#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_Mutation_Status	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
OPRD1	4985	mdanderson.org	37	1	29189700	29189700	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr1:29189700C>T	ENST00000234961.2	+	3	1266	c.1024C>T	c.(1024-1026)Ccc>Tcc	p.P342S		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	342					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CCGCCCAGACCCCAGCAGCTT	0.711																																					p.P342S													.	.			0			c.C1024T												9.0	9.0	9.0					1																	29189700		2186	4283	6469	SO:0001583	missense	4985	exon3			CCAGACCCCAGCA	U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.1024C>T	1.37:g.29189700C>T	ENSP00000234961:p.Pro342Ser		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	23	0.09	2	NM_000911	0		0	B5B0B8	Missense_Mutation	SNP	ENST00000234961.2	37	CCDS329.1	.	.	.	.	.	.	.	.	.	.	C	9.884	1.202294	0.22121	.	.	ENSG00000116329	ENST00000234961;ENST00000536280	T	0.36157	1.27	4.06	4.06	0.47325	.	0.506099	0.19945	N	0.102553	T	0.23171	0.0560	N	0.22421	0.69	0.38965	D	0.958636	B	0.14438	0.01	B	0.13407	0.009	T	0.06607	-1.0817	10	0.09590	T	0.72	.	13.7884	0.63123	0.0:1.0:0.0:0.0	.	342	P41143	OPRD_HUMAN	S	342;294	ENSP00000234961:P342S	ENSP00000234961:P342S	P	+	1	0	OPRD1	29062287	1.000000	0.71417	0.387000	0.26183	0.796000	0.44982	5.838000	0.69388	2.097000	0.63578	0.462000	0.41574	CCC			0.711	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000010330.1		NM_000911	
MIR137HG	400765	hgsc.bcm.edu	37	1	98511786	98511786	+	lincRNA	SNP	C	C	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr1:98511786C>T	ENST00000580305.1	-	0	0				MIR137HG_ENST00000385223.1_lincRNA	NR_039604.1				MIR137 host gene (non-protein coding)																		ctactgccgccgccgccgcCA	0.632																																					.													.	.			0			.												3.0	7.0	6.0					1																	98511786		293	1060	1353			400765	.			TGCCGCCGCCGCC	AK094607		1p21.3	2013-05-22			ENSG00000225206	ENSG00000225206		"""Long non-coding RNAs"""	42871	non-coding RNA	RNA, long non-coding							Standard	NR_046105		Approved		uc001drx.2		OTTHUMG00000010680		1.37:g.98511786C>T			Somatic	90	0	0		WXS	Illumina HiSeq	.	71	0.21	15	.	0		0		RNA	SNP	ENST00000580305.1	37																																																																																						0.632	MIR137HG-203	KNOWN	basic	miRNA	lincRNA				NR_046105	
MIR137HG	400765	hgsc.bcm.edu	37	1	98511792	98511792	+	lincRNA	SNP	C	C	T	rs566138074	byFrequency	TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr1:98511792C>T	ENST00000580305.1	-	0	0				MIR137HG_ENST00000385223.1_lincRNA	NR_039604.1				MIR137 host gene (non-protein coding)																		ccgccgccgccgcCACCAGAA	0.632													C|||	13	0.00259585	0.0038	0.0014	5008	,	,		10160	0.002		0.004	False		,,,				2504	0.001				.													.	.			0			.												2.0	5.0	4.0					1																	98511792		347	1150	1497			400765	.			CGCCGCCGCCACC	AK094607		1p21.3	2013-05-22			ENSG00000225206	ENSG00000225206		"""Long non-coding RNAs"""	42871	non-coding RNA	RNA, long non-coding							Standard	NR_046105		Approved		uc001drx.2		OTTHUMG00000010680		1.37:g.98511792C>T			Somatic	74	0	0		WXS	Illumina HiSeq	.	56	0.11	6	.	0		0		RNA	SNP	ENST00000580305.1	37																																																																																						0.632	MIR137HG-203	KNOWN	basic	miRNA	lincRNA				NR_046105	
SRGAP2-AS1	100873165	broad.mit.edu	37	1	121116750	121116750	+	lincRNA	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr1:121116750G>T	ENST00000437515.1	-	0	329					NR_104189.1																						GTACTTGCTGGCTTTGGAGGC	0.453																																					p.A103S													.	.			0			c.G307T																																											0	exon3			TTGCTGGCTTTGG																													1.37:g.121116750G>T			Somatic	186	0.0053763441	1		WXS	Illumina HiSeq	Phase_I	208	0.04	9	NM_001271887	61	0.00	0		RNA	SNP	ENST00000437515.1	37																																																																																						0.453	RP11-343N15.1-002	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000098477.2			
CELF3	11189	ucsc.edu;bcgsc.ca	37	1	151678746	151678746	+	Silent	SNP	C	C	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr1:151678746C>T	ENST00000290583.4	-	10	1873	c.1080G>A	c.(1078-1080)caG>caA	p.Q360Q	CELF3_ENST00000290585.4_Silent_p.Q310Q|RP11-98D18.1_ENST00000457548.1_RNA|CELF3_ENST00000392706.3_Silent_p.Q155Q|CELF3_ENST00000470688.1_5'UTR	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	Q5SZQ8	CELF3_HUMAN	CUGBP, Elav-like family member 3	360	Gln-rich.				mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	21						gctgctgctgctgttgAGGTG	0.652																																					p.Q360Q													.	CELF3	49		0			c.G1080A												19.0	21.0	20.0					1																	151678746		2199	4294	6493	SO:0001819	synonymous_variant	11189	exon10			CTGCTGCTGTTGA	U80759	CCDS1002.1, CCDS53367.1	1q21	2013-02-12	2010-02-19	2010-02-19	ENSG00000159409	ENSG00000159409		"""Trinucleotide (CAG) repeat containing"", ""RNA binding motif (RRM) containing"""	11967	protein-coding gene	gene with protein product	"""expanded repeat domain, CAG/CTG 4"", ""CAG repeat domain"", ""CUG-BP and ETR-3 like factor 3"""	612678	"""trinucleotide repeat containing 4"""	TNRC4		9225980	Standard	XM_005244859		Approved	CAGH4, BRUNOL1, ERDA4, MGC57297	uc001eys.2	Q5SZQ8	OTTHUMG00000013064	ENST00000290583.4:c.1080G>A	1.37:g.151678746C>T			Somatic	29	0	0		WXS	Illumina HiSeq		40	0.10	4	NM_007185	0		0	B7ZKK6|O15414|Q499Y6|Q5SZQ7|Q6NVK0|Q8IZ98|Q9BZC2|Q9HB30	Silent	SNP	ENST00000290583.4	37	CCDS1002.1	.	.	.	.	.	.	.	.	.	.	.	8.446	0.851874	0.17034	.	.	ENSG00000159409	ENST00000420342	.	.	.	4.18	3.18	0.36537	.	.	.	.	.	T	0.45994	0.1370	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41910	-0.9482	4	.	.	.	-1.649	8.7523	0.34622	0.0:0.876:0.0:0.124	.	.	.	.	N	361	.	.	S	-	2	0	CELF3	149945370	.	.	1.000000	0.80357	0.943000	0.58893	.	.	2.183000	0.69458	0.655000	0.94253	AGC			0.652	CELF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000036663.2		NM_007185	
FLG	2312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	152280480	152280480	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr1:152280480G>T	ENST00000368799.1	-	3	6917	c.6882C>A	c.(6880-6882)caC>caA	p.H2294Q	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2294	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCTCTGCAGAGTGCCCATGAC	0.552									Ichthyosis																												p.H2294Q													.	.			0			c.C6882A												288.0	299.0	295.0					1																	152280480		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	TGCAGAGTGCCCA	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6882C>A	1.37:g.152280480G>T	ENSP00000357789:p.His2294Gln		Somatic	242	0	0		WXS	Illumina HiSeq	.	336	0.24	82	NM_002016	0		0	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	2.971	-0.212514	0.06140	.	.	ENSG00000143631	ENST00000368799;ENST00000271820	T	0.00949	5.51	3.07	-6.14	0.02111	.	.	.	.	.	T	0.00210	0.0006	L	0.28504	0.86	0.09310	N	1	B	0.14438	0.01	B	0.11329	0.006	T	0.40440	-0.9563	9	0.25751	T	0.34	.	4.4718	0.11715	0.0961:0.539:0.1369:0.228	.	2294	P20930	FILA_HUMAN	Q	2294;204	ENSP00000357789:H2294Q	ENSP00000271820:H204Q	H	-	3	2	FLG	150547104	0.000000	0.05858	0.000000	0.03702	0.198000	0.23893	-2.842000	0.00737	-2.926000	0.00302	0.194000	0.17425	CAC			0.552	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033742.1		NM_002016	
OR6K6	128371	broad.mit.edu	37	1	158725536	158725536	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr1:158725536T>C	ENST00000368144.2	+	1	1027	c.931T>C	c.(931-933)Ttt>Ctt	p.F311L		NM_001005184.1	NP_001005184.1	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K, member 6	311						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(17)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0378)					CCTTGCTCCCTTTTTCAACCC	0.438																																					p.F311L													.	OR6K6	81		0			c.T931C												149.0	140.0	143.0					1																	158725536		2203	4300	6503	SO:0001583	missense	128371	exon1			GCTCCCTTTTTCA	BK004198	CCDS30904.1	1q23.1	2012-08-09			ENSG00000180433	ENSG00000180433		"""GPCR / Class A : Olfactory receptors"""	15033	protein-coding gene	gene with protein product							Standard	NM_001005184		Approved		uc001fsw.1	Q8NGW6	OTTHUMG00000022772	ENST00000368144.2:c.931T>C	1.37:g.158725536T>C	ENSP00000357126:p.Phe311Leu		Somatic	212	0	0		WXS	Illumina HiSeq	Phase_I	208	0.03	6	NM_001005184	0		0	B9EIM8|Q5VUU9|Q6IFR4	Missense_Mutation	SNP	ENST00000368144.2	37	CCDS30904.1	.	.	.	.	.	.	.	.	.	.	T	7.953	0.745283	0.15710	.	.	ENSG00000180433	ENST00000368144	T	0.35789	1.29	5.33	4.21	0.49690	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41500	D	0.000869	T	0.05914	0.0154	N	0.03281	-0.365	0.29167	N	0.877357	B	0.28667	0.219	B	0.27380	0.079	T	0.16070	-1.0415	10	0.40728	T	0.16	-17.7057	7.5224	0.27635	0.1408:0.0:0.147:0.7122	.	311	Q8NGW6	OR6K6_HUMAN	L	311	ENSP00000357126:F311L	ENSP00000357126:F311L	F	+	1	0	OR6K6	156992160	0.000000	0.05858	0.973000	0.42090	0.816000	0.46133	-1.108000	0.03313	1.043000	0.40175	-0.257000	0.10917	TTT			0.438	OR6K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000059065.2		NM_001005184	
PFKFB3	5209	bcgsc.ca	37	10	6271098	6271098	+	Intron	SNP	C	C	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr10:6271098C>T	ENST00000379775.4	+	14	1845				PFKFB3_ENST00000379789.4_Intron|PFKFB3_ENST00000540253.1_Intron|PFKFB3_ENST00000379782.3_Intron|PFKFB3_ENST00000379785.1_Intron|PFKFB3_ENST00000536985.1_Intron|PFKFB3_ENST00000360521.2_Intron	NM_004566.3	NP_004557.1	Q16875	F263_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3						carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|liver(2)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)	22						ATGAGGAATGCAGCCTGAGAT	0.483																																					.													.	PFKFB3	82		0			.												38.0	36.0	36.0					10																	6271098		876	1991	2867	SO:0001627	intron_variant	5209	.			GGAATGCAGCCTG		CCDS7078.1, CCDS44353.1, CCDS60479.1	10p15.1	2008-05-14			ENSG00000170525	ENSG00000170525			8874	protein-coding gene	gene with protein product		605319				9146922, 10072580	Standard	NM_004566		Approved		uc001ije.3	Q16875	OTTHUMG00000017621	ENST00000379775.4:c.1515+2770C>T	10.37:g.6271098C>T			Somatic	142	0	0		WXS	Illumina HiSeq	Phase_1	136	0.04	6	.	0		0	B7Z955|O43622|O75902|Q5VX15|Q5VX18|Q5VX19	Missense_Mutation	SNP	ENST00000379775.4	37	CCDS7078.1	.	.	.	.	.	.	.	.	.	.	C	9.572	1.121183	0.20877	.	.	ENSG00000170525	ENST00000379781;ENST00000414237	.	.	.	1.89	-1.29	0.09288	.	.	.	.	.	T	0.33990	0.0882	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.38520	-0.9657	5	0.87932	D	0	.	2.6851	0.05105	0.0:0.3869:0.2585:0.3547	.	.	.	.	V	116;91	.	ENSP00000369107:A116V	A	+	2	0	PFKFB3	6311104	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-0.556000	0.05992	-0.380000	0.07894	0.313000	0.20887	GCA			0.483	PFKFB3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000046647.1			
MRC1	4360	broad.mit.edu	37	10	18138582	18138582	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr10:18138582G>T	ENST00000239761.3	+	7	1241	c.1138G>T	c.(1138-1140)Gag>Tag	p.E380*		NM_002438.2	NP_002429.1	P22897	MRC1_HUMAN	mannose receptor, C type 1	380	C-type lectin 2. {ECO:0000255|PROSITE- ProRule:PRU00040}.				receptor-mediated endocytosis (GO:0006898)	cell surface (GO:0009986)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	mannose binding (GO:0005537)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|kidney(1)|lung(2)|prostate(1)|urinary_tract(1)	6						TCACAGAGATGAGAAAAAAAT	0.483																																					p.E380X	GBM(115;1153 1594 28187 28781 35884)												.	MRC1	13		0			c.G1138T												38.0	46.0	43.0					10																	18138582		2149	3676	5825	SO:0001587	stop_gained	4360	exon7			AGAGATGAGAAAA	J05550	CCDS7123.1, CCDS7123.2	10p13	2014-04-10			ENSG00000120586	ENSG00000260314		"""CD molecules"", ""C-type lectin domain containing"""	7228	protein-coding gene	gene with protein product		153618	"""mannose receptor, C type 1-like 1"""	MRC1L1		1294118	Standard	NM_002438		Approved	CLEC13D, CD206, bA541I19.1, CLEC13DL	uc031ptj.1	P22897	OTTHUMG00000174646	ENST00000239761.3:c.1138G>T	10.37:g.18138582G>T	ENSP00000239761:p.Glu380*		Somatic	409	0	0		WXS	Illumina HiSeq	Phase_I	504	0.01	4	NM_002438	3	0.00	0	A5PKW3|Q5VSJ2|Q5VSK2	Nonsense_Mutation	SNP	ENST00000239761.3	37	CCDS7123.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.780254	0.90195	.	.	ENSG00000120586	ENST00000239761	.	.	.	4.35	3.43	0.39272	.	0.104739	0.39687	U	0.001297	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-14.0062	12.4185	0.55508	0.0:0.1696:0.8304:0.0	.	.	.	.	X	380	.	ENSP00000239761:E380X	E	+	1	0	MRC1	18178588	0.794000	0.28838	0.759000	0.31340	0.228000	0.25075	1.226000	0.32563	0.801000	0.34066	0.430000	0.28490	GAG			0.483	MRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047057.1		NM_002438	
ENTPD7	57089	broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	101451184	101451184	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr10:101451184G>T	ENST00000370489.4	+	8	930	c.752G>T	c.(751-753)aGa>aTa	p.R251I		NM_020354.3	NP_065087.1	Q9NQZ7	ENTP7_HUMAN	ectonucleoside triphosphate diphosphohydrolase 7	251						cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|urinary_tract(1)	18		Colorectal(252;0.234)		Epithelial(162;4.72e-10)|all cancers(201;3.75e-08)		GCAGGACGGAGAAGGACAGTA	0.418																																					p.R251I													.	ENTPD7	44		0			c.G752T												101.0	93.0	96.0					10																	101451184		2203	4300	6503	SO:0001583	missense	57089	exon8			GACGGAGAAGGAC	AF269255	CCDS7480.1	10q23-q24	2004-07-01			ENSG00000198018	ENSG00000198018			19745	protein-coding gene	gene with protein product						11278936	Standard	NM_020354		Approved	LALP1, FLJ30978	uc001kqa.4	Q9NQZ7	OTTHUMG00000018888	ENST00000370489.4:c.752G>T	10.37:g.101451184G>T	ENSP00000359520:p.Arg251Ile		Somatic	99	0.0101010101	1		WXS	Illumina HiSeq	Phase_I	103	0.05	5	NM_020354	8	0.00	0	B2RB83|B3KP21|D3DR64	Missense_Mutation	SNP	ENST00000370489.4	37	CCDS7480.1	.	.	.	.	.	.	.	.	.	.	G	14.68	2.607913	0.46527	.	.	ENSG00000198018	ENST00000370489	T	0.11712	2.75	5.05	0.659	0.17861	.	0.225052	0.44688	D	0.000425	T	0.09730	0.0239	L	0.48362	1.52	0.44275	D	0.997139	B	0.16802	0.019	B	0.23275	0.045	T	0.12915	-1.0529	10	0.45353	T	0.12	-4.8798	8.541	0.33393	0.5804:0.0:0.4196:0.0	.	251	Q9NQZ7	ENTP7_HUMAN	I	251	ENSP00000359520:R251I	ENSP00000359520:R251I	R	+	2	0	ENTPD7	101441174	0.993000	0.37304	0.997000	0.53966	0.971000	0.66376	1.322000	0.33689	0.222000	0.20900	-0.140000	0.14226	AGA			0.418	ENTPD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049809.2		NM_020354	
AP2A2	161	mdanderson.org	37	11	1000510	1000510	+	Missense_Mutation	SNP	G	G	T	rs570397060		TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr11:1000510G>T	ENST00000448903.2	+	15	2176	c.2035G>T	c.(2035-2037)Ggc>Tgc	p.G679C	AP2A2_ENST00000332231.5_Missense_Mutation_p.G680C|AP2A2_ENST00000525891.1_3'UTR|AP2A2_ENST00000534328.1_Intron	NM_001242837.1|NM_012305.3	NP_001229766.1|NP_036437.1	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2 subunit	679					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)	21		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)		ACCCTCCTCCGGCGGCAGCGG	0.677																																					p.G680C													.	.			0			c.G2038T												5.0	5.0	5.0					11																	1000510		1748	3884	5632	SO:0001583	missense	161	exon15			TCCTCCGGCGGCA	AB020706	CCDS44512.1, CCDS73234.1	11p15.5	2008-07-18			ENSG00000183020	ENSG00000183020			562	protein-coding gene	gene with protein product	"""alpha-adaptin C; Huntingtin interacting protein J"", ""adaptin, alpha B"", ""clathrin-associated/assembly/adaptor protein, large, alpha 2"""	607242		CLAPA2, ADTAB		9700202, 2564002	Standard	NM_012305		Approved	DKFZP564D1864, HYPJ, KIAA0899, HIP9	uc001lst.2	O94973	OTTHUMG00000165627	ENST00000448903.2:c.2035G>T	11.37:g.1000510G>T	ENSP00000413234:p.Gly679Cys		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	27	0.07	2	NM_001242837	23	0.00	0	O75403|Q53ET1|Q96SI8	Missense_Mutation	SNP	ENST00000448903.2	37	CCDS44512.1	.	.	.	.	.	.	.	.	.	.	G	13.29	2.194217	0.38707	.	.	ENSG00000183020	ENST00000448903;ENST00000332231;ENST00000529125;ENST00000452310	T;T	0.19105	2.17;2.17	2.15	0.191	0.15130	.	0.670581	0.15142	N	0.278258	T	0.24353	0.0590	L	0.53249	1.67	0.09310	N	1	P;B	0.35174	0.488;0.355	P;B	0.44447	0.45;0.263	T	0.22068	-1.0227	10	0.59425	D	0.04	-60.0054	6.412	0.21696	0.4843:0.0:0.5157:0.0	.	680;679	O94973-2;O94973	.;AP2A2_HUMAN	C	679;680;416;419	ENSP00000413234:G679C;ENSP00000327694:G680C	ENSP00000327694:G680C	G	+	1	0	AP2A2	990510	0.101000	0.21875	0.059000	0.19551	0.897000	0.52465	1.269000	0.33074	0.037000	0.15575	-0.234000	0.12200	GGC			0.677	AP2A2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000385431.2		NM_012305	
MUC5B	727897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	1269803	1269803	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr11:1269803C>G	ENST00000529681.1	+	31	11751	c.11693C>G	c.(11692-11694)aCa>aGa	p.T3898R	MUC5B_ENST00000447027.1_Missense_Mutation_p.T3901R|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3898	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ACCACACCCACAACCAGTGGC	0.652																																					p.T3898R													.	.			0			c.C11693G												110.0	133.0	125.0					11																	1269803		2101	4205	6306	SO:0001583	missense	727897	exon31			CACCCACAACCAG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.11693C>G	11.37:g.1269803C>G	ENSP00000436812:p.Thr3898Arg		Somatic	256	0	0		WXS	Illumina HiSeq	.	249	0.23	57	NM_002458	0		0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	c	3.837	-0.034678	0.07543	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.18810	2.19;2.37	2.87	-4.32	0.03688	.	.	.	.	.	T	0.14399	0.0348	M	0.63843	1.955	0.09310	N	1	P;P	0.38922	0.651;0.651	B;B	0.27608	0.081;0.081	T	0.08249	-1.0731	9	0.87932	D	0	.	4.5541	0.12128	0.3307:0.4294:0.0:0.2398	.	4426;3901	A7Y9J9;E9PBJ0	.;.	R	3898;3901;3842;3803	ENSP00000436812:T3898R;ENSP00000415793:T3901R	ENSP00000343037:T3842R	T	+	2	0	MUC5B	1226379	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.467000	0.02352	-0.965000	0.03591	-1.031000	0.02408	ACA			0.652	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000390041.2		XM_001126093	
TNKS1BP1	85456	mdanderson.org	37	11	57076874	57076874	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr11:57076874G>T	ENST00000532437.1	-	5	3622	c.3311C>A	c.(3310-3312)cCa>cAa	p.P1104Q	TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.P1104Q|TNKS1BP1_ENST00000530920.1_5'Flank			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	1104	Acidic.|Gly-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)			breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				CTGCTGCCCTGGGCTAAATGC	0.592																																					p.P1104Q													.	.			0			c.C3311A												81.0	73.0	76.0					11																	57076874		2201	4296	6497	SO:0001583	missense	85456	exon6			TGCCCTGGGCTAA	AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.3311C>A	11.37:g.57076874G>T	ENSP00000437271:p.Pro1104Gln		Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	49	0.06	3	NM_033396	80	0.00	0	A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	ENST00000532437.1	37	CCDS7951.1	.	.	.	.	.	.	.	.	.	.	G	12.16	1.853359	0.32791	.	.	ENSG00000149115	ENST00000358252;ENST00000532437	T;T	0.33438	1.41;1.41	5.05	2.93	0.34026	.	0.477150	0.17550	N	0.170223	T	0.41488	0.1161	L	0.51422	1.61	0.09310	N	1	D	0.71674	0.998	D	0.66497	0.944	T	0.12811	-1.0533	10	0.72032	D	0.01	-1.4207	5.0209	0.14361	0.3003:0.0:0.6997:0.0	.	1104	Q9C0C2	TB182_HUMAN	Q	1104	ENSP00000350990:P1104Q;ENSP00000437271:P1104Q	ENSP00000350990:P1104Q	P	-	2	0	TNKS1BP1	56833450	0.001000	0.12720	0.064000	0.19789	0.432000	0.31715	0.971000	0.29396	1.135000	0.42183	0.462000	0.41574	CCA			0.592	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000392455.1		NM_033396	
OR5B17	219965	mdanderson.org	37	11	58126036	58126036	+	Silent	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr11:58126036G>T	ENST00000357377.3	-	1	506	c.507C>A	c.(505-507)tcC>tcA	p.S169S		NM_001005489.1	NP_001005489.1	Q8NGF7	OR5BH_HUMAN	olfactory receptor, family 5, subfamily B, member 17	169						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				GAATCACATTGGACATGCAGA	0.398																																					p.S169S													OR5B17,NS,malignant_melanoma,-1,1	OR5B17	-1	1	0			c.C507A												87.0	79.0	82.0					11																	58126036		2201	4295	6496	SO:0001819	synonymous_variant	219965	exon1			CACATTGGACATG	AB065849	CCDS31548.1	11q12.1	2012-08-09			ENSG00000197786	ENSG00000197786		"""GPCR / Class A : Olfactory receptors"""	15267	protein-coding gene	gene with protein product				OR5B20P			Standard	NM_001005489		Approved		uc010rke.2	Q8NGF7	OTTHUMG00000167465	ENST00000357377.3:c.507C>A	11.37:g.58126036G>T			Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	57	0.05	3	NM_001005489	0		0	Q6IEX1	Silent	SNP	ENST00000357377.3	37	CCDS31548.1																																																																																					0.398	OR5B17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394708.2		NM_001005489	
