	0.00	0	B2RNP3	Silent	SNP	ENST00000602269.1	37	CCDS33040.1																																																																																					0.617	IRGQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463205.1		NM_001007561	
RPL18	6141	mdanderson.org	37	19	49118703	49118703	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr19:49118703G>T	ENST00000549920.1	-	7	885	c.493C>A	c.(493-495)Ccc>Acc	p.P165T	RPL18_ENST00000549273.1_3'UTR|FAM83E_ENST00000263266.3_5'Flank|RPL18_ENST00000550645.1_Splice_Site_p.P110T|FAM83E_ENST00000595110.1_5'Flank|RPL18_ENST00000552588.1_Splice_Site_p.P136T	NM_000979.3	NP_000970.1	Q07020	RL18_HUMAN	ribosomal protein L18	165					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			cervix(1)|kidney(2)	3		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.89e-05)|all cancers(93;0.00011)|GBM - Glioblastoma multiforme(486;0.0061)|Epithelial(262;0.0154)		CGGACGTAGGGTCTGTGGGGA	0.587																																					p.P165T													.	.			0			c.C493A												62.0	74.0	70.0					19																	49118703		2203	4299	6502	SO:0001630	splice_region_variant	6141	exon7			CGTAGGGTCTGTG	L11566	CCDS12726.1, CCDS58669.1	19q13	2011-04-06				ENSG00000063177		"""L ribosomal proteins"""	10310	protein-coding gene	gene with protein product	"""60S ribosomal protein L18"""	604179				8218404	Standard	NM_000979		Approved	L18	uc002pjq.2	Q07020	OTTHUMG00000169760	ENST00000549920.1:c.492-1C>A	19.37:g.49118703G>T			Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_000979	6036	0.00	3	F8VWC5|Q8WTZ6	Missense_Mutation	SNP	ENST00000549920.1	37	CCDS12726.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	31|31	5.102820|5.102820	0.94245|0.94245	.|.	.|.	ENSG00000063177|ENSG00000063177	ENST00000549920;ENST00000550645;ENST00000552588;ENST00000550973|ENST00000084795;ENST00000546623	.|.	.|.	.|.	5.26|5.26	5.26|5.26	0.73747|0.73747	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.85474|0.85474	0.5705|0.5705	M|M	0.93197|0.93197	3.39|3.39	0.80722|0.80722	D|D	1|1	D|.	0.54772|.	0.968|.	P|.	0.56612|.	0.802|.	D|D	0.88902|0.88902	0.3353|0.3353	9|5	0.72032|.	D|.	0.01|.	-30.392|-30.392	14.7247|14.7247	0.69336|0.69336	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	165|.	Q07020|.	RL18_HUMAN|.	T|N	165;110;136;113|166;143	.|.	ENSP00000447001:P165T|.	P|T	-|-	1|2	0|0	RPL18|RPL18	53810515|53810515	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.974000|0.974000	0.67602|0.67602	8.778000|8.778000	0.91785|0.91785	2.631000|2.631000	0.89168|0.89168	0.655000|0.655000	0.94253|0.94253	CCC|ACC			0.587	RPL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000405732.2		NM_000979	Missense_Mutation
DBP	1628	mdanderson.org	37	19	49136911	49136911	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr19:49136911G>T	ENST00000222122.5	-	3	995	c.552C>A	c.(550-552)ggC>ggA	p.G184G	DBP_ENST00000601104.1_Splice_Site_p.G184G|DBP_ENST00000593500.1_5'UTR|DBP_ENST00000599385.1_5'UTR	NM_001352.3	NP_001343.2	Q10586	DBP_HUMAN	D site of albumin promoter (albumin D-box) binding protein	184					liver development (GO:0001889)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|rhythmic process (GO:0048511)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000112)|GBM - Glioblastoma multiforme(486;0.00615)|Epithelial(262;0.0155)		GAGAGGTCAGGCCTTGGGGAA	0.527																																					p.G184G													.	.			0			c.C552A												101.0	93.0	96.0					19																	49136911		2203	4300	6503	SO:0001630	splice_region_variant	1628	exon3			GGTCAGGCCTTGG	U06936	CCDS12728.1	19q13.33	2013-09-20			ENSG00000105516	ENSG00000105516			2697	protein-coding gene	gene with protein product		124097				1535333, 7835883	Standard	XR_243907		Approved	DABP	uc002pjx.4	Q10586	OTTHUMG00000183319	ENST00000222122.5:c.551-1C>A	19.37:g.49136911G>T			Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	46	0.07	3	NM_001352	21	0.00	0	A2I2P4	Silent	SNP	ENST00000222122.5	37	CCDS12728.1																																																																																					0.527	DBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466167.1		NM_001352	Silent
NLRP12	91662	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	19	54304502	54304502	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr19:54304502G>T	ENST00000324134.6	-	7	2903	c.2735C>A	c.(2734-2736)aCg>aAg	p.T912K	NLRP12_ENST00000391775.3_Missense_Mutation_p.T912K|NLRP12_ENST00000535162.1_Missense_Mutation_p.T912K|NLRP12_ENST00000345770.5_Missense_Mutation_p.T913K|NLRP12_ENST00000391772.1_Intron|NLRP12_ENST00000351894.4_Intron|NLRP12_ENST00000391773.1_Missense_Mutation_p.T913K|NLRP12_ENST00000354278.3_Intron	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	912					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)	p.T912M(1)		NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		GAGCTTGCACGTGGGATGCCT	0.627																																					p.L912H													NLRP12,caecum,carcinoma,0,1	NLRP12	0	1	1	Substitution - Missense(1)	large_intestine(1)	c.T2735A												66.0	62.0	63.0					19																	54304502		2203	4300	6503	SO:0001583	missense	91662	exon7			TTGCACGTGGGAT	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.2735C>A	19.37:g.54304502G>T	ENSP00000319377:p.Thr912Lys		Somatic	79	0	0		WXS	Illumina HiSeq	.	50	0.08	4	NM_144687	2	0.00	0	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	ENST00000324134.6	37	CCDS12864.1	.	.	.	.	.	.	.	.	.	.	G	5.082	0.200753	0.09652	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000358661;ENST00000391775;ENST00000391773;ENST00000345770	T;T;T;T	0.53206	0.63;0.63;0.63;0.63	5.45	-4.61	0.03380	.	0.885835	0.09284	N	0.823342	T	0.24470	0.0593	N	0.13235	0.315	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.08055	0.003;0.001;0.001;0.001	T	0.29058	-1.0024	10	0.15066	T	0.55	.	9.5993	0.39593	0.095:0.066:0.6525:0.1865	.	195;912;912;912	P59046-5;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	K	912;912;195;912;913;913	ENSP00000319377:T912K;ENSP00000438030:T912K;ENSP00000375655:T912K;ENSP00000375653:T913K	ENSP00000319377:T912K	T	-	2	0	NLRP12	58996314	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.248000	0.08854	-1.288000	0.02378	-1.150000	0.01838	ACG			0.627	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000134340.1		NM_144687	
TMEM86B	255043	mdanderson.org	37	19	55739615	55739615	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr19:55739615A>T	ENST00000327042.4	-	2	764	c.242T>A	c.(241-243)cTt>cAt	p.L81H	AC010327.2_ENST00000598855.1_3'UTR	NM_173804.4	NP_776165.3	Q8N661	TM86B_HUMAN	transmembrane protein 86B	81					ether lipid metabolic process (GO:0046485)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alkenylglycerophosphocholine hydrolase activity (GO:0047408)|alkenylglycerophosphoethanolamine hydrolase activity (GO:0047409)			skin(2)	2			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0443)		CGAGCACACAAGGGCTCCCTG	0.652																																					p.L81H													.	.			0			c.T242A												32.0	33.0	32.0					19																	55739615		2202	4300	6502	SO:0001583	missense	255043	exon2			CACACAAGGGCTC	BC023000	CCDS12920.1	19q13.42	2011-07-12					3.3.2.2, 3.3.2.5		28448	protein-coding gene	gene with protein product						21515882	Standard	NM_173804		Approved	MGC30208	uc002qju.3	Q8N661		ENST00000327042.4:c.242T>A	19.37:g.55739615A>T	ENSP00000321038:p.Leu81His		Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_173804	17	0.00	0		Missense_Mutation	SNP	ENST00000327042.4	37	CCDS12920.1	.	.	.	.	.	.	.	.	.	.	.	16.44	3.123004	0.56613	.	.	ENSG00000180089	ENST00000327042	T	0.50548	0.74	5.4	5.4	0.78164	.	0.000000	0.64402	D	0.000006	T	0.78387	0.4275	H	0.95850	3.73	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.85532	0.1210	10	0.87932	D	0	.	14.7291	0.69368	1.0:0.0:0.0:0.0	.	81	Q8N661	TM86B_HUMAN	H	81	ENSP00000321038:L81H	ENSP00000321038:L81H	L	-	2	0	TMEM86B	60431427	1.000000	0.71417	0.456000	0.27044	0.058000	0.15608	6.344000	0.72991	2.198000	0.70561	0.533000	0.62120	CTT			0.652	TMEM86B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452659.1		NM_173804	
LINC01317	104355287	broad.mit.edu	37	2	33951855	33951858	+	lincRNA	DEL	AGAG	AGAG	-	rs201739772|rs3217585|rs397818101|rs80178219	byFrequency	TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	AGAG	AGAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr2:33951855_33951858delAGAG	ENST00000366209.2	+	0	68				MYADML_ENST00000474610.1_RNA																							AAGAAACAAAAGAGAGAGTGGAAA	0.436														1656	0.330671	0.3464	0.255	5008	,	,		17649	0.3016		0.3052	False		,,,				2504	0.4192				.													.	.			0			.																																											0	.			AACAAAAGAGAGA																													2.37:g.33951859_33951862delAGAG			Somatic	11	0	0		WXS	Illumina HiSeq	Phase_I	10	0.70	7	.	0		0		RNA	DEL	ENST00000366209.2	37																																																																																						0.436	AC009499.1-002	KNOWN	non_canonical_polymorphism|basic	lincRNA	lincRNA		OTTHUMT00000325406.1			
EPAS1	2034	broad.mit.edu	37	2	46605215	46605215	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr2:46605215A>T	ENST00000263734.3	+	10	1942	c.1432A>T	c.(1432-1434)Agc>Tgc	p.S478C		NM_001430.4	NP_001421.2	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	478	Poly-Ser.				angiogenesis (GO:0001525)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|erythrocyte differentiation (GO:0030218)|lung development (GO:0030324)|mitochondrion organization (GO:0007005)|myoblast fate commitment (GO:0048625)|norepinephrine metabolic process (GO:0042415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart rate (GO:0002027)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|surfactant homeostasis (GO:0043129)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			CAGCAGCAGCAGCTGCTCCAC	0.652																																					p.S478C													.	EPAS1	83		0			c.A1432T												10.0	10.0	10.0					2																	46605215		2180	4275	6455	SO:0001583	missense	2034	exon10			AGCAGCAGCTGCT	U81984	CCDS1825.1	2p21-p16	2013-05-21			ENSG00000116016	ENSG00000116016		"""Basic helix-loop-helix proteins"""	3374	protein-coding gene	gene with protein product	"""HIF-1 alpha-like factor"""	603349				9000051, 9079689, 18378852	Standard	NM_001430		Approved	MOP2, PASD2, HIF2A, HLF, bHLHe73	uc002ruv.3	Q99814	OTTHUMG00000128818	ENST00000263734.3:c.1432A>T	2.37:g.46605215A>T	ENSP00000263734:p.Ser478Cys		Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	89	0.04	4	NM_001430	29	0.00	0	Q86VA2|Q99630	Missense_Mutation	SNP	ENST00000263734.3	37	CCDS1825.1	.	.	.	.	.	.	.	.	.	.	A	18.75	3.689835	0.68271	.	.	ENSG00000116016	ENST00000263734	T	0.56444	0.46	5.58	3.23	0.37069	.	0.981388	0.08371	N	0.956092	T	0.67287	0.2877	M	0.76574	2.34	0.37050	D	0.897573	D	0.62365	0.991	P	0.59288	0.855	T	0.59553	-0.7433	10	0.37606	T	0.19	.	9.6414	0.39842	0.8591:0.0:0.1409:0.0	.	478	Q99814	EPAS1_HUMAN	C	478	ENSP00000263734:S478C	ENSP00000263734:S478C	S	+	1	0	EPAS1	46458719	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	4.474000	0.60203	0.427000	0.26145	0.533000	0.62120	AGC			0.652	EPAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250752.2		NM_001430	
WASH2P	375260	broad.mit.edu	37	2	114355768	114355769	+	RNA	INS	-	-	GCCC	rs11490601		TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr2:114355768_114355769insGCCC	ENST00000538033.2	+	0	2154							Q6VEQ5	WASH2_HUMAN	WAS protein family homolog 2 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										ccctggccctgtccccgaggtg	0.619																																					.													.	.			0			.																																											0	.			GGCCCTGTCCCCG			2q13	2010-07-08	2008-01-16	2008-01-16	ENSG00000146556	ENSG00000146556		"""WAS protein homologs"""	33145	pseudogene	pseudogene			"""family with sequence similarity 39, member B"""	FAM39B		18159949	Standard	NR_024077		Approved	MGC52000	uc002tkh.3	Q6VEQ5	OTTHUMG00000047822		2.37:g.114355768_114355769insGCCC			Somatic	14	0	0		WXS	Illumina HiSeq	Phase_I	7	0.29	2	.	5	0.00	0		RNA	INS	ENST00000538033.2	37																																																																																						0.619	WASH2P-002	KNOWN	mRNA_end_NF|basic	retained_intron	pseudogene		OTTHUMT00000467782.1		NM_198943	
TMEM194B	100131211	mdanderson.org	37	2	191383892	191383892	+	Silent	SNP	T	T	C			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr2:191383892T>C	ENST00000409150.3	-	3	297	c.231A>G	c.(229-231)ccA>ccG	p.P77P	TMEM194B_ENST00000492292.1_5'UTR	NM_001142645.1	NP_001136117.1	A6NFY4	T194B_HUMAN	transmembrane protein 194B	77						integral component of membrane (GO:0016021)											TGAACAGGCCTGGACTGGTAA	0.358																																					p.P77P													.	.			0			c.A231G												68.0	54.0	59.0					2																	191383892		692	1591	2283	SO:0001819	synonymous_variant	100131211	exon3			CAGGCCTGGACTG		CCDS46476.1	2q32.2	2008-06-10			ENSG00000189362	ENSG00000189362			33700	protein-coding gene	gene with protein product							Standard	NM_001142645		Approved		uc010zgf.2	A6NFY4	OTTHUMG00000154454	ENST00000409150.3:c.231A>G	2.37:g.191383892T>C			Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_001142645	4	0.00	0	B4DYG6	Silent	SNP	ENST00000409150.3	37	CCDS46476.1																																																																																					0.358	TMEM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000335299.1		XM_001723498	
MFF	56947	broad.mit.edu	37	2	228211978	228211978	+	Silent	SNP	T	T	C			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr2:228211978T>C	ENST00000353339.3	+	8	1071	c.630T>C	c.(628-630)ccT>ccC	p.P210P	MFF_ENST00000392059.1_Silent_p.P210P|MFF_ENST00000304593.9_Silent_p.P159P|MFF_ENST00000354503.6_Intron|MFF_ENST00000349901.7_Intron|MFF_ENST00000337110.7_Intron|MFF_ENST00000409616.1_Intron|MFF_ENST00000476924.1_Intron|MFF_ENST00000524634.1_Intron|MFF_ENST00000409565.1_Intron	NM_001277061.1	NP_001263990.1	Q9GZY8	MFF_HUMAN	mitochondrial fission factor	210					mitochondrial fission (GO:0000266)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial fusion (GO:0008053)|mitochondrion morphogenesis (GO:0070584)|peroxisome fission (GO:0016559)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homooligomerization (GO:0051260)|protein targeting to mitochondrion (GO:0006626)|regulation of mitochondrion organization (GO:0010821)|regulation of peroxisome organization (GO:1900063)|release of cytochrome c from mitochondria (GO:0001836)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of mitochondrial membrane (GO:0032592)|mitochondrial outer membrane (GO:0005741)|peroxisome (GO:0005777)|synapse (GO:0045202)	protein homodimerization activity (GO:0042803)			breast(3)|endometrium(2)|kidney(3)|large_intestine(7)|lung(4)|stomach(2)	21						GGGTCTGTCCTCCCCATATGT	0.453																																					p.P210P													.	MFF	48		0			c.T630C												182.0	167.0	172.0					2																	228211978		2203	4300	6503	SO:0001819	synonymous_variant	56947	exon8			CTGTCCTCCCCAT	AF258660	CCDS2465.1, CCDS63139.1, CCDS63140.1, CCDS63141.1, CCDS63142.1, CCDS74662.1	2q36	2008-05-29	2008-05-29	2008-05-29	ENSG00000168958	ENSG00000168958			24858	protein-coding gene	gene with protein product		614785	"""chromosome 2 open reading frame 33"""	C2orf33		18353969	Standard	NM_001277061		Approved	GL004	uc002voy.4	Q9GZY8	OTTHUMG00000133180	ENST00000353339.3:c.630T>C	2.37:g.228211978T>C			Somatic	171	0	0		WXS	Illumina HiSeq	Phase_I	172	0.02	3	NM_020194	63	0.00	0	Q567U1|Q658R6|Q9BVZ1|Q9H690|Q9NRG8	Silent	SNP	ENST00000353339.3	37	CCDS2465.1																																																																																					0.453	MFF-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000256887.2		NM_020194	
ADAM33	80332	mdanderson.org	37	20	3653452	3653452	+	Silent	SNP	C	C	T	rs551532679		TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr20:3653452C>T	ENST00000356518.2	-	12	1468	c.1227G>A	c.(1225-1227)ccG>ccA	p.P409P	ADAM33_ENST00000379861.4_Silent_p.P409P|ADAM33_ENST00000466620.1_5'UTR|ADAM33_ENST00000350009.2_Silent_p.P409P	NM_025220.2	NP_079496.1	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33	409	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|skin(3)	29						GTCCGGGGTCCGGGGCATTGG	0.731																																					p.P409P													.	.			0			c.G1227A												5.0	8.0	7.0					20																	3653452		2021	4056	6077	SO:0001819	synonymous_variant	80332	exon12			GGGGTCCGGGGCA	AL117415, AB055891	CCDS13058.1, CCDS63219.1	20p13	2010-04-06	2005-08-18		ENSG00000149451	ENSG00000149451		"""ADAM metallopeptidase domain containing"""	15478	protein-coding gene	gene with protein product		607114	"""a disintegrin and metalloproteinase domain 33"", ""chromosome 20 open reading frame 153"""	C20orf153		11814695	Standard	XM_005260843		Approved	DKFZp434K0521, dJ964F7.1	uc002wit.3	Q9BZ11	OTTHUMG00000031758	ENST00000356518.2:c.1227G>A	20.37:g.3653452C>T			Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	18	0.11	2	NM_025220	4	0.00	0	A0A1K6|Q5JT75|Q5JT76|Q8N0W6	Silent	SNP	ENST00000356518.2	37	CCDS13058.1																																																																																					0.731	ADAM33-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000077763.2		NM_025220	
APCDD1L	164284	mdanderson.org	37	20	57045759	57045759	+	Missense_Mutation	SNP	G	G	A	rs147147447		TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr20:57045759G>A	ENST00000371149.3	-	2	324	c.94C>T	c.(94-96)Cgc>Tgc	p.R32C	APCDD1L_ENST00000439429.1_Missense_Mutation_p.R43C	NM_153360.1	NP_699191.1	Q8NCL9	APCDL_HUMAN	adenomatosis polyposis coli down-regulated 1-like	32						integral component of membrane (GO:0016021)				large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(1)	18	Lung NSC(12;0.000856)|all_lung(29;0.0025)		BRCA - Breast invasive adenocarcinoma(13;5.6e-11)|Epithelial(14;1.67e-07)|all cancers(14;1.48e-06)			GGTTCCCAGCGCAGGCAGCTG	0.657													G|||	1	0.000199681	0.0	0.0	5008	,	,		13930	0.001		0.0	False		,,,				2504	0.0				p.R32C													.	.			0			c.C94T							G	CYS/ARG	4,4290		0,4,2143	28.0	24.0	25.0		94	4.9	0.0	20	dbSNP_134	25	0,8396		0,0,4198	yes	missense	APCDD1L	NM_153360.1	180	0,4,6341	AA,AG,GG		0.0,0.0932,0.0315	possibly-damaging	32/502	57045759	4,12686	2147	4198	6345	SO:0001583	missense	164284	exon2			CCCAGCGCAGGCA	AK074647	CCDS13467.1	20q13.32	2006-07-07			ENSG00000198768	ENSG00000198768			26892	protein-coding gene	gene with protein product							Standard	NM_153360		Approved	FLJ90166	uc002xze.1	Q8NCL9	OTTHUMG00000032845	ENST00000371149.3:c.94C>T	20.37:g.57045759G>A	ENSP00000360191:p.Arg32Cys		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_153360	1	0.00	0		Missense_Mutation	SNP	ENST00000371149.3	37	CCDS13467.1	.	.	.	.	.	.	.	.	.	.	G	18.15	3.560634	0.65538	9.32E-4	0.0	ENSG00000198768	ENST00000371149;ENST00000439429;ENST00000425773	T;T;T	0.36157	2.41;2.41;1.27	4.88	4.88	0.63580	.	0.714038	0.13697	N	0.369081	T	0.34454	0.0898	L	0.36672	1.1	0.09310	N	1	D;D	0.60160	0.986;0.987	P;P	0.47015	0.534;0.528	T	0.13710	-1.0499	10	0.40728	T	0.16	-12.5397	11.851	0.52412	0.0815:0.0:0.9185:0.0	.	43;32	F5H6V6;Q8NCL9	.;APCDL_HUMAN	C	32;43;43	ENSP00000360191:R32C;ENSP00000413261:R43C;ENSP00000396856:R43C	ENSP00000360191:R32C	R	-	1	0	APCDD1L	56479165	0.993000	0.37304	0.008000	0.14137	0.077000	0.17291	3.652000	0.54439	2.412000	0.81896	0.655000	0.94253	CGC	0		0.657	APCDD1L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000079881.2		NM_153360	
ZNF512B	57473	mdanderson.org	37	20	62594730	62594730	+	Silent	SNP	G	G	A			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr20:62594730G>A	ENST00000450537.1	-	11	1822	c.1762C>T	c.(1762-1764)Ctg>Ttg	p.L588L	ZNF512B_ENST00000217130.3_Silent_p.L588L|ZNF512B_ENST00000369888.1_Silent_p.L588L			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	588					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					ATCTGCTTCAGCACCTTGCGC	0.726																																					p.L588L													.	.			0			c.C1762T												8.0	8.0	8.0					20																	62594730		2148	4200	6348	SO:0001819	synonymous_variant	57473	exon11			GCTTCAGCACCTT	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.1762C>T	20.37:g.62594730G>A			Somatic	18	0	0		WXS	Illumina HiSeq	Phase_I	24	0.08	2	NM_020713	36	0.00	0	Q08AK9|Q9ULM4	Silent	SNP	ENST00000450537.1	37	CCDS13548.1																																																																																					0.726	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080246.1		NM_020713	
ANKRD20A11P	391267	broad.mit.edu	37	21	15352291	15352291	+	RNA	SNP	A	A	C			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr21:15352291A>C	ENST00000344693.5	-	0	467					NR_027270.1				ankyrin repeat domain 20 family, member A11, pseudogene																		TCACCTTTTCACCTCCCCGCC	0.577																																					.													.	.			0			.																																											0	.			CTTTTCACCTCCC			21q11.2	2011-11-23			ENSG00000215559	ENSG00000215559			42024	pseudogene	pseudogene			"""chromosome 21 open reading frame 81"""	C21orf81			Standard	NR_027270		Approved		uc002yjj.4		OTTHUMG00000074237		21.37:g.15352291A>C			Somatic	29	0.3793103448	11		WXS	Illumina HiSeq	Phase_I	31	0.32	10	.	0		0		RNA	SNP	ENST00000344693.5	37																																																																																						0.577	ANKRD20A11P-005	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000157750.1			
RIBC2	26150	bcgsc.ca	37	22	45813494	45813494	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr22:45813494G>T	ENST00000342894.3	+	3	419	c.5G>T	c.(4-6)aGg>aTg	p.R2M	RIBC2_ENST00000538017.1_Missense_Mutation_p.R70M			Q9H4K1	RIBC2_HUMAN	RIB43A domain with coiled-coils 2	2						nucleus (GO:0005634)				NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|skin(2)|urinary_tract(1)	10		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		GCTGAAATGAGGCAAAATGAC	0.333																																					.													.	RIBC2	25		0			.												44.0	44.0	44.0					22																	45813494		2203	4300	6503	SO:0001583	missense	26150	.			AAATGAGGCAAAA	AK098586		22q13.3	2004-08-18	2004-08-18	2004-08-18	ENSG00000128408	ENSG00000128408			13241	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 11"""	C22orf11		12477932	Standard	NM_015653		Approved	DKFZp566F0546, FLJ25720	uc011aqs.3	Q9H4K1	OTTHUMG00000151332	ENST00000342894.3:c.5G>T	22.37:g.45813494G>T	ENSP00000342529:p.Arg2Met		Somatic	185	0	0		WXS	Illumina HiSeq	Phase_1	171	0.04	6	.	5	0.00	0	Q6ICD0|Q9Y413	Missense_Mutation	SNP	ENST00000342894.3	37		.	.	.	.	.	.	.	.	.	.	G	15.22	2.769173	0.49680	.	.	ENSG00000128408	ENST00000342894;ENST00000538017	T;T	0.22945	1.93;1.93	4.85	2.54	0.30619	.	0.435314	0.23718	N	0.045243	T	0.27798	0.0684	.	.	.	0.26774	N	0.969734	P	0.49696	0.927	P	0.49140	0.601	T	0.07888	-1.0749	9	0.41790	T	0.15	-7.6259	7.4039	0.26979	0.5268:0.0:0.4732:0.0	.	2	Q9H4K1	RIBC2_HUMAN	M	2;70	ENSP00000342529:R2M;ENSP00000444196:R70M	ENSP00000342529:R2M	R	+	2	0	RIBC2	44192158	0.860000	0.29831	0.988000	0.46212	0.901000	0.52897	0.401000	0.20948	0.183000	0.20059	0.563000	0.77884	AGG			0.333	RIBC2-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000322250.1		NM_015653	