PPFIA1	8500	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	70224251	70224251	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr11:70224251C>G	ENST00000253925.7	+	26	3715	c.3500C>G	c.(3499-3501)aCt>aGt	p.T1167S	AP000487.5_ENST00000530690.1_RNA|AP000487.5_ENST00000500185.2_RNA|PPFIA1_ENST00000530548.1_3'UTR|PPFIA1_ENST00000389547.3_Missense_Mutation_p.T1167S|AP000487.5_ENST00000524619.1_RNA	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1	1167					cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			TTCCGGGTGACTTCTTCTATG	0.493																																					p.T1167S													.	.			0			c.C3500G												149.0	134.0	139.0					11																	70224251		2200	4294	6494	SO:0001583	missense	8500	exon26			GGGTGACTTCTTC	U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.3500C>G	11.37:g.70224251C>G	ENSP00000253925:p.Thr1167Ser		Somatic	103	0	0		WXS	Illumina HiSeq	.	66	0.42	28	NM_177423	20	0.05	1	A6NLE3|Q13135|Q14567|Q8N4I2	Missense_Mutation	SNP	ENST00000253925.7	37	CCDS31627.1	.	.	.	.	.	.	.	.	.	.	C	1.248	-0.619454	0.03663	.	.	ENSG00000131626	ENST00000253925;ENST00000389547;ENST00000544950;ENST00000528853	T;T	0.17528	2.28;2.27	4.72	4.72	0.59763	.	0.216297	0.37857	N	0.001912	T	0.09423	0.0232	N	0.10874	0.06	0.33756	D	0.621252	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.11329	0.004;0.002;0.006	T	0.17319	-1.0373	10	0.19147	T	0.46	.	12.7562	0.57336	0.164:0.836:0.0:0.0	.	664;1167;1167	F5H1G2;Q13136;Q13136-2	.;LIPA1_HUMAN;.	S	1167;1167;664;23	ENSP00000253925:T1167S;ENSP00000374198:T1167S	ENSP00000253925:T1167S	T	+	2	0	PPFIA1	69901899	1.000000	0.71417	0.045000	0.18777	0.101000	0.19017	4.716000	0.61916	2.180000	0.69256	0.561000	0.74099	ACT			0.493	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000393905.1		NM_003626	
MYO7A	4647	mdanderson.org	37	11	76919803	76919803	+	Silent	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr11:76919803G>T	ENST00000409709.3	+	44	6278	c.6006G>T	c.(6004-6006)gtG>gtT	p.V2002V	MYO7A_ENST00000409619.2_Silent_p.V1953V|MYO7A_ENST00000458637.2_Silent_p.V1964V|MYO7A_ENST00000605744.1_3'UTR	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	2002	FERM 2. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						CCACCACGGTGCCAGGGAAGG	0.567																																					p.V2002V													.	.			0			c.G6006T												55.0	65.0	62.0					11																	76919803		2067	4183	6250	SO:0001819	synonymous_variant	4647	exon44			CACGGTGCCAGGG	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.6006G>T	11.37:g.76919803G>T			Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	39	0.08	3	NM_000260	8	0.00	0	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Silent	SNP	ENST00000409709.3	37	CCDS53683.1																																																																																					0.567	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000328133.1		NM_000260	
RSF1	51773	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	77451960	77451960	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr11:77451960C>G	ENST00000308488.6	-	4	696	c.394G>C	c.(394-396)Gat>Cat	p.D132H	RSF1-IT1_ENST00000528233.1_RNA|RSF1_ENST00000360355.2_Missense_Mutation_p.D101H			Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	132				D -> G (in Ref. 4; AAG43114). {ECO:0000305}.	CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RSF complex (GO:0031213)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			AGATTGTCATCAAACTGACAC	0.368																																					p.D132H													.	.			0			c.G394C												77.0	66.0	70.0					11																	77451960		2200	4292	6492	SO:0001583	missense	51773	exon4			TGTCATCAAACTG	AF380176, AF227948	CCDS8253.1	11q14.1	2013-01-28	2006-05-25	2006-05-25	ENSG00000048649	ENSG00000048649		"""Zinc fingers, PHD-type"""	18118	protein-coding gene	gene with protein product		608522	"""hepatitis B virus x associated protein"""	HBXAP		11788598, 12972596	Standard	NM_016578		Approved	XAP8, RSF-1, p325	uc001oyn.3	Q96T23	OTTHUMG00000150433	ENST00000308488.6:c.394G>C	11.37:g.77451960C>G	ENSP00000311513:p.Asp132His		Somatic	151	0	0		WXS	Illumina HiSeq	.	88	0.33	29	NM_016578	13	0.69	9	Q86X86|Q9H3L8|Q9NVZ8|Q9NYU0	Missense_Mutation	SNP	ENST00000308488.6	37	CCDS8253.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.9|26.9	4.779967|4.779967	0.90195|0.90195	.|.	.|.	ENSG00000048649|ENSG00000048649	ENST00000308488;ENST00000360355;ENST00000528095|ENST00000440064	D;D;T|.	0.94184|.	-3.36;-3.37;0.05|.	5.65|5.65	5.65|5.65	0.86999|0.86999	.|.	0.000000|.	0.56097|.	D|.	0.000033|.	T|.	0.78381|.	0.4274|.	M|M	0.78049|0.78049	2.395|2.395	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.79108|.	0.992|.	T|.	0.77744|.	-0.2473|.	10|.	0.87932|.	D|.	0|.	-19.8262|-19.8262	19.3332|19.3332	0.94303|0.94303	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	132|.	Q96T23|.	RSF1_HUMAN|.	H|S	132;101;131|98	ENSP00000311513:D132H;ENSP00000353511:D101H;ENSP00000436408:D131H|.	ENSP00000311513:D132H|.	D|X	-|-	1|2	0|2	RSF1|RSF1	77129608|77129608	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.711000|7.711000	0.84669|0.84669	2.667000|2.667000	0.90743|0.90743	0.655000|0.655000	0.94253|0.94253	GAT|TGA			0.368	RSF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000318075.2		NM_016578	
ERC1	23085	broad.mit.edu	37	12	1292505	1292505	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr12:1292505A>G	ENST00000397203.2	+	11	2481	c.2075A>G	c.(2074-2076)aAg>aGg	p.K692R	ERC1_ENST00000543086.3_Missense_Mutation_p.K664R|ERC1_ENST00000536573.2_3'UTR|ERC1_ENST00000546231.2_Missense_Mutation_p.K692R|ERC1_ENST00000355446.5_Missense_Mutation_p.K692R|ERC1_ENST00000360905.4_Missense_Mutation_p.K692R|ERC1_ENST00000589028.1_Missense_Mutation_p.K692R			Q8IUD2	RB6I2_HUMAN	ELKS/RAB6-interacting/CAST family member 1	692					I-kappaB phosphorylation (GO:0007252)|multicellular organismal development (GO:0007275)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|IkappaB kinase complex (GO:0008385)|presynaptic membrane (GO:0042734)	leucine zipper domain binding (GO:0043522)			NS(1)|breast(2)|cervix(2)|endometrium(2)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			GGACTGAAAAAGGACTCACGG	0.363																																					p.K692R													.	ERC1	95		0			c.A2075G												89.0	88.0	89.0					12																	1292505		2203	4300	6503	SO:0001583	missense	23085	exon11			TGAAAAAGGACTC	AB015617	CCDS8508.1, CCDS53732.1	12p13.3	2008-02-05	2006-08-14	2006-08-14	ENSG00000082805	ENSG00000082805			17072	protein-coding gene	gene with protein product		607127	"""RAB6 interacting protein 2"""	RAB6IP2		10697956, 11929610	Standard	NM_178040		Approved	ELKS, KIAA1081, CAST2, MGC12974	uc001qjb.2	Q8IUD2	OTTHUMG00000130138	ENST00000397203.2:c.2075A>G	12.37:g.1292505A>G	ENSP00000380386:p.Lys692Arg		Somatic	512	0.001953125	1		WXS	Illumina HiSeq	Phase_I	956	0.01	5	NM_178040	127	0.00	0	A2RU77|A7E295|D3DUP7|D3DUP8|Q6NVK2|Q8IUD3|Q8IUD4|Q8IUD5|Q8NAS1|Q9NXN5|Q9UIK7|Q9UPS1	Missense_Mutation	SNP	ENST00000397203.2	37	CCDS8508.1	.	.	.	.	.	.	.	.	.	.	A	10.81	1.455744	0.26161	.	.	ENSG00000082805	ENST00000347735;ENST00000397203;ENST00000454194;ENST00000537890;ENST00000299183;ENST00000543086;ENST00000542302;ENST00000545948;ENST00000546231;ENST00000355446;ENST00000360905;ENST00000440394;ENST00000538971;ENST00000536573	T;T;T;T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88;0.88;0.88;0.88	5.37	5.37	0.77165	.	0.093551	0.64402	D	0.000001	T	0.35595	0.0937	L	0.42686	1.345	0.80722	D	1	B;B;B;B;B	0.16166	0.002;0.016;0.003;0.003;0.001	B;B;B;B;B	0.19666	0.011;0.026;0.008;0.008;0.008	T	0.16041	-1.0416	10	0.11485	T	0.65	-32.4174	15.6887	0.77434	1.0:0.0:0.0:0.0	.	440;332;664;664;692	F5H327;F5GZU8;Q8IUD2-2;Q8IUD2-3;Q8IUD2	.;.;.;.;RB6I2_HUMAN	R	664;692;664;664;392;664;664;392;692;692;692;664;440;332	ENSP00000340054:K664R;ENSP00000380386:K692R;ENSP00000438546:K664R;ENSP00000442976:K392R;ENSP00000442739:K692R;ENSP00000347621:K692R;ENSP00000354158:K692R;ENSP00000410064:K664R	ENSP00000299183:K392R	K	+	2	0	ERC1	1162766	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.281000	0.72632	2.170000	0.68504	0.460000	0.39030	AAG			0.363	ERC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398380.2		NM_015064	
NRIP2	83714	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	2943815	2943815	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr12:2943815T>A	ENST00000337508.4	-	1	375	c.335A>T	c.(334-336)aAg>aTg	p.K112M		NM_031474.2	NP_113662.1	Q9BQI9	NRIP2_HUMAN	nuclear receptor interacting protein 2	112					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	aspartic-type endopeptidase activity (GO:0004190)			central_nervous_system(1)|endometrium(2)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			CACCAAGTCCTTGGAGGTGCC	0.642																																					p.K112M													.	.			0			c.A335T												50.0	51.0	51.0					12																	2943815		2203	4300	6503	SO:0001583	missense	83714	exon1			AAGTCCTTGGAGG	AK054740	CCDS8514.1	12p13.33	2008-02-05			ENSG00000053702	ENSG00000053702			23078	protein-coding gene	gene with protein product						11230166	Standard	NM_031474		Approved	DKFZP761G1913	uc001qlc.3	Q9BQI9	OTTHUMG00000130616	ENST00000337508.4:c.335A>T	12.37:g.2943815T>A	ENSP00000337501:p.Lys112Met		Somatic	64	0	0		WXS	Illumina HiSeq	.	150	0.08	12	NM_031474	2	0.00	0	A2RRE3|B4DV61	Missense_Mutation	SNP	ENST00000337508.4	37	CCDS8514.1	.	.	.	.	.	.	.	.	.	.	T	17.81	3.480206	0.63849	.	.	ENSG00000053702	ENST00000337508;ENST00000546074;ENST00000542990;ENST00000542386	.	.	.	4.34	4.34	0.51931	.	0.000000	0.85682	D	0.000000	T	0.70150	0.3191	L	0.57536	1.79	0.38928	D	0.95787	D	0.89917	1.0	D	0.87578	0.998	T	0.73833	-0.3858	9	0.56958	D	0.05	-28.3456	11.5258	0.50580	0.0:0.0:0.0:1.0	.	112	Q9BQI9	NRIP2_HUMAN	M	112;101;62;62	.	ENSP00000337501:K112M	K	-	2	0	NRIP2	2814076	1.000000	0.71417	1.000000	0.80357	0.751000	0.42716	6.741000	0.74837	1.832000	0.53329	0.397000	0.26171	AAG			0.642	NRIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253090.4		NM_031474	
ATN1	1822	mdanderson.org	37	12	7045879	7045879	+	Missense_Mutation	SNP	C	C	A	rs141514883|rs201442555		TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr12:7045879C>A	ENST00000356654.4	+	5	1686	c.1449C>A	c.(1447-1449)caC>caA	p.H483Q	ATN1_ENST00000396684.2_Missense_Mutation_p.H483Q	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	483	Poly-His.				cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						ACCATCACCACcagcaacagc	0.627																																					p.H483Q													.	.			0			c.C1449A							C	GLN/HIS,GLN/HIS	0,4406		0,0,2203	90.0	103.0	98.0		1449,1449	-0.2	1.0	12	dbSNP_134	98	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense	ATN1	NM_001007026.1,NM_001940.3	24,24	0,3,6500	AA,AC,CC		0.0349,0.0,0.0231	benign,benign	483/1191,483/1191	7045879	3,13003	2203	4300	6503	SO:0001583	missense	1822	exon5			TCACCACCAGCAA	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1449C>A	12.37:g.7045879C>A	ENSP00000349076:p.His483Gln		Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	225	0.04	10	NM_001007026	280	0.00	0	Q99495|Q99621|Q9UEK7	Missense_Mutation	SNP	ENST00000356654.4	37	CCDS31734.1	.	.	.	.	.	.	.	.	.	.	c	5.779	0.328161	0.10956	0.0	3.49E-4	ENSG00000111676	ENST00000356654;ENST00000396684;ENST00000544325;ENST00000229279	T;T;T	0.39229	1.09;1.09;1.09	3.41	-0.17	0.13335	.	.	.	.	.	T	0.22437	0.0541	N	0.08118	0	0.22266	N	0.999248	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.001	T	0.19289	-1.0310	9	0.20519	T	0.43	.	13.5577	0.61770	0.0:0.5325:0.4674:0.0	.	483;483	Q86V38;P54259	.;ATN1_HUMAN	Q	483;483;483;68	ENSP00000349076:H483Q;ENSP00000379915:H483Q;ENSP00000441744:H483Q	ENSP00000229279:H68Q	H	+	3	2	ATN1	6916140	1.000000	0.71417	0.985000	0.45067	0.188000	0.23474	0.000000	0.12993	0.175000	0.19841	-0.290000	0.09829	CAC	0		0.627	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401948.2		NM_001940	
KRAS	3845	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	25380276	25380276	+	Missense_Mutation	SNP	T	T	A	rs121913240		TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr12:25380276T>A	ENST00000256078.4	-	3	245	c.182A>T	c.(181-183)cAa>cTa	p.Q61L	KRAS_ENST00000557334.1_Intron|KRAS_ENST00000311936.3_Missense_Mutation_p.Q61L|AC087239.1_ENST00000594112.1_5'Flank	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	61			Q -> H (in lung carcinoma; dbSNP:rs17851045). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16533793, ECO:0000269|Ref.7}.|Q -> R (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61L(73)|p.Q61R(56)|p.Q61P(12)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GTACTCCTCTTGACCTGCTGT	0.418	Q61L(NCIH650_LUNG)|Q61L(SW948_LARGE_INTESTINE)|Q61R(PANC0213_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.Q61L	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)			Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS_ENST00000256078,colon,carcinoma,+1,429	KRAS_ENST00000256078	1	429	141	Substitution - Missense(141)	large_intestine(63)|lung(27)|thyroid(14)|haematopoietic_and_lymphoid_tissue(9)|pancreas(6)|skin(5)|stomach(3)|cervix(3)|upper_aerodigestive_tract(2)|soft_tissue(1)|central_nervous_system(1)|biliary_tract(1)|endometrium(1)|urinary_tract(1)|gastrointestinal_tract_(site_indeterminate)(1)|breast(1)|prostate(1)|kidney(1)	c.A182T												109.0	97.0	101.0					12																	25380276		2203	4300	6503	SO:0001583	missense	3845	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	TCCTCTTGACCTG	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.182A>T	12.37:g.25380276T>A	ENSP00000256078:p.Gln61Leu		Somatic	116	0	0		WXS	Illumina HiSeq	.	225	0.12	26	NM_004985	104	0.06	6	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	T	28.1	4.889058	0.91814	.	.	ENSG00000133703	ENST00000311936;ENST00000256078	D;D	0.83992	-1.79;-1.79	5.77	5.77	0.91146	Small GTP-binding protein domain (1);	0.049057	0.85682	D	0.000000	D	0.92097	0.7495	H	0.96333	3.805	0.80722	D	1	D;P	0.58970	0.984;0.812	P;P	0.53689	0.732;0.69	D	0.94295	0.7532	10	0.72032	D	0.01	.	15.5753	0.76373	0.0:0.0:0.0:1.0	.	61;61	P01116-2;P01116	.;RASK_HUMAN	L	61	ENSP00000308495:Q61L;ENSP00000256078:Q61L	ENSP00000256078:Q61L	Q	-	2	0	KRAS	25271543	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.983000	0.88140	2.326000	0.78906	0.533000	0.62120	CAA			0.418	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000412232.1		NM_033360	
FAM186A	121006	broad.mit.edu	37	12	50747102	50747102	+	Silent	SNP	A	A	G			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr12:50747102A>G	ENST00000327337.5	-	4	3512	c.3513T>C	c.(3511-3513)ctT>ctC	p.L1171L	FAM186A_ENST00000543096.1_5'Flank|FAM186A_ENST00000543111.1_Silent_p.L1171L	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1171								p.L1171L(2)									GCTGAGGGGTAAGAGGGATCC	0.642																																					p.L1171L	NSCLC(138;1796 1887 12511 19463 37884)												FAM186A_ENST00000327337,NS,carcinoma,0,3	FAM186A	181	3	2	Substitution - coding silent(2)	endometrium(2)	c.T3513C												28.0	25.0	26.0					12																	50747102		692	1591	2283	SO:0001819	synonymous_variant	121006	exon4			AGGGGTAAGAGGG		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.3513T>C	12.37:g.50747102A>G			Somatic	114	0.0175438596	2		WXS	Illumina HiSeq	Phase_I	164	0.04	7	NM_001145475	1	0.00	0		Silent	SNP	ENST00000327337.5	37	CCDS44878.1																																																																																					0.642	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000396838.1		XM_001718353	
KRT75	9119	broad.mit.edu	37	12	52827741	52827741	+	Silent	SNP	A	A	G			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr12:52827741A>G	ENST00000252245.5	-	1	568	c.348T>C	c.(346-348)tgT>tgC	p.C116C		NM_004693.2	NP_004684.2	O95678	K2C75_HUMAN	keratin 75	116	Gly-rich.|Head.				hematopoietic progenitor cell differentiation (GO:0002244)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(10)|prostate(1)|skin(1)	28				BRCA - Breast invasive adenocarcinoma(357;0.192)		CTCCAGGGGGACACACGGGGA	0.612																																					p.C116C													.	KRT75	75		0			c.T348C												117.0	119.0	119.0					12																	52827741		2203	4300	6503	SO:0001819	synonymous_variant	9119	exon1			AGGGGGACACACG	Y19212	CCDS8827.1	12q13.13	2013-06-25			ENSG00000170454	ENSG00000170454		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24431	protein-coding gene	gene with protein product		609025				9856802, 10692104, 16831889	Standard	NM_004693		Approved	K6HF	uc001saj.2	O95678	OTTHUMG00000169592	ENST00000252245.5:c.348T>C	12.37:g.52827741A>G			Somatic	232	0	0		WXS	Illumina HiSeq	Phase_I	283	0.02	5	NM_004693	0		0	B4DQU4|Q9NSA9	Silent	SNP	ENST00000252245.5	37	CCDS8827.1																																																																																					0.612	KRT75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404968.1		NM_004693	
DCTN2	10540	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57926527	57926527	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr12:57926527C>T	ENST00000548249.1	-	10	1108	c.841G>A	c.(841-843)Gct>Act	p.A281T	DCTN2_ENST00000537439.1_Missense_Mutation_p.A258T|DCTN2_ENST00000434715.3_Missense_Mutation_p.A286T|DCTN2_ENST00000543672.1_Missense_Mutation_p.A286T|DCTN2_ENST00000551400.1_5'Flank	NM_001261412.1|NM_001261413.1	NP_001248341.1|NP_001248342.1	Q13561	DCTN2_HUMAN	dynactin 2 (p50)	281					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|vesicle (GO:0031982)	motor activity (GO:0003774)|spectrin binding (GO:0030507)			endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|upper_aerodigestive_tract(2)	11						TGTAGCCGAGCCTCCACTTGA	0.468																																					p.A283T													.	.			0			c.G847A												83.0	81.0	81.0					12																	57926527		1914	4130	6044	SO:0001583	missense	10540	exon10			GCCGAGCCTCCAC	U50733	CCDS44930.1, CCDS58245.1, CCDS73489.1	12q13.3	2008-05-14				ENSG00000175203			2712	protein-coding gene	gene with protein product		607376				8647893	Standard	NM_001261412		Approved	RBP50, DCTN-50	uc001som.2	Q13561	OTTHUMG00000170124	ENST00000548249.1:c.841G>A	12.37:g.57926527C>T	ENSP00000447824:p.Ala281Thr		Somatic	169	0	0		WXS	Illumina HiSeq	.	219	0.19	42	NM_001261412	553	0.23	127	B2RBK5|Q86YN2|Q9BW17	Missense_Mutation	SNP	ENST00000548249.1	37	CCDS58245.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.726948	0.89390	.	.	ENSG00000175203	ENST00000548249;ENST00000434715;ENST00000543672;ENST00000537439;ENST00000354743;ENST00000543105;ENST00000550086	.	.	.	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.71693	0.3370	L	0.43923	1.385	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.998;0.999	T	0.63283	-0.6672	9	0.16420	T	0.52	-7.8126	18.01	0.89220	0.0:1.0:0.0:0.0	.	281;286;281	F8WAG8;F5H2S7;Q13561	.;.;DCTN2_HUMAN	T	281;286;286;258;281;194;122	.	ENSP00000346785:A281T	A	-	1	0	DCTN2	56212794	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.076000	0.76806	2.868000	0.98415	0.557000	0.71058	GCT			0.468	DCTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000407393.2		NM_006400	
TSPAN19	144448	broad.mit.edu	37	12	85408282	85408282	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr12:85408282A>T	ENST00000532498.2	-	9	811	c.731T>A	c.(730-732)aTc>aAc	p.I244N		NM_001100917.1	NP_001094387.1	P0C672	TSN19_HUMAN	tetraspanin 19	244						integral component of membrane (GO:0016021)				ovary(1)	1						TTCTGCATGGATTATATTCTT	0.269																																					p.I244N													.	TSPAN19	23		0			c.T731A												69.0	67.0	68.0					12																	85408282		1798	4056	5854	SO:0001583	missense	144448	exon9			GCATGGATTATAT		CCDS44949.1	12q21.31	2013-02-14			ENSG00000231738	ENSG00000231738		"""Tetraspanins"""	31886	protein-coding gene	gene with protein product							Standard	NM_001100917		Approved		uc009zsj.3	P0C672	OTTHUMG00000166181	ENST00000532498.2:c.731T>A	12.37:g.85408282A>T	ENSP00000433816:p.Ile244Asn		Somatic	463	0	0		WXS	Illumina HiSeq	Phase_I	454	0.02	8	NM_001100917	0		0		Missense_Mutation	SNP	ENST00000532498.2	37	CCDS44949.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.27|10.27	1.304365|1.304365	0.23736|0.23736	.|.	.|.	ENSG00000231738|ENSG00000231738	ENST00000532498|ENST00000525452	T|.	0.47869|.	0.83|.	3.71|3.71	3.71|3.71	0.42584|0.42584	.|.	.|.	.|.	.|.	.|.	T|T	0.19644|0.19644	0.0472|0.0472	N|N	0.08118|0.08118	0|0	0.21020|0.21020	N|N	0.999809|0.999809	D|.	0.69078|.	0.997|.	P|.	0.60789|.	0.879|.	T|T	0.17228|0.17228	-1.0376|-1.0376	9|5	0.42905|.	T|.	0.14|.	.|.	9.3848|9.3848	0.38336|0.38336	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	244|.	P0C672|.	TSN19_HUMAN|.	N|T	244|65	ENSP00000433816:I244N|.	ENSP00000433816:I244N|.	I|S	-|-	2|1	0|0	TSPAN19|TSPAN19	83932413|83932413	0.734000|0.734000	0.28142|0.28142	0.287000|0.287000	0.24848|0.24848	0.002000|0.002000	0.02628|0.02628	3.220000|3.220000	0.51207|0.51207	1.640000|1.640000	0.50565|0.50565	0.449000|0.449000	0.29647|0.29647	ATC|TCC			0.269	TSPAN19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388240.2		NM_001100917	
RAN	5901	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	131357394	131357394	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr12:131357394G>A	ENST00000543796.1	+	3	308	c.50G>A	c.(49-51)gGt>gAt	p.G17D	RAN_ENST00000541630.1_5'UTR|RAN_ENST00000392367.3_Missense_Mutation_p.G17D|RAN_ENST00000392369.2_Missense_Mutation_p.G17D|RAN_ENST00000254675.3_5'UTR			P62826	RAN_HUMAN	RAN, member RAS oncogene family	17					actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|cellular protein complex localization (GO:0034629)|DNA metabolic process (GO:0006259)|gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription, DNA-templated (GO:0045893)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(2)	9	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	Lung NSC(355;7.46e-07)|all_epithelial(31;7.36e-06)		OV - Ovarian serous cystadenocarcinoma(86;9.18e-49)|Epithelial(86;1.42e-45)|all cancers(50;6.28e-40)		GTATTGGTTGGTGATGGTGGT	0.428																																					p.G17D													.	.			0			c.G50A												332.0	326.0	328.0					12																	131357394		2203	4300	6503	SO:0001583	missense	5901	exon3			TGGTTGGTGATGG	M31469	CCDS9271.1, CCDS73546.1	12q24.33	2014-05-09			ENSG00000132341	ENSG00000132341			9846	protein-coding gene	gene with protein product		601179				8421051	Standard	XM_005253592		Approved	ARA24, TC4, Gsp1	uc001uir.3	P62826	OTTHUMG00000134328	ENST00000543796.1:c.50G>A	12.37:g.131357394G>A	ENSP00000446215:p.Gly17Asp		Somatic	155	0	0		WXS	Illumina HiSeq	.	244	0.18	43	NM_006325	2292	0.22	502	A8K3Z8|P17080|P28746|P28747|Q6IPB2|Q86V08|Q8NI90|Q9CSP3|Q9CWI7|Q9CZA2|Q9UDJ5|Q9UEU9	Missense_Mutation	SNP	ENST00000543796.1	37	CCDS9271.1	.	.	.	.	.	.	.	.	.	.	G	18.57	3.651721	0.67472	.	.	ENSG00000132341	ENST00000543796;ENST00000448750;ENST00000392369;ENST00000535090;ENST00000392367	D;D;D;D;D	0.98362	-4.89;-4.89;-4.89;-4.89;-4.89	3.52	3.52	0.40303	Small GTP-binding protein domain (1);	0.000000	0.85682	U	0.000000	D	0.99384	0.9783	H	0.99042	4.41	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98124	1.0427	10	0.87932	D	0	-12.6421	14.3772	0.66886	0.0:0.0:1.0:0.0	.	17;17	A8K3Z8;P62826	.;RAN_HUMAN	D	17;35;17;13;17	ENSP00000446215:G17D;ENSP00000396127:G35D;ENSP00000376176:G17D;ENSP00000444042:G13D;ENSP00000376174:G17D	ENSP00000376174:G17D	G	+	2	0	RAN	129923347	1.000000	0.71417	0.572000	0.28498	0.320000	0.28249	8.558000	0.90704	1.682000	0.51000	0.436000	0.28706	GGT			0.428	RAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000259441.2		NM_006325	
MYO16	23026	mdanderson.org	37	13	109772789	109772789	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr13:109772789G>T	ENST00000357550.2	+	28	3485	c.3444G>T	c.(3442-3444)caG>caT	p.Q1148H	MYO16_ENST00000457511.2_Missense_Mutation_p.Q660H|MYO16_ENST00000356711.2_Missense_Mutation_p.Q1148H	NM_001198950.1	NP_001185879.1			myosin XVI									p.Q1148H(1)		NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TACAGTTGCAGAGAAAAATTA	0.353																																					p.Q1170H													MYO16,NS,carcinoma,0,1	MYO16	0	1	1	Substitution - Missense(1)	lung(1)	c.G3510T												113.0	108.0	110.0					13																	109772789		2203	4300	6503	SO:0001583	missense	23026	exon29			GTTGCAGAGAAAA		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.3444G>T	13.37:g.109772789G>T	ENSP00000350160:p.Gln1148His		Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	45	0.07	3	NM_001198950	8	0.00	0		Missense_Mutation	SNP	ENST00000357550.2	37	CCDS32008.1	.	.	.	.	.	.	.	.	.	.	G	7.684	0.689547	0.14973	.	.	ENSG00000041515	ENST00000356711;ENST00000357550;ENST00000457511	D;D;D	0.95238	-3.65;-3.65;-3.65	5.38	4.52	0.55395	.	0.000000	0.38720	U	0.001588	D	0.88020	0.6325	N	0.17082	0.46	0.40800	D	0.983335	B;B	0.22414	0.069;0.041	B;B	0.23419	0.046;0.021	T	0.83015	-0.0170	9	.	.	.	.	12.2943	0.54836	0.0825:0.0:0.9175:0.0	.	660;1148	F8W883;Q9Y6X6	.;MYO16_HUMAN	H	1148;1148;660	ENSP00000349145:Q1148H;ENSP00000350160:Q1148H;ENSP00000401633:Q660H	.	Q	+	3	2	MYO16	108570790	1.000000	0.71417	0.998000	0.56505	0.980000	0.70556	2.111000	0.41883	1.227000	0.43598	0.650000	0.86243	CAG			0.353	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045746.1		NM_015011	
SYNDIG1L	646658	broad.mit.edu	37	14	74876236	74876236	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr14:74876236C>A	ENST00000554823.1	-	1	273	c.212G>T	c.(211-213)aGc>aTc	p.S71I	SYNDIG1L_ENST00000331628.3_Missense_Mutation_p.S71I			A6NDD5	SYN1L_HUMAN	synapse differentiation inducing 1-like	71					response to biotic stimulus (GO:0009607)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|lung(8)|pancreas(1)|prostate(1)|skin(1)	14						CAGGAGGCAGCTGGGCCGGTA	0.682																																					p.S71I													.	SYNDIG1L	24		0			c.G212T												23.0	26.0	25.0					14																	74876236		1867	4092	5959	SO:0001583	missense	646658	exon2			AGGCAGCTGGGCC		CCDS41970.1	14q24.3	2011-06-30	2011-06-30	2011-06-30		ENSG00000183379			32388	protein-coding gene	gene with protein product	"""caudate-and putamen-enriched sequence"", ""interferon induced transmembrane protein domain containing 4"""	609999	"""transmembrane protein 90A"""	TMEM90A		16359841	Standard	NM_001105579		Approved	capucin, IFITMD4	uc001xpx.2	A6NDD5		ENST00000554823.1:c.212G>T	14.37:g.74876236C>A	ENSP00000450439:p.Ser71Ile		Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	106	0.05	5	NM_001105579	0		0		Missense_Mutation	SNP	ENST00000554823.1	37	CCDS41970.1	.	.	.	.	.	.	.	.	.	.	C	14.29	2.492063	0.44352	.	.	ENSG00000183379	ENST00000331628;ENST00000554823;ENST00000554953	D;D	0.95377	-3.69;-3.69	4.44	0.0747	0.14396	.	0.160430	0.53938	D	0.000049	D	0.89136	0.6629	L	0.29908	0.895	0.27297	N	0.957695	B	0.25719	0.132	B	0.24701	0.055	T	0.81865	-0.0736	10	0.87932	D	0	-8.4229	5.0384	0.14447	0.0:0.4319:0.3101:0.2579	.	71	A6NDD5	SYN1L_HUMAN	I	71	ENSP00000331474:S71I;ENSP00000450439:S71I	ENSP00000331474:S71I	S	-	2	0	SYNDIG1L	73945989	0.998000	0.40836	0.999000	0.59377	0.961000	0.63080	0.518000	0.22847	0.121000	0.18284	0.467000	0.42956	AGC			0.682	SYNDIG1L-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000412341.1		XM_938515	
POMT2	29954	mdanderson.org	37	14	77769282	77769282	+	Silent	SNP	C	C	A	rs562425016		TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr14:77769282C>A	ENST00000261534.4	-	5	754	c.552G>T	c.(550-552)acG>acT	p.T184T	POMT2_ENST00000556880.1_5'UTR	NM_013382.5	NP_037514.2	Q9UKY4	POMT2_HUMAN	protein-O-mannosyltransferase 2	184			T -> M (in MDDGC2). {ECO:0000269|PubMed:17878207, ECO:0000269|PubMed:17923109}.			endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(1)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	14			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0292)		TGAGGCATCCCGTGTCTGAAA	0.532																																					p.T184T													.	.			0			c.G552T												83.0	72.0	76.0					14																	77769282		2203	4300	6503	SO:0001819	synonymous_variant	29954	exon5			GCATCCCGTGTCT	AF105020	CCDS9857.1	14q24	2014-09-17			ENSG00000009830	ENSG00000009830	2.4.1.109	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19743	protein-coding gene	gene with protein product		607439				11162531, 12460945	Standard	NM_013382		Approved	LGMD2N	uc001xti.2	Q9UKY4	OTTHUMG00000171556	ENST00000261534.4:c.552G>T	14.37:g.77769282C>A			Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	51	0.06	3	NM_013382	28	0.00	0	Q9NSG6|Q9P1W0|Q9P1W2	Silent	SNP	ENST00000261534.4	37	CCDS9857.1																																																																																					0.532	POMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000414155.1		NM_013382	
AKAP13	11214	broad.mit.edu	37	15	86064728	86064728	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr15:86064728G>T	ENST00000394518.2	+	3	198	c.103G>T	c.(103-105)Gta>Tta	p.V35L	AKAP13_ENST00000361243.2_Missense_Mutation_p.V35L|AKAP13_ENST00000560302.1_Missense_Mutation_p.V35L	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	35					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						GTTTTACTTGGTATTTTTGGG	0.423																																					p.V35L	Melanoma(94;603 1453 3280 32295 32951)												AKAP13_ENST00000394518,NS,carcinoma,-2,2	AKAP13	394	2	0			c.G103T												396.0	348.0	364.0					15																	86064728		2202	4299	6501	SO:0001583	missense	11214	exon3			TACTTGGTATTTT	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.103G>T	15.37:g.86064728G>T	ENSP00000378026:p.Val35Leu		Somatic	289	0	0		WXS	Illumina HiSeq	Phase_I	391	0.01	4	NM_007200	5	0.00	0	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	ENST00000394518.2	37	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	G	13.17	2.157544	0.38119	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	T;T	0.60672	0.17;0.17	5.52	4.59	0.56863	.	.	.	.	.	T	0.36166	0.0957	N	0.11201	0.11	0.80722	D	1	P;P;B	0.46277	0.802;0.875;0.013	B;B;B	0.40825	0.184;0.341;0.019	T	0.33650	-0.9860	9	0.72032	D	0.01	.	7.5201	0.27622	0.0909:0.1677:0.7414:0.0	.	35;35;35	Q12802;Q12802-2;Q12802-5	AKP13_HUMAN;.;.	L	35;35;34;34	ENSP00000354718:V35L;ENSP00000378026:V35L	ENSP00000354718:V35L	V	+	1	0	AKAP13	83865732	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	1.509000	0.35780	1.437000	0.47472	0.591000	0.81541	GTA			0.423	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000417318.1		NM_007200	
ANPEP	290	broad.mit.edu	37	15	90328669	90328669	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr15:90328669G>T	ENST00000300060.6	-	21	3128	c.2815C>A	c.(2815-2817)Caa>Aaa	p.Q939K		NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	939	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	TCCAGGGCTTGCTCCAGGGCC	0.547																																					p.Q939K	NSCLC(30;827 977 2459 19669 26125)												.	ANPEP	124		0			c.C2815A												199.0	184.0	189.0					15																	90328669		2200	4299	6499	SO:0001583	missense	290	exon21			GGGCTTGCTCCAG	M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.2815C>A	15.37:g.90328669G>T	ENSP00000300060:p.Gln939Lys		Somatic	162	0	0		WXS	Illumina HiSeq	Phase_I	206	0.03	6	NM_001150	82	0.00	0	Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Missense_Mutation	SNP	ENST00000300060.6	37	CCDS10356.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.507633	0.85282	.	.	ENSG00000166825	ENST00000300060	T	0.07908	3.15	5.31	5.31	0.75309	.	0.125811	0.56097	D	0.000038	T	0.36799	0.0980	M	0.90542	3.125	0.58432	D	0.999996	D	0.76494	0.999	D	0.81914	0.995	T	0.33471	-0.9867	10	0.72032	D	0.01	.	16.5192	0.84309	0.0:0.0:1.0:0.0	.	939	P15144	AMPN_HUMAN	K	939	ENSP00000300060:Q939K	ENSP00000300060:Q939K	Q	-	1	0	ANPEP	88129673	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	7.529000	0.81952	2.763000	0.94921	0.650000	0.86243	CAA			0.547	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313425.1			
IFT140	9742	mdanderson.org	37	16	1561124	1561124	+	Silent	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr16:1561124G>T	ENST00000426508.2	-	31	4573	c.4210C>A	c.(4210-4212)Cgg>Agg	p.R1404R	IFT140_ENST00000361339.5_Silent_p.R598R|LA16c-385E7.1_ENST00000566922.1_lincRNA	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	1404					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				GGAAGCCGCCGCCGCATCTCC	0.657																																					p.R1404R													.	.			0			c.C4210A												21.0	23.0	22.0					16																	1561124		2196	4299	6495	SO:0001819	synonymous_variant	9742	exon31			GCCGCCGCCGCAT	AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.4210C>A	16.37:g.1561124G>T			Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	60	0.05	3	NM_014714	9	0.00	0	A2A2A8|D3DU75|O60332|Q9UG52	Silent	SNP	ENST00000426508.2	37	CCDS10439.1																																																																																					0.657	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250438.2		NM_014714	
TSC2	7249	mdanderson.org	37	16	2124247	2124247	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr16:2124247C>T	ENST00000219476.3	+	22	3032	c.2402C>T	c.(2401-2403)gCc>gTc	p.A801V	TSC2_ENST00000439673.2_Missense_Mutation_p.A764V|TSC2_ENST00000401874.2_Missense_Mutation_p.A801V|TSC2_ENST00000382538.6_Missense_Mutation_p.A752V|TSC2_ENST00000353929.4_Missense_Mutation_p.A801V|TSC2_ENST00000350773.4_Missense_Mutation_p.A801V|TSC2_ENST00000568454.1_Missense_Mutation_p.A812V	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	801					acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)	p.E793fs*9(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				CACCGCTGTGCCAGCCAGTGC	0.627			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.A801V			yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	.			1	Deletion - Frameshift(1)	pancreas(1)	c.C2402T												87.0	67.0	74.0					16																	2124247		2198	4299	6497	SO:0001583	missense	7249	exon22	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	GCTGTGCCAGCCA	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.2402C>T	16.37:g.2124247C>T	ENSP00000219476:p.Ala801Val		Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_001114382	54	0.00	0	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	ENST00000219476.3	37	CCDS10458.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.834285	0.91036	.	.	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	D;D;D;D;D;D	0.89415	-2.51;-2.51;-2.51;-2.51;-2.51;-2.51	5.35	5.35	0.76521	Tuberin-type domain (1);	0.129318	0.51477	D	0.000089	D	0.93334	0.7875	M	0.67700	2.07	0.58432	D	0.999995	D;P;D;D;D;D	0.76494	0.977;0.941;0.971;0.971;0.997;0.999	D;P;P;P;D;D	0.79108	0.926;0.734;0.853;0.792;0.97;0.992	D	0.93743	0.7052	10	0.72032	D	0.01	-29.8225	14.6411	0.68726	0.0:0.8547:0.1453:0.0	.	752;764;801;801;801;801	B4DIL8;P49815-6;P49815-4;P49815-3;P49815-5;P49815	.;.;.;.;.;TSC2_HUMAN	V	801;801;801;764;752;801	ENSP00000219476:A801V;ENSP00000384468:A801V;ENSP00000248099:A801V;ENSP00000399232:A764V;ENSP00000371978:A752V;ENSP00000344383:A801V	ENSP00000219476:A801V	A	+	2	0	TSC2	2064248	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	5.946000	0.70234	2.500000	0.84329	0.313000	0.20887	GCC			0.627	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250657.2		NM_000548	
ACSM2B	348158	broad.mit.edu	37	16	20570613	20570613	+	Missense_Mutation	SNP	T	T	C	rs374648082		TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr16:20570613T>C	ENST00000329697.6	-	3	502	c.334A>G	c.(334-336)Atg>Gtg	p.M112V	ACSM2B_ENST00000565322.1_Missense_Mutation_p.M33V|ACSM2B_ENST00000414188.2_Missense_Mutation_p.M112V|ACSM2B_ENST00000567001.1_Missense_Mutation_p.M112V|ACSM2B_ENST00000565232.1_Missense_Mutation_p.M112V	NM_001105069.1	NP_001098539.1	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member 2B	112					fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(4)|lung(33)|ovary(1)|prostate(1)|skin(5)	57						CGGGGCAGCATCACTGCCACA	0.552													t|||	1	0.000199681	0.0008	0.0	5008	,	,		16639	0.0		0.0	False		,,,				2504	0.0				p.M112V													ACSM2B,NS,carcinoma,0,1	ACSM2B	121	1	0			c.A334G												80.0	64.0	69.0					16																	20570613		2201	4300	6501	SO:0001583	missense	348158	exon4			GCAGCATCACTGC	AY160217	CCDS10586.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000066813	ENSG00000066813		"""Acyl-CoA synthetase family"""	30931	protein-coding gene	gene with protein product	"""xenobiotic/medium chain fatty acid:CoA ligase"""	614359	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2		12616642	Standard	NM_182617		Approved	HXMA, HYST1046	uc002dhk.4	Q68CK6	OTTHUMG00000131555	ENST00000329697.6:c.334A>G	16.37:g.20570613T>C	ENSP00000327453:p.Met112Val		Somatic	209	0.004784689	1		WXS	Illumina HiSeq	Phase_I	208	0.03	7	NM_182617	0		0	Q86YT1	Missense_Mutation	SNP	ENST00000329697.6	37	CCDS10586.1	.	.	.	.	.	.	.	.	.	.	t	0.019	-1.457556	0.01071	.	.	ENSG00000066813	ENST00000329697;ENST00000414188	T;T	0.40225	1.04;1.04	3.51	1.34	0.21922	AMP-dependent synthetase/ligase (1);	0.418948	0.17928	N	0.157273	T	0.15565	0.0375	N	0.04373	-0.215	0.20975	N	0.999816	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.20405	-1.0276	10	0.14656	T	0.56	-12.621	4.4767	0.11746	0.0:0.499:0.0:0.501	.	112;112	A8K051;Q68CK6	.;ACS2B_HUMAN	V	112	ENSP00000327453:M112V;ENSP00000390378:M112V	ENSP00000327453:M112V	M	-	1	0	ACSM2B	20478114	0.087000	0.21565	0.873000	0.34254	0.106000	0.19336	0.278000	0.18753	0.682000	0.31407	-0.190000	0.12839	ATG			0.552	ACSM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254417.2		NM_182617	
KIAA0895L	653319	mdanderson.org	37	16	67212358	67212358	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr16:67212358G>T	ENST00000290881.7	-	6	1823	c.897C>A	c.(895-897)aaC>aaA	p.N299K	KIAA0895L_ENST00000563831.2_5'UTR|KIAA0895L_ENST00000561621.1_Missense_Mutation_p.N299K|KIAA0895L_ENST00000563902.1_Missense_Mutation_p.N299K			Q68EN5	K895L_HUMAN	KIAA0895-like	299										breast(2)|endometrium(5)|kidney(2)|large_intestine(3)|lung(2)|prostate(2)|skin(1)	17						GGCCCTCCGCGTTGTGCCACG	0.751																																					p.N299K													.	.			0			c.C897A												2.0	3.0	3.0					16																	67212358		1501	3329	4830	SO:0001583	missense	653319	exon5			CTCCGCGTTGTGC	AK092303	CCDS42177.1	16q22.1	2008-11-27				ENSG00000196123			34408	protein-coding gene	gene with protein product							Standard	NM_001040715		Approved	LOC653319	uc002ert.3	Q68EN5		ENST00000290881.7:c.897C>A	16.37:g.67212358G>T	ENSP00000290881:p.Asn299Lys		Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	11	0.18	2	NM_001040715	5	0.00	0	A2VCS8|Q8N3H9|Q8NAQ5|Q96IE5	Missense_Mutation	SNP	ENST00000290881.7	37	CCDS42177.1	.	.	.	.	.	.	.	.	.	.	G	10.79	1.448826	0.26074	.	.	ENSG00000196123	ENST00000290881	.	.	.	4.54	-1.04	0.10068	.	0.292904	0.42053	D	0.000764	T	0.26011	0.0634	N	0.25890	0.77	0.20975	N	0.999815	B;B;B	0.32396	0.117;0.152;0.369	B;B;B	0.34093	0.066;0.175;0.066	T	0.15636	-1.0430	9	0.48119	T	0.1	-10.8862	8.6014	0.33747	0.5428:0.0:0.4572:0.0	.	299;299;144	Q68EN5-2;Q68EN5;Q68EN5-3	.;K895L_HUMAN;.	K	299	.	ENSP00000290881:N299K	N	-	3	2	KIAA0895L	65769859	0.000000	0.05858	0.737000	0.30932	0.038000	0.13279	0.277000	0.18734	-0.225000	0.09913	-0.225000	0.12378	AAC			0.751	KIAA0895L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000421193.4		NM_001040715	
SMG6	23293	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	2200556	2200556	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr17:2200556C>T	ENST00000263073.6	-	4	2182	c.2132G>A	c.(2131-2133)aGc>aAc	p.S711N	SMG6_ENST00000544865.1_Missense_Mutation_p.S680N	NM_017575.4	NP_060045.4	Q86US8	EST1A_HUMAN	SMG6 nonsense mediated mRNA decay factor	711					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|telomeric DNA binding (GO:0042162)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(10)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						TAATGGCTTGCTGCGAATGGC	0.383																																					p.S711N	Melanoma(59;28 1088 11621 25887 46638 50814)												.	.			0			c.G2132A												114.0	117.0	116.0					17																	2200556		2203	4300	6503	SO:0001583	missense	23293	exon4			GGCTTGCTGCGAA	AB018275	CCDS11016.1, CCDS58498.1	17p13.3	2013-07-02	2013-07-02	2006-02-16	ENSG00000070366	ENSG00000070366			17809	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog A (S. cerevisiae)"""	610963	"""chromosome 17 open reading frame 31"", ""smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf31		12676087, 12699629	Standard	NM_017575		Approved	KIAA0732, SMG-6, EST1A	uc002fub.1	Q86US8	OTTHUMG00000177578	ENST00000263073.6:c.2132G>A	17.37:g.2200556C>T	ENSP00000263073:p.Ser711Asn		Somatic	119	0	0		WXS	Illumina HiSeq	.	110	0.18	20	NM_017575	51	0.35	18	B7Z874|O94837|Q86VH6|Q9UF60	Missense_Mutation	SNP	ENST00000263073.6	37	CCDS11016.1	.	.	.	.	.	.	.	.	.	.	C	17.11	3.306927	0.60305	.	.	ENSG00000070366	ENST00000263073;ENST00000544865	T;T	0.18960	2.18;2.18	5.08	4.1	0.47936	Telomerase activating protein Est1 (1);	0.162225	0.56097	D	0.000025	T	0.22975	0.0555	L	0.48642	1.525	0.42346	D	0.992356	P	0.48911	0.917	P	0.45577	0.486	T	0.02683	-1.1124	10	0.18276	T	0.48	-1.3701	14.7911	0.69844	0.1457:0.8543:0.0:0.0	.	711	Q86US8	EST1A_HUMAN	N	711;680	ENSP00000263073:S711N;ENSP00000443920:S680N	ENSP00000263073:S711N	S	-	2	0	SMG6	2147306	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.949000	0.56668	1.088000	0.41272	0.455000	0.32223	AGC			0.383	SMG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000437826.3			
PITPNM3	83394	mdanderson.org	37	17	6371655	6371655	+	Missense_Mutation	SNP	G	G	T	rs150769456		TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr17:6371655G>T	ENST00000262483.8	-	14	1867	c.1780C>A	c.(1780-1782)Cgc>Agc	p.R594S	PITPNM3_ENST00000576664.1_5'UTR|PITPNM3_ENST00000421306.3_Missense_Mutation_p.R558S	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	594	DDHD. {ECO:0000255|PROSITE- ProRule:PRU00378}.				phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		CTCTCATAGCGCATTACCTAG	0.627																																					p.R594S													PITPNM3,NS,carcinoma,+1,1	PITPNM3	1	1	0			c.C1780A												69.0	70.0	70.0					17																	6371655		2203	4300	6503	SO:0001583	missense	83394	exon14			CATAGCGCATTAC	AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.1780C>A	17.37:g.6371655G>T	ENSP00000262483:p.Arg594Ser		Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	54	0.06	3	NM_031220	4	0.00	0	A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Missense_Mutation	SNP	ENST00000262483.8	37	CCDS11076.1	.	.	.	.	.	.	.	.	.	.	G	14.35	2.509825	0.44660	.	.	ENSG00000091622	ENST00000262483;ENST00000421306	T;T	0.46451	0.87;0.88	4.89	1.2	0.21068	DDHD (2);	0.411149	0.24960	N	0.034233	T	0.45357	0.1338	M	0.72353	2.195	0.47374	D	0.9994	P;P	0.49862	0.929;0.846	P;B	0.48982	0.597;0.392	T	0.45440	-0.9261	10	0.51188	T	0.08	.	7.5413	0.27740	0.0:0.1457:0.4184:0.4358	.	558;594	F8WEW5;Q9BZ71	.;PITM3_HUMAN	S	594;558	ENSP00000262483:R594S;ENSP00000407882:R558S	ENSP00000262483:R594S	R	-	1	0	PITPNM3	6312379	1.000000	0.71417	0.998000	0.56505	0.071000	0.16799	1.242000	0.32755	0.997000	0.38969	0.448000	0.29417	CGC			0.627	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000219824.2		NM_031220	