PKDREJ	10343	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	22	46658471	46658471	+	Missense_Mutation	SNP	G	G	T	rs149432283		TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr22:46658471G>T	ENST00000253255.5	-	1	748	c.749C>A	c.(748-750)cCg>cAg	p.P250Q		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	250	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		GCGCGCGGCCGGGCAGTCCAG	0.706																																					p.P250Q													.	.			0			c.C749A												24.0	28.0	26.0					22																	46658471		2201	4296	6497	SO:0001583	missense	10343	exon1			GCGGCCGGGCAGT	AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.749C>A	22.37:g.46658471G>T	ENSP00000253255:p.Pro250Gln		Somatic	62	0	0		WXS	Illumina HiSeq	.	67	0.06	4	NM_006071	0		0	B1AJY3|O95850	Missense_Mutation	SNP	ENST00000253255.5	37	CCDS14073.1	.	.	.	.	.	.	.	.	.	.	G	15.38	2.815787	0.50527	.	.	ENSG00000130943	ENST00000253255	T	0.68903	-0.36	3.75	-1.66	0.08265	Egg jelly receptor, REJ-like (1);PKD/REJ-like protein (1);	1.424940	0.04586	N	0.395917	T	0.71143	0.3305	L	0.58810	1.83	0.09310	N	1	D	0.64830	0.994	D	0.63192	0.912	T	0.58702	-0.7590	10	0.14656	T	0.56	-5.7628	4.6188	0.12440	0.4314:0.1583:0.4102:0.0	.	250	Q9NTG1	PKDRE_HUMAN	Q	250	ENSP00000253255:P250Q	ENSP00000253255:P250Q	P	-	2	0	PKDREJ	45037135	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.317000	0.08060	-0.318000	0.08665	-0.438000	0.05819	CCG			0.706	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318466.1		NM_006071	
SHANK3	85358	ucsc.edu;bcgsc.ca	37	22	51117453	51117453	+	Silent	SNP	C	C	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr22:51117453C>T	ENST00000414786.2	+	6	834	c.607C>T	c.(607-609)Ctg>Ttg	p.L203L	SHANK3_ENST00000262795.3_Silent_p.L203L|SHANK3_ENST00000445220.2_Silent_p.L203L			Q9BYB0	SHAN3_HUMAN	SH3 and multiple ankyrin repeat domains 3	203					adult behavior (GO:0030534)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|brain morphogenesis (GO:0048854)|dendritic spine morphogenesis (GO:0060997)|guanylate kinase-associated protein clustering (GO:0097117)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell volume (GO:0045794)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glutamate receptor signaling pathway (GO:1900451)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse structural plasticity (GO:0051835)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density assembly (GO:0097107)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of long term synaptic depression (GO:1900452)|regulation of long-term synaptic potentiation (GO:1900271)|social behavior (GO:0035176)|striatal medium spiny neuron differentiation (GO:0021773)|synapse assembly (GO:0007416)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)	8		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		TCAGACCCTGCTGGACCTGGG	0.682																																					p.L203L													.	SHANK3	96		0			c.C607T												10.0	12.0	12.0					22																	51117453		2046	4166	6212	SO:0001819	synonymous_variant	85358	exon6			ACCCTGCTGGACC	AB051437		22q13.3	2013-11-14			ENSG00000251322	ENSG00000251322		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14294	protein-coding gene	gene with protein product	"""proline rich synapse associated protein 2"", ""shank postsynaptic density protein"""	606230				11258795, 11431708, 10806096, 17173049	Standard	NM_033517		Approved	SPANK-2, prosap2, KIAA1650, PSAP2	uc031ryd.1	Q9BYB0	OTTHUMG00000150169	ENST00000414786.2:c.607C>T	22.37:g.51117453C>T			Somatic	35	0	0		WXS	Illumina HiSeq		29	0.14	4	NM_033517	15	0.00	0	D7UT47|Q8TET3	Silent	SNP	ENST00000414786.2	37																																																																																						0.682	SHANK3-001	KNOWN	non_canonical_polymorphism|basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000316674.2		NM_001080420	
SLC22A13	9390	bcgsc.ca;mdanderson.org	37	3	38317788	38317788	+	Silent	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr3:38317788G>T	ENST00000311856.4	+	8	1297	c.1248G>T	c.(1246-1248)gtG>gtT	p.V416V	SLC22A13_ENST00000450935.2_3'UTR	NM_004256.3	NP_004247.2	Q9Y226	S22AD_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 13	416					nicotinate transport (GO:2001142)|organic cation transport (GO:0015695)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	nicotinate transporter activity (GO:0090416)|organic cation transmembrane transporter activity (GO:0015101)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|urinary_tract(1)	20				KIRC - Kidney renal clear cell carcinoma(284;0.0533)|Kidney(284;0.067)		ATCTGCCCGTGGTGGTCACCA	0.622																																					p.V416V													SLC22A13,right_upper_lobe,carcinoma,+1,2	SLC22A13	42	2	0			c.G1248T												104.0	91.0	95.0					3																	38317788		2203	4300	6503	SO:0001819	synonymous_variant	9390	exon8			GCCCGTGGTGGTC	AB010438	CCDS2676.1	3p22.2	2013-07-18	2013-07-18	2003-10-15	ENSG00000172940	ENSG00000172940		"""Solute carriers"""	8494	protein-coding gene	gene with protein product		604047	"""organic cationic transporter-like 3"", ""solute carrier family 22 (organic anion transporter), member 13"""	ORCTL3		10072596, 18411268	Standard	NM_004256		Approved	OCTL1, OCTL3, OAT10	uc003chz.3	Q9Y226	OTTHUMG00000131086	ENST00000311856.4:c.1248G>T	3.37:g.38317788G>T			Somatic	86	0	0		WXS	Illumina HiSeq	Phase_1	86	0.06	5	NM_004256	0		0	B2RCV9|Q8IYG1	Silent	SNP	ENST00000311856.4	37	CCDS2676.1																																																																																					0.622	SLC22A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253746.2		NM_004256	
EPHA6	285220	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	96706454	96706454	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr3:96706454C>T	ENST00000389672.5	+	3	769	c.731C>T	c.(730-732)aCa>aTa	p.T244I	EPHA6_ENST00000542517.1_Missense_Mutation_p.T150I|EPHA6_ENST00000470610.2_Missense_Mutation_p.T244I	NM_001080448.2	NP_001073917.2	Q9UF33	EPHA6_HUMAN	EPH receptor A6	150						integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						AAGATCGACACAATTGCTGCT	0.413																																					p.T244I													.	.			0			c.C731T												183.0	186.0	185.0					3																	96706454		1880	4139	6019	SO:0001583	missense	285220	exon3			TCGACACAATTGC	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000389672.5:c.731C>T	3.37:g.96706454C>T	ENSP00000374323:p.Thr244Ile		Somatic	186	0	0		WXS	Illumina HiSeq	.	172	0.24	41	NM_001080448	2	0.50	1	D6RAL5	Missense_Mutation	SNP	ENST00000389672.5	37	CCDS46876.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.475769	0.84640	.	.	ENSG00000080224	ENST00000470610;ENST00000389672;ENST00000542517	T;T;T	0.05855	3.38;3.38;3.38	5.74	5.74	0.90152	.	0.000000	0.64402	U	0.000002	T	0.38612	0.1047	H	0.94423	3.535	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.52056	-0.8626	10	0.87932	D	0	.	18.9233	0.92534	0.0:1.0:0.0:0.0	.	244;244	B3KS12;E7EU71	.;.	I	244;244;150	ENSP00000420598:T244I;ENSP00000374323:T244I;ENSP00000439758:T150I	ENSP00000374323:T244I	T	+	2	0	EPHA6	98189144	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.703000	0.92315	0.655000	0.94253	ACA			0.413	EPHA6-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000353845.3		NM_001080448	
HCLS1	3059	broad.mit.edu	37	3	121354648	121354648	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr3:121354648C>T	ENST00000314583.3	-	9	716	c.625G>A	c.(625-627)Gct>Act	p.A209T	HCLS1_ENST00000428394.2_Missense_Mutation_p.A172T|HCLS1_ENST00000473883.1_5'UTR	NM_005335.4	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1	209					actin filament polymerization (GO:0030041)|cellular response to cytokine stimulus (GO:0071345)|erythrocyte differentiation (GO:0030218)|intracellular signal transduction (GO:0035556)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell proliferation (GO:0008284)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|regulation of actin filament polymerization (GO:0030833)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	protein kinase binding (GO:0019901)|RNA polymerase II transcription factor binding (GO:0001085)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				GBM - Glioblastoma multiforme(114;0.0912)		AAGCCGACAGCGCTCTGCAGG	0.557																																					p.A209T													.	HCLS1	78		0			c.G625A												78.0	80.0	80.0					3																	121354648		2203	4300	6503	SO:0001583	missense	3059	exon9			CGACAGCGCTCTG		CCDS3003.1	3q13	2007-08-03			ENSG00000180353	ENSG00000180353			4844	protein-coding gene	gene with protein product	"""cortactin-like"""	601306				8978766, 15710041	Standard	NM_001292041		Approved	HS1, CTTNL	uc003eeh.4	P14317	OTTHUMG00000159409	ENST00000314583.3:c.625G>A	3.37:g.121354648C>T	ENSP00000320176:p.Ala209Thr		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	98	0.03	3	NM_005335	124	0.00	0	B4DQ69|Q53Y93|Q6IBK9|Q9UDK0	Missense_Mutation	SNP	ENST00000314583.3	37	CCDS3003.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.573715	0.86542	.	.	ENSG00000180353	ENST00000314583;ENST00000428394	T;T	0.40756	1.02;1.36	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	T	0.70544	0.3236	M	0.89534	3.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.994	T	0.77432	-0.2590	10	0.87932	D	0	-13.9362	15.6436	0.77029	0.0:1.0:0.0:0.0	.	172;209	E7EVW7;P14317	.;HCLS1_HUMAN	T	209;172	ENSP00000320176:A209T;ENSP00000387645:A172T	ENSP00000320176:A209T	A	-	1	0	HCLS1	122837338	1.000000	0.71417	0.944000	0.38274	0.506000	0.33950	6.129000	0.71657	2.624000	0.88883	0.655000	0.94253	GCT			0.557	HCLS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000355144.1		NM_005335	
YEATS2	55689	broad.mit.edu	37	3	183493770	183493770	+	Silent	SNP	A	A	C	rs539213451		TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr3:183493770A>C	ENST00000305135.5	+	18	2631	c.2436A>C	c.(2434-2436)ggA>ggC	p.G812G		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	812	Gly-rich.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			gaggaggaggaggcggcagtg	0.582													a|||	1	0.000199681	0.0	0.0014	5008	,	,		12178	0.0		0.0	False		,,,				2504	0.0				p.G812G													YEATS2,colon,carcinoma,0,2	YEATS2	111	2	0			c.A2436C																																									SO:0001819	synonymous_variant	55689	exon18			AGGAGGAGGCGGC	AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.2436A>C	3.37:g.183493770A>C			Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	40	0.08	3	NM_018023	0		0	A7E2B9|D3DNS9|Q641P6|Q9NW96	Silent	SNP	ENST00000305135.5	37	CCDS43175.1																																																																																					0.582	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000346507.2		NM_018023	
MUC4	4585	bcgsc.ca	37	3	195505805	195505805	+	Missense_Mutation	SNP	A	A	C	rs540560059	byFrequency	TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr3:195505805A>C	ENST00000463781.3	-	2	13105	c.12646T>G	c.(12646-12648)Tca>Gca	p.S4216A	MUC4_ENST00000475231.1_Missense_Mutation_p.S4216A|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTGGATGCTGAGGAAGTGTCG	0.592													.|||	14	0.00279553	0.0015	0.0029	5008	,	,		14788	0.001		0.004	False		,,,				2504	0.0051				p.S4216A													.	MUC4	1505		0			c.T12646G												31.0	26.0	28.0					3																	195505805		692	1581	2273	SO:0001583	missense	4585	exon2			ATGCTGAGGAAGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12646T>G	3.37:g.195505805A>C	ENSP00000417498:p.Ser4216Ala		Somatic	134	0.0149253731	2		WXS	Illumina HiSeq	Phase_1	153	0.06	9	NM_018406	0		0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	a	1.575	-0.533159	0.04082	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.29655	1.56;1.58	0.93	-0.342	0.12635	.	.	.	.	.	T	0.12646	0.0307	N	0.19112	0.55	0.09310	N	1	P	0.37985	0.613	B	0.28139	0.086	T	0.15954	-1.0419	8	.	.	.	.	2.8918	0.05678	0.6746:0.0:0.3254:0.0	.	4088	E7ESK3	.	A	4216	ENSP00000417498:S4216A;ENSP00000420243:S4216A	.	S	-	1	0	MUC4	196990584	.	.	0.001000	0.08648	0.002000	0.02628	.	.	-0.091000	0.12440	0.421000	0.28195	TCA			0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324081.6		NM_018406	