LOC146880	146880	broad.mit.edu	37	17	62757842	62757843	+	RNA	INS	-	-	A	rs79383345|rs76968253		TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr17:62757842_62757843insA	ENST00000400873.3	-	0	1605					NR_026899.1																						gactccgtctcaaaaaaaaaaa	0.416																																					.													.	.			0			.																																											0	.			CCGTCTCAAAAAA																													17.37:g.62757853_62757853dupA			Somatic	11	0	0		WXS	Illumina HiSeq	Phase_I	10	0.50	5	.	0		0		RNA	INS	ENST00000400873.3	37																																																																																						0.416	hsa-mir-6080.1-201	KNOWN	basic	processed_transcript	processed_transcript					
PTPN2	5771	broad.mit.edu;bcgsc.ca;mdanderson.org	37	18	12830954	12830954	+	Silent	SNP	C	C	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr18:12830954C>T	ENST00000309660.5	-	4	441	c.348G>A	c.(346-348)gtG>gtA	p.V116V	PTPN2_ENST00000591497.1_Silent_p.V87V|PTPN2_ENST00000591115.1_Silent_p.V116V|PTPN2_ENST00000353319.4_Silent_p.V116V|PTPN2_ENST00000327283.3_Silent_p.V116V	NM_002828.3	NP_002819.2	P17706	PTN2_HUMAN	protein tyrosine phosphatase, non-receptor type 2	116	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				B cell differentiation (GO:0030183)|cytokine-mediated signaling pathway (GO:0019221)|erythrocyte differentiation (GO:0030218)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemotaxis (GO:0050922)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of interleukin-2-mediated signaling pathway (GO:1902206)|negative regulation of interleukin-4-mediated signaling pathway (GO:1902215)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage colony-stimulating factor signaling pathway (GO:1902227)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of positive thymic T cell selection (GO:1902233)|negative regulation of prolactin signaling pathway (GO:1902212)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|negative regulation of tyrosine phosphorylation of Stat1 protein (GO:0042512)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|negative regulation of tyrosine phosphorylation of Stat6 protein (GO:0042527)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of gluconeogenesis (GO:0045722)|regulation of hepatocyte growth factor receptor signaling pathway (GO:1902202)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|T cell differentiation (GO:0030217)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|syntaxin binding (GO:0019905)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|prostate(1)|skin(3)	13		Lung NSC(161;8.94e-06)				ATTCTTTCTCCACAATGCGGT	0.393																																					p.V116V													.	PTPN2	37		0			c.G348A												64.0	62.0	63.0					18																	12830954		2203	4300	6503	SO:0001819	synonymous_variant	5771	exon4			TTTCTCCACAATG	M25393	CCDS11863.1, CCDS11864.1, CCDS11865.1, CCDS59306.1	18p11.3-p11.2	2011-06-09			ENSG00000175354	ENSG00000175354		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9650	protein-coding gene	gene with protein product		176887		PTPT		2164224	Standard	NM_002828		Approved	TCELLPTP, TC-PTP, TCPTP	uc002krp.3	P17706	OTTHUMG00000131702	ENST00000309660.5:c.348G>A	18.37:g.12830954C>T			Somatic	176	0	0		WXS	Illumina HiSeq	Phase_I	144	0.04	6	NM_001207013	187	0.00	0	A8K955|A8MXU3|K7ENG3|Q96AU5|Q96HR2	Silent	SNP	ENST00000309660.5	37	CCDS11865.1																																																																																					0.393	PTPN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000254613.3		NM_002828, NM_080422, NM_080423	
SETBP1	26040	broad.mit.edu	37	18	42531523	42531523	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr18:42531523G>T	ENST00000282030.5	+	4	2514	c.2218G>T	c.(2218-2220)Gaa>Taa	p.E740*		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	740						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		ACCCCCATCCGAAGAACCCAA	0.552									Schinzel-Giedion syndrome																												p.E740X													.	SETBP1	577		0			c.G2218T												37.0	42.0	40.0					18																	42531523		2203	4300	6503	SO:0001587	stop_gained	26040	exon4	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	CCATCCGAAGAAC	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.2218G>T	18.37:g.42531523G>T	ENSP00000282030:p.Glu740*		Somatic	133	0.007518797	1		WXS	Illumina HiSeq	Phase_I	121	0.03	4	NM_015559	6	0.00	0	A6H8W5|Q6P6C3|Q9UEF3	Nonsense_Mutation	SNP	ENST00000282030.5	37	CCDS11923.2	.	.	.	.	.	.	.	.	.	.	G	40	8.510642	0.98843	.	.	ENSG00000152217	ENST00000282030	.	.	.	6.17	6.17	0.99709	.	0.122601	0.56097	D	0.000024	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	13.9957	0.64397	0.0685:0.0:0.9315:0.0	.	.	.	.	X	740	.	ENSP00000282030:E740X	E	+	1	0	SETBP1	40785521	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.070000	0.64376	2.941000	0.99782	0.655000	0.94253	GAA			0.552	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255854.4		NM_001130110	
UHRF1	29128	broad.mit.edu	37	19	4960773	4960773	+	RNA	SNP	G	G	A			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr19:4960773G>A	ENST00000592666.1	+	0	2916							Q96T88	UHRF1_HUMAN	ubiquitin-like with PHD and ring finger domains 1						cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|histone monoubiquitination (GO:0010390)|histone ubiquitination (GO:0016574)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of DNA topoisomerase (ATP-hydrolyzing) activity (GO:2000373)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autoubiquitination (GO:0051865)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|replication fork (GO:0005657)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|hemi-methylated DNA-binding (GO:0044729)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|methyl-CpG binding (GO:0008327)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|upper_aerodigestive_tract(2)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0276)		TCTGCAGACCGTCCTCAACCA	0.612																																					.													.	UHRF1	56		0			.												11.0	13.0	13.0					19																	4960773		1849	4048	5897			29128	.			CAGACCGTCCTCA	AF129507	CCDS74262.1, CCDS74263.1	19p13.3	2012-04-20	2008-08-14		ENSG00000034063	ENSG00000276043		"""RING-type (C3HC4) zinc fingers"""	12556	protein-coding gene	gene with protein product		607990				10646863	Standard	NM_001048201		Approved	ICBP90, Np95, FLJ21925, RNF106	uc002mbo.3	Q96T88			19.37:g.4960773G>A			Somatic	395	0	0		WXS	Illumina HiSeq	Phase_I	574	0.01	6	.	4	0.00	0	A0JBR2|A8K024|B2RBA9|Q2HIX7|Q8J022|Q9H6S6|Q9P115|Q9P1U7	RNA	SNP	ENST00000592666.1	37		.	.	.	.	.	.	.	.	.	.	G	1.015	-0.686587	0.03328	.	.	ENSG00000034063	ENST00000262952;ENST00000396708;ENST00000455180;ENST00000543616;ENST00000398240	.	.	.	4.43	-2.58	0.06228	Zinc finger, RING/FYVE/PHD-type (1);	0.437398	0.22834	N	0.055076	T	0.14227	0.0344	.	.	.	0.23834	N	0.996716	B;B	0.10296	0.003;0.0	B;B	0.04013	0.001;0.001	T	0.41610	-0.9499	7	0.02654	T	1	-37.4898	6.9817	0.24706	0.5298:0.2106:0.2597:0.0	.	794;781	Q2HIX7;Q96T88	.;UHRF1_HUMAN	I	780;395;780;780;793	.	ENSP00000262952:V780I	V	+	1	0	UHRF1	4911773	0.000000	0.05858	0.024000	0.17045	0.537000	0.34900	-0.174000	0.09839	-0.195000	0.10382	-0.367000	0.07326	GTC			0.612	UHRF1-006	KNOWN	sequence_error|basic	processed_transcript	processed_transcript		OTTHUMT00000450444.1		NM_001048201	
RFX1	5989	broad.mit.edu	37	19	14104595	14104595	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr19:14104595C>G	ENST00000254325.4	-	2	295	c.61G>C	c.(61-63)Gcc>Ccc	p.A21P		NM_002918.4	NP_002909.4	P22670	RFX1_HUMAN	regulatory factor X, 1 (influences HLA class II expression)	21					immune response (GO:0006955)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			tgtggcggggcctgtggcggc	0.647																																					p.A21P													.	RFX1	63		0			c.G61C												10.0	15.0	13.0					19																	14104595		1724	3803	5527	SO:0001583	missense	5989	exon2			GCGGGGCCTGTGG		CCDS12301.1	19p13.1	2008-07-17				ENSG00000132005			9982	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 1"", ""enhancer factor C"", ""MHC class II regulatory factor RFX"""	600006				1505960, 8289803	Standard	NM_002918		Approved	EF-C	uc002mxv.3	P22670		ENST00000254325.4:c.61G>C	19.37:g.14104595C>G	ENSP00000254325:p.Ala21Pro		Somatic	62	0.2580645161	16		WXS	Illumina HiSeq	Phase_I	97	0.29	28	NM_002918	3	0.00	0		Missense_Mutation	SNP	ENST00000254325.4	37	CCDS12301.1	.	.	.	.	.	.	.	.	.	.	C	13.63	2.293181	0.40594	.	.	ENSG00000132005	ENST00000254325	T	0.59906	0.23	4.92	4.92	0.64577	.	3.276640	0.01489	N	0.016981	T	0.60051	0.2239	N	0.12182	0.205	0.29892	N	0.825094	D	0.65815	0.995	P	0.57911	0.829	T	0.58929	-0.7549	10	0.25106	T	0.35	-22.5938	14.0018	0.64437	0.0:1.0:0.0:0.0	.	21	P22670	RFX1_HUMAN	P	21	ENSP00000254325:A21P	ENSP00000254325:A21P	A	-	1	0	RFX1	13965595	1.000000	0.71417	0.999000	0.59377	0.242000	0.25591	1.468000	0.35332	2.451000	0.82905	0.655000	0.94253	GCC			0.647	RFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458510.1		NM_002918	
U2AF1L4	199746	mdanderson.org	37	19	36233572	36233572	+	3'UTR	SNP	C	C	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr19:36233572C>T	ENST00000412391.2	-	0	724				IGFLR1_ENST00000587101.1_5'Flank|PSENEN_ENST00000587708.2_5'Flank|PSENEN_ENST00000222266.2_5'Flank|IGFLR1_ENST00000344990.3_5'Flank|IGFLR1_ENST00000592889.1_5'Flank|AD000671.6_ENST00000589807.1_Intron|IGFLR1_ENST00000588992.1_5'Flank|IGFLR1_ENST00000246532.1_5'Flank|U2AF1L4_ENST00000292879.5_Nonsense_Mutation_p.W179*|U2AF1L4_ENST00000588100.1_5'Flank|IGFLR1_ENST00000592537.1_5'Flank|PSENEN_ENST00000591949.1_5'Flank|U2AF1L4_ENST00000378975.3_3'UTR			Q8WU68	U2AF4_HUMAN	U2 small nuclear RNA auxiliary factor 1-like 4						mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	8	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GAGGTCCTGCCAGGAACATCT	0.592																																					p.W179X													.	.			0			c.G536A												85.0	97.0	93.0					19																	36233572		2203	4300	6503	SO:0001624	3_prime_UTR_variant	199746	exon6			TCCTGCCAGGAAC	BC021186, AY569437	CCDS12473.1, CCDS42551.1	19q13.13	2013-02-12	2006-04-12	2006-04-12		ENSG00000161265		"""RNA binding motif (RRM) containing"""	23020	protein-coding gene	gene with protein product		601080	"""U2(RNU2) small nuclear RNA auxiliary factor 1-like 3"", ""U2 small nuclear RNA auxiliary factor 1-like 3"""	U2AF1L3		8586425, 11739736	Standard	NM_001040425		Approved	MGC33901, U2af26	uc002obf.3	Q8WU68		ENST00000412391.2:c.*48G>A	19.37:g.36233572C>T			Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	53	0.08	4	NM_144987	52	0.00	0	A6NKI8|Q56UU3	Nonsense_Mutation	SNP	ENST00000412391.2	37		.	.	.	.	.	.	.	.	.	.	C	14.93	2.683695	0.47991	.	.	ENSG00000161265	ENST00000292879	.	.	.	4.97	3.94	0.45596	.	2.063240	0.02287	N	0.069948	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.4176	0.49962	0.0:0.9098:0.0:0.0902	.	.	.	.	X	179	.	ENSP00000292879:W179X	W	-	2	0	U2AF1L4	40925412	0.000000	0.05858	0.523000	0.27875	0.013000	0.08279	-0.140000	0.10342	1.210000	0.43336	0.563000	0.77884	TGG			0.592	U2AF1L4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_144987	
ZNF526	116115	mdanderson.org	37	19	42730029	42730029	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr19:42730029C>T	ENST00000301215.3	+	3	1699	c.1474C>T	c.(1474-1476)Cgg>Tgg	p.R492W		NM_133444.1	NP_597701.1	Q8TF50	ZN526_HUMAN	zinc finger protein 526	492					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(3)	22		Prostate(69;0.0704)				CAACCACCTGCGGACACACAC	0.637																																					p.R492W													.	.			0			c.C1474T												78.0	79.0	79.0					19																	42730029		2203	4300	6503	SO:0001583	missense	116115	exon3			CACCTGCGGACAC	AB075831	CCDS12598.1	19q13.31	2013-01-08				ENSG00000167625		"""Zinc fingers, C2H2-type"""	29415	protein-coding gene	gene with protein product		614387				11853319	Standard	NM_133444		Approved	KIAA1951, MGC4267	uc002osz.1	Q8TF50		ENST00000301215.3:c.1474C>T	19.37:g.42730029C>T	ENSP00000301215:p.Arg492Trp		Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	89	0.04	4	NM_133444	74	0.01	1	B3KV29|Q69YI2|Q96E24	Missense_Mutation	SNP	ENST00000301215.3	37	CCDS12598.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.944736	0.73672	.	.	ENSG00000167625	ENST00000437878;ENST00000301215	T	0.25579	1.79	4.79	3.74	0.42951	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	U	0.000006	T	0.55097	0.1899	M	0.86420	2.815	0.45883	D	0.998731	D	0.89917	1.0	D	0.91635	0.999	T	0.64984	-0.6278	10	0.87932	D	0	-17.1122	13.666	0.62396	0.1562:0.8438:0.0:0.0	.	492	Q8TF50	ZN526_HUMAN	W	348;492	ENSP00000301215:R492W	ENSP00000301215:R492W	R	+	1	2	ZNF526	47421869	0.994000	0.37717	0.997000	0.53966	0.969000	0.65631	3.185000	0.50934	1.358000	0.45922	-0.188000	0.12872	CGG			0.637	ZNF526-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463681.2		XM_057401	
SPHK2	56848	mdanderson.org	37	19	49129574	49129574	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr19:49129574G>T	ENST00000245222.4	+	3	832	c.466G>T	c.(466-468)Gcc>Tcc	p.A156S	SPHK2_ENST00000601712.1_Missense_Mutation_p.A120S|AC022154.7_ENST00000600303.1_RNA|AC022154.7_ENST00000598735.1_RNA|SPHK2_ENST00000340932.3_Missense_Mutation_p.A120S|SPHK2_ENST00000598088.1_Missense_Mutation_p.A156S|AC022154.7_ENST00000594850.1_RNA|SPHK2_ENST00000599029.1_Missense_Mutation_p.A120S|SPHK2_ENST00000443164.1_Missense_Mutation_p.A218S|SPHK2_ENST00000599748.1_Missense_Mutation_p.A120S|SPHK2_ENST00000600537.1_Missense_Mutation_p.A97S	NM_001204158.2|NM_001243876.1|NM_020126.4	NP_001191087.1|NP_001230805.1|NP_064511.2	Q9NRA0	SPHK2_HUMAN	sphingosine kinase 2	156	Required for binding to sulfatide and phosphoinositides and for membrane localization.				blood vessel development (GO:0001568)|brain development (GO:0007420)|cell proliferation (GO:0008283)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|small molecule metabolic process (GO:0044281)|sphinganine-1-phosphate biosynthetic process (GO:0006669)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	ATP binding (GO:0005524)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|Ras GTPase binding (GO:0017016)|sphinganine kinase activity (GO:0008481)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		CTGGGCCACTGCCCTCACCTG	0.701																																					p.A156S													.	.			0			c.G466T												7.0	8.0	8.0					19																	49129574		2012	3962	5974	SO:0001583	missense	56848	exon3			GCCACTGCCCTCA	AF245447	CCDS12727.1, CCDS59404.1, CCDS59405.1, CCDS74414.1	19q13.33	2013-09-20			ENSG00000063176	ENSG00000063176			18859	protein-coding gene	gene with protein product		607092				10751414, 17895250	Standard	NM_020126		Approved		uc002pjs.3	Q9NRA0	OTTHUMG00000183318	ENST00000245222.4:c.466G>T	19.37:g.49129574G>T	ENSP00000245222:p.Ala156Ser		Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	13	0.15	2	NM_020126	14	0.00	0	A0T4C8|B4DU87|Q9BRN1|Q9H0Q2|Q9NWU7	Missense_Mutation	SNP	ENST00000245222.4	37	CCDS12727.1	.	.	.	.	.	.	.	.	.	.	G	9.348	1.064807	0.20067	.	.	ENSG00000063176	ENST00000245222;ENST00000406269;ENST00000340932;ENST00000443164	T;T;T	0.28454	1.94;1.64;1.61	3.77	1.55	0.23275	.	0.064364	0.64402	D	0.000011	T	0.23688	0.0573	L	0.45137	1.4	0.33274	D	0.561436	B;P;P;P	0.48089	0.145;0.78;0.905;0.518	B;B;B;B	0.44044	0.07;0.265;0.439;0.197	T	0.31081	-0.9956	10	0.26408	T	0.33	-47.0563	6.9314	0.24444	0.2474:0.0:0.7526:0.0	.	97;218;120;156	B4DU87;A0T4C8;Q9NRA0-3;Q9NRA0	.;.;.;SPHK2_HUMAN	S	156;129;120;218	ENSP00000245222:A156S;ENSP00000341091:A120S;ENSP00000413369:A218S	ENSP00000245222:A156S	A	+	1	0	SPHK2	53821386	0.347000	0.24853	0.336000	0.25522	0.496000	0.33645	2.401000	0.44513	0.343000	0.23821	0.563000	0.77884	GCC			0.701	SPHK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000466153.1			
AC021021.2	0	bcgsc.ca	37	2	6636107	6636107	+	lincRNA	SNP	G	G	T	rs112551650	byFrequency	TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr2:6636107G>T	ENST00000436082.1	+	0	0																											GAAGTGCTTCGTTAAACTTCA	0.547																																					.													.	.			0			.																																											0	.			TGCTTCGTTAAAC																													2.37:g.6636107G>T			Somatic	49	0	0		WXS	Illumina HiSeq	Phase_1	38	0.13	5	.	0		0		RNA	SNP	ENST00000436082.1	37																																																																																						0.547	AC021021.2-001	KNOWN	basic|exp_conf	lincRNA	lincRNA		OTTHUMT00000322748.1			
GPAT2	150763	broad.mit.edu	37	2	96687959	96687959	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr2:96687959A>T	ENST00000434632.1	-	23	2795	c.2336T>A	c.(2335-2337)cTg>cAg	p.L779Q	GPAT2_ENST00000377137.3_3'UTR|FAHD2CP_ENST00000607780.1_RNA|GPAT2_ENST00000453542.1_Missense_Mutation_p.L708Q|GPAT2_ENST00000359548.4_Missense_Mutation_p.L779Q			Q6NUI2	GPAT2_HUMAN	glycerol-3-phosphate acyltransferase 2, mitochondrial	779					CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerol-3-phosphate metabolic process (GO:0006072)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)	p.L779Q(2)		NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(5)|skin(3)	16						CTGATTGTCCAGGCTGGCAAA	0.567																																					p.L779Q													GPAT2,trunk,malignant_melanoma,0,2	GPAT2	46	2	2	Substitution - Missense(2)	skin(2)	c.T2336A												30.0	30.0	30.0					2																	96687959		1847	4102	5949	SO:0001583	missense	150763	exon22			TTGTCCAGGCTGG	BC042847	CCDS42714.1	2q11.2	2010-05-04			ENSG00000186281	ENSG00000186281			27168	protein-coding gene	gene with protein product	"""cancer/testis antigen 123"""					12477932	Standard	NM_207328		Approved	CT123	uc010yuf.1	Q6NUI2	OTTHUMG00000155208	ENST00000434632.1:c.2336T>A	2.37:g.96687959A>T	ENSP00000389395:p.Leu779Gln		Somatic	522	0.0019157088	1		WXS	Illumina HiSeq	Phase_I	558	0.01	5	NM_207328	4	0.00	0	Q6P2E4|Q6ZNI3|Q6ZNI5|Q6ZWJ4	Missense_Mutation	SNP	ENST00000434632.1	37	CCDS42714.1	.	.	.	.	.	.	.	.	.	.	t	0.005	-2.199373	0.00299	.	.	ENSG00000186281	ENST00000359548;ENST00000434632;ENST00000453542	T;T;T	0.74526	-0.85;-0.85;0.16	4.97	-1.85	0.07784	.	.	.	.	.	T	0.31857	0.0810	N	0.00483	-1.445	0.09310	N	0.999997	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.39187	-0.9626	9	0.02654	T	1	-26.1951	5.7343	0.18057	0.1497:0.2636:0.0:0.5866	.	708;785;779;708	E9PE95;Q6NUI2-4;Q6NUI2;B4DNZ9	.;.;GPAT2_HUMAN;.	Q	779;779;708	ENSP00000352547:L779Q;ENSP00000389395:L779Q;ENSP00000393770:L708Q	ENSP00000352547:L779Q	L	-	2	0	GPAT2	96051686	0.001000	0.12720	0.375000	0.26029	0.081000	0.17604	-0.019000	0.12546	-0.483000	0.06772	-0.751000	0.03497	CTG			0.567	GPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000338786.1		NM_207328	
CRYGB	1419	broad.mit.edu	37	2	209007463	209007463	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr2:209007463T>C	ENST00000260988.4	-	3	474	c.427A>G	c.(427-429)Agg>Ggg	p.R143G		NM_005210.3	NP_005201.2	P07316	CRGB_HUMAN	crystallin, gamma B	143	Beta/gamma crystallin 'Greek key' 4. {ECO:0000255|PROSITE-ProRule:PRU00028}.				lens fiber cell morphogenesis (GO:0070309)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	structural constituent of eye lens (GO:0005212)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|stomach(1)	14				Epithelial(149;0.0641)|LUSC - Lung squamous cell carcinoma(261;0.0703)|Lung(261;0.132)		AGATACTGCCTCCCCCTGTAG	0.532																																					p.R143G													CRYGB,trunk,malignant_melanoma,+1,1	CRYGB	24	1	0			c.A427G												97.0	97.0	97.0					2																	209007463		2203	4300	6503	SO:0001583	missense	1419	exon3			ACTGCCTCCCCCT		CCDS2380.1	2q34	2013-02-14			ENSG00000182187	ENSG00000182187			2409	protein-coding gene	gene with protein product		123670	"""crystallin, gamma 1-2"""	CRYG2			Standard	NM_005210		Approved		uc002vcp.4	P07316	OTTHUMG00000132941	ENST00000260988.4:c.427A>G	2.37:g.209007463T>C	ENSP00000260988:p.Arg143Gly		Somatic	260	0.0038461538	1		WXS	Illumina HiSeq	Phase_I	276	0.01	4	NM_005210	1	0.00	0	Q17RB5|Q53ST2	Missense_Mutation	SNP	ENST00000260988.4	37	CCDS2380.1	.	.	.	.	.	.	.	.	.	.	T	12.93	2.086675	0.36855	.	.	ENSG00000182187	ENST00000260988	T	0.79033	-1.23	4.73	-2.91	0.05631	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.087422	0.85682	D	0.000000	D	0.83963	0.5368	H	0.97635	4.045	0.30931	N	0.726935	B	0.22480	0.07	B	0.32533	0.147	T	0.80527	-0.1343	10	0.87932	D	0	.	11.0176	0.47698	0.1151:0.0:0.6542:0.2307	.	143	P07316	CRGB_HUMAN	G	143	ENSP00000260988:R143G	ENSP00000260988:R143G	R	-	1	2	CRYGB	208715708	0.000000	0.05858	0.147000	0.22382	0.993000	0.82548	-0.662000	0.05305	-0.516000	0.06470	0.459000	0.35465	AGG			0.532	CRYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256473.2		NM_005210	
NCOA6	23054	broad.mit.edu	37	20	33337630	33337630	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr20:33337630G>T	ENST00000374796.2	-	10	4938	c.2368C>A	c.(2368-2370)Cca>Aca	p.P790T	NCOA6_ENST00000359003.2_Missense_Mutation_p.P790T			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	790	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.|NCOA6IP-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						GGCCCTGGTGGCCGCAGGACC	0.542																																					p.P790T													.	NCOA6	219		0			c.C2368A												74.0	61.0	65.0					20																	33337630		2203	4300	6503	SO:0001583	missense	23054	exon9			CTGGTGGCCGCAG	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.2368C>A	20.37:g.33337630G>T	ENSP00000363929:p.Pro790Thr		Somatic	104	0.0096153846	1		WXS	Illumina HiSeq	Phase_I	114	0.05	6	NM_014071	43	0.00	0	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Missense_Mutation	SNP	ENST00000374796.2	37	CCDS13241.1	.	.	.	.	.	.	.	.	.	.	G	17.20	3.329858	0.60743	.	.	ENSG00000198646	ENST00000374796;ENST00000359003	T;T	0.23754	1.89;1.89	5.24	4.27	0.50696	.	0.172191	0.41294	N	0.000913	T	0.17323	0.0416	N	0.24115	0.695	0.46631	D	0.999132	B	0.10296	0.003	B	0.06405	0.002	T	0.03784	-1.1004	10	0.42905	T	0.14	-2.3904	10.8104	0.46543	0.0:0.1421:0.7104:0.1476	.	790	Q14686	NCOA6_HUMAN	T	790	ENSP00000363929:P790T;ENSP00000351894:P790T	ENSP00000351894:P790T	P	-	1	0	NCOA6	32801291	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.743000	0.62110	1.392000	0.46585	0.563000	0.77884	CCA			0.542	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078811.2		NM_014071	
Unknown	0	bcgsc.ca	37	22	16389579	16389579	+	IGR	SNP	T	T	A	rs371360996		TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr22:16389579T>A								LA16c-2F2.8 (12524 upstream) : LA16c-23H5.4 (27689 downstream)																							TAGCTGAGCGTGACCACTTGT	0.383																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			TGAGCGTGACCAC																													22.37:g.16389579T>A			Somatic	38	0.0263157895	1		WXS	Illumina HiSeq	Phase_1	22	0.32	7	.	0		0		RNA	SNP		37																																																																																					0	0.383										
MN1	4330	mdanderson.org	37	22	28194155	28194155	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr22:28194155G>T	ENST00000302326.4	-	1	3331	c.2377C>A	c.(2377-2379)Ccc>Acc	p.P793T		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	793					intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						CGCTGGCTGGGCTGGAAATCA	0.706			T	ETV6	"""AML, meningioma"""																																p.P793T				Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	.			0			c.C2377A												9.0	11.0	11.0					22																	28194155		1870	4061	5931	SO:0001583	missense	4330	exon1			GGCTGGGCTGGAA	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.2377C>A	22.37:g.28194155G>T	ENSP00000304956:p.Pro793Thr		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	26	0.12	3	NM_002430	1	0.00	0	A9Z1V9	Missense_Mutation	SNP	ENST00000302326.4	37	CCDS42998.1	.	.	.	.	.	.	.	.	.	.	G	7.455	0.643466	0.14451	.	.	ENSG00000169184	ENST00000302326	T	0.44881	0.91	4.12	3.07	0.35406	.	0.336608	0.28273	N	0.015947	T	0.20414	0.0491	N	0.08118	0	0.29030	N	0.885776	B	0.25904	0.137	B	0.29942	0.109	T	0.19192	-1.0313	10	0.18710	T	0.47	-3.7113	7.0516	0.25075	0.0985:0.1733:0.7282:0.0	.	793	Q10571	MN1_HUMAN	T	793	ENSP00000304956:P793T	ENSP00000304956:P793T	P	-	1	0	MN1	26524155	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	0.864000	0.27926	0.681000	0.31386	0.462000	0.41574	CCC			0.706	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320737.1		NM_002430	
TTC38	55020	mdanderson.org	37	22	46685356	46685356	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr22:46685356C>A	ENST00000381031.3	+	12	1216	c.1140C>A	c.(1138-1140)tgC>tgA	p.C380*	TTC38_ENST00000445282.2_Nonsense_Mutation_p.C322*	NM_017931.2	NP_060401	Q5R3I4	TTC38_HUMAN	tetratricopeptide repeat domain 38	380						extracellular vesicular exosome (GO:0070062)				endometrium(4)|large_intestine(3)|lung(4)|ovary(1)	12						TGCCCCTGTGCCAGGCCCTGG	0.687																																					p.C380X													.	.			0			c.C1140A												28.0	36.0	33.0					22																	46685356		2085	4197	6282	SO:0001587	stop_gained	55020	exon12			CCTGTGCCAGGCC		CCDS43030.1	22q13	2013-01-11			ENSG00000075234	ENSG00000075234		"""Tetratricopeptide (TTC) repeat domain containing"""	26082	protein-coding gene	gene with protein product							Standard	NM_017931		Approved	FLJ20699	uc003bhi.3	Q5R3I4	OTTHUMG00000150494	ENST00000381031.3:c.1140C>A	22.37:g.46685356C>A	ENSP00000370419:p.Cys380*		Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	31	0.10	3	NM_017931	11	0.00	0	Q8WV27|Q9NWP8	Nonsense_Mutation	SNP	ENST00000381031.3	37	CCDS43030.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.840640	0.91197	.	.	ENSG00000075234	ENST00000381031;ENST00000445282	.	.	.	4.77	2.67	0.31697	.	0.138494	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.4238	8.3363	0.32217	0.0:0.8061:0.0:0.1939	.	.	.	.	X	380;322	.	ENSP00000370419:C380X	C	+	3	2	TTC38	45064020	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	0.601000	0.24119	1.020000	0.39573	0.655000	0.94253	TGC			0.687	TTC38-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000318469.1		NM_017931	
CELSR1	9620	mdanderson.org	37	22	46931248	46931248	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr22:46931248G>A	ENST00000262738.3	-	1	1819	c.1820C>T	c.(1819-1821)aCg>aTg	p.T607M	CELSR1_ENST00000395964.1_Missense_Mutation_p.T607M|CELSR1_ENST00000497509.1_5'Flank	NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	607	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GGTGGAGGCCGTGTCCACCAG	0.647																																					p.T607M													.	.			0			c.C1820T												26.0	28.0	27.0					22																	46931248		2202	4300	6502	SO:0001583	missense	9620	exon1			GAGGCCGTGTCCA	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.1820C>T	22.37:g.46931248G>A	ENSP00000262738:p.Thr607Met		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_014246	8	0.00	0	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	37	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	G	1.332	-0.596548	0.03771	.	.	ENSG00000075275	ENST00000262738;ENST00000395964	T;T	0.53423	0.62;1.12	4.92	-0.101	0.13618	Cadherin (4);Cadherin-like (1);	0.081472	0.46442	U	0.000293	T	0.32556	0.0833	L	0.39020	1.185	0.09310	N	1	P	0.37233	0.588	B	0.35607	0.206	T	0.18713	-1.0328	10	0.44086	T	0.13	.	9.2725	0.37679	0.462:0.0:0.538:0.0	.	607	Q9NYQ6	CELR1_HUMAN	M	607	ENSP00000262738:T607M;ENSP00000379293:T607M	ENSP00000262738:T607M	T	-	2	0	CELSR1	45309912	0.998000	0.40836	0.145000	0.22337	0.003000	0.03518	2.676000	0.46883	0.154000	0.19237	-0.379000	0.06801	ACG			0.647	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318037.1		NM_014246	
KLHDC7B	113730	mdanderson.org	37	22	50986623	50986623	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr22:50986623A>T	ENST00000395676.2	+	1	162	c.28A>T	c.(28-30)Agg>Tgg	p.R10W	CTA-384D8.31_ENST00000434237.1_RNA	NM_138433.3	NP_612442.2	Q96G42	KLD7B_HUMAN	kelch domain containing 7B	10										central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	14		all_cancers(38;1.53e-10)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		OV - Ovarian serous cystadenocarcinoma(4;7.49e-69)|all cancers(3;9.79e-66)|Epithelial(4;1.3e-63)|GBM - Glioblastoma multiforme(4;0.000399)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCCCTTCCCCAGGCAAGACAG	0.642																																					p.R10W													.	.			0			c.A28T												33.0	35.0	35.0					22																	50986623		692	1591	2283	SO:0001583	missense	113730	exon1			TTCCCCAGGCAAG	BC009980	CCDS14097.2	22q13.33	2006-11-29		2005-12-13	ENSG00000130487	ENSG00000130487			25145	protein-coding gene	gene with protein product							Standard	NM_138433		Approved	MGC16635	uc003bmi.3	Q96G42	OTTHUMG00000150250	ENST00000395676.2:c.28A>T	22.37:g.50986623A>T	ENSP00000379034:p.Arg10Trp		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	35	0.09	3	NM_138433	1	0.00	0		Missense_Mutation	SNP	ENST00000395676.2	37	CCDS14097.2	.	.	.	.	.	.	.	.	.	.	A	19.72	3.880802	0.72294	.	.	ENSG00000130487	ENST00000395676	D	0.84800	-1.9	3.72	3.72	0.42706	.	.	.	.	.	T	0.73659	0.3615	L	0.27053	0.805	0.30547	N	0.765905	P	0.34977	0.478	B	0.24541	0.054	T	0.74460	-0.3658	9	0.87932	D	0	.	10.4551	0.44546	1.0:0.0:0.0:0.0	.	10	Q96G42	KLD7B_HUMAN	W	10	ENSP00000379034:R10W	ENSP00000379034:R10W	R	+	1	2	KLHDC7B	49333489	0.017000	0.18338	1.000000	0.80357	0.950000	0.60333	0.192000	0.17096	1.564000	0.49628	0.397000	0.26171	AGG			0.642	KLHDC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000317089.2		NM_138433	
BRPF1	7862	mdanderson.org	37	3	9783075	9783075	+	Silent	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr3:9783075G>T	ENST00000457855.1	+	4	1817	c.1806G>T	c.(1804-1806)cgG>cgT	p.R602R	BRPF1_ENST00000302054.3_Silent_p.R602R|BRPF1_ENST00000433861.2_Silent_p.R602R|BRPF1_ENST00000424362.1_Silent_p.R602R|BRPF1_ENST00000383829.2_Silent_p.R602R			P55201	BRPF1_HUMAN	bromodomain and PHD finger containing, 1	602	Interaction with MEAF6 and ING5.|Required for RUNX1 and RUNX2 transcriptional activation.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	49	Medulloblastoma(99;0.227)					AGCGAGCTCGGCTGCTCGTGG	0.493																																					p.R602R													.	.			0			c.G1806T												57.0	66.0	63.0					3																	9783075		2203	4300	6503	SO:0001819	synonymous_variant	7862	exon5			AGCTCGGCTGCTC	M91585	CCDS2575.1, CCDS33692.1	3p26-p25	2008-07-18			ENSG00000156983	ENSG00000156983			14255	protein-coding gene	gene with protein product	"""peregrin"", ""bromodomain-containing protein, 140kD"""	602410				8946209, 7906940	Standard	NM_001003694		Approved	BR140	uc003bsf.3	P55201	OTTHUMG00000097033	ENST00000457855.1:c.1806G>T	3.37:g.9783075G>T			Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	44	0.07	3	NM_004634	53	0.00	0	B4DEZ6|Q7Z6E0|Q8TCM6|Q9UHI0	Silent	SNP	ENST00000457855.1	37	CCDS2575.1																																																																																					0.493	BRPF1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000338485.1		NM_001003694	
TRH	7200	broad.mit.edu	37	3	129695840	129695840	+	Silent	SNP	G	G	A			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr3:129695840G>A	ENST00000302649.3	+	3	1037	c.510G>A	c.(508-510)gaG>gaA	p.E170E	TRH_ENST00000507066.1_Silent_p.E166E	NM_007117.3	NP_009048.1	P20396	TRH_HUMAN	thyrotropin-releasing hormone	170					adult walking behavior (GO:0007628)|cell-cell signaling (GO:0007267)|eating behavior (GO:0042755)|histamine metabolic process (GO:0001692)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of feeding behavior (GO:2000252)|negative regulation of glutamate secretion (GO:0014050)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of insulin secretion (GO:0032024)|response to cold (GO:0009409)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	thyrotropin-releasing hormone activity (GO:0008437)	p.E170E(1)		NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)	14						Gggaagaagaggaggaggagg	0.642																																					p.E170E	Esophageal Squamous(60;321 1330 17401 41911)												TRH,right_upper_lobe,carcinoma,0,2	TRH	30	2	1	Substitution - coding silent(1)	prostate(1)	c.G510A												33.0	35.0	34.0					3																	129695840		2202	4300	6502	SO:0001819	synonymous_variant	7200	exon3			AGAAGAGGAGGAG		CCDS3066.1	3q13.3-q21	2013-02-28				ENSG00000170893		"""Endogenous ligands"""	12298	protein-coding gene	gene with protein product	"""prothyroliberin"""	613879				2126343, 1900134	Standard	NM_007117		Approved		uc003enc.4	P20396		ENST00000302649.3:c.510G>A	3.37:g.129695840G>A			Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	62	0.05	3	NM_007117	0		0	B2R8R1|Q2TB83	Silent	SNP	ENST00000302649.3	37	CCDS3066.1																																																																																					0.642	TRH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000356592.1		NM_007117	
PIK3CB	5291	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	138374244	138374244	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr3:138374244T>A	ENST00000477593.1	-	23	3273	c.3200A>T	c.(3199-3201)gAc>gTc	p.D1067V	PIK3CB_ENST00000289153.2_Missense_Mutation_p.D1067V|PIK3CB_ENST00000544716.1_Missense_Mutation_p.D518V			P42338	PK3CB_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta	1067	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|embryonic cleavage (GO:0040016)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of autophagy (GO:0010508)|regulation of cell-matrix adhesion (GO:0001952)|regulation of clathrin-mediated endocytosis (GO:2000369)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)	p.D1067V(1)		NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	41					Caffeine(DB00201)	AGATCTGTAGTCTTTCCGAAC	0.408																																					p.D1067V													PIK3CB,NS,carcinoma,-1,4	PIK3CB	-1	4	1	Substitution - Missense(1)	skin(1)	c.A3200T												139.0	129.0	132.0					3																	138374244		2203	4300	6503	SO:0001583	missense	5291	exon22			CTGTAGTCTTTCC		CCDS3104.1	3q22.3	2013-09-19	2012-07-13		ENSG00000051382	ENSG00000051382	2.7.1.153		8976	protein-coding gene	gene with protein product		602925	"""phosphoinositide-3-kinase, catalytic, beta polypeptide"""	PIK3C1		8246984	Standard	NM_006219		Approved		uc011bmq.3	P42338	OTTHUMG00000159893	ENST00000477593.1:c.3200A>T	3.37:g.138374244T>A	ENSP00000418143:p.Asp1067Val		Somatic	185	0	0		WXS	Illumina HiSeq	.	181	0.26	47	NM_006219	95	0.27	26	D3DNF0|Q24JU2	Missense_Mutation	SNP	ENST00000477593.1	37	CCDS3104.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.64|19.64	3.866111|3.866111	0.71949|0.71949	.|.	.|.	ENSG00000051382|ENSG00000051382	ENST00000477593;ENST00000544716;ENST00000289153|ENST00000493568	T;T;T|.	0.71934|.	-0.61;-0.19;-0.61|.	5.55|5.55	5.55|5.55	0.83447|0.83447	Phosphatidylinositol 3-/4-kinase, catalytic (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75133|0.75133	0.3808|0.3808	M|M	0.75447|0.75447	2.3|2.3	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.77557|.	0.99;0.987;0.99|.	T|T	0.75645|0.75645	-0.3246|-0.3246	10|5	0.66056|.	D|.	0.02|.	-22.5439|-22.5439	15.8615|15.8615	0.79026|0.79026	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1067;654;518|.	P42338;B4DZI3;Q68DL0|.	PK3CB_HUMAN;.;.|.	V|S	1067;518;1067|699	ENSP00000418143:D1067V;ENSP00000438259:D518V;ENSP00000289153:D1067V|.	ENSP00000289153:D1067V|.	D|T	-|-	2|1	0|0	PIK3CB|PIK3CB	139856934|139856934	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.886000|0.886000	0.51366|0.51366	7.398000|7.398000	0.79919|0.79919	2.333000|2.333000	0.79357|0.79357	0.533000|0.533000	0.62120|0.62120	GAC|ACT			0.408	PIK3CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000358019.1			
IGF2BP2	10644	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	185407330	185407330	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr3:185407330A>T	ENST00000382199.2	-	6	585	c.490T>A	c.(490-492)Tcg>Acg	p.S164T	IGF2BP2_ENST00000346192.3_Missense_Mutation_p.S164T|IGF2BP2_ENST00000457616.2_Missense_Mutation_p.S170T|IGF2BP2_ENST00000494906.1_5'Flank|IGF2BP2_ENST00000421047.2_Missense_Mutation_p.S107T	NM_006548.4	NP_006539.3	Q9Y6M1	IF2B2_HUMAN	insulin-like growth factor 2 mRNA binding protein 2	164					anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)	20	all_cancers(143;5.84e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			TGAGGGGGCGAAGGGGAGCTC	0.597																																					p.S164T													.	IGF2BP2	69		0			c.T490A												52.0	57.0	55.0					3																	185407330		2203	4298	6501	SO:0001583	missense	10644	exon6			GGGGCGAAGGGGA	BC021290	CCDS3273.2, CCDS33903.1	3q27.2	2013-02-12			ENSG00000073792	ENSG00000073792		"""RNA binding motif (RRM) containing"""	28867	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 2"""	608289				10190901, 9891060	Standard	NM_001007225		Approved	IMP-2	uc003fpo.3	Q9Y6M1	OTTHUMG00000074025	ENST00000382199.2:c.490T>A	3.37:g.185407330A>T	ENSP00000371634:p.Ser164Thr		Somatic	201	0.0049751244	1		WXS	Illumina HiSeq	Phase_I	196	0.28	54	NM_001007225	76	0.29	22	A0A4Z0|B3FTN2|B3FTN3|B3FTN4	Missense_Mutation	SNP	ENST00000382199.2	37	CCDS3273.2	.	.	.	.	.	.	.	.	.	.	A	10.63	1.405039	0.25378	.	.	ENSG00000073792	ENST00000382199;ENST00000421047;ENST00000457616;ENST00000346192	T;T;T;T	0.43688	2.22;0.94;2.46;2.23	5.03	-4.6	0.03390	Nucleotide-binding, alpha-beta plait (1);	0.917522	0.09475	N	0.797152	T	0.20861	0.0502	N	0.12182	0.205	0.23978	N	0.996285	B;B;B;B;B;B	0.26147	0.143;0.001;0.001;0.001;0.143;0.0	B;B;B;B;B;B	0.29077	0.098;0.003;0.003;0.008;0.062;0.004	T	0.34900	-0.9810	10	0.15066	T	0.55	0.5964	9.835	0.40965	0.2302:0.0:0.6334:0.1364	.	101;101;107;170;164;164	Q9Y6M1-5;Q9Y6M1-3;Q9Y6M1-4;F8W930;Q9Y6M1-1;Q9Y6M1	.;.;.;.;.;IF2B2_HUMAN	T	164;107;170;164	ENSP00000371634:S164T;ENSP00000413787:S107T;ENSP00000410242:S170T;ENSP00000320204:S164T	ENSP00000320204:S164T	S	-	1	0	IGF2BP2	186890024	0.999000	0.42202	0.969000	0.41365	0.998000	0.95712	0.823000	0.27366	-0.743000	0.04784	0.533000	0.62120	TCG			0.597	IGF2BP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000157087.2		NM_006548	
FBXO45	200933	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	196296078	196296078	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr3:196296078A>G	ENST00000311630.6	+	1	520	c.223A>G	c.(223-225)Aac>Gac	p.N75D	WDR53_ENST00000433160.1_5'Flank|WDR53_ENST00000429115.1_5'Flank|FBXO45_ENST00000440469.1_Intron|WDR53_ENST00000332629.5_5'Flank	NM_001105573.1	NP_001099043.1	P0C2W1	FBSP1_HUMAN	F-box protein 45	75	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				anterior commissure morphogenesis (GO:0021960)|cellular response to DNA damage stimulus (GO:0006974)|cerebral cortex radially oriented cell migration (GO:0021799)|cerebral cortex tangential migration (GO:0021800)|corticospinal tract morphogenesis (GO:0021957)|neuron migration (GO:0001764)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|synapse assembly involved in innervation (GO:0060386)	cell junction (GO:0030054)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				cervix(1)|kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	7	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;2.75e-23)|all cancers(36;2.47e-21)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		CGGCGATGAGAACAGCGAGGT	0.652																																					p.N75D													.	FBXO45	18		0			c.A223G												9.0	13.0	11.0					3																	196296078		2138	4263	6401	SO:0001583	missense	200933	exon1			GATGAGAACAGCG	AK025697	CCDS46985.1	3q29	2008-02-05			ENSG00000174013	ENSG00000174013		"""F-boxes /  ""other"""""	29148	protein-coding gene	gene with protein product		609112					Standard	NM_001105573		Approved	Fbx45	uc010iai.3	P0C2W1	OTTHUMG00000155571	ENST00000311630.6:c.223A>G	3.37:g.196296078A>G	ENSP00000310332:p.Asn75Asp		Somatic	64	0.015625	1		WXS	Illumina HiSeq	Phase_I	74	0.34	25	NM_001105573	53	0.30	16	A6NF90|D3DXB5	Missense_Mutation	SNP	ENST00000311630.6	37	CCDS46985.1	.	.	.	.	.	.	.	.	.	.	a	18.34	3.603082	0.66445	.	.	ENSG00000174013	ENST00000311630	T	0.41400	1.0	5.17	5.17	0.71159	F-box domain, cyclin-like (2);	0.045923	0.85682	D	0.000000	T	0.30916	0.0780	N	0.17631	0.505	0.80722	D	1	B	0.23316	0.083	B	0.27262	0.078	T	0.08207	-1.0733	10	0.25751	T	0.34	-14.5251	15.1223	0.72453	1.0:0.0:0.0:0.0	.	75	P0C2W1	FBSP1_HUMAN	D	75	ENSP00000310332:N75D	ENSP00000310332:N75D	N	+	1	0	FBXO45	197780475	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.270000	0.89880	1.966000	0.57179	0.436000	0.28706	AAC			0.652	FBXO45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000340687.2			
WDR19	57728	mdanderson.org	37	4	39218846	39218846	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr4:39218846G>T	ENST00000399820.3	+	13	1496	c.1342G>T	c.(1342-1344)Gtc>Ttc	p.V448F	WDR19_ENST00000506503.1_Missense_Mutation_p.V448F|WDR19_ENST00000288634.7_Missense_Mutation_p.V288F	NM_025132.3	NP_079408.3	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19	448					ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium assembly (GO:0042384)|digestive system development (GO:0055123)|ear morphogenesis (GO:0042471)|embryonic camera-type eye development (GO:0031076)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|intraciliary retrograde transport (GO:0035721)|myotome development (GO:0061055)|neurological system process (GO:0050877)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|motile cilium (GO:0031514)|nonmotile primary cilium (GO:0031513)|photoreceptor connecting cilium (GO:0032391)				large_intestine(1)	1						TGAAGGCAAAGTCCAGTTACA	0.388																																					p.V448F													.	.			0			c.G1342T												81.0	74.0	76.0					4																	39218846		1860	4097	5957	SO:0001583	missense	57728	exon13			GGCAAAGTCCAGT	AB046858, AY029257	CCDS47042.1	4p14	2014-02-21			ENSG00000157796	ENSG00000157796		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	18340	protein-coding gene	gene with protein product	"""intraflagellar transport 144 homolog (Chlamydomonas)"""	608151				12906858, 22019273	Standard	XM_005262658		Approved	Pwdmp, KIAA1638, FLJ23127, ORF26, DYF-2, Oseg6, IFT144, NPHP13	uc003gtv.3	Q8NEZ3	OTTHUMG00000160466	ENST00000399820.3:c.1342G>T	4.37:g.39218846G>T	ENSP00000382717:p.Val448Phe		Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	47	0.06	3	NM_025132	8	0.00	0	B5MEF2|Q8N5B4|Q9H5S0|Q9HCD4	Missense_Mutation	SNP	ENST00000399820.3	37	CCDS47042.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.994805	0.74703	.	.	ENSG00000157796	ENST00000399820;ENST00000288634;ENST00000506503;ENST00000399836	D;D;T	0.96587	-4.06;-4.06;0.86	5.63	3.62	0.41486	WD40 repeat-like-containing domain (1);	0.222920	0.45867	D	0.000327	D	0.96658	0.8909	M	0.74647	2.275	0.45087	D	0.998105	B;P	0.52577	0.395;0.954	B;P	0.54270	0.234;0.747	D	0.96381	0.9281	10	0.72032	D	0.01	-16.9879	10.7314	0.46098	0.2073:0.0:0.7927:0.0	.	448;448	Q8NEZ3;D6R9P6	WDR19_HUMAN;.	F	448;288;448;447	ENSP00000382717:V448F;ENSP00000288634:V288F;ENSP00000423491:V448F	ENSP00000288634:V288F	V	+	1	0	WDR19	38895241	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.642000	0.54367	1.369000	0.46134	0.591000	0.81541	GTC			0.388	WDR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000360689.1			