MUC4	4585	bcgsc.ca	37	3	195508165	195508165	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr3:195508165C>T	ENST00000463781.3	-	2	10745	c.10286G>A	c.(10285-10287)aGc>aAc	p.S3429N	MUC4_ENST00000475231.1_Missense_Mutation_p.S3429N|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGAGGAAGTGCTGGTGACAGG	0.577																																					p.S3429N													.	MUC4	1505		0			c.G10286A																																									SO:0001583	missense	4585	exon2			GAAGTGCTGGTGA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10286G>A	3.37:g.195508165C>T	ENSP00000417498:p.Ser3429Asn		Somatic	191	0.0209424084	4		WXS	Illumina HiSeq	Phase_1	264	0.06	15	NM_018406	0		0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	4.411	0.075895	0.08485	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.31510	1.49;1.57	0.894	-1.48	0.08745	.	.	.	.	.	T	0.10809	0.0264	N	0.08118	0	0.09310	N	1	B	0.29212	0.237	B	0.15484	0.013	T	0.16928	-1.0386	8	.	.	.	.	3.6415	0.08169	0.2301:0.5596:0.0:0.2103	.	3301	E7ESK3	.	N	3429	ENSP00000417498:S3429N;ENSP00000420243:S3429N	.	S	-	2	0	MUC4	196992944	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.669000	0.25142	-2.247000	0.00703	-2.041000	0.00417	AGC			0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324081.6		NM_018406	
UCHL1	7345	mdanderson.org	37	4	41259027	41259027	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr4:41259027G>T	ENST00000284440.4	+	1	177		c.e1+1		UCHL1_ENST00000512788.1_Splice_Site|UCHL1_ENST00000508768.1_Splice_Site|UCHL1-AS1_ENST00000507190.1_RNA|UCHL1_ENST00000504818.1_Splice_Site|UCHL1-AS1_ENST00000510073.1_RNA|UCHL1_ENST00000503431.1_Splice_Site	NM_004181.4	NP_004172.2	P09936	UCHL1_HUMAN	ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)						adult walking behavior (GO:0007628)|axon target recognition (GO:0007412)|axon transport of mitochondrion (GO:0019896)|cell death (GO:0008219)|cell proliferation (GO:0008283)|eating behavior (GO:0042755)|muscle fiber development (GO:0048747)|negative regulation of MAP kinase activity (GO:0043407)|neuromuscular process (GO:0050905)|protein deubiquitination (GO:0016579)|response to ischemia (GO:0002931)|sensory perception of pain (GO:0019233)|ubiquitin-dependent protein catabolic process (GO:0006511)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	alpha-2A adrenergic receptor binding (GO:0031694)|cysteine-type endopeptidase activity (GO:0004197)|ligase activity (GO:0016874)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|skin(2)	8						CAACCCCGAGGTGAGCGCCAG	0.617																																					.													.	.			0			c.33+1G>T												82.0	92.0	88.0					4																	41259027		2203	4300	6503	SO:0001630	splice_region_variant	7345	exon1			CCCGAGGTGAGCG	BC000332	CCDS3462.1	4p13	2011-07-21			ENSG00000154277	ENSG00000154277	3.4.19.12	"""Parkinson disease"""	12513	protein-coding gene	gene with protein product		191342		PARK5		1840236	Standard	NM_004181		Approved	PGP9.5, Uch-L1	uc003gvo.3	P09936	OTTHUMG00000099377	ENST00000284440.4:c.33+1G>T	4.37:g.41259027G>T			Somatic	127	0.0157480315	2		WXS	Illumina HiSeq	Phase_I	96	0.04	4	NM_004181	2	0.00	0	Q4W5K6|Q71UM0	Splice_Site	SNP	ENST00000284440.4	37	CCDS3462.1	.	.	.	.	.	.	.	.	.	.	G	18.47	3.630964	0.67015	.	.	ENSG00000154277	ENST00000514924;ENST00000503431;ENST00000284440;ENST00000508768;ENST00000512788	.	.	.	4.78	3.91	0.45181	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.2411	0.48970	0.0927:0.0:0.9073:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UCHL1	40953784	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	5.787000	0.69013	2.486000	0.83907	0.460000	0.39030	.			0.617	UCHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000216827.1		NM_004181	Intron
Unknown	0	bcgsc.ca	37	4	49244875	49244875	+	IGR	SNP	T	T	A			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr4:49244875T>A								AC118282.4 (33410 upstream) : AC119751.5 (340166 downstream)																							GTAGGAAGAGTGCTGAGAAAA	0.378																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GAAGAGTGCTGAG																													4.37:g.49244875T>A			Somatic	29	0.1034482759	3		WXS	Illumina HiSeq	Phase_1	7	0.57	4	.	1	0.00	0		RNA	SNP		37																																																																																					0	0.378										
Unknown	0	bcgsc.ca	37	4	49244932	49244932	+	IGR	SNP	C	C	T	rs201474862		TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr4:49244932C>T								AC118282.4 (33467 upstream) : AC119751.5 (340109 downstream)																							CTGATCATTGCTATTTTCTTA	0.353																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			TCATTGCTATTTT																													4.37:g.49244932C>T			Somatic	19	0	0		WXS	Illumina HiSeq	Phase_1	11	0.64	7	.	0		0		RNA	SNP		37																																																																																					0	0.353										
LARP1B	55132	mdanderson.org	37	4	129019452	129019452	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr4:129019452G>T	ENST00000326639.6	+	8	991	c.780G>T	c.(778-780)caG>caT	p.Q260H	LARP1B_ENST00000264584.5_Missense_Mutation_p.Q213H|LARP1B_ENST00000354456.3_5'UTR|LARP1B_ENST00000432347.2_Missense_Mutation_p.Q260H|LARP1B_ENST00000394288.3_Missense_Mutation_p.Q260H|LARP1B_ENST00000441387.1_Missense_Mutation_p.Q260H|LARP1B_ENST00000512292.1_Missense_Mutation_p.Q260H|LARP1B_ENST00000427266.1_Missense_Mutation_p.Q260H	NM_018078.2	NP_060548.2	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family, member 1B	260	HTH La-type RNA-binding. {ECO:0000255|PROSITE-ProRule:PRU00332}.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(11)|ovary(1)|prostate(3)	34						AGCGTGTTCAGGCTCTCACTA	0.383																																					p.Q260H													LARP1B_ENST00000427266,NS,carcinoma,+2,2	LARP1B_ENST00000427266	2	2	0			c.G780T												92.0	79.0	83.0					4																	129019452		2203	4300	6503	SO:0001583	missense	55132	exon8			TGTTCAGGCTCTC		CCDS3738.1, CCDS47133.1, CCDS64057.1	4q28.2	2009-06-09	2009-06-09	2009-06-09	ENSG00000138709	ENSG00000138709		"""La ribonucleoprotein domain containing"""	24704	protein-coding gene	gene with protein product			"""La ribonucleoprotein domain family, member 2"""	LARP2		12045101	Standard	NM_018078		Approved	FLJ10378, DKFZp434K245, DKFZp686E0316	uc003iga.3	Q659C4	OTTHUMG00000133343	ENST00000326639.6:c.780G>T	4.37:g.129019452G>T	ENSP00000321997:p.Gln260His		Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	92	0.04	4	NM_178043	29	0.00	0	Q2YDB6|Q4W599|Q4W5B2|Q659A0|Q6P5X2|Q7Z3F7|Q86VK7|Q8N6F4|Q8N7H4|Q8NAF2|Q9H5E7|Q9NW12	Missense_Mutation	SNP	ENST00000326639.6	37	CCDS3738.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.3|23.3	4.399233|4.399233	0.83120|0.83120	.|.	.|.	ENSG00000138709|ENSG00000138709	ENST00000507377|ENST00000326639;ENST00000512292;ENST00000508819;ENST00000394288;ENST00000432347;ENST00000264584;ENST00000441387;ENST00000427266	.|T;T;T;T;T;T;T;T	.|0.46063	.|0.88;0.88;0.88;0.88;0.88;0.88;0.88;0.88	5.27|5.27	5.27|5.27	0.74061|0.74061	.|Winged helix-turn-helix transcription repressor DNA-binding (1);RNA-binding protein Lupus La (3);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.69691|0.69691	0.3139|0.3139	M|M	0.90650|0.90650	3.135|3.135	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;0.971;0.984	.|D;D;P;D	.|0.91635	.|0.989;0.999;0.867;0.913	T|T	0.75578|0.75578	-0.3269|-0.3269	5|10	.|0.87932	.|D	.|0	.|.	13.3657|13.3657	0.60682|0.60682	0.0772:0.0:0.9228:0.0|0.0772:0.0:0.9228:0.0	.|.	.|260;260;260;260	.|Q659C4;G3XAJ5;Q659C4-3;G3V0E9	.|LAR1B_HUMAN;.;.;.	C|H	229|260;260;213;260;260;213;260;260	.|ENSP00000321997:Q260H;ENSP00000422850:Q260H;ENSP00000427281:Q213H;ENSP00000377829:Q260H;ENSP00000390395:Q260H;ENSP00000264584:Q213H;ENSP00000396521:Q260H;ENSP00000403586:Q260H	.|ENSP00000264584:Q213H	G|Q	+|+	1|3	0|2	LARP1B|LARP1B	129238902|129238902	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.039000|2.039000	0.41193|0.41193	2.732000|2.732000	0.93576|0.93576	0.650000|0.650000	0.86243|0.86243	GGC|CAG			0.383	LARP1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000257173.2		NM_018078	
ZFP42	132625	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	188924033	188924033	+	Silent	SNP	G	G	A			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr4:188924033G>A	ENST00000326866.4	+	4	480	c.72G>A	c.(70-72)ggG>ggA	p.G24G	ZFP42_ENST00000509524.1_Silent_p.G24G	NM_174900.3	NP_777560.2	Q96MM3	ZFP42_HUMAN	ZFP42 zinc finger protein	24					female gonad development (GO:0008585)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|meiotic nuclear division (GO:0007126)|regulation of genetic imprinting (GO:2000653)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)		CCCCCAGTGGGGCTAAGCCCA	0.557																																					p.G24G													.	.			0			c.G72A												74.0	73.0	73.0					4																	188924033		2203	4300	6503	SO:0001819	synonymous_variant	132625	exon4			CAGTGGGGCTAAG	AK056719	CCDS3849.1	4q35.2	2014-09-04	2012-11-27		ENSG00000179059	ENSG00000179059		"""Zinc fingers, C2H2-type"""	30949	protein-coding gene	gene with protein product		614572	"""zinc finger protein 42 homolog (mouse)"", ""zinc finger protein 42"""			12110702	Standard	NM_174900		Approved	REX1, ZNF754	uc003izh.1	Q96MM3	OTTHUMG00000160235	ENST00000326866.4:c.72G>A	4.37:g.188924033G>A			Somatic	211	0	0		WXS	Illumina HiSeq	.	169	0.46	77	NM_174900	8	0.25	2	D3DP65|Q8WXE2	Silent	SNP	ENST00000326866.4	37	CCDS3849.1																																																																																					0.557	ZFP42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000359794.1		NM_174900	
FER	2241	broad.mit.edu	37	5	108168539	108168539	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr5:108168539G>T	ENST00000281092.4	+	4	660	c.276G>T	c.(274-276)ttG>ttT	p.L92F	CTD-2197I11.1_ENST00000510935.1_RNA|FER_ENST00000536402.1_Missense_Mutation_p.L92F|FER_ENST00000438717.2_Intron|FER_ENST00000502752.1_3'UTR	NM_005246.2	NP_005237.2	P16591	FER_HUMAN	fer (fps/fes related) tyrosine kinase	92	Important for interaction with membranes containing phosphoinositides.				actin cytoskeleton reorganization (GO:0031532)|cell proliferation (GO:0008283)|cell-cell adhesion mediated by cadherin (GO:0044331)|cellular response to insulin stimulus (GO:0032869)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to reactive oxygen species (GO:0034614)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|diapedesis (GO:0050904)|extracellular matrix-cell signaling (GO:0035426)|Fc-epsilon receptor signaling pathway (GO:0038095)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular signal transduction (GO:0035556)|Kit signaling pathway (GO:0038109)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of mast cell activation involved in immune response (GO:0033007)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of fibroblast migration (GO:0010762)|regulation of lamellipodium assembly (GO:0010591)|regulation of protein phosphorylation (GO:0001932)|response to lipopolysaccharide (GO:0032496)|response to platelet-derived growth factor (GO:0036119)|substrate adhesion-dependent cell spreading (GO:0034446)|tyrosine phosphorylation of Stat3 protein (GO:0042503)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|nucleus (GO:0005634)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			NS(2)|biliary_tract(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	32		all_cancers(142;2.86e-06)|all_epithelial(76;9.81e-08)|Prostate(80;0.00972)|Lung NSC(167;0.039)|Ovarian(225;0.0448)|all_lung(232;0.0496)|Colorectal(57;0.0986)|Breast(839;0.152)		OV - Ovarian serous cystadenocarcinoma(64;6.77e-10)|Epithelial(69;4.13e-08)|COAD - Colon adenocarcinoma(37;0.0174)		CAGAGGACTTGAACTCTGGAC	0.378																																					p.L92F	Colon(146;1051 1799 9836 27344 47401)												.	FER	100		0			c.G276T												143.0	130.0	135.0					5																	108168539		2202	4300	6502	SO:0001583	missense	2241	exon4			GGACTTGAACTCT	J03358	CCDS4098.1	5q21	2013-02-14	2008-02-07		ENSG00000151422	ENSG00000151422	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""SH2 domain containing"""	3655	protein-coding gene	gene with protein product	"""phosphoprotein NCP94"", ""protein phosphatase 1, regulatory subunit 74"""	176942					Standard	NM_005246		Approved	TYK3, PPP1R74	uc003kop.1	P16591	OTTHUMG00000128751	ENST00000281092.4:c.276G>T	5.37:g.108168539G>T	ENSP00000281092:p.Leu92Phe		Somatic	290	0.0034482759	1		WXS	Illumina HiSeq	Phase_I	241	0.03	7	NM_005246	3	0.00	0	B2RCR4|B4DSQ2|H2FLB8	Missense_Mutation	SNP	ENST00000281092.4	37	CCDS4098.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.059872	0.76074	.	.	ENSG00000151422	ENST00000281092;ENST00000536402	T;T	0.61274	0.12;0.12	6.0	-6.77	0.01727	Fps/Fes/Fer/CIP4 homology (2);	0.000000	0.85682	D	0.000000	T	0.63803	0.2542	M	0.76170	2.325	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.67059	-0.5766	10	0.72032	D	0.01	-7.6808	4.7459	0.13036	0.1366:0.2567:0.4736:0.1331	.	92;92	Q6PEJ9;P16591	.;FER_HUMAN	F	92	ENSP00000281092:L92F;ENSP00000442627:L92F	ENSP00000281092:L92F	L	+	3	2	FER	108196438	0.992000	0.36948	0.930000	0.37139	0.984000	0.73092	0.254000	0.18314	-0.849000	0.04158	-0.302000	0.09304	TTG			0.378	FER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250664.1		NM_005246	
PCDHB8	56128	hgsc.bcm.edu	37	5	140559196	140559196	+	Silent	SNP	G	G	T	rs146788088		TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr5:140559196G>T	ENST00000239444.2	+	1	1826	c.1581G>T	c.(1579-1581)gcG>gcT	p.A527A	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	527	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCCTGCAGGCGTTCGAGTTCC	0.682																																					p.A527A													PCDHB8,NS,carcinoma,+1,1	PCDHB8	1	1	0			c.G1581T												89.0	147.0	127.0					5																	140559196		2203	4300	6503	SO:0001819	synonymous_variant	56128	exon1			GCAGGCGTTCGAG	AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1581G>T	5.37:g.140559196G>T			Somatic	85	0.0235294118	2		WXS	Illumina HiSeq	.	78	0.05	4	NM_019120	0		0	B9EGV1	Silent	SNP	ENST00000239444.2	37	CCDS4250.1																																																																																					0.682	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251816.2		NM_019120	
TNIP1	10318	mdanderson.org	37	5	150439917	150439917	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr5:150439917G>T	ENST00000389378.2	-	5	985	c.397C>A	c.(397-399)Cag>Aag	p.Q133K	TNIP1_ENST00000523338.1_Missense_Mutation_p.Q133K|TNIP1_ENST00000522226.1_Missense_Mutation_p.Q133K|TNIP1_ENST00000521591.1_Missense_Mutation_p.Q133K|TNIP1_ENST00000524280.1_Missense_Mutation_p.Q133K|TNIP1_ENST00000315050.7_Missense_Mutation_p.Q133K|TNIP1_ENST00000518977.1_Missense_Mutation_p.Q133K|TNIP1_ENST00000523200.1_Missense_Mutation_p.Q133K|TNIP1_ENST00000520931.1_Missense_Mutation_p.Q80K	NM_001252385.1|NM_001252393.1|NM_001258454.1|NM_006058.4	NP_001239314.1|NP_001239322.1|NP_001245383.1|NP_006049.3	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1	133	Interacts with Nef.				defense response (GO:0006952)|glycoprotein biosynthetic process (GO:0009101)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|modulation by symbiont of host I-kappaB kinase/NF-kappaB cascade (GO:0085032)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral genome replication (GO:0045071)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|translation (GO:0006412)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	mitogen-activated protein kinase binding (GO:0051019)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(5)|ovary(2)|prostate(2)|skin(3)	23		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGTGAATTCTGCTCCTCAGGA	0.577																																					p.Q133K													.	.			0			c.C397A												90.0	85.0	87.0					5																	150439917		2203	4300	6503	SO:0001583	missense	10318	exon5			AATTCTGCTCCTC	AJ011895	CCDS34280.1, CCDS58982.1, CCDS58983.1, CCDS58984.1, CCDS58985.1, CCDS75359.1	5q32-q33.1	2008-07-18							16903	protein-coding gene	gene with protein product	"""virion-associated nuclear-shuttling protein"", ""Nef-associated factor 1 SNP"""	607714				9923610, 11090181	Standard	NM_001252385		Approved	NAF1, KIAA0113, ABIN-1, VAN	uc003ltj.3	Q15025		ENST00000389378.2:c.397C>A	5.37:g.150439917G>T	ENSP00000374029:p.Gln133Lys		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_001252385	169	0.00	0	A4F1W8|A4F1W9|A4F1X2|A4F1X4|A4F1X5|A4F1X6|A4F1X7|A4F1X9|B7Z699|E7EPY1|E7ET96|O76008|Q05KP3|Q05KP4|Q6N077|Q96EL9|Q99833|Q9H1J3	Missense_Mutation	SNP	ENST00000389378.2	37	CCDS34280.1	.	.	.	.	.	.	.	.	.	.	G	3.878	-0.026446	0.07589	.	.	ENSG00000145901	ENST00000520931;ENST00000389378;ENST00000315050;ENST00000523338;ENST00000544828;ENST00000417127;ENST00000539213;ENST00000522226;ENST00000521591;ENST00000518977;ENST00000524280;ENST00000523200;ENST00000545840;ENST00000522100;ENST00000520695;ENST00000521001	T;T;T;T;T;T;T;T;T;T;T;T	0.44083	2.87;2.87;2.87;2.87;2.87;2.87;2.87;2.87;2.88;2.65;1.04;0.93	5.24	4.31	0.51392	.	0.330527	0.31963	N	0.006791	T	0.24661	0.0598	N	0.20685	0.6	0.34431	D	0.69854	B;B;B;B;B;B;B	0.12630	0.002;0.003;0.004;0.003;0.006;0.002;0.001	B;B;B;B;B;B;B	0.10450	0.005;0.002;0.005;0.002;0.002;0.005;0.002	T	0.17684	-1.0361	10	0.08381	T	0.77	-6.907	12.0207	0.53342	0.0:0.0:0.8276:0.1724	.	133;87;87;133;133;133;133	B7Z8K2;A4F1X9;A4F1X7;E7EPY1;E7ET96;A4F1W9;Q15025	.;.;.;.;.;.;TNIP1_HUMAN	K	80;133;133;133;90;90;95;133;133;133;133;133;90;80;133;133	ENSP00000429891:Q80K;ENSP00000374029:Q133K;ENSP00000317891:Q133K;ENSP00000428243:Q133K;ENSP00000428187:Q133K;ENSP00000430760:Q133K;ENSP00000430971:Q133K;ENSP00000429912:Q133K;ENSP00000431105:Q133K;ENSP00000428487:Q80K;ENSP00000430279:Q133K;ENSP00000428404:Q133K	ENSP00000317891:Q133K	Q	-	1	0	TNIP1	150420110	0.502000	0.26107	0.997000	0.53966	0.271000	0.26615	1.542000	0.36137	2.595000	0.87683	0.655000	0.94253	CAG			0.577	TNIP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000374914.1		NM_006058	
MTCH1	23787	mdanderson.org	37	6	36953795	36953795	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr6:36953795C>A	ENST00000373627.5	-	1	279	c.155G>T	c.(154-156)cGc>cTc	p.R52L	MTCH1_ENST00000373616.5_Missense_Mutation_p.R52L|MTCH1_ENST00000538808.1_5'UTR	NM_001271641.1	NP_001258570.1	Q9NZJ7	MTCH1_HUMAN	mitochondrial carrier 1	52					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|neuronal ion channel clustering (GO:0045161)|positive regulation of apoptotic process (GO:0043065)|regulation of signal transduction (GO:0009966)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	6						CCGAGGGTGGCGAGGATGTGC	0.751																																					p.R52L													.	.			0			c.G155T												3.0	3.0	3.0					6																	36953795		1775	3497	5272	SO:0001583	missense	23787	exon1			GGGTGGCGAGGAT	AF151822	CCDS4828.1, CCDS64411.1	6p21.2	2013-05-22	2011-05-19		ENSG00000137409	ENSG00000137409		"""Solute carriers"""	17586	protein-coding gene	gene with protein product	"""solute carrier family 25, member 49"""	610449	"""mitochondrial carrier homolog 1 (C. elegans)"""			12377771	Standard	NM_014341		Approved	CGI-64, PSAP, SLC25A49	uc003ond.2	Q9NZJ7	OTTHUMG00000014614	ENST00000373627.5:c.155G>T	6.37:g.36953795C>A	ENSP00000362730:p.Arg52Leu		Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	34	0.09	3	NM_014341	211	0.00	0	A8KAX5|B2RCE3|Q6PK60|Q6UX45|Q7L465|Q9BW23|Q9NZR6|Q9UJZ5	Missense_Mutation	SNP	ENST00000373627.5	37		.	.	.	.	.	.	.	.	.	.	C	11.55	1.673346	0.29693	.	.	ENSG00000137409	ENST00000373616;ENST00000373627;ENST00000460219	T;T;T	0.73047	1.59;1.6;-0.71	3.41	1.6	0.23607	.	0.612692	0.12686	U	0.447570	T	0.26122	0.0637	N	0.08118	0	0.80722	D	1	P;B;B	0.38827	0.649;0.054;0.166	B;B;B	0.29598	0.104;0.01;0.022	T	0.08229	-1.0732	10	0.59425	D	0.04	-0.9899	7.1666	0.25693	0.0:0.7733:0.0:0.2267	.	34;52;52	Q8IW90;Q9NZJ7;Q9NZJ7-2	.;MTCH1_HUMAN;.	L	52;52;36	ENSP00000362718:R52L;ENSP00000362730:R52L;ENSP00000419739:R36L	ENSP00000362718:R52L	R	-	2	0	MTCH1	37061773	1.000000	0.71417	0.831000	0.32960	0.010000	0.07245	1.690000	0.37711	0.441000	0.26529	-0.237000	0.12165	CGC			0.751	MTCH1-008	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000040396.1		NM_014341	
DST	667	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	56422278	56422278	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr6:56422278T>C	ENST00000361203.3	-	55	13853	c.13846A>G	c.(13846-13848)Aga>Gga	p.R4616G	DST_ENST00000421834.2_Missense_Mutation_p.R2530G|DST_ENST00000370788.2_Missense_Mutation_p.R2530G|DST_ENST00000370769.4_Missense_Mutation_p.R4618G|DST_ENST00000370754.5_Missense_Mutation_p.R4796G|DST_ENST00000312431.6_3'UTR|DST_ENST00000244364.6_Missense_Mutation_p.R2204G|DST_ENST00000446842.2_Missense_Mutation_p.R4292G			Q03001	DYST_HUMAN	dystonin	4616					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TTTTGTTGTCTATCAATTGTT	0.343																																					p.R2204G													.	.			0			c.A6610G												138.0	123.0	128.0					6																	56422278		1806	4069	5875	SO:0001583	missense	667	exon40			GTTGTCTATCAAT	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.13846A>G	6.37:g.56422278T>C	ENSP00000354508:p.Arg4616Gly		Somatic	154	0	0		WXS	Illumina HiSeq	.	142	0.30	43	NM_015548	1	0.00	0	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	T	19.79	3.892735	0.72524	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.61392	0.11;0.11;0.11;0.11;0.11;0.11;0.11	5.87	5.87	0.94306	.	0.000000	0.64402	D	0.000012	T	0.71829	0.3386	M	0.76574	2.34	0.28543	N	0.911991	D;D;D;D;D	0.89917	0.997;1.0;1.0;1.0;0.999	D;D;D;D;D	0.91635	0.994;0.999;0.999;0.998;0.994	T	0.75906	-0.3152	9	0.87932	D	0	.	16.5764	0.84681	0.0:0.0:0.0:1.0	.	2530;4618;4796;4616;2204	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	G	2204;4796;4618;2530;4292;2530;4616	ENSP00000244364:R2204G;ENSP00000359790:R4796G;ENSP00000359805:R4618G;ENSP00000400883:R2530G;ENSP00000393645:R4292G;ENSP00000359824:R2530G;ENSP00000354508:R4616G	ENSP00000244364:R2204G	R	-	1	2	DST	56530237	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.062000	0.71155	2.371000	0.80710	0.533000	0.62120	AGA			0.343	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000041021.3		NM_001723	
MAP3K7	6885	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	91254350	91254350	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr6:91254350G>T	ENST00000369329.3	-	12	1373	c.1212C>A	c.(1210-1212)gcC>gcA	p.A404A	MAP3K7_ENST00000369332.3_Intron|MAP3K7_ENST00000369320.1_Intron|MAP3K7_ENST00000369327.3_Intron|MAP3K7_ENST00000369325.3_Splice_Site_p.A404A	NM_145331.2	NP_663304.1	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7	404					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone H3 acetylation (GO:0043966)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of ripoptosome assembly involved in necroptotic process (GO:1902443)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|regulation of reactive oxygen species metabolic process (GO:2000377)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	28		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		GCTTGGAATAGGCTGCAAAAA	0.383																																					p.A404A													MAP3K7_ENST00000369329,NS,carcinoma,-1,1	MAP3K7_ENST00000369329	-1	1	0			c.C1212A												105.0	102.0	103.0					6																	91254350		2203	4300	6503	SO:0001630	splice_region_variant	6885	exon12			GGAATAGGCTGCA	AB009356	CCDS5027.1, CCDS5028.1, CCDS5029.1, CCDS5030.1	6q15	2011-06-09			ENSG00000135341	ENSG00000135341		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6859	protein-coding gene	gene with protein product		602614		TAK1		9466656	Standard	NM_003188		Approved	MEKK7	uc003pnz.2	O43318	OTTHUMG00000015217	ENST00000369329.3:c.1211-1C>A	6.37:g.91254350G>T			Somatic	154	0	0		WXS	Illumina HiSeq	.	188	0.32	60	NM_145331	19	0.32	6	B2RE27|E1P523|O43317|O43319|Q5TDN2|Q5TDN3|Q5TDT7|Q9NTR3|Q9NZ70	Silent	SNP	ENST00000369329.3	37	CCDS5028.1																																																																																					0.383	MAP3K7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000041530.1		NM_145331	Silent