BMP3	651	bcgsc.ca;mdanderson.org	37	4	81952602	81952602	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr4:81952602A>G	ENST00000282701.2	+	1	484	c.164A>G	c.(163-165)aAg>aGg	p.K55R		NM_001201.2	NP_001192.2	P12645	BMP3_HUMAN	bone morphogenetic protein 3	55					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|growth (GO:0040007)|ossification (GO:0001503)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	BMP receptor binding (GO:0070700)|receptor binding (GO:0005102)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	29						CCGCAAGACAAGGTCTCTGAA	0.677																																					p.K55R													.	BMP3	59		0			c.A164G												31.0	34.0	33.0					4																	81952602		2203	4299	6502	SO:0001583	missense	651	exon1			AAGACAAGGTCTC	M22491	CCDS3588.1	4q21	2013-02-06	2008-05-22		ENSG00000152785	ENSG00000152785		"""Bone morphogenetic proteins"""	1070	protein-coding gene	gene with protein product	"""osteogenin"""	112263	"""bone morphogenetic protein 3 (osteogenic)"""				Standard	NM_001201		Approved		uc003hmg.4	P12645	OTTHUMG00000130292	ENST00000282701.2:c.164A>G	4.37:g.81952602A>G	ENSP00000282701:p.Lys55Arg		Somatic	131	0	0		WXS	Illumina HiSeq	Phase_1	116	0.04	5	NM_001201	0		0	Q4VAS5	Missense_Mutation	SNP	ENST00000282701.2	37	CCDS3588.1	.	.	.	.	.	.	.	.	.	.	A	9.330	1.060267	0.19987	.	.	ENSG00000152785	ENST00000282701	T	0.64991	-0.13	4.67	3.48	0.39840	Transforming growth factor-beta, N-terminal (1);	0.416766	0.27636	N	0.018486	T	0.49304	0.1549	L	0.47716	1.5	0.29591	N	0.848402	B	0.27882	0.192	B	0.28553	0.091	T	0.40459	-0.9562	10	0.15066	T	0.55	.	7.9945	0.30261	0.9055:0.0:0.0945:0.0	.	55	P12645	BMP3_HUMAN	R	55	ENSP00000282701:K55R	ENSP00000282701:K55R	K	+	2	0	BMP3	82171626	1.000000	0.71417	0.967000	0.41034	0.001000	0.01503	2.118000	0.41949	0.809000	0.34255	-0.441000	0.05720	AAG			0.677	BMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252634.1			
ADH1C	126	broad.mit.edu	37	4	100261864	100261864	+	RNA	SNP	C	C	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr4:100261864C>T	ENST00000510055.1	-	0	872				ADH1C_ENST00000515683.1_RNA			P00326	ADH1G_HUMAN	alcohol dehydrogenase 1C (class I), gamma polypeptide						ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|zinc ion binding (GO:0008270)								OV - Ovarian serous cystadenocarcinoma(123;1.08e-07)	Ethanol(DB00898)|Fomepizole(DB01213)	AACAGGGAAGCCATCTGGAAT	0.428																																					.													.	.			0			.												191.0	179.0	183.0					4																	100261864		2203	4300	6503			126	.			GGGAAGCCATCTG	M12272		4q23	2010-03-16			ENSG00000248144	ENSG00000248144	1.1.1.1	"""Alcohol dehydrogenases"""	251	protein-coding gene	gene with protein product		103730		ADH3		3006456	Standard	NM_000669		Approved		uc031sgp.1	P00326	OTTHUMG00000161422		4.37:g.100261864C>T			Somatic	143	0	0		WXS	Illumina HiSeq	Phase_I	75	0.04	3	.	0		0	Q4PJ18|Q5WRV0|Q6LBW4|Q6NWV0|Q6NZA7	RNA	SNP	ENST00000510055.1	37																																																																																						0.428	ADH1C-004	KNOWN	mRNA_end_NF|basic	processed_transcript	polymorphic_pseudogene		OTTHUMT00000365189.2		NM_000669	
NDST4	64579	mdanderson.org	37	4	115751039	115751039	+	Silent	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr4:115751039G>T	ENST00000264363.2	-	13	3084	c.2406C>A	c.(2404-2406)ccC>ccA	p.P802P		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	802	Heparan sulfate N-sulfotransferase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		AACCCTTTTGGGGATCAAACC	0.358																																					p.P802P													.	.			0			c.C2406A												70.0	71.0	70.0					4																	115751039		2203	4300	6503	SO:0001819	synonymous_variant	64579	exon13			CTTTTGGGGATCA	AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.2406C>A	4.37:g.115751039G>T			Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	57	0.05	3	NM_022569	0		0	Q2KHM8	Silent	SNP	ENST00000264363.2	37	CCDS3706.1																																																																																					0.358	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256427.1		NM_022569	
OTUD4	54726	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	146059616	146059616	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr4:146059616G>T	ENST00000447906.2	-	21	2498	c.2311C>A	c.(2311-2313)Cag>Aag	p.Q771K	OTUD4_ENST00000455611.2_Intron|OTUD4_ENST00000454497.2_Missense_Mutation_p.Q706K			Q01804	OTUD4_HUMAN	OTU deubiquitinase 4	771					protein K48-linked deubiquitination (GO:0071108)		poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)					GCCTCAGTCTGCATAGGAAAG	0.498																																					p.Q706K													.	.			0			c.C2116A												91.0	81.0	84.0					4																	146059616		2203	4300	6503	SO:0001583	missense	54726	exon21			CAGTCTGCATAGG		CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164		"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""			1475186, 12727813, 19996094	Standard	NM_001102653		Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.2311C>A	4.37:g.146059616G>T	ENSP00000395487:p.Gln771Lys		Somatic	111	0	0		WXS	Illumina HiSeq	.	97	0.34	33	NM_001102653	58	0.48	28	B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	Missense_Mutation	SNP	ENST00000447906.2	37		.	.	.	.	.	.	.	.	.	.	G	13.42	2.231452	0.39399	.	.	ENSG00000164164	ENST00000454497;ENST00000447906	T;T	0.30714	1.53;1.52	5.79	4.94	0.65067	.	0.252905	0.33650	N	0.004695	T	0.23289	0.0563	N	0.19112	0.55	0.80722	D	1	B;B	0.27068	0.167;0.104	B;B	0.28011	0.085;0.039	T	0.02736	-1.1117	10	0.28530	T	0.3	-3.5123	16.9016	0.86115	0.0:0.1282:0.8718:0.0	.	771;770	G3V0I6;Q01804	.;OTUD4_HUMAN	K	706;771	ENSP00000409279:Q706K;ENSP00000395487:Q771K	ENSP00000395487:Q771K	Q	-	1	0	OTUD4	146279066	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.003000	0.57061	1.437000	0.47472	0.563000	0.77884	CAG			0.498	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000365117.2		NM_017493	
PLEKHG4B	153478	mdanderson.org	37	5	163611	163611	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr5:163611T>C	ENST00000283426.6	+	11	2406	c.2356T>C	c.(2356-2358)Tcc>Ccc	p.S786P		NM_052909.3	NP_443141.3	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B	786							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(1)|large_intestine(2)|lung(2)|prostate(3)|skin(3)	11			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		GAGTCTGTCCTCCCCCTCGGG	0.657																																					p.S786P													.	.			0			c.T2356C												17.0	19.0	18.0					5																	163611		2201	4298	6499	SO:0001583	missense	153478	exon11			CTGTCCTCCCCCT	BC008352	CCDS34124.1	5p15.33	2013-01-11			ENSG00000153404	ENSG00000153404		"""Pleckstrin homology (PH) domain containing"""	29399	protein-coding gene	gene with protein product						11572484	Standard	NM_052909		Approved	KIAA1909	uc003jak.2	Q96PX9	OTTHUMG00000161570	ENST00000283426.6:c.2356T>C	5.37:g.163611T>C	ENSP00000283426:p.Ser786Pro		Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	59	0.05	3	NM_052909	1	0.00	0		Missense_Mutation	SNP	ENST00000283426.6	37	CCDS34124.1	.	.	.	.	.	.	.	.	.	.	T	13.09	2.134695	0.37630	.	.	ENSG00000153404	ENST00000283426	T	0.32272	1.46	3.14	3.14	0.36123	.	.	.	.	.	T	0.28566	0.0707	N	0.24115	0.695	0.24470	N	0.9944	D	0.61697	0.99	P	0.53649	0.731	T	0.05954	-1.0854	9	0.33141	T	0.24	.	7.7781	0.29049	0.0:0.0:0.0:1.0	.	786	Q96PX9	PKH4B_HUMAN	P	786	ENSP00000283426:S786P	ENSP00000283426:S786P	S	+	1	0	PLEKHG4B	216611	0.974000	0.33945	0.995000	0.50966	0.233000	0.25261	1.148000	0.31614	1.071000	0.40834	0.383000	0.25322	TCC			0.657	PLEKHG4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000365359.1		NM_052909	
MROH2B	133558	broad.mit.edu	37	5	41057377	41057377	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr5:41057377A>G	ENST00000399564.4	-	8	1292	c.842T>C	c.(841-843)cTc>cCc	p.L281P	MROH2B_ENST00000506092.2_Intron	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	281																	TACCTGCTGGAGTAAATTGAT	0.403																																					p.L281P													.	.			0			c.T842C												59.0	55.0	56.0					5																	41057377		1839	4093	5932	SO:0001583	missense	133558	exon8			TGCTGGAGTAAAT		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.842T>C	5.37:g.41057377A>G	ENSP00000382476:p.Leu281Pro		Somatic	118	0.0084745763	1		WXS	Illumina HiSeq	Phase_I	110	0.03	3	NM_173489	0		0	Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	ENST00000399564.4	37	CCDS47202.1	.	.	.	.	.	.	.	.	.	.	A	12.57	1.976405	0.34848	.	.	ENSG00000171495	ENST00000399564	T	0.74632	-0.86	5.21	3.98	0.46160	Armadillo-type fold (1);	0.151936	0.32655	N	0.005805	T	0.77772	0.4180	L	0.47716	1.5	0.53688	D	0.99997	D	0.69078	0.997	D	0.65010	0.931	T	0.78086	-0.2341	10	0.62326	D	0.03	.	7.8952	0.29702	0.8168:0.0:0.0:0.1832	.	281	Q7Z745	HTRB2_HUMAN	P	281	ENSP00000382476:L281P	ENSP00000382476:L281P	L	-	2	0	HEATR7B2	41093134	1.000000	0.71417	0.977000	0.42913	0.157000	0.22087	2.344000	0.44010	2.317000	0.78254	0.459000	0.35465	CTC			0.403	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000367558.2		NM_173489	
NNT-AS1	100652772	broad.mit.edu	37	5	43588450	43588451	+	RNA	INS	-	-	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr5:43588450_43588451insT	ENST00000506247.1	-	0	1158				NNT-AS1_ENST00000513560.2_RNA|NNT-AS1_ENST00000500258.2_RNA|NNT-AS1_ENST00000515466.1_RNA|NNT-AS1_ENST00000503484.1_RNA|NNT-AS1_ENST00000606697.1_RNA					NNT antisense RNA 1																		GTTCAGGTTCCTTTTTTTTTTT	0.48																																					.													.	.			0			.																																											0	.			AGGTTCCTTTTTT			5p12	2013-07-30			ENSG00000248092	ENSG00000248092		"""Long non-coding RNAs"""	49005	non-coding RNA	RNA, long non-coding							Standard	NR_073113		Approved				OTTHUMG00000162220		5.37:g.43588461_43588461dupT			Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	6	0.33	2	.	0		0		RNA	INS	ENST00000506247.1	37																																																																																						0.480	NNT-AS1-002	KNOWN	basic|exp_conf	antisense	antisense		OTTHUMT00000367957.1			
HMGCR	3156	broad.mit.edu	37	5	74654641	74654641	+	Missense_Mutation	SNP	G	G	T	rs373896859		TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr5:74654641G>T	ENST00000287936.4	+	16	2302	c.2146G>T	c.(2146-2148)Gtt>Ttt	p.V716F	HMGCR_ENST00000511206.1_Missense_Mutation_p.V716F|HMGCR_ENST00000343975.5_Missense_Mutation_p.V663F	NM_000859.2	NP_000850.1	P04035	HMDH_HUMAN	3-hydroxy-3-methylglutaryl-CoA reductase	716	Catalytic.				aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|coenzyme A metabolic process (GO:0015936)|isoprenoid biosynthetic process (GO:0008299)|myoblast differentiation (GO:0045445)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of vasodilation (GO:0045908)|negative regulation of wound healing (GO:0061045)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein tetramerization (GO:0051262)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|ubiquinone metabolic process (GO:0006743)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)	coenzyme binding (GO:0050662)|hydroxymethylglutaryl-CoA reductase (NADPH) activity (GO:0004420)|hydroxymethylglutaryl-CoA reductase activity (GO:0042282)|NADPH binding (GO:0070402)			breast(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	20		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;2.24e-54)	Atorvastatin(DB01076)|Fluvastatin(DB01095)|Lovastatin(DB00227)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)	TCCAGCCAAGGTTGTCAGAGA	0.338																																					p.V716F													.	HMGCR	53		0			c.G2146T							G	PHE/VAL,PHE/VAL	1,4405	2.1+/-5.4	0,1,2202	116.0	116.0	116.0		2146,1987	4.9	1.0	5		116	0,8600		0,0,4300	no	missense,missense	HMGCR	NM_000859.2,NM_001130996.1	50,50	0,1,6502	TT,TG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	716/889,663/836	74654641	1,13005	2203	4300	6503	SO:0001583	missense	3156	exon16			GCCAAGGTTGTCA		CCDS4027.1, CCDS47234.1	5q13.3-q14	2012-10-02	2010-04-30		ENSG00000113161	ENSG00000113161	1.1.1.88, 1.1.1.34		5006	protein-coding gene	gene with protein product	"""hydroxymethylglutaryl-CoA reductase"", ""3-hydroxy-3-methylglutaryl CoA reductase (NADPH)"""	142910	"""3-hydroxy-3-methylglutaryl-Coenzyme A reductase"""				Standard	NM_000859		Approved		uc003kdp.3	P04035	OTTHUMG00000102069	ENST00000287936.4:c.2146G>T	5.37:g.74654641G>T	ENSP00000287936:p.Val716Phe		Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	108	0.03	3	NM_000859	160	0.00	0	B7Z3Y9|Q8N190	Missense_Mutation	SNP	ENST00000287936.4	37	CCDS4027.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.3|23.3	4.401977|4.401977	0.83120|0.83120	2.27E-4|2.27E-4	0.0|0.0	ENSG00000113161|ENSG00000113161	ENST00000509085|ENST00000511206;ENST00000544469;ENST00000287936;ENST00000343975;ENST00000429286;ENST00000511986	.|T;T;T;T	.|0.49720	.|0.77;0.77;0.77;0.77	5.77|5.77	4.91|4.91	0.64330|0.64330	.|Hydroxymethylglutaryl-CoA reductase, class I/II, catalytic domain (1);Hydroxymethylglutaryl-CoA reductase, class I/II, substrate-binding (1);	.|0.051576	.|0.85682	.|D	.|0.000000	T|T	0.77336|0.77336	0.4115|0.4115	H|H	0.96048|0.96048	3.76|3.76	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.76494	.|0.992;0.998;0.999;0.998;0.992	.|D;D;D;D;D	.|0.74348	.|0.936;0.975;0.983;0.942;0.957	D|D	0.84524|0.84524	0.0629|0.0629	5|10	.|0.87932	.|D	.|0	-14.483|-14.483	13.335|13.335	0.60512|0.60512	0.0733:0.0:0.9267:0.0|0.0733:0.0:0.9267:0.0	.|.	.|716;647;93;663;716	.|B2R649;B7Z3Y9;B4DSB1;P04035-2;P04035	.|.;.;.;.;HMDH_HUMAN	S|F	45|716;647;716;663;93;43	.|ENSP00000426745:V716F;ENSP00000287936:V716F;ENSP00000340816:V663F;ENSP00000420871:V43F	.|ENSP00000287936:V716F	R|V	+|+	3|1	2|0	HMGCR|HMGCR	74690397|74690397	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.988000|0.988000	0.76386|0.76386	8.017000|8.017000	0.88712|0.88712	1.444000|1.444000	0.47605|0.47605	0.655000|0.655000	0.94253|0.94253	AGG|GTT			0.338	HMGCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000219877.2			
GRAMD3	65983	broad.mit.edu	37	5	125809020	125809020	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr5:125809020G>T	ENST00000285689.3	+	5	907	c.446G>T	c.(445-447)tGg>tTg	p.W149L	GRAMD3_ENST00000502348.1_Missense_Mutation_p.W40L|GRAMD3_ENST00000543198.1_Missense_Mutation_p.W126L|GRAMD3_ENST00000511134.1_Missense_Mutation_p.W133L|GRAMD3_ENST00000513040.1_Missense_Mutation_p.W164L|GRAMD3_ENST00000544396.1_Missense_Mutation_p.W45L|GRAMD3_ENST00000515200.1_Missense_Mutation_p.W126L|GRAMD3_ENST00000542322.1_Missense_Mutation_p.W157L|RP11-517I3.1_ENST00000515808.1_RNA	NM_023927.2	NP_076416.2	Q96HH9	GRAM3_HUMAN	GRAM domain containing 3	149	GRAM.					cytoplasmic microtubule (GO:0005881)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0401)|OV - Ovarian serous cystadenocarcinoma(64;0.0604)|all cancers(49;0.108)		TCAGAAAACTGGATTTGTTTT	0.308																																					p.W164L													.	GRAMD3	30		0			c.G491T												52.0	56.0	54.0					5																	125809020		2202	4299	6501	SO:0001583	missense	65983	exon5			AAAACTGGATTTG	BC008590	CCDS4136.1, CCDS54891.1, CCDS54892.1, CCDS54893.1, CCDS54894.1	5q23.2	2014-02-12	2005-11-03		ENSG00000155324	ENSG00000155324			24911	protein-coding gene	gene with protein product	"""HCV NS3 transactivated protein 2"""					12477932	Standard	NM_023927		Approved	NS3TP2, FLJ21313	uc011cwt.2	Q96HH9	OTTHUMG00000128943	ENST00000285689.3:c.446G>T	5.37:g.125809020G>T	ENSP00000285689:p.Trp149Leu		Somatic	258	0	0		WXS	Illumina HiSeq	Phase_I	239	0.03	6	NM_001146319	5	0.00	0	B7Z1F2|B7Z3R1|B7Z6D8|B7Z8T2|D3DSZ3|Q9H753	Missense_Mutation	SNP	ENST00000285689.3	37	CCDS4136.1	.	.	.	.	.	.	.	.	.	.	G	32	5.123246	0.94429	.	.	ENSG00000155324	ENST00000513040;ENST00000506445;ENST00000543367;ENST00000285689;ENST00000515200;ENST00000542322;ENST00000544396;ENST00000543198;ENST00000502348;ENST00000511134	D;D;D;D;D;D;D;D;D	0.86627	-2.15;-2.15;-2.15;-2.15;-2.15;-2.15;-2.15;-2.15;-2.15	6.04	6.04	0.98038	GRAM (2);	0.116792	0.64402	D	0.000002	D	0.93877	0.8041	M	0.77486	2.375	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;1.0	D	0.93198	0.6589	10	0.56958	D	0.05	.	20.1743	0.98175	0.0:0.0:1.0:0.0	.	133;45;157;164;149	B7Z8T2;B7Z1F2;B7Z3R1;B7Z6D8;Q96HH9	.;.;.;.;GRAM3_HUMAN	L	164;163;133;149;126;157;45;126;40;133	ENSP00000426120:W164L;ENSP00000424985:W163L;ENSP00000285689:W149L;ENSP00000426143:W126L;ENSP00000441876:W157L;ENSP00000444049:W45L;ENSP00000442902:W126L;ENSP00000427596:W40L;ENSP00000426088:W133L	ENSP00000285689:W149L	W	+	2	0	GRAMD3	125836919	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.886000	0.87288	2.873000	0.98535	0.561000	0.74099	TGG			0.308	GRAMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250922.2		NM_023927	
LMNB1	4001	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	126171941	126171941	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr5:126171941C>A	ENST00000261366.5	+	11	2107	c.1746C>A	c.(1744-1746)agC>agA	p.S582R	LMNB1_ENST00000460265.1_3'UTR	NM_001198557.1|NM_005573.3	NP_001185486.1|NP_005564.1	P20700	LMNB1_HUMAN	lamin B1	582	Tail.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	lamin filament (GO:0005638)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(142;0.103)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.033)|OV - Ovarian serous cystadenocarcinoma(64;0.0398)|all cancers(49;0.0903)		CCAATAGAAGCTGTGCAATTA	0.333																																					p.S582R													.	.			0			c.C1746A												124.0	132.0	129.0					5																	126171941		2203	4299	6502	SO:0001583	missense	4001	exon11			TAGAAGCTGTGCA	L37737	CCDS4140.1	5q23.2	2013-01-16			ENSG00000113368	ENSG00000113368		"""Intermediate filaments type V, lamins"""	6637	protein-coding gene	gene with protein product		150340				7557986, 8838815	Standard	NM_005573		Approved		uc003kud.2	P20700	OTTHUMG00000128969	ENST00000261366.5:c.1746C>A	5.37:g.126171941C>A	ENSP00000261366:p.Ser582Arg		Somatic	267	0	0		WXS	Illumina HiSeq	.	243	0.21	52	NM_005573	259	0.31	80	B2R6J6|Q3SYN7|Q96EI6	Missense_Mutation	SNP	ENST00000261366.5	37	CCDS4140.1	.	.	.	.	.	.	.	.	.	.	C	12.28	1.889164	0.33348	.	.	ENSG00000113368	ENST00000261366	D	0.83837	-1.77	5.75	4.89	0.63831	.	0.202936	0.51477	D	0.000089	T	0.71693	0.3370	N	0.25647	0.755	0.80722	D	1	B	0.29432	0.244	B	0.25140	0.058	T	0.67273	-0.5712	10	0.24483	T	0.36	.	12.6555	0.56786	0.0:0.9232:0.0:0.0768	.	582	P20700	LMNB1_HUMAN	R	582	ENSP00000261366:S582R	ENSP00000261366:S582R	S	+	3	2	LMNB1	126199840	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.546000	0.45778	1.437000	0.47472	-0.218000	0.12543	AGC			0.333	LMNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250956.2		NM_005573	
MEGF10	84466	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	126755897	126755897	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr5:126755897C>T	ENST00000274473.6	+	13	1855	c.1588C>T	c.(1588-1590)Cag>Tag	p.Q530*	MEGF10_ENST00000508365.1_Nonsense_Mutation_p.Q530*|MEGF10_ENST00000418761.2_Nonsense_Mutation_p.Q530*|MEGF10_ENST00000503335.2_Nonsense_Mutation_p.Q530*	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	530	Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		ACTTCCCTGCCAGGTATGCAC	0.542																																					p.Q530X													.	.			0			c.C1588T												61.0	53.0	56.0					5																	126755897		2203	4300	6503	SO:0001587	stop_gained	84466	exon13			CCCTGCCAGGTAT	AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.1588C>T	5.37:g.126755897C>T	ENSP00000274473:p.Gln530*		Somatic	67	0	0		WXS	Illumina HiSeq	.	58	0.22	13	NM_032446	0		0	Q68DE5|Q8WUL3	Nonsense_Mutation	SNP	ENST00000274473.6	37	CCDS4142.1	.	.	.	.	.	.	.	.	.	.	C	39	7.697247	0.98438	.	.	ENSG00000145794	ENST00000503335;ENST00000508365;ENST00000418761;ENST00000274473	.	.	.	5.72	5.72	0.89469	.	0.074998	0.53938	D	0.000043	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	-13.418	20.2406	0.98372	0.0:1.0:0.0:0.0	.	.	.	.	X	530	.	ENSP00000274473:Q530X	Q	+	1	0	MEGF10	126783796	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	7.737000	0.84957	2.857000	0.98124	0.650000	0.86243	CAG			0.542	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250973.2		NM_032446	