UST	10090	broad.mit.edu	37	6	149262435	149262435	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr6:149262435G>T	ENST00000367463.4	+	3	415	c.312G>T	c.(310-312)caG>caT	p.Q104H		NM_005715.2	NP_005706.1	Q9Y2C2	UST_HUMAN	uronyl-2-sulfotransferase	104					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)			breast(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(2)	12		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)		TCCCAAGCCAGGTGGTGTACA	0.438																																					p.Q104H													.	UST	42		0			c.G312T												157.0	150.0	152.0					6																	149262435		2203	4300	6503	SO:0001583	missense	10090	exon3			AAGCCAGGTGGTG	AB020316	CCDS5213.1	6q25.1	2008-02-05			ENSG00000111962	ENSG00000111962		"""Sulfotransferases, membrane-bound"""	17223	protein-coding gene	gene with protein product		610752				10187838	Standard	NM_005715		Approved	2OST	uc003qmg.3	Q9Y2C2	OTTHUMG00000016135	ENST00000367463.4:c.312G>T	6.37:g.149262435G>T	ENSP00000356433:p.Gln104His		Somatic	195	0	0		WXS	Illumina HiSeq	Phase_I	209	0.02	4	NM_005715	4	0.00	0	B2RCX6	Missense_Mutation	SNP	ENST00000367463.4	37	CCDS5213.1	.	.	.	.	.	.	.	.	.	.	G	16.70	3.196292	0.58126	.	.	ENSG00000111962	ENST00000367463	T	0.40476	1.03	5.95	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.38904	0.1058	L	0.59436	1.845	0.52501	D	0.999955	D	0.61697	0.99	D	0.65323	0.934	T	0.29027	-1.0025	10	0.15066	T	0.55	-26.5993	6.7097	0.23270	0.2729:0.0:0.7271:0.0	.	104	Q9Y2C2	UST_HUMAN	H	104	ENSP00000356433:Q104H	ENSP00000356433:Q104H	Q	+	3	2	UST	149304128	1.000000	0.71417	1.000000	0.80357	0.766000	0.43426	3.354000	0.52254	2.817000	0.96982	0.563000	0.77884	CAG			0.438	UST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000043363.1		NM_005715	
SDK1	221935	mdanderson.org	37	7	4198179	4198179	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr7:4198179G>T	ENST00000404826.2	+	31	4864	c.4725G>T	c.(4723-4725)caG>caT	p.Q1575H	SDK1_ENST00000389531.3_Missense_Mutation_p.Q1575H	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1575	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CCACGCTGCAGGATGGTGAGC	0.617																																					p.Q1575H													.	.			0			c.G4725T												77.0	70.0	72.0					7																	4198179		2203	4300	6503	SO:0001583	missense	221935	exon31			GCTGCAGGATGGT	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.4725G>T	7.37:g.4198179G>T	ENSP00000385899:p.Gln1575His		Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	52	0.06	3	NM_152744	26	0.00	0	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	G	17.05	3.289218	0.59976	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.55052	0.54;0.54	4.81	1.42	0.22433	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000005	T	0.69975	0.3171	M	0.82193	2.58	0.44908	D	0.997922	D;D;D	0.89917	1.0;0.999;0.997	D;D;D	0.79784	0.993;0.954;0.962	T	0.70802	-0.4773	10	0.54805	T	0.06	.	10.4462	0.44495	0.2637:0.0:0.7363:0.0	.	1575;62;1575	F8W6X9;F2Z3E9;Q7Z5N4	.;.;SDK1_HUMAN	H	1575	ENSP00000385899:Q1575H;ENSP00000374182:Q1575H	ENSP00000374182:Q1575H	Q	+	3	2	SDK1	4164705	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	1.275000	0.33144	0.428000	0.26173	0.563000	0.77884	CAG			0.617	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000323702.1		NM_152744	
DAGLB	221955	broad.mit.edu	37	7	6485734	6485734	+	Splice_Site	SNP	A	A	C			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr7:6485734A>C	ENST00000297056.6	-	2	266	c.97T>G	c.(97-99)Tgg>Ggg	p.W33G	KDELR2_ENST00000463747.1_5'UTR|DAGLB_ENST00000428902.2_5'UTR|DAGLB_ENST00000479922.2_5'UTR|DAGLB_ENST00000425398.2_Splice_Site_p.W33G|DAGLB_ENST00000421761.2_5'UTR|DAGLB_ENST00000436575.1_5'UTR	NM_139179.3	NP_631918.3	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta	33					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|lipid catabolic process (GO:0016042)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|urinary_tract(2)	26		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)		ATGCCAATCCACCTGGCAAAA	0.473																																					p.W33G													.	DAGLB	74		0			c.T97G												52.0	45.0	47.0					7																	6485734		2203	4300	6503	SO:0001630	splice_region_variant	221955	exon2			CAATCCACCTGGC	AF450090	CCDS5350.1, CCDS47536.1	7p22.1	2008-03-18			ENSG00000164535	ENSG00000164535	3.1.1.-		28923	protein-coding gene	gene with protein product		614016					Standard	NM_139179		Approved	KCCR13L, DAGLBETA	uc003sqa.3	Q8NCG7	OTTHUMG00000125513	ENST00000297056.6:c.96-1T>G	7.37:g.6485734A>C			Somatic	71	0.2957746479	21		WXS	Illumina HiSeq	Phase_I	112	0.31	35	NM_139179	20	0.00	0	A4D2P3|B3KV90|B4DQU0|Q6PIX3|Q8N2N2|Q8N9S1|Q8TED3|Q8WXE6	Splice_Site	SNP	ENST00000297056.6	37	CCDS5350.1	.	.	.	.	.	.	.	.	.	.	A	12.73	2.024227	0.35701	.	.	ENSG00000164535	ENST00000297056;ENST00000425398;ENST00000471132;ENST00000432248	T;T	0.43294	0.99;0.95	4.61	2.06	0.26882	.	0.242001	0.37304	N	0.002160	T	0.37320	0.0999	L	0.43152	1.355	0.80722	D	1	P;D	0.59357	0.839;0.985	B;P	0.49799	0.425;0.622	T	0.07558	-1.0766	10	0.24483	T	0.36	-2.0968	7.5229	0.27639	0.711:0.1478:0.0:0.1412	.	33;33	B4DQU0;Q8NCG7	.;DGLB_HUMAN	G	33	ENSP00000297056:W33G;ENSP00000391171:W33G	ENSP00000297056:W33G	W	-	1	0	DAGLB	6452259	1.000000	0.71417	0.982000	0.44146	0.206000	0.24218	5.999000	0.70665	0.202000	0.20498	-0.636000	0.03981	TGG			0.473	DAGLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000246840.2		NM_139179	Missense_Mutation
MYO1G	64005	broad.mit.edu	37	7	45016249	45016249	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr7:45016249A>C	ENST00000258787.7	-	3	448	c.312T>G	c.(310-312)agT>agG	p.S104R		NM_033054.2	NP_149043.2	B0I1T2	MYO1G_HUMAN	myosin IG	104	Myosin motor.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|skin(4)	28						TCCCTGCCCCACTCTCCCCTG	0.577																																					p.S104R													.	MYO1G	86		0			c.T312G												137.0	107.0	117.0					7																	45016249		2203	4300	6503	SO:0001583	missense	64005	exon3			TGCCCCACTCTCC	AF380932	CCDS34629.1	7p13-p11.2	2011-09-27			ENSG00000136286	ENSG00000136286		"""Myosins / Myosin superfamily : Class I"""	13880	protein-coding gene	gene with protein product	"""minor histocompatibility antigen HA-2"""	600642					Standard	NM_033054		Approved	HA-2	uc003tmh.2	B0I1T2	OTTHUMG00000155821	ENST00000258787.7:c.312T>G	7.37:g.45016249A>C	ENSP00000258787:p.Ser104Arg		Somatic	154	0.038961039	6		WXS	Illumina HiSeq	Phase_I	175	0.05	8	NM_033054	1	0.00	0	Q8TEI9|Q8TES2|Q96BE2|Q96RI5|Q96RI6	Missense_Mutation	SNP	ENST00000258787.7	37	CCDS34629.1	.	.	.	.	.	.	.	.	.	.	A	19.34	3.808044	0.70797	.	.	ENSG00000136286	ENST00000258787	D	0.96232	-3.95	4.2	-4.17	0.03857	Myosin head, motor domain (3);	0.000000	0.43747	D	0.000534	D	0.98188	0.9401	H	0.94964	3.605	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97593	1.0118	10	0.87932	D	0	.	14.8221	0.70082	0.2974:0.0:0.7026:0.0	.	104;104	B0I1T2-4;B0I1T2	.;MYO1G_HUMAN	R	104	ENSP00000258787:S104R	ENSP00000258787:S104R	S	-	3	2	MYO1G	44982774	0.636000	0.27207	0.960000	0.40013	0.963000	0.63663	-0.009000	0.12765	-0.968000	0.03578	0.533000	0.62120	AGT			0.577	MYO1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000341832.2			
GIGYF1	64599	mdanderson.org	37	7	100280727	100280727	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr7:100280727G>T	ENST00000275732.5	-	19	3529	c.2320C>A	c.(2320-2322)Ctc>Atc	p.L774I	GIGYF1_ENST00000471340.2_5'Flank	NM_022574.4	NP_072096.2	O75420	PERQ1_HUMAN	GRB10 interacting GYF protein 1	774					insulin-like growth factor receptor signaling pathway (GO:0048009)					central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					AACTCCAGGAGCGTCTTCATG	0.706																																					p.L774I													.	.			0			c.C2320A												6.0	8.0	7.0					7																	100280727		2098	4176	6274	SO:0001583	missense	64599	exon19			CCAGGAGCGTCTT	AF053356	CCDS34708.1	7q22	2008-02-11	2008-02-11	2008-02-11	ENSG00000146830	ENSG00000146830			9126	protein-coding gene	gene with protein product	"""GYF domain containing 1"""	612064	"""PERQ amino acid rich, with GYF domain 1"""	PERQ1		9799793, 12771153	Standard	NM_022574		Approved	GYF1	uc003uwg.1	O75420	OTTHUMG00000157036	ENST00000275732.5:c.2320C>A	7.37:g.100280727G>T	ENSP00000275732:p.Leu774Ile		Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_022574	100	0.00	0	Q6Y7W7|Q8WZ38	Missense_Mutation	SNP	ENST00000275732.5	37	CCDS34708.1	.	.	.	.	.	.	.	.	.	.	.	13.25	2.182281	0.38511	.	.	ENSG00000146830	ENST00000539430;ENST00000275732	D	0.86865	-2.18	4.34	3.46	0.39613	.	0.000000	0.56097	D	0.000021	D	0.86451	0.5936	L	0.29908	0.895	0.43971	D	0.996655	P	0.52842	0.956	P	0.62184	0.899	D	0.85303	0.1074	10	0.56958	D	0.05	-10.7747	7.8899	0.29672	0.1121:0.0:0.8879:0.0	.	774	O75420	PERQ1_HUMAN	I	493;774	ENSP00000275732:L774I	ENSP00000275732:L774I	L	-	1	0	GIGYF1	100118663	1.000000	0.71417	0.975000	0.42487	0.545000	0.35147	2.955000	0.49121	1.059000	0.40554	0.313000	0.20887	CTC			0.706	GIGYF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347205.2		NM_022574	
LHFPL3	375612	mdanderson.org	37	7	103969251	103969251	+	Silent	SNP	C	C	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr7:103969251C>T	ENST00000535008.1	+	1	148	c.24C>T	c.(22-24)gcC>gcT	p.A8A	LHFPL3_ENST00000543266.1_Silent_p.A8A|LHFPL3_ENST00000424859.1_5'UTR|LHFPL3_ENST00000401970.2_5'UTR			Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3	8						integral component of membrane (GO:0016021)		p.A8A(1)		kidney(1)|large_intestine(2)|lung(6)	9						ccgccgctgccgccgccgccg	0.721																																					p.A8A													LHFPL3,NS,carcinoma,0,1	LHFPL3	0	1	1	Substitution - coding silent(1)	kidney(1)	c.C24T												11.0	14.0	13.0					7																	103969251		1949	4092	6041	SO:0001819	synonymous_variant	375612	exon1			CGCTGCCGCCGCC	AY260763		7q22.2	2006-06-13			ENSG00000187416	ENSG00000187416			6589	protein-coding gene	gene with protein product		609719	"""lipoma HMGIC fusion partner-like 4"""	LHFPL4		10329012	Standard	NM_199000		Approved		uc003vce.3	Q86UP9	OTTHUMG00000157273	ENST00000535008.1:c.24C>T	7.37:g.103969251C>T			Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_199000	0		0	A1L383|A4D0Q5	Silent	SNP	ENST00000535008.1	37																																																																																						0.721	LHFPL3-201	KNOWN	basic	protein_coding	protein_coding				NM_199000	
LRGUK	136332	broad.mit.edu	37	7	133943050	133943050	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr7:133943050G>T	ENST00000285928.2	+	19	2309	c.2240G>T	c.(2239-2241)cGg>cTg	p.R747L		NM_144648.1	NP_653249.1	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain containing	747						cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)			breast(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	49						TCATTGTTTCGGTTCTGTCCG	0.453																																					p.R747L													LRGUK,NS,carcinoma,+1,1	LRGUK	113	1	0			c.G2240T												149.0	141.0	143.0					7																	133943050		2203	4300	6503	SO:0001583	missense	136332	exon19			TGTTTCGGTTCTG	AK057348	CCDS5830.1	7q33	2006-10-27			ENSG00000155530	ENSG00000155530			21964	protein-coding gene	gene with protein product							Standard	NM_144648		Approved	FLJ32786	uc003vrm.1	Q96M69	OTTHUMG00000155320	ENST00000285928.2:c.2240G>T	7.37:g.133943050G>T	ENSP00000285928:p.Arg747Leu		Somatic	206	0	0		WXS	Illumina HiSeq	Phase_I	295	0.02	6	NM_144648	0		0	Q2M3I1	Missense_Mutation	SNP	ENST00000285928.2	37	CCDS5830.1	.	.	.	.	.	.	.	.	.	.	g	9.651	1.141454	0.21205	.	.	ENSG00000155530	ENST00000285928	T	0.36340	1.26	3.64	-7.28	0.01456	.	2.405000	0.01522	N	0.018393	T	0.17789	0.0427	N	0.14661	0.345	0.09310	N	1	B	0.23735	0.09	B	0.17722	0.019	T	0.11275	-1.0594	10	0.59425	D	0.04	10.2392	2.381	0.04354	0.2036:0.3904:0.2779:0.128	.	747	Q96M69	LRGUK_HUMAN	L	747	ENSP00000285928:R747L	ENSP00000285928:R747L	R	+	2	0	LRGUK	133593590	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.000000	0.03693	-1.751000	0.01326	-1.080000	0.02220	CGG			0.453	LRGUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000339442.1		NM_144648	