BTN2A3P	54718	hgsc.bcm.edu	37	6	26422353	26422353	+	RNA	SNP	C	C	T	rs571530750	byFrequency	TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr6:26422353C>T	ENST00000466808.2	+	0	7							Q96KV6	BT2A3_HUMAN	butyrophilin, subfamily 2, member A3, pseudogene							integral component of membrane (GO:0016021)		p.P3S(2)									GCTCATGGAACCAGCTGCTGC	0.622													C|||	7	0.00139776	0.0023	0.0	5008	,	,		16376	0.001		0.0	False		,,,				2504	0.0031				.													BTN2A3,NS,carcinoma,0,9	BTN2A3	0	9	2	Substitution - Missense(2)	endometrium(1)|kidney(1)	.																																											54718	.			ATGGAACCAGCTG	AL021917		6p22.1	2014-01-14	2011-09-06	2011-09-06	ENSG00000124549	ENSG00000124549		"""Butyrophilins"""	13229	pseudogene	pseudogene		613592	"""butyrophilin, subfamily 2, member A3"""	BTN2A3			Standard	NR_027795		Approved	BTN2.3	uc011dkl.1	Q96KV6	OTTHUMG00000014453		6.37:g.26422353C>T			Somatic	95	0	0		WXS	Illumina HiSeq	.	99	0.06	6	.	2	0.00	0	A6NEF4	RNA	SNP	ENST00000466808.2	37																																																																																						0.622	BTN2A3P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000040118.4		NR_027795	
VARS2	57176	broad.mit.edu	37	6	30888845	30888845	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr6:30888845G>T	ENST00000321897.5	+	15	2115	c.1483G>T	c.(1483-1485)Gtg>Ttg	p.V495L	VARS2_ENST00000542001.1_Missense_Mutation_p.V355L|VARS2_ENST00000416670.2_Missense_Mutation_p.V495L|VARS2_ENST00000476162.1_3'UTR|VARS2_ENST00000541562.1_Missense_Mutation_p.V525L			Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial	495					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(3)|prostate(3)|skin(4)|urinary_tract(1)	46						TCTCCAGGCTGTGGAGTCGGG	0.557																																					p.V525L													.	VARS2	60		0			c.G1573T												37.0	37.0	37.0					6																	30888845		2203	4300	6503	SO:0001583	missense	57176	exon16			CAGGCTGTGGAGT	AB067472	CCDS34387.1, CCDS54980.1	6p21.33	2012-10-26	2012-10-26	2007-02-23	ENSG00000137411	ENSG00000137411	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	21642	protein-coding gene	gene with protein product	"""valine tRNA ligase 2, mitochondrial"""	612802	"""valyl-tRNA synthetase 2-like"", ""valyl-tRNA synthetase like"", ""valyl-tRNA synthetase 2, mitochondrial (putative)"""	VARS2L, VARSL		1898367, 11572484, 18400783	Standard	NM_001167734		Approved	DKFZP434L1435, KIAA1885, G7a	uc011dmz.2	Q5ST30	OTTHUMG00000031263	ENST00000321897.5:c.1483G>T	6.37:g.30888845G>T	ENSP00000316092:p.Val495Leu		Somatic	109	0	0		WXS	Illumina HiSeq	Phase_I	116	0.03	4	NM_001167734	96	0.00	0	A2ABL7|B4DET4|B4E3P5|F5GXJ0|F5H323|Q2M2A0|Q59FI1|Q5SQ96|Q5SS98|Q6DKJ5|Q6ZV24|Q96GN2|Q96H77|Q96Q02|Q9H6R2|Q9UFH7	Missense_Mutation	SNP	ENST00000321897.5	37	CCDS34387.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.022114	0.93462	.	.	ENSG00000137411	ENST00000321897;ENST00000416670;ENST00000542001;ENST00000541562	T;T;T;T	0.18810	2.19;2.19;2.19;2.19	4.56	4.56	0.56223	Rossmann-like alpha/beta/alpha sandwich fold (1);Aminoacyl-tRNA synthetase, class Ia (1);	0.056675	0.64402	D	0.000001	T	0.34687	0.0906	M	0.73430	2.235	0.49687	D	0.999811	P;P;D	0.60160	0.867;0.938;0.987	P;P;P	0.61722	0.841;0.801;0.893	T	0.24261	-1.0165	10	0.87932	D	0	-24.1053	15.1648	0.72814	0.0:0.0:1.0:0.0	.	493;525;495	B7ZL25;F5GXJ0;Q5ST30	.;.;SYVM_HUMAN	L	495;495;355;525	ENSP00000316092:V495L;ENSP00000394802:V495L;ENSP00000438200:V355L;ENSP00000441000:V525L	ENSP00000316092:V495L	V	+	1	0	VARS2	30996824	1.000000	0.71417	0.998000	0.56505	0.947000	0.59692	5.811000	0.69187	2.250000	0.74265	0.561000	0.74099	GTG			0.557	VARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076566.2		NM_020442	
ME1	4199	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	83949272	83949272	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr6:83949272G>C	ENST00000369705.3	-	8	1014	c.898C>G	c.(898-900)Caa>Gaa	p.Q300E	ME1_ENST00000541327.1_Missense_Mutation_p.Q134E|ME1_ENST00000543031.1_Missense_Mutation_p.Q225E	NM_002395.4	NP_002386.1	P48163	MAOX_HUMAN	malic enzyme 1, NADP(+)-dependent, cytosolic	300					carbohydrate metabolic process (GO:0005975)|cellular lipid metabolic process (GO:0044255)|malate metabolic process (GO:0006108)|NADP biosynthetic process (GO:0006741)|protein tetramerization (GO:0051262)|response to carbohydrate (GO:0009743)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|electron carrier activity (GO:0009055)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|manganese ion binding (GO:0030145)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|oxaloacetate decarboxylase activity (GO:0008948)			NS(2)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)		BRCA - Breast invasive adenocarcinoma(397;0.0641)		CCAGCTCCTTGGAATAGTATT	0.363																																					p.Q300E													.	.			0			c.C898G												162.0	154.0	157.0					6																	83949272		2203	4300	6503	SO:0001583	missense	4199	exon8			CTCCTTGGAATAG	X77244	CCDS34492.1	6q12	2012-10-02			ENSG00000065833	ENSG00000065833	1.1.1.40		6983	protein-coding gene	gene with protein product		154250				8187880	Standard	NM_002395		Approved		uc003pjy.3	P48163	OTTHUMG00000015111	ENST00000369705.3:c.898C>G	6.37:g.83949272G>C	ENSP00000358719:p.Gln300Glu		Somatic	125	0	0		WXS	Illumina HiSeq	.	105	0.12	13	NM_002395	8	0.25	2	B4DZ70|Q16797|Q16855|Q53F72|Q5VWA2|Q9BWX8|Q9H1W3|Q9UIY4	Missense_Mutation	SNP	ENST00000369705.3	37	CCDS34492.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.491629	0.84962	.	.	ENSG00000065833	ENST00000369705;ENST00000541327;ENST00000543031	T;T;T	0.29142	1.58;1.58;1.58	5.66	5.66	0.87406	Malic enzyme, NAD-binding (2);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.54029	0.1833	M	0.83603	2.65	0.80722	D	1	D	0.71674	0.998	D	0.69824	0.966	T	0.59794	-0.7387	10	0.87932	D	0	-12.5595	18.5012	0.90882	0.0:0.0:1.0:0.0	.	300	P48163	MAOX_HUMAN	E	300;134;225	ENSP00000358719:Q300E;ENSP00000439912:Q134E;ENSP00000446114:Q225E	ENSP00000358719:Q300E	Q	-	1	0	ME1	84005991	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.039000	0.93777	2.658000	0.90341	0.650000	0.86243	CAA			0.363	ME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041350.1			
MDN1	23195	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	90467976	90467976	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr6:90467976G>C	ENST00000369393.3	-	19	2815	c.2700C>G	c.(2698-2700)aaC>aaG	p.N900K	MDN1_ENST00000428876.1_Missense_Mutation_p.N900K			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	900					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		ACCCTCACCTGTTTCTTATTC	0.478																																					p.N900K													.	.			0			c.C2700G												78.0	72.0	74.0					6																	90467976		2203	4300	6503	SO:0001583	missense	23195	exon19			TCACCTGTTTCTT	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.2700C>G	6.37:g.90467976G>C	ENSP00000358400:p.Asn900Lys		Somatic	100	0	0		WXS	Illumina HiSeq	.	107	0.21	22	NM_014611	40	0.15	6	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	G	15.57	2.872653	0.51695	.	.	ENSG00000112159	ENST00000369393;ENST00000428876;ENST00000439638	T;T;T	0.44881	0.91;0.91;0.91	6.04	4.28	0.50868	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.000000	0.85682	D	0.000000	T	0.53481	0.1799	M	0.80028	2.48	0.58432	D	0.999994	D;D	0.89917	1.0;0.968	D;P	0.77557	0.99;0.898	T	0.60627	-0.7226	10	0.72032	D	0.01	.	10.0323	0.42107	0.2038:0.0:0.7962:0.0	.	827;900	Q5T795;Q9NU22	.;MDN1_HUMAN	K	900;900;827	ENSP00000358400:N900K;ENSP00000413970:N900K;ENSP00000409664:N827K	ENSP00000358400:N900K	N	-	3	2	MDN1	90524697	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	4.407000	0.59754	0.898000	0.36418	0.563000	0.77884	AAC			0.478	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041514.2			
TBC1D32	221322	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	121526289	121526289	+	Silent	SNP	T	T	G			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr6:121526289T>G	ENST00000398212.2	-	22	2551	c.2502A>C	c.(2500-2502)atA>atC	p.I834I	TBC1D32_ENST00000398197.2_Intron|TBC1D32_ENST00000275159.6_Silent_p.I834I	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	834					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)										AATTCAAAATTATAAGTCTAT	0.244																																					p.I834I													.	.			0			c.A2502C												46.0	47.0	47.0					6																	121526289		1783	4015	5798	SO:0001819	synonymous_variant	221322	exon22			CAAAATTATAAGT	AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.2502A>C	6.37:g.121526289T>G			Somatic	376	0	0		WXS	Illumina HiSeq	.	392	0.18	69	NM_152730	3	0.33	1	Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Silent	SNP	ENST00000398212.2	37	CCDS43501.1																																																																																					0.244	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000380937.2		NM_152730	
Unknown	0	bcgsc.ca	37	7	35479	35479	+	IGR	SNP	C	C	T	rs62429398		TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr7:35479C>T								None (None upstream) : AC093627.7 (35492 downstream)																							ctgctgccgccgccgccgcCG	0.552																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			TGCCGCCGCCGCC																													7.37:g.35479C>T			Somatic	311	0.0096463023	3		WXS	Illumina HiSeq	Phase_1	465	0.06	30	.	0		0		RNA	SNP		37																																																																																					0	0.552										
BRAT1	221927	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	2580652	2580652	+	Silent	SNP	G	G	C			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr7:2580652G>C	ENST00000340611.4	-	10	1612	c.1356C>G	c.(1354-1356)gtC>gtG	p.V452V	BRAT1_ENST00000473879.1_5'UTR	NM_152743.3	NP_689956.2	Q6PJG6	BRAT1_HUMAN	BRCA1-associated ATM activator 1	452					response to ionizing radiation (GO:0010212)	membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	23						ACTCCAGGAGGACAGCAAGCG	0.672																																					p.V452V													.	.			0			c.C1356G												18.0	20.0	19.0					7																	2580652		2199	4292	6491	SO:0001819	synonymous_variant	221927	exon10			CAGGAGGACAGCA	BC015632	CCDS5334.1	7p22.3	2011-03-22	2011-02-28	2011-03-22	ENSG00000106009	ENSG00000106009			21701	protein-coding gene	gene with protein product	"""BRCA1-associated protein required for ATM activation protein 1"""	614506	"""chromosome 7 open reading frame 27"""	C7orf27, BAAT1		16452482	Standard	NM_152743		Approved	MGC22916	uc003smi.3	Q6PJG6	OTTHUMG00000119091	ENST00000340611.4:c.1356C>G	7.37:g.2580652G>C			Somatic	207	0	0		WXS	Illumina HiSeq	.	276	0.36	100	NM_152743	211	0.25	53	A4D200|C9JY24|Q8IW85|Q8IZ43|Q8WVR8|Q96IV9|Q9H7J8|Q9UFA3	Silent	SNP	ENST00000340611.4	37	CCDS5334.1																																																																																					0.672	BRAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000239305.2		NM_152743	
HOXA4	3201	mdanderson.org	37	7	27170154	27170154	+	Silent	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr7:27170154G>T	ENST00000360046.5	-	1	264	c.199C>A	c.(199-201)Cga>Aga	p.R67R	RP1-170O19.22_ENST00000467897.2_RNA|HOXA-AS3_ENST00000518848.1_RNA|HOXA-AS2_ENST00000521159.1_RNA|HOXA-AS2_ENST00000517550.1_RNA|HOXA4_ENST00000428284.2_Silent_p.R67R|HOXA3_ENST00000521401.1_Intron|HOXA-AS2_ENST00000521687.1_RNA	NM_002141.4	NP_002132.3	Q00056	HXA4_HUMAN	homeobox A4	67	Pro-rich (part of the transcriptional activation domain).				anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(6)	12						GTGGGCTCTCGGCCGCCGCCC	0.801																																					p.R67R													.	.			0			c.C199A												1.0	1.0	1.0					7																	27170154		872	2077	2949	SO:0001819	synonymous_variant	3201	exon1			GCTCTCGGCCGCC		CCDS5405.1	7p15.2	2011-06-20	2005-12-22		ENSG00000197576	ENSG00000197576		"""Homeoboxes / ANTP class : HOXL subclass"""	5105	protein-coding gene	gene with protein product		142953	"""homeo box A4"""	HOX1D, HOX1		1973146, 1358459	Standard	NM_002141		Approved		uc003sym.4	Q00056	OTTHUMG00000023213	ENST00000360046.5:c.199C>A	7.37:g.27170154G>T			Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	11	0.18	2	NM_002141	0		0	A4D180|O43366	Silent	SNP	ENST00000360046.5	37	CCDS5405.1																																																																																					0.801	HOXA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000059534.4			
ZNF680	340252	ucsc.edu	37	7	63981631	63981631	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr7:63981631G>A	ENST00000309683.6	-	4	1652	c.1501C>T	c.(1501-1503)Cgg>Tgg	p.R501W	ZNF680_ENST00000476563.1_5'Flank	NM_178558.4	NP_848653.2	Q8NEM1	ZN680_HUMAN	zinc finger protein 680	501					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	27		Lung NSC(55;0.118)|all_lung(88;0.243)				TGTGAGGACCGGTTAAAAGCT	0.358																																					p.R501W													ZNF680,NS,carcinoma,+1,1	ZNF680	58	1	0			c.C1501T												65.0	69.0	67.0					7																	63981631		2203	4300	6503	SO:0001583	missense	340252	exon4			AGGACCGGTTAAA	AK074911	CCDS34644.1, CCDS47594.1	7q11.21	2013-01-08			ENSG00000173041	ENSG00000173041		"""Zinc fingers, C2H2-type"", ""-"""	26897	protein-coding gene	gene with protein product	"""hypothetical protein FLJ90430"""					12477932	Standard	NM_178558		Approved	FLJ90430	uc003tta.2	Q8NEM1	OTTHUMG00000156542	ENST00000309683.6:c.1501C>T	7.37:g.63981631G>A	ENSP00000309330:p.Arg501Trp		Somatic	121	0	0		RNA-Seq	Illumina HiSeq		179	0.01	1	NM_178558	51	0.29	15	B3KVJ4|Q6ZNF3|Q8NC79	Missense_Mutation	SNP	ENST00000309683.6	37	CCDS34644.1	.	.	.	.	.	.	.	.	.	.	g	16.13	3.035027	0.54896	.	.	ENSG00000173041	ENST00000309683	T	0.58210	0.35	1.31	-2.46	0.06461	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.51466	0.1676	L	0.45285	1.41	0.09310	N	1	D	0.89917	1.0	D	0.64877	0.93	T	0.41142	-0.9525	9	0.27082	T	0.32	.	2.0402	0.03549	0.2511:0.0:0.4566:0.2924	.	501	Q8NEM1	ZN680_HUMAN	W	501	ENSP00000309330:R501W	ENSP00000309330:R501W	R	-	1	2	ZNF680	63619066	0.000000	0.05858	0.000000	0.03702	0.125000	0.20455	0.133000	0.15912	-0.859000	0.04105	-0.359000	0.07587	CGG			0.358	ZNF680-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000344568.1		NM_178558	
INTS4L2	644619	broad.mit.edu	37	7	65139108	65139109	+	RNA	INS	-	-	A			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr7:65139108_65139109insA	ENST00000430126.2	+	0	305							Q2T9F4	IN4L2_HUMAN	integrator complex subunit 4-like 2																		atctcaggaagaaaaaaaaaaa	0.436																																					.													.	.			0			.																																											0	.			CAGGAAGAAAAAA	BC111554		7q11.21	2013-03-26			ENSG00000232270	ENSG00000273024			22351	other	unknown							Standard	NR_027392		Approved	MGC133166	uc003tue.2	Q2T9F4	OTTHUMG00000156558		7.37:g.65139119_65139119dupA			Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	9	0.44	4	.	0		0		RNA	INS	ENST00000430126.2	37																																																																																						0.436	INTS4L2-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000345545.2		NR_027392	
ELN	2006	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	73466166	73466166	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr7:73466166G>T	ENST00000252034.7	+	16	1285	c.886G>T	c.(886-888)Gca>Tca	p.A296S	ELN_ENST00000445912.1_Missense_Mutation_p.A296S|ELN_ENST00000357036.5_Missense_Mutation_p.A301S|ELN_ENST00000358929.4_Missense_Mutation_p.A296S|ELN_ENST00000380584.4_Missense_Mutation_p.A282S|ELN_ENST00000320399.6_Missense_Mutation_p.A296S|ELN_ENST00000429192.1_Missense_Mutation_p.A301S|ELN_ENST00000414324.1_Missense_Mutation_p.A291S|ELN_ENST00000380562.4_Missense_Mutation_p.A296S|ELN_ENST00000380575.4_Missense_Mutation_p.A286S|ELN_ENST00000458204.1_Missense_Mutation_p.A286S|ELN_ENST00000380553.4_Missense_Mutation_p.A179S|ELN_ENST00000380576.5_Missense_Mutation_p.A296S|ELN_ENST00000320492.7_Missense_Mutation_p.A260S	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	296	Ala-rich.				blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				TGGAGGCATCGCAGGTAACAT	0.622			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""				OREG0018112	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A301S				Dom	yes		7	7q11.23	2006	elastin	yes	L	.	ELN	81		0			c.G901T												109.0	88.0	95.0					7																	73466166		2203	4300	6503	SO:0001583	missense	2006	exon16			GGCATCGCAGGTA		CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.886G>T	7.37:g.73466166G>T	ENSP00000252034:p.Ala296Ser		Somatic	134	0.0074626866	1	1145	WXS	Illumina HiSeq	Phase_I	191	0.18	34	NM_001081753	0		0	B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Missense_Mutation	SNP	ENST00000252034.7	37	CCDS5562.2	.	.	.	.	.	.	.	.	.	.	G	12.71	2.018860	0.35606	.	.	ENSG00000049540	ENST00000445912;ENST00000252034;ENST00000358929;ENST00000320492;ENST00000438906;ENST00000438880;ENST00000414324;ENST00000380562;ENST00000380575;ENST00000380584;ENST00000458204;ENST00000357036;ENST00000429192;ENST00000442462;ENST00000380553;ENST00000380576;ENST00000320399	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.49139	1.34;1.34;1.36;1.29;0.88;0.79;1.36;1.34;1.39;1.37;1.35;1.33;1.35;1.24;1.4;1.34	4.81	2.96	0.34315	.	.	.	.	.	T	0.37705	0.1013	L	0.38175	1.15	0.33790	D	0.625422	P;P;P;P;P;P;P;P;P;P;P;P;P;P	0.45474	0.859;0.859;0.859;0.859;0.859;0.859;0.859;0.859;0.859;0.859;0.859;0.859;0.859;0.859	B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.43052	0.406;0.406;0.406;0.406;0.406;0.406;0.406;0.406;0.406;0.406;0.406;0.406;0.406;0.406	T	0.47837	-0.9086	9	0.38643	T	0.18	-5.3465	8.321	0.32130	0.1756:0.0:0.8244:0.0	.	296;265;260;291;286;296;286;301;301;296;179;252;282;296	E7ENM0;E9PBM4;G5E950;G3V0G6;E7EN65;P15502-1;P15502-7;P15502-12;P15502-5;P15502-13;P15502-11;B3KRT8;P15502-8;P15502-2	.;.;.;.;.;.;.;.;.;.;.;.;.;.	S	296;296;296;260;274;157;291;296;286;282;286;301;301;265;179;296;296	ENSP00000389857:A296S;ENSP00000252034:A296S;ENSP00000351807:A296S;ENSP00000315607:A260S;ENSP00000406949:A274S;ENSP00000389206:A157S;ENSP00000392575:A291S;ENSP00000369936:A296S;ENSP00000369949:A286S;ENSP00000369958:A282S;ENSP00000403162:A286S;ENSP00000349540:A301S;ENSP00000391129:A301S;ENSP00000369926:A179S;ENSP00000369950:A296S;ENSP00000313565:A296S	ENSP00000252034:A296S	A	+	1	0	ELN	73104102	0.995000	0.38212	0.951000	0.38953	0.361000	0.29550	2.366000	0.44204	0.538000	0.28769	0.551000	0.68910	GCA			0.622	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000316913.1		NM_000501	
KMT2E	55904	broad.mit.edu	37	7	104747054	104747054	+	Silent	SNP	G	G	A			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr7:104747054G>A	ENST00000311117.3	+	20	3227	c.2682G>A	c.(2680-2682)ccG>ccA	p.P894P	KMT2E_ENST00000334877.4_Silent_p.P894P|CTB-152G17.6_ENST00000607968.1_RNA|KMT2E_ENST00000334914.7_5'UTR|KMT2E_ENST00000257745.4_Silent_p.P894P	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	894					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										CTCCTTCCCCGTATGCTACAC	0.398																																					p.P894P													.	MLL5	173		0			c.G2682A												152.0	151.0	152.0					7																	104747054		2203	4300	6503	SO:0001819	synonymous_variant	55904	exon19			TTCCCCGTATGCT	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.2682G>A	7.37:g.104747054G>A			Somatic	207	0	0		WXS	Illumina HiSeq	Phase_I	402	0.01	6	NM_018682	26	0.00	0	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Silent	SNP	ENST00000311117.3	37	CCDS34723.1																																																																																					0.398	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348697.1			
GSTK1	373156	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	142961249	142961249	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr7:142961249T>A	ENST00000358406.5	+	2	214	c.143T>A	c.(142-144)aTg>aAg	p.M48K	GSTK1_ENST00000443571.2_Missense_Mutation_p.M48K|AC073342.12_ENST00000427392.1_RNA|GSTK1_ENST00000409500.3_Missense_Mutation_p.M48K|GSTK1_ENST00000494735.1_3'UTR|GSTK1_ENST00000479303.1_Missense_Mutation_p.M48K	NM_015917.2	NP_057001.1	Q9Y2Q3	GSTK1_HUMAN	glutathione S-transferase kappa 1	48					epithelial cell differentiation (GO:0030855)|glutathione metabolic process (GO:0006749)|oxidation-reduction process (GO:0055114)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|peroxisome (GO:0005777)	glutathione peroxidase activity (GO:0004602)|glutathione transferase activity (GO:0004364)|protein disulfide oxidoreductase activity (GO:0015035)|receptor binding (GO:0005102)			lung(4)	4	Melanoma(164;0.059)				Glutathione(DB00143)	ACAGGGATCATGAAAGACAGT	0.572																																					p.M48K													.	.			0			c.T143A												54.0	46.0	49.0					7																	142961249		2203	4300	6503	SO:0001583	missense	373156	exon2			GGATCATGAAAGA		CCDS5877.1, CCDS47730.1, CCDS47731.1, CCDS47732.1	7q34	2012-06-21			ENSG00000197448	ENSG00000197448	2.5.1.18	"""Glutathione S-transferases / Mitochondrial (kappa)"""	16906	protein-coding gene	gene with protein product		602321				12720545, 14742434	Standard	NM_015917		Approved	GST13	uc003wcj.3	Q9Y2Q3	OTTHUMG00000152637	ENST00000358406.5:c.143T>A	7.37:g.142961249T>A	ENSP00000351181:p.Met48Lys		Somatic	163	0	0		WXS	Illumina HiSeq	.	211	0.11	24	NM_001143681	103	0.17	17	B4DIH1|B4DSY2|Q6P4H0|Q7Z520|Q9P1S4	Missense_Mutation	SNP	ENST00000358406.5	37	CCDS5877.1	.	.	.	.	.	.	.	.	.	.	T	27.7	4.855774	0.91355	.	.	ENSG00000197448	ENST00000436038;ENST00000409500;ENST00000443571;ENST00000358406;ENST00000479303	.	.	.	6.14	6.14	0.99180	DSBA-like thioredoxin domain (1);Thioredoxin-like fold (1);	0.110994	0.85682	D	0.000000	T	0.79505	0.4457	M	0.86028	2.79	0.58432	D	0.999997	P;P;D;D	0.55800	0.828;0.604;0.973;0.958	P;B;P;D	0.63877	0.488;0.334;0.726;0.919	T	0.79976	-0.1576	9	0.38643	T	0.18	-22.0507	14.758	0.69583	0.0:0.0:0.0:1.0	.	48;48;48;48	Q9Y2Q3-3;Q9Y2Q3-4;Q9Y2Q3-2;Q9Y2Q3	.;.;.;GSTK1_HUMAN	K	38;48;48;48;48	.	ENSP00000351181:M48K	M	+	2	0	GSTK1	142671371	1.000000	0.71417	0.999000	0.59377	0.654000	0.38779	4.859000	0.62954	2.367000	0.80283	0.529000	0.55759	ATG			0.572	GSTK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000327091.1		NM_015917	