PRSS3P2	154754	broad.mit.edu	37	7	142480429	142480430	+	RNA	INS	-	-	AC			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr7:142480429_142480430insAC	ENST00000603901.1	+	0	200					NR_001296.3		Q8NHM4	TRY6_HUMAN	protease, serine, 3 pseudogene 2						endothelial cell migration (GO:0043542)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)										cagggcaattatcaggaatttt	0.396																																					.													.	.			0			.																																											0	.			GCAATTATCAGGA			7q34	2012-03-06			ENSG00000250606	ENSG00000275896			43788	pseudogene	pseudogene	"""trypsinogen C"""						Standard	NR_001296		Approved	TRY6	uc011ksq.2	Q8NHM4	OTTHUMG00000158904		7.37:g.142480429_142480430insAC			Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	INS	ENST00000603901.1	37																																																																																						0.396	PRSS3P2-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000470000.1		NR_001296	
ZNF775	285971	broad.mit.edu;mdanderson.org	37	7	150094605	150094605	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr7:150094605T>C	ENST00000329630.5	+	3	1143	c.1036T>C	c.(1036-1038)Ttc>Ctc	p.F346L		NM_173680.3	NP_775951.2	Q96BV0	ZN775_HUMAN	zinc finger protein 775	346					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(7)|skin(1)	11	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.0173)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGGCCGCGGCTTCCGCCAGAA	0.736																																					p.F346L													.	ZNF775	34		0			c.T1036C												4.0	6.0	5.0					7																	150094605		1902	3839	5741	SO:0001583	missense	285971	exon3			CGCGGCTTCCGCC	BC038111	CCDS43678.1	7q36.1	2013-01-08			ENSG00000196456	ENSG00000196456		"""Zinc fingers, C2H2-type"""	28501	protein-coding gene	gene with protein product						12477932	Standard	NM_173680		Approved	MGC33584	uc003whf.1	Q96BV0	OTTHUMG00000158324	ENST00000329630.5:c.1036T>C	7.37:g.150094605T>C	ENSP00000330838:p.Phe346Leu		Somatic	10	0	0		WXS	Illumina HiSeq	Phase_I	14	0.36	5	NM_173680	21	0.19	4	Q8IY24	Missense_Mutation	SNP	ENST00000329630.5	37	CCDS43678.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.122383	0.77436	.	.	ENSG00000196456	ENST00000329630	T	0.41065	1.01	3.78	3.78	0.43462	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.54886	0.1886	M	0.67953	2.075	0.34282	D	0.682289	P	0.52061	0.95	P	0.58520	0.84	T	0.66590	-0.5885	8	.	.	.	.	10.4888	0.44739	0.0:0.0:0.0:1.0	.	346	Q96BV0	ZN775_HUMAN	L	346	ENSP00000330838:F346L	.	F	+	1	0	ZNF775	149725538	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	1.908000	0.39907	1.571000	0.49722	0.260000	0.18958	TTC			0.736	ZNF775-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350679.1		NM_173680	
KMT2C	58508	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	7	152012230	152012230	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr7:152012230G>A	ENST00000262189.6	-	4	801	c.583C>T	c.(583-585)Cag>Tag	p.Q195*	KMT2C_ENST00000355193.2_Nonsense_Mutation_p.Q195*	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	195					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TACTTTCTCTGTCCTCTTTGT	0.338																																					p.Q195X													MLL3_ENST00000355193,NS,carcinoma,0,2	MLL3_ENST00000355193	0	2	0			c.C583T												218.0	186.0	197.0					7																	152012230		2203	4300	6503	SO:0001587	stop_gained	58508	exon4			TTCTCTGTCCTCT	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.583C>T	7.37:g.152012230G>A	ENSP00000262189:p.Gln195*		Somatic	215	0	0		WXS	Illumina HiSeq	.	274	0.26	71	NM_170606	0		0	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Nonsense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	37	6.249618	0.97412	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	.	.	.	5.78	5.78	0.91487	.	0.000000	0.42821	D	0.000647	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	20.0137	0.97470	0.0:0.0:1.0:0.0	.	.	.	.	X	195	.	ENSP00000262189:Q195X	Q	-	1	0	MLL3	151643163	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.980000	0.56895	2.734000	0.93682	0.563000	0.77884	CAG			0.338	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000318887.3			
CNBD1	168975	broad.mit.edu	37	8	88613386	88613386	+	RNA	DEL	T	T	-	rs561786984|rs557463556	byFrequency	TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr8:88613386delT	ENST00000517711.1	-	0	232				AF121898.3_ENST00000440763.2_RNA|AF121898.3_ENST00000518494.1_RNA																							CTGATAATACTTTTTTTTTTT	0.358																																					.													.	.			0			.																																											0	.			TAATACTTTTTTT																													8.37:g.88613386delT			Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	DEL	ENST00000517711.1	37																																																																																						0.358	AF121898.3-002	KNOWN	basic	antisense	antisense		OTTHUMT00000375298.1			
MLLT3	4300	hgsc.bcm.edu	37	9	20414373	20414373	+	Silent	SNP	G	G	A			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr9:20414373G>A	ENST00000380338.4	-	5	757	c.471C>T	c.(469-471)agC>agT	p.S157S	MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000429426.2_Silent_p.S154S|MLLT3_ENST00000475957.1_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	157	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S157S(5)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctgctactgctgc	0.527			T	MLL	ALL																																p.S157S				Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	MLLT3,NS,carcinoma,0,4	MLLT3	0	4	5	Substitution - coding silent(5)	endometrium(3)|urinary_tract(1)|prostate(1)	c.C471T												9.0	14.0	12.0					9																	20414373		1757	3647	5404	SO:0001819	synonymous_variant	4300	exon5			GCTGCTGCTACTG	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.471C>T	9.37:g.20414373G>A			Somatic	36	0.0277777778	1		WXS	Illumina HiSeq	.	42	0.10	4	NM_004529	4	0.00	0	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																					0.527	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000051872.1		NM_004529	
FAM221B	392307	broad.mit.edu	37	9	35826017	35826017	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr9:35826017G>T	ENST00000423537.2	-	2	411	c.142C>A	c.(142-144)Ccg>Acg	p.P48T	TMEM8B_ENST00000377996.1_Intron	NM_001012446.3	NP_001012448.2	A6H8Z2	F221B_HUMAN	family with sequence similarity 221, member B	48										endometrium(2)|kidney(1)|lung(4)	7						GGCTCTAACGGGGTCTCAGAG	0.552											OREG0019180	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P48T													.	FAM221B	38		0			c.C142A												88.0	89.0	89.0					9																	35826017		1876	4094	5970	SO:0001583	missense	392307	exon2			CTAACGGGGTCTC	BX648702	CCDS43799.1, CCDS43799.2	9p13.3	2012-04-02	2012-04-02	2012-04-02	ENSG00000204930	ENSG00000204930			30762	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 128"""	C9orf128			Standard	NM_001012446		Approved		uc010mlc.2	A6H8Z2	OTTHUMG00000019880	ENST00000423537.2:c.142C>A	9.37:g.35826017G>T	ENSP00000415299:p.Pro48Thr		Somatic	84	0	0	858	WXS	Illumina HiSeq	Phase_I	101	0.04	4	NM_001012446	0		0	Q5TCW2	Missense_Mutation	SNP	ENST00000423537.2	37	CCDS43799.2	.	.	.	.	.	.	.	.	.	.	g	14.21	2.466607	0.43839	.	.	ENSG00000204930	ENST00000423537;ENST00000377984;ENST00000472182	T;T;T	0.38560	2.41;2.14;1.13	3.8	-1.68	0.08212	.	0.924887	0.08987	N	0.864960	T	0.30166	0.0756	N	0.19112	0.55	0.09310	N	1	D	0.59357	0.985	P	0.51615	0.675	T	0.12785	-1.0534	10	0.49607	T	0.09	-16.5874	0.7315	0.00958	0.3048:0.1643:0.3628:0.1681	.	48	A6H8Z2	CI128_HUMAN	T	48	ENSP00000415299:P48T;ENSP00000367222:P48T;ENSP00000420279:P48T	ENSP00000367222:P48T	P	-	1	0	C9orf128	35816017	0.001000	0.12720	0.000000	0.03702	0.831000	0.47069	0.804000	0.27098	-0.318000	0.08665	0.645000	0.84053	CCG			0.552	FAM221B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000355861.1		NM_001012446	
LINC01410	103352539	broad.mit.edu	37	9	66464851	66464851	+	lincRNA	DEL	A	A	-	rs201011437|rs372621619		TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr9:66464851delA	ENST00000424345.1	+	0	224																											ACACAGTTTTACAAATTTTAG	0.408																																					.													.	.			0			.																																											0	.			AGTTTTACAAATT																													9.37:g.66464851delA			Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	6	0.50	3	.	7	0.00	0		RNA	DEL	ENST00000424345.1	37																																																																																						0.408	RP11-262H14.1-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000128851.1			
PALM2	114299	bcgsc.ca	37	9	112629770	112629770	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr9:112629770G>T	ENST00000374531.2	+	3	125		c.e3-1		PALM2_ENST00000448454.2_Splice_Site|PALM2-AKAP2_ENST00000374530.3_Splice_Site|PALM2-AKAP2_ENST00000302798.7_Splice_Site|AKAP2_ENST00000555236.1_Splice_Site|AKAP2_ENST00000510514.5_Splice_Site|PALM2_ENST00000483909.1_Splice_Site|PALM2_ENST00000314527.4_Splice_Site	NM_001037293.2	NP_001032370.1	Q8IXS6	PALM2_HUMAN	paralemmin 2						regulation of cell shape (GO:0008360)	plasma membrane (GO:0005886)				breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(1)	18						TTATTTTCAAGGAAAAAAGAA	0.473																																					.													.	PALM2	51		0			c.52-1G>T												50.0	52.0	52.0					9																	112629770		2203	4300	6503	SO:0001630	splice_region_variant	445815	exon3			TTTCAAGGAAAAA	AJ312216	CCDS35099.1, CCDS48002.1, CCDS48002.2	9q31.3	2009-10-16			ENSG00000243444	ENSG00000243444			15845	protein-coding gene	gene with protein product						11478809	Standard	NM_001037293		Approved			Q8IXS6	OTTHUMG00000020479	ENST00000374531.2:c.52-1G>T	9.37:g.112629770G>T			Somatic	48	0	0		WXS	Illumina HiSeq	Phase_1	62	0.06	4	NM_001037293	0		0	A9Z1X9|Q8N9D5|Q96DU1	Splice_Site	SNP	ENST00000374531.2	37	CCDS35099.1	.	.	.	.	.	.	.	.	.	.	G	17.78	3.473759	0.63737	.	.	ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000157654;ENSG00000157654;ENSG00000157654;ENSG00000241978;ENSG00000241978	ENST00000374531;ENST00000448454;ENST00000483909;ENST00000314527;ENST00000497711;ENST00000374530;ENST00000413420;ENST00000302798;ENST00000555236;ENST00000510514	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4362	0.83875	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PALM2-AKAP2;PALM2;AKAP2	111669591	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.313000	0.72844	2.667000	0.90743	0.650000	0.86243	.			0.473	PALM2-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000053604.1		NM_001037293	Intron