ATG9B	285973	broad.mit.edu;mdanderson.org	37	7	150713893	150713893	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr7:150713893G>T	ENST00000377974.2	-	11	2378	c.2303C>A	c.(2302-2304)gCc>gAc	p.A768D	ATG9B_ENST00000444312.1_Missense_Mutation_p.A254D|ATG9B_ENST00000605938.1_Missense_Mutation_p.P769T|ATG9B_ENST00000494791.1_5'UTR			Q674R7	ATG9B_HUMAN	autophagy related 9B	769					autophagic vacuole assembly (GO:0000045)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(4)|prostate(1)	14	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GAAGAGGTTGGCCAGGAAGGC	0.607																																					.													.	ATG9B	51		0			.												39.0	44.0	43.0					7																	150713893		2066	4215	6281	SO:0001583	missense	285973	.			AGGTTGGCCAGGA	AK027791		7q36	2014-02-12	2012-06-06	2005-09-11	ENSG00000181652	ENSG00000181652			21899	protein-coding gene	gene with protein product		612205	"""nitric oxide synthase 3 antisense"", ""ATG9 autophagy related 9 homolog B (S. cerevisiae)"""	NOS3AS		15234981, 15755735	Standard	NM_173681		Approved	FLJ14885, APG9L2, SONE	uc011kvc.2	Q674R7	OTTHUMG00000158634	ENST00000377974.2:c.2303C>A	7.37:g.150713893G>T	ENSP00000475005:p.Ala768Asp		Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	117	0.05	6	.	2	0.00	0	A1A5D3|Q6JRW5|Q8N8I8	Missense_Mutation	SNP	ENST00000377974.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.23|15.23	2.773144|2.773144	0.49680|0.49680	.|.	.|.	ENSG00000248602|ENSG00000248602	ENST00000377974;ENST00000444312|ENST00000397266	.|.	.|.	.|.	5.33|5.33	5.33|5.33	0.75918|0.75918	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75376|0.75376	0.3841|0.3841	.|.	.|.	.|.	.|.	.|.	.|.	D|.	0.76494|.	0.999|.	D|.	0.63488|.	0.915|.	T|T	0.79155|0.79155	-0.1920|-0.1920	7|4	0.40728|0.62326	T|D	0.16|0.03	-18.1467|-18.1467	16.5113|16.5113	0.84286|0.84286	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	769|.	Q674R7|.	ATG9B_HUMAN|.	D|T	768;254|769	.|.	ENSP00000444232:A768D|ENSP00000380436:P769T	A|P	-|-	2|1	0|0	AC010973.1|AC010973.1	150344826|150344826	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.910000|0.910000	0.53928|0.53928	5.465000|5.465000	0.66725|0.66725	2.485000|2.485000	0.83878|0.83878	0.561000|0.561000	0.74099|0.74099	GCC|CCA			0.607	ATG9B-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_173681	
GALNTL5	168391	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	151716815	151716815	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr7:151716815G>C	ENST00000392800.2	+	9	1515	c.1261G>C	c.(1261-1263)Ggt>Cgt	p.G421R	GALNTL5_ENST00000431418.2_Missense_Mutation_p.G421R	NM_145292.3	NP_660335.2	Q7Z4T8	GLTL5_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 5	421					spermatid development (GO:0007286)	endosome (GO:0005768)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(11)|ovary(2)|prostate(2)|skin(3)	32	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		GAAACGACTGGGTTGCAAGTC	0.393																																					p.G421R													.	.			0			c.G1261C												122.0	115.0	117.0					7																	151716815		2203	4300	6503	SO:0001583	missense	168391	exon9			CGACTGGGTTGCA	AF440400	CCDS5929.1	7q36.2	2014-03-13	2014-03-13	2004-07-28	ENSG00000106648	ENSG00000106648		"""Glycosyltransferase family 2 domain containing"""	21725	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 5"""	615133	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5"""	GALNT15			Standard	NM_145292		Approved	GalNAc-T5L	uc003wkp.3	Q7Z4T8	OTTHUMG00000157306	ENST00000392800.2:c.1261G>C	7.37:g.151716815G>C	ENSP00000376548:p.Gly421Arg		Somatic	116	0	0		WXS	Illumina HiSeq	.	197	0.17	34	NM_145292	1	0.00	0	Q75KN2|Q75MD3|Q8NCV4|Q8WW05|Q9UDR9	Missense_Mutation	SNP	ENST00000392800.2	37	CCDS5929.1	.	.	.	.	.	.	.	.	.	.	G	17.64	3.439244	0.63067	.	.	ENSG00000106648	ENST00000431418;ENST00000392800	T;T	0.27557	1.66;1.66	5.01	4.11	0.48088	.	0.000000	0.49916	D	0.000136	T	0.33789	0.0875	L	0.54965	1.715	0.35672	D	0.813391	P;P	0.50617	0.937;0.482	P;B	0.46320	0.512;0.145	T	0.50180	-0.8858	10	0.59425	D	0.04	.	11.1523	0.48466	0.0:0.1857:0.8143:0.0	.	172;421	A8MZD3;Q7Z4T8	.;GLTL5_HUMAN	R	421	ENSP00000392582:G421R;ENSP00000376548:G421R	ENSP00000376548:G421R	G	+	1	0	GALNTL5	151347748	1.000000	0.71417	0.916000	0.36221	0.953000	0.61014	2.420000	0.44679	1.279000	0.44446	0.650000	0.86243	GGT			0.393	GALNTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348395.1		NM_145292	
CPQ	10404	broad.mit.edu	37	8	97892110	97892110	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr8:97892110G>T	ENST00000220763.5	+	4	936	c.726G>T	c.(724-726)atG>atT	p.M242I		NM_016134.2	NP_057218.1	Q9Y646	CBPQ_HUMAN	carboxypeptidase Q	242					peptide catabolic process (GO:0043171)|proteolysis (GO:0006508)|thyroid hormone generation (GO:0006590)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)	carboxypeptidase activity (GO:0004180)|metal ion binding (GO:0046872)|metallodipeptidase activity (GO:0070573)|protein homodimerization activity (GO:0042803)										CAGAAATGATGTCAAGAATGG	0.458																																					p.M242I													.	.			0			c.G726T												199.0	195.0	197.0					8																	97892110		2203	4300	6503	SO:0001583	missense	10404	exon4			AATGATGTCAAGA	AF107834	CCDS6273.1	8q22.2	2012-02-17			ENSG00000104324	ENSG00000104324			16910	protein-coding gene	gene with protein product	"""lysosomal dipeptidase"", ""Ser-Met dipeptidase"", ""plasma glutamate carboxypeptidase"""					10206990	Standard	NM_016134		Approved	LDP, PGCP	uc003yhw.3	Q9Y646	OTTHUMG00000164690	ENST00000220763.5:c.726G>T	8.37:g.97892110G>T	ENSP00000220763:p.Met242Ile		Somatic	223	0	0		WXS	Illumina HiSeq	Phase_I	343	0.02	6	NM_016134	44	0.00	0	B2RD88|Q8NBZ1|Q9UNM8|Q9Y5X6	Missense_Mutation	SNP	ENST00000220763.5	37	CCDS6273.1	.	.	.	.	.	.	.	.	.	.	G	13.08	2.130351	0.37630	.	.	ENSG00000104324	ENST00000220763	T	0.36878	1.23	5.53	3.74	0.42951	.	0.043875	0.85682	D	0.000000	T	0.19046	0.0457	N	0.10916	0.065	0.41598	D	0.988836	B;B	0.06786	0.001;0.0	B;B	0.08055	0.001;0.003	T	0.04551	-1.0943	10	0.29301	T	0.29	-22.082	10.0391	0.42146	0.145:0.0:0.855:0.0	.	242;242	B5MDX4;Q9Y646	.;PGCP_HUMAN	I	242	ENSP00000220763:M242I	ENSP00000220763:M242I	M	+	3	0	AC010859.1	97961286	1.000000	0.71417	0.999000	0.59377	0.969000	0.65631	3.689000	0.54706	0.825000	0.34637	0.586000	0.80456	ATG			0.458	CPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000379757.2		NM_016134	
ATAD2	29028	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	124383988	124383988	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr8:124383988T>G	ENST00000287394.5	-	4	565	c.458A>C	c.(457-459)gAa>gCa	p.E153A	ATAD2_ENST00000534257.1_5'Flank|ATAD2_ENST00000521903.1_5'UTR	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	153					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			TCGACGCACTTCAACATCACC	0.373																																					p.E153A													.	ATAD2	160		0			c.A458C												191.0	143.0	160.0					8																	124383988		2203	4300	6503	SO:0001583	missense	29028	exon4			CGCACTTCAACAT	BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.458A>C	8.37:g.124383988T>G	ENSP00000287394:p.Glu153Ala		Somatic	269	0.0074349442	2		WXS	Illumina HiSeq	Phase_I	383	0.21	80	NM_014109	90	0.17	15	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Missense_Mutation	SNP	ENST00000287394.5	37	CCDS6343.1	.	.	.	.	.	.	.	.	.	.	T	12.48	1.951035	0.34471	.	.	ENSG00000156802	ENST00000287394	T	0.32023	1.47	4.86	4.86	0.63082	.	1.515090	0.03682	N	0.245620	T	0.44456	0.1294	M	0.74258	2.255	0.80722	D	1	B	0.33448	0.412	B	0.35655	0.207	T	0.21008	-1.0258	10	0.41790	T	0.15	-20.522	14.1376	0.65297	0.0:0.0:0.0:1.0	.	153	Q6PL18	ATAD2_HUMAN	A	153	ENSP00000287394:E153A	ENSP00000287394:E153A	E	-	2	0	ATAD2	124453169	1.000000	0.71417	1.000000	0.80357	0.663000	0.39108	4.364000	0.59479	1.812000	0.52913	0.459000	0.35465	GAA			0.373	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381766.2		NM_014109	
EPPK1	83481	mdanderson.org	37	8	144946192	144946192	+	Silent	SNP	C	C	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr8:144946192C>T	ENST00000525985.1	-	2	1301	c.1230G>A	c.(1228-1230)agG>agA	p.R410R				P58107	EPIPL_HUMAN	epiplakin 1	410						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GCAGCCGGAGCCTGCGTGCTG	0.677																																					p.R410R													.	.			0			c.G1230A												3.0	4.0	4.0					8																	144946192		1885	3929	5814	SO:0001819	synonymous_variant	83481	exon1			CCGGAGCCTGCGT	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.1230G>A	8.37:g.144946192C>T			Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	38	0.08	3	NM_031308	5	0.00	0	Q76E58|Q9NSU9	Silent	SNP	ENST00000525985.1	37																																																																																						0.677	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000382675.1		NM_031308	
BAAT	570	mdanderson.org	37	9	104125233	104125233	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr9:104125233G>T	ENST00000395051.3	-	3	804	c.734C>A	c.(733-735)gCt>gAt	p.A245D	BAAT_ENST00000259407.2_Missense_Mutation_p.A245D			Q14032	BAAT_HUMAN	bile acid CoA:amino acid N-acyltransferase	245					acyl-CoA metabolic process (GO:0006637)|bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid conjugation (GO:0002152)|bile acid metabolic process (GO:0008206)|fatty acid metabolic process (GO:0006631)|glycine metabolic process (GO:0006544)|liver development (GO:0001889)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|taurine metabolic process (GO:0019530)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carboxylic ester hydrolase activity (GO:0052689)|glycine N-choloyltransferase activity (GO:0047963)|long-chain acyl-CoA hydrolase activity (GO:0052816)|medium-chain acyl-CoA hydrolase activity (GO:0052815)|N-acyltransferase activity (GO:0016410)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)|very long chain acyl-CoA hydrolase activity (GO:0052817)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		Acute lymphoblastic leukemia(62;0.0559)			Glycine(DB00145)	TAGGTAAATAGCCATAGATAG	0.413																																					p.A245D													.	.			0			c.C734A												102.0	105.0	104.0					9																	104125233		2201	4300	6501	SO:0001583	missense	570	exon4			TAAATAGCCATAG	L34081	CCDS6752.1	9q22.3	2014-06-24	2014-06-24		ENSG00000136881	ENSG00000136881	2.3.1.65		932	protein-coding gene	gene with protein product	"""glycine N-choloyltransferase"""	602938	"""bile acid Coenzyme A:amino acid N-acyltransferase (glycine N-choloyltransferase)"", ""bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase)"""				Standard	NM_001701		Approved	BAT	uc010mtd.3	Q14032	OTTHUMG00000020377	ENST00000395051.3:c.734C>A	9.37:g.104125233G>T	ENSP00000378491:p.Ala245Asp		Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	48	0.06	3	NM_001127610	0		0	Q3B7W9|Q96L31	Missense_Mutation	SNP	ENST00000395051.3	37	CCDS6752.1	.	.	.	.	.	.	.	.	.	.	G	13.44	2.238937	0.39598	.	.	ENSG00000136881	ENST00000259407;ENST00000395051	T;T	0.64618	-0.11;-0.11	4.96	3.12	0.35913	BAAT/Acyl-CoA thioester hydrolase C-terminal (1);	0.276182	0.30890	N	0.008680	T	0.79851	0.4517	M	0.89968	3.075	0.47862	D	0.999536	D	0.89917	1.0	D	0.97110	1.0	T	0.80181	-0.1489	10	0.87932	D	0	-16.3631	8.4849	0.33065	0.0852:0.1552:0.7596:0.0	.	245	Q14032	BAAT_HUMAN	D	245	ENSP00000259407:A245D;ENSP00000378491:A245D	ENSP00000259407:A245D	A	-	2	0	BAAT	103165054	1.000000	0.71417	0.783000	0.31826	0.016000	0.09150	3.311000	0.51919	0.674000	0.31244	-0.176000	0.13171	GCT			0.413	BAAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053433.1			
ZMYND19	116225	ucsc.edu;bcgsc.ca	37	9	140481474	140481474	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr9:140481474G>T	ENST00000298585.2	-	4	530	c.304C>A	c.(304-306)Caa>Aaa	p.Q102K	ZMYND19_ENST00000471957.1_5'UTR	NM_138462.2	NP_612471.1	Q96E35	ZMY19_HUMAN	zinc finger, MYND-type containing 19	102						cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|synapse (GO:0045202)	metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	13	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.000275)|Epithelial(140;0.00047)		GGCACCAGTTGCAGGTTGTCC	0.662																																					p.Q102K													.	ZMYND19	16		0			c.C304A												55.0	54.0	54.0					9																	140481474		2203	4300	6503	SO:0001583	missense	116225	exon4			CCAGTTGCAGGTT	BC012948	CCDS7048.1	9q34.3	2008-02-05			ENSG00000165724	ENSG00000165724		"""Zinc fingers, MYND-type"""	21146	protein-coding gene	gene with protein product		611424					Standard	NM_138462		Approved	MIZIP	uc004cno.1	Q96E35	OTTHUMG00000020992	ENST00000298585.2:c.304C>A	9.37:g.140481474G>T	ENSP00000298585:p.Gln102Lys		Somatic	35	0	0		WXS	Illumina HiSeq		40	0.10	4	NM_138462	274	0.00	0	Q5T366	Missense_Mutation	SNP	ENST00000298585.2	37	CCDS7048.1	.	.	.	.	.	.	.	.	.	.	G	8.228	0.804051	0.16467	.	.	ENSG00000165724	ENST00000298585	.	.	.	4.92	2.96	0.34315	.	0.198409	0.45606	D	0.000351	T	0.34454	0.0898	N	0.19112	0.55	0.39630	D	0.970161	B	0.02656	0.0	B	0.04013	0.001	T	0.22836	-1.0205	9	0.02654	T	1	-18.64	10.1304	0.42676	0.0:0.1492:0.696:0.1548	.	102	Q96E35	ZMY19_HUMAN	K	102	.	ENSP00000298585:Q102K	Q	-	1	0	ZMYND19	139601295	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	6.169000	0.71913	0.577000	0.29470	0.655000	0.94253	CAA			0.662	ZMYND19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055356.1		NM_138462	
KDM5C	8242	mdanderson.org	37	X	53222378	53222378	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chrX:53222378G>T	ENST00000375401.3	-	26	4986	c.4454C>A	c.(4453-4455)tCa>tAa	p.S1485*	KDM5C_ENST00000404049.3_Nonsense_Mutation_p.S1484*|KDM5C_ENST00000452825.3_Intron|KDM5C_ENST00000375383.3_Nonsense_Mutation_p.S1441*|KDM5C_ENST00000375379.3_Nonsense_Mutation_p.S1482*	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	1485					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						CTCTGGCCCTGAGCTCCGTAC	0.711			"""N, F, S"""		clear cell renal carcinoma																																p.S1485X				Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	.	.			0			c.C4454A												63.0	40.0	48.0					X																	53222378		2203	4300	6503	SO:0001587	stop_gained	8242	exon26			GGCCCTGAGCTCC	Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.4454C>A	X.37:g.53222378G>T	ENSP00000364550:p.Ser1485*		Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	61	0.07	4	NM_004187	246	0.00	1	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Nonsense_Mutation	SNP	ENST00000375401.3	37	CCDS14351.1	.	.	.	.	.	.	.	.	.	.	g	45	11.777268	0.99601	.	.	ENSG00000126012	ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	.	.	.	4.4	3.52	0.40303	.	0.718117	0.11415	U	0.566405	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.5503	4.9215	0.13872	0.1213:0.216:0.6626:0.0	.	.	.	.	X	1485;1484;1482;1441	.	ENSP00000364528:S1482X	S	-	2	0	KDM5C	53239103	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.619000	0.36965	1.803000	0.52742	0.407000	0.27541	TCA			0.711	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000056737.2		NM_004187	
HMGB3	3149	mdanderson.org	37	X	150156378	150156378	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chrX:150156378G>T	ENST00000325307.7	+	5	690	c.594G>T	c.(592-594)gaG>gaT	p.E198D	HMGB3_ENST00000448905.2_Missense_Mutation_p.E198D	NM_005342.2	NP_005333.2	O15347	HMGB3_HUMAN	high mobility group box 3	198	Asp/Glu-rich (acidic).				DNA recombination (GO:0006310)|multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)			endometrium(3)|large_intestine(2)|lung(2)|skin(1)	8	Acute lymphoblastic leukemia(192;6.56e-05)					aggaggaggaggaTGAATAAA	0.463																																					p.E198D													.	.			0			c.G594T												49.0	48.0	49.0					X																	150156378		2203	4299	6502	SO:0001583	missense	3149	exon5			GGAGGAGGATGAA	AF274572	CCDS35428.1	Xq28	2011-07-01	2011-04-05	2002-08-16	ENSG00000029993	ENSG00000029993		"""High-mobility group / Canonical"""	5004	protein-coding gene	gene with protein product	"""non-histone chromosomal protein"""	300193	"""high-mobility group (nonhistone chromosomal) protein 4"", ""high-mobility group box 3"""	HMG4		9598312	Standard	XM_005274665		Approved	HMG2A, MGC90319	uc004fep.3	O15347	OTTHUMG00000024162	ENST00000325307.7:c.594G>T	X.37:g.150156378G>T	ENSP00000359393:p.Glu198Asp		Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	20	0.10	2	NM_005342	88	0.00	0	O95556|Q6NS40	Missense_Mutation	SNP	ENST00000325307.7	37	CCDS35428.1	.	.	.	.	.	.	.	.	.	.	g	0.347	-0.947364	0.02304	.	.	ENSG00000029993	ENST00000325307;ENST00000448905	T;T	0.35048	1.33;1.33	4.84	-6.29	0.02013	.	0.320496	0.22526	N	0.058902	T	0.10208	0.0250	N	0.08118	0	0.20764	N	0.999851	B	0.02656	0.0	B	0.01281	0.0	T	0.15636	-1.0430	9	.	.	.	.	0.6043	0.00750	0.3103:0.1878:0.1198:0.3821	.	198	O15347	HMGB3_HUMAN	D	198	ENSP00000359393:E198D;ENSP00000442758:E198D	.	E	+	3	2	HMGB3	149907036	0.210000	0.23517	0.059000	0.19551	0.160000	0.22226	0.068000	0.14531	-1.155000	0.02822	0.600000	0.82982	GAG			0.463	HMGB3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000060867.1		NM_005342	
EPT1	85465	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	26587175	26587175	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr2:26587175T>G	ENST00000260585.7	+	2	182	c.63T>G	c.(61-63)agT>agG	p.S21R		NM_033505.2	NP_277040.1	Q9C0D9	EPT1_HUMAN	ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific)	21					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ethanolaminephosphotransferase activity (GO:0004307)|metal ion binding (GO:0046872)										AACAGTACAGTGCTGTGGATA	0.328																																					.													.	.			0			.												100.0	92.0	94.0					2																	26587175		1837	4072	5909	SO:0001583	missense	85465	.			GTACAGTGCTGTG		CCDS46240.1	2p23.3	2012-03-01			ENSG00000138018	ENSG00000138018	2.7.8.1		29361	protein-coding gene	gene with protein product	"""selenoprotein I"""	607915				11214970, 17132865	Standard	NM_033505		Approved	KIAA1724, SELI, SEPI	uc021veu.1	Q9C0D9	OTTHUMG00000151931	ENST00000260585.7:c.63T>G	2.37:g.26587175T>G	ENSP00000260585:p.Ser21Arg		Somatic	55	0	0		WXS	Illumina HiSeq	.	58	0.38	22	.	22	0.36	8	Q63ZE3	Missense_Mutation	SNP	ENST00000260585.7	37	CCDS46240.1	.	.	.	.	.	.	.	.	.	.	T	15.02	2.707903	0.48412	.	.	ENSG00000138018	ENST00000260585;ENST00000447170	T	0.52526	0.66	5.66	1.71	0.24356	.	0.038576	0.85682	D	0.000000	T	0.42063	0.1186	M	0.73319	2.225	0.58432	D	0.999996	B	0.18310	0.027	B	0.17433	0.018	T	0.34079	-0.9843	10	0.56958	D	0.05	-18.2302	5.6828	0.17786	0.0:0.2731:0.1493:0.5776	.	21	Q9C0D9	EPT1_HUMAN	R	21	ENSP00000260585:S21R	ENSP00000260585:S21R	S	+	3	2	EPT1	26440679	0.997000	0.39634	1.000000	0.80357	0.973000	0.67179	0.352000	0.20113	0.434000	0.26340	0.482000	0.46254	AGT			0.328	EPT1-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	protein_coding		OTTHUMT00000324484.3		NM_033505.2	
RHOA	387	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	49395636	49395636	+	IGR	SNP	C	C	A			TCGA-2G-AAH8-01A-11D-A42Y-10	TCGA-2G-AAH8-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf4e939a-ec2e-42e2-a404-56b7e3c355ea	933fc86a-905f-44dc-897e-20ba42f39b6a	g.chr3:49395636C>A	ENST00000418115.1	-	0	2031				GPX1_ENST00000419783.1_Missense_Mutation_p.G26C|GPX1_ENST00000419349.1_Missense_Mutation_p.G26C|GPX1_ENST00000496791.1_5'UTR	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A						actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)			cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		GGCTCCCCGCCGGCCAGCGGG	0.682																																					.													.	.			0			.												4.0	5.0	4.0					3																	49395636		1728	3852	5580	SO:0001628	intergenic_variant	2876	.			CCCCGCCGGCCAG	BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838		3.37:g.49395636C>A			Somatic	97	0	0		WXS	Illumina HiSeq	.	111	0.30	33	.	1310	0.32	421	P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	Missense_Mutation	SNP	ENST00000418115.1	37	CCDS2795.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.801420	0.90538	.	.	ENSG00000233276	ENST00000419783;ENST00000419349	T;T	0.24723	2.54;1.84	5.75	4.77	0.60923	Thioredoxin-like fold (2);	0.267444	0.19749	U	0.106957	T	0.49592	0.1566	M	0.76838	2.35	0.37082	D	0.899048	D;D	0.76494	0.999;0.998	D;P	0.70487	0.969;0.855	T	0.58014	-0.7711	10	0.87932	D	0	.	11.6268	0.51151	0.0:0.883:0.0:0.117	.	26;26	E9PAS1;P07203	.;GPX1_HUMAN	C	26	ENSP00000407375:G26C;ENSP00000391316:G26C	ENSP00000391316:G26C	G	-	1	0	GPX1	49370640	0.001000	0.12720	1.000000	0.80357	0.983000	0.72400	0.408000	0.21065	2.720000	0.93068	0.455000	0.32223	GGC			0.682	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000346157.3		NM_001664	