MAN1B1	11253	broad.mit.edu;mdanderson.org	37	9	140002112	140002112	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chr9:140002112C>T	ENST00000371589.4	+	12	1967	c.1894C>T	c.(1894-1896)Cgg>Tgg	p.R632W	MAN1B1_ENST00000474902.1_Missense_Mutation_p.R335W|MAN1B1_ENST00000540391.1_3'UTR	NM_016219.4	NP_057303.2	Q9UKM7	MA1B1_HUMAN	mannosidase, alpha, class 1B, member 1	632					cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)	14	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		CCGATTCACACGGGTGAGCAC	0.657																																					p.R632W													.	MAN1B1	40		0			c.C1894T												102.0	85.0	91.0					9																	140002112		2203	4300	6503	SO:0001583	missense	11253	exon12			TTCACACGGGTGA	AF145732	CCDS7029.1	9q34.3	2014-05-27			ENSG00000177239	ENSG00000177239			6823	protein-coding gene	gene with protein product	"""endoplasmic reticulum alpha-mannosidase 1"", ""alpha 1,2-mannosidase"", ""endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1"", ""ER alpha 1,2-mannosidase"", ""Man9GlcNAc2-specific processing alpha-mannosidase"""	604346				10409699, 10521544	Standard	NM_016219		Approved	MANA-ER, MRT15	uc004cld.3	Q9UKM7	OTTHUMG00000020978	ENST00000371589.4:c.1894C>T	9.37:g.140002112C>T	ENSP00000360645:p.Arg632Trp		Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_016219	209	0.00	0	Q5VSG3|Q9BRS9|Q9Y5K7	Missense_Mutation	SNP	ENST00000371589.4	37	CCDS7029.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.388|9.388	1.074868|1.074868	0.20227|0.20227	.|.	.|.	ENSG00000177239|ENSG00000177239	ENST00000371589;ENST00000474902|ENST00000535144;ENST00000475449;ENST00000550113	T;T|T;T;T	0.74526|0.74632	-0.85;-0.85|-0.86;-0.86;-0.86	4.45|4.45	2.39|2.39	0.29439|0.29439	.|.	.|.	.|.	.|.	.|.	D|D	0.83138|0.83138	0.5189|0.5189	M|M	0.82716|0.82716	2.605|2.605	0.46798|0.46798	D|D	0.999201|0.999201	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.87578|.	0.99;0.997;0.998|.	D|D	0.84474|0.84474	0.0601|0.0601	8|6	.|.	.|.	.|.	.|.	13.4573|13.4573	0.61206|0.61206	0.3439:0.6561:0.0:0.0|0.3439:0.6561:0.0:0.0	.|.	519;305;632|.	B4DPS9;B3KXZ1;Q9UKM7|.	.;.;MA1B1_HUMAN|.	W|M	632;335|605;105;69	ENSP00000360645:R632W;ENSP00000447256:R335W|ENSP00000441398:T605M;ENSP00000448658:T105M;ENSP00000450147:T69M	.|.	R|T	+|+	1|2	2|0	MAN1B1|MAN1B1	139121933|139121933	0.946000|0.946000	0.32159|0.32159	0.980000|0.980000	0.43619|0.43619	0.046000|0.046000	0.14306|0.14306	2.018000|2.018000	0.40991|0.40991	1.093000|1.093000	0.41377|0.41377	0.561000|0.561000	0.74099|0.74099	CGG|ACG			0.657	MAN1B1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055294.2		NM_016219	
MT-ND1	4535	hgsc.bcm.edu	37	M	820	820	+	5'Flank	SNP	G	G	A			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chrM:820G>A	ENST00000361390.2	+	0	0				MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TV_ENST00000387342.1_RNA|MT-TL1_ENST00000386347.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	CGGGAAACAGCAGTGATTAAC	0.483																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	6052	.			ACAGCAGTGATTA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886			M.37:g.820G>A	Exception_encountered		Somatic	190	0	0		WXS	Illumina HiSeq	.	163	0.08	13	.	0		0	C0JKH6|Q37523	RNA	SNP	ENST00000361390.2	37																																																																																						0.483	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024026	
CXorf28	100129464	hgsc.bcm.edu	37	X	3202175	3202175	+	Intron	SNP	A	A	G			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chrX:3202175A>G	ENST00000457435.1	+	3	175									chromosome X open reading frame 28																		ACATATACTAATTCTCCTGTT	0.413																																					.													.	.			0			.																																									SO:0001627	intron_variant	100129464	.			ATACTAATTCTCC			Xp22.33	2013-01-16			ENSG00000228459	ENSG00000228459			27336	other	unknown							Standard	NR_038428		Approved		uc022bsa.1	A6NGU7	OTTHUMG00000021082	ENST00000457435.1:c.163-21A>G	X.37:g.3202175A>G			Somatic	90	0	0		WXS	Illumina HiSeq	.	106	0.41	43	.	0		0		RNA	SNP	ENST00000457435.1	37																																																																																						0.413	CXorf28-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000055654.1		NR_038428	
CTPS2	56474	broad.mit.edu	37	X	16711311	16711311	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chrX:16711311G>T	ENST00000443824.1	-	6	1335	c.592C>A	c.(592-594)Caa>Aaa	p.Q198K	CTPS2_ENST00000380241.3_Missense_Mutation_p.Q198K|CTPS2_ENST00000359276.4_Missense_Mutation_p.Q198K	NM_001144002.1	NP_001137474.1	Q9NRF8	PYRG2_HUMAN	CTP synthase 2	198					'de novo' CTP biosynthetic process (GO:0044210)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP synthase activity (GO:0003883)			breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Hepatocellular(33;0.0997)					ACGCTGTTTTGGGTGGGTTTG	0.527																																					p.Q198K													.	CTPS2	49		0			c.C592A												87.0	76.0	80.0					X																	16711311		2203	4300	6503	SO:0001583	missense	56474	exon6			TGTTTTGGGTGGG	AF086422	CCDS14175.1	Xp22	2012-05-02	2012-05-02		ENSG00000047230	ENSG00000047230	6.3.4.2		2520	protein-coding gene	gene with protein product		300380	"""CTP synthase II"""			10899599	Standard	NM_001144002		Approved		uc004cxm.3	Q9NRF8	OTTHUMG00000021193	ENST00000443824.1:c.592C>A	X.37:g.16711311G>T	ENSP00000401264:p.Gln198Lys		Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	205	0.02	4	NM_001144002	68	0.00	0	B3KWM2|Q9BRI0|Q9H809|Q9H8K9	Missense_Mutation	SNP	ENST00000443824.1	37	CCDS14175.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.545141	0.86022	.	.	ENSG00000047230	ENST00000443824;ENST00000380241;ENST00000359276	T;T;T	0.58940	0.3;0.3;0.3	4.73	4.73	0.59995	CTP synthase, N-terminal (1);	0.000000	0.64402	D	0.000009	D	0.86372	0.5917	H	0.99156	4.45	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	D	0.92785	0.6243	10	0.87932	D	0	-7.8728	17.2578	0.87062	0.0:0.0:1.0:0.0	.	198	Q9NRF8	PYRG2_HUMAN	K	198	ENSP00000401264:Q198K;ENSP00000369590:Q198K;ENSP00000352222:Q198K	ENSP00000352222:Q198K	Q	-	1	0	CTPS2	16621232	1.000000	0.71417	0.754000	0.31244	0.774000	0.43823	9.444000	0.97578	2.085000	0.62840	0.600000	0.82982	CAA			0.527	CTPS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055906.1		NM_019857	
CCNB3	85417	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	50053935	50053935	+	Silent	SNP	T	T	C			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chrX:50053935T>C	ENST00000376042.1	+	6	3064	c.2766T>C	c.(2764-2766)aaT>aaC	p.N922N	CCNB3_ENST00000376038.1_Intron|CCNB3_ENST00000348603.2_Intron|CCNB3_ENST00000276014.7_Silent_p.N922N			Q8WWL7	CCNB3_HUMAN	cyclin B3	922					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					CTACCATCAATGAGGCAGTCC	0.463																																					p.N922N													.	.			0			c.T2766C												85.0	77.0	80.0					X																	50053935		2203	4300	6503	SO:0001819	synonymous_variant	85417	exon5			CATCAATGAGGCA	AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.2766T>C	X.37:g.50053935T>C			Somatic	162	0	0		WXS	Illumina HiSeq	.	214	0.05	10	NM_033031	1	0.00	0	B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Silent	SNP	ENST00000376042.1	37	CCDS14331.1																																																																																					0.463	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056558.1			
CYLC1	1538	broad.mit.edu	37	X	83129489	83129489	+	Silent	SNP	A	A	G			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chrX:83129489A>G	ENST00000329312.4	+	4	1810	c.1773A>G	c.(1771-1773)aaA>aaG	p.K591K		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	591					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						TCAATGAAAAAGGGGAAAAAG	0.418																																					p.K591K													.	CYLC1	272		0			c.A1773G												67.0	59.0	61.0					X																	83129489		2202	4299	6501	SO:0001819	synonymous_variant	1538	exon4			TGAAAAAGGGGAA	Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.1773A>G	X.37:g.83129489A>G			Somatic	232	0	0		WXS	Illumina HiSeq	Phase_I	289	0.01	4	NM_021118	0		0	A0AVQ8|Q5JQQ9	Silent	SNP	ENST00000329312.4	37	CCDS35341.1																																																																																					0.418	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057371.1		NM_021118	
RNF128	79589	broad.mit.edu	37	X	105937558	105937558	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chrX:105937558C>T	ENST00000324342.3	+	1	491	c.326C>T	c.(325-327)gCg>gTg	p.A109V		NM_024539.3	NP_078815.3	Q8TEB7	RN128_HUMAN	ring finger protein 128, E3 ubiquitin protein ligase	135	PA.				negative regulation of cytokine biosynthetic process (GO:0042036)	cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(1)	11						ATTCAAACAGCGGGCAGAAGA	0.388																																					p.A109V													.	RNF128	74		0			c.C326T												64.0	61.0	62.0					X																	105937558		2203	4299	6502	SO:0001583	missense	79589	exon1			AAACAGCGGGCAG	AK027169	CCDS14520.1, CCDS14521.1	Xq22.3	2013-01-09	2012-02-23		ENSG00000133135	ENSG00000133135		"""RING-type (C3HC4) zinc fingers"""	21153	protein-coding gene	gene with protein product		300439	"""ring finger protein 128"""				Standard	NM_024539		Approved	FLJ23516, GRAIL	uc004eml.3	Q8TEB7	OTTHUMG00000022151	ENST00000324342.3:c.326C>T	X.37:g.105937558C>T	ENSP00000316127:p.Ala109Val		Somatic	252	0	0		WXS	Illumina HiSeq	Phase_I	318	0.01	4	NM_024539	4	0.00	0	A0PJI4|Q6PH80|Q6ZTJ8|Q96RF3|Q9H5E4	Missense_Mutation	SNP	ENST00000324342.3	37	CCDS14520.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.191287	0.78902	.	.	ENSG00000133135	ENST00000418562;ENST00000324342	T;T	0.35789	1.29;3.14	5.94	5.94	0.96194	.	.	.	.	.	T	0.67785	0.2930	M	0.88842	2.985	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73219	-0.4052	9	0.62326	D	0.03	.	17.6899	0.88267	0.0:1.0:0.0:0.0	.	109	Q8TEB7-2	.	V	82;109	ENSP00000412610:A82V;ENSP00000316127:A109V	ENSP00000316127:A109V	A	+	2	0	RNF128	105824214	1.000000	0.71417	0.648000	0.29521	0.985000	0.73830	6.245000	0.72398	2.499000	0.84300	0.594000	0.82650	GCG			0.388	RNF128-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000057805.1		NM_024539	
NKRF	55922	broad.mit.edu	37	X	118724147	118724147	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH4-01A-12D-A42Y-10	TCGA-2G-AAH4-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a76ac28a-7e0c-4ca4-ad0e-109bf04deac8	09fe59f5-a2c3-4148-aac8-4b370b8cfae1	g.chrX:118724147G>T	ENST00000371527.1	-	2	1893	c.1241C>A	c.(1240-1242)cCc>cAc	p.P414H	NKRF_ENST00000542113.1_Missense_Mutation_p.P429H|NKRF_ENST00000304449.5_Missense_Mutation_p.P414H|NKRF_ENST00000487600.1_Intron	NM_001173488.1	NP_001166959.1	O15226	NKRF_HUMAN	NFKB repressing factor	414					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	30						TGGATAAGTGGGCTGTGTTTT	0.388																																					p.P429H													.	NKRF	121		0			c.C1286A												148.0	136.0	140.0					X																	118724147		2203	4300	6503	SO:0001583	missense	55922	exon4			TAAGTGGGCTGTG	AJ011812	CCDS35375.1, CCDS55486.1	Xq24	2013-01-28	2008-03-26		ENSG00000186416	ENSG00000186416		"""G patch domain containing"""	19374	protein-coding gene	gene with protein product		300440	"""NF-kappaB repressing factor"""			10562553	Standard	NM_017544		Approved	ITBA4, NRF	uc022cdk.1	O15226	OTTHUMG00000022277	ENST00000371527.1:c.1241C>A	X.37:g.118724147G>T	ENSP00000360582:p.Pro414His		Somatic	52	0.0384615385	2		WXS	Illumina HiSeq	Phase_I	89	0.03	3	NM_001173487	36	0.00	0	G3V1N1|Q4VC41|Q9UJ91	Missense_Mutation	SNP	ENST00000371527.1	37	CCDS35375.1	.	.	.	.	.	.	.	.	.	.	G	10.23	1.293297	0.23564	.	.	ENSG00000186416	ENST00000371527;ENST00000304449;ENST00000542113	T;T;T	0.77358	-1.09;-1.09;-1.09	5.48	5.48	0.80851	.	0.222275	0.46758	D	0.000268	T	0.73179	0.3554	L	0.31476	0.935	0.09310	N	1	D	0.59357	0.985	P	0.49999	0.628	T	0.69091	-0.5237	10	0.87932	D	0	-9.0408	10.8886	0.46981	0.0875:0.0:0.9125:0.0	.	414	O15226	NKRF_HUMAN	H	414;414;429	ENSP00000360582:P414H;ENSP00000304803:P414H;ENSP00000442308:P429H	ENSP00000304803:P414H	P	-	2	0	NKRF	118608175	1.000000	0.71417	0.999000	0.59377	0.798000	0.45092	6.749000	0.74883	2.294000	0.77228	0.594000	0.82650	CCC			0.388	NKRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058044.1		NM_017544	
